IAI Accepted Manuscript Posted Online 22 July 2019 Infect. Immun. doi:10.1128/IAI.00528-19 Copyright © 2019 American Society for Microbiology. All Rights Reserved. Downloaded from 1 Peptidyl-prolyl isomerase, ppiB, is essential for proteome homeostasis and
2 virulence in Burkholderia pseudomallei
3
1 2 3 3
4 Nicole M. Bzdyl , Nichollas E. Scott , Isobel H. Norville , Andrew E. Scott , Timothy http://iai.asm.org/
5 Atkins3, Stanley Pang4, Derek S. Sarovich5, Geoffrey Coombs4,6, Timothy J. J. Inglis1,6,7,
6 Charlene M. Kahler1 and Mitali Sarkar-Tyson1
7 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 8 1Marshall Centre for Infectious Diseases Research and Training, School of Biomedical
9 Sciences, University of Western Australia, Perth, WA, Australia
10 2Department of Microbiology and Immunology, University of Melbourne at the Peter
11 Doherty Institute for Infection and Immunity, Parkville, VIC 3010 Australia
12 3Defence Science Technology Laboratory (Dstl), Porton Down, Salisbury, United
13 Kingdom
14 4School of Veterinary and Life Sciences, Murdoch University, Murdoch, Australia.
15 5GeneCology Research Centre, University of the Sunshine Coast, Sippy Downs, QLD,
16 Australia
17 6PathWest Laboratory Medicine WA, Perth, WA, Australia
18 7School of Medicine, University of Western Australia, Perth, WA, Australia
19
20 Correspondence Address: 1
Downloaded from 21 Dr Mitali Sarkar-Tyson
22 Marshall Centre for Infectious Diseases Research and Training
23 School of Biomedical Sciences
24 University of Western Australia http://iai.asm.org/
25 Perth, WA, Australia
26 E-mail: [email protected]
27 Tel: +61 8 6457 4872 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
28
2
Downloaded from 29 Abstract
30 Burkholderia pseudomallei is the causative agent of melioidosis, a disease endemic in
31 South-East Asia and northern Australia. Mortality rates in these areas are high even
32 with antimicrobial treatment, and there are few options for effective therapy. Therefore http://iai.asm.org/ 33 there is a requirement to identify anti-bacterial targets for the development of novel
34 treatments. Cyclophilins are a family of highly conserved enzymes important in multiple
35 cellular processes. Cyclophilins catalyse the cis-trans isomerization of xaa-proline
36 bonds, a rate limiting step in protein folding which has been shown to be important for on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 37 bacterial virulence. B. pseudomallei encodes a putative cyclophilin B gene, ppiB, the
38 role of which was investigated. A mutant strain, BpsΔppiB, demonstrates impaired
39 biofilm formation and reduced motility. Macrophage invasion and survival assays
40 showed that although BpsΔppiB retained the ability to infect macrophages, it had
41 reduced survival and lacked the ability to spread cell-to-cell, indicating ppiB is essential
42 for B. pseudomallei virulence. This is reflected in the BALB/c mouse infection model
43 demonstrating the requirement of ppiB for in vivo disease dissemination and
44 progression. Proteomic analysis demonstrates that the loss of PpiB leads to pleiotropic
45 effects supporting the role of PpiB in maintaining proteome homeostasis. The loss of
46 PpiB leads to decreased abundance of multiple virulence determinants including
47 flagellar machinery and alterations in Type VI secretion system proteins. In addition, the
48 loss of ppiB leads to increased sensitivity towards multiple antibiotics including
49 meropenem and doxycycline, highlighting ppiB inhibition as a promising anti-virulence
50 target to both treat B. pseudomallei infections and increase antibiotic efficacy.
51 3
Downloaded from 52 Introduction
53 Burkholderia pseudomallei is a Gram-negative soil saprophyte found in tropical and
54 sub-tropical areas around the world such as in South-East Asia and northern Australia
55 (1-3). It is the causative agent of melioidosis and has been reported in 45 countries with http://iai.asm.org/ 56 a predicted global burden of 165,000 cases and 89,000 deaths annually (4). Melioidosis
57 can present as a variety of clinical syndromes ranging from non-healing skin lesions to
58 intra-abdominal abscesses to pneumonia and septicaemia (5), leading to difficulty in
59 prompt diagnosis particularly in non-endemic regions. Mortality rates vary depending on on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 60 geographic location with rates ranging from 14% in Darwin (5) to 49% in North-East
61 Thailand (6). Treatment of melioidosis is prolonged, consisting of two phases; a two-
62 week intensive intravenous phase followed by a 3 to 6-month oral eradication phase (7,
63 8). Due to intrinsic resistance to antimicrobials (9) treatment of B. pseudomallei infection
64 can be further complicated by the limited number of viable antimicrobial alternatives.
65 Relapse of infection is common and is associated with increased mortality, particularly
66 in cases were treatment is unsuccessful or an incomplete course of antimicrobial
67 therapy is taken (10, 11).
