Restoring connectivity in a fragmented landscape: Creation of an ecological corridor in southwestern Ecuador
Thesis submitted in partial fulfillment of the requirements of the degree Dr. rer. nat. of the Faculty of Environment and Natural Resources, Albert-Ludwigs-Universität Freiburg
by Claudia Stefanie Hermes Freiburg im Breisgau, Germany 2017
Dean: Prof. Dr. Tim Freytag Supervisor: Prof. Dr. Gernot Segelbacher 2nd Supervisor: Dr. H. Martin Schaefer 2nd Reviewer: Prof. Dr. Jürgen Bauhus June 2017
Date of Thesis’ Defense:
Contents
1 Introduction 1
2 Thesis Structure 7
3 Habitat requirements and population estimate of the endangered Ecuadorian Tapaculo Scytalopus robbinsi 9
4 Effects of forest fragmentation on the morphological and genetic structure of a dispersal-limited, endangered bird species 31
5 Projected impacts of climate change on habitat availability for an endangered parakeet 51
6 A framework for prioritizing areas for conservation on tropical mountains 69
7 The ecological corridor Pagua - Cerro Azul - Buenaventura Puyango 89
8 Synthesis – 101
9 Summary 107
10 Zusammenfassung 111
11 Acknowledgements 115
12 Bibliography 117
13 List of Figures 135
14 List of Tables 139
Chapter 1 Introduction
TROPICAL FORESTS IN A CHANGING WORLD
Global biodiversity is declining at an unprecedented rate (Pimm et al. 1995). Anthropogenic land-use change is causing a severe loss in habitat, accompanied by a drastic increase of the extinction rates of animal and plant species (Sala et al. 2000, Butchart et al. 2010, Pereira et al. 2010). Likewise, anthropogenic climate change puts global biodiversity under serious strain, as global warming can alter species distribution ranges and reduce habitat availability, thus aggravating the extinction risk for several species (Thomas et al. 2004, Malcolm et al. 2006).
Among the areas most prone to biodiversity loss are the so- global biodiversity hotspots (Mittermeier et al. 1998, Myers et al. 2000). Biodiversity hotspots are areas called where an extraordinarily high concentration of endemic species is threatened by an extraordinarily high loss of habitat (Myers et al. 2000). To date, 34 biodiversity hotspots have been identified worldwide, mostly located in tropical regions. Each of these hotspots harbors more than 1500 endemic plant species, while at least 70 % of the original habitat within each hotspot is already lost (Brooks et al. 2002). The most imminent threat to pristine habitat in the tropical hotspots is deforestation and land- use change. Between 1990 and 1995, tropical biodiversity hotspots have lost on average 1.6 % of their forested area annually (Brooks et al. 2002). Throughout the tropical hotspots, pristine forests are converted into cropland or cattle pasture.
Due to the severe loss and degradation of forests in the tropics, the formerly continuous cover of primary forest has given way to a heterogeneous landscape of scattered forest fragments in various successional stages, separated by large areas of open land. Under current deforestation rates, the clearance of tropical forests is 1
Chapter 1 - Introduction expected to drive 15 % of forest-dependent species to extinction (Pimm and Raven 2000, Brook et al. 2008). Forest fragmentation aggravates the extinction risk of species though habitat loss, as it isolates populations from each other with increasing disconnection between forest patches (Kareiva and Wennergren 1995). Isolation between forest fragments largely reduces migration and gene flow between populations (Coulon et al. 2006), which can lower the genetic diversity within a population and make it vulnerable to environmental and demographic stochasticity as well as to inbreeding effects, such as reductions in fitness and disease resistance (Ellstrand and Elam 1993, Keller and Waller 2002, Dixo et al. 2009). Furthermore, lower genetic diversity may also lead to reduced evolutionary responses on the long- term, as the potential of a population to adapt to future environmental changes is restricted (Keller and Waller 2002, Beissinger et al. 2008). Thus, a decrease in genetic diversity caused by declines in population size and migration rates can severely threaten the survival of populations.
In the cloud forests on tropical mountains, the aforementioned negative impacts of habitat loss and fragmentation are worsened by climate change. The biodiversity of these forests heavily depends on a humid, cool environment created by frequent immersion in the cloud bank (Foster 2001). With ongoing climate change, the lower zones are becoming increasingly dry and hot, shifting the level of cloud formation to higher elevations (Still et al. 1999). Following the cloud bank, the species also shift their distribution ranges uphill (Pounds et al. 1999, Chen et al. 2001, Raxworthy et al. 2008, Feeley et al. 2011). As many cloud forest species occur in very narrow ranges or close to mountain tops (Foster 2001), the upslope displacement of their ranges can be accompanied by severe reductions in range size and thus an increased extinction risk (Rull and Vegas-Vilarrúbia 2006, Raxworthy et al. 2008). Moreover, an upslope shift of distribution ranges can disrupt connectivity among populations confined to different mountains. Taken together, the effects of forest loss and climate change
CONSERVATION OF TROPICAL BIODIVERSITY
Habitat loss due to deforestation, forest degradation and fragmentation can be counteracted by sound conservation actions, e.g. the reforestation of open land and the improvement of forest quality. However, conservation measures on tropical mountains should not merely alleviate forest loss, but also account for climate change impacts in order to provide habitat and connectivity for cloud forest species in the long-term. Consequently, a major aspect in biodiversity management is the protection
2
Chapter 1 - Introduction of remaining habitat and the restoration of connectivity between populations (Hess and Fischer 2001, Chetkiewicz et al. 2006).
A priority approach for the conservation of biodiversity is the establishment of dispersal corridors. Dispersal corridors can mitigate the negative effects of habitat loss on the genetic diversity and population size by enhancing migration and dispersal among populations (Caro et al. 2009). In general, a corridor, or linkage, can among populations in disconnected habitat patches, or ction by fulfill a conduit function by enabling or facilitating the movement and gene flow providing habitat and facilitating dispersal (Lindenmayer and Nix 1993, Hess and a habitat fun Fischer 2001). In fragmented tropical forests, linear forest remnants or riparian corridors, i.e. forested corridors close to watercourses, up to 500 m wide can provide habitat for small mammals, understory birds and amphibians (Laurance and Laurance 1999, Lima and Gascon 1999, Gillies and St Clair 2008), while enabling dispersal for larger mammals like jaguars (Rabinowitz and Zeller 2010). Live fences, i.e. tree rows demarking pasture edges, or scattered trees on pastures serving as stepping stones, highly enhance dispersal of canopy birds and bats (Gillies and St Clair 2008, Fischer et al. 2010), but do not necessarily provide habitat. Therefore, which of the two functions is mainly fulfilled largely depends on the design of the corridor.
A large number of studies have already proven the positive effects of ecological corridors in conservation practice (e.g. Beier and Noss 1998, Levey et al. 2005; Damschen et al. 2006, Lees and Peres 2008). Corridors can provide a variety of benefits to biodiversity. The restoration of connectivity between habitat patches prevents the declines of genetic diversity and population size, as immigration and gene flow from other patches are possible. Moreover, the total area and diversity of habitats increase with connection to other patches (Caro et al. 2009). Likewise, corridors can allow the colonization of new habitat. In tropical montane cloud forests, where climate change is driving species uphill, this feature takes on an important position. A corridor designed to account for climate change impacts should therefore facilitate migration upslope in order to enable evasion into higher elevations.
THE BIODIVERISITY HOTSPOT TUMBES-CHOCÓ-MAGDALENA
A biodiversity hotspot in need for urgent conservation measures is the Tumbes- Chocó-Magdalena hotspot on the western flanks of the Andes. This hotspot covers an area of more than 250,000 km² from Panama and Colombia to Ecuador and northern Peru, and harbors a high diversity of ecosystems, including tropical dry forests, wet 3
Chapter 1 - Introduction and humid forests, and mangroves. This variety of ecosystems makes the Tumbes- Chocó-Magdalena hotspot one of the most species-rich areas on Earth, with over 2500 plant and 400 vertebrate endemic species (Myers et al. 2000). The extraordinary biodiversity of the Tumbes-Chocó-Magdalena hotspot, however, is heavily threatened by deforestation and climate change. Projections suggest that the hotspot will lose over 90 % of its original habitat until the year 2100 (Jantz et al. 2015), which ranks the Tumbes-Chocó-Magdalena area among the hotspots most prone to species extinction in the near future.
CREATION OF AN ECOLOGICAL CORRIDOR IN SOUTHWESTERN ECUADOR
In the premontane cloud forests on the foothills of the Andes in the El Oro province of southwestern Ecuador, the two main ecoregions of the Tumbes-Chocó-Magdalena hotspot, the dry Tumbesian forests of northern Peru and the wet Chocó forests of Colombia and Ecuador, are intermingling. The resulting mosaic of wet and dry forests produces sharp environmental gradients and thus provides habitat for an extraordinarily high and unique biodiversity. However, southwestern Ecuador is severely affected by forest loss. In this region, up to 95% of the original cover of primary forest has been logged by now (Dodson and Gentry 1991). Consequently, the region is a priority area for the implementation of conservation measures.
Until now, there are no national parks or governmental reserves existing in the El Oro province. However, in 1997, the Ecuadorian NGO Jocotoco Foundation created the private Buenaventura reserve (Figure 1) to protect the remaining cloud forest remnants and to preserve the biodiversity therein. This reserve is especially known for its diverse avifauna, protecting around 350 bird species, of which twelve are endangered. Two prominent bird species that were discovered in the Buenaventura reserve are the El Oro Parakeet (Pyrrhura orcesi) and the Ecuadorian Tapaculo (Scytalopus robbinsi). Being endemic to the cloud forests of southwestern Ecuador, both species depend on a dense forest cover and are thus heavily threatened by the severe degradation and deforestation in their habitat (BirdLife International 2016).
In order to efficiently and sustainably protect the animal and plant communities of the El Oro province, the Jocotoco Foundation, together with the Ecuadorian National Biodiversity Institute and the government of the El Oro province, developed a plan to establish a network of four interconnected reserves, spanning across a total area of 2000 km² in the province (Figure 1). This region consists of patchily distributed fragments of premontane cloud forest and coastal dry forest, and areas used for agriculture, mainly as cattle pasture and plantations. The proposed network will 4
Chapter 1 - Introduction include protected areas as well as corridor linkages between them and is named Pagua - Cerro Azul - Buenaventura Puyango In the following, I will refer to the proposed reserve network as ecological corridor. ecological corridor – . Within the delimitation of the ecological corridor, three governmental reserves are planned to be created (near Pagua, Cerro Azul and Puyango; Figure 1) in addition to the already existing Buenaventura reserve. The main purposes of the ecological corridor will be to protect the natural ecosystem and to provide habitat for native species on the long-term. A key aspect will be to maintain connectivity among these four protected areas and, if needed, to restore it via reforestation, in order to allow for dispersal and gene flow of the native biodiversity. Importantly, the proposed ecological corridor will be designed to span an altitudinal gradient between sea level and over 2000 m, to increase its robustness in the face of climate change-related range shifts and thus to provide habitat for forest-dependent species in the future.
Figure 1: Designated area of the ecological corridor in the El Oro province in southwestern Ecuador (red outline). The Buenaventura reserve is shown by the bolt black outline. Three governmental reserves are planned near Pagua, Cerro Azul and Puyango.
This thesis aims at creating a scientific basis for the establishment of the ecological corridor Pagua - Cerro Azul - Buenaventura - Puyango. In my study area in the center of the proposed ecological corridor, between Cerro Azul and Nalacapa (Figure 1), I specifically want to investigate the following aspects: 5
Chapter 1 - Introduction
1. How severely are the forests fragmented and degraded? 2. Is the connectivity between forest patches high enough to enable migration and gene flow for dispersal-limited species? 3. How does climate change affect cloud forest species? 4. What is the optimal corridor design to ensure functional connectivity and sustainability in the face of climate change?
I will use the Ecuadorian Tapaculo and the El Oro Parakeet as focal species to assess the effects of forest fragmentation and climate change on cloud forest animals. Both species are classified as endangered (BirdLife International 2016). The Ecuadorian Tapaculo is a dispersal-limited understory bird with presumably strong demands for a dense cover of mature forests. The group-living, cooperatively breeding El Oro Parakeet is highly susceptible to topographic barriers to dispersal and shows genetic structuring already at a small spatial scale (Klauke et al. 2016). As both birds require well connected forested habitat, they are valuable focal species for the creation of the ecological corridor: A protected area meeting the demands of these two birds will likely protect many other species as well.
So far, the Ecuadorian Tapaculo is not well known to science. Therefore, in Chapter 3, I explore its habitat requirements in terms of the forest structure and the configuration of the forests in the landscape. Moreover, I make the first estimate of the global population size based on field data. These analyses give insight into the quality of forest fragments as habitat for forest-dependent species, and give an estimate about the population trend of a threatened cloud forest species. In Chapter 4, I analyze the effects of forest fragmentation on genetic diversity and morphology of the Ecuadorian Tapaculo, which informs about potential barriers to gene flow and population sub-structuring. For the assessment of climate change effects on the distribution ranges of cloud forest birds in Chapter 5, I use the El Oro Parakeet as a focal species. Projecting its climatic niche to different climate change scenarios informs about the intensity of the range shift that is to be expected until the year 2100. Finally, in Chapter 6, I integrate the results gained in the previous chapters in order to derive recommendations for the design of the ecological corridor. The aim of this thesis is to contribute to the establishment of a corridor which, by incorporating well-connected high-quality forests and being robust to climate change, is able to preserve and restore habitat and connectivity not only for Ecuadorian Tapaculos and El Oro Parakeets, but likewise for a large part of the unique biodiversity of the Tumbes-Chocó-Magdalena hotspot.
6
Chapter 2 Thesis Structure
This thesis consists of an introduction (Chapter 1) and an overview of the thesis structure (Chapter 2), followed by the research chapters 3 to 6. In Chapter 7, I discuss the management recommendations derived from the research chapters for the specific case of the ecological corridor Pagua - Cerro Azul - Buenaventura - Puyango.
(Chapter 9) and German (Chapter 10). The thesis ends with a synthesis Chapter 8 and the thesis’ summaries in English
The research chapters (Chapters 3-6) have been published in or submitted to scientific journals. Authorization to re-print the published articles within this thesis has been granted by the publishers. In the following, I provide information on the - articles. authorships, publication status and the author’s and co authors’ contributions to the
Chapter 3: Hermes C, Jansen J, Schaefer HM (2016): Habitat requirements and population estimate of the endangered Ecuadorian Tapaculo Scytalopus robbinsi. Bird Conservation International (in press).
C. Hermes and H.M. Schaefer originated and developed the idea for the study. C. Hermes and J. Jansen conducted the field work. C. Hermes analyzed the data. H.M. Schaefer contributed to analyzing the data. C. Hermes wrote the manuscript. J. Jansen and H.M. Schaefer contributed to writing the manuscript.
7
Chapter 2 - Thesis Structure
Chapter 4: Hermes C, Döpper A, Schaefer HM, Segelbacher G (2016): Effects of forest fragmentation on the morphological and genetic structure of a dispersal-limited, endangered bird species. Nature Conservation 16: 39-58.
C. Hermes, H.M. Schaefer and G. Segelbacher originated and developed the idea for the study. C. Hermes and A. Döpper conducted the field work. A. Döpper conducted the laboratory work. C. Hermes and G. Segelbacher contributed to the laboratory work. C. Hermes analyzed the data. A. Döpper, H.M. Schaefer and G. Segelbacher contributed to analyzing the data. C. Hermes wrote the manuscript. H.M Schaefer and G. Segelbacher contributed to writing the manuscript.
Chapter 5: Hermes C, Keller K, Nicholas R, Segelbacher G, Schaefer HM: Projected impacts of climate change on habitat availability for an endangered parakeet. Submitted to Biological Conservation.
C. Hermes, K. Keller and H.M. Schaefer originated and developed the idea for the study. C. Hermes and K. Keller developed the niche model. R. Nicholas and H.M. Schaefer contributed to developing the niche model. C. Hermes analyzed the data. K. Keller and H.M. Schaefer contributed to analyzing the data. C. Hermes wrote the manuscript. K. Keller, G. Segelbacher and H.M. Schaefer contributed to writing the manuscript.
Chapter 6: Hermes C, Segelbacher G, Schaefer HM: A framework for prioritizing areas for conservation on tropical mountains. Submitted to Peerage of Science.
C. Hermes, G. Segelbacher and H.M. Schaefer originated and developed the idea for the study. C. Hermes analyzed the data and wrote the manuscript. G. Segelbacher and H.M. Schaefer contributed to writing the manuscript.
8
Chapter 3 Habitat requirements and population estimate of the endangered Ecuadorian Tapaculo Scytalopus robbinsi
Claudia Hermes, Jeroen Jansen & H. Martin Schaefer
Manuscript accepted for publication in Bird Conservation International
ABSTRACT
The Chocó-Tumbesian region of western Ecuador is one of the 25 global biodiversity hotspots harboring high numbers of endemic species, which are heavily threatened by habitat loss and fragmentation. Moreover, ongoing climate change in the tropics drives species uphill as lower-lying areas are becoming constantly drier. Such upslope movement can pose major challenges for less mobile species, like understory birds which are confined to mature forests and unable to cross habitat gaps. Consequently, these species are threatened by a combination of upslope range shifts and forest fragmentation. In our study, we investigated population numbers and habitat requirements of the Ecuadorian Tapaculo (Scytalopus robbinsi), which is endemic to the premontane cloud forests of southwestern Ecuador. Comparing the microhabitat structure within territories with control sites revealed that Ecuadorian Tapaculos prefer old secondary forests. Moreover, connectivity between forest fragments was the strongest predictor for the presence of territories within them. We estimated the mean upslope shift of the distribution range as 100 m per decade and 9
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– developed a model of habitat availability for the revised range. Extrapolating the number of territories from the study area to the distributional range of the Ecuadorian Tapaculo showed that the global population size is smaller than previously assumed. Our results suggest that the Ecuadorian Tapaculo is strongly affected by forest loss and degradation. Therefore, to prevent a continuing decline in population numbers or even extinction, conservation measures focusing on restoring connectivity between fragments and increasing habitat quality and quantity for the remaining populations need to be prioritized.
KEYWORDS: El Oro Tapaculo; cloud forest; forest fragmentation; habitat preference; Tumbes-Chocó-Magdalena hotspot
INTRODUCTION
The pre-montane cloud forests in the Tumbes-Chocó-Magdalena region of western Ecuador and Colombia are considered a global biodiversity hotspot (Myers et al. 2000), where extraordinary high numbers of endemic species are facing a severe loss of habitat. While only about 25 % of the original extent of primary vegetation remains, the region harbors highly diverse and partly endemic plant and animal communities (Myers et al. 2000). Annual deforestation rates of 1.43 % are driving species to the brink of extinction (Brooks et al. 2002). manyThe environmental of the hotspot s distress endemic that species in the Tumbes-Chocó-Magdalena area are facing can be further deteriorated by climate change. Human-induced warming of the atmosphere is altering the level of cloud formation, causing an upslope shift of the cloud bank (Still et al. 1999, Foster 2001). Thus, the increasingly dry conditions in the lower-lying cloud forests result in a global upward range shift of tropical montane plant and animal communities (Pounds et al. 1999, Foster 2001, LaVal 2004, Parmesan 2006, Feeley et al. 2011, Freeman and Class Freeman 2014, Morueta- Holme et al. 2016). This shift does not only generate a loss of original habitat, but can even cause the extinction of species confined to mountain tops (Rull and Vegas- Vilarrúbia 2006, Raxworthy et al. 2008, Nogué et al. 2009). Moreover, drier and hotter conditions in the lower areas can form dispersal barriers for some species and, as a consequence, disrupt linkages between populations. Reduced connectivity between populations diminishes their genetic diversity (Epps et al. 2005, Coulon et al. changing environmental conditions (Keller and Waller 2002, Beissinger et al. 2008). , Segelbacher et al. and thus restricts a species potential to adapt to 10
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– The uplifting cloud bank, the loss of habitat and the reduction in connectivity between populations can act synergistically as drivers of an extinction vortex for cloud forest species (Fagan and Holmes 2006, Brook et al. 2008). A model revealed that approximately one third of the Tumbes-Chocó-Magdalena endemics will become extinct if an additional 1,000 km² of habitat is lost, which ranks the region among the biodiversity hotspots most prone to species loss at a short term (Brooks et al. 2002).
Within the tropical avifauna, endemic insectivorous birds are especially threatened by extinction (Duncan and Blackburn 2004, Sodhi et al. 2004). One example for such a species is the Ecuadorian Tapaculo, also known as El Oro Tapaculo (Scytalopus robbinsi, Rhinocryptidae). It was first described in 1997 (Krabbe and Schulenberg) as an understory bird confined to wet forests in southwestern Ecuador. So far, little is distribution range. It is assumed that the species, being forest dependent and known about the Ecuadorian Tapaculo s population size, habitat requirements and reluctant to cross open areas (Krabbe and Schulenberg 1997), is vulnerable to the degradation, fragmentation and loss of its habitat, which is why the species is classified as endangered by IUCN.
Being endemic to the Tumbes-Chocó-Magdalena hotspot, the Ecuadorian Tapaculo is affected by the deforestation and the upshift in the cloud bank that are characteristic for the region. It is probable that the above mentioned environmental pressures have strong effects on the population size and the extent of the distribution range of the species. Due to ongoing deforestation, the size of the population is thought to decrease rapidly (BirdLife International 2016). Drier conditions in its habitat as a consequence of an upshifting cloud base potentially have negative impacts on the species, as it favors the most humid areas (Krabbe and Schulenberg 1997). The similarly endangered El Oro Parakeet (Pyrrhura orcesi), which is occupying the same range as the Ecuadorian Tapaculo, has shifted its altitudinal range upslope at a rate of about 200 m per 30 years (Klauke et al. 2016). Thus, it is possible that the Ecuadorian Tapaculo is currently undergoing a similar altitudinal shift.
In this study, we want to assess the effects of habitat fragmentation caused by deforestation and the uplifting cloud bank on the distribution range of the Ecuadorian Tapaculo, on its population size and on the availability of habitat for the species. On a small scale, we evaluated the habitat preferences of the Ecuadorian Tapaculo by comparing microhabitat structure, i.e. fine-scale features of the habitat, within territories with control plots. Specifically, we tested the hypothesis that the Ecuadorian Tapaculo is heavily threatened by habitat degradation. Accordingly, on a medium scale, we expect the species to be restricted to mature forests or older secondary stands. Alternatively, the species is more tolerant towards habitat
11
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– degradation and therefore less threatened than assumed by BirdLife International. In this case we expect to find their territories also in young successional forests.
On a large scale, we assessed the macrohabitat structure in the southern part of the distribution range of the Ecuadorian Tapaculo in terms of the configuration of the remaining forest patches in a landscape context. Specifically, we quantified the area, shape and connectivity of forests, as these are key drivers of the abundance of fragmentation-sensitive species (Noss and Harris 1986). The analyses allowed us to assess species-specific habitat requirements, i.e. to define the preferences of Ecuadorian Tapaculos for a certain microhabitat and macrohabitat structure. Moreover, we evaluated whether the remaining forests provide suitable habitat for Ecuadorian Tapaculos by meeting their specific habitat requirements. To make the first estimate of the global population size based upon field data, we developed a patch occupancy model. During an intensive survey in southwestern Ecuador, we determined the number of territories and their density and extrapolated these values to the model area and to the global range.
METHODS
Study species and study site
IUCN. It is endemic to the western slopes of the Andes in southwestern Ecuador The Ecuadorian Tapaculo is a globally threatened species listed as endangered by (Figure 2). The Ecuadorian Tapaculo was described to occur in a range of 1,200 km² in an elevation between 700 m and 1,250 m, preferring the most humid areas in the undergrowth of wet forests (Birdlife International 2016). There is evidence that the distribution range of the species stretches about 55 km farther to the north than previously assumed: In February 2015, a territory of the Ecuadorian Tapaculo was found in the northern Cañar province (N. K. Krabbe and F. Sornoza, personal communication).
Tapaculos in general are poor flyers and move around mainly by hopping, walking or short distance flights (Reid et al. 2004, Castellón and Sieving 2006). Ongoing loss and fragmentation of habitat presumably pose a major threat to the remaining populations. The global population of the Ecuadorian Tapaculo is unknown. Birdlife International (2016) estimated the population size between 2,500 and 9,999 mature individuals, based on the potential extent of occurrence of the Ecuadorian Tapaculo and on a previous estimate of the population size of an unrelated species with a similar range (A. Symes, personal communication). In view of rapid habitat loss, the
12
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– global population of the Ecuadorian Tapaculo is feared to be decreasing at an alarming pace (BirdLife International 2016).
Figure 2: Distribution range of the Ecuadorian Tapaculo. The species occurs in premontane cloud forests and was found only in an elevation between 850 m and 1500 m (indicated by the black line). Field work was carried out in our study area in the southern part of the distribution range, with the Buenaventura Reserve in the south being the only well-protected site within the area. The satellite images cover about one-third of the distribution range.
forest fragments, which are mostly smaller than 100 ha (Robbins and Ridgely 1990, The species distribution range is characterized by a mosaic of patchily distributed Freile and Santander 2005). From 2005 to 2010, the deforestation rate in Ecuador was 1.89 %, which is the highest rate in South America (FAO 2010). The main causes for the conversion of remaining forests are the intensification of agriculture and
13
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– forest clearance for livestock (BirdLife International 2016). Already 20 years ago natural vegetation persisted only on steep slopes unsuitable for cattle pastures or agriculture (Best and Kessler 1995). There is only one protected site within the ventura Reserve (S 3,655°, W 79,744°), owned by the Ecuadorian NGO Fundación Jocotoco. The Ecuadorian Tapaculo s distribution range, which is the private Buena prevailing vegetation types within the reserve are secondary forests which are separated by areas of abandoned pasture.
Territory identification
Field work was carried out between December 2013 and May 2014, between October 2014 and January 2015, and between September and November 2015 in 190 km² of
Buenaventura Reserve as core area (Figure 2). We searched in forests in elevations the southern part of the Ecuadorian Tapaculo s distribution range, with the between 600 m and 1,700 m for territories of Ecuadorian Tapaculos. In order to survey the greatest possible area within a forest fragment, we established transects parallel to the valley, with a distance of 50 m to 100 m between transects. Territories were located using tape recordings of the song of male Ecuadorian Tapaculos. The recordings were played every 50 m with an 8 W portable playback speaker (Funbox, Intenso, Germany). Tapaculos are known to show year-round strong territorial response to potential intruders by responding with territorial singing or closely approaching the playback (Sieving et al. 1996, De Santo et al. 2002). We estimated the distance in which we would hear an individual answering to our playback to be 60 m. After 2 minutes of playback, we waited for 5 minutes for any reaction (i.e., singing or approaching to the playback), and repeated this cycle three times in total. To make sure that we did not miss an individual which might have been less responsive at a given time, each transect was re-visited at least three times during the field season, with intervals of at least one week. For each located territory, we marked coordinates and elevation with a GPS (Oregon 550, Garmin Ltd., USA) for subsequent assessment of microhabitat structure and patch occupancy analyses.
Analysis of microhabitat structure on a small scale
In order to investigate the habitat requirements of the Ecuadorian Tapaculo, we assessed microhabitat characteristics of 28 territories and 36 control plots in the Buenaventura Reserve. Using Quantum GIS 2.0, control plots were generated as random points in forested areas above 700 m within the reserve, at places where Ecuadorian Tapaculos were not observed. Moreover, we recorded the microhabitat structure in 44 territories and 73 randomly selected control plots in forest fragments 14
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– outside of the Buenaventura Reserve (Figure 3). On one hand, this enabled us to assess whether the microhabitat preferences found inside the Buenaventura Reserve apply also to a much larger area. On the other hand, it allowed us to later evaluate habitat suitability in fragments where we did not detect territories. Depending on fragment size, we analyzed between one and 18 plots per fragment. Minimum distance between fragments was 10 m.
Figure 3 elevational range were mapped from satellite images of the area. Fragments where we analyzed : Detailed map of the study area. Forest fragments in the Ecuadorian Tapaculo s microhabitat structure are depicted in black, while forests that were not analyzed are shown in grey. White dots roughly indicate the locations of the territories of Ecuadorian Tapaculos. The Buenaventura Reserve is indicated by the bolt white line.
15
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– The exact territory size of the Ecuadorian Tapaculo is unknown. Observing the movements of four territorial birds and measuring the area in which we obtained their territorial response yielded a territory size of 0.1 ha to 0.5 ha (see also Klemann Jr. and Vieira 2013). We therefore used a conservative estimated value of ~ 0.1 ha (simplified as a square with side length of 33 x 33 m) as standard territory size. For each territory, we analyzed five randomly selected subplots with the length of 5 x 5 m. To characterize the microhabitat structure, we chose eleven habitat parameters (see Table 1 and Appendix A for parameter description) that are commonly used to describe the structure of tropical forests in different successional stages (e.g., Montgomery and Chazdon 2001, DeWalt et al. 2003, Faria et al. 2009), or are of special importance for other species of Tapaculos (De Santo et al. 2002, Reid et al. 2004, Amico et al. 2008). These parameters were assessed within each subplot. To obtain one value per plot for each variable, we calculated the arithmetic mean for the five subplots.
Evaluation of habitat requirements and habitat suitability on a medium scale microhabitat structure of the 36 control plots and 28 territories that were analyzed in To evaluate the Ecuadorian Tapaculo s habitat requirements, we compared the 21 forest fragments in the Buenaventura Reserve. Microhabitat variables differed in their numerical range (e.g., from 3 - 50 m in -standardized before the analysis. To limit the number of ° in inclination compared to – variables, we conducted a principal component analysis (PCA) with the standardized tree height and were z mean values and used the first four principal components (PCs) for a logistic regression model. In the model, we entered the presence or absence of a territory in a plot as the dependent variable and the PCs describing the habitat characteristics as independent variables. To assess differences in microhabitat structure between territories and control plots, we carried out Mann-Whitney U- tests with the PCs which in the logistic model yielded the largest effects on whether a fragment was occupied by a territory.
To assess the habitat quality in a larger area outside of the Buenaventura Reserve, we carried out a linear discriminant analysis (LDA) for 44 territories and 73 control plots in a total of 64 forest fragments in the study area (Figure 3 - . The two variables Tree analysis, as they were strongly correlated with other variables (r > 0.8, P < 0.001). We Basal Area and Vegetation density in cm had to be excluded from the then performed a leave-one-out cross-validation of the LDA to reassess group membership. The cross-validation provided a posterior value for the probability of a given plot to be classified as a territory. This16 value was used as a proxy for the plot s
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– quality as habitat for the Ecuadorian Tapaculo in the following estimation of the population size. Moreover, the LDA allowed us to identify suitable habitat in areas that were not occupied by territories.
Analysis of land cover and connectivity on a medium scale
Landscape heterogeneity is influencing the abundance and population viability of fragmentation-sensitive species (Noss and Harris 1986). As explained above, the disconnected forest fragments separated by large areas of agricultural plantations or Ecuadorian Tapaculo s distributional range is characterized by a variety of small, cattle pastures. To quantify the amount of remaining forest patches, we applied remote sensing and geographic information system (GIS) analyses. Geo-referenced satellite images (RapidEye, Blackbridge, Germany) of the southern part of the resolution of 5 m were used as a template to manually create a map of forested Ecuadorian Tapaculo s distributional range taken between and with a Figure 3). The satellite images covered about 345 (Figure 2). habitats ≥ . ha in ArcMap . As the Ecuadorian Tapaculo is restricted to forests, we did not distinguish between km² of the southern end of the Ecuadorian Tapaculo s known total range other land cover types like pastures or shrubby habitat and classified them for simplicity as matrix of unsuitable habitat. To assess the amount and shape of the forest fragments in a landscape context, we quantified the following landscape metrics of the fragments: patch size, fragment compactness, and connectivity. We calculated the index of fragment compactness as forest area divided by perimeter to account for a different complexity of fragments and different extents of core vs. edge- affected areas (e.g., a fragment with a round shape will get a higher compactness index than a fragment which splits up into several long, thin tree rows reaching into open habitat). The connectivity of a fragment was measured as the distance to the nearest forested patch with a compactness index higher than the minimum assumed to be large enough to hold a source population for emigration (see Castellón compactness we found for the Ecuadorian Tapaculo and with an area ≥ ha, what we and Sieving 2006).
