Taxonomic Notes on Phyllocnistis Citrella

JAPB90_proof ■ 6 November 2015 ■ 1/3

Journal of Asia-Paciﬁc Biodiversity xxx (2015) 1e3

55 HOSTED BY Contents lists available at ScienceDirect 56 57 Journal of Asia-Pacific Biodiversity 58 59 60 journal homepage: http://www.elsevier.com/locate/japb 61 62 63 Original article 64 65 1 Taxonomic notes on Phyllocnistis citrella (Lepidoptera: Gracillariidae) 66 2 67 3 with genital structures and DNA barcode from Korea 68 4 69 a b b a,* 5 Q15 Da-Som Kim , Chung-Won Choi , Sanghyeob Lee , Bong-Kyu Byun 70 6 a 71 7 Department of Biological Science and Biotechnology, Hannam University, Daejeon, South Korea b Department of Plant Biotechnology and Plant Engineering Research Institute, Sejong University, Seoul, South Korea 72 8 73 9 74 10 article info abstract 75 11 76 12 Article history: Until now, only one species, Phyllocnistis citrella Stainton, of the genus Phyllocnistis belonging to the 77 13 Received 25 September 2015 family Gracillariidae is listed in Korea, without available information on its identification and 78 14 Received in revised form morphology, which is now a very serious and important insect pest species in southern area. This study 79 14 October 2015 15 Q1 was carried out to provide the identical illustration with genital structure and DNA barcode data for rapid 80 Accepted 14 October 2015 16 monitoring, which has not been presented in this country to date. Available online xxx 81 17 Copyright Ó 2015, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). 82 Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http:// 18 Keywords: 83 creativecommons.org/licenses/by-nc-nd/4.0/). 19 citrus leafminer 84 20 DNA barcode 85 insect pests 21 86 22 Korea Phyllocnistis 87 23 88 24 89 25 90 26 Introduction damage in Korea at present, CLM may become a major economic 91 27 pest in the near future due to the climatic and environmental 92 28 The genus Phyllocnistis belongs to the family Gracillariidae that changes. While there are many studies on the occurrence, dam- Q2 93 29 includes 85 described species in the world (De Prins and De Prins age, and parasitoids of CLM for the control of pests (Argov and 94 30 2005). It has a tiny size (wingspan, 5 mm) and shows high sim- Rössler 1996; Legaspi et al 1999; Garcia-Marí et al 2004), the 95 31 ilarity in external morphological characteristics among the allied external morphology including the adult and genital illustration 96 32 species. For this reason, the genus Phyllocnistis has not been well was not available relatively in spite of their difficulty of 97 33 studied until now compared with other genera of Gracillariidae. identification. Q3 98 34 In Korea, only one species of Phyllocnistis was listed for the first This study was carried out to identify correctly the external 99 35 time by Ko (1969) without the taxonomic information. There has morphological and genital characteristics of CLM. In addition, DNA 100 36 been no further taxonomic study on this species till date (Park barcode is required for the exact and rapid identification, which has 101 37 1983; Byun et al 2009). not yet been developed in Korea. All the available information on 102 38 It was first reported by Heppner (1993) in North America. the species, including distributional ranges and host plants, is 103 39 Recently, it is treated as the major pest of Rutaceae, especially the presented in this study. 104 40 genus Citrus spp., in the world, also called CLM (Jacas et al 1997; 105 41 Song and Kang 2006). In North America, CLM lays eggs on the 106 Materials and methods 42 underside of leaves, and eclosion occurs within 2e10 days. After 107 43 eclosion, the larvae mine into leaves, causing serious damage to 108 Collecting and rearing 44 the leaves (Heppner 1993). After its occurrence in one region, CLM 109 45 spreads across the whole country within 1 year, as was the case in 110 The material examined for this study was obtained from the 46 Spain in 1993 (Urbaneja et al 2000). Although there is no serious 111 Citrus Research Institute, National Institute of Horticultural & 47 112 Herbal Science, Rural Development Administration, located in 48 113 Seoguipo, Jeju-do, Korea in 2015, and are now deposited at the 49 * Corresponding author. Tel.: þ8242 629 8892; fax: þ8242 629 8750. 114 Systematic Entomology Laboratory, Hannam University, Daejeon, 50 E-mail address: [email protected] (B.-K. Byun). 115 Korea. In addition, larvae or pupae within the leaves of Citrus spp. 51 Peer review under responsibility of National Science Museum of Korea (NSMK) and 116 Korea National Arboretum (KNA). were collected in a plastic bag for rearing and observation. Q4 52 117 53 http://dx.doi.org/10.1016/j.japb.2015.10.005 118 54 pISSN2287-884X eISSN2287-9544/Copyright Ó 2015, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. 119 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Please cite this article in press as: Kim D-S, et al., Taxonomic notes on Phyllocnistis citrella (Lepidoptera: Gracillariidae) with genital structures and DNA barcode from Korea, Journal of Asia-Paciﬁc Biodiversity (2015), http://dx.doi.org/10.1016/j.japb.2015.10.005 JAPB90_proof ■ 6 November 2015 ■ 2/3