68 B. pseudomallei infections can be difficult to overcome due to the bacterium encoding
69 for an array of defence mechanisms which enables successful survival in diverse
70 environments including inside mammalian host cells. The ability of B. pseudomallei to
71 form biofilms allows it to persist in the environment and has been implicated in infection
72 (12-14). B. pseudomallei encodes flagellin, important for disease dissemination and
73 virulence in BALB/c mouse infection models (15, 16). Intracellular survival is reliant on
74 B. pseudomallei rapidly escaping from the phagolysosome and establishing a replicative 4
Downloaded from 75 niche in the cytosol of eukaryotic cells (17). The ability to escape into the cytosol is
76 dependent on multiple secretion systems which function to deliver specialised secreted
77 proteins known as effectors into the host which enhance bacterial survival and enable
78 the spread of B. pseudomallei into neighbouring cells (18). Three different Type-III http://iai.asm.org/ 79 Secretion Systems (T3SS-1, -2, -3) are found in B. pseudomallei with only T3SS-3
80 required for full virulence in a hamster model of infection (17, 19-21). Following
81 phagosome escape and replication in the cytosol, expression of Type-VI Secretion
82 Systems (T6SS) is induced and is essential for in vivo virulence (22-24). A well- on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 83 documented phenomena of B. pseudomallei is the formation of multinucleated giant
84 cells (MNGC). This formation has been attributed to the T6SS-5 (T6SS Cluster 1)
85 effector VgrG-5 which is required to stimulate cell fusion and leading to the spread of
86 infection (22, 25, 26). Six clusters of T6SS are found in B. pseudomallei with T6SS
87 Cluster 1, as defined by Shalom et al (24) as tss5, shown to play a role in the formation
88 of MNGC and cellular cytotoxicity (26, 27) Throughout this paper the Schell et al (28)
89 nomenclature for T6SS will be used .
90
91 Cyclophilins are part of the immunophilin superfamily, with bacteria generally encoding
92 two cyclophilin genes, ppiA and ppiB with one located in the cytoplasm and the other in
93 the periplasm or outer membrane respectively (29). Cyclophilins catalyse the cis-trans
94 isomerisation of xaa-proline bonds, a rate limiting step in protein folding, which is
95 required for proteome homeostasis (30, 31). Not only are cyclophilins required for
96 optimal protein folding but in multiple bacterial systems cyclophilins are important for
97 stress response and infectivity, suggesting a role in folding virulence factors. In Brucella 5
Downloaded from 98 abortus the expression of both CypA and CypB become elevated during intracellular
99 infection with deletion of these genes resulting in virulence attenuation, reduced
100 intracellular survival and increased susceptibility to acidic and oxidative stress (32).
101 Further evidence of the role of cyclophilins in virulence is demonstrated in Legionella http://iai.asm.org/ 102 pneumophila where the cyclophilin gene cyp18 is essential for optimal intracellular
103 survival in Acanthaemoba castellanii (33). Cyclophilins also play an important role in
104 biofilm formation with Escherichia coli ppiB shown to be a negative regulator of both
105 motility and biofilm formation, mutagenesis of E. coli ppiB results in hypermotility and on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 106 increased biofilm formation (34). The pleiotropic role of cyclophilins in bacteria is also
107 demonstrated in E. coli where interaction of PpiB with the protein, FtsZ, is important for
108 correct cell division, with deletion of ppiB resulting in aberrant cell division and formation
109 of filamentous cells (35).
110
111 B. pseudomallei encodes a ppiB gene, the role of which was investigated by
112 construction of a null mutant strain Bps∆ppiB. In vitro characterisation of Bps∆ppiB
113 demonstrates a loss of multiple virulence determinants including reduced motility and
114 biofilm production. Intracellular survival of Bps∆ppiB was significantly reduced with
115 bacteria confined within the macrophage cell, lacking the ability to spread cell-to-cell,
116 indicating ppiB is important for B. pseudomallei virulence. This is reflected in the BALB/c
117 mouse infection model in which BpsΔppiB was avirulent, demonstrating the important
118 role for ppiB in in vivo disease dissemination and progression. Proteomic analysis
119 confirms widespread alterations within BpsΔppiB, that are partially restored by
120 complementation of ppiB. Consistent with this, complementation restored 6
Downloaded from 121 multinucleated cell formation and cell disruption. Finally, we demonstrate that loss of
122 ppiB leads to increased susceptibly to first-line treatment antibiotics such as
123 meropenem and doxycycline. Thus, this study shows the importance of ppiB for
124 virulence of B. pseudomallei and how disruption of proteome homeostasis may be http://iai.asm.org/ 125 targeted to sensitize B. pseudomallei to antibiotic regimes.