Patch occupancy model and population extrapolation on a large scale
Using the map of forested habitats created from satellite images and the coordinates of the territories we located in the study area, we determined the minimum size, compactness and connectivity of fragments that are suitable for Ecuadorian Tapaculos in ArcMap 10.2. To estimate the total number and density of territories, we first determined the total area that was searched in the fragments by multiplying the 17
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– length of the transects by 120 m width (60 m on either side of the transect). Then we evaluated territory density within this area. Using this value, we extrapolated the number of territories in areas which were not covered by playback, but suitable according to their landscape metrics. With the help of altitudinal contour lines, the forest fragments in the area covered by satellite images were assigned to elevation zones.
Based on the minimum values for compactness, area and connectivity that were evaluated earlier, we assessed the suitability of a given fragment as habitat for Ecuadorian Tapaculos. We then determined the number of territories within a fragment as the area not covered by playback divided by the average territory density. The resulting value gives an estimate for territory numbers based on landscape metrics. To additionally account for density differences as a consequence of variation in habitat quality, we multiplied the extrapolated territory numbers in a given fragment with its value for habitat quality derived from the LDA cross- validation. However, we could not assess habitat quality range. To obtain a sound estimate even though habitat quality was unknown for parts over the entire species of the range, we extrapolated territory numbers in two steps to the distributional range: First, we developed three different models assuming low, medium or high habitat quality in the fragments we did not visit in the area covered by our satellite images (Figure 2). In the medium quality model, we multiplied territory numbers by the mean posterior value for habitat quality in all fragments, as obtained from the LDA. For the low habitat quality model, we multiplied territory numbers by the mean posterior value minus its standard deviation; for the high quality model, territory numbers were multiplied by the mean posterior value plus one standard deviation. As we did not have satellite images for the northern part of the distribution range, we based the second step of the extrapolation only on the geographical area of the distribution range, assuming a similar distribution of forest fragments. We inferred the global population size by projecting the minimum, medium and maximum quality models to the entire range.
In a subsequent analysis, we assessed which factors influenced the suitability of a fragment as habitat for the Ecuadorian Tapaculo. To this aim, we created a logistic regression model, with the presence or absence of a territory as dependent variable and forest size, compactness, connectivity and habitat suitability as well as the two- way interactions between them as independent variables.
18
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– RESULTS
Territory density
In contrast to the previously known altitudinal distribution between 700 and 1,250 m, Ecuadorian Tapaculos occurred only between 870 m and 1,460 m, with a mean of 1,170 m ± 130 m (Figure 4). Based on these indications, we determined the in the provinces El Oro, Azuay and Cañar, in an altitudinal band between 850 m and Ecuadorian Tapaculo s distribution range to extend over an area of about , km² 1500 m (Figure 2).
Figure 4: Histogram of the altitudinal distribution of the Ecuadorian Tapaculo in southwestern Ecuador with density curve. The species was found between 870 and 1460 m (mean 1170 m).
Overall, we discovered 113 Ecuadorian Tapaculo territories in our study area (Figure 3 indicates territory locations). A total area of 835 ha in forests between 850 and 1,500 m was covered by playback. The smallest fragment with a territory had a size of 2.29 ha (mean 28.52 ha, max 1,856.99 ha) whereas mean density was one territory per 7.39 ha of forest. The minimum compactness index for a fragment occupied by a territory was 37.03 (mean 95.59, max 174.94), and the maximum distance between an occupied fragment and the nearest fragment larger than 5 ha was 245 m (mean 81.79 m, min 10 m).
Microhabitat structure on a small scale
The first four PCs of the PCA accounted for 72.10 % of the total variance in the 11 microhabitat variables (Table 1). Original variables with loadings above a threshold of 0.375 were assigned to the respective PC. PC 1 described the vegetation density in
19
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– the undergrowth (0 - 150 cm), whereas PC 2 mainly characterized tree features (tree height and diameter in breast height) and terrain inclination. PC 3 represented once again tree characteristics (tree basal area and diameter in breast height) as well as vegetation density in 0 50 cm. PC 4 described the number of trees and crown density. –
Habitat requirements and habitat suitability on a medium scale
The logistic regression model of microhabitat structure revealed that PC 2 (P < 0.001) and PC 4 (P = 0.001), representing number, height and diameter of trees, crown density and terrain inclination, were the strongest predictors for the presence of a territory. Territories had lower values for PC 2 than control plots (Mann-Whitney U- test: -0.702 vs. 0.546, W = 754, P < 0.001), indicating that Ecuadorian Tapaculos prefer microhabitats with large trees, big trunks and a strong inclination. Moreover, territories were characterized by lower values for PC 4 (Mann-Whitney U-test: -0.459 vs. 0.357, W = 756, P < 0.001). This means that territories have more trees than control areas, but a lower density in the crown layer.
The LDA produced similar results. Territories of Ecuadorian Tapaculos and control plots differed in their mic P < 0.0001). We defined 0.04 as the threshold for variable coefficients that strongly contributed to rohabitat structure Wilks Lambda = . , identify territories. Territories were characterized by the number and height of trees and by the presence of streams, while the presence of coarse wooden debris (e.g. fallen trees or large branches) described control plots (Table 2). Cross-validating the LDA correctly classified 80.34 % of the plots (75.61 % of territories and 82.89 % of the control plots) to their original group. In the cross-validation of the LDA, the mean probability for a plot to be classified as a territory was 0.34 ± 0.25.
The logistic regression of landscape metrics and habitat quality revealed that the connectivity between fragments determined the suitability of a fragment as Tapaculo habitat (P = 0.028), followed by the interaction between connectivity and habitat quality (P = 0.034) and the interaction between connectivity and fragment compactness (P = 0.044).
20
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– Table 1: Variables used to assess and compare habitat characteristics of 28 territories of Ecuadorian Tapaculos and 36 control plots within the Buenaventura Reserve (S 3,655°, W 79,744°), with the loadings, eigenvalues and variance of the first four principal components (threshold: 0.375; bold font).
Variables Loadings Habitat variable Variable description PC 1 PC 2 PC 3 PC 4 Inclination [°] Mean inclination 0.148 - -0.329 -0.119 0.394 Tree height [m] Maximum tree height -0.128 - -0.111 -0.296 0.465 DBH [cm] Diameter in breast height, for all -0.295 - 0.430 0.018 0.422 TBA [m²] Tree basal area, for all trees with -0.320 -0.329 0.503 0.012 trees with DB( ≥ cm Number of trees -0.275 -0.004 -0.242 - DB( ≥ cm 0.656 Density in 0 50 cm [%] PercentageNumber of treesof vegetation with DB( in ≥ this cm 0.390 0.021 0.410 -0.274 layer Density in 50– 100 cm [%] Percentage of vegetation in this 0.466 -0.174 0.167 -0.010 layer Density in 100– 150 cm [%] Percentage of vegetation in this 0.446 -0.157 0.093 0.060 layer Wooden debris– Presence of coarse wooden debris 0.216 -0.364 -0.318 -0.105 (fallen trunks, branches etc.) Streams Presence of streams or water runs 0.116 -0.373 -0.144 0.374 Canopy density [%] Percentage of the sky obscured by -0.262 -0.126 -0.238 0.487 vegetation Eigenvalue 3.183 2.340 1.366 1.042 Variance 28.94 21.28 12.42 9.47
Table 2: Linear discriminant coefficients for the microhabitat variables. Positive values (threshold: 0.04; bold font) describe Ecuadorian Tapaculo territories, and negative values (threshold: -0.04; bold font) describe control plots.
Habitat variable Linear discriminant coefficient Inclination [°] 0.017 Tree height [m] 0.101 DBH [cm] 0.002 Number of trees 0.500 Density in 0 50 cm [%] 0.013 Density in 100 150 cm [%] 0.014 – Wooden debris -0.414 – Streams 0.047 Canopy density [%] -0.001
21
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– Patch occupancy model and population extrapolation on a large scale
The model for medium habitat quality produced a number of 505 territories, equaling 1,010 mature individuals for the area covered by the satellite photos. Respectively, the low habitat quality model yielded 297 territories, equaling 594 mature individuals. The high habitat quality model resulted in 721 territories, or 1,442 mature individuals.
In a second step, we extrapolated territory numbers to the global range. The medium habitat quality model amounted to 1,610 territories (3,220 mature individuals), while the low habitat quality model yielded 947 territories (1,894 mature individuals) and the high habitat quality model 2,299 territories (4,598 mature individuals).
DISCUSSION
In this study, we modelled the population size and territory characteristics of a threatened understory bird, the Ecuadorian Tapaculo. In a detailed survey carried out in an area of 190 km² in the southern part of the distribution range, we discovered a total of 113 territories. Extrapolating habitat quality and territory numbers to the global range revealed that the population size is lower than the previous estimate, which was based upon the geographical range only (BirdLife International 2016). Moreover, we found that the species occurs at higher elevations than thus far known. Within the distributional range of the Ecuadorian Tapaculo, there are almost no primary forests remaining. Ecuadorian Tapaculos prefer mature secondary forests over younger secondary forests. Connectivity between forest fragments is the strongest determinant of whether Ecuadorian Tapaculos occupy a fragment.
Habitat requirements
Forests in the Tumbes-Chocó-Magdalena hotspot are suffering from extensive logging and habitat degradation. Throughout southwestern Ecuador, up to 95 % of the original primary forest had been cut already 20 years ago (Gentry 1992), with only small fragments in different successional stages remaining. Analyzing the microhabitat structure in the distribution range of the Ecuadorian Tapaculo allowed us to determine the successional stage of a forest fragment. Forests in the Buenaventura Reserve vary mainly in vegetation density in the understory, tree height and diameter, canopy density, tree basal area, the number of trees and terrain inclination. The first five of these parameters are structural characteristics used to assess the stage of forest succession. In old-growth or old secondary stands, the 22
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– vegetation density in the understory layer is low, whereas younger forests are characterized by a higher density in this layer (DeWalt et al. 2003, Faria et al. 2009). Likewise, the highest basal area as well as very large trees can only be found in older stands (Guariguata and Ostertag 2001, Montgomery and Chazdon 2001, De Avila et al. 2015). Older forests have a lower canopy density, with frequent gaps in the canopy layer (Guariguata and Ostertag 2001). The number of trees however is not clearly related to forest age (DeWalt et al. 2003). In the southern part of the distributional range of the Ecuadorian Tapaculo, we did not detect any primary forest. The remaining forest fragments show different grades of succession.
Comparing the forest structure in territories of Ecuadorian Tapaculos with control plots showed that individuals preferably settled in microhabitats with tall trees having large trunks and a low density of the vegetation in the canopy, which are strong indicators of old-growth or forests in later successional stages. As old forests in this area mainly persist on steep slopes unsuitable for conversion into cattle pastures (Best and Kessler 1995), the apparent preference of the Ecuadorian Tapaculo for strong inclination might be attributable to the unavailability of mature forests in flatter areas. We conclude that the Ecuadorian Tapaculo is restricted to old- growth forests and old secondary stands and is avoiding forests in young successional stages. These findings were additionally confirmed by the linear discriminant analysis, which yielded similar parameters to separate territories and control plots along the discriminant axis over a large spatial area. Thus, the species is indeed heavily threatened by habitat degradation.
Several other closely related species do not show clear preferences for high-quality habitat. Contradictory to our findings, Cuervo et al. (2005) did not detect an effect of tree height or terrain inclination on the presence of Scytalopus stilesi in Colombia. Especially S. latrans, which is widespread throughout the Tumbes-Chocó-Magdalena hotspot, also occurs in heavily disturbed forest fragments (Krabbe et al. 2005). Similarly, the recently discovered S. griseicollis gilesi and S. rodriguezi from Colombia as well as S. diamantinensis from Brazil are able to occupy secondary stands in early successional stages (Krabbe et al. 2005, Bornschein et al. 2007, Donegan and Avendaño 2008). The Ecuadorian Tapaculo seems to be less tolerant towards habitat degradation than other species of the same genus. It is also conceivable that the habitat degradation throughout the distribution range of the Ecuadorian Tapaculo is stronger that in the ranges of the above mentioned species.
Ecuadorian Tapaculos established territories in forests of a late successional stage might be a consequence of the overall poor state of the forests in the distribution and avoided younger stands. The species preference for older secondary forests
23
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– range. Assessing habitat quality throughout our study area revealed a mean quality of 0.34 in the study area. This value indicates that only a third of the available forest fragments are suitable for Ecuadorian Tapaculos, suggesting that most forests in the study area are young secondary stands or forests where large old trees were selectively cut. Moreover, we only detected one territory per 7 ha, while the minimal size of a territory was about 0.1 ha. Even though this value might underestimate the actual territory size, the high proportion of habitat which was unoccupied by Ecuadorian Tapaculos indicate its unsuitability for territory establishment. The overall quality of the forest fragments might be so low that the Ecuadorian Tapaculos are confined to the parts providing the highest habitat quality. The fact that habitat quality was partly assessed in the protected Buenaventura Reserve, where the proportion of forests in older successional stages is high, may represent a bias, as the fragments in the remaining distribution range probably have lower habitat quality. Nevertheless, since we detected the biggest population of Ecuadorian Tapaculos in a forest about 5 km south of the Buenaventura Reserve, the quality in some fragments outside of the reserve is sufficiently high for territory establishment. However, low habitat quality likely presents a limiting factor for the species.
Ecuadorian Tapaculos are dispersal-limited. A logistic regression model revealed that the distance to the nearest large forest patch is the strongest predictor of the presence of Ecuadorian Tapaculos in a fragment. On average, fragments holding territories were separated by clearings of 82 m, with the maximum distance being 245 m. The most isolated fragment holding a territory, which was separated by 245 m of open habitat from the nearest forest, was at the same time the smallest occupied fragment with an area of about 2 ha. However, only fragments larger than 5 ha are believed to hold a sufficient amount of territories for a self-sustaining population of Tapaculos (Castellón and Sieving 2006). Consequently, we consider it likely that the individual who established its territory in this particular fragment has immigrated from the nearest larger fragment, which involved crossing 245 m of non-forested habitat. A study on Chucao Tapaculos (Scelorchilus rubecola) discovered that they crossed gaps of up to 120 m width (Castellón and Sieving 2006). For the Ecuadorian Tapaculo, exact dispersal data are lacking so far. Deducing from our observational data, we assume 245 m to be the largest distance an Ecuadorian Tapaculo is able to disperse through clearings.
Range size and population estimates
Until now, a relatively precise estimate of the population size of the Ecuadorian Tapaculo has been lacking, but the population was suspected to decrease rapidly
24
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– (BirdLife International 2016). Even in the only protected area in its distribution range, the Buenaventura Reserve, the species declined, particularly at lower elevations (HMS, personal observation). Hence, one aim of our study was to estimate global population size by extrapolating the number of territories located in the study area to the entire distribution range.
In the course of this study, we gained two important new insights into the extent of undergone a 100 m upslope range shift in the lower boundary and a 250 m shift in the species distribution range. First, the Ecuadorian Tapaculo seems to have the upper boundary within the last 25 years. In 1990, the species was discovered at elevations between 700 and 1,250 m (Krabbe and Schulenberg 1997). Now, we recorded territories only above 870 m, but as high as 1,460 m, which we round here to 850 to 1,500 m. We did not detect any territory between 700 and 870 m, despite the fact that in large parts of the Buenaventura Reserve, the zones below 870 m are covered by dense forests that appear suitable as habitat for Ecuadorian Tapaculos. As such, the potential upslope shift in the lower species boundary is not due to the lack of forest and presumably not an artefact of specific conditions at this site. On the contrary, as the study area contained several different valley systems which yielded similar results, the conclusions drawn from our study can be generalized over a larger area. Although detailed climate data about the region are lacking, forests in the lower parts specifically in the Buenaventura area are reportedly becoming drier (Klauke et al. in press). This suggests that the potential range shift might be attributable to an altitudinal shift in the cloud bank and therefore humidity, together with a temperature increase. Upslope range shifts as a consequence of climate change have already been observed in other tropical bird species (Freeman and Class Freeman 2014, Lenoir and Svenning 2014), including the endemic El Oro Parakeet (Pyrrhura orcesi), which occupies a similar range as the Ecuadorian Tapaculo (Klauke et al. 2016). It is already known that arid valleys represent distribution boundaries for Andean forest birds, including other Tapaculo species (Krabbe 2008). We therefore consider it likely that the Ecuadorian Tapaculo shifts its range uphill in order to evade increasingly dry conditions in the lower-lying areas.
The detection of a territory of an Ecuadorian Tapaculo in the northern Cañar province in February 2015 represents another new finding regarding the distribution range (N.K. Krabbe and F. Sornoza, personal communication; see also http://www.xeno- canto.org/241054). Until now, it was assumed that the species would only occur in an area of 1,200 km² in the cloud forests in El Oro and Azuay provinces (BirdLife International 2016), so the new record infers a range expansion of about 55 km to the north. Importantly however, we show that even this 55 km expansion of the known range does not extend the earlier estimated distribution range size. The observed 25
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– upslope shift of the range results in a strong decrease in the net area that was not compensated for by the extension towards the north. Based on these findings, we revised the distribution range of the Ecuadorian Tapaculo, with the species occurring at elevations between 850 and 1,500 m, to an area of 1,100 km² in El Oro, Azuay, Guayas and Cañar provinces of southwestern Ecuador (Figure 2).
The population extrapolation yielded a likely global population size between 1,900 and 4,600 mature individuals. Territory density was highest between about 1,000 and 1,300 m (Figure 4). For the population extrapolation, we used a conservative estimate of one territory per 7.39 ha, which was derived over the whole elevation range. It is likely that the actual territory density is higher between 1,000 and 1,300 m, while it is lower in the zones above and below this band. Given the specific habitat requirements of the Ecuadorian Tapaculo, we accounted for varying habitat quality when calculating the population size.
Our results show that the population size of the Ecuadorian Tapaculo is smaller than previously assumed, indicating that the effects of the loss and degradation of its habitat are even more severe than feared. Birdlife International estimates place the Ecuadorian Tapaculo in the band of 2,500 to 9,999 mature individuals and classifies it conservation status was evaluated for the first time in 2007 (BirdLife International as endangered based on population and range size criteria. The species 2016); however, in 2003, the species was described as uncommon, but not threatened (Krabbe and Schulenberg 2003). Given our lower, but more precise estimate compared to the one from Birdlife International, it is likely that the decrease in population size in the last decades is more severe than hitherto known. Perhaps most alarmingly, even assuming a high-quality habitat, population numbers are less than half of the previous estimate. In addition, we highlight that the upslope range shift that the species has undergone in the past 25 years and which is accompanied by a reduction in range size, may continue in the future. Continuing deforestation and habitat degradation may reduce the amount of forested habitat and connectivity between fragments further, which will reduce gene flow and the sizes of the remaining populations of this endangered species and other associated biodiversity in the Tumbes-Chocó-Magdalena biodiversity hotspot.
Implications for conservation
The Ecuadorian Tapaculo is exposed to two major threats: fragmentation and degradation of its habitat, and an upslope range shift. Both threats are inevitably contributing to disrupt connectivity between populations, which can lead to lower migration rates and genetic impoverishment of the species. To ensure the persistence 26
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– of the Ecuadorian Tapaculo in a rapidly changing environment, conservation actions have to be undertaken to mitigate the above mentioned negative effects. Our study revealed that the connectivity between fragments, habitat quality and fragment compactness are major predicto Ecuadorian Tapaculo. Hence, the improvement of these parameters should be the rs of a forest s suitability as habitat for the priority target when planning science-based conservation measures to increase habitat availability for the Ecuadorian Tapaculo and incite dispersal between populations.
The establishment of forested corridors is a reliable method to enable dispersal of less mobile species (Sieving et al. 2000, Castellón and Sieving 2006, Castellón and Sieving 2007, Lees and Peres 2008). As Ecuadorian Tapaculos are potentially able to cross up to 245 m of open habitat, we assume this to be the maximum distance between forest fragments that still provides for connectivity for the species. However, the majority of fragments containing territories were only separated by gaps of up to 80 m. Consequently, we recommend to create dispersal corridors between remote fragments with the priority aim of reducing the amount of open habitat between them to a maximum of 245 m and, secondary, to a maximum of 80 m. Considering the high level of fragmentation in the range of the Ecuadorian Tapaculo (Figure 3), the creation of fully forested corridors may not be possible due to money, time, and energy constraints. However, even shrubby vegetation in the matrix (Castellón and Sieving 2006), small forest patches that serve as stepping stones (Uezu et al. 2008), or narrow corridors of about 25 m width (Sieving et al. 2000) already enhance the movement of understory birds and may facilitate dispersal between disconnected populations of the Ecuadorian Tapaculo.
Apart from re-establishing connectivity between fragments, improving forest quality and quantity is crucial for the persistence of Ecuadorian Tapaculos. The species is unable to endure in low-quality habitat and requires compact forests that are not subject to extensive edge-effects. Owing to the dramatic deforestation rates in southwestern Ecuador, forest patches are mainly comprised of young secondary stands that are unsuitable as habitat for the species. Hence, it is crucial to initiate conservation measures focusing on improving forest quality and protecting older forests within the distribution range. Studies conducted in Costa Rica and Panama revealed that secondary forests recover within a few decades (Aide et al. 2000, DeWalt et al. 2003). Even abandoned cattle pastures have the ability to regain characteristics of primary forests (Aide et al. 1995, 2000). Habitat management can further accelerate the recovery process. Depending on the level of degradation, reforesting native trees facilitates the reestablishment of the original forest ecosystem (Holl et al. 2000, Lamb et al. 2005). 27
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– While forest recovery and the restoration of connectivity between disconnected populations of the Ecuadorian Tapaculo can be influenced by the implementation of sound conservation actions, the upslope range shift is likely caused by climate change and therefore less foreseeable. Global warming is most likely not stoppable in the near future. Given that within the last 25 years, the Ecuadorian Tapaculo apparently migrated uphill at a rate of up to 100 m per decade, it is possible that the upslope shift is still an ongoing process and the species is further driven to even higher elevations. Whether the range shift will continue at the same speed, will be slowed down or even accelerate remains unclear. In view of ongoing deforestation and, potentially, a further upslope shift in the distribution range, it will be crucial to protect remaining uadorian Tapaculo, but also in elevations that by now exceed the range but may be invaded by the species within the forest fragments not only in today s range of the Ec next decades. Here, reforestation actions to enable effective dispersal between populations have to be implemented. Given that the Ecuadorian Tapaculo has low dispersal abilities and, at the same time, specific demands for high-quality habitat, conservation measures to restore connectivity between different populations will be beneficial for the dispersal of a variety of other Tumbes-Chocó-Magdalena species as well.
ACKNOWLEDGEMENTS
We thank Annika Döpper, Arne Pinnschmidt and Hannes Kampf for their great assistance in field work. We are grateful to Niels Krabbe for his valuable advice during the development of the project. Moreover, we thank Niels Krabbe and Francisco Sornoza for providing the coordinates of the territory found in Cañar. César Garzón kindly provided the satellite images of the study area. We thank Fundación Jocotoco for logistic support during field work, and the landowners in the study area for granting us access to their properties. Permission to conduct eld work (No. 005- IC-FAN-DPEO-MAE) was granted by the Ministerio de Ambiente, Ecuador. This work fi was supported by the Mohamed bin Zayed Species Conservation Fund (grant number 13257994); and Sweden Club300 Bird Protection.
28
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
– APPENDIX
Appendix A: Detailed description of the assessment of the microhabitat characteristics in the subplots of the Tapaculo territories and the control plots
Inclination: Mean inclination of a subplot was measured with a clinometer. Values are given in °.
Tree height: The tree height was measured using a rangefinder (Rangemaster CRF 900, Leica, Wetzlar) and rounded to the nearest 10 m. Values are given in m.
DBH (Diameter in breast height): The girth of trees was measured with a tape into the analysis. Values are given in cm. measure and converted into the diameter. We only included trees with a DB( ≥ cm TBA (Tree basal area): The tree basal area was determined for all trees with a DBH . Values are given in m².
≥Number cm of trees:
Density in 0 – 50We cm counted: The density all trees was with estimated a DB( ≥ visually cm. as the proportion of the subplot covered by vegetation in 0 - 50 cm. Values are given in %.
Density in 50 – 100 cm: The density was estimated visually as the proportion of the subplot covered by vegetation in 50 100 cm. Values are given in %.
Density in 100 – 150 cm: The density– was estimated visually as the proportion of the subplot covered by vegetation in 100 150 cm. Values are given in %.
Wooden debris: We recorded the presence– or absence of coarse wooden debris like fallen trunks or large branches. Smaller twigs or pieces of bark were not included.
Streams: We recorded the presence or absence of streams or water runs of any size.
Canopy density: Canopy density was assessed via the estimation of light penetration. For each subplot, three standard canopy photographs were taken using a digital camera (Lumix DMC FT-5, Panasonic, Osaka). After conversion into a monochromatic bitmap format, the percentage of black (canopy) and white (sky) pixels was analyzed
using the open source software CanopyDigi Goodenough & Goodenough .
29
Chapter 3 Habitat requirements and population estimate of the Ecuadorian Tapaculo
–
30
Chapter 4 Effects of forest fragmentation on the morphological and genetic structure of a dispersal-limited, endangered bird species
Claudia Hermes, Annika Döpper, H. Martin Schaefer & Gernot Segelbacher
Manuscript published in Nature Conservation
ABSTRACT
Throughout the tropics, pristine forests disappear at an alarming pace. This presents a severe threat to forest-dependent species. Especially dispersal-limited understory birds are affected by forest loss. We here explored the effects of habitat fragmentation on the genetic structure and the morphology of the Ecuadorian Tapaculo (Scytalopus robbinsi). This bird occurs only in a small range in the premontane cloud forests of southwestern Ecuador. The global population size is declining rapidly due to habitat loss and is currently estimated at only 3000 mature individuals. We caught a total of 28 Ecuadorian Tapaculos in forests of varying size in an area of about 40 km². From each bird, we took morphological measurements and a blood sample. This was used to develop a set of 10 species-specific microsatellite primers for genetic analysis and we found that the Ecuadorian Tapaculos display high levels of genetic diversity. Additionally, we identified dispersal corridors for the species across the landscape using a least-cost path analysis. Notably, we found that wing shape is related to forest size. Individuals in smaller fragments show adaptations of the wing morphology to Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– enhanced mobility and better flight capacity. Our results suggest that the Ecuadorian Tapaculo may rapidly adapt its morphology to the level of habitat fragmentation. This potential can possibly mitigate the risk of local extinctions of the species due to human-caused forest loss and fragmentation.
KEYWORDS: El Oro Tapaculo; cloud forest; habitat fragmentation; wing morphology; genetic diversity; microsatellites
INTRODUCTION
Forest loss and fragmentation are among the main drivers of species extinction in the Neotropics. For many forest-dependent species, the amount of available habitat as well as the connectivity between remaining forested patches decline. The sensitivity of (Vetter et al. 2011). Especially understory insectivorous birds are sensitive to the a species to forest loss and fragmentation is related to the species functional traits logging of forests and therefore particularly threatened by extinction (Stratford and Stouffer 1999, Ferraz et al. 2003, Sodhi et al. 2004). Many of these species have rudimentary dispersal abilities (Moore et al. 2008) and only reluctantly cross large gaps between forest fragments (Sieving et al. 1996, Vergara and Simonetti 2006, Van Houtan et al. 2007). Even smaller distances due to valleys (Krabbe 2008) or roads (Laurance et al. 2004) can contribute to habitat fragmentation for understory birds. Migration is costly for dispersal-limited species, with the costs depending on the distance to be crossed and the mobility of the species (Tischendorf and Fahrig 2000, Moilanen and Hanski 2001). While it is assumed that the population sizes of understory birds shrink due to forest loss, habitat fragmentation makes migration between disconnected populations increasingly difficult for a high number of species.
Small populations are inherently vulnerable to genetic drift and loss of genetic diversity, which constitutes an extinction risk for populations (Frankham et al. 2002). Moreover, reduced connectivity between populations diminishes migration rates and gene flow between them (Epps et al. 2005, Coulon et al. 2006, Segelbacher et al. 2010). In case that disconnected populations are occupying different ecological environments, they may be subject to different natural selection regimes, leading to adaptive divergence of functional traits and population diversity (Hendry and Taylor 2004, Räsänen and Hendry 2008). However, the effects of gene flow and adaptive divergence as drivers of diversification in different environments are controversial (Räsänen and Hendry 2008): First, reduced gene flow may promote adaptive 32
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– divergence, as it increases the independence of gene pools and the potential to diversify due to different ecological selection regimes (Langerhans et al. 2003, Hendry and Taylor 2004). Second, adaptive divergence can reduce gene flow by the evolution of reproductive isolation (Saint-Laurent et al. 2003, de León et al. 2010). Third, ongoing gene flow can favor adaptive divergence by maintaining genetic variation and non-random dispersal (Garant et al. 2005, Postma and van Noordwijk 2005). Altogether, forest fragmentation can affect the genotype by altering the levels of genetic diversity and gene flow, but can also affect the phenotype by promoting adaptive divergence in case of diverging natural selection.
Insectivorous, forest-dependent birds are particularly sensitive to the fragmentation of forests (Duncan and Blackburn 2004, Sodhi et al. 2004, Vetter et al. 2011). Heavily fragmented habitats can produce significant genetic population structuring already at a small spatial scale of less than 40 km (Moore et al. 2005, Woltmann et al. 2012). Moreover, several studies have reported changes in morphology according to the degree of fragmentation in the distribution range of a particular bird species (Anciães and Marini 2000, Lens and van Dongen 2000, Desrochers 2010). In less fragmented forests, birds are likely to develop shorter, rounder wings than in heavily fragmented habitat, which proved advantageous for maneuvering in dense vegetation (Desrochers 2010). Longer, pointed wings enhance mobility in heavily disturbed and fragmented forests (Fiedler 2005, Desrochers 2010).