2 DS Kim et al. / Journal of Asia-Paciﬁc Biodiversity xxx (2015) 1e3

1 Genitalia dissection and illustration 66 2 67 3 Male genitalia was dissected and mounted on glass slides with 68 4 an Euparal mountant following the method of Holloway and de 69

5 Q5,6 Lacoste (1987). Images of the species were taken by a digital cam- 70 6 era attached to the microscope LEICA M205C (Leica Microsystems, 71 7 Wetzlar, Germany). Abbreviations used in this study were as fol- 72 8 lows: TLdtype locality; GSdgenitalia slide. 73 9 74 10 DNA barcoding 75 11 76 12 In this study, we extracted DNA barcode (COI) from the spec- 77 13 imen of Phyllocnistis citrella Stainton. In order to obtain the DNA 78 14 barcode, protocols of Canadian Center for DNA Barcoding (Biodi- 79 15 versity Institute of Ontario, University of Guelph, Guelph, ON, 80 16 Q7 Canada) were used in this study. Extraction was carried out with 81 17 Q8 the NucleoGen Cell/Tissue Mini Kit (200). The region of COI (sets of 82 18 648 bp) was ampliﬁed with the primer LepF1/LepR1 (Hebert et al 83 19 2004). DNA barcoding analysis of mt COI gene was performed by 84 20 the process of sequencing with an automated DNA sequencer, 85 21 which was applied with a 30 primer (50-TAAACTTCAGGGTGAC- 86 22 CAAAAAATCA-30)(Table 1). 87 23 88 24 89 Systematic accounts 25 Figure 1. Phyllocnistis citrella Stainton: A, adult; B, male genitalia; C, aedeagus; and D, 90 26 91 Order Lepidoptera Linnaeus, 1758 female genitalia. 27 92 Family Gracillariidae Stainton, 1854 28 93 Subfamily Phyllocnistinae Herrich-Schäffer, 1857 29 Female genitalia (Figure 1D). Papillae anales moderate with 94 30 Genus Phyllocnistis Zeller, 1848 numerous long hairs, apex slightly sharpened; apophyses ante- 95 31 Type species: Opostega suffusela Zeller, 1847 riores very short and as long as apophyses posteriores, a bit thick; 96 32 ductus bursae very thin, membranous, as long as corpus bursae; 97 Phyllocnistis citrella Stainton, 1856 33 corpus bursae membranous, long, sack shaped with two different 98 (Figures 1AeD) 34 sized signa, having a shortly protruded projection on middle, 99 Phyllocnistis citrella Stainton, 1856: 302e303. TL: Calcutta (West 35 located on both the upper side and the downside. 100 Bengal, India). Syntype: BMNH. 36 Material examined.1_at1\aterial examined with two different 101 Q9 Phyllocnistis minutella Snellen, 1904:87e89. 37 sizMay 13, 2015 (CW Choi & YK Park); 1_CW1\CW Choi & YK 102 Lithocolletis citricola Shiraki, 1913: 330. 