126
127 Results
128 Deletion of ppiB gene in B. pseudomallei. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
129 BPSL2246 (UnitProt Entry Q63SS5) encodes a putative cytoplasmic cyclophilin, ppiB
130 homologue in B. pseudomallei (Supplementary Fig 1). There is 66.3% and 57.7%
131 protein identity with cyclophilin B homologues from E. coli and L. pneumophila
132 respectively, with residues involved in enzymatic activity also being conserved
133 (Supplementary Fig 1) (36). To determine the role of ppiB in B. pseudomallei strain
134 K96243, the gene was deleted by construction of an in-frame null mutation strain,
135 Bps∆ppiB (37). Deletion of ppiB in Bps∆ppiB was confirmed by whole genome
136 sequencing. In comparison to the parent K96243, strain there was one additional SNP
137 in Bps∆ppiB that resulted in a missense mutation in rpoZ (RpoZLeu10Pro). No differences
138 in growth were observed between the BpsWT and Bps∆ppiB mutant strain in either
139 Luria Bertani broth or M9 minimal media (Supplementary Fig 2).
140
141 Bps∆ppiB can infect mouse murine macrophage cells in vitro but has reduced
142 intracellular numbers 6 and 9 hours post infection. 7
Downloaded from 143 Mouse murine macrophages, J774.1 cells, were infected with either the wild-type or
144 Bps∆ppiB strain, bacteria were enumerated at various time points post infection (Fig 1).
145 There were no significant differences in the levels of adherence and invasion of
146 macrophages (data not shown). Significant differences in the numbers of intracellular http://iai.asm.org/ 147 bacteria at 6 (14-fold, P-value 0.0159, Mann Whitney U-test) and 9 (36.8-fold, P-value
148 0.0159, Mann Whitney U-test) hours post infection were seen with Bps∆ppiB
149 demonstrating reduced survival and/or replication. At 12 hours Bps∆ppiB was able to
150 overcome the reduced growth phenotype showing similar levels of intracellular bacteria on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 151 to that of the BpsWT parental control. At 24 hours although the levels of intracellular
152 bacteria in both BpsWT and Bps∆ppiB appears to be similar, there was a substantial
153 reduction in cell cytotoxicity caused by Bps∆ppiB compared to BpsWT using LDH
154 cytotoxicity screening (Supplementary Fig 3). Together these results demonstrate
155 Bps∆ppiB has reduced growth and/or survival in macrophage cells.
156
157 ppiB is essential for in vivo infection
158 As in vitro results demonstrated a decrease in intracellular counts during early time
159 points the role of ppiB during infection was further investigated using the BALB/c mouse
160 infection model of B. pseudomallei. Groups of mice were challenged by the
161 intraperitoneal route with either BpsWT or BpsΔppiB (Fig 2A). At the end of the
162 experiment 100% of the animals challenged with Bps∆ppiB survived compared to 33%
163 in the group challenged with BpsWT (P-value 0.0183 by Log-rank (Mantel-Cox) test).
164 Disease progression was also monitored by measuring weight loss during the infection
8
Downloaded from 165 study, all except two mice infected with BpsWT showed considerable weight loss (Fig
166 2B). In contrast, mice infected with BpsΔppiB demonstrated no weight loss throughout
167 the experiment (Figs 2C). The lungs, livers and spleens in survivors were enumerated
168 for bacteraemia, all were clear from infection at the conclusion of the experiment. This http://iai.asm.org/ 169 demonstrates that ppiB is essential for B. pseudomallei to successfully establish in vivo
170 infection.
171
172 BpsΔppiB demonstrates reduced ability to form MNGC. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
173 The in vitro cell infection study suggests BpsΔppiB is attenuated, in contrast the mouse
174 infection studies demonstrate that BpsΔppiB is avirulent. To investigate this in more
175 detail a complemented strain was constructed, BpsΔppiB/ppiB, and was further
176 characterised in macrophage cells. BpsWT, Bps∆ppiB, Bps∆ppiB/ppiB infected cells
177 were analysed by immunofluorescence microscopy 12 hours post infection. Fig 3A
178 shows that during a later time point of 12 hours post infection, macrophage cells
179 infected with BpsWT has multiple MNGC formations. In contrast, Bps∆ppiB infected
180 cells demonstrate a significant reduction in multinucleated giant cell (MNGC) formation,
181 although actin protrusions are still observed (Fig 3B). Complementation of ppiB
182 demonstrates restoration to a BpsWT phenotype (Fig 3C). Enumeration of nuclei within
183 multi-nucleated cells relative to mononucleated cells shows that there is a 67.4%
184 reduction in nuclei associated with MNGCs in macrophage monolayers infected with
185 Bps∆ppiB, this is significantly restored in the complemented strain, Bps∆ppiB/ppiB (Fig
9
Downloaded from 186 3D), confirming the role of ppiB in the virulence of B. pseudomallei during intracellular
187 infection.
188
189 BpsΔppiB reveals marked changes in the proteome http://iai.asm.org/
190 To understand the changes driving the alterations in virulence, we analysed the
191 proteome of Bps∆ppiB, its complement Bps∆ppiB/ppiB and BpsWT strains. Using label
192 free based quantitative (LFQ) proteomics, we identified 2091 proteins with high
193 consistency observed across biological replicates as determined by Pearson on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
194 correlations (average: 0.95, Supplementary Fig 4). Consistent with the role of PpiB in
195 multiple cellular pathways, 734 proteins underwent statistically significant alterations
196 within the proteome of BpsΔppiB compared to BpsWT (Supplementary Table 1) with
197 these proteins predicted to be localized to multiple cellular compartments (Fig 4A).
