DOCSLIB.ORG

A Thesis Data Pooling to Identify Differentially Expressed Genes In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Thesis Data Pooling to Identify Differentially Expressed Genes In A Thesis entitled Data Pooling to Identify Differentially Expressed Genes in Lung Cancer of Nonsmokers by Nicole Carr Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Biomedical Sciences ______________________________________ Dr. Sadik A. Khuder, Committee Chair ______________________________________ Dr. Barbara Saltzman, Committee Member ______________________________________ Dr. Alexei Fedorov, Committee Member ______________________________________ Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo May, 2016 Copyright 2016, Nicole M. Carr This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of Data Pooling to Identify Differentially Expressed Genes in Lung Cancer of Nonsmokers by Nicole Carr Submitted to the graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Biomedical Science The University of Toledo May 2016 Lung cancer is the leading cause of cancer deaths in the United States. While cigarette smoking is the principle causal agent of lung cancer, 10–15% of patients have no history of smoking, yet still manifest gene expression similar to smokers. Although microarrays have been applied widely to lung cancer, few studies have explored the specific expression differences between smokers and nonsmokers. The purpose of this study was to identify differentially expressed genes in lung cancer of nonsmokers by combining data from different microarray platforms using quantile transformation. Two statistical approaches were introduced in this study: the ordinal logistic regression and a new statistical test based on the DISCO Normal distribution. Results from these models were corroborated against the finding of the modified t-tests. The top reported genes were shown to play multiple differing roles in the cellular environment, including muscle maintenance, DNA damage repair mechanisms, cellular metabolism, proliferation and growth, and tumor progression. The results of this study give further insight to the genetic differences observed in lung cancer patients, as well as demonstrating the opportunity to combine data from different microarray platforms. iii Acknowledgements I would like to extend a most sincere thank you to my mentor Dr. Sadik Khuder for all he has taught me. Without his kindness, patience, knowledge, and experience, this project would not have been possible. He’s an ordinary person, with an extraordinary heart. Thank you to Dr. Barbara Saltzman, for not only her participation as a committee member but for her unparalleled kindness and sincere guidance through my academic career. Her words of wisdom will never be forgotten. Additional thanks to Dr. Alexei Fedorov, again not only for being a committee member, but for always driving me towards success and inspiring me to learn. I feel sincerely privileged to have had him as a professor. Many thanks as well to Dr. Sjaak Philipsen, of the Erasmus University Medical Center Rotterdam, for supplying phenotype information beyond what was publically available for his study. My deepest gratitude to Dr. Bob Blumenthal and Jo Anne Gray. Without the two of them, their understanding, their perseverance, and their dedication, I may never have made it through the program. I am forever indebted to their kindness. Finally, sincere thanks to my family and Nathanial Carter. Their endless love and support has always inspired me to strive for the highest. iv Table of Contents An Abstract of .................................................................................................................... iii Acknowledgements ............................................................................................................ iv Table of Contents ................................................................................................................ v List of Tables .................................................................................................................... vii List of Figures .................................................................................................................. viii 1 Introduction ...................................................................................................................... 1 2 Background ...................................................................................................................... 4 2.1 Histologies of Lung Cancer....................................................................................... 4 2.2 Causes of Lung Cancer ............................................................................................. 5 2.3 Familial Lung Cancer ................................................................................................ 5 2.4 Microarray Analysis .................................................................................................. 6 2.5 DNA Hybridization ................................................................................................... 6 2.6 Types of Microarrays ................................................................................................ 7 2.7 Cross Validation Studies ........................................................................................... 8 2.8. Statistical Methods ................................................................................................... 9 2.8.1 DISCO Normal Distribution .................................................................................. 9 2.8.2 Ordinal Logistic Regression ................................................................................. 10 3 Methods.......................................................................................................................... 11 3.1 Data Collection ........................................................................................................ 11 v 3.1.1 Tumor Tissue Data ............................................................................................... 11 3.1.2 Tumor and Adjacent Normal Tissue Data............................................................ 12 3.2 Data Analysis .......................................................................................................... 13 3.3 Data Comparison ..................................................................................................... 13 3.4 Quantile Scoring Method: ....................................................................................... 14 4 Results ............................................................................................................................ 18 4.1 Individual Platform Results ..................................................................................... 18 4.2 Quantile Combination: Non-Smokers ..................................................................... 19 4.3 Quantile Combination: Smokers ............................................................................. 21 4.4 Quantile Combination: Tumor Samples .................................................................. 24 4.5 Common Non-Smoker / Smoker Results ................................................................ 26 5 Discussion ...................................................................................................................... 33 6 Conclusion ..................................................................................................................... 40 References .......................................................................... Error! Bookmark not defined. A Supplementary Tables and Figures .............................................................................. 48 B R-Codes ................................................................................................................................... 77 vi List of Tables Table 4.1: Top 25 common DEGs from Non-Smoker samples. ....................................... 20 Table 4.2 Top 25 common DEGS from smoker samples ................................................. 23 Table 4.3: Top 25 common DEGs from tumor samples. .................................................. 25 Table 4.4: Common DEGs from smoker and non-smoker results. ................................... 27 Table A.1: List of Microarray analysis used in this study ................................................ 48 Table A.2: Common 407 DEGs from non-smoker data pool ........................................... 55 Table A.3: 493 Common DEGs from smoker data pool .................................................. 61 Table A.4: Top 100 Common DEGs from tumor samples ............................................... 74 vii List of Figures Figure 3-1: Example Venn diagram. ................................................................................. 14 Figure 3-2: Schematic representation of Quantile Transformation technique. ................. 16 Figure 4-1: Relationship of statistical results for non-smokers ........................................ 19 Figure 4-2: Relationship of statistical results for smokers................................................ 22 Figure 4-3: Relationship of statistical for tumor samples ................................................. 24 Figure A-1: HGU133A platform merge results. ............................................................... 50 Figure A-2: HGU133A platform merge results. ..............................................................
Load more

Recommended publications
  • Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers
    Published OnlineFirst May 9, 2012; DOI: 10.1158/1055-9965.EPI-12-0352-T Cancer Epidemiology, Research Article Biomarkers & Prevention Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers Margaret R. Spitz1, Ivan P. Gorlov2, Qiong Dong3, Xifeng Wu3, Wei Chen4, David W. Chang3, Carol J. Etzel3, Neil E. Caporaso5, Yang Zhao8, David C. Christiani8, Paul Brennan9, Demetrius Albanes7, Jianxin Shi6, Michael Thun10, Maria Teresa Landi5, and Christopher I. Amos4 Abstract Background: Tobacco-induced lung cancer is characterized by a deregulated inflammatory microenviron- ment. Variants in multiple genes in inflammation pathways may contribute to risk of lung cancer. Methods: We therefore conducted a three-stage comprehensive pathway analysis (discovery, replication, and meta-analysis) of inflammation gene variants in ever-smoking lung cancer cases and controls. A discovery set (1,096 cases and 727 controls) and an independent and nonoverlapping internal replication set (1,154 cases and 1,137 controls) were derived from an ongoing case–control study. For discovery, we used an iSelect BeadChip to interrogate a comprehensive panel of 11,737 inflammation pathway single-nucleotide poly- morphisms (SNP) and selected nominally significant (P < 0.05) SNPs for internal replication. Results: There were six SNPs that achieved statistical significance (P < 0.05) in the internal replication data set with concordant risk estimates for former smokers and five concordant and replicated SNPs in current smokers. Replicated hits were further tested in a subsequent meta-analysis using external data derived from two published genome-wide association studies (GWAS) and a case–control study. Two of these variants (a BCL2L14 SNP in former smokers and an SNP in IL2RB in current smokers) were further validated.
    [Show full text]
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Accepted Version
    Article A catalog of genetic loci associated with kidney function from analyses of a million individuals WUTTKE, Matthias, et al. Abstract Chronic kidney disease (CKD) is responsible for a public health burden with multi-systemic complications. Through trans-ancestry meta-analysis of genome-wide association studies of estimated glomerular filtration rate (eGFR) and independent replication (n?=?1,046,070), we identified 264 associated loci (166 new). Of these, 147 were likely to be relevant for kidney function on the basis of associations with the alternative kidney function marker blood urea nitrogen (n?=?416,178). Pathway and enrichment analyses, including mouse models with renal phenotypes, support the kidney as the main target organ. A genetic risk score for lower eGFR was associated with clinically diagnosed CKD in 452,264 independent individuals. Colocalization analyses of associations with eGFR among 783,978 European-ancestry individuals and gene expression across 46 human tissues, including tubulo-interstitial and glomerular kidney compartments, identified 17 genes differentially expressed in kidney. Fine-mapping highlighted missense driver variants in 11 genes and kidney-specific regulatory variants. These results provide a comprehensive priority [...] Reference WUTTKE, Matthias, et al. A catalog of genetic loci associated with kidney function from analyses of a million individuals. Nature Genetics, 2019, vol. 51, no. 6, p. 957-972 DOI : 10.1038/s41588-019-0407-x PMID : 31152163 Available at: http://archive-ouverte.unige.ch/unige:147447 Disclaimer: layout of this document may differ from the published version. 1 / 1 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Genet Manuscript Author . Author manuscript; Manuscript Author available in PMC 2019 August 19.
    [Show full text]
  • A 14.8 Mb 12P Deletion Disrupting ETV6 in a Patient with Myelodysplastic Syndrome
    tics: Cu ne rr e en G t y R r e a t s i e d a e r r c e h Valetto et al., Hereditary Genet 2017, 6:1 H Hereditary Genetics DOI: 10.4172/2161-1041.1000174 ISSN: 2161-1041 Research Article Open Access A 14.8 Mb 12p Deletion Disrupting ETV6 in a Patient with Myelodysplastic Syndrome Angelo Valetto 1*, Veronica Bertini1, Elena Ciabatti2,3, Maria Immacolata Ferreri1, Alice Guazzelli1, Antonio Azzarà2, Susanna Grassi2, Alessia Azzarà1, Francesca Guerrini2, Iacopo Petrini2,4 and Sara Galimberti2 1Laboratory of Medical Genetics, A.O.U.P., S. Chiara Hospital, Pisa, Italy 2Department of Clinical and Experimental Medicine, Section of Hematology, University of Pisa, Pisa, Italy 3GenOMeC, University of Siena 4Department of translational Research and New Technologies in Medicine, University of Pisa, Pisa, Italy *Corresponding author: Valetto A, Laboratory of Medical Genetics, A.O.U.P., S. Chiara Hospital, Pisa, Italy, Tel: +39050992777; E-mail: [email protected] Received Date: Oct 27, 2016; Accepted Date: Mar 16, 2017; Published Date: Mar 21, 2017 Copyright: © 2017 Valetto A, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract We present on a new case of myelodysplastic syndrome characterized by array Comparative Genomic Hybridization. This technique confirmed the monosomy 7, detected by conventional cytogenetics, and revealed also a deletion on the short arm of chromosome 12. This deletion extends for about 14.8 Mb and breaks ETV6 gene.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • (BCL2L14) (NM 138722) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC206404 Bcl G (BCL2L14) (NM_138722) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Bcl G (BCL2L14) (NM_138722) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BCL2L14 Synonyms: BCLG Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC206404 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGTAGCACCAGTGGGTGTGACCTGGAAGAAATCCCCCTAGATGATGATGACCTAAACACCATAGAAT TCAAAATCCTCGCCTACTACACCAGACATCATGTCTTCAAGAGCACCCCTGCTCTCTTCTCACCAAAGCT GCTGAGAACAAGAAGTTTGTCCCAGAGGGGCCTGGGGAATTGTTCAGCAAATGAGTCATGGACAGAGGTG TCATGGCCTTGCAGAAATTCCCAATCCAGTGAGAAGGCCATAAACCTTGGCAAGAAAAAGTCTTCTTGGA AAGCATTCTTTGGAGTAGTGGAGAAGGAAGATTCGCAGAGCACGCCTGCCAAGGTCTCTGCTCAGGGTCA AAGGACGTTGGAATACCAAGATTCGCACAGCCAGCAGTGGTCCAGGTGTCTTTCTAACGTGGAGCAGTGC TTGGAGCATGAAGCTGTGGACCCCAAAGTCATTTCCATTGCCAACCGAGTAGCTGAAATTGTTTACTCCT GGCCACCACCACAAGCGACCCAGGCAGGAGGCTTCAAGTCCAAAGAGATTTTTGTAACTGAGGGTCTCTC CTTCCAGCTCCAAGGCCACGTGCCTGTAGCTTCAAGTTCTAAGAAAGATGAAGAAGAACAAATACTAGCC AAAATTGTTGAGCTGCTGAAATATTCAGGAGATCAGTTGGAAAGAAAGCTGAAGAAAGATAAGGCTTTGA TGGGCCACTTCCAGGATGGGCTGTCCTACTCTGTTTTCAAGACCATCACAGACCAGGTCCTAATGGGTGT GGACCCCAGGGGAGAATCAGAGGTCAAAGCTCAGGGCTTTAAGGCTGCCCTTGTAATAGACGTCACGGCC AAGCTCACAGCTATTGACAACCACCCGATGAACAGGGTCCTGGGCTTTGGCACCAAGTACCTGAAAGAGA
    [Show full text]
  • Bcl-G Acquitted of Murder&Excl;
    Citation: Cell Death and Disease (2012) 3, e405; doi:10.1038/cddis.2012.147 & 2012 Macmillan Publishers Limited All rights reserved 2041-4889/12 www.nature.com/cddis Editorial Bcl-G acquitted of murder! D Tischner1 and A Villunger*,1 Cell Death and Disease (2012) 3, e405; doi:10.1038/cddis.2012.147; published online 11 October 2012 Proteins of the Bcl-2 family are characterized by the presence Philippe Bouillet and colleagues8 started a whole-hearted of structural motives, referred to as Bcl-2 homology (BH) effort to elucidate the protein expression pattern and domains that orchestrate protein–protein interactions within physiological function of Bcl-G by the generation of a set of the family. The prosurvival members, such as Bcl-2 or Bcl-xL, highly specific monoclonal antibodies and Bcl-G-deficient usually contain four such domains (BH1–4), while their pro- mice.9 Contrary to some commercially available antibodies apoptotic opponents, Bax/Bak-like proteins and the BH3-only that picked up a 22-kDa band by western blotting, the newly proteins, contain three or only one such domain, that is, the generated monoclonals detected only a single 38-kDa band BH1, 2 and 3 or the BH3 domain, respectively.1 In concert, that was not present in protein extracts from cells and tissues these proteins regulate cell death by the mitochondrial derived from Bcl-G-deficient mice. Using four different anti- apoptosis pathway. However, some members of the family bodies, they could confirm that in mice only one Bcl-G isoform cannot be fully integrated in one of the three described exists, reflecting human Bcl-GL.
    [Show full text]
  • Chromatin Accessibility Dynamics of Chlamydia-Infected Epithelial Cells
    Hayward et al. Epigenetics & Chromatin (2020) 13:45 https://doi.org/10.1186/s13072-020-00368-2 Epigenetics & Chromatin RESEARCH Open Access Chromatin accessibility dynamics of Chlamydia-infected epithelial cells Regan J. Hayward1, James W. Marsh2, Michael S. Humphrys3, Wilhelmina M. Huston4 and Garry S. A. Myers1,4* Abstract Chlamydia are Gram-negative, obligate intracellular bacterial pathogens responsible for a broad spectrum of human and animal diseases. In humans, Chlamydia trachomatis is the most prevalent bacterial sexually transmitted infec- tion worldwide and is the causative agent of trachoma (infectious blindness) in disadvantaged populations. Over the course of its developmental cycle, Chlamydia extensively remodels its intracellular niche and parasitises the host cell for nutrients, with substantial resulting changes to the host cell transcriptome and proteome. However, little infor- mation is available on the impact of chlamydial infection on the host cell epigenome and global gene regulation. Regions of open eukaryotic chromatin correspond to nucleosome-depleted regions, which in turn are associated with regulatory functions and transcription factor binding. We applied formaldehyde-assisted isolation of regulatory elements enrichment followed by sequencing (FAIRE-Seq) to generate temporal chromatin maps of C. trachomatis- infected human epithelial cells in vitro over the chlamydial developmental cycle. We detected both conserved and distinct temporal changes to genome-wide chromatin accessibility associated with C. trachomatis infection. The observed diferentially accessible chromatin regions include temporally-enriched sets of transcription factors, which may help shape the host cell response to infection. These regions and motifs were linked to genomic features and genes associated with immune responses, re-direction of host cell nutrients, intracellular signalling, cell–cell adhesion, extracellular matrix, metabolism and apoptosis.
    [Show full text]
  • Supplementary Information Contents
    Supplementary Information Contents Supplementary Methods: Additional methods descriptions Supplementary Results: Biology of suicidality-associated loci Supplementary Figures Supplementary Figure 1: Flow chart of UK Biobank participants available for primary analyses (Ordinal GWAS and PRS analysis) Supplementary Figure 2: Flow chart of UK Biobank participants available for secondary analyses. The flow chart of participants is the same as Supplementary Figure 1 up to the highlighted box. Relatedness exclusions were applied for A) the DSH GWAS considering the categories Controls, Contemplated self-harm and Actual self-ham and B) the SIA GWAS considering the categories Controls, Suicidal ideation and attempted suicide. Supplementary Figure 3: Manhattan plot of GWAS of ordinal DSH in UK Biobank (N=100 234). Dashed red line = genome wide significance threshold (p<5x10-5). Inset: QQ plot for genome-wide association with DSH. Red line = theoretical distribution under the null hypothesis of no association. Supplementary Figure 4: Manhattan plot of GWAS of ordinal SIA in UK Biobank (N=108 090). Dashed red line = genome wide significance threshold (p<5x10-5). Inset: QQ plot for genome-wide association with SIA. Red line = theoretical distribution under the null hypothesis of no association. Supplementary Figure 5: Manhattan plot of gene-based GWAS of ordinal suicide in UK Biobank (N=122 935). Dashed red line = genome wide significance threshold (p<5x10-5). Inset: QQ plot for genome-wide association with suicidality in UK Biobank. Red line = theoretical distribution under the null hypothesis of no association. Supplementary Figure 6: Manhattan plot of gene-based GWAS of ordinal DSH in UK Biobank (N=100 234).
    [Show full text]