38 ParkJune 15, 2015 (CW Choi & YK Park); 1_;1\; Parki & YK ParkJuly Q11 103 39 22, 2015 (CW Choi & YK Park); 8_CW4\, same locality, August 18, 104 Adult (Figure 1A). Wingspan 4.0e4.7 mm in male and female; 40 2015 (CW Choi & YK Park)-GS-_5201, \5202-coll. SEL/HNU. 105 length of head and thorax combined 0.6e0.7mm; length of 41 Distribution. Korea (South, Jeju), Japan, China, India, Spain, North 106 abdomen 1.7 mm. Head covered with whitish-silvery and short 42 America, Costa Rica. Cosmopolitan. Of Southeast-Asian origin, 107 scales; antenna ciliate and brown with silvery scales; compound 43 dispersed since 1900 to citrus-producing areas all over the world 108 eye blackish. Thorax light brown, covered with shiny scales. Fore- 44 (De Prins and De Prins 2005). 109 wing very narrow, lanceolate, with two blackish streaks until 45 Host plants. Citrus sp. (Stainton 1856: 303)- Rutaceae, Garcinia 110 middle of cell horizontally, forming a blackish “y” on the middle of 46 mangostana L.- Clusiaceae, Jasminum sambac (L.) Aiton, 111 forewing. Ground color of forewing bright silver mixed with 47 J. simplicifolium Forst. f.- Oleaceae, Loranthus sp.- Loranthaceae, 112 blackish streaks and some yellowish brown scales; blackish streaks 48 Alseodaphne semecarpifolia Nees, Cinnamomum zeylanicum Blume- 113 in the apex and outer margin with short and tiny blackish dashes; 49 Lauraceae (De Prins and De Prins 2005). 114 Q10 apex with a round blackish spot with long cliae. Hindwing rather 50 Bionomics (Figures 2AeD). Larvae feed on the mesophylls of 115 narrow, lanceolate with long silver hairs along the dorsum. Legs 51 leaves and mine under the epidermal cell layer of leaves. They have 116 covered with whitish silvery hairs. 52 four larval instars, which are 5e20 days in total; they suck the sap 117 Male genitalia (Figures 1B and 1C). Tegumen narrow, a bit 53 of leaves in ﬁrst three instars. In the larval stages, they are bright 118 shorter than the valva, parallel with valva; uncus uncertain; valva 54 green, but changes to ash brown from the head when they pupate. 119 long (2.2 times longer than saccus) and narrow, slightly extended 55 Fourth-instar larvae form the silken cocoon, folding the edge of a 120 with rounded termination and apex with short hairs; saccus as long 56 leaf, which will protect them in pupal stages (Figures 2Ae2C). Then, 121 as valva, rounded ventrally. Aedeagus moderate, apex relatively 57 the pupae come out from the cocoon for emergence of adults, after 122 rounded, with a bit of tiny cornuti in the vesica. 58 6e22 days from pupation (Figure 2D). The mined leaves dry out 123 59 because of a lack of chlorophylls, resulting in harvest damage in the 124 60 Table 1. Primers used for extracting DNA barcode in this study. Citrus farm (Lee et al 2015). 125 61 126 62 Gene Name Sequence Reference DNA barcode. The sequences of P. citrella Stainton in Korea is as 127 63 Mitochondrial COI follows (658 bp): AACATTATATTTTTTATTTGGAATTTGATC 128 64 Forward LepF1 attcaaccaatcataaagatattgg (Hebert et al 2004) AGGAATAGTTGGTACTTCTTTAAGTTTATTAATTCGGATAGAATTAGG 129 65 Reverse LepR1 taaacttctggatgtccaaaaaatca (Hebert et al 2004) AAATCCAGGAAATTTAATTGGAGATGATCAAATTTATAATACTATTGTT 130