198 Consistent with the loss of PpiB in BpsΔppiB, this protein demonstrated the largest fold
199 difference of -10.14 log2 within the proteome with the majority of altered proteins also
200 showing a decreased abundance in response to loss of PpiB (Fig 4B). Upon
201 complementation, PpiB levels were restored to 10% of the level of wild-type, yet
202 consistent with phenotypic assays, this led to restoration of proteins observed to
203 increase (Fig 4C) and decrease (Fig 4D) to near wild-type levels. Within the categories
204 of proteins that had reduced abundance upon the loss of PpiB, we observed alterations
205 in multiple proteins associated with motility, consistent with the reductions in BpsΔppiB
206 including BPSL3305 (CheW, -2.78587 log2, -log10(P-value): 4.38) and BPSL3301
207 (CheB1, -2.48162 log2, -log10(P-value): 6.03) as well as the flagellin (BPSL3319, FliC -
10
Downloaded from
208 3.38141 log2, -log10(P-value): 5.81). Again, consistent with phenotypic assay
209 complementation only partial restoration of these proteins occurred with FliC only
210 restored by 0.9 log2. Other changes observed in response to the loss of PpiB including
211 reduction in capsule-associated proteins BSPL2799 (WcbI, -1.32 log2, -log10(P-value): http://iai.asm.org/ 212 4.30), BSPL2800 (WcbH, -0.47 log2, -log10(P-value): 1.36), BPSL2807 (WcbC, -0.36
213 log2, -log10(P-value): 1.61) (highlighted in green in Fig 4D) and BPSL2810 (ManC, 0.80
214 log2, -log10(P-value): 2.33), as well as increases in multiple components of the Type VI
215 T6SS-3 including BPSS2099 (TssC3, 4.49 log2, -log10(P-value): 3.38) and BPSS2098 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 216 (Hcp3, 3.99 log2, -log10(P-value): 4.28) (highlighted in blue in Fig 4B). A KEGG
217 pathway analysis was undertaken to determine what functional pathways were being
218 affected in Bps∆ppiB (Fig 5). Metabolism accounted for 268 of differentially present
219 proteins, with 170 being increased while 98 were decreased. Genetic Information
220 Processing, Signalling and Cellular Processes, and Environmental Information
221 Processing related proteins were a majority of proteins affected. In addition, many
222 hypothetical or unassigned proteins were also differentially present.
223
224 BpsΔppiB has decreased motility and biofilm formation under nutrient rich
225 conditions.
226 Motility of B. pseudomallei has been shown to be important for successful establishment
227 of in vitro and in vivo infections (15, 16). The motility of Bps∆ppiB was determined
228 using a swarming assay (Fig 6). The mean bacterial spread from the site of inoculation
229 of the BpsWT parental strain was 48.5 mm after 24 hours. In comparison the spread of
11
Downloaded from 230 Bps∆ppiB was reduced to 24.5 mm (P-value 0.0022, Mann Whitney U-test), but was not
231 restored in the complemented strain, consistent with the partial restoration of motility
232 associated proteins levels as shown by the proteomics studies. This suggests a role for
233 PpiB in motility although further research is required to determine if this is a direct effect http://iai.asm.org/ 234 on the flagellum or due to regulatory or sensory deficits.
235
236 Another important survival mechanism in the environment and potentially for
237 establishing a chronic infection is the ability to form a biofilm. BpsΔppiB demonstrates on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
238 significant attenuation in the formation of biofilms under nutrient rich conditions
239 compared to BpsWT (P-value 0.0022, Mann-Whitney U-test), again this was not
240 restored in the complemented strain (Fig 6B).
241
242 BpsΔppiB has greater susceptibility to antimicrobial and intracellular stresses.
243 The reduced survival of Bps∆ppiB under both in vitro and in vivo conditions may be a
244 consequence of incorrect folding of proteins involved in resistance to intracellular
245 stresses such as peroxide and acid tolerance. This was determined by minimum
246 inhibitory concentrations (MIC) of Bps∆ppiB to hydrogen peroxide and hydrochloric acid.
247 BpsΔppiB demonstrates greater sensitivity towards oxidative stress, with a significant 3-
248 fold reduction in the MIC of hydrogen peroxide exposure compared to BpsWT, which is
249 partially restored in Bps∆ppiB/ppiB (Fig 7). There was however, no increased
250 susceptibility to acid stress perhaps reflected in the ability of Bps∆ppiB to survive in
251 cells (Supplementary Table 2). 12
Downloaded from 252
253 B. pseudomallei is intrinsically resistant to antimicrobials which are cleared by active
254 efflux pumps (9). It is feasible that PpiB may be involved in protein folding of some efflux
255 pumps, as such the susceptibility to antimicrobials was investigated. In particular the http://iai.asm.org/ 256 MIC to antimicrobials that are currently used for B. pseudomallei treatment was
257 determined (Table 1). BpsΔppiB displayed a 4-fold increase in susceptibility (128
258 µg/mL to 8 µg/mL) to the 3rd-generation cephalosporin ceftriaxone. B. pseudomallei is
259 intrinsically resistant to 3rd-generation cephalosporins, indicating that some mechanism on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 260 of resistance is being modulated by PpiB. There was a 2-fold decrease in resistance to
261 tetracycline (2 µg/mL to 0.5 µg/mL) and its derivative doxycycline (1 µg/mL to <0.25
262 µg/mL). Tetracyclines are involved in protein synthesis inhibition and the main
263 mechanism of resistance in B. pseudomallei is efflux out of the cell, confirming a
264 potential role for ppiB in the correct folding of efflux pumps. The complemented strain,
265 Bps∆ppiB/ppiB, partially restores resistance to those of wild type levels.
266
267 Discussion 268 Previous work has demonstrated that cyclophilin B plays a role in modulating virulence
269 in a number of bacterial species resulting in attenuation in vivo (32, 33, 38, 39).
270 Consistent with these studies we demonstrate that Cyclophilin B in B. pseudomallei
271 influences multiple virulence associated phenotypes with loss of the ppiB gene resulting
272 in complete attenuation in the BALB/c mouse infection model (Fig 2). Although most
273 work has focused on the role of cyclophilins in virulence, recently the direct interaction
13
Downloaded from 274 of cyclophilin B with intracellular proteins important for bacterial growth and survival
275 such as DnaK, AccC and FtsZ has been reported (34, 35, 39-41). It is shown here that
276 B. pseudomallei deletion of ppiB leads to pleiotropic effects including stress intolerance,
277 reduction in motility and biofilm formation. Furthermore, the direct effect of ppiB loss on http://iai.asm.org/ 278 the proteome homeostasis of B. pseudomallei has been defined. Key pathways
279 important for virulence modulation have been identified and disrupted, providing
280 evidence of the importance of PpiB in bacterial protein folding and overall virulence.
281 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
282 B. pseudomallei is able to infect a wide range of cells in order to survive and cause
283 disease (42). Infection of murine macrophages demonstrated that BpsΔppiB retained its
284 ability to adhere and invade macrophage cells with reduced survival 6 and 9 hours post
285 infection (Fig 1), with intracellular counts similar to the parental control reached by 12
286 hours. This delayed growth phenotype has been shown with the disruption of type VI/III
287 secretion systems and is important in cell-to-cell spread of B. pseudomallei (27, 43, 44).
288 BpsΔppiB is unable to effectively spread intracellularly as determined by
289 immunofluorescence and cause cell fusion into MNGC, with complementation studies
290 showing restoration of the BpsWT phenotype (Fig 3B). As seen 12 hours post-infection
291 BpsWT and the complemented strain BpsΔppiB/ppiB display marked bacterial
292 movement throughout the monolayer and cellular fusion into MNGC (Fig 3A and 3C).
293 Enumeration of nuclei also indicates a significant reduction in the formation of MNGC in
294 BpsΔppiB, which is restored in the complement BpsΔppiB/ppiB (Fig 3D).
295 Complementation is observed despite only a 10% restoration of PpiB protein levels,
296 demonstrating that even low levels of PpiB is sufficient to overcome some virulence 14
Downloaded from 297 deficiencies, something which has been previously noted in Saccharomyces cerevisiae
298 (45). This lack of cell-to-cell spread is characteristic of various mutants of the T6SS
299 cluster-1 (26, 27, 46), in particular T6SS Cluster 1 mutants ∆hcp1 and ∆vgrG1 (26, 27).
300 It is hypothesized that PpiB is playing a role in either folding or regulating the expression http://iai.asm.org/ 301 of Type VI Secretion Systems in B. pseudomallei. It is reported that T6SSs in B.
302 pseudomallei are kept under strict transcriptional control and are only induced upon
303 invasion of macrophages (24), yet despite this our proteomic data showed an increase
304 in BPSS2098 (Hcp-1, 1.10 log2, -log10(P-value): 3.05) and BPSS2099 (Tss-1, 4.06 log2, on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 305 -log10(P-value): 1.8), two proteins belonging to T6SS-3, a cluster which is usually not
306 expressed in nutrient media (27, 47). Interestingly BPSL3097 (-1.28 log2, -log10(P-
307 value): 6.12), BPSL3099 (-0.87 log2, -log10(P-value): 2.89), BPSL3105 (-0.75 log2, -
308 log10(P-value): 3.31), BPSL3106 (-0.51 log2, -log10(P-value): 2.45) and BPSl3108 (-
309 0.82 log2, -log10(P-value): 4.37) were all decreased in BpsΔppiB. These belong to
310 T6SS Cluster 6 which has been shown to be the only T6SS expressed in nutrient media
311 (27). This again points to a dysregulation of transcriptional or translational control.
312 Additionally, a MarR-family regulator (BPSL3431) shown to be involved in regulation of
313 T6SS transcription was downregulated (-0.67 log2, -log10(P-value): 3.40) (48). This
314 indicates that T6SS proteins are escaping their tight transcriptional control in nutrient
315 media, and it is hypothesized the same is occurring upon infection in cells resulting in a
316 malfunctional T6SS and hence the loss of MNGC formation. Further assessment of the
317 transcriptome and proteome of BpsΔppiB upon invasion of macrophages would be
318 useful to verify if PpiB is playing a role at the transcriptional or translational level of
319 T6SS regulators or machinery. This also explains the clearance of infection in the
15
Downloaded from 320 BALB/c mouse studies where no viable bacteria were recovered at the end of the
321 experiment demonstrating the essential role of PpiB and its potential as a novel anti-
322 virulence target.
323 http://iai.asm.org/
324 Motility and biofilm formation are important for establishing B. pseudomallei infection
325 (13, 15). Deletion of the flagellum, ΔfliC, has been shown to be important for virulence in
326 the BALB/c mouse infection model (15, 49). Here a decrease in the protein levels of
327 FliC (BPSL3319, -3.38 log2, -log10(P-value): 5.81) is observed, consistent with the on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
328 reduction in motility in BpsppiB with recent studies have demonstrated that PpiB from
329 Clostridioides difficle interacts with FliC using bacterial two-hybrid systems (50).
330 Furthermore, reduced levels of CheB1 (BPSL3301, -2.48 log2, -log10(P-value): 6.02)
331 and CheW (BPSL3305, -2.78 log2, -log10(P-value): 4.38) (Fig 6B), important for
332 chemotactic directed motility (51-54), may also contribute to the observed reduction in
333 motility. As BpsΔppiB only displayed a decrease in motility, not a complete loss, there is
334 potentially a dysregulation of the signal transduction pathways leading to a delay or
335 absence of appropriate signalling to begin movement, rather than elimination of the
336 flagellum in BpsΔppiB, although additional studies are required to validate this. Motility
337 has also been implicated as an important factor for biofilm production with ΔfliC mutants
338 showing a decrease in biofilm production (55). Transcriptomics have identified B.
339 pseudomallei genes important in biofilm formation (56) and of these genes flagged as
340 differentially regulated, 12 were present at opposing protein abundance in BpsΔppiB
341 possibly explaining the decrease in biofilm formation by BpsΔppiB (Fig 6B), with genes
16
Downloaded from
342 such as universal stress proteins (BPSS0837, -1.16 log2, -log10(P-value): 4.66;
343 BPSS1140, -0.57 log2, -log10(P-value): 2.03), receptors (BPSS1742, -1.22 log2, -
344 log10(P-value): 4.10) and efflux pumps (BPSL0816, 0.35 log2, -log10(P-value): 2.13)
345 being differentially expressed. This decrease in biofilm formation is in stark contrast to http://iai.asm.org/ 346 what has been reported in E. coli where PpiB is a negative regulator of both biofilm and
347 motility with deletion of ppiB resulting in hypermotility and increased biofilm production
348 (34). This disparity may indicate different roles for PpiB in E. coli and B. pseudomallei,
349 but a lack of in vivo data with ΔppiB makes it difficult to determine the overall effect on on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 350 virulence.
351
352 Cyclophilin B in Gram-negatives are known to play a role in response to a variety of
353 stresses encountered during infection (32). B. pseudomallei is exposed to reactive
354 oxidising species within phagocytes, a natural defence mechanism for eukaryotic cells
355 (57), with loss of ppiB increasing the susceptibility to oxidative stress (Fig 7). Others
356 have shown that there are a variety of mechanisms by which B. pseudomallei responds
357 to and tolerates oxidative stress, with quorum sensing regulating gene expression of
358 genes important in protecting the cell against DNA damage as well as polyphosphate
359 kinases playing a role (55, 58, 59). Although none of these genes appear in the
360 proteomics screen, proteins involved in stress (BPSS0837 -1.3 log2, -log10(P-value):
361 3.63, BPSS1140 -0.57 log2, -log10(P-value): 2.03) and OmpR, an oxidative stress two-
362 component system transcriptional regulator (BPSL2094, -0.53 log2, -log10(P-value):
363 2.69), are decreased and may play an as of yet unknown role in oxidative stress
17
Downloaded from 364 response. These results indicate that other currently unknown mechanisms may exist to
365 combat oxidative stress and this warrants further investigation.
366
367 B. pseudomallei has a number of chromosomally encoded genes associated with http://iai.asm.org/
368 antimicrobial resistance and hence is intrinsically resistant to most antibiotics used to
369 treat serious infections (9). BpsΔppiB has increased susceptibility to ceftriaxone,
370 tetracycline and doxycycline, antibiotics currently used for treatment of melioidosis
371 (Table 1) (7, 8). Resistance to these antibiotics is shown to be moderated by on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
372 Resistance-Nodulation Division (RND) efflux pumps (60), of which B. pseudomallei
373 strain K96243 has 10 annotated within its genome, as well as by beta-lactamases (9,
374 61). Differences in the protein levels of the efflux pump components, AmrA (BPSL1804,
375 -1.66 log2, -log10(P-value): 2.98), BpeB (BPSL0815 0.2 log2, -log10(P-value): 1.97) and
376 OprB (BPSL2094, -0.53, -log10(P-value): 2.69), indicate that loss of PpiB may result in
377 malfunctioning pumps. It is hypothesized that deletion of ppiB results in a reduction of
378 the pump components, making ineffective pumps and restoring susceptibility to certain
379 antibiotics.
380
381 There are many reports on the pleiotropic effects that immunophilin proteins have in
382 cells, this study demonstrates that virtually every compartment within the cell displays
383 gross proteomic changes, especially those involved in metabolism and genetic
384 information processing (32, 34, 38, 50, 62). It has recently been shown by Rasch et al
385 (38) that proteins from the immunophilin family also have the ability to compensate one
18
Downloaded from 386 another, in this case the macrophage infectivity potentiator (Mip) protein, belonging to
387 the FK506-binding protein family, is able to compensate for the loss of PpiB in L.
388 pneumophila (38). This compensatory effect has always been theorised, these studies
389 show that there is an increase in the protein levels of three immunophilin proteins, Mip http://iai.asm.org/ 390 (BPSS1823, 0.98 log2, -log10(P-value): 2.42), PpiA (BPSL2245, 1.1 log2, -log10(P-
391 value): 3.05) and SurA (BPSL0659, 0.53 log2, -log10(P-value): 2.53), whether these
392 proteins can compensate and to what degree for PpiB loss in B. pseudomallei requires
393 further investigation. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 394
395 To conclude, PpiB in B. pseudomallei is essential for virulence with the deletion mutant
396 BpsΔppiB displaying pleiotropic effects on virulence determinants such as the flagella,
397 biofilm production and antimicrobial susceptibility. Infection of macrophages with
398 BpsΔppiB displayed a delayed growth phenotype and an inability to cause fulminant
399 disease in BALB/c mice. On closer investigation it was shown that this was due to
400 BpsΔppiB being unable to spread cell-to-cell and form MNGCs, indicating that
401 clearance of infection occurs in vivo. Whole cell proteomic analysis reveals marked
402 changes in the proteome including proteins previously shown to be important for cell-to-
403 cell spread and virulence of B. pseudomallei and has also identified a plethora of new
404 proteins potentially playing an important role in infection. Although further work still
405 needs to be conducted to demonstrate the direct interactions of PpiB with its folding
406 partners, it is clear that PpiB is essential for the correct protein folding of virulence
407 determinants in B. pseudomallei, thus making it indispensable for virulence.
19
Downloaded from 408
409 Materials and methods
410 Bacterial strains and growth conditions. The bacterial strains used in this study are
411 shown in Table 2. All bacterial strains were grown in Luria Bertani (LB) broth overnight http://iai.asm.org/
412 at 37°C with agitation unless stated otherwise. Antibiotics were used at final
413 concentrations of: ampicillin, 50 µg/ml; chloramphenicol, 30 µg/ml; kanamycin, 50 µg/ml.
414 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 415 Construction of in-frame deletion mutant of ppiB. Construction of B. pseudomallei
416 in-frame deletion mutants was performed using the technique previously described by
417 Logue et al (37). For ppiB a 449-bp upstream flanking region and a 403-bp downstream
418 flanking region were amplified by Polymerase Chain Reaction (PCR) from B.
419 pseudomallei K96243 genomic DNA (obtained using Qiagen Gentra Purgene
420 Yeast/Bact Kit) using the primer pairs ppiB_UP_F/ppiB_UP_R
421 (TCTAGATTCCATCGCGTGATCAAGGG/ AGATCTTGGTTCCTTCGATGGATGGG)
422 and ppiB_DN_F/ppiB_DN_R (AGATCTGGGATGTTGCAGGAGACACC/
423 TCTAGATTGCCGAACGCGACGATG). Restriction sites were incorporated into the
424 primers to allow for the ligation of the flanks to one another (using BglII) and XbaI to
425 allow for the insertion of the joint flanks into the suicide plasmid, pDM4. Upon
426 construction of an upstream-downstream fragment and its subsequent ligation into
427 pDM4, the construct was transformed by heat shock into E. coli S17-1 λpir which were
428 made calcium competent, and selected for with the antibiotic chloramphenicol.
429 Following conjugation with B. pseudomallei K96243, merodiploid integrants that has
20
Downloaded from 430 successfully integrated the upstream-downstream-pDM4 construct were identified using
431 double antibiotic selection of ampicillin/chloramphenicol. A merodiploid integrant was
432 plated onto LB agar lacking sodium chloride but containing 10 % sucrose. sacB counter-
433 selection was used to select for the excision of the pDM4 backbone, resulting in an in- http://iai.asm.org/ 434 frame unmarked deletion. Colonies were subsequently screened for chloramphenicol
435 sensitivity and analysed by PCR to determine their phenotype; wild-type revertant or in-
436 frame deletion mutant. Colonies determined to be in-frame deletion mutants had the site
437 of recombination sequenced (Sanger sequencing) to confirm a 492-bp deletion of ppiB. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 438 The mutant strain, B. pseudomallei∆ppiB (BpsΔppiB) and the parent B. pseudomallei
439 K96243 strain was sequenced using Illumina MiSeq (Murdoch University, Perth,
440 Western Australia) or HiSeq2500 (Australian Genome Research Facility, Melbourne,
441 Australia) respectively. Whole genome sequencing data was aligned to the K96243
442 reference genome (versions NC_006350.1 [chromosome 1] and NC_006350.1
443 [chromosome 2]) and variants were identified using the SPANDx pipeline (62).
444
445 J774A.1 murine macrophage infection assay. J774A.1 murine macrophages were
446 seeded into a 24-well tissue culture treated plate at a concentration of 4 x 105 cells/mL
447 in Dulbecco’s modified eagle’s medium (DMEM) (Gibco) supplemented with a final
448 concentration of 1 % GlutaMAX (Gibco, Life Technologies) and 10 % heat-inactivated
449 fetal calf serum (Gibco, Life Technologies, Lot #1939338) and incubated for 20 hours at
450 37°C with 5 % CO2. B. pseudomallei strains were grown overnight at 37°C for 18 hrs
451 and adjusted in Leibovitz L-15 medium (Gibco) supplemented with 1 % GlutaMAX and
452 10 % heat-inactivated fetal calf serum to an absorbance between 0.35 and 0.4 at 580 21
Downloaded from 453 nm using a PLP Colourimeter. Strains were serially diluted in L-15 medium and 1 mL of
454 bacteria was added to each well at a multiplicity of infection (MOI) of 10 and incubated
455 30 minutes at 37°C. To determine the exact starting inoculum at time of infection
456 bacteria were further serially diluted and plated on LB agar. Bacteria were aspirated off http://iai.asm.org/ 457 the cell monolayer and infected cells were gently washed three times with PBS (Life
458 Technologies, autoclaved and filter sterilised) and then incubated with L-15 medium
459 containing 1 mg/mL kanamycin for a further 30 minutes at 37°C to kill extracellular
460 bacteria. The supernatant was removed and infected cells were then incubated with L- on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 461 15 media containing 250 µg/mL kanamycin for 12 hours. At 0, 3, 6, 9 and 12 hours post-
462 infection, cell monolayers were lysed with 1 mL MilliQ water and serially diluted in 1 mL
463 PBS and plated onto LB agar for bacterial enumeration.
464
465 Determination of Minimum Inhibitory Concentration (MIC) and susceptibility to
466 stress. Broth microdilutions were tested against a variety of antibiotic classes as
467 described in (63) with the following modifications. Strains were incubated overnight in
468 Mueller Hinton Broth (MHB) at 37°C. Overnight cultures were diluted 1:50 in fresh MHB
469 and were incubated at 37°C for 1 hour with agitation. Antibiotics were 2-fold serially
470 diluted across a 96-well plate in MHB with a final volume of 100 µL with an antibiotic
471 range of 256 to 0.25 μg/mL. Following bacterial incubation, 100 µL of each strain was
472 added to antibiotic containing media in a 96 well plate and incubated statically at 37°C
473 for 24 hours. Optical density of plates was read at an optical density of 590 nm using a
474 spectrophotometer (BioRad Xmark). The Minimum Inhibitory Concentration (MIC) was
22
Downloaded from 475 called as the minimum antibiotic concentration needed to keep overnight growth to
476 under 20% of the unexposed bacterial growth control.
477
478 Motility assay. Assessment of motility was performed as described in (64). Briefly, B. http://iai.asm.org/
479 pseudomallei strains were incubated at 37°C overnight with agitation. One microliter of
480 overnight culture was stabbed into the middle of a 0.3 % motility agar using a sterile
481 inoculation loop and plates were incubated upright for 24 hours upon which the distance
482 of bacterial spread was measured. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
483
484 Biofilm Forming Capacity Assay. Biofilm assays were performed according following
485 the methodology in (65) but with the following modifications. B. pseudomallei strains
486 were incubated overnight at 37°C with agitation. The following day 2% of overnight
487 culture (v/v) was inoculated into fresh media and incubated for a further 24 hours at
488 37°C with agitation. Overnight cultures (200µL) were added to a 96-well plate and
489 incubated for 3 hours at 37°C to allow for adhesion. Supernatant was gently aspirated to
490 avoid disturbing the adhered cells and fresh Luria Bertani Broth was added and
491 incubated at 37°C for a further 24 hours. Supernatant was aspirated and biofilms were
492 washed once with PBS and fresh LBB media added and incubated for a further 24
493 hours. On the final day supernatant was removed and biofilms were washed three times
494 with PBS before being fixed with methanol and allowed to air dry. Cells were stained
495 with 2 % crystal violet, with excess stain removed with running ddH2O and plates were
23
Downloaded from 496 allowed to air dry. Dye bound to cells was solubilised with 33 % Glacial acetic acid and
497 the optical density was read at 590 nm on a spectrophotometer (BioRad X-Mark).
498
499 BALB/c murine infection model http://iai.asm.org/
500 Investigations involving animals were carried out according to the requirements of the
501 United Kingdom Animal (Scientific Procedures) Act 1986 under project licence PPL
502 30/3026. This project licence was approved following an ethical review by Dstl's Animal
503 Welfare and Ethical Review Body. Studies were performed using female BALB/cAnNCrl on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
504 mice (BALB/c; Charles River, UK) implanted with a subcutaneous Pico transponder
505 (Uno BV, Netherlands) to allow individual mice to be tracked through the study. On
506 arrival into containment level 3 animal facilities, mice were randomly allocated into
507 cages of five animals and acclimatised to their new surroundings for 5 days before any
508 procedures were performed. Animal husbandry practices and environmental conditions
509 during study were as described previously Scott et al (66). Challenges were performed
510 with B. pseudomallei