In this study, we examined the effects of forest fragmentation on the genetic and morphological structure of the Ecuadorian Tapaculo (Scytalopus robbinsi, Rhinocrytidae), a species almost unknown to science. This bird is endemic to the understory of cloud forests in southwestern Ecuador. In general, Tapaculos are among the species most sensitive to habitat fragmentation and are therefore considered an ideal model for assessing fragmentation effects on dispersal-limited species (Castellón and Sieving 2006). Throughout the distribution range of the Ecuadorian Tapaculo, forests are heavily degraded and fragmented, affecting the habitat of not only Tapaculos, but also of other dispersal-limited, understory species like antbirds, antpittas or hummingbirds. It is estimated that over 90% of the original forest cover in southwestern Ecuador has been logged since the beginning of the 20th century (Dodson and Gentry 1991, Best and Kessler 1995). From 2005 to 2010, the deforestation rate in Ecuador was 1.89%, which is the highest rate in South America (FAO 2010). The population size of the Ecuadorian Tapaculo thus is assumed to be declining rapidly (Krabbe and Schulenberg 1997, Hermes et al. in press) and likely the remaining populations are strongly isolated from each other, with ongoing deforestation disrupting linkages between them. The Ecuadorian Tapaculo has only limited dispersal abilities and avoids crossing areas of un-forested habitat (Krabbe 33
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– and Schulenberg 1997, Hermes et al. in press). Therefore, it is possible that migration rates between different populations confined to disjunctive forest fragments are low, resulting in a clear fine-scale genetic structure, as it was shown for a similar understory bird species (Woltmann et al. 2012). In view of the high level of forest loss throughout the distribution range of the Ecuadorian Tapaculo, it is possible that individuals show morphological differences depending on the degree of fragmentation. Morphological adaptations of the flight apparatus in relation to the level of habitat fragmentation could mitigate negative effects of forest loss by improving the dispersal abilities of Ecuadorian Tapaculos and thereby maintaining population connectivity.
The ability of a species to cope with ongoing habitat fragmentation can determine its abilities to persist in a changing environment and avoid local extinction (Castellón and Sieving 2006, Stouffer et al. 2006). Therefore, we want to investigate the effects of forest fragmentation on the morphology of the Ecuadorian Tapaculo, on the level of genetic diversity and on gene flow between populations. Detailed information about these effects are crucial to make scientifically sound recommendations for conservation measures not only for this endemic species, but also for other forest specialists restricted to this kind of habitat. Given the presumably low dispersal abilities of the species and, at the same time, the high level of habitat fragmentation in the study area, we expect migration rates and gene flow between forest patches to be reduced, leading to genetically distinct sub-populations. However, not only is the individuals to assess the genetic status of the population. We expected to find genetic species ecology unknown, but also genetic information is lacking. We thus caught differentiation between individuals caught in locations separated by dispersal barriers, like areas of open habitat, unsuitable elevation, or highways. To identify corridors with low dispersal cost, i.e., the optimal routes for migration of Ecuadorian Tapaculos, we calculated least-cost paths between territories. Moreover, we assessed morphological differences of birds caught in different sites of the study area; we predicted to find differences according to the level of habitat fragmentation.
34
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– METHODS
Study species and study area
The Ecuadorian Tapaculo, also known as El Oro Tapaculo, is an insectivorous bird endemic to a small range (~ 1100 km2) on the western slopes of the Andes in southwestern Ecuador, at an elevation of 850 - 1500 m (Hermes et al. in press). The species was only discovered in 1990 (Krabbe and Schulenberg 1997) and is so far not well studied. It occurs in the undergrowth of mature forests and is very reluctant to cross even small areas of open habitat (Krabbe and Schulenberg 1997). Being practically unable to fly longer distances, Tapaculos move around by hopping or walking (Reid et al. 2004, Castellón and Sieving 2006). The IUCN classifies the Ecuadorian Tapaculo as endangered. Global population size is estimated to range between 1900 and 4600 mature individuals (Hermes et al. in press). It is feared that -quality habitat and presumed susceptibility to forest degradation and fragmentation have led to a severe population decline, which the species requirements for high might still be ongoing (Hermes et al. in press).
The only protected site within the range of the Ecuadorian Tapaculo is the private Buenaventura reserve in the canton Piñas (3.655° S, 79.744° W), established in 1999 by the Ecuadorian NGO Fundación Jocotoco. This reserve covers an area of 2300 ha in an elevation of 400 - 1500 m (Figure 5). The predominant vegetation types within the reserve are secondary forests in various successional stages, which are separated by areas of abandoned pasture. Outside the reserve, deforestation is intense, with mostly only forest patches smaller than 100 ha remaining. The main causes for the logging of forests are intensification of agriculture and forest clearance for livestock. Natural forests mainly persist in areas which are not suitable for conversion into cattle pasture or cropland, like steep slopes or river banks (Best and Kessler 1995).
Field work was carried out between December 2013 and May 2014 and between November 2014 and January 2015 in the Buenaventura reserve, and near Ñalacapa, about 5 km south of Buenaventura (Figure 5). The study area is located at the the total range. The size of forest fragments was assessed in ARCMAP 10.2 using southern end of the Ecuadorian Tapaculo s distribution range, covering about 5% of satellite images of the area as a template (Hermes et al. in press). Forest areas ranged from about 15 ha to 900 ha. The northern and southern part of the study area was divided by a highway and a valley with an altitude of about 400 m.
35
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
–
Figure 5: Map of the study area in southwestern Ecuador. Forested areas are shaded grey, whereas white areas represent non-forested areas (mainly cow pastures). The Buenaventura reserve is circled by the dashed line. The bolt black line represents a highway cutting the reserve into a northern and a southern part, while minor roads are indicated by the thin lines.
Bird sampling
For bird capturing, we used mist-nets and tape recordings of the song of male Ecuadorian Tapaculos as a decoy. If an individual approached the playback, observers and excellent maneuverability made the capturing very challenging. We captured 28 herded it into the net. The Ecuadorian Tapaculo s secretive behavior, very good vision males. Birds were ringed with a standard aluminum ring and color-banded individually. Then, individuals were weighed and the lengths of tail, tarsus, wing, primary feathers and the first secondary feather were measured. From each individual, we took a blood sample from the brachial vein. To minimize stress, birds
36
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– were handled within less than 10 minutes of capture and released unharmed to the same sites. Blood samples were stored in 99.8% ethanol and transferred into a -20 °C freezer.
Assessment of morphological differences
To obtain an index for body size, we carried out a principal component analysis (PCA) for all the morphological variables that we recorded. As variables differed in their numerical range, they were z-standardized prior to the analysis. A second PCA for the variables wing length and length of the feathers P9 to S1 provided an index for the wing shape. For both PCAs, missing values (e.g., caused by feather molt) were replaced by the mean. Additionally, we quantified the body condition of each individual using the scaled mass index (Peig and Green 2009). Then, we tested for was captured. To this aim, we carried out Kendall correlations between the fragment relationships between an individual s morphology and the size of the forest where it area and the first principal components of the PCAs for body size and wing shape as well as the body condition index. The statistical analysis was carried out in R 3.3.0 (R Development Core Team).
Analysis of genetic population structure
We extracted DNA from the blood samples and compiled a set of 10 species-specific microsatellite primers (for a description of the primer development see Appendix B and C). Two individuals had to be excluded from the analysis due to failure of amplification during PCR in two loci. Then, we applied a Bayesian clustering method using the program STRUCTURE 2.3.4 (Pritchard et al. 2000) to explore the genetic population structure of the individuals (n = 26) caught in different fragments. This program uses a Markov chain Monte-Carlo (MCMC) approach to compute the probability of the sampled individuals belonging to a given number K of discrete genetic subpopulations. An admixture model with correlated allele frequencies was used. We pre-defined the parts north and south of the highway as distinct sampling locations (Figure 1). We set K from 1 to 8 and carried out 10 runs for each K, with 106 MCMC iterations and 500,000 burn-in iterations for each run. We determined the best value for K by analyzing the probability scores in the program STRUCTURE HARVESTER (Earl and vonHoldt 2012).
37
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– Least-cost paths and isolation by distance
Landscape barriers disrupting or decreasing connectivity between individuals or populations can be quantified and qualified by the creation of a resistance map, which allocates a specific resistance value to each cell of the land cover grid according to the mobility of the species (Adriaensen et al. 2003). To evaluate landscape permeability for Ecuadorian Tapaculos in the study area and to assess least-cost paths (LCPs) between the individuals, we created a resistance map accounting for species-specific demands and landscape features. We produced a map (cell size 30 x 30 m) for the in the RASTER CALCULATOR tool of ARCMAP. Weights were determined on expert- parameters forest cover , elevation , and roads by assigning them different weights opinion based on literature review and observations of the behavior of individuals. As Ecuadorian Tapaculos are reluctant to cross open habitats without forests (Krabbe and Schulenberg 1997), we assumed the costs for crossing open areas to be 100-fold higher than for dispersing through forests. Roads are known to represent a strong dispersal barrier for understory birds; even narrow, unpaved roads significantly reduce dispersal, while highways can even entirely block movement (Laurance et al. 2004). We created a buffer zone with a radius of 15 m around the roads in the study area in order to obtain a continuous reproduction of the roads on the 30 x 30 m resolution of the map. We assigned a 200-fold weight to the highway dissecting the northern and southern part of the study area, while the less frequented country lanes only obtained a 100-fold weight. For the resistance values of the elevation, we considered the mean altitude of territories to be the optimum for Ecuadorian Tapaculos, with dispersal costs being zero. There are hints that the Ecuadorian Tapaculo is sensitive to elevation. Presumably, the species has shifted its distribution range uphill within the last decades and now avoids areas of lower elevation (Hermes et al. in press). Therefore, higher or lower elevations were assigned costs equaling the difference in altitude to the mean altitude of territories. Merging of the layers generated the resistance map. The LINKAGE MAPPER tool of ARCMAP was then used to identify the LCP between territories by detecting cells with the lowest costs while avoiding cost-intensive cells.
To assess isolation by distance, we tested for relationships between the genetic and the geographic distances between the individuals. Geographic distance was expressed by Euclidian distance between territories as well as by LCP length and LCP cost. In GENALEX 6.5 (Peakall and Smouse 2012), we carried out Mantel tests with 999 permutations for each of the three parameters separately.
38
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– Analysis of past genetic diversity and population size change
Using the R package HIERFSTAT, we tested whether genetic diversity has been reduced since the species was discovered in 1990. Accounting for the difference in sample size between the two groups, we compared allelic richness of the 26 samples we took in 2013 - 2015 with those of seven museum specimen collected in 1990 - 1991 in the same area (from the tissue collection at the Zoological Museum Copenhagen; sample numbers 125057, 125070, 125071, 125072, 126057, 126058 and 126167).
Additionally, we tested for a potential decline in the effective population size in the past with the program MSVAR 1.3 (Beaumont 1999, Storz and Beaumont 2002). This program was shown to be particularly powerful at detecting severe and ancient population declines (Girod et al. 2011), and can deal with small sample and population sizes (Beaumont 1999). Using multilocus microsatellite data, MSVAR applies a Bayesian coalescent-based hierarchical model to estimate the current population size as well as the ancestral population size, the time since a potential population decline or expansion started and the mutation rate of loci. With MCMC simulations, the program quantifies the likelihood of observing the allele frequencies in a sample, given a pre-defined demographic and mutational model. The simulation then produces probability estimates for the above-mentioned parameters by maximizing the likelihood of the observed data. We ran the model four times. To avoid a bias on the posterior distribution, each time we used different prior information assuming different scenarios of past population size change. We ran each chain with 109 iterations and a thinning interval of 100,000. Thus, we obtained an output of 20,000 iterations for each run and dismissed the first 5,000 iterations as burn-in. The output was analyzed using the R packages CODA, BOA and LOCFIT. We checked the output chains for convergence using the Gelman-Rubin analysis (Gelman and Hill 2007) and calculated modes and 95% highest probability density (HPD) intervals for each parameter. Parts of the R script were taken from Paz-Vinas et al. 2013.
RESULTS
Bird morphology in relation to forest size
The first four principal components (PCs) of the PCA of body size accounted for 71.92% of the variance of 14 morphological variables (Table 3). We assigned loadings above a threshold of 0.35 to the respective PC. PC 1 described the length of the inner 39
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– primary feathers P5, P3, P2 and P1, while PC 2 described the outer primary feathers P9, P8 and P7. PC 3 characterized the length of tarsus and the P4 feather, and PC 4 described the length of wing and tail. The PCA for the wing shape yielded similar results, with the first three PCs accounting for a total of 74.82% of the variance (Table 4). Here, PC 1 also represented the primary feathers P5, P3, P2 and P1. PC 2, accordingly, described the feathers P9, P8 and P7. PC 3 characterized the total wing length, as well as the length of the feathers P5 and S1. We concluded that, for both PCAs, individuals with high values for PC 1 have shorter inner primaries, i.e., a narrow wing, and individuals with high values for PC 2 have shorter outer primaries, i.e., a less pointed wing.
For both PCAs, we detected a marginally significant relationship between PC 1 and forest size (PCA of body size: P = 0.057; tau = -0.273; and PCA of wing shape: P = 0.063; tau = -0.267; Kendall correlation). None of the other PCs correlated with forest size (all P > 0.12; Kendall correlation). Similarly, there was no relationship between the body condition of birds and the size of the forest fragments (P = 0.76; tau = 0.044; Kendall correlation).
Table 3: Body size of Ecuadorian Tapaculos. Principal component analysis for the body size of 28 Ecuadorian Tapaculos, with the loadings, eigenvalues and variance of the first four principal components (threshold: 0.35; bold font).
Variables Loadings PC 1 PC 2 PC 3 PC 4 Tarsus -0.037 -0.052 0.641 0.087 Wing -0.170 0.001 -0.326 0.549 P9 feather -0.187 -0.534 -0.185 -0.173 P8 feather -0.269 -0.398 -0.024 -0.045 P7 feather -0.270 -0.356 0.102 -0.190 P6 feather -0.321 -0.258 -0.077 0.029 P5 feather -0.356 0.102 -0.180 0.327 P4 feather -0.203 0.193 -0.355 -0.193 P3 feather -0.388 0.202 0.041 -0.003 P2 feather -0.373 0.238 0.041 0.067 P1 feather -0.371 0.189 0.240 -0.069 S1 feather -0.300 0.235 0.317 -0.192 Weight 0.002 -0.339 0.267 0.174 Tail 0.043 -0.095 0.205 0.634 Eigenvalue 5.202 1.889 1.627 1.351 Variance explained 37.16% 13.49% 11.62% 9.65%
40
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– Table 4: Wing shape of Ecuadorian Tapaculo. Principal component analysis for the wing shape of 28 Ecuadorian Tapaculos, with the loadings, eigenvalues and variance of the first three principal components (threshold: 0.35; bold font).
Variables Loadings PC 1 PC 2 PC 3 Wing -0.174 0.004 0.669 P9 feather -0.187 -0.593 0.050 P8 feather -0.270 -0.401 -0.047 P7 feather -0.270 -0.363 -0.346 P6 feather -0.323 -0.292 0.042 P5 feather -0.359 0.106 0.379 P4 feather -0.205 0.126 0.167 P3 feather -0.388 0.207 -0.050 P2 feather -0.372 0.261 0.082 P1 feather -0.359 0.230 -0.224 S1 feather -0.300 0.284 -0.442 Eigenvalue 5.188 1.787 1.256 Variance explained 47.16% 16.25% 11.42%
Genetic diversity, population genetic structure and gene flow
Allelic richness of the museum samples was 3.80 ± 0.75, while that of the recently collected samples was 3.59 ± 0.57. Therefore we concluded that genetic diversity has not changed within the last ~ 25 years. The STRUCTURE analysis showed no clear population substructure. K = 1 yielded the highest probability, indicating that most likely all samples belonged to the same population. However, error bars were highly overlapping amongst the estimates for different numbers of clusters (Figure 6).
41
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
–
Figure 6: Mean ± SD of the log-likelihood for K = 1 to 8 distinct genetic populations. Strong support for K = 1 indicates that most likely all the samples stem from the same genetic group.
With the least-cost path analysis, we could identify a dispersal corridor for Ecuadorian Tapaculos across the study area, which circumvented the valley between the northern and southern part (Figure 7). Mantel tests indicated clear evidence for isolation by distance. Euclidian distance showed the strongest relationship to the genetic distance (Rxy = 0.418; P = 0.001), followed by LCP length (Rxy = 0.399; P =
0.001) and LCP cost (Rxy = 0.319; P = 0.001).
42
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
–
Figure 7: Resistance map with least-cost path. The cost of movement is visualized by the color gradient from black to white, with black indicating higher costs and white lower costs. The bolt black lines show the least-cost paths between 26 Ecuadorian Tapaculo territories in the study area.
Past demographic changes
Modelling the population demography yielded evidence of a severe population decline in the past. All potential scale reduction factors were < 1.1, so we concluded that chains converged well (Gelman and Hill 2007). Modal values (and 95% HPD intervals) indicated a current effective population size of 770 individuals (150 2,820). Ancestral population size was 26,000 (5,275 171,400), suggesting an – approximately 30-fold population decline. Time since the population started – decreasing was estimated to about 7000 years (870 52,000) and the mutation rate to 1.42e-4 (1.32e-6 7.23e-3). However, the large probability density intervals for the – parameter estimates indicate a high level of uncertainty in the simulation. – 43
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– DISCUSSION
In this study, we investigated the genetic and morphological structure of the Ecuadorian Tapaculo, an endangered bird endemic to the understory of premontane cloud forests in southwestern Ecuador. In the study population, genetic diversity has remained constant within the last 25 years, even though the global population has declined dramatically. Despite the fact that forests are highly fragmented and the species has only limited dispersal abilities, we did not detect a structuring into genetically distinct sub-populations on a scale of 40 km². Notably forest size influenced bird morphology, with individuals in larger fragments having rounder wings than their conspecifics in smaller forests.
Population genetics of the Ecuadorian Tapaculo
Throughout the study area, we found no genetic structuring among Ecuadorian Tapaculos, indicating that a substantial amount of gene flow is still maintained. Even though the Ecuadorian Tapaculo is a bad disperser, migration between different forest fragments seems not to be blocked. We expected that habitat fragmentation in the range of the species produced genetically distinct populations in different forest fragments, as it was shown for a similar species (Woltmann et al. 2012). Our study area was disrupted by a valley and a highway, which we expected to act as barriers to dispersal. Besides, the distances between the different forest fragments following the least-cost path ranged between 10 m and 400 m and were thus partly larger than the mean dispersal distances observed for Ecuadorian Tapaculos (80 m; Hermes et al. in press). Nevertheless, we did not detect genetic structuring in distinct sub- populations. Similarly, a study analyzing genetic differentiation in White-ruffed Manakins (Corapipo altera) at a comparable scale than our study did not detect genetic structuring either, although the habitat was highly fragmented (Barnett et al. 2008). However, fragmentation does not necessarily lead to reduced gene flow and genetic differentiation (Galbusera et al. 2004). Even a species with strong dispersal limitation can show low levels of differentiation across a highly fragmented landscape (Callens et al. 2011). In the case of the Ecuadorian Tapaculo, even the high degree of forest fragmentation in the northern part of the study area is not sufficient to cause genetic structuring.
Gene flow across the study area is not impeded by barriers and Mantel-tests between genetic and geographic distances suggest isolation by distance (IBD). In theory, IBD can lead to considerable genetic differentiation even at small scales (Wright 1943). In the most extreme dispersal event observed in the Ecuadorian Tapaculo, an individual crossed 245 m of un-forested habitat to establish a territory in a remote forest 44
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– fragment (Hermes et al. in press). The IBD detected here is therefore likely a consequence of the generally low dispersal capacities and mean migration distances of the species, which are reinforced by forest fragmentation.
Genetic diversity of Ecuadorian Tapaculos in the study area remained constant between 1990 and 2015. On a global scale however, population size and most likely also genetic diversity still decrease. Even though the result of the analysis of past population demography yielded a high level of uncertainty and should therefore be treated with caution, it gave evidence of a severe population decline. The Buenaventura reserve remains until now the only protected site within the distribution range of the Ecuadorian Tapaculo. Around the reserve, forests are heavily fragmented and degraded; mostly, patches are smaller than 100 ha and consist of young secondary stands. The constant level of genetic diversity in the study population over 25 years, which is presumably attributable to the establishment of the reserve, shows that a negative population trend can be stopped. However, in order to achieve a change for the better on the scale of the global population of Ecuadorian Tapaculos, it would be necessary to protect remaining forests throughout the entire distribution range, which, in view of ongoing deforestation, seems implausible. In general, Tapaculos are among the understory species most sensitive to fragmentation and are therefore seen as umbrella species for conservation planning (Willson et al. 1994, Reid et al. 2002, Castellón and Sieving 2007). The fact that we found population connectivity and a constant high level of genetic diversity in the Ecuadorian Tapaculo gives hope that other understory birds and dispersal- limited mammals in the area show similar population trends.
Morphological adaptations to forest fragmentation
While several studies have already addressed the effects of forest fragmentation on the genetic structure of a population, its effects on individual morphology are far less examined. However, the degree of habitat fragmentation can cause different morphological adaptations in birds (Desrochers 2010). Increasing distance between forest fragments exerts a selective pressure for enhanced mobility and flight ability, i.e., more pointed wings, in order to enable migration between remote fragments (Fahrig 2003, Fiedler 2005, Desrochers 2010). While the studies of Fiedler (2005) and Desrochers (2010) were carried out at a much larger spatial scale (several 1000 km), we found effects on wing morphology already at a distance of less than 15 km.
Ecuadorian Tapaculos have short, round wings and only limited flight capacities; they do rarely fly distances longer than 3 m and move mainly by walking or hopping (Krabbe and Schulenberg 1997). In this study, we found wing shape to be related to 45
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– forest size. Individuals in small patches had narrow wings, which can be seen as an adaptation to enhanced mobility and better flight capacity, which probably allowed colonization in the first place. In larger fragments, on the other hand, selection pressure for increased mobility is absent. Dispersing individuals do not face the necessity to cross habitat gaps before establishing their territories. For movement within large fragments, round wings enabling good maneuverability are advantageous. Alternatively, the differences in wing shape could be caused by different structural characteristics of the understory layer in relation to fragment size, with pointier wings facilitating flights in search for food. However, microhabitat structure of the understory in the forest fragments were assessed in a previous study (Hermes et al. in press), but had no influence on wing shape. Therefore, we conclude that the morphological differences are most likely caused by the fragmentation of forests and not by the degradation within forests.
Wing morphology is highly heritable in birds (Boag and van Noordwijk 1987). In this study, we detected effects of forest fragmentation on the morphology of the species already in a small population and at a small spatial scale. This implies that habitat fragmentation exerts considerable selective pressure favoring adaptive divergence of wing morphology. However, the morphological variability of the Ecuadorian Tapaculo
This potential can possibly mitigate the risk of local extinction of the Ecuadorian gives evidence of the species potential to rapidly adapt to environmental changes. Tapaculo due to human-caused forest loss and fragmentation.
In the study population, phenotypic divergence in wing shape could arise in sympatry. Even though the individuals in the study area were not genetically differentiated at neutral markers, the morphological changes are likely promoted by the isolation by distance we discovered over the study area. Moreover, the differences in the level of forest fragmentation likely exert a selective pressure, which is strong enough to produce distinct phenotypes despite the homogenizing effect of gene flow. If the diverging selective pressures are high, a new beneficial allele can fix quickly and affect the genome (Crisci et al. 2016). In the case of the Ecuadorian Tapaculo, morphological adaptations have possibly arisen rapidly after the onset of intense forest fragmentation at the beginning of the 20th century. Similar to our results, a study on Wedge-billed Woodcreepers (Glyphorynchus spirurus) found considerable morphological differences, although the level of gene flow was high (Milá et al. 2009). Generally, gene flow is assumed to constrain adaptive divergence by homogenizing the gene pool (Hendry and Taylor 2004, Räsänen and Hendry 2008). However, adaptive divergence caused by environmental differences can also constrain gene flow by the evolution of reproductive isolation over a few generations, i.e., ecological speciation (Schluter 2000, Carroll et al. 2007, Hendry et al. 2007). Moreover, in case 46
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– that the adaptive divergence reduces the fitness of migrants between different environments, a negative feedback loop can be initiated: Reduced fitness of migrants reduces dispersal between the different environments, which in turn reduces gene flow. This can lead to a further increase in adaptive divergence and a further reduction in dispersal and gene flow (Räsänen and Hendry 2008). It is possible that the Ecuadorian Tapaculos are currently beginning a similar loop. Their flight apparatus is adapted to the specific level of habitat fragmentation and can be disadvantageous in different conditions. Therefore, the fitness of birds migrating to forests with a differing degree of fragmentation is likely reduced. Even though gene flow is not diminished at present, it is possible that it will decrease in future under ongoing diverging selection, forming genetically and morphologically distinct sub- populations. Nevertheless, this is not the only possible future scenario. Throughout the study area, considerable reforestation efforts have been made within the last 20 years. Forest regrowth increases habitat availability and homogeneity for the Ecuadorian Tapaculo. Thus, assuming far-reaching reforestation programs, the selective pressure for adaptations to enhanced mobility might disappear, reducing the divergence in wing morphology and increasing gene flow.
ACKNOWLEDGEMENTS
We thank Jeroen Jansen, Arne Pinnschmidt and Hannes Kampf for their great assistance during field work and Niels Krabbe for his valuable advice in the preparation of this study. We thank the Tissue Collection at the Zoological Museum Copenhagen for lending us their blood samples of the Ecuadorian Tapaculo. Stefanie Hartmann kindly assisted in the analysis of past population demography. We are grateful to Fundación de Conservación Jocotoco and the landowners in the Ñalacapa area for permission to mist-net on their land. Permissions to conduct field work (No. 005-IC-FAN-DPEO-MAE) and to export samples (No. 05-2014-FAU-DPAP-MA) were granted by Ministerio de Ambiente and Ministerio de Agricultura, Ganadería, Acuacultura y Pesca, Ecuador. The project was funded by Mohammed bin Zayed Species Conservation Fund (grant number 13257994) and Sweden Club300 Bird Protection.
47
Chapter 4 Morphological and genetic structure of a dispersal-limited bird
– APPENDIX
Appendix B: Development of species-specific microsatellite primers
DNA was extracted from the blood samples of the Ecuadorian Tapaculos (Scytalopus robbinsi) using the DNeasy Blood and Tissue Kit (Qiagen, Hilden). 50 µl of extracted DNA from three museum samples collected between September 1990 and December 1991 (from the Tissue collection at the Zoological Museum Copenhagen; sample numbers 125058, 125070 and 126057) were pooled and sequenced (at MICROSYNTH, Switzerland). We used the software MSATCOMMANDER (Faircloth 2008) to look for repetitive motives out of a pool of 35,057 DNA sequences. We found a total of 203 sequences containing di-, tri- or tetranucleotid repeats and created a set of 49 primers using the software PRIMER3 (Rozen and Skaletsky 2000). The sequences were amplified in a Mastercycler Gradient Thermocycler (Eppendorf, Hamburg, Germany). The PCRs were conducted for each locus separately. Each reaction was carried out in a 10µl volume containing 1 µl DNA extract, 6 µl 10 µM forward primer, 6 µl 10 µM reverse primer, 12 µl 10 x TopTaq buffer, 12 µl Coral Load buffer, 0.72 µl Taq polymerase (all from Qiagen, Hilden), 3.6 µl 10 mM dNTPs and 68.4 µl distilled water. A touchdown temperature profile was used for the PCR (5 min at 95 °C; 20 cycles of 30 s at 94 °C, 30 s at 62 °C, 70 s at 72 °C; 15 cycles of 30 s at 94 °C, 30 s at 52 °C, 40 s at 72 °C; 5 min at 72 °C, storage at 5 °C). 4 µl of each PCR product were transferred on an agarose gel (1.2 %) to check via gel electrophoresis (Elchrom SEA 2000) whether amplification was successful. Only polymorphic loci were used for further analysis. We tested for linkage disequilibrium between the loci using the program GENEPOP ON THE WEB 4.2 (Rousset 2008). Moreover, we determined the number of alleles, observed and expected heterozygosity using the program GENALEX 6.5 (Peakall and Smouse 2012), as well as the polymorphic information content and the null allele frequency for each locus with the program CERVUS 3.0.3 (Marshall et al. 1998).
After excluding loci that did not amplify or were monomorphic, we compiled a final set of 10 polymorphic microsatellite primers (Appendix B). The number of alleles per locus ranged from 4 to 7, mean polymorphic information content was 0.573, mean observed heterozygosity was 0.597 and mean expected heterozygosity 0.636. No linkage disequilibrium was found between any primer pair. Two individuals had to be excluded from the analysis due to failure of amplification during PCR in two loci.
48
Appendix C. Microsatellites of the polymorphic loci in Scytalopus robbinsi (n = 33).
Locus Accession no. Repeat motif - Range (bp) Dye PIC NA Ho He Null alleles
ScyRo1 KT266563 (ACCTTATAC)(GT)11GCATGTTGAGG AGCAGTGTCATCCCAGAGC 175-183 FAM 0.580 4 0.636 0.658 +0.0061 Primer sequences 5 3 ATGCCATGTGGTTGCTGAC
ScyRo2 KT266564 (CA)3(CT)(CA)11(CT)(CA)3CTCA TCCATAACCTGCCAGCGAC 209-280 HEX 0.472 7 0.455 0.519 +0.0447 TGAGCTGGAGGCCTGATTG
ScyRo4 KT266565 CAGTCTTTCA(TA11TTTGATACCAT GGGTACCTTGTGCATTGGC 178-205 FAM 0.701 5 0.576 0.757 +0.1324 GCGTTGTTGGAGGAGATGC
ScyRo6 KT266566 TTTTCTGAAA(CA)14CTTCT(AC)2ATC GAAGGCTGAACTTCCCTGC 292-298 FAM 0.520 4 0.636 0.571 -0.0781 ACCTGTGCATTGCTGGTTC
ScyRo8 KT266568 TGGT(TGG)2(TTTG)11TGGTTCTTTG TCACAATAGGCTGTACGCAG 350-366 FAM 0.619 4 0.606 0.696 +0.0618 GTAGAACAGCAAGGTCAGGC
ScyRo9 KT266569 GGAGCTGGA(GT)13CTAGGCA(G)3GC TGTCAGCCCTTGGATCACC 255-275 HEX 0.554 5 0.636 0.629 -0.0069 TGGCAAACGCATGTTCAGG
ScyRo10 KT266570 GC(AGA)2(TGGT)10TTCTGGGCTGCA GGGACTCACATGGGCAGG 212-224 FAM 0.562 4 0.667 0.643 -0.0209 TGGAGAATGGGTTGGGAGC
ScyRo11 KT266571 ACTT(CA)2CAG(ATTT)8(C)4ACTCATC TCACCGCACCACAAATGAG 222-242 FAM 0.533 5 0.515 0.598 +0.0498 ATGGGAGAGAAGGCAGGTC
ScyRo12 KT266572 (A)3GTGGAGG(GATG)7GACAGACTGG GCCTGGTACAGGTAGGCTC 374-410 FAM 0.517 6 0.636 0.552 -0.0987 GAGAGGCCAGAGGTGGAAC
ScyRo13 KT266573 T(AC)3GT(AC)24CG(TG)3TAA GCAGTCAGATGCCCTACTTC 261-283 HEX 0.672 6 0.606 0.733 +0.0885 CTCTGCAAGAACCTATGCCC
PIC = polymorphic information content, NA = Number of alleles, Ho = observed heterozygosity, He = expected heterozygosity
49
50
Chapter 5 Projected impacts of climate change on habitat availability for an endangered parakeet
Claudia Hermes, Klaus Keller, Robert Nicholas, Gernot Segelbacher & H. Martin Schaefer
Manuscript submitted to Biological Conservation
ABSTRACT
In tropical montane cloud forests, climate change causes upslope shifts in the distribution ranges of species, leading to reductions in distributional range. Endemic species with small ranges are particularly vulnerable to such decreases in range size, as the population size may be reduced significantly. To ensure the survival of cloud forest species on the long term, it is crucial to quantify the future shifts in their distribution ranges and the related changes in habitat availability in order to assure the long-term effectiveness of conservation measures. In this study, we assessed the influence of climate change on the availability of forested habitat for the endemic El Oro Parakeet. We investigated the future range shift by modelling the climatic niche of the El Oro Parakeets and projecting it to four different climate change scenarios. Depending on the intensity of climate change, the El Oro Parakeets shift their range between 100 and 600 m uphill until the year 2100. On average, the shift is accompanied by a reduction in range size to 35 % and a reduction in forested habitat to only 20 % of the current extent. Additionally, the connectivity between populations
51
Chapter 5 Projected climate change impacts on habitat availability
– in different areas is decreasing in higher altitudes where forest fragmentation is higher. To prevent a population decline due to habitat loss following an upslope range shift, it will be necessary to restore habitat across a large elevational span in order to allow for movement of El Oro parakeets into higher altitudes.
KEYWORDS: El Oro Parakeet; climate change; tropical cloud forest; range shift; climatic niche; representative concentration pathway
INTRODUCTION
Tropical montane cloud forests harbor some of the highest concentrations of biodiversity on Earth (Gentry 1992, Myers et al. 2000, Brooks et al. 2006). Their extreme altitudinal zonation of microhabitats combined with narrow species ranges make them centers of endemism (Myers et al. 2000, Brooks et al. 2006). Tropical montane cloud forests depend on frequent immersion in the cloudbank, creating a cool, moist environment with low direct sunlight and low evapotranspiration (Foster 2001). Anthropogenic climate change has the potential to result in an uphill shift of the cloudbank, thus leaving lower elevation zones in hotter and drier conditions (Pounds et al. 1999, Still et al. 1999). Consequently, cloud forest animal and plant species depending on a humid, cool environment may get into severe climatic distress caused by warming temperatures.
Tropical species have generally a narrow temperature niche and low tolerance towards temperature changes (Janzen 1967, McCain 2009, Sekercioglu et al. 2012, Zeh et al. 2012). To avoid the negative impacts of rising temperatures, species may evade into cooler surroundings. Previous work has demonstrated behavioral responses of tropical species to global warming, like poleward or upslope shifts in animal and plant communities as a consequence of increasing temperatures in their original ranges (Hill et al. 1998, Parmesan 2006, Yamano et al. 2011). In tropical montane cloud forests, species shift within their specific temperature niche uphill at a speed of up to 70 m per decade (Raxworthy et al. 2008, Chen et al. 2009, Feeley et al. 2011, Freeman and Class Freeman 2014, Duque et al. 2015). In comparison to species in temperate zones, which have been observed to shift their ranges at a rate of 4 to 30 m per decade (Parmesan and Yohe 2003, Hickling et al. 2006, Lenoir et al. 2008), tropical cloud forest species thus seem to be much stronger affected by warming temperatures. Since tropical mountains are centers of endemism and species often have only narrow altitudinal ranges, upslope range shifts can result in a complete
52
Chapter 5 Projected climate change impacts on habitat availability
– exchange of the ecosystem in lower zones, reductions in the size of the distribution range and extinction of species occurring near mountain tops (Foster 2001). In case that an upslope range shift is impossible and no suitable habitat is available, tropical cloud forest ecosystems are at risk of severe losses of biodiversity.
The intensity of an upslope range shift is not only determined by climatic variables, but also by topographical characteristics of the area. In case of environmental barriers like mountain tops or fragmented habitat, a range shift might not be possible as suitable habitat is no longer available. In this case, a species has to respond to warming temperatures within the same habitat. In order to prevent local extinction due to heat stress, a species has to adapt physiologically to increasingly warmer temperatures and ex genetically or plastic to environmental changes is largely determined by its genetic pand its temperature niche. A species potential to adapt diversity (Reed and Frankham 2003, Lavergne and Molofsky 2007, Beissinger et al. 2008). The genetic diversity of a species, in turn, highly depends on the population size and the level of gene flow between sub-populations in different areas (Epps et al. 2005, Coulon et al. 2006). Therefore, sufficient habitat but also connectivity among sub-populations is crucial to facilitate migration and gene flow and thereby ensure a high level of genetic diversity. As a result, conservation efforts aiming at preserving habitat and restoring connectivity are required to maintain the potential of cloud forest species to adapt to warming temperatures.
The cloud forests in the global biodiversity hotspot of Tumbes-Chocó-Magdalena on the western flanks of the Andes are the habitat of more than 400 endemic animal species (Myers et al. 2000). These forests are at high risk of decreasing drastically in area and losing large parts of their biodiversity until the end of this century as a consequence of climate change and ongoing deforestation (Brooks et al. 2002, Jantz et al. 2015). Previous studies have broken important new ground by modelling climate change effects on species richness and distribution in the hotspot (Velásquez-Tibatá et al. 2013, Ramirez-Villegas et al. 2014). However, thus far, we lack detailed information about the future temperature-induced upslope shift at the species level and at the southern edge of the hotspot. This information is essential because high- vulnerability to warming temperatures (Sekercioglu et al. 2008), but also to examine resolution data on range shifts are necessary not only to quantify a species the availability and configuration of suitable habitat in the projected range. With this data, it will be possible to establish sound conservation measures that aim at ensuring habitat availability and connectivity for cloud forest species in view of ongoing climate change.
53
Chapter 5 Projected climate change impacts on habitat availability
– Here we investigate the future temperature-induced upslope shift in the Tumbes- Chocó-Magdalena hotspot and the consequences that the shift might have on the availability of habitat. To assess the generality of our results, we investigate the relationship between altitudinal shift and forest cover at four different sites in southwestern Ecuador. We use the El Oro Parakeet (Pyrrhura orcesi) as a model species, which is endemic to the cloud forests to a narrow range in the Tumbes- Chocó-Magdalena hotspot and heavily threatened by forest loss. There is some evidence that the species has shifted its range uphill within the last decades since its discovery in the 1980s (Klauke et al. 2016). As the El Oro Parakeets are susceptible to forest fragmentation (Schaefer and Schmidt 2003), the survival of the species may hinge on the availability of forests in its range. The El Oro Parakeet is a highly mobile species, but presumably not very temperature-sensitive. Therefore, we consider it an appropriate umbrella species for assessing the upslope shift in the southern part of the Tumbes-Chocó-Magdalena hotspot. We hypothesize that the results gained for the El Oro Parakeet and the conservation implications derived from these results are also applicable and of high relevance for many other cloud forest species, including such species which are less mobile but highly temperature-sensitive, like amphibians (Pounds et al. 1999, Parmesan 2006) or dispersal-limited bird species such as the endemic Ecuadorian Tapaculo (Scytalopus robbinsi) which is likewise moving upslope (Hermes et al. in press).
In this study, we quantify the upslope range shift by assessing the temperature niche of the El Oro Parakeet and projecting it to four different climate change scenarios as ssment Report (Stocker et al. 2013). Then, we transfer the projected ranges to a map of forest described by the )ntergovernmental Panel on Climate Change s Fifth Asse ibution range. We hypothesize that habitat availability differs between climate change scenarios. We expect the differences in fragments in the El Oro parakeet s distr habitat availability to be predictable, with an inverse relationship between habitat availability and the intensity of climate change.
METHODS
Study area and study species
The El Oro Parakeets are endemic to a small range (~ 750 km²) in the southernmost cloud forests of the Tumbes-Chocó-Magdalena hotspot (Figure 8). This hotspot is located on the western flanks of the Andes and stretches from Panama through Colombia and Ecuador to northern Peru. Over 2500 plant species and 400 vertebrate species are endemic to the hotspot (Myers et al. 2000). Importantly however, the 54
Chapter 5 Projected climate change impacts on habitat availability
– Tumbes-Chocó-Magdalena hotspot is facing an exceptionally high projected rate of habitat loss: Model simulations suggest that by the end of the 21st century, the hotspot will have lost around 90 % of its original area due to global warming and land-use change (Jantz et al. 2015).
Figure 8: Overview of the southern part of the original distribution range of the El Oro Parakeet (600-1100 m; specified by the hatched area) in southwestern Ecuador. Forest fragments in the area are inferred from satellite images and depicted in light grey. The four study areas Cerro Azul, Buenaventura, Nalacapa and Guayacan are indicated by the dashed outlines, with the Buenaventura reserve (solid black outline) being the only protected site within the area.
The distribution range of the El Oro Parakeets is suffering from intense deforestation. Up to 95 % of the original forest cover in western Ecuador has already been logged and converted into cattle pasture (Dodson and Gentry 1991). The only protected site
55
Chapter 5 Projected climate change impacts on habitat availability
– ntura reserve near Piñas (S 3,655°, W 79,744°). This reserve covers an area of 2500 ha of secondary forests and within the parakeets distribution range is the Buenave abandoned cattle pastures. Outside the reserve, remaining forest fragments are mostly small (< 100 ha) and separated by large areas of open habitat (Figure 8). As a result of the intense deforestation throughout its range, the population of the El Oro Parakeet is declining rapidly. The population size is currently estimated at less than 1000 individuals (BirdLife International 2016). Being frugivorous birds breeding in tree cavities, the El Oro Parakeets rely heavily on a dense forest cover (Schaefer and Schmidt, 2003). However, the species is able to cope with a certain degree of forest fragmentation and can cross narrow gaps between forests (Schaefer and Schmidt 2003). The El Oro Parakeet was discovered 1980, when it occurred at an altitude of 600-1100 m, with one record from 1931 at 300 m (Ridgely and Robbins, 1988). Since then, the El Oro Parakeets have continuously shifted their distribution range uphill: In 2003, they occurred mainly at 800-1300 m (Schaefer & Schmidt 2003), while today they are regularly observed in altitudes as high as 1600 m (Klauke et al. 2016). It has been hypothesized that the upslope shift could be attributed to increasingly warmer and drier conditions in the lower elevation zones (Klauke et al. 2016).
Climate data
We downloaded detailed climate data for the area of the Buenaventura reserve (box coordinates: 3,616°S 3,675°S; 79,738°W 79,782°W) from KNMI Climate Explorer (http://climexp.knmi.nl/plot_atlas_form.py). For our study, we focused on the – – anomalies of annual mean temperature and annual precipitation sum for the years 2000-2100 (reference period 1986-2005). We obtained historical climate data (years 2000-2015) from ERA-interim reanalysis. ERA-interim reconstructs a high-resolution model of the state of the atmosphere from 1979 to the present. Future climate (years 2016-2100) was expressed by a subset of CMIP5 models used in the Atlas of Global
Assessment Report (Stocker et al. 2013). We used the output of multiple models to and Regional Climate Projections hereafter Atlas subset of the )PCC s Fifth account for key uncertainties due to factors such as different model structures, model parameters, and model initial conditions (for a discussion, see for example Sriver et al. 2015). Future climate forcings were sampled by four Representative Concentration Pathways (RCPs) 2.6, 4.5, 6.0, and 8.5. The RCPs describe different trajectories of greenhouse gas emission scenarios leading to specific values of radiative forcing by the year 2100 (2.6, 4.5, 6.0, and 8.5 W/m²). While RCP2.6 represents a scenario of strong mitigation of greenhouse gas emissions in the future, RCP8.5 represents a scenario of drastically increasing climate forcing. RCP4.5 and
56
Chapter 5 Projected climate change impacts on habitat availability
– RCP6.0 describe intermediate scenarios (Stocker et al. 2013). The models used for each RCP scenario are listed in the Appendix D (see also Stocker et al. 2013).
Modelling the climatic niche of the El Oro Parakeet and projecting the range shift
We observed El Oro Parakeets in the rainy season (December to July) of the years 2002, 2011 and 2012 in the Buenaventura reserve and recorded the altitude of each observation. In 2002, the birds occurred at a mean altitude of 998 ± 36 m (n = 353 observations), while in 2011 (n = 70 observations) and 2012 (n = 1063 observations) we found them at 1061 ± 63 m and 1081 ± 23 m, respectively. We characterized the uncertainty surrounding the altitudes where El Oro Parakeets occurred for the time period 2000 to 2015 using a bootstrap of the observed altitudes with 1000 iterations, retaining the auto-correlated structure of the residuals. We estimated the altitudinal extent of the El Oro P elevations. In a linear model, we assessed the influence of temperature and arakeets distribution range as mean ± *SD of the bootstrapped precipitation anomalies as independent variables on the bootstrapped altitudes for the years 2000-2015. As only temperature anomalies affected the altitude of El Oro Parakeets (R² = 0.038; p < 0.0001), we approximated the situation with a model where temperature alone drives the upslope shift and conducted all further analyses only for temperature anomalies. To obtain an estimate for the temperature niche of the parakeets, we carried out a linear regression of temperature anomalies and the mean altitude for the bootstrapped values for the years 2000-2015. To predict the geographic extent of the El Oro P change scenarios, we projected the temperature niche to the Atlas subset models for arakeets distribution range under different climate the four RCPs 2.6, 4.5, 6.0, and 8.5.
Projected future habitat availability and connectivity
We quantified changes in the geographical range and habitat availability for the El Oro Parakeet in an area covering about one- To this aim, we projected the original range and the expected ranges for the years third of the species distribution range. 2050 and 2100 to a map of forest fragments in ArcMap 10.2. The map was created using satellite images from the years 2010 and 2013 as a template. Prior to the analysis, we identified four study areas Cerro Azul (CA), Buenaventura (BV), Nalacapa (NA) and Guayacan (GY, Figure 8), where parakeets are known to occur. The exact extent of the study areas (each ~10,000 ha) depended on the availability of forest maps. Within each of the four areas, we measured the size of the original altitudinal range and the projected ranges for 2050 and 2100 under the four RCP scenarios. Additionally, we measured the extent of forested habitat within the original and 57
Chapter 5 Projected climate change impacts on habitat availability
– projected ranges. We based this analysis on the assumption that no changes in the extent and distribution of forest cover would occur until the year 2100. This assumption relies on forest cover not being limited by climate, but by anthropogenic land use. We acknowledge that our assumption is simplistic and most likely not plausible considering the high deforestation rates in the area; however, it yields information about the order of magnitude in the changes in habitat availability that is to be expected under the different climate change scenarios.
To assess differences in the connectivity between the forest fragments for each of the projected ranges, we measured the distance between forests along four transects in ArcMap. Transects were placed in east-west direction in the center of each of the four study areas. According to the altitude, each distance value was classified into the projected ranges for the four RCP scenarios in 2050 and 2100. We quantified the connectivity for each range by multiplying each reciprocal distance value with the probability density value for the distribution of El Oro Parakeets in the respective altitude for each of the projected ranges. Then, we carried out a bootstrap with 100 iterations to resample the mean of each connectivity distribution and tested via pairwise Mann-Whitney U-test for differences in the connectivity between ranges.
RESULTS
Modelling the climatic niche of the El Oro Parakeet
The El Oro P - 2015, parakeets shifted their range 175.5 m uphill per 1°C warming. While in 2000, arakeets distribution range spans 6 6 m in altitude. )n the years according to our model, they occurred at a mean altitude of 979 m (670 - 1290 m), by 2015 they already moved uphill to 1119 m (810 - 1430 m; Figure 9).
58
Chapter 5 Projected climate change impacts on habitat availability
–
Figure 9: Projected upslope shift of the El Oro P 2000 and 2100. Each line represents the mean altitude of parakeets derived from the single model arakeets distribution range between the years runs. The maximum extent of the distribution range (mean ± 2*SD) is shaded grey. Boxplots indicate the altitudinal distribution of parakeets in the years 2050 and 2100 for each of the four scenarios RCP2.6, 4.5, 6.0, and 8.5.
Projection of the range shift
All four climate change scenarios implied an upslope shift of the El Oro P distribution range until the end of the 21st century (Figure 9). For the RCP2.6 climate arakeets forcing scenario, the shift was lowest and stagnated in the second half of the 21st century: In 2050 and 2100, parakeets occurred in the same altitude of 840 - 1480 m. Under the RCP4.5 and RCP6.0 climate forcing scenarios, the shift was more pronounced (930 - 1550 m in 2050 and 1000 - 1620 m in 2100 under RCP4.5; 900 - 1520 m in 2050 and 1090 - 1710 m in 2100 under RCP6.0). Even though the RCP4.5 scenario implies stronger climate change mitigation than RCP6.0, the upslope shift under RCP4.5 was more obvious until the year 2050. The strongest considered climate forcing scenario (RCP8.5) yielded the most drastic upslope shift: Until 2050, the distribution range shifted to an altitude of 1000 - 1610 m, and reached 1380 - 1990 m in 2100. The probability density, cumulative density and survival function of the modelled altitudes under the four RCPs for the year 2100 are depicted in Figure 10.
59
Chapter 5 Projected climate change impacts on habitat availability
–
Figure 10: Probability density, cumulative density and survival function for the four scenarios RCP2.6, 4.5, 6.0, and 8.5 for the year 2100. The altitudinal extent of the original range (600 1100 m) is shaded grey. –
Projected future habitat availability and connectivity
The altitudinal range size underwent different changes depending on the study area. In Cerro Azul (CA) and Buenaventura (BV), under RCP2.6, the projected range increased by 10 % until the year 2100 in comparison to the original range. The forested area, however, decreased to around 95 % of the current size in CA and to 85 % in BV. In Nalacapa (NA) and Guayacan (GY), the range decreased to 60 % and 30 % of the original size, while the forested cover shrank to 75 % in NA and to 40 % in GY (Table 5, Appendix E). Under RCP4.5 though, the projected range decreased to 90 % of the original extent until the year 2100 in both CA and BV, while the forested area decreased to 60 %. In NA, the range decreased to 30 % and the forested area to 50 % of the original extent, while in GY, they declined to 15 % each (Figure 11). Under RCP6.0, the range decreased to 70 % in CA until the year 2100, to 75 % in BV, to 20 % in NA and to 5 % in GY. The forested area declined to 50 % in CA, to 40 % in BV and NA, and to 5 % in GY. RCP8.5 yielded the strongest decline in range and forest size: In CA, the range decreased to 30 % of the original extent, in BV to 40 % and in NA to 1 %. The forest declined to 10 % in CA and BV and to 2% in NA. In GY, there did not remain any habitat under RCP8.5 (Table 5, Appendix E). The connectivity between forest fragments differed between the projected ranges, but not depending on the climate change scenario or altitudinal gradient (data not shown).
60
Chapter 5 Projected climate change impacts on habitat availability
– Table 5: Habitat availability for the original range and the projected ranges for 2050 and 2100 under four RCP scenarios.
Original RCP2.6 RCP4.5 RCP6.0 RCP8.5 2050 2100 2050 2100 2050 2100 2050 2100 600 860 860 930 1000 900 1090 1000 1380 Altitude (m) ------1100 1480 1480 1550 1620 1520 1710 1610 1990 Cerro Azul Altitudinal 5883 6517 6510 5931 5216 6171 4331 5290 1581 (12,120 ha) range (ha) Forested area 2515 2392 2388 2008 1621 2161 1196 1654 255 (ha) Buena- Altitudinal 4026 4266 4409 4116 3682 4190 3026 3702 1477 ventura range (ha) (9,880 ha) Forested area 1645 1342 1357 1150 910 1219 585 935 177 (ha) Nalacapa Altitudinal 5488 3400 3387 2548 1821 2863 1217 1875 63 (11,680 ha) range (ha) Forested area 1568 1193 1191 996 783 1076 599 798 39 (ha) Guayacan Altitudinal 5503 1708 1700 1194 683 1404 288 726 0 (10,070 ha) range (ha) Forested area 1958 775 772 539 310 633 133 328 0 (ha)
Figure 11: Original range (hatched) and predicted ranges for the years 2050 (light grey, solid outline) and 2100 (light grey, dashed outline) for RCP6.0 in the study areas Cerro Azul (a), Buenaventura (b), Nalacapa (c), and Guayacan (d). Forests fragments are shaded dark grey. 61
Chapter 5 Projected climate change impacts on habitat availability
– DISCUSSION
We quantified the projected upslope shift in the El Oro P during this century for different climate change scenarios. Depending on the intensity arakeet s distribution range of climate forcing and projected climate change, the predicted range shifts between 100 and 600 m uphill until the end of the 21st century. In our model, this shift is accompanied by a drastic loss in habitat for the species of this ecosystem. Moreover, the shift will additionally disrupt connectivity between parakeet populations in different areas.
Upslope shift of the distribution range
(Parmesan 2006, Burrows et al. 2011). Consistent with this interpretation, the El Oro Temperature increase has been identified as the main driver for species range shifts Parakeets are moving uphill as a consequence of warming temperatures throughout its range. El Oro Parakeets have been observed to seasonally migrate between the lower and higher areas in the Buenaventura reserve, which might be caused by a low tolerance to temperature changes. While El Oro Parakeets can be observed in lower altitudes in the cooler dry season (August-November), in the warmer wet season they mainly stay in higher and thus cooler zones. It is conceivable that this migration is linked to the seasonal temperature variation, causing the El Oro Parakeets to follow the temperature gradient uphill and downhill.
The shift in the El Oro P availability which may be temperature-sensitive, and therefore be an indirect effect of arakeets range could also be caused by changes in food the temperature increase. It has been suggested that food availability might be partly responsible for altitudinal migrations of frugivorous birds (Chaves-Campos 2004). However, in the El Oro P an ecologically very distinct species, the Ecuadorian Tapaculo (Scytalopus robbinsi). arakeets range, a similar upslope shift has been observed in The Ecuadorian Tapaculo is a dispersal-limited, insectivorous bird which seems to have undergone a 250 m upslope shift in its distribution range within the last 25 years (Hermes et al. in press). The altitudinal shift of a similar magnitude among two ecologically distinct species suggests that the shift in the range of the El Oro Parakeets is indeed driven by sensitivity to the temperature increase rather than to sensitivity to food availability, and is therefore a direct effect of warming temperatures. These parallel altitudinal shifts of threatened endemics imply that our results hold more generally for species in the Tumbes-Chocó-Magdalena hotspot.
All four climate change scenarios imply an altitudinal range shift of the El Oro Parakeets until the end of the 21st century. Compared to the altitudinal range of 600- 1100 m, where the species was discovered in 1980 (Ridgely and Robbins 1988), the 62
Chapter 5 Projected climate change impacts on habitat availability
– birds will shift their range uphill at a rate between 25 and 70 m per decade until the year 2100. This rate is consistent with the range shifts that were observed for endemic animal species on mountains in Madagascar and Indonesia (Raxworthy et al. 2008, Chen et al. 2009, Freeman and Class Freeman 2014). Importantly, only under the most optimistic scenario RCP2.6, the range shift will stagnate after the year 2050 (Figure 9). However, there are doubts whether climate change mitigation can limit the temperature change to fit the RCP2.6 scenario (Knutti et al. 2016, Rogelj et al. 2016). Therefore, the range shift of the El Oro Parakeets will likely exceed the projections under the RCP2.6 scenario and continue at least until the year 2100.
Projecting the range shift of the El Oro Parakeets based purely on warming temperatures is, of course, only an approximated forecast of future changes in its temperature alone; yet, biological mechanisms like physiological traits, phenotypic distribution range. A species response to climate change is likely not mediated by plasticity, local adaptations, species interactions, dispersal abilities or habitat availability should also be taken into account when modelling future range shifts (Hoffmann and Sgro 2011, Urban et al. 2016). The above mentioned biological parameters may be able to mitigate or enhance the rate of the temperature-driven range shift (Sekercioglu et al. 2012). Most of these data are lacking for the El Oro Parakeets; thus, we only integrated habitat availability into the model. It is possible that the actual changes in the distribution range differ slightly from our projection. However, we accounted for a large range of uncertainty in the intensity of the shift by including the results of 25 to 42 single CMIP5 models for each RCP scenario into the analysis (Figure 9, Figure 10). Even though our projection is only an approximation, it still provides a notion of the estimated magnitude of the shift that is to be expected under distinct climate change scenarios.
Implications for conservation
In the tropics, climate change poses a severe risk to native biodiversity, as especially birds (Nogué et al. 1999, Sekercioglu et al. 2008, 2012, Freeman and Class Freeman 2014), but also insects, amphibians and reptiles (Pounds et al. 1999, Deutsch et al. 2008, Raxworthy et al. 2008, Chen et al. 2009) are susceptible to rising temperatures. Increased heat causes tropical species to shift their distribution ranges uphill, which can lead to reductions in the range size (Foster 2001). Remarkably, in our study we found that the projected shift of the El Oro P necessarily lead to a decrease in the range size. Under some climate change scenarios, arakeets distribution range does not the range size increased with the upslope shift, at least on the short term. However, within all projected ranges the area covered by forests, which represent the habitat of
63
Chapter 5 Projected climate change impacts on habitat availability
– the El Oro parakeets, drastically decreases with increasing elevation. This suggests that the disproportionally large decrease in forest availability to, on average, 20 % of the current extent compared to a decrease in range area to on average 35 %, is a general phenomenon in the cloud forests of the southern Tumbes-Chocó-Magdalena hotspot.
The available habitat shrinks more quickly than does range area. This has important implications for conservation: A species might actually be more threatened than assumed based on the analysis of the range size alone. Not considering the changes in xtinction risk (Akcakaya et al. 2006, Ocampo-Peñuela et al. 2016). After integrating projected changes in forest habitat availability might underestimate a species e availability, the reassessment of the threat status of 800 Amazonian bird species % to 10 % (Bird et al. 2012). Nevertheless, accounting for changes in altitudinal ranges and resulted in an increase in the number of species qualifying as threatened from forest cover combined for more than 800 endemic birds from tropical biodiversity hotspots produced a more striking result: 43 % of the species were found to be more threatened than currently estimated by IUCN (Ocampo-Peñuela et al. 2016). To obtain a precise quantification of the extinction risk of the species of the Tumbes- Chocó-Magdalena hotspot, a similar approach should to the same extent be implemented in this hotspot.
The upslope shift of the El Oro Parakeets contributes to changes in connectivity among populations in different areas. While the original range covered a continuous altitudinal band from Guayacan to the northern part of the range (Figure 8), this linkage will become interrupted between Guayacan and Nalacapa until the year 2050. It has been shown that low-elevation zones present a dispersal barrier for El Oro parakeets (Klauke et al. 2016). The elevation of the valley between the two regions is so low that it will restrict dispersal as the range shifts uphill. Gene flow between populations of the El Oro Parakeet in Guayacan and in the northern part of the range therefore might become greatly reduced, leading to a reduction in genetic diversity, which inevitably presents a risk of extinction (Epps et al. 2005, Coulon et al. 2006, Segelbacher et al. 2010). Until the year 2100, Guayacan could become a prime example of extinction at a mountain top, not only of the El Oro Parakeet, but also of other cloud forest species. Thus, the area of Guayacan should be surveyed for the occurrence of endemic species, e.g. orchids or amphibians.
Apart from the reduction in connectivity due to topographic barriers, the unavailability of forested habitat might additionally contribute to disrupting linkages between populations. At higher altitudes, forest cover is greatly reduced. Although the configuration of forests is site-specific, the connectivity is generally low owing to
64
Chapter 5 Projected climate change impacts on habitat availability
– the increasing ruggedness of the terrain. We did not detect a clear pattern in the change in connectivity according to a height gradient. Nevertheless, our result shows that the range shift is accompanied by changes in connectivity. This will likely influence gene flow, even though it remains difficult to predict to which extent. The increase in fragmentation accompanying the upslope shift of the range together with the formation of new topographic obstacles might enhance and aggravate the dispersal barriers impeding the movement of El Oro Parakeets.
The future availability of forest in the range of the El Oro Parakeet is difficult to project. We based the analysis of forest availability in the study areas on a map of forest fragments of the years 2010 and 2013, but did not account for future changes in forest cover. Considering the high deforestation rates throughout the Tumbes- Chocó-Magdalena hotspot, our assumption that forest cover remained constant until 2100 is very conservative. It is likely that forest cover changes differently in the four areas within the next decades. In the protected Buenaventura reserve, intense reforestation programs are carried out, increasing the forested area significantly. The other three study areas are until now unprotected; the changes in forest cover there are deeply uncertain.
We identified areas that could potentially be invaded by the El Oro Parakeet in the next decades and investigated the configuration of forests therein. The overall pattern of drastic decrease in forest cover in the areas that might be colonized by the El Oro Parakeets in the near future already now requires action to be taken in order to provide the species with forested habitat. Andean trees and vegetation communities have been reported to move uphill at 25-35 m per decade in the course of climate change (Feeley et al. 2011, Morueta-Holme et al. 2015). Compared to the El Oro Parakeets, which likely move uphill at a rate of 25-70 m per decade, the migration of trees falls behind. It has been shown that secondary forests and even abandoned cattle pastures have the potential to regain characteristics of old-growth forests within a few decades (Aide et al. 1995, 2000, De Walt et al. 2003). Conservation measures aiming at reforesting open areas with native trees can speed up the process of forest restoration and regeneration (Holl et al. 2000, Lamb et al. 2005), and thereby mitigate the gap between the altitudinal shifts of El Oro Parakeets and their food plants.
To enable dispersal and gene flow for El Oro Parakeets in the future and, with it, to prevent a population decline due to habitat loss, it is crucial to not only aim at restoring or facilitating connectivity in a horizontal direction between forests in the same altitudinal band. Additionally, the vertical connectivity between forests in different altitudes has to be taken into account in order to allow for movement of
65
Chapter 5 Projected climate change impacts on habitat availability
– parakeets into higher zones. In view of the high biodiversity in the Tumbes-Chocó- Magdalena hotspot and the similar altitudinal change of the endemic Ecuadorian Tapaculo, it seems likely that many other cloud forest species are affected by climate change and the related range shift. Its high mobility, but presumably low temperature sensitivity make the El Oro Parakeet an appropriate umbrella species not only for the assessment of the upslope shift, but also for targeting sound conservation actions. We hypothesize that several other, less mobile cloud forest species, including understory birds and amphibians, will greatly benefit from conservation measures aiming at restoring horizontal and vertical connectivity for the El Oro Parakeet.
ACKNOWLEDGEMENTS
We are grateful to Cesar Garzon and his colleagues for providing us with their observational data of the parakeets in the years 2011 and 2012. Kelsey Ruckert kindly assisted in the statistical analysis. This work was partially supported by the National Science Foundation through the Network for Sustainable Climate Risk Management (SCRiM) under NSF cooperative agreement GEO-1240507 as well as the Penn State Center for Climate Risk Management. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the funding agencies.
66
Chapter 5 Projected climate change impacts on habitat availability
– APPENDIX
Appendix D: List of models used in the IPCC WG1 AR5 Annex I: Atlas of Global and Regional Climate Projections (Stocker et al. 2013).
CMIP5 Model Name RCP2.6 RCP4.5 RCP6.0 RCP8.5 ACCESS1-0 X X ACCESS1-3 X X bcc-csm1-1 X X X X bcc-csm1-1-m X X X BNU-ESM X X X CanESM2 X X X CCSM4 X X X X CESM1-BGC X X CESM1-CAM5 X X X X CMCC-CM X X CMCC-CMS X X CNRM-CM5 X X X CSIRO-Mk3-6-0 X X X X EC-EARTH X X X FGOALS-g2 X X X FIO-ESM X X X X GFDL-CM3 X X X X GFDL-ESM2G X X X X GFDL-ESM2M X X X X GISS-E2-H p1 X X X X GISS-E2-H p2 X X X X GISS-E2-H p3 X X X X GISS-E2-H-CC X GISS-E2-R p1 X X X X GISS-E2-R p2 X X X X GISS-E2-R p3 X X X X GISS-E2-R-CC X HadGEM2-AO X X X X HadGEM2-CC X X HadGEM2-ES X X X X immcm4 X X IPSL-CM5A-LR X X X X IPSL-CM5A-MR X X X X IPSL-CM5B-LR X X MIROC5 X X X X MIROC-ESM X X X X MIROC-ESM-CHEM X X X X MPI-ESM-LR X X X MPI-ESM-MR X X X MPI-ESM-P MRI-CGCM3 X X X X NorESM1-M X X X X NorESM1-ME X X X X
Number of Models 32 42 25 39
67
Chapter 5 Projected climate change impacts on habitat availability
– Appendix E: Original range (light grey) and predicted ranges for the years 2050 (solid outline) and 2100 (dashed outline) for RCP2.6 (dark blue), RCP 6.0 (orange), and RCP8.5 (red) in the four study areas Cerro Azul, Buenaventura, Nalacapa, and Guayacan. Forest fragments are depicted in dark grey.
68
Chapter 6 A framework for prioritizing areas for conservation in tropical montane cloud forests
Claudia Hermes, Gernot Segelbacher & H. Martin Schaefer
Manuscript submitted to Peerage of Science
ABSTRACT
Tropical cloud forests are under severe environmental distress. While ongoing deforestation leads to fragmentation and degradation of forests, climate change causes species to shift their distribution ranges uphill. The resulting loss of habitat availability and connectivity can be mitigated by the creation of protected areas and dispersal corridors, providing forested habitat and allowing for migration between patches. Here, we present a novel framework for identifying areas offering high quality habitat and connectivity for cloud forest species. The framework presented here consists of four steps and integrates data on the structural composition of forests, on the configuration of forests in the landscape, on dispersal abilities and on the altitudinal range for several focal species. Importantly, the framework integrates projections of future range shifts caused by climate change. Thus, it prioritizes a network of areas with high conservation value for native biodiversity which is robust to climate change on the long-term. We applied the framework to the cloud forests of southwestern Ecuador, using two ecologically very distinct endemic and threatened birds as focal species for the quantification of the habitat quality and the projected
69
Chapter 6 Prioritizing areas for conservation
– range shift. Our approach allows targeting reforestation measures effectively to priority areas which are of high conservation value for the two species. Reforestation would improve the quality and quantity of forests as well as the connectivity between forests. As a high number of species in many regions are suffering from forest loss and range shifts, the framework presented here can be applied to different ecosystems and geographical locations, and therefore contribute to making informed decisions about the implementation of robust conservation measures.
KEYWORDS: Connectivity; forest fragmentation; habitat quality; least-cost path; Tumbes-Chocó-Magdalena biodiversity hotspot
INTRODUCTION
The loss and fragmentation of habitat are considered major drivers of species extinction. While habitat loss reduces the population size of a species, fragmentation contributes to isolating populations from each other as the connectivity between patches is declining (Kareiva and Wennergren 1995). Increasing isolation between populations leads to a reduction in migration rates and, consequently, to a reduction in gene flow and genetic diversity (Coulon et al. 2006). Small, isolated populations are thus becoming increasingly vulnerable to environmental stochasticity or demographic fluctuations (Lande 1993, Burkey 1999). Overall, the decline in population size caused by the loss of habitat is further aggravated by the detrimental effects of habitat fragmentation, putting species at risk of local extinctions.
Global biodiversity hotspots are especially affected by habitat loss and fragmentation (Myers et al. 2000). These hotspots are areas where exceptionally high concentrations of endemic species are facing an exceptionally high loss of habitat (Myers et al. 2000, Brooks et al. 2002). The majority of the 34 global biodiversity hotspots are located in tropical forests, which constitute the most species-rich places on Earth (Myers et al. 2000) Tropical montane cloud forests, showing a strong altitudinal stratification of ecosystems and spec endemic species (Foster 2001). However, the persistence of tropical montane cloud ies’ ranges, harbor a high density of forests and the biodiversity they host are threatened by changes in land-use and climate. As human population growth within the tropical biodiversity hotspots is substantially larger than global average, deforestation and anthropogenic land-use change will in the future reduce the native vegetation even further (Cincotta et al. 2000).
70
Chapter 6 Prioritizing areas for conservation
– The severe distress caused by logging of the tropical montane cloud forests is further aggravated by climate change. These forests depend on frequent immersions in the cloud bank (Foster 2001). With ongoing climate change, the cloud bank is shifting uphill, leaving the lower elevation zones in drier and warmer conditions (Pounds et al. 1999, Still et al. 1999). As cloud forest species depend on a cool, humid environment, they are following the cloud bank uphill, shifting their ranges into higher elevations (Breshears et al. 2008, Chen et al. 2009, Feeley et al. 2011, Freeman and Class Freeman 2014). The rate of the range shifts amounts to up to 70 m per decade for cloud forest animals (Raxworthy et al. 2009, Chen et al. 2009), while the migration of trees lags behind with about 30 m per decade (Feeley et al. 2011, Morueta-Holme et al. 2015). As such, climate change can alter the altitudinal stratification of habitats, while forest logging contributes to loss and fragmentation of the habitat. Tropical montane cloud forests are thus strongly in the need of sound conservation measures to protect the habitat and restore connectivity, which are at the same time robust in the face of ongoing climate change. Consequently, the installation of protected areas and dispersal corridors has become a key aspect of biodiversity conservation in the tropics (Margules and Pressey 2000, Caro et al. 2009, Jenkins et al. 2010).
Protected areas and dispersal corridors are designed for multiple focal species in order to protect ecosystem processes (Beier et al. 2008, 2011). To rank places for the establishment of protected areas and corridors in a given location, it is crucial to quantify the habitat quality and connectivity for several focal species. Each of these focal species serves as an umbrella species for different environmental parameters by determining the minimum acceptable values for structural characteristics of the landscape. Focal species should have strong requirements for certain characteristics of the landscape and specify the minimum acceptable values for, e.g., the connectivity between habitat patches, the quality of habitat, or the distance between stepping stones when crossing a matrix of unsuitable habitat. Thus, a protected area or corridor meeting the requirements of the focal species will likewise meet the needs of many co-occurring species as well (Lambeck 1997). Using several focal species in conservation planning can allow the identification of places with a high conservation value (e.g., where habitat quality and connectivity are high) for a large number of species, or of places where conservation action needs to be taken in order to improve habitat quality or connectivity.
Here, we present an integrated framework for the evaluation of habitat quality and connectivity in tropical montane cloud forests, followed by the prioritization of areas for conservation, for several focal species. The method consists of four steps (Figure 12). In the first step, we use biological data of the focal species and remote sensing 71
Chapter 6 Prioritizing areas for conservation
– information on the configuration of the landscape. We develop a habitat quality model integrating data on the quality of the microhabitat (i.e. structural characteristics of the forests) and macrohabitat (i.e. the spatial configuration of the forest fragments), data on the altitudinal range, as well as on the dispersal abilities of the focal species. These factors influence species abundance in tropical montane cloud forests (Lee et al. 2004, Shoo et al. 2005, Moore et al. 2008). In a second step, these data are combined in order to set resistance values for all map units within the area of interest. These resistance values express the general quality of the habitat for landscape. In the third step, by setting thresholds for habitat quality, the areas with the focal species, which we define as the species’ cost of movement through the highest habitat quality, and thus priority conservation value, are identified. Then, in the fourth step, a least-cost path analysis selects the trajectory of the lowest resistance values for movement between habitat patches. This corridor identifies the most important areas for dispersal.
Figure 12: Method for prioritizing forest fragments depending on their habitat quality and for assessing the least-cost paths between fragments in ARCMAP 10.2 in four steps. Arrows indicate the ARCMAP tools used. After creating four layers depicting microhabitat quality, macrohabitat quality, the maximum dispersal zone around forest fragments, and elevation (Step 1), these layers were added in the RASTER CALCULATOR tool to obtain a resistance surface for habitat quality (Step 2). The ZONAL STATISTICS tool was used to calculate the mean movement costs per fragment. After classifying the fragments into four groups according to their mean costs (Step 3), the least-cost paths (LCPs) between fragments were identified using the LINKAGE MAPPER tool (Step 4).
72
Chapter 6 Prioritizing areas for conservation
– The method presented here constitutes a new approach for the identification of areas that have a high conservation value in the face of climate change. The combination of ecological data on the focal species with detailed information on the structural composition of the landscape, accounting for future range shifts, gives comprehensive insights into temporal changes in the availability of habitat for the focal species. Thus, it allows taking informed decisions about the prioritization of areas for sustainable conservation on the long-term. In these areas, conservation measures should already now be implemented, in order to protect and further improve habitat quality and connectivity in the future.
We apply the method on a landscape in the montane cloud forests in the southern part of the Tumbes-Chocó-Magdalena biodiversity hotspot in southwestern Ecuador. As focal species, we use two endemic birds, the Ecuadorian Tapaculo (Scytalopus robbinsi) and the El Oro Parakeet (Pyrrhura orcesi). Both species depend on dense forest cover and are thus heavily affected by deforestation in their ranges. Moreover, ongoing climate change causes both species to migrate uphill, producing altitudinal range shifts of over 100 m until the year 2050 (Hermes et al. in press, Hermes et al. in review). Therefore, we want to assess which forests are most valuable for the two species in terms of habitat quality and connectivity, today as well as for a projected range shift in the year 2050. This enables the preservation of habitat and the long- term functioning of dispersal corridors for the two focal species and other biodiversity of the Tumbes-Chocó-Magdalena hotspot.
METHODS
Study area
The study area is located in the Tumbes-Chocó-Magdalena biodiversity hotspot in southwestern Ecuador. This hotspot stretches over a length of 1500 km from Panama to the western foothills of the Andes in Colombia, Ecuador and northern Peru. While the Tumbes-Chocó-Magdalena hotspot harbors an extremely high diversity of partly endemic plant and animal species, including 85 endemic bird species (Brooks et al. 2002), it is threatened by an extremely high loss of habitat. Between 1990 and 1995, the deforestation rate in the Tumbes-Chocó-Magdalena hotspot amounted to 1.43 % annually (Brooks et al. 2002). It is feared that the hotspot will have lost about 90 % of its original habitat by the year 2100 (Jantz et al. 2015).
Our study area covered around 700 km² of the Tumbes-Chocó-Magdalena hotspot in southwestern Ecuador, in an elevation between 130 and 2500 m (Figure 13). In most
73
Chapter 6 Prioritizing areas for conservation
– parts of this area, the original vegetation of premontane cloud forests is gone. In total, around 210 km² of our study area is forested. Remaining forest patches are comprised of secondary stands in various successional stages; they are mostly smaller than 100 ha and often separated by large areas of cattle pastures. The only protected site is the private Buenaventura reserve in the center of the study area, which is owned by the Ecuadorian NGO Fundación Jocotoco. The Buenaventura reserve covers a total of 2560 ha of secondary forests and abandoned cattle pastures in an elevation between 400 and 1500 m.
Figure 13: The study area in southwestern Ecuador. Forest patches are hatched grey; the Buenaventura reserve is indicated by the bolt black outline.
74
Chapter 6 Prioritizing areas for conservation
– Focal bird species
As focal species for modelling the habitat availability and connectivity in the premontane cloud forests of southwestern Ecuador, we chose two endangered bird species which are endemic to the Tumbes-Chocó-Magdalena hotspot and have overlapping ranges: the Ecuadorian Tapaculo (Scytalopus robbinsi) and the El Oro Parakeet (Pyrrhura orcesi). The two species have different dispersal abilities, but both depend on humid cloud forests. The Ecuadorian Tapaculo occurs in the understory of mature forests in an elevation between 850 and 1500 m. So far, there is no detailed information about the dispersal ability of the species; however, it was estimated that the majority of Ecuadorian Tapaculos were only able to cross up to 80 m of open habitat between different forest fragments (Hermes et al. in press). Due to their sensitivity to habitat fragmentation, Tapaculos in general are seen as an ideal umbrella species for modelling landscape connectivity in conservation planning (Castellón and Sieving 2006, 2007). The El Oro Parakeet occurs in a narrow range between 800 and 1450 m. Even though the species is able to cross gaps between forest fragments, it relies on a dense forest cover for foraging and breeding (Schaefer and Schmidt 2003). The El Oro Parakeet has intermediate dispersal abilities; the maximum uninterrupted flight distance observed in a radio-tracking study amounted to 600 m (Dietrich 2003). Topographic barriers like valleys have led to a genetic structuring of the species (Klauke et al. 2016).
Quantification of microhabitat and macrohabitat quality in the study area
The Ecuadorian Tapaculo is dispersal-limited and has strong demands for high- quality forests for territory establishment. A previous study revealed that the species only occurred in forests which structurally resembled old, mature stands (Hermes et al. in press). We therefore used it as umbrella species for the quantification of forest quality in the study area, assuming that a forest which is suitable for this species and offers a high level of connectivity will likewise be appropriate not only for the El Oro Parakeet, but also for many other dispersal-limited animals, like amphibians, reptiles, or similar understory birds. We assessed forest quality as the quality of the microhabitat, i.e., the vegetation characteristics within a forest, and the quality of the macrohabitat, i.e., the configuration of forests in the landscape.
In a previous study, we assessed the specific microhabitat requirements of the Ecuadorian Tapaculo by analyzing structural characteristics (inclination, tree height, tree diameter in breast height, number of trees, vegetation density in 0-50 cm and in 100-150 cm, presence of wooden debris, presence of streams, canopy density) in 44 territories of Ecuadorian Tapaculos and compared them with those of 73 control 75
Chapter 6 Prioritizing areas for conservation
– plots without territories (Hermes et al. in press). To assess differences in microhabitat between areas with territories and areas without territories, we carried out a linear discriminant analysis (LDA), and discovered that Ecuadorian Tapaculos only occurred in forests that structurally resembled old successional stands, i.e., in forests with many large trees. With a leave-one-out cross-validation of the LDA, we reassessed the microhabitat structure of the plots as being a territory or a control plot. The cross-validation yielded a posterior value of the probability of each plot to be categorized as a territory. We used these values as a proxy for the forest quality. This analysis enabled us to classify the microhabitat quality of remaining forest patches in a total of 100 km ² in the study area.
To obtain a value of microhabitat quality in forests that could not be analyzed, e.g. because they were topographically inaccessible, we performed an Inverse Distance Weighting interpolation in ARCMAP 10.2. This interpolation technique estimates cell values based on the assumption that the influence of each point decreases with increasing distance from the sample location, meaning that geographically close sampling plots are more similar to each other than plots further apart. We thus obtained a resistance map of forest fragments (cell size 30 x 30 m), where each forest cell was assigned a cost value depending on its microhabitat quality. Costs ranged from 1 (high microhabitat quality) to 100 (low microhabitat quality).
To assess the macrohabitat quality for each forest fragment, we quantified its area, compactness (fragment area divided by fragment perimeter) and connectivity microhabitat quality, we quantified macrohabitat quality based on the needs of distance to the nearest fragment ≥ ha in ARCMAP. Analogous to the analysis of Ecuadorian Tapaculos: We assumed a fragment whose configuration in the landscape met the needs of this species to be of high macrohabitat quality, while unsuitable fragments were classified as being of low macrohabitat quality. On the resistance map depicting macrohabitat quality, each forest cell was assigned a cost value between 1 in suitable fragments and 100 in unsuitable fragments.
Habitat availability and connectivity for El Oro Parakeets today
To generate a resistance surface for El Oro Parakeets, we assigned cost values to every cell on the map (30 x 30 m) depending on different criteria. Two layers for the quality of the microhabitat within a forest and for the quality of the macrohabitat, depending on the configuration of a forest in the landscape, were generated as described above. Around each forest fragment, we generated a zone with radius of 600 m, assuming that this would be the distance that an El Oro Parakeet could cover outside of forested habitat. We assigned costs between 1 (high quality) and 100 (low 76
Chapter 6 Prioritizing areas for conservation
– quality) for each of the three layers. A forest with highest quality, i.e. a forest within the maximum dispersal distance of the El Oro Parakeet offering the best possible quality of microhabitat and macrohabitat, could thus obtain an up to 300 fold higher weight than non-forested areas. To additionally obtain a cost value for the elevation, to be the optimal elevation with a cost of 1. Higher and lower elevations were we considered the mean altitude of the El Oro Parakeet’s distribution range m gradually assigned higher costs, until the maximum cost of 100 in unsuitable elevations (Step 1). We acknowledge that these assumptions are fairly simplistic; yet, the El Oro Parakeet seems to be susceptible to elevation (Klauke et al. 2016). In the RASTER CALCULATOR tool of ARCMAP, we merged the different layers to obtain a resistance surface for El Oro Parakeets in the study area (Step 2; Figure 14a). With the ZONAL STATISTICS tool of ARCMAP, we calculated the mean costs of every forest fragment to quantify the availability of habitat with different levels of quality. We determined thresholds for fragments with high quality as up to 25 % of the total costs, with medium quality as up to 50 % of the total costs, and with low quality as up to 75 % of the total costs, and assigned the forest fragments to their respective group. Forests with more than 75 % of the total costs were assumed to be unsuitable as habitat for the Ecuadorian Tapaculos and disregarded in the further analysis (Step 3). Using the LINKAGE MAPPER tool in ARCMAP, we evaluated the least-cost paths (LCPs) between the forest fragments for each of the three quality groups separately (Step 4).
Habitat availability and connectivity for El Oro Parakeets as climate changes
To generate a resistance surface that accounts for an upslope shift in the distribution range of the El Oro Parakeets, we took over the range that has been projected for the species for the year 2050 under the climate change scenario RCP4.5 (Hermes et al., in review). The RCP4.5 scenario describes a trajectory of greenhouse gas emissions with intermediate mitigation. RCP4.5 will lead to a radiative forcing of 4.5 W/m² by the year 2100 and a temperature increase of about 2.5 °C above pre-industrial level (Stocker et al. 2013). Under this scenario, the range of the El Oro Parakeet will likely shift to a mean altitude of 1240 m by 2050. We updated the costs for altitude accordingly and generated a layer with movement costs being 1 at 1240 m and gradually increasing at lower and higher altitudes. Adding the layers for microhabitat and macrohabitat quality and the buffer zone of 600 m around forests to the layer of altitudinal costs in the RASTER CALCULATOR (Step 1), we obtained a resistance maps for the projected range of the El Oro Parakeets in 2050 (Step 2; Figure 14b). Likewise,
77
Chapter 6 Prioritizing areas for conservation
– we grouped the forest fragments according to their movement costs and identified the LCPs (Step 4).
Figure 14: Resistance surfaces for El Oro Parakeets El Oro Parakeets in their projected range for 2050 (b), Ecuadorian Tapaculos Ecuadorian in today’s range a , Tapaculos in their projected range for 2050 (d). The costs of movement are visualized by the color in today’s range c , and gradient from blue to red, with blue indicating higher costs and red lower costs. The bolt black line marks the Buenaventura reserve.
Habitat availability and connectivity for Ecuadorian Tapaculos today
Owing to the strong habitat requirements and low dispersal abilities of the Ecuadorian Tapaculo, we assume that areas of high conservation value for this species will likewise offer suitable habitat for co-occurring species with less strong demands. For the resistance surface for the Ecuadorian Tapaculo, we first generated 78
Chapter 6 Prioritizing areas for conservation
– zones with a radius of 80 m around forest fragments, depicting the maximum dispersal distance. Moreover, we assigned costs to the elevation according to the tion range, with the mean of the altitudinal range (1200 m) obtaining a cost of 1 and costs increasing gradually in higher and lower Ecuadorian Tapaculo’s distribu elevations (Step 1). Adding the two layers with the maps of microhabitat and macrohabitat quality in the RASTER CALCULATOR tool resulted in a map depicting resistance values over the study area for the El Oro Parakeets (Step 2; Figure 14c). We classified the fragments (Step 3) and assessed the LCPs (Step 4) as described in Figure 12.
Habitat availability and connectivity for Ecuadorian Tapaculos as climate changes
There are hints that between the years 1990 and 2015, the Ecuadorian Tapaculos have shifted their range uphill at a rate of 70 m per decade (Hermes et al., in press). It has been hypothesized that the shift has been caused by a temperature increase throughout their range. Here, we make the assumption that the observed upslope shift will continue at the same pace until the year 2050; thus, the Ecuadorian Tapaculos would occur at a mean altitude of 1450 m (1100 1750 m) in 2050. Therefore, we revised the layer for the altitudinal costs, with costs being 1 at 1450 m – and gradually increasing at lower and higher altitudes. We added the layers for microhabitat quality, macrohabitat quality and the buffer of 80 m around forest fragments to the layer with altitudinal costs in the RASTER CALCULATOR (Step 1) and obtained a resistance map depicting habitat quality in the projected range for the year 2050 (Step 2; Figure 14d). Then, we classified the forest fragments (Step 3) and identified the LCPs (Step 4).
RESULTS
The resistance maps for the Ecuadorian Tapaculos and El Oro Parakeets in their ranges today and in their projected ranges in the year 2050 are depicted in Figure 14. In general, the costs of movements across the landscape for the El Oro Parakeets (Table 6) are higher than for the Ecuadorian Tapaculos (Table 7). Fragments offering high quality habitat (2 %) are strongly fragmented and isolated. Only 48 % of the forests are at least of medium and 65 % at least of low quality. Until the year 2050, these values decrease: Fragments with high quality habitat (0.5 %), with at least medium quality (48 %) and at least low quality (57 %) decline further. The proportion of forests which are unsuitable as habitat for the El Oro Parakeets rises
79
Chapter 6 Prioritizing areas for conservation
– from 35 % today to 43 % in 2050 (Table 6; Figure 15a, b). However, the mean length and cost of the LCPs are much lower between the forest fragments of medium and low quality, compared to those of high quality (Table 6).
Table 6: Habitat availability and connectivity for El Oro Parakeets today and in their projected range in the year 2050. The habitat quality is classified into three groups (good quality = up to 25 % of the total costs of movement; medium quality = up to 50 % of the total costs of movement; low quality = up to 75 % of the total costs of movement). The availability of habitat is denoted as the number of forest patches and the total area covered by forest in each of the three groups for ts of the least-cost paths (LCPs) between the forest patches in each group. today’s range and the range in . The connectivity is expressed as the mean length and cos Habitat Number of Total forested Mean length Mean cost of quality Forest patches area (ha) of LCP (m) LCP (x 1000) Today High 6 400 7,700 930 Medium 72 10,100 1,400 200 Low 219 13,600 1,300 240 2050 High 6 100 8,300 1,080 Medium 65 10,100 1,500 220 Low 201 12,000 1,300 240
Habitat availability and connectivity for the Ecuadorian Tapaculos decline in a similar % of the forest fragments have at least medium quality and 64 % at least low quality, respectively, only 0.5 % of the forests pattern over time. While in today’s range, are of good quality. In the range projected for the year 2050, only 0.01 % of the forests are of good quality, 29 % at least of medium quality and 54 % at least of low quality. The proportion of forest patches which are not suitable as habitat for the Ecuadorian Tapaculos increases from 36 % today to 46 % in the projected range in 2050 (Table 7). Notably, forest fragments that today have a medium quality decrease to low quality in 2050, while forests of low quality today are no longer suitable in 2050 (Figure 15c, d). Analogous to the Ecuadorian Tapaculos, length and cost of the LCPs between forest fragments of high quality are higher than between forests of medium and low quality (Table 7). Overall, the quality of habitat and the connectivity between patches deteriorates within the next decades.
80
Chapter 6 Prioritizing areas for conservation
– Table 7: Habitat availability and connectivity for Ecuadorian Tapaculos today and in their projected range in the year 2050. The habitat quality is classified into three groups (good quality = up to 25 % of the total costs of movement; medium quality = up to 50 % of the total costs of movement; low quality = up to 75 % of the total costs of movement). The availability of habitat is denoted as the number of forest patches and the total area covered by forest in each of the three and costs of the least-cost paths (LCPs) between the forest patches in each group. groups for today’s range and the range in . The connectivity is expressed as the mean length Habitat Number of Total forested Mean length Mean cost of quality forest patches area (ha) of LCP (m) LCP (x 1000) Today High 6 100 8,100 1,220 Medium 67 9,600 1,900 260 Low 208 13,400 1,300 250 2050 High 1 3 Medium 31 6,000 2,500 460 Low 135 11,400 1,300 280
When including forests of low habitat quality, the LCPs between fragments covered up on average 8 km of unsuitable habitat, while the LCPs between forests of high or medium habitat quality were much shorter (Table 6, 7). In most cases, the analysis identified more than one alternative route between forest fragments (Figure 15 a-d). Moreover, several dispersal corridors are shared between the two focal species, and are additionally robust to climate change (e.g. north of the Buenaventura reserve, Figure 15 a-d). Importantly, the dispersal corridors for the Ecuadorian Tapaculo identified here largely match the LCPs modelled in a previous study based on genetic information of the species (Hermes et al. 2016).
81
Chapter 6 Prioritizing areas for conservation
–
Figure 15: Forest fragments with high quality (up to 25 % of the total costs of movement; red), medium quality (up to 50 % of the total costs of movement; green), and low quality (up to 75 % of the total costs of movement; blue) and least-cost paths (in red, green and blue respectively) between them for El Oro Parakeets El Oro Parakeets in their projected range for 2050 (b), Ecuadorian Tapaculos Ecuadorian Tapaculos in their in today’s range a , projected range for 2050 (d). Forest fragments with more than 75 % of the total costs of in today’s range c , and movement are depicted in light grey. The bolt black line marks the Buenaventura reserve.
82
Chapter 6 Prioritizing areas for conservation
– DISCUSSION
Using a four-step framework to prioritize areas for conservation, we investigated habitat quality and connectivity for two endemic bird species, the Ecuadorian Tapaculo and the El Oro Parakeet, in the Tumbes-Chocó-Magdalena hotspot in southwestern Ecuador. We discovered that only a small fraction of the forests offers high-quality habitat and good connectivity to other forest patches. Accounting for future shifts in the distribution ranges of the two focal species revealed that habitat quality, forest quantity as well as the connectivity will further decrease within the projected ranges until the year 2050. Importantly, the framework identified forests with high conservation value on the long-term, which already now should be prioritized for protection, as well as potential corridors for dispersal, where reforestation should be initiated soon.
Prioritizing areas for conservation
In the past decades, deforestation and forest degradation in the tropical cloud forest have led to a drastic decrease in the availability of habitat for cloud forest species; forest fragmentation has left only few dispersal corridors or even disrupted connectivity completely. The resulting heterogeneity in landscape configuration and habitat quality caused an overall decrease in population sizes and genetic diversity of tropical species (Fahrig 2003, Dixo et al. 2009, Sodhi et al. 2010, Hartmann et al. 2014), which requires urgent conservation action to be taken in order to protect and restore the remaining forested habitat. The general framework we described here provides a guideline for selecting areas with high conservation value. The assessment of habitat quality, connectivity and future range shifts, identified a network of forest fragments with a high conservation value on the long-term.
The framework presented here can serve as a useful tool for prioritizing areas for conservation at a small geographical scale. A reserve should fulfill two objectives: Represent native biodiversity, and reduce threats to populations in order to ensure their long-term survival (Margules and Pressey 2000). Our framework contributes to the second objective by identifying suitable habitat and connectivity in a landscape context. The importance of connectivity between habitat patches is generally recognized in reserve design (Noss and Harris 1986, Minor and Urban 2008, Caro et al. 2009). The assessment of existing linkages, the identification of forests of minor quality that can serve as stepping stones for dispersal (Manning et al. 2006, Fischer et al. 2010) as well as the selection of areas where reforestation should be implemented in order to restore connectivity between high-quality forest patches (García-Feced et al. 2011) are integral parts in conservation planning and key benefits of the method 83
Chapter 6 Prioritizing areas for conservation
– proposed here. Especially in the Ecuadorian Andes, a high number of small reserves have been created by local NGOs like Fundación Jocotoco, Fundación EcoMinga, Jatun Sacha, Copalinga and many more. The framework can provide valuable guidelines for these NGOs for the identification areas with high conservation value for the establishment of new protected areas or for the expansion of existing reserves.
Contrary to many methods for conservation priority setting, which rely heavily on remote sensing and use little or no field data (Minor and Urban 2008, Rabinowitz and Zeller 2010, Thomassen et al. 2011, Xiaofeng et al. 2011), our framework integrates detailed information gathered in extensive field surveys. The availability of suitable habitat can be over-estimated considerably when relying on remote sensing data alone, which in turn under-estimates the extinction risk for the species (Ocampo- Peñuela et al. 2016). By including field data, the quality of the habitat is taken into account, thus providing a more detailed estimate of the availability of suitable habitat.
Choosing a valuable umbrella species for the quantification of microhabitat and macrohabitat quality, e.g. a species with a relatively large range and specific demands for good habitat , allows the generalizability of habitat quality over a large number of less sensitive co-occurring Caro and O’Doherty 999, Roberge and Angelstam species as well. Even though the distribution range of the Ecuadorian Tapaculo, which we used here as an umbrella species for the quantification of forest quality, covers only about 1100 km², its strong demands for old-growth forest or late successional stands on the microhabitat scale as well as for compact forests with good connectivity to other patches on the macrohabitat scale (Hermes et al. in press) make it a surrogate for other cloud forest birds threatened by forest loss and degradation, like the Grey-backed Hawk (Pseudastur occidentalis), the Long-wattled Umbrellabird (Cepahlopterus penduliger), and the Pacific Royal Flycatcher (Onychorhynchus occidentalis). Field data for a single, carefully selected species thus furnishes information on the overall state of the forests in the southern part of the Tumbes- Chocó-Magdalena hotspot and provides a basis for conservation prioritization on a small geographical scale.
Integrating information on future range shifts ensures the long-term functionality of the selected conservation network. The observed upslope movements of many tropical montane species is projected to go on (Rull and Vegas-Vilarrúbia 2006, Sekercioglu et al. 2012); thus it is crucial to prioritize areas for conservation that will be invaded by the focal species in the future. Even though projections of future changes in the distribution range of a species are often only rough estimates providing coarse data, they account for the landscape composition of areas that will come into focus in several decades and the habitat quality therein. We highlight that
84
Chapter 6 Prioritizing areas for conservation
– the method described here cannot predict future microhabitat and macrohabitat quality. The future state of the forests in the Tumbes-Chocó-Magdalena hotspot is deeply uncertain, as it is subject to different intensities of forest degradation and logging, reforestation, or tree range shifts, all of which can alter habitat quality to a different extent (Feeley et al. 2011, Jantz et al. 2015).
Our method identifies areas of high conservation value on the long-term, as well as areas where immediate forest restoration is required, in order to ensure habitat availability in the future. Selecting areas for protection in suitable habitats is useful within the current distribution ranges, though most likely not robust in the face of climate change (Araujo et al. 2004). Thus, in order to ensure long-term habitat availability and survival of the focal species, protected areas should be selected to account for climate change impacts. The framework represented here explicitly integrates information on current distribution ranges as well as projected future ranges. Thus, it constitutes a novel guideline to taking informed, robust decisions for conservation planning in the face of climate change.
Applying the framework focal species with distinct ecological requirements allows the generalizability of the results. Insectivorous, understory birds generally have low dispersal abilities (Stouffer and Bierregaard 1995, Moore et al. 2008), while frugivorous canopy birds can cover larger distances (Menke et al. 2012). Importantly however, insectivorous and frugivorous birds similarly respond to climate change by shifting their ranges uphill (Klauke et al. 2016, Hermes et al. in press, Hermes et al. in review). By basing the analysis on several species with different dispersal abilities, the areas prioritized for conservation will equally ensure long-term survival of other species sharing the same habitat. Prioritizing areas for the conservation of multiple target species enhances the survival of all native species (Nicholson et al. 2006, Beier et al. 2008). The method described here is not only generalizable for a range of species, but can also be applied to different ecosystems and geographical locations, including areas outside the tropics. Range shifts caused by climate change occur on mountains in many regions (Gottfried et al. 1999, Raxworthy et al. 2008, Chen et al. 2009); thus protected areas worldwide need to proactively account for climate species for the quantification of habitat quality and of future range shifts, the method change effects on species’ ranges. By selecting one or several appropriate umbrella can be adapted to a wide range of species-specific and site-specific conditions. Thus, the framework can contribute to achieving long-term conservation goals in a large variety of threatened habitats worldwide.
85
Chapter 6 Prioritizing areas for conservation
– Case study of Ecuadorian Tapaculos and El Oro Parakeets
The quantification of habitat quality for Ecuadorian Tapaculos and El Oro Parakeets showed that less than half of the forests in our study area offer at least a medium habitat quality for the two species, indicating that the forests are largely degraded and fragmented. Importantly, the proportion of suitable habitat will further decrease following an upslope shift in the distribution ranges until the year 2050. Given that the Ecuadorian Tapaculo is an indicator species for good habitat quality, the fact that most of the forest fragments were even classified as unsuitable indicates that the potential for habitat preservation projects in the study area is generally low. Thus, in order to provide the two species with habitat on the long run, it will be necessary to, at first, initiate programs which aim at stopping further degradation and improving habitat quality, e.g. by restricting timber extraction.
The analysis of the least-cost paths between forests identified linkages where connectivity for both species is highest. However, the mean length of the least-cost paths in all categories of habitat quality is much higher than the maximum dispersal distance observed for the two species. While El Oro Parakeets are known to cross un- forested areas of up to 600 m (Dietrich 2003) and Ecuadorian Tapaculos are presumably able to disperse up to 250 m through open habitat (Hermes et al. in press), the LCPs all have a length of more than 1000 m. Therefore, forests of lower habitat quality that were identified as stepping stones in the analysis of the LCPs should become a focus of attention when planning conservation programs.
The overall poor quality of the habitat and the low connectivity in the study area, which are likely going to deteriorate in the near future, urgently require action to be taken in order to build conservation areas. The forests of highest conservation value, which offer the highest connectivity and at least medium-quality habitat on the long run, are located in the northern part of the study area around Cerro Azul, in the Buenaventura reserve, as well as in the south of the study area around Nalacapa. Apart from the Buenaventura reserve, these areas so far are unprotected. Therefore, it is recommendable to establish official conservation areas around Cerro Azul and Nalacapa and link them to the already existing reserve. In such a way, a network of protected areas with high conservation value can be created in order to provide the two species with habitat and to maintain gene flow between different sub- populations. Such a network will increase the survival chances of the Ecuadorian Tapaculos and El Oro Parakeets in the long-term.
After the prioritization of the three highest-quality areas Cerro Azul, Buenaventura and Nalacapa, hands-on follow-up activities and conservation initiatives need to be started. Apart from expanding the area under protection, it is necessary to further
86
Chapter 6 Prioritizing areas for conservation
– increase the quality and quantity of forested habitat, as well as to restore forest corridors and enhance migration between the three areas. Reforestation with native trees, especially following the LCPs between the three areas and in proximity to the prioritized forests, can greatly contribute to restoring habitat and to providing effective linkages within a few decades (Aide et al. 2000, Chazdon 2003). This will not only be beneficial for Ecuadorian Tapaculos and El Oro Parakeets, but for many other threatened species of the Tumbes-Chocó-Magdalena hotspot as well.
ACKNOWLEDGEMENTS
We are grateful to Valentina Vitali for her assistance with the GIS analysis. This work was funded by the Mohamed bin Zayed Species Conservation Fund and Loro Parque Foundation. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the funding agencies.
87
Chapter 6 Prioritizing areas for conservation
–
88
Chapter 7 The ecological corridor Pagua - Cerro Azul - Buenaventura - Puyango
The aim of this thesis is to provide a scientific basis for the establishment of the ecological corridor Pagua - Cerro Azul - Buenaventura - Puyango. Investigating the effects of forest fragmentation and climate change on my two focal species enabled me to develop recommendations for the detailed planning of the ecological corridor. The results gained in this thesis are generalizable over a large part of the cloud forest biodiversity, i.e. they apply for bad dispersers like understory birds, amphibians or reptiles, as well as for better dispersers like parrots or mammals. Thus, the recommendations discussed here contribute to ensure functional connectivity and long-term sustainability of the corridor.
The results from the four research chapters are briefly summarized here:
Chapter 3: The Ecuadorian Tapaculo is more severely threatened than assumed. The forests in the study area are heavily fragmented, and they are mainly comprised of young secondary stands.
Chapter 4: The Ecuadorian Tapaculo is able to cope with a certain degree of forest fragmentation. Gene flow is not blocked, and the species shows morphological adaptations to the level of fragmentation.
Chapter 5: Climate change causes an upslope shift of the distribution range of the El Oro Parakeet. This shift is accompanied by a drastic decrease in forested habitat.
89
Chapter 7 The ecological corridor
– Chapter 6: Modelling a dispersal corridor for Ecuadorian Tapaculos and El Oro Parakeets identified forests with a high conservation value and priority areas for reforestation.
From these results, I derived four recommendations for the establishment of the ecological corridor, all of which focusing on increasing forest quality and quantity and restoring connectivity between forest fragments:
Recommendation 1: Forests harboring large populations of Ecuadorian Tapaculos should be of priority for protection, as these forests presumably have the highest habitat quality and are therefore of highest conservation value.
Recommendation 2: To enable dispersal through the corridor, the distance between forest fragments should be reduced to less than 250 m, ideally to less than 80 m. This can be achieved by creating continuous forested corridors or small forested patches which serve as stepping stones for dispersal.
Recommendation 3: Reforestation measures should be aimed at increasing the compactness of forest fragments, minimizing the amount of habitat that is subject to edge effects.
Recommendation 4: In view of the ongoing upslope range shifts of cloud forest species, reforestation programs should already now be initiated in higher elevation zones, which might be colonized by the species in the near future. Here, it is crucial to not only increase the amount of forested habitat, but also to restore connectivity between forests in different altitudinal bands.
In the following, I will discuss the implementation of these recommendations in four sites of my study area (Buenaventura, Nalacapa, Sambotambo and Cerro Azul, Figure 16).
90
Chapter 7 The ecological corridor
–
Figure 16: The study area with the four sites Cerro Azul, Sambotambo, Buenaventura, and Nalacapa (bolt grey outline). The proposed corridor in the El Oro province is marked red. Forests are depicted in light grey; the Buenaventura reserve is indicated by the black outline.
BUENAVENTURA
Since the creation of the Buenaventura reserve in 1999, reforestation programs have been carried out within the reserve, which helped increasing the amount of native forests by, until now, more than 400 ha (Fundación Jocotoco 2017). Especially the lower elevation zones in the center of the reserve (400 900 m) are now covered by dense forests, which structurally resemble later successional stands. However, in the – higher parts of the reserve where Ecuadorian Tapaculos and El Oro Parakeets occur, forest fragmentation is higher. The forests in the Finca Ramírez in the northern part of the reserve (Figure 17, red) represent a stronghold for Ecuadorian Tapaculos; yet,
91
Chapter 7 The ecological corridor
– the high density of territories in these forests suggest that carrying capacity is reaching its limit (Chapter 3). Therefore, to allow for a population increase, more forested habitat with good connectivity to other fragments is necessary.
Figure 17: Corridor model for the Buenaventura site. The Buenaventura reserve is indicated by the bolt black line, the highway running through the reserve by the bolt grey line. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests.
Here, my recommendations can be implemented as follows:
Recommendation 1 (Buenaventura): Within the reserve, forests are protected. Importantly however, the forests directly south of the reserve have a high conservation value, as they harbor relatively large populations of the Ecuadorian
92
Chapter 7 The ecological corridor
– Tapaculo and are well connected to the reserve (Figure 17). Thus, in order to conserve these forests, it may be worth considering an expansion of the Buenaventura reserve to the south and include the forests to the reserve.
Recommendation 2 (Buenaventura): The connectivity between forests within the reserve is high enough to maintain gene flow for Ecuadorian Tapaculos (Chapter 4). However, for the El Oro Parakeets the migration between the northern and southern part is impeded by the low elevation zones in the center of the reserve. Therefore, it is important to facilitate movement between the two parts at higher elevations. This could be achieved by concentrating reforestation efforts to suitable elevations in the eastern part of the reserve (Finca Jarrín). There, the forests are mostly small and scattered; however, an increase in forested habitat following the least-cost paths (Figure 17, blue) could greatly improve connectivity between the northern and southern parts of the reserve.
Recommendation 3 (Buenaventura): Mostly, forests in Buenaventura have a compact shape. However, especially in the higher elevation zones, the forests are less compact (Finca Jarrín in the eastern part, Finca Carrión in the northeastern part). Already now, natural regeneration of forests has started; abandoned pastures are overgrown by bushes, shrubs and small trees. Especially in the Finca Jarrín, where pastures are small and surrounded by forested areas, natural regeneration will inevitably lead to a higher compactness of forests. However, this process should be accelerated by reforestation, with trees being planted close to forest edges (see Recommendation 2).
Recommendation 4 (Buenaventura): The recent expansion of the reserve to the north into higher elevation zones is a valuable approach to providing habitat in the face of range shifts. However, as the highest parts of the reserve are less forested, reforestation programs should be implemented soon in areas above 1200 m.
NALACAPA
Nalacapa is the southernmost part of the distribution ranges of Ecuadorian Tapaculos and El Oro Parakeets. The highest peak in this area reaches 1500 m (Figure 18); depending on the intensity of the upslope shift in the distribution ranges of the two species, the area of Nalacapa might become too low for them within the next decades. Nevertheless, considering the large populations of both Ecuadorian Tapaculos and El Oro Parakeets there, the forests of Nalacapa are important for the maintenance of the genetic diversity within the two species. Thus, the forests should be conserved and
93
Chapter 7 The ecological corridor
– connectivity should be increased in order to enable migration and gene flow to the populations in the north.
Figure 18: Corridor model for the Nalacapa site. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests.
The recommendations for the corridor establishment can be realized as follows:
Recommendation 1 (Nalacapa): The forest in the center of the Nalacapa site (Figure 18) harbors the largest population of Ecuadorian Tapaculos known so far (Chapter 3). This forest should be of priority for receiving an official protection status.
Recommendation 2 (Nalacapa): The connectivity between the largest forest in the center of Nalacapa and the Buenaventura reserve in the north is sufficiently high. Even smaller fragments hold territories of Ecuadorian Tapaculos and thus serve as dispersal corridors, allowing for regular gene flow (Chapter 4). However, to further facilitate migration between Nalacapa and Buenaventura, the amount of forested habitat should be increased, especially in the areas identified as least-cost paths (Figure 18, blue) in northern part of Nalacapa.
94
Chapter 7 The ecological corridor
– Recommendation 3 (Nalacapa): Most of the forests are compact. Nevertheless, the fragments in the northern part of the site are more loosely shaped (Figure 18). There, on abandoned pastures around several fragments, natural regeneration and regrowth of trees have already started. Still, closing un-forested gaps within the forest fragments should be of high priority, as this reduces the amount of edge-affects forests and at the same time largely increases habitat availability.
Recommendation 4 (Nalacapa): Increasing the amount of forests in larger elevations is not possible in this site. The highest elevations (1500 m) are forested; instead, the focus should lie on maintaining forest quantity, while further improving quality.
SAMBOTAMBO
The area of Sambotambo is of fundamental importance for the ecological corridor, as this site acts as a connection between the southern populations of Ecuadorian Tapaculos and El Oro Parakeets in Buenaventura and Nalacapa and the northern populations in Cerro Azul and the northern part of the corridor. Moreover, it is the highest site within the study area and, therefore, in view of the ongoing upslope range shifts might become important as a refuge for Ecuadorian Tapaculos and El Oro Parakeets. Yet, deforestation there is highest in the study area, especially directly adjacent to the reserve (Figure 16, Figure 19). Large parts of Sambotambo are currently used as cattle pastures. Even though there is occasional migration of El Oro Parakeets across Sambotambo, the birds are rarely observed there. Territories of Ecuadorian Tapaculos can only be found in the northern part of the site.
The implementation of my recommendations can be done as follows:
Recommendation 1 (Sambotambo): All forests of Sambotambo are only of intermediate quality and do not yield large populations of Ecuadorian Tapaculos. Therefore, habitat quality should be improved before choosing specific fragments for protection.
Recommendation 2 (Sambotambo): Considering the high level of fragmentation in the area, reforestation to increase forest quantity and quality will likely be a challenging task. To restore connectivity to the Buenaventura reserve, a distance of around 3 km of open habitat needs to be reforested (Figure 19). Given that this area is used as cow pastures, the establishment of fully forested corridors seems implausible. Instead, conservation actions should focus on establishing small forested patches that 95
Chapter 7 The ecological corridor
– can serve as stepping stones for migration, following the least-cost paths between Buenaventura and the forests in the north of Sambotambo (Figure 19, blue).
Recommendation 3 (Sambotambo): The forests of Sambotambo are scattered and less compact, with areas of open habitat of up to 500 m in diameter within forest fragments. Therefore, it should be a priority to reduce these un-forested gaps or even close them.
Recommendation 4 (Sambotambo): The eastern part of Sambotambo reaches elevations of up to 1900 m and is thus of high importance as future habitat for El Oro Parakeets. Given that the area covered by forests in elevations over 1400 m is small, reforestation programs should principally be carried out there, starting as soon as possible in order to provide forested habitat in a few decades, when these zones could be colonized by the El Oro Parakeets.
Figure 19: Corridor model for the Sambotambo site. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests.
96
Chapter 7 The ecological corridor
– CERRO AZUL
Cerro Azul consists of several large forest patches and only few smaller fragments. Ecuadorian Tapaculos and El Oro Parakeets are regularly observed there. However, a large part of the zone is used for agriculture, separating the forests by gaps of several hundreds of meters of open habitat (Figure 20). Especially in the higher elevations (over 1300 m), deforestation is intense. Nevertheless, high mountains on the eastern side of Cerro Azul make upslope range shifts possible. Additionally, Cerro Azul offers a high degree of connectivity to the northern part of the ecological corridor. Thus, the site is of high importance for conservation.
Figure 20: Corridor model for the Cerro Azul site. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests.
In Cerro Azul, my recommendations can be implemented as follows:
Recommendation 1 (Cerro Azul): The forest fragments in the southern and eastern parts are occupied by territories of the Ecuadorian Tapaculo. Notably, the highest habitat quality is found in smaller fragments (Figure 20, red). These forests should be prioritized for protection.
97
Chapter 7 The ecological corridor
– Recommendation 2 (Cerro Azul): As forests are separated by large pastures, considerable effort has to be made in order to restore connectivity. Even though in the northwestern part of Cerro Azul, the forests are better connected, the elevation of this part is lowest and thus of less priority for the ecological corridor. Therefore, reforestation should be targeted at the central and eastern parts of Cerro Azul following the least-cost paths, in order to ensure long-term functioning of the ecological corridor in the face of upslope range shifts.
Recommendation 3 (Cerro Azul): Overall, the forests in Cerro Azul have compact shapes. Nevertheless, for the fragments in the southeastern part, reforestation measures close to the forest edges could largely decrease the amount of edge-affected habitat and lead to a more compact shape.
Recommendation 4 (Cerro Azul): The highest elevation zones in the southeastern part of Cerro Azul are largely deforested. This area should be prioritized for reforestation (see Recommendation 3).
PUTTING THE RECOMMENDATIONS INTO PRACTICE
Throughout the proposed ecological corridor, almost none of the original primary forests remain. Instead, the area consists of a mosaic of patchily distributed secondary forest fragments, separated by large spaces of open habitat. Thus, the functioning of the ecological corridor strongly depends on the increase of forested habitat. This can be achieved in two ways, which I already touched briefly in the above recommendations: natural regeneration of forests, and reforestation of native trees. By natural regeneration, secondary stands can grow within several decades into high-quality forests that structurally resemble primary forests (Aide et al. 2000). Alternatively, by the implementation of reforestation measures, the process of forest recovery can be sped up considerably (Aide et al. 2000, DeWalt et al. 2003). In the Buenaventura reserve, reforesting former cattle pastures takes about one decade (R. Rivas, personal communication). Even though active reforestation is much more expensive in terms of time, energy and money than natural regeneration of forests, it is highly recommendable to start reforestation programs soon, especially in the higher elevations of the ecological corridor. In course of climate change, El Oro Parakeets and Ecuadorian Tapaculos are expected to shift their ranges further uphill within the next decades; thus it is necessary to already now initiate forest recovery in these zones in order to provide the species with habitat. The recommendations in the above text can hopefully contribute to electing specific locations for reforestation measures. 98
Chapter 7 The ecological corridor
– Reforesting the least-cost paths requires a detailed a priori cost-benefit analysis, as each linkage is subject to different local conditions, depending on the length of open habitat that need to be reforested and the use of the land on both sides of the proposed linkage. The creation of a dispersal corridor of closed-canopy forests of several hundred meters width has the advantage that it would provide at the same time habitat and connectivity for cloud forest species. Yet, the practical implementation of reforesting a closed-canopy corridor is most likely in many cases not feasible, as it would require the creation of vast tree plantations on agricultural land. A viable alternative which could be implemented on a shorter timescale is the creation of live fences or tree rows along the borders of cattle pastures. This type of corridor proved beneficial for a variety of tropical species of different taxa (Chacón León and Harvey 2006). Even though live fences most probably cannot provide for habitat in the same extent as a closed-canopy corridor, in the case of the ecological corridor Pagua - Cerro Azul - Buenaventura - Puyango they could represent a highly acceptable trade-off between costs and benefits. Therefore, I recommend the priority creation of live fences as dispersal corridors, as they might greatly enhance animal movements across the area of the ecological corridor within a very short time.
Within my study area, only one major asphalt road is intersecting the landscape: the highway E585 which runs through the Buenaventura reserve (Figure 17). Roads represent a strong barrier to dispersal for tropical forest species (Laurance et al. 2009). To facilitate movement in the area of the ecological corridor, it is of high importance to reduce the barrier effect of the highway. Maintaining a closed canopy over the road by promoting tree growth along the road edges is beneficial for animal road-crossing; yet the E585 highway is too wide. Therefore, the construction of crossing structures facilitating animal movement across the road can be a powerful tool to enhance connectivity within the reserve. Wildlife overpasses have been shown to maintain connectivity between populations isolated by roads (Corlatti et al. 2009). For mammals, amphibians, reptiles, or understory birds like Tapaculos, road crossing could potentially be facilitated by a vegetated bridge overpass, while canopy rope bridges could be sufficient for monkeys and other arboreal mammals. However, the possible construction of an overpass crossing the E585 highway will largely depend on the Ministry of Transportation of the El Oro province.
The establishment of the ecological corridor will predominantly affect land which is privately owned and managed. Thus, the project and the realization of reforestation strongly depend on the cooperation of the local communities and landowners. In order to implement conservation measures on their land, landowners will have to forgo alternative use of their land, e.g. for agriculture or timber production, which may represent severe financial losses to the local population. To enhance the 99
Chapter 7 The ecological corridor
– willingness of landowners to participate in conservation measures and stop altering the original vegetation in favor of the ecological corridor, incentives should be greater than potential financial loss (Langpap 2006, Sorice et al. 2011). A possibility of engaging landowners in conservation is the SocioBosque scheme (De Koning et al. 2011): SocioBosque is a governmental program where landowners willing to protect the forests in their land receive a direct monetary incentive per hectare of forest. This conservation agreement is sealed on a voluntary basis, and the compliance is regularly monitored by government officials.
To gain the support of the local population, it is highly necessary to raise awareness for the project (Moon et al. 2012). Regularly communicating conservation goals, e.g. via environmental education, can generate interest in the protection of endangered species and in the esteem of native biodiversity (Brook et al. 2003, Reyers et al. 2010, Wyner and Desalle 2010). Support and acceptance of local stakeholders is crucial for the functioning of the ecological corridor in the long run and thereby for the survival of many threatened species.
100
Chapter 8 Synthesis
In this study, I gathered data on the effects of changes in land cover and climate on two endangered cloud forest bird species, the Ecuadorian Tapaculo and the El Oro Parakeet. On one hand, these data inform about the biology of two endemic species and their way of coping with anthropogenic global change. On the other hand, the information I collected here offers a scientific basis for the design of an ecological corridor in the Ecuadorian cloud forest, i.e. a network of interconnected reserves that aims to protect the remaining forest patches and restore their interconnectivity. My results suggest that the Ecuadorian Tapaculo strongly requires mature forests and is thus more severely threatened by forest loss than previously assumed (Chapter 3). Nevertheless, the species is able to maintain a relatively high level of genetic diversity and gene flow owing to morphological adaptations to the fragmentation habitat (Chapter 4). The projection of the climate change-related upslope shift in the distribution range of the El Oro Parakeet revealed that both the extent of the range and the availability of suitable habitat will decrease drastically within the next century (Chapter 5). To reduce the risk of extinction of the Ecuadorian Tapaculo and of the El Oro Parakeet, it will be necessary to increase the quantity and quality of forests not only in their current range, but also in areas further uphill, as they might be colonized by the two species in the near future. The development of a framework for the detection of forests with highest habitat quality in the study area, and for the identification of linkages between, them proposes a potential design for the ecological corridor (Chapter 6).
As more and more tropical forests are logged and converted to agricultural use, the preservation of remaining forest fragments and the restoration of connectivity
101
Chapter 8 - Synthesis between them are increasingly spotlighted by conservationists. Establishing a network of reserves connected by dispersal corridors represents a powerful approach to protect large populations and to maintain gene flow between them (Beier and Noss 1998, Caro et al. 2009, Gilbert-Norton et al. 2010).
In order to identify the most appropriate linkages to promote connectivity between habitat patches, numerous assumptions and decisions need to be made. First, it is necessary to clearly define the patches of habitat to be connected, as well as the focal species for the restoration of connectivity. Second, the effort of movement between habitat patches for the focal species has to be quantified to generate a resistance map across the landscape. Third, the corridor with the lowest movement costs has to be identified. Finally, the design of the ecological corridor has to be adapted to the species-specific ecological requirements and local conditions (Beier et al. 2008). These assumptions and decisions require knowledge of the basic ecology of the focal species and the state and configuration of the habitat in the study site. With detailed information on these parameters, the design of the linkage is more likely to ensure functional connectivity for the focal species (Beier et al. 2008, 2011). In the following, I would like to demonstrate how my results address the aforementioned assumptions and decisions for the creation of the ecological corridor Pagua - Cerro Azul - Buenaventura - Puyango:
SELECTION OF THE TARGET AREA AND FOCAL SPECIES
Overall, the forests in the area of the proposed ecological corridor are in a poor state, as deforestation and forest degradation have left only small forest patches and mostly young secondary stands (Chapter 3, Chapter 6). For the design of a network of protected areas in a fragmented landscape, the core areas of the network should consist of high-quality habitat beneficial for maintaining the size and viability of populations (Hodgson et al. 2009, 2011). Animal movement is favored when the habitat is perceived as suitable by the target species (Chetkiewicz et al. 2006, Caro et al. 2009). Yet, the degradation and conversion of tropical forests has dramatically decreased the extent of the highest-quality primary forests and the biodiversity sustained therein (Gibson et al. 2011). Nevertheless, high densities of territories of the Ecuadorian Tapaculo were found in secondary forests (Chapter 3), proving their value for the conservation of endangered species (Turner and Corlett 1996, Gascon et al. 1999, Chazdon et al. 2009). As such, even small, remote forest remnants can serve as valuable habitat patches and anchor points for the restoration of connectivity. Thus, identifying secondary forests with high conservation value to form the core 102
Chapter 8 - Synthesis areas of a reserve network supports the spatial delimitation of the corridor linkages (Chapter 6).
Using several carefully selected focal species for conservation planning greatly contributes to covering the needs of a large part of the ecosystem. If each species has strong demands for a certain landscape parameter, e.g. high connectivity between habitat patches, and thus specifies the minimum acceptable value for this parameter, the combination of several focal species can set the minimum requirements for a variety of spatial and compositional attributes of a landscape (Lambeck 1997). Consequently, the protection of the focal species extends to a variety of ecologically similar species, as well as to species with less strong requirements (Berger 1997, . The Ecuadorian Tapaculo can be considered an appropriate focal species for the assessment of habitat quality and connectivity in the Caro and O Doherty 1999) corridor area (Chapter 3, Chapter 4), while the El Oro Parakeet serves as a focal species for the quantification of habitat availability in the future (Chapter 5). Therefore, an ecological corridor designed for the Ecuadorian Tapaculo and El Oro Parakeet combined places special emphasis at ensuring a high level of connectivity between forest patches and at providing high-quality habitat on the long-term, accounting for climate change-related range shifts. Conservation measures targeted at these two species will likewise meet the needs of many species of the Tumbes- Chocó-Magdalena hotspot and protect them as well.
QUANTIFICATION OF MOVEMENT COSTS
Modelling a dispersal corridor with the lowest possible movement costs requires detailed information about the behavior and the dispersal abilities of one or multiple focal species. Functional connectivity between patches does not only depend on the configuration of the landscape, but also on the dispersal abilities of the species (Tischendorf and Fahrig 2000, Adriaensen et al. 2003, Driezen et al. 2007, Sawyer et al. 2011). Defining the resistance of a landscape as a suite of continuous variables (e.g. the quality of the microhabitat and the elevation) as well as of categorical variables (e.g. whether or not a patch can be reached by the focal species) (Chapter 6) helps identifying the least-cost path for the target species (Adriaensen et al. 2003, Parks et al. 2013). To generate a network of protected areas for several focal species, it is recommendable to produce separate maps for each species in order to prevent existing linkages from becoming masked by higher resistance values for other species (Beier et al. 2008). Ecuadorian Tapaculos and El Oro Parakeets are both forest- dependent, but display large differences in their dispersal abilities. Mapping the 103
Chapter 8 - Synthesis connectivity for both species revealed that in some cases they share the same linkages, while in other cases the least-cost paths of the two species are separated (Chapter 6). Ideally, a dispersal corridor valuable for both species should aim at restoring connectivity not only following the shared linkages, but also in the areas specified for each focal species separately.
INDENTIFICATION OF DISPERSAL CORRIDORS
Even though the main purpose of a corridor is to enable movement between forest patches, the increase in forested area within the linkages can also provide for habitat for a variety of species like insects, amphibians or understory birds. Ecuadorian Tapaculos established territories in small forest patches between bigger fragments (Chapter 4 (Beier and Loe 1992). A corridor for corridor dwellers should be wider than the minimum territory ); therefore, they can be considered a corridor dweller width in order to avoid territorial behavior to constitute a barrier to movement (Horskins et al. 2006, Beier et al. 2008). So, a corridor providing for dispersal and habitat for the Ecuadorian Tapaculo should at least be 30 m in width and consist of closed-canopy forest in a later successional stage (Chapter 3). El Oro Parakeets,
(Beier and Loe 1992); thus, scattered trees on open pastures or tree rows following however, most likely are passage species which use a corridor mainly for dispersal pasture edges can serve as stepping stones and already provide for sufficient connectivity for El Oro Parakeets. Consequently, the design of a linkage can vary depending on the dispersal abilities and the territorial behavior of the species that is mainly using it.
ADAPTATION OF THE CORRIDOR DESIGN
Any reserve network needs to proactively account for climate change impacts on its biodiversity; otherwise species might be driven out of the protected areas or even become locally extinct (Araujo et al. 2004). Both Ecuadorian Tapaculos and El Oro Parakeets seem to have undergone an upslope range shift in the past, which is expected to go on in the future (Chapter 3, Chapter 5). Most likely, other cloud forest species sharing the same habitat are also subject to climate change-induced range shifts. As an upslope range shift is not only accompanied by a decrease in range size, but also by a drastic loss in forest availability (Chapter 5), it is crucial to take the projected future range into consideration for conservation planning. Although several 104
Chapter 8 - Synthesis studies have already addressed the challenges of designing a protected area network robust to climate change, the probability of long-term functioning of the respective corridors remained largely site- and species-specific (Williams et al. 2005, Seo et al. 2009). The framework for identifying high-quality habitat and linkages developed in Chapter 6 here prioritizes areas for protecting cloud forest species on the long-term, accounting for climate change effects. Therefore, it can help taking informed decisions for sustainable conservation planning in tropical regions. Overall, this thesis shows that Ecuadorian Tapaculos and El Oro Parakeets can be considered valuable focal species for conservation planning and the design of the ecological corridor. In order to meet the requirements of the two species, the ecological corridor should integrate well-connected patches of mature forests and span a large altitudinal gradient to account for future range shifts. If Ecuadorian Tapaculos and El Oro Parakeets are successfully protected, a large part of the unique biodiversity of the cloud forests of southwestern Ecuador will be protected as well.
105
Chapter 8 - Synthesis
106
Chapter 9 Summary
In premontane cloud forests of the tropical Andes, many species are facing extinction due to the loss and fragmentation of forested habitat. Logging and degradation of cloud forests decrease the population size of forest-dependent species, as well as the connectivity between populations. Moreover, climate change causes species to shift their distribution ranges uphill, leading to a further decrease in habitat and connectivity. Inevitably, the survival of small, isolated populations is threatened by stochastic events like environmental catastrophes and by declines in gene flow and genetic diversity. To ensure the long-term survival of tropical cloud forest species, extensive conservation measures are needed, aiming at the preservation of forests and the restoration of connectivity between them. One approach to conserve the biodiversity is the establishment of ecological corridors to enable or facilitate movement and gene flow between populations in disconnected forest fragments.
The aim of my thesis is to provide a scientific basis for the creation of an ecological corridor in the premontane cloud forests of southwestern Ecuador. This region is considered a biodiversity hotspot harboring a high number of endemic species, which are heavily threatened by habitat loss. Thus, the main purpose of the ecological corridor is to protect and restore the habitat and connectivity for cloud forest species.
The development of sound conservation measures demands detailed information about the population size and habitat requirements of the species concerned. Yet, within the area of the ecological corridor, many species until now remain almost unknown to science. Among these species is the Ecuadorian Tapaculo (Scytalopus robbinsi), an endemic understory bird which is feared to decline rapidly due to forest loss. So far, this species has not been studied intensively. Therefore, I assessed the 107
Chapter 9 - Summary habitat requirements of the Ecuadorian Tapaculos by investigating the microhabitat structure within their territories as well as the configuration of the forests in the landscape. I found that the species only occurred in older secondary forests with good connectivity to other forest patches. Importantly, the species seems to have shifted its distribution range 200 m uphill since its discovery in 1990. This upslope shift is likely a consequence of temperature increase throughout the distribution range. Extrapolating the number of territories discovered in the study area to the entire distribution range amounted to a global population size of 1900 to 4600 mature individuals. This number is much lower than the estimate by IUCN of up to 10,000 individuals, indicating that the Ecuadorian Tapaculo is more severely threatened than previously assumed. Considering the high diversity of species sharing the same habitat as the Ecuadorian Tapaculo, it is likely that many other species are likewise declining more rapidly than feared. This underlines the urgent need for conservation measures in the area (Chapter 3).
To design an ecological corridor, it is important to identify landscape features acting as barriers to dispersal for cloud forest species. A reduced migration rate between disjunct populations can lead to significant genetic population structuring and, in case of divergent natural selection in different forest patches, to morphological divergence. The Ecuadorian Tapaculo has limited dispersal abilities and only reluctantly crosses areas of open habitat between forest patches. Nevertheless, forest fragmentation throughout the study area did not cause genetic structuring, while the genetic diversity in the species was relatively high. Migration between different forest patches was not impeded by landscape barriers. Instead, I found isolation by distance between different individuals, which can be a consequence of the overall low dispersal abilities of the species. Nevertheless, the Ecuadorian Tapaculo showed adaptations of the wing morphology to the level of forest fragmentation. In small forest fragments, individuals had pointier wings, which increase mobility and flight capacity. The morphological variability of the species can possibly mitigate the risk of local extinctions due fragmentation and loss of forests (Chapter 4).
Anthropogenic climate change is altering the distribution ranges of cloud forest species. Thus, it is necessary that the ecological corridor proactively accounts for climate change-related range shifts in the future, in order to ensure the effective protection of threatened species on the long-term. To make informed decisions about the design of the ecological corridor, it is crucial to assess the future shifts in the distribution ranges of cloud forest species and the related changes in habitat availability. To this end, I quantified the effects of climate change on the availability of habitat for an endemic bird species of the Ecuadorian cloud forests, the endangered El Oro Parakeet (Pyrrhura orcesi). Until the end of the 21st century, the El Oro 108
Chapter 9 - Summary
Parakeets will shift their range between 100 and 600 m further upslope. While the range size will decrease by up to 70 % as a consequence of the shift, the area covered by forest shrinks by even 80 % of the current extent. Additionally, the range shift will contribute to disrupting linkages between populations of the El Oro Parakeet in different areas. The investigation of habitat availability in areas that will likely be invaded by the species in the near future is of high importance for targeting conservation measures, as the restoration of forested habitat and connectivity in these areas should already now be initiated (Chapter 5).
Considering the high degree of forest loss in southwestern Ecuador, the creation of the ecological corridor requires hands-on reforestation actions in order to restore connectivity between forest fragments. A framework for the identification of forests with high quality as habitat for both Ecuadorian Tapaculos and El Oro Parakeets prioritized areas with high conservation value on the long-term. These forests represent valuable core areas for the ecological corridor. Moreover, a least-cost path analysis pinpointed the optimal dispersal corridors between the core areas identified before. The implementation of reforestation programs following these corridors could ensure functional connectivity not only for Ecuadorian Tapaculos and El Oro Parakeets, but also for many other species, and thus contribute to preserving the biodiversity of the Andean cloud forests (Chapter 6).
This thesis shows how basic research on the ecology of threatened species can be translated into scientifically sound recommendations for conservation measures. Investigating changes in the population size, genetic diversity and distribution range helps understanding the effects of habitat loss and climate change on a species and thus represents the first step for the development of practical conservation actions. Thus, this thesis can be seen as a contribution to preserving the global biodiversity, especially the unique species communities of the Ecuadorian cloud forests.
109
Chapter 9 - Summary
110
Chapter 10 Zusammenfassung
Die fortschreitende Abholzung und Fragmentierung der tropischen Nebelwälder am Fuße der Anden hat viele Tier- und Pflanzenarten an den Rand des Aussterbens gebracht. Sowohl die Populationsgröße der vom Wald abhängigen Arten als auch die Konnektivität zwischen Populationen ist durch die Abholzung gesunken. Eine weitere Bedrohung für die Artengemeinschaft stellt der Klimawandel dar, da viele Arten aufgrund von steigenden Temperaturen ihr Verbreitungsgebiet hangaufwärts verschieben. Dies kann zu einem weiteren Verlust an Habitat und Konnektivität führen. Die Überlebensfähigkeit von kleinen, voneinander isolierten Populationen ist jedoch durch Zufallsereignisse wie Naturkatastrophen sowie durch einen Rückgang von Genfluss und genetischer Diversität stark eingeschränkt. Um das Überleben der Artengemeinschaft in tropischen Nebelwäldern sicherzustellen, sind weitreichende Naturschutzmaßnahmen erforderlich, die die Erhaltung der Wälder und die Wiederherstellung der Konnektivität zwischen Waldfragmenten zum Ziel haben. Eine wichtige Schutzmaßnahme ist der Aufbau eines ökologischen Korridors, der die Wanderungen und damit den Genfluss zwischen Populationen in verschiedenen Waldfragmenten fördert.
Ziel dieser Arbeit ist es, eine wissenschaftliche Grundlage für die Einrichtung eines ökologischen Korridors in den Nebelwäldern von Südwest-Ecuador zu schaffen. In dieser Region kommt eine Vielzahl endemischer Arten vor, die durch Habitatverlust stark bedroht sind. Der Korridor soll daher die übrigen Waldfragmente und die Konnektivität dazwischen schützen.
Zur Entwicklung effektiver Naturschutzmaßnahmen sind detaillierte Informationen zu Populationsgröße und Habitatansprüchen der betroffenen Arten erforderlich. 111
Chapter 10 - Zusammenfassung
Allerdings sind im Gebiet des geplanten Korridors noch viele Arten weitgehend unerforscht. Ein Beispiel dafür ist der endemische Robbinstapaculo (Scytalopus robbinsi), der im Unterholz der Nebelwälder vorkommt und vermutlich durch Waldverlust stark bedroht ist. Da über diese Art bisher nur wenig bekannt ist, wurden hier die Habitatansprüche des Robbinstapaculos untersucht. Dies ergab, dass die Art nur in älteren Sekundärwäldern mit guter Konnektivität zu anderen Waldfragmenten vorkommt. Seit der Entdeckung der Art im Jahr 1990 hat sich ihr Verbreitungsgebiet um etwa 200 m hangaufwärts verschoben, was vermutlich auf einen Temperaturanstieg im Zuge des Klimawandels zurückzuführen ist. Die Hochrechnung der Populationsgröße auf das gesamte Verbreitungsgebiet ergab, dass nur noch zwischen 1900 und 4600 Individuen existieren, wesentlich weniger als die von der IUCN geschätzten 10.000 Individuen. Angesichts der hohen Biodiversität im Verbreitungsgebiet des Robbinstapaculos ist es möglich, dass noch weitere Arten in ähnlichem Maße zurückgehen. Daher sind in diesem Gebiet weitreichende Schutzmaßnahmen dringend erforderlich (Kapitel 3).
Die Identifikation von Landschaftselementen, die als Ausbreitungsbarriere wirken können, ist für den Entwurf eines Korridors entscheidend. Der Rückgang der Migrationsraten zwischen isolierten Populationen kann eine genetische Strukturierung zur Folge haben, sowie im Falle unterschiedlicher Selektionsdrücke in verschiedenen Waldfragmenten zu morphologischer Divergenz führen. Obwohl der Robbinstapaculo nur geringe Ausbreitungsfähigkeiten besitzt, hat die Fragmentierung der Wälder im Untersuchungsgebiet bisher nicht zu einer genetischen Strukturierung oder einem Verlust an genetischer Diversität geführt. Die verschiedenen Individuen waren nur aufgrund ihrer geografischen Distanz, nicht aber durch Ausbreitungsbarrieren isoliert. Dennoch zeigten die Robbinstapaculos morphologische Anpassungen der Flügelform an den Grad der Waldfragmentierung. Individuen in kleineren Wäldern hatten spitzere Flügel, was sich positiv auf das Flugvermögen auswirkt. Die morphologische Variabilität der Art kann möglicherweise ihr Aussterberisiko mindern (Kapitel 4).
Die Verbreitungsgebiete der in ecuadorianischen Nebelwäldern heimischen Arten werden durch den Klimawandel verschoben. Daher ist es unerlässlich, bei der Planung des Korridors auch zukünftige Änderungen in den Verbreitungsgebieten zu berücksichtigt, da nur so ein effektiver Artenschutz auf längere Sicht gewährleistet werden kann. Um fundierte Entscheidungen über die genaue Lage des Korridors zu treffen, müssen zunächst die zu erwartenden Veränderungen in den Verbreitungsgebieten der Arten beurteilt werden. In einem Modell wurden daher die zukünftigen Auswirkungen des Klimawandels auf Verbreitungsgebiet und Habitatverfügbarkeit für den Orcessittich (Pyrrhura orcesi), eine weitere bedrohte 112
Chapter 10 - Zusammenfassung
Vogelart aus den Nebelwäldern Südwest-Ecuadors, quantifiziert. Bis zum Jahre 2100 wird sich das Verbreitungsgebiet des Orcessittichs voraussichtlich zwischen 100 und 600 m hangaufwärts verschieben. Damit einhergehend verkleinert sich das Verbreitungsgebiet um bis zu 70 %, während die bewaldete Fläche sogar um 80 % zurückgeht. Zudem unterbricht die Verschiebung des Verbreitungsgebiets die Konnektivität zwischen verschiedenen Populationen. Die Untersuchung der Habitatverfügbarkeit in Gebieten, in die der Orcessittich voraussichtlich in naher Zukunft einwandert, ist für die Planung von Wiederaufforstungsmaßnahmen von großer Wichtigkeit, da diese Maßnahmen so bald wie möglich umgesetzt werden sollten (Kapitel 5).
Angesichts der hohen Entwaldungsrate in Ecuador sind für die Einrichtung des Korridors praktische Maßnahmen zur Vergrößerung der Waldfläche und Verbesserung der Konnektivität nötig. Anhand eines Leitfadens zur Identifizierung von Wäldern, die hochwertiges Habitat für Robbinstapaculos und Orcessittiche bieten, konnten Gebiete mit langfristig hohem Erhaltungswert identifiziert werden. Diese Wälder stellen wertvolle Kernzonen für den Korridor dar. Des Weiteren konnten in einer Analyse der kostenggünstigsten Pfade die geeignetsten Ausbreitungskorridore zwischen diesen Kernzonen festgelegt werden. Durch Wiederaufforstungsprogramme entlang dieser Ausbreitungskorridore könnte die Konnektivität für Robbinstapaculos und Orcessittiche sowie zusätzlich für viele weitere Arten verbessert werden. Dies würde einen bedeutenden Beitrag zum Schutz der Biodiversität in den Nebelwäldern am Westhang der Anden leisten (Kapitel 6).
Diese Arbeit gibt ein Beispiel, wie Grundlagenforschung zur Ökologie bedrohter Arten zu Empfehlungen für wissenschaftlich fundierte Naturschutzmaßnahmen führen kann. Die Auswirkungen von Habitatverlust und Klimawandel werden durch Untersuchung der Änderungen in Populationsgröße, genetischer Diversität sowie im Verbreitungsgebiet einer Art verdeutlicht, was einen ersten Schritt zur Entwicklung praktischer Naturschutzmaßnahmen darstellt. Daher kann diese Arbeit als ein Beitrag zum Schutz der Biodiversität, im Besonderen der einzigartigen Artengemeinschaft der ecuadorianischen Nebelwälder, verstanden werden.
113
Chapter 10 - Zusammenfassung
114
Chapter 11 Acknowledgements
I would never have been able to complete this thesis without the support of many people involved in the project.
First of all, I would like to thank my supervisors Prof. Gernot Segelbacher and Dr. Martin Schaefer for their professional advice and guidance during the last three years. Thank you for giving me the chance to work in the best project ever, at the interface between research and conservation. And, after all, thank you for refusing to believe that the Tapaculos might have gone extinct!
I thank Prof. Jürgen Bauhus for kindly agreeing to be the second reviewer of my thesis.
Many thanks to Prof. Klaus Keller, Dr. Rob Nicholas and Kelsey Ruckert for their admirable patience in introducing me to the principles of climate modelling and robust decision making. I learned a lot!
Furthermore, I would like to thank the best field assistants of all times: Jeroen Jansen, Annika Döpper, Arne Pinnschmidt and Hannes Kampf. Thank you for your contributions, your creativity, your persistence, tolerance, patience and encouragement and of course for the good time in rainy Buenaventura! greatest!! – You’re the
115
Chapter 11 - Acknowledgements
I thank the Fundación Jocotoco for the permission to carry out my study in one of their reserves, and for logistic support during my altogether 15 months in Buenaventura. Especially, I would like to thank Leodan Aguilar and Leovigildo Cabrera for their assistance in field work and in repairing the car, Diana Lojan for the washing machine, and René Rivas for explaining how reforestation works. Moreover, I thank César Garzón for his assistance in obtaining the research permits.
Many thanks go to the members of the Chair of Wildlife Ecology and Management. Thank you for the great time, for your assistance and support, and for spontaneous corrections of my chapters! In particular, I thank Li Li, Marlotte Jonker, Fanny Betge, Farina Sooth, Luca Corlatti, Ralph Martin, Nathalie Keller, Geva Peerenboom and Lino Kämmerle. Not to forget Tammy and Urs! In various ways, all of you contributed to my thesis. Thanks a lot!
Last but not least I would like to thank Valentina Vitali and Stefanie Hartmann for many small but significant contributions to my project.
116
Chapter 12 Bibliography
Adriaensen F, Chardon JP, De Blust G, Swinnen E, Villalba S, Gulinck H, Matthysen E (2003): - model. Landscape and Urban Planning 64: 233-247 The application of least cost modelling as a functional landscape Aide TM, Zimmerman JK, Herrera L, Rosario M, Serrano M (1995): Forest recovery in abandoned tropical pastures in Puerto Rico. Forest Ecology and Management 77: 77-86 Aide TM, Zimmerman JK, Pascarella JB, Rivera L, Marcano-Vega H (2000): Forest regeneration in a chronosequence of tropical abandoned pastures: Implications for restoration ecology. Restoration Ecology 8: 328-338 Akcakaya HR, Butchart SHM, Mace GM, Stuart S, Hilton-Taylor C (2006): Use and misuse of the IUCN Red List criteria in projecting climate change impacts on biodiversity. Global Change Biology 12: 2037 2043 Amico GC, Garcia D, Rodriguez-Cabal MA (2008): Spatial structure and scale- – dependen temperate forest of southern South America. Ecología Austral 18: 169-180 t microhabitat use of endemic Tapaculos Rhinocryptidae in a Araujo MB, Cabeza M, Thuiller W, Hannah L, Williams PH (2004): Would climate change drive species out of reserves? An assessment of existing reserve- selection methods. Global Change Biology 10: 1618-1626 Barnett JR, Ruiz-Gutierrez V, Coulon A, Lovette IJ (2008): Weak genetic structuring White-ruffed Manakin (Corapipo altera) populations in a highly fragmented Costa Rica landscape. Conservation Genetics indicates ongoing gene flow across 9: 1403 1412 Beaumont MA (1999): Detecting population expansion and decline using – microsatellites. Genetics 153: 2013-2029 117
Chapter 12 - Bibliography
Beier P, Loe S (1992): In my experience: A checklist for evaluating impacts to wildlife movement corridors. Wildlife Society Bulletin 20: 434-440 Beier P, Majka DR, Spencer WD (2008): Forks in the road: Choices in procedures for designing wildland linkages. Conservation Biology 22: 836-851 Beier P, Noss RF (1998): Do habitat corridors provide connectivity? Conservation Biology 12: 1243-1252 Beier P, Spencer W, Baldwin RF, McRae BH (2011): Toward best practice for developing regional connectivity maps. Conservation Biology 25: 879-892 Beissinger SR, Wunderle JM, Meyers JM, Saether BE, Engen S (2008): Anatomy of a bottleneck: Diagnosing factors limiting population growth in the Puerto Rican Parrot. Ecological Monographs 78: 185-203 Berger J (1997): Population constraints associated with the use of Black Rhinos as an umbrella species for desert herbivores. Conservation Biology 11: 67-78 Best BJ, Kessler M (1995): Biodiversity and conservation in Tumbesian Ecuador and Peru. BirdLife International, Cambridge, United Kingdom Bird JP, Buchanan GM, Lees AC, Clay RP, Develey PF, Yépez I, Butchart SHM (2012): Integrating spatially explicit habitat projections into extinction risk assessments: A reassessment of Amazonian avifauna incorporating projected deforestation. Diversity and Distributions 18: 273 281 BirdLife International (2016): IUCN Red List for birds. www.birdlife.org. – Boag PT, van Noordwijk AJ (1987): Quantitative genetics. In: Cooke F, Buckley PA (eds.) Avian genetics: A population and ecological approach. Academic Press, London, United Kingdom Bornschein MR, Nachtigall MG, Belmonte-Lopes R, Mata H, Bonatto SL (2007): Diamantina Tapaculo, a new Scytalopus endemic to the Chapada Diamantina, northeastern Brazil (Passeriformes: Rhinocryptidae). Revista Brasileira de Ornitologia 15: 151-174 Breshears DD, Huxman TE, Adams HD, Zou CB, Davison JE (2008): Vegetation synchronously leans upslops as climate warms. PNAS 105: 11591-11592
species act listing and implications for encouraging conservation. Conservation Brook A, Zint M, De Young R : Landowner s responses to an endangered Biology 17: 1638-1649 Brook BW, Sodhi NS, Bradshaw CJA (2008): Synergies among extinction drivers under global change. Trends in Ecology and Evolution 23: 453-460 Brooks TM, Mittermeier RA, da Fonseca GAB, Gerlach J, Hoffman M, Lamoreux JF, Mittermeier CG, Pilgrim JD, Rodrigues ASL (2006): Global biodiversity conservation priorities. Science 313: 58 61
–
118
Chapter 12 - Bibliography
Brooks TM, Mittermeier RA, Mittermeier CG, Da Fonseca GAB, Rylands AB, Konstant WR, Flick P, Pilgrim J, Oldfield S, Magin G, Hilton-Taylor C (2002): Habitat loss and extinction in the hotspots of biodiversity. Conservation Biology 16: 909- 923 Burkey TV (1999): Extinction in fragmented habitats predicted from stochastic birth- death processes with density dependence. Journal of Theoretical Biology 199: 395-406 Burrows MT, Schoeman DS, Buckley LB, Moore P, Poloczanska ES, Brander KM, Brown C, Bruno JF, Duarte CM, Halpern BS, Holding J, Kappel CV, Kiessling W, O'Connor MI, Pandolfi JM, Parmesan C, Schwing FB, Sydeman WJ, Richardson AJ (2011): The pace of shifting climate in marine and terrestrial ecosystems. Science 334: 652 655 Butchart SHM, Walpole M, Collen B, van Strien A, Scharlemann JPW, Almond REA, – Baillie JEM, Bomhard B, Brown C, Bruno J, Carpenter KE, Carr GM, Chanson J, Chenery AM, Csirke J, Davidson NC, Dentener F, Foster M, Galli A, Galloway JN, Genovesi P, Gregory RD, Hockings M, Kapos V, Lamarque JF, Leverington F, Loh J, McGeoch MA, McRae L, Minasyan A, Hernández Morcillo M, Oldfield TEE, Pauly D, Quader S, Revenga C, Sauer JR, Skolnik B, Spear D, Stanwell-Smith D, Stuart SN, Symes A, Tierney M, Tyrrell TD, Vié JC, Watson R (2010): Global biodiversity: Indicators of recent decline. Science 328: 1164-1168 Callens T, Galbusera P, Matthysen E, Durand EY, Githiru M, Huyghe JR, Lens L (2011): Genetic signature of population fragmentation varies with mobility in seven bird species of a fragmented Kenyan cloud forest. Molecular Ecology 20: 1829- 2844 Caro T, Jones T, Davenport TRB (2009): Realities of documenting wildlife corridors in tropical countries. Biological Conservation 142: 2807-2811
Conservation Biology 13: 805-814 Caro T, O Doherty G 999 : On the use of surrogate species in conservation biology. Carroll SP, Hendry AP, Reznich DN, Fox CW (2007): Evolution on ecological time- scales. Functional Ecology 21: 387-393 Castellón TD, Sieving KE (2006): An experimental test of matrix permeability and corridor use by an endemic understory bird. Conservation Biology 20: 135-145 Castellón TD, Sieving KE (2007): Patch network criteria for dispersal-limited endemic birds of South American temperate rain forest. Ecological Applications 17: 2152-2163 Chacón León M, Harvey CA (2006): Live fences and landscape connectivity in a neotropical agricultural landscape. Agroforestry Systems 68: 15-26
119
Chapter 12 - Bibliography
Chavez-Campos J (2004): Elevational movements of large frugivorous birds and temporal variation in abundance of fruits along an elevational gradient. Ornitologia Neotropical 15: 433 445 Chazdon RL (2003): Tropical forest recovery. Legacies of human impact and natural – disturbances. Perspectives in Plant Ecology, Evolution and Systematics 6: 51-71 Chazdon RL, Peres CA, Dent D, Sheil D, Lugo AE, Lamb D, Stork NW, Miller SE (2009): The potential for species conservation in tropical secondary forests. Conservation Biology 23: 1406-1417 Chen IC, Shiu HJ, Benedick S, Holloway JD, Chey VK, Barlow HS, Hill JK, Thomas CD (2009): Elevation increases in moth assemblages over 42 years on a tropical mountain. PNAS 106: 1479 1483 Chetkiewicz CLB, St Clair CC, Boyce MS (2006): Corridors for conservation: – Integrating pattern and process. Annual Review of Ecology, Evolution, and Systematics 37: 317-342 Cincotta RP, Wisnewski J, Engelman R (2000): Human population in the biodiversity hotspots. Nature 404: 990-992 Corlatti L, Hackländer K, Frey-Roos R (2009): Ability of wildlife overpasses to provide connectivity and prevent genetic isolation. Conservation Biology 23: 548-556 Coulon A, Guillot G, Cosson JF, Angibault JMA, Aulagnier S, Cargnelutti B, Galan M, Hewison AJM (2006): Genetic structure is influenced by landscape features: Empirical evidence from a roe deer population. Molecular Ecology 15: 1669- 1679 Crisci JL, Dean MD, Ralph P (2016): Adaptation in isolated populations: When does it happen and when can we tell? Molecular Ecology 25: 3901-3911 Cuervo AM, Cadena CD, Krabbe NK, Renjifo LM (2005): Scytalopus stilesi, a new species of Tapaculo (Rhinocryptidae) from the Cordillera Central of Colombia. The Auk 122: 445-463 Damschen EI, Haddad NM, Orrock JL, Tewksbury JL, Levey DJ (2006): Corridors increase plant species richness at large scales. Science 313: 1284-1286 De Avila AL, Ruschel AR, De Carvalho JOP, Mazzei L, Macedo Silva JN, Lopes JD, Machado Araujo M, Dormann CF, Bauhus J (2015): Medium-term dynamics of tree species composition in response to silvicultural intervention intensities in a tropical rain forest. Biological Conservation 191: 577-586 De Koning M, Aguinaga M, Bravo M, Chiu M, Lascano M, Lozada T, Suarez L (2011): Bridging the gap between forest conservation and poverty alleviation: The Ecuadorian SocioBosque program. Environmental Science and Policy 14: 531- 542
120
Chapter 12 - Bibliography
De León LF, Bermingham E, Podos J, Hendry AP (2010): Divergence with gene flow as facilitated by ecological differences: Within- finches. Philosopohical Transactions of the Royal Society B 365: 1041-1052 island variation in Darwin s De Santo TL, Willson MF, Sieving KE, Armesto JJ (2002): Nesting biology of Tapaculos (Rhinocryptidae) in fragmented south-temperate rainforests of Chile. The Condor 104: 482-495 Desrochers A (2010): Morphologcal response of songbirds to 100 years of landscape change in North America. Ecology 91: 1577-1582 Deutsch CA, Tewksbury JJ, Huey RB, Sheldon KS, Ghalambor CK, Haak DC, Martin PR (2008): Impacts of climate warming on terrestrial ectotherms across latitude. PNAS 105: 6668 6672 DeWalt SJ, Maliakal SK, Denslow JS (2003): Changes in vegetation structure and – composition along a tropical forest chronosequence: Implications for wildlife. Forest Ecology and Management 182: 139 151 Dietrich M (2003): Habitatpräferenz und Raumnutzungsmuster des Orcessittichs in – Südwest-Ecuador. Diploma Thesis. University of Oldenburg, Germany Dixo M, Metzger JP, Morgante JS, Zamudio KR (2009): Habitat fragmentation reduces genetic diversity and connectivity among toad populations in the Brazilian Atlantic Coastal Forest. Biological Conservation 142: 1560-1569 Dodson CG, Gentry AH (1991): Biological extinction in western Ecuador. Annals of the Missouri Botanical Garden 78: 273-295 Donegan TM, Avendaño JE (2008): Notes on Tapaculos (Passeriformes: Rhinocryptidae) of the eastern Andes of Colombia and the Venezuelan Andes, with a new subspecies of Scytalopus griseicollis from Colombia. Ornitología Colombiana 6: 24-65 Driezen K, Adriaensen F, Rondinini C, Doncaster CP, Matthysen E (2007): Evaluating least-cost model predictions with empirical dispersal data. A case-study using radiotraching data of hedgehogs (Erinaceus europaeus). Ecological Modelling 209: 314-322 Duncan RP, Blackburn TM (2004): Extinction and endemism in the New Zealand avifauna. Global Ecology and Biogeography 13: 509-517 Duque A, Stevenson PR, Feeley KJ (2015): Thermophilization of adult and juvenile tree communities in the northern tropical Andes. PNAS 112: 10744 10749 Earl DA, vonHoldt BM (2012): STRUCTURE HARVESTER: A website and program for – visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources 4: 359-361
121
Chapter 12 - Bibliography
Eggers B, Matern A, Drees C, Eggers J, Hardtle W, Assmann T (2010): Value of semi- open corridors for simultaneously connecting open and wooded habitats: A case study with ground beetles. Conservation Biology 24: 256-266 Ellstrand NC, Elam DR (1993): Population genetic consequences of small population size. Implications for plant conservation. Annual Review of Ecology, Evolution, and Systematics 24: 783-791 Epps CW, Palsbøll PJ, Wehausen JD, Roderick GK, Ramey RR, McCullough DR (2005): w and cause a rapid decline in genetic diversity of desert bighorn sheep. Ecology Letters 8: 1029 1038 (ighways block gene flo FAO (2010): Global Forest Resources Assessment. Main Report. FAO Forestry Paper 163. – Food and Agriculture Organization of the United Nations, Rome, Italy Fagan WF, Holmes EE (2006): Quantifying the extinction vortex. Ecology Letters 9: 51 60 Fahrig L (2003): Effects of habitat fragmentation on biodiversity. Annual Review of – Ecology, Evolution, and Systematics 34: 487-515 Faria D, Mariano-Neto E, Zanforlin Martini AM, Ortiz JV, Montingelli R, Rosso S, Barradas Paciencia ML, Baumgarten J (2009): Forest structure in a mosaic of rainforest sites: The effect of fragmentation and recovery after clear cut. Forest Ecology and Management 257: 2226-2234 Feeley KJ, Silman MR, Bush MB, Farfan W, Garcia Cabrera K, Malhi Y, Meir P, Salinas Revilla N, Raurau Quisiyupanqui MN, Saatchi S (2011): Upslope migration of Andean trees. Journal of Biogeography 38: 783-791 Ferraz G, Russell GJ, Stouffer PC, Bierregaard RO, Pimm SL, Lovejoy TE (2003): Rates of species loss from Amazonian forest fragments. PNAS 100: 14069-14073 Fiedler W (2005): Ecomorphology of the external flight apparatus of Blackcaps (Sylvia atricapilla) with different migration behavior. Annals of the New York Academy of Sciences 1046: 253-263 Fischer JS, Stott J, Law BS (2010): The disproportionate value of scattered trees. Biological Conservation 143: 1564-1567 Foster P (2001): The potential negative impacts of global climate change on tropical montane cloud forests. Earth-Science Reviews 55: 73-106 Frankham R, Ballou JD, Briscoe DA (2002): Introduction to conservation genetics. Cambridge University Press, Cambridge, United Kingdom Freeman BG, Class Freeman AM (2014): Rapid upslope shifts in New Guinean birds illustrate strong distributional responses of tropical montane species to global warming. PNAS 111: 4490 4494 Freile JF, Santander T (2005): Áreas importantes para la conservación de las aves en – Ecuador. In: Áreas importantes para la conservación de las aves en los Andes
122
Chapter 12 - Bibliography
tropicales: Sitios prioritarios para la conservación de la biodiversidad. Serie de conservación No. 14. BirdLife International and Conservation International, Quito, Ecuador Fundación Jocotoco (2017): Buenaventura. www.fjocotoco.org/buenaventura3.html. Downloaded 4 January 2017 Galbusera P, Githiru M, Lens L, Matthysen E (2004): Genetic equilibrium despite habitat fragmentation in an Afrotropical bird. Molecular Ecology 13: 1409- 1421 Garant D, Kruuk LEB, Wilkin TA, McCleery RH, Sheldon BC (2005): Evolution driven by differential dispersal within a wild bird population. Nature 433: 60-65 García-Feced C, Saura S, Elena-Rosselló R (2011): Improving landscape connectivity in forest districts. A two-stage process for prioritizing agricultural patches for reforestation. Forest Ecology and Management 261: 154-161 Gascon C, Lovejoy TE, Bierregaard RO, Malcolm JR, Stouffer PC, Vasconcelos HL, Laurance WF, Zimmerman B, Tocher M, Borges S (1999): Matrix habitat and species richness in tropical forest remnants. Biological Conservation 91: 223- 229 Gelman A, Hill J (2007): Data analysis using regression and multilevel/hierarchical models. Cambridge University Press, New York, USA Gentry AH (1992): Tropical forest biodiversity: Distribitional patterns and their conservational significance. Oikos 63: 19-28 Gibson L, Lee RM, Koh LP, Brook BW, Gardner TA, Barlow J, Peres CA, Bradshaw CJA, Laurance WF, Lovejoy TE, Sodhi NS (2011): Primary forests are irreplaceable for sustaining tropical biodiversity. Nature 478: 378-381 Gilbert-Norton L, Wilson R, Stevens JR, Beard KH (2010): A meta-analytic revies of corridor effectiveness. Conservation Biology 24: 660-668 Gillies CS, St Clair CC (2008): Riparian corridors enhance movement of a forest specialist bird in fragmented tropical forest. PNAS 105: 19774-19779 Girod C, Vitalis R, Leblois R, Frécille H (2011): Inferring population decline and expansion from microsatellite data: A simulation-based evaluation of the Msvar method. Genetics 188: 165-179 Goodenough AE, Goodenough AS (2012): Development of a rapid and precise method of digital image analysis to quantify canopy density and structural complexity. ISRN Ecology 2012: 1-11 Gottfried M, Pauli H, Reiter K, Grabherr G (1999): A fine-scale predictive model for changes in species distribution patterns of high mountain plants induced by climate warming. Diversity and Distributions 5: 241-251
123
Chapter 12 - Bibliography
Guariguata MR, Ostertag R (2001): Neotropical secondary forest succession: Changes in structural and functional characteristics. Forest Ecology and Management 148: 185-206 Guariguata MR, Chazdon RL, Denslow JS, Dupuy JM, Anderson L (1997): Structure and -growth forest stands in lowland Costa Rica. Plant Ecology 132: 107 120 floristics of secondary and old Hartmann SA, Schaefer HM, Segelbacher G (2014): Genetic depletion at adaptive but – not neutral loci in an endangered bird species. Molecular Ecology 23: 5712- 5725 Hendry AP, Nosil P, Rieseberg LH (2007): The speed of ecological speciation. Functional Ecology 21: 455 464 Hendry AP, Taylor EB (2004): How much of the variation in adaptive divergence can – be explained by gene flow? An evaluation using lake-stream Stickleback pairs. Evolution 58: 2319-2331 Hermes C, Döpper A, Schaefer HM, Segelbacher G (2016): Effects of forest fragmentation on the morphological and genetic structure of a dispersal- limited, endangered bird species. Nature Conservation 16: 39-58 Hermes C, Jansen J, Schaefer HM (in press): Habitat requirements and population estimate of the endangered Ecuadorian Tapaculo. Bird Conservation International Hermes C, Keller K, Nicholas R, Segelbacher G, Schaefer HM (in review): Projected impacts of climate change on habitat availability for an endangered parakeet. Biological Conservation Hess GR, Fischer RA (2001): Communicating clearly about conservation corridors. Landscape and Urban Planning 55: 195-208 Hickling R, Roy DB, Hill JK, Fox R, Thomas CD (2006): The distributions of a wide range of taxonomic groups are expanding polewards. Global Change Biology 12: 450 455 Hill GE, Sargent RR, Sargent MB (1998): Recent change in the winter distribution of – Rufous Hummingbirds. The Auk 115: 240 245 Hodgson JA, Moilanen A, Wintle BA, Thomas CD (2011): Habitat area, quality and – connectivity: Striking the balance for efficient conservation. Journal of Applied Ecology 48: 148-152 Hodgson JA, Thomas CD, Wintle BA, Moilanen A (2009): Climate change, connectivity and conservation decision making: Back to basics. Journal of Applied Ecology 46: 964-969 Hoffmann AA, Sgro CM (2011): Climate change and evolutionary adaptation. Nature 470: 479 485
– 124
Chapter 12 - Bibliography
Holl KD, Loik ME, Lin EHV, Samuels IA (2000): Tropical montane forest restoration in Costa Rica: overcoming barriers to dispersal and establishment. Restoration Ecology 8: 339-349 Horskins K, Mather PB, Wilson JC (2006): Corridors and connectivity: When use and function do not equate. Landscape Ecology 21: 641-655 Jantz SM, Barker B, Brooks TM, Chini LP, Huang Q, Moore RM, Noel J, Hurtt GC (2015): Future habitat loss and extinctions driven by land-use change in biodiversity hotspots under four scenarios of climate-change mitigation. Conservation Biology 29: 1122-1131 Janzen DH (1967): Why mountain passes are higher in the tropics. The American Naturalist 101: 233-249 Jenkins CN, Alves MAS, Pimm SL (2010): Avian conservation priorities in a top-ranked biodiversity hotspot. Biological Conservation 143: 992-998 Kareiva P, Wennergren U (1995): Connecting landscape patterns to ecosystem and population processes. Nature 373: 299-302 Keller LF, Waller DM (2002): Inbreeding effects in wild populations. Trends in Ecology and Evolution 17: 230-241 Klauke N, Schaefer HM, Bauer M, Segelbacher G (2016): Limited dispersal and significant fine-scale genetic structure in a tropical montane parrot species. PLoS One 11: e0169165 Kleman Jr. L, Vieira JS (2013): Assessing the extent of occurrence, area of occupancy, territory size, and population size of Marsh Tapaculo (Scytalopus iraiensis). Animal Biodiversity and Conservation 36: 47 57 Knutti R, Rohelj J, Sedlacek J, Fischer EM (2016): A scientific critique of the two- – degree climate change target. Nature Geoscience 9: 13-18 Krabbe NK (2008): Arid valleys as dispersal barriers to high-Andean forest birds in Ecuador. Cotinga 29: 28-30 Krabbe NK, Salaman P, Cortés A, Quevedo A, Ortega LA, Cadena CD (2005): A new species of Scytalopus Tapaculo from the upper Magdalena Valley, Colombia. Bulletin of the British Ornithologists’ Club 125: 93-108 Krabbe NK, Schulenberg TS (1997): Species limits and natural history of Scytalopus Tapaculos (Rhinocryptidae), with descriptions of the Ecuadorian taxa, including three new species. Ornithological Monographs 48: 47-88 Krabbe NK, Schulenberg TS (2003): Family Rhinocryptidae (Tapaculos). In: Del Hoyo J, Elliott A, Christie DA (eds.) Handbook of the Birds of the World. Vol. 8. Broadbills to Tapaculos. Lynx Edition, Barcelona, Spain Lamb D, Erskine PD, Parrotta JA (2005): Restoration of degraded tropical forest landcapes. Science 310: 1628-1632
125
Chapter 12 - Bibliography
Lambeck RJ (1997): Focal species: A multi-species umbrella for nature conservation. Conservation Biology 11: 849-856 Lande R (1993): Risks of population extinction from demographic and environmental stochasticity and random catastrophes. The American Naturalist 142: 911-927 Langerhans RB, Layman CA, Langerhans AK, Dewitt TJ (2003): Habitat-associated Biological Journal of the Linnean Society 80: 689-698 morphological divergence in two Neotropical fish species. Langpap C (2006): Conservation of endangered species: Can incentives work for private landowners? Ecological Economics 57: 558-572 Laurance SGW, Laurance WF (1999): Tropical wildlife corridors: Use of linear rainforest remnants by arboreal mammals. Biological Conservation 91: 231- 239 Laurance SGW, Stouffer PC, Laurance WF (2004): Effects of road clearings on movement patterns of understory rainforest birds in central Amazonia. Conservation Biology 18: 1099-1109 LaVal RK (2004): Impact of global warming and locally changing climate on tropical cloud forest bats. Journal of Mammalogy 85: 237-244 Lavergne S, Molofsky J (2007): Increased genetic variation and evolutionary potential drive the success of an invasive grass. PNAS 104: 3883-3888 Lee PF, Ding TS, Hsu FH, Geng S (2004): Breeding bird species richness in Taiwan: Distribution on gradients of elevation, primary productivity and urbanization. Journal of Biogeography 31: 307-314 Lees AC, Peres CA (2008): Conservation value of remnant riparian forest corridors of varying quality for Amazonian birds and mammals. Conservation Biology 22: 439-449 Lenoir J, Gegout JC, Marquet PA, Ruffray P, Brisse H (2008): A significant upward shift in plant species optimum elevation during the 20th century. Science 320: 1768- 1771 Lenoir J, Svenning JC (2014): Climate-related range shifts a global multidimensional synthesis and new research directions. Ecography 37: 1-14 – Lens L, van Dongen S (2000): Fluctuating and directional asymmetry in natural bird populations exposed to different levels of habitat disturbance, as revealed by mixture analysis. Ecology Letters 3: 516-522 Levey DJ, Bolker BM, Tewksbury JJ, Sargent S, Haddad NM (2005): Effects of landscape corridors on seed dispersal by birds. Science 309: 146-148 Lima MG, Gascon C (1999): The conservation value of linear forest remnants in central Amazonia. Biological Conservation 91: 241-247
126
Chapter 12 - Bibliography
Lindenmayer D, Nix HA (1993): Ecological principles for the design of wildlife corridors. Conservation Biology 7: 627-630 Malcolm JR, Liu C, Neilson RP, Hansen L, Hannah L (2006): Global warming and extinction of endemic species from biodiversity hotspots. Conservation Biology 20: 538-548 Manning AD, Fischer J, Lindenmayer DB (2006): Scattered trees are keystone structures: Implications for conservation. Biological Conservation 132: 311- 321 Margules CR, Pressey RL (2000): Systematic conservation planning. Nature 405: 243- 253 Marshall TC, Slate J, Kruuk LEB, Pemberton JM (1998): Statistical confidence for likelihood-based paternity inference in natural populations. Molecular Ecology 7: 639-655 McCain CM (2009): the tropics. Ecology Letters 12: 550-560 Vertebrate range sizes indicate that mountains may be ‚higher in Menke S, Böhning-Gaese K, Schleuning M (2012): Plant-frugivore networks are less specialized and more robust at forest-farmland edges than in the interior of a tropical forest. Oikos 121: 1553-1566 Milá B, Wayne RK, Fitze P, Smith TB (2009): -scale phylogeographical structure in the Wedge-billed Woodcreeper, Glyphorynchus Divergence with gene flow and fine spirurus, a Neotropical rainforest bird. Molecular Ecology 18: 2979 2995 Minor ES, Urban DL (2008): A graph-theory framework for evaluating landscape – connectivity and conservation planning. Conservation Biology 22: 297-307 Mittermeier RA, Myers N, Thomsen JB, da Fonseca GAB, Olivieri S (1998): Biodiversity hotspots and major tropical wildnerness areas: Approaches to setting conservation priorities. Conservation Biology 12: 516-520 Moilanen A, Hanski I (2001): On the use of connectivity measures in spatial ecology. Oikos 95: 147-151 Montgomery RA, Chazdon RL (2001): Forest structure, canopy architecture, and light transmittance in tropical wet forests. Ecology 82: 2707-2718 Moon K, Marshall N, Cocklin C (2012): Personal circumstances and social characteristics as determinants of landholder participation in biodiversity conservation programs. Journal of Environmental Management 113: 292-300 Moore IT, Bonier F, Wingfield JC (2005): Reproductive asynchrony and population divergence between two tropical bird populations. Behavioral Ecology 16: 755- 762
127
Chapter 12 - Bibliography
Moore RP, Robinson WD, Lovette IJ, Robinson TR (2008): Experimental evidence for extreme dispersal limitation in tropical forest birds. Ecology Letters 11: 960- 968 Morueta-Holme N, Engemann K, Sandoval- Acuña P, Jonas JD, Segnitz RM, Svenning JC (2016): since Humboldt. PNAS 112: 12741-12745 Strong upslope shifts in Chimborazo s vegetation over two centuries Myers N, Mittermeier RA, Mittermeier CG, Da Fonseca GAB, Kent J (2000): Biodiversity hotspots for conservation priorities. Nature 403: 853-858 Nicholson E, Westphal MI, Frank K, Rochester WA, Pressey RL, Lindenmayer DB, Possingham HP (2006): A new method for conservation planning for the persistence of multiple species. Ecology Letters 9: 1049-1060 Nogué S, Rull V, Vegas-Vilarrúbia T (2009): Modeling biodiversity loss by global warming on Pantepui, northern South America: projected upward migration and potential habitat loss. Climatic Change 94: 77 85 Noss RF, Harris LD (1986): Nodes, networks, and MUMs: Preserving diversity at all – scales. Environmental Management 10: 299-309 Ocampo-Peñuela N, Jenkins CN, Vijay V, Li BV, Pimm SL (2016): Incorporating explicit geospatial data shows more species at risk of extinction than the current Red List. Science Advances 2: e1601367 Parks SA, McKelvey KS, Schwartz MK (2013): Effects of weighting schemes on the identification of wildlife corridors generated with least-cost methods. Conservation Biology 27: 145-154 Parmesan C (2006): Ecological and evolutionary responses to recent climate change. Anual Review in Ecology, Evolution, and Systematics 37: 637-669 Parmesan C, Yohe G (2003): A globally coherent fingerprint of climate change impacts across natural systems. Nature 421: 37-42 Paz-Vinas I, Quéméré E, Chikhi L, Loot G, Blanchet S (2013): The demographic history
empirical data. Molecular Ecology 22: 3279-3291 of populations experiencing asymmetric gene flow: combining simulated and Peakall R, Smouse PE (2012): GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 28: 2537- 2539 Peig J, Green AJ (2009): New perspectives for estimating body condition from mass/length data: The scaled mass index as an alternative method. Oikos 118: 1883-1891 Pereira HM, Leadley PW, Proenca V, Alkemade R, Scharlemann JPW, Fernandez- Manjarrés JF, Araújo MB, Balvanera P, Biggs R, Cheung WWL, Chini L, Cooper HD, Gilman EL, Guénette S, Hurtt GC, Huntington HP, Mace GM, Oberdorff T,
128
Chapter 12 - Bibliography
Revenga C, Rodrigues P, Scholes RJ, Sumaila UR, Walpole M (2010): Scenarios for global biodiversity in the 21st century. Science 330: 1496-1501 Pimm SL, Raven P (2000): Extinction by numbers. Nature 403: 843-845 Pimm SL, Russell GJ, Gittleman JL, Brooks TM (1995): The future of biodiversity. Science 269: 347-350 Postma E, van Noordwijk AJ (2005): Gene flow maintains a large genetic difference in clutch size at a small spatial scale. Nature 433: 65-68 Pounds AJ, Fogden MPL, Campbell JH (1999): Biological response to climate change on a tropical mountain. Nature 398: 611-615 Pritchard JK, Stephens M, Donnelly P (2000): Inference of population structure using multilocus genotype data. Genetics 155: 945-959 Rabinowitz A, Zeller KA (2010): A range-wide model of landscape connectivity and conservation for the jaguar, Panthera onca. Biological Conservation 143: 939- 945 Ramirez-Villegas J, Cuesta F, Devenish C, Peralvo M, Jarvis A, Arnillas CA (2014): Using species distribution models for designing conservation strategies of Tropical Andean biodiversity under climate change. Journal for Nature Conservation 22: 391-404 Räsänen K, Hendry AP (2008): Disentangling interactions between adaptive divergence and gene flow when ecology drives diversification. Ecology Letters 11: 624-636 Raxworthy CJ, Pearson RG, Rabibisoa N, Rakotondrazafy AM, Ramanamanjato JB, Raselimanana AM, Wu S, Nussbaum RA, Stone DA (2008): Extinction vulnerability of tropical montane endemism from warming and upslope displacement: A preliminary appraisal for the highest massif in Madagascar. Global Change Biology 14: 1703-1720 Reed DH, Frankham R (2003): Correlation between fitness and genetic diversity. Conservation Biology 17: 230-237 Reid S, Cornelius C, Barbosa O, Meynard C, Silva-García C, Marquet P (2002): Conservation of temperate forest birds in Chile: Implications from the study of an isolated forest relict. Biodiversity and Conservation 11: 1975 1990 Reid S, Diaz IA, Armesto JJ, Willson MF (2004): Importance of native bamboo for – understory birds in Chilean temperate forests. The Auk 121: 515 525
– Conservation planning as a transdisciplinary process. Conservation Biology 24: Reyers B, Roux DJ, Cowling RM, Ginsburg AE, Nel JL, O Farrell PO : 957-965 Ridgely RS, Greenfield PJ (2001): The birds of Ecuador. Volume 1. Status, distribution and taxonomy. Christopher Helm, London
129
Chapter 12 - Bibliography
Ridgely RS, Robbins MB (1988): Pyrrhura orcesi, a new parakeet from southwestern Ecuador, with systematic notes on the P. melanura complex. The Wilson Bulletin 100: 173-182 Robbins MB, Ridgely RS (1990): The avifauna of an upper tropical cloud forest in southwestern Ecuador. Proceedings of the Academy of Natural Sciences of Philadelphia 142: 59-71 Rogelj J, den Elzen M, Höhne N, Fransen T, Fekete H, Winkler H, Schaeffer R, Sha F, Riahi K (2016): Paris Agreement climate proposals need a boost to keep warming well below 2 °C. Nature 534: 631-639 Rousset F (2008): -implementation of the genepop software for Windows and Linux. Molecular Ecology Resources 8: 103-106 Genepop 7: A complete re Rozen S, Skaletsky H (2000): Primer3 on WWW for general users and for biologist programmers. Methods in Molecular Biology 132: 365-386 Rull V, Vegas-Vilarrúbia T (2006): Unexpected biodiversity loss under global warming in the neotropical Guayana Highlands: A preliminary appraisal. Global Change Biology 12: 1-9 Saint-Laurent R, Legault M, Bernatchez L (2003): Divergent selection maintains adaptive differentiation despite high gene flow between sympatric Rainbow Smelt ecotypes (Osmerus mordax Mitchill). Molecular Ecology 12: 315-330 Sala OE, Chapin III FS, Armesto JJ, Berlow E, Bloomfield J, Dirzo R, Huber-Sanwald E, Huenneke LF, Jackson RB, Kinzig A, Leemans R, Lodge DM, Mooney HA, Oesterheld M, Poff NL, Sykes MT, Walker BH, Walker M, Wall DH (2000): Global biodiversity scenarios for the year 2100. Science 287: 1770-1774 Sawyer SC, Epps CW, Brashares JS (2011): Placing linkages among fragmented habitats. Do least-cost models reflect how animals use landscapes? Journal of Applied Ecology 48: 668-678 Schaefer HM, Schmidt V (2003): Conservation of the endangered El Oro parakeet Pyrrhura orcesi. Cyanopsitta 71: 10-16 Schluter D (2000): The ecology of adaptive radiation. Oxford University Press, Oxford, United Kingdom Segelbacher G, Cushman SA, Epperson BK, Fortin MJ, Francois O, Hardy OJ, Holderegger R, Taberlet P, Waits LP, Manel S (2010): Applications of landscape genetics in conservation biology: Concepts and challenges. Conservation Genetics 11: 375-385 Seo C, Thorne JH, Hannah L, Thuiller W (2009): Scale effects in species distribution models: Implications for conservation planning under climate change. Biology Letters 5: 39-43
130
Chapter 12 - Bibliography
Sekercioglu CH, Schneider SH, Fay JP, Loarie SR (2008): Climate change, elevational range shifts, and bird extinctions. Conservation Biology 22: 140 150 Sekercioglu CH, Primack RB, Wormworth J (2012): The effects of climate change on – tropical birds. Biological Conservation 148: 1 18 Shoo LP, Williams SE, Hero JM (2005): Climate warming and the rainforest birds of – the Australian wet tropics: Using abundance data as a sensitive predictor of change in total population size. Biological Conservation 125: 335-343 Sieving KE, Willson MF, De Santo TL (1996): Habitat barriers to movement of understory birds in fragmented south-temperate rainforest. The Auk 113: 944- 949 Sieving KE, Willson MF, De Santo TL (2000): Defining corridor functions for endemic birds in fragmented south-temperate rainforest. Conservation Biology 14: 1120-1132 Sodhi NS, Liow LH, Bazzaz FA (2004): Avian extinctions from tropical and subtropical forests. Annual Review in Ecology, Evolution, and Systematics 35: 323-345 Sorice MG, Haider W, Conner JR, Ditton RB (2011): Incentive structure of and private landowner participation in an endangered species conservation program. Conservation Biology 25: 587-596 Sriver RL, Forest CE, Keller K (2015): Effects of initial conditions uncertainty on regional climate variability. An analysis using a low-resolution CESM ensemble. Geophysical Research Letters 42: 5468 5476 Still CJ, Foster PN, Schneider SH (1999): Simulating the effects of climate change on – tropical montane cloud forests. Nature 398: 608-610 Stouffer PC, Bierregaard Jr RO (1995): Use of Amazonian forest fragments by understory insectivorous birds. Ecology 76: 2429-2445 Stouffer PC, Bierregaard Jr RO, Strong C, Lovejoy TE (2006): Long-term landscape change and bird abundance in Amazonian rainforest fragments. Conservation Biology 20: 1212-1223 Stratford JA, Stouffer PC (1999): Local extinctions of terrestrial insectivorous birds in a fragmented landscape near Manaus, Brazil. Conservation Biology 13: 1416- 1423 Stocker TF, Qin D, Plattner GK, Tignor M, Allen SK, Boschung J, Nauels A, Xia Y, Bex V, Midgley PM (eds.) (2013): Climate change 2013: The physical science basis. Contributions of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, United Kingdom and New York, USA
131
Chapter 12 - Bibliography
Storz JF, Beaumont MA (2002): Testing for genetic evidence of population expansion and contraction: An empirical analysis of microsatellite DNA variation using a hierarchical Bayesian model. Evolution 56: 154-166 Thomas CD, Cameron A, Green RE, Bakkenes M, Beaumont LJ, Collingham YC, Erasmus BFN, Ferreira de Siqueira M, Grainger A, Hannah L, Hughes L, Huntley B, van Jaarsveld AS, Midgley GF, Miles L, Ortega-Huerta MA, Peterson AT, Phillips OL, Williams SE (2004): Extinction risk from climate change. Nature 427: 145-148 Thomassen HA, Fuller T, Buermann W, Mila B, Kieswetter CM, Jarrin VP, Cameron SE, Mason E, Schweizer R, Schlunegger J, Chan J, Wang O, Peralvo M, Schneider CJ, Graham CH, Pollinger JP, Saatchi S, Wayne RK, Smith TB (2011): Mapping evolutionary process: A multi-taxa approach to conservation prioritization. Evolutionary Applications 4: 397-413 Tischendorf L, Fahrig L (2000): On the usage and measurement of landscape connectivity. Oikos 90: 7-19 Townsend PA, Levey DJ (2005): An experimental test of whether habitat corridors affect pollen transfer. Ecology 86: 466-475 Turner IM, Corlett RT (1996): The conservation value of small, isolated fragments of lowland tropical rain forest. Trends in Ecology and Evolution 11: 330-333 Uezu A, Beyer DD, Metzger JP (2008): Can agroforest woodlots work as stepping stones for birds in the Atlantic forest region? Biodiversity and Conservation 17: 1907 1922 Urban MC (2015): Climate change. Accelerating extinction risk from climate change. – Science 348: 571 573 Urban MC, Bocedi G, Hendry AP, Mihoub JB, Pe'er G, Singer A, Bridle JR, Crozier LG, de – Meester L, Godsoe W, Gonzalez A, Hellmann JJ, Holt RD, Huth A, Johst K, Krug CB, Leadley PW, Palmer SCF, Pantel JH, Schmitz A, Zollner PA, Travis JMJ (2016): Improving the forecast for biodiversity under climate change. Science 353: aad88466 Van Houtan KS, Pimm SL, Halley JM, Bierregaard RO, Lovejoy TE (2007): Dispersal of Amazonian birds in continuous and fragmented forest. Ecology Letters 10: 219 229 Velásquez-Tibatá J, Salaman P, Graham CH (2013): Effects of climate change on – species distribution, community structure, and conservation of birds in protected areas in Colombia. Regional Environmental Change 13: 235 248 Vergara PM, Simonetti JA (2006): Abundance and movement of understory birds in a – Maulino forest fragmented by pine plantations. Biodiversity and Conservation 15: 3937-3947
132
Chapter 12 - Bibliography
Vetter D, Hansbauer MM, Végvári Z, Storch I (2011): Predictors of forest fragmentation sensitivity in Neotropical vertebrates: a quantitative review. Ecography 34: 1-8 Williams P, Hannah L, Andelman S, Midgley G, Araujo M, Hughes G, Manne L, Martinez-Meyer E, Pearson R (2005): Planning for climate change. Identifying minimum-dispersal corridors for the Cape Proteaceae. Conservation Biology 19: 1063-1074 Willson MF, De Santo TL, Sabag C, Armesto JJ (1994): Avian communities in fragmented south-temperate rainforest in Chile. Conservation Biology 8: 508 520 – Woltmann S, Kreiser BR, Sherry TW (2012): Fine-scale genetic population structure of an understory rainforest bird in Costa Rica. Conservation Genetics 13: 925- 935 Wrigth S (1943): Isolation by distance. Genetics 28: 114-138 Wyner Y, Desalle R (2010): Taking the conservation biology perspective to secondary school classrooms. Conservation Biology 24: 649-654 Xiaofeng L, Yi Q, Diqiang L, Shirong L, Xiulei W, Bo W, Chunquan Z (2011): Habitat evaluation of wild Amur tiger (Panthera tigris altaica) and conservation priority setting in north-eastern China. Journal of Environmental Management 92: 31-42 Yamano H, Sugihara K, Nomura K (2011): Rapid poleward range expansion of tropical reef corals in response to rising sea surface temperatures. Geophysical Research Letters 38, 1-6 Zeh JA, Bonilla MM, Su EJ, Padua MV, Anderson RV, Kaur D, Yang D, Zeh DW (2012): Degrees of disruption. Projected temperature increase has catastrophic consequences for reproduction in a tropical ectotherm. Global Change Biology 18, 1833 1842
–
133
Chapter 12 - Bibliography
134
Chapter 13 List of Figures
1 Designated area of the ecological corridor in the El Oro province in southwestern Ecuador (red outline). The Buenaventura reserve is shown by the bolt black outline. Three governmental reserves are planned near Pagua, Cerro Azul and Puyango. 5
2 Distribution range of the Ecuadorian Tapaculo. The species occurs in premontane cloud forests and was found only in an elevation between 850 m and 1500 m (indicated by the black line). Field work was carried out in our study area in the southern part of the distribution range, with the Buenaventura Reserve in the south being the only well-protected site within the area. The satellite images cover about one-third of the distribution range. 13
3 Detailed map of the study elevational range were mapped from satellite images of the area. Fragments where we area. Forest fragments in the Ecuadorian Tapaculo’s analyzed microhabitat structure are depicted in black, while forests that were not analyzed are shown in grey. White dots roughly indicate the locations of the territories of Ecuadorian Tapaculos. The Buenaventura Reserve is indicated by the bolt white 15 line.
4 Histogram of the altitudinal distribution of the Ecuadorian Tapaculo in southwestern Ecuador with density curve. The species was found between 870 and 1460 m (mean 1170 m). 19
5 Map of the study area in southwestern Ecuador. Forested areas are shaded grey, whereas white areas represent non-forested areas (mainly cow pastures). The Buenaventura reserve is circled by the dashed line. The bolt black line represents a highway cutting the reserve into a northern and a southern part, while minor roads are indicated by the thin lines. 36
135
Chapter 13 List of Figures
–
6 Mean ± SD of the log-likelihood for K = 1 to 8 distinct genetic populations. Strong support for K = 1 indicates that most likely all the samples stem from the same genetic group. 42
7 Resistance map with least-cost path. The cost of movement is visualized by the color gradient from black to white, with black indicating higher costs and white lower costs. The bolt black lines show the least-cost paths between 26 Ecuadorian Tapaculo territories in the study area. 43
8 Overview of the southern part of the original distribution range of the El Oro Parakeet (600 - 1100 m; specified by the hatched area) in southwestern Ecuador. Forest fragments in the area are inferred from satellite images and depicted in light grey. The four study areas Cerro Azul, Buenaventura, Nalacapa and Guayacan are indicated by the dashed outlines, with the Buenaventura reserve (solid black outline) being the only protected site within the area. 55
9 Projected upslope shift of the El Oro P 2000 and 2100. Each line represents the mean altitude of parakeets derived from the arakeets’ distribution range between the years single model runs. The maximum extent of the distribution range (mean ± 2*SD) is shaded grey. Boxplots indicate the altitudinal distribution of parakeets in the years 2050 and 2100 for each of the four scenarios RCP2.6, 4.5, 6.0, and 8.5. 59
10 Probability density, cumulative density and survival function for the four scenarios RCP2.6, 4.5, 6.0, and 8.5 for the year 2100. The altitudinal extent of the original range (600 1100 m) is shaded grey. 60
11 Original– range (hatched) and predicted ranges for the years 2050 (light grey, solid outline) and 2100 (light grey, dashed outline) for RCP6.0 in the study areas Cerro Azul (a), Buenaventura (b), Nalacapa (c), and Guayacan (d). Forests fragments are shaded dark grey. 61 12 Method for prioritizing forest fragments depending on their habitat quality and for assessing the least-cost paths between fragments in ARCMAP 10.2 in four steps. Arrows indicate the ARCMAP tools used. After creating four layers depicting microhabitat quality, macrohabitat quality, the maximum dispersal zone around forest fragments, and elevation (Step 1), these layers were added in the RASTER CALCULATOR tool to obtain a resistance surface for habitat quality (Step 2). The ZONAL STATISTICS tool was used to calculate the mean movement costs per fragment. After classifying the fragments into four groups according to their mean costs (Step 3), the least-cost paths (LCPs) between fragments were identified using the LINKAGE 72 MAPPER tool (Step 4).
13 The study area in southwestern Ecuador. Forest patches are hatched grey; the Buenaventura reserve is indicated by the bolt black outline. 74
136
Chapter 13 List of Figures
– 14 projected range for 2050 (b), Ecuadorian Tapaculos Resistance surfaces for El Oro Parakeets in today’s range a , El Oro Parakeets in their Ecuadorian Tapaculos in their projected range for 2050 (d). The costs of movement in today’s range c , and are visualized by the color gradient from blue to red, with blue indicating higher costs and red lower costs. The bolt black line marks the Buenaventura reserve. 78
15 Forest fragments with high quality (up to 25 % of the total costs of movement; red), medium quality (up to 50 % of the total costs of movement; green), and low quality (up to 75 % of the total costs of movement; blue) and least-cost paths (in red, green and blue respectively) bet Parakeets in their projected range for 2050 (b), Ecuadorian Tapaculos ween them for El Oro Parakeets in today’s range a , El Oro (c), and Ecuadorian Tapaculos in their projected range for 2050 (d). Forest fragments in today’s range with more than 75 % of the total costs of movement are depicted in light grey. The bolt black line marks the Buenaventura reserve. 82
16 The study area with the four sites Cerro Azul, Sambotambo, Buenaventura, and Nalacapa (bolt grey outline). The proposed corridor in the El Oro province is marked red. Forests are depicted in light grey; the Buenaventura reserve is indicated by the black outline. 91
17 Corridor model for the Buenaventura site. The Buenaventura reserve is indicated by the bolt black line, the highway running through the reserve by the bolt grey line. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests. 92
18 Corridor model for the Nalacapa site. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests. 94
19 Corridor model for the Sambotambo site. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests. 96
20 Corridor model for the Cerro Azul site. Forests with high priority for the corridor are depicted in red (high habitat quality) and green (medium habitat quality). Forests of lower priority are depicted in grey. The bolt blue lines indicate the least-cost paths between the prioritized forests. 97
Appendix Original range (light grey) and predicted ranges for the years 2050 (solid E outline) and 2100 (dashed outline) for RCP2.6 (dark blue), RCP 6.0 (orange), and RCP8.5 (red) in the four study areas Cerro Azul, Buenaventura, Nalacapa, and Guayacan. Forest fragments are depicted in dark grey. 68
137
Chapter 13 List of Figures
–
138
Chapter 14 List of Tables
1 Variables used to assess and compare habitat characteristics of 28 territories of Ecuadorian Tapaculos and 36 control plots within the Buenaventura Reserve (S 3,655°, W 79,744°), with the loadings, eigenvalues and variance of the first four principal components (threshold: 0.375; bold font). 21
2 Linear discriminant coefficients for the microhabitat variables. Positive values (threshold: 0.04; bold font) describe Ecuadorian Tapaculo territories, and negative values (threshold: -0.04; bold font) describe control plots. 21
3 Body size of Ecuadorian Tapaculos. Principal component analysis for the body size of 28 Ecuadorian Tapaculos, with the loadings, eigenvalues and variance of the first four principal components (threshold: 0.35; bold font). 40
4 Wing shape of Ecuadorian Tapaculo. Principal component analysis for the wing shape of 28 Ecuadorian Tapaculos, with the loadings, eigenvalues and variance of the first three principal components (threshold: 0.35; bold font). 41
5 Habitat availability for the original range and the projected ranges for 2050 and 2100 under four RCP scenarios. 61
6 Habitat availability and connectivity for El Oro Parakeets today and in their projected range in the year 2050. The habitat quality is classified into three groups (good quality = up to 25 % of the total costs of movement; medium quality = up to 50 % of the total costs of movement; low quality = up to 75 % of the total costs of movement). The availability of habitat is denoted as the number of forest patches and the total area covered by 2050. The connectivity is expressed as the mean length and costs of the least-cost forest in each of the three groups for today’s range and the range in paths (LCPs) between the forest patches in each group. 80
139
Chapter 14 List of Tables
– 7 Habitat availability and connectivity for Ecuadorian Tapaculos today and in their projected range in the year 2050. The habitat quality is classified into three groups (good quality = up to 25 % of the total costs of movement; medium quality = up to 50 % of the total costs of movement; low quality = up to 75 % of the total costs of movement). The availability of habitat is denoted as the number of forest patches and
range in 2050. The connectivity is expressed as the mean length and costs of the least- the total area covered by forest in each of the three groups for today’s range and the cost paths (LCPs) between the forest patches in each group. 81
Appendix Detailed description of the assessment of the microhabitat characteristics in the A subplots of the Tapaculo territories and the control plots. 29
Appendix Development of species-specific microsatellite primers. B 48
Appendix Microsatellites of the polymorphic loci in Scytalopus robbinsi (n = 33). C 49
Appendix List of models used in the IPCC WG1 AR5 Annex I: Atlas of Global and Regional D Climate Projections (Stocker et al. 2013). 67
140