DS Kim et al. / Journal of Asia-Paciﬁc Biodiversity xxx (2015) 1e3 3

1 References Q12 49 2 50 3 Argov Y, Rössler Y. 1996. Introduction, release and recovery of several exotic natural 51 enemies for biological control of the citrus leaf miner, Phyllocnistis citrella,in 4 Israel. Phytoparasitica 24:33e38. 52 5 Byun BK, Park KT, Bae YS, et al. 2009. A checklist of the microlepidoptera in Korea 53 6 (Lepidoptera). Pocheon: Korea National Arboretum. 54 7 De Prins W, De Prins J. 2005. World catalogue of insect,InGracillariidae, Vol. 6. 55 Stenstrup: Apollo Books. 8 Garcia-Marı F, Vercher R, Costa-Comelles J, et al. 2004. Establishment of Citrostichus 56 9 phyllocnistoides (Hymenoptera: Eulophidae) as a biological control agent for the 57 10 citrus leafminer Phyllocnistis citrella (Lepidoptera: Gracillariidae) in Spain. Bio- 58 logical Control 29:215e226. 11 Hebert PDN, Penton EH, Burns J, et al. 2004. Ten species in one: DNA barcoding 59 12 revealed cryptic species in the neotropical skipper butterfly, Astraptes fulgerator. 60 13 Proceedings of the National Academy of Sciences of the United States of America 61 101:14812e14817. 14 Heppner JB. 1993. Citrus leafminer, Phyllocnistis citrella Stainton (Lepidoptera: 62 15 Gracillariidae: Phyllocnistinae). Entomology Circular No. 359, Division of Plant 63 16 Industry, Florida Department of Agriculture and Consumer Services. pp 1e2. 64 Herrich-Schäffer GAW. 1857. Sammlungen des Vereines. 5. Insecten. Correspondenz 17 Blatt des Zoologisch-mineralogischen Vereines in Regensburg 11:33e70. 65 18 Figure 2. Pupa of Phyllocnistis citrella: A, pupa within the leaf of host plant; B, pupa in Holloway RL, de Lacoste MC. 1987. Sexual dimorphism in the human corpus cal- 66 e 19 cocoon; C, pupa before emergence; and D, pupa after emergence. losum: an extension and replication study. Human Neurobiology 5:87 91. 67 Jacas JA, Garrido A, Margaix C, et al. 1997. Screening of citrus rootstocks and citrus- 20 related species for resistance to Phyllocnistis citrella (Lepidoptera: Gracillar- 68 21 iidae). Crop Protection 16:701e705. 69 22 ACAGCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCTATAATAATT Ko JH. 1969. A list of forest insect pests in Korea. Seoul: Forest Research Institute. 70 23 GGAGGATTTGGAAATTGATTAGTTCCTATTATATTAGGAGCTCCTGAT Lee S, Kim IK, Park YK, et al. 2015. Preliminary survey of indigenous parasites 71 ATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCCCC associated with Phyllocnistis citrella Stainton (Lepidoptera, Phyllocnistidae) in 24 Jeju, Korea. Journal of Asia-Pacific Biodiversity;2015.http://dx.doi.org/10.1016/ 72 25 ATCTTTACTATTATTAATTTCAAGAAGTTTAGTTGAAAACGGAGCTGG j.japb.2015.09.002. Q13 73 26 AACAGGATGAACAGTTTACCCACCATTATCATCTAATATTGCCCAC Legaspi JC, French JV, Schauff ME, et al. 1999. The citrus leafminer Phyllocnistis 74 GGTGGTAGATCAGTTGATTTAGCTATTTTTTCTTTACACTTAGCTGG citrella (Lepidoptera: Gracillariidae) in South Texas: incidence and parasitism. 27 Florida Entomologist 82:305e316. 75 ́ 28 TATTAGTTCAATTTTAGGTGCTATTAATTTTATTACAACAATTATTAATA Linnaeus C. 1758. Systema naturae.10th ed. Stockholm: Laurentius Salvius [In 76 TACGAATTAATAAAATAACTTTAGATTCTATATCCTTATTTGTTTGATCA Swedish]. 29 fl 77 GTTGGAATTACAGCCTTATTATTACTTTTATCTTTACCTGTATTAGCTG Park KT. 1983. Gracillariidae. In: Shin YH, Park KT, Nam SH, editors. Illustrated ora 30 and fauna of Korea,.Insecta IX, Vol. 27. Seoul: Ministry of Education. 78 31 GAGCTATTACAATATTATTAACTGACCGAAACTTAAATACTTCATTTTTT Shiraki T. 1913. Investigations upon general insect pests. Formosa Agricultural 79 32 GATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTC Experiment Station Special Report 8. pp 670. 80 Song JH, Kang SH. 2006. Responses of citrus leafminer, Phyllocnistis citrella (Lepi- 33 doptera: Gracillariidae) for a sex pheromone component, (Z,Z)-7, 11-hex- 81 34 adecadienal on Jeju Island. Korean Journal of Applied Entomology 45:161e167. 82 35 Uncited reference Stainton HT. 1854. Insecta britannica,InLepidoptera: Tineina, Vol. 3. London: Lovell 83 Reeve. 36 Stainton HT. 1856. Descriptions of three species of Indian micro-Lepidoptera. 84 37 Q14 van Deventer, 1904. Transactions of the Entomological Society of London, N.S. (series 2) 3:301e304. 85 38 Urbaneja A, Llácer E, Tomás O, et al. 2000. Indigenous natural enemies associated 86 Acknowledgments with Phyllocnistis citrella (Lepidoptera: Gracillariidae) in Eastern Spain. Biolog- 87 39 ical Control 18:199e207. 40 Zeller PC. 1847. Bemerkungen über die auf einer Reise nach Italien und Sicilien 88 “ fi 41 This study was funded by the project Identi cation of Parasit- beobachteten Schmetterlingsarten X. (Schluss von Isis Heft XI. Pag. 859). Isis, 89 e 42 oids of Citrus Leafminer and Development of Their Indoor Breeding oder enzyklopädische Zeitung von Oken 12:881 904. 90 Technology” (Project No.: PJ01025301201401) of the Rural Devel- Zeller PC. 1848. Die Gattungen der mit Augendeckeln versehenen blattminirenden 43 Schaben. Linnaea Entomologica 3:248e344. 91 44 opment Administration in Korea. We wish to express our sincere van Deventer W. 1904. Over de ontwikkelingstoestanden van eenige Microlepi- 92 fi e 45 thanks to Young-Kyu Park of the Korea Bene cial Insects Laboratory doptera van Java. Tijdschrift voor Entomologie 46:79 89. 93 46 for collecting the samples of the species for our study. 94 47 95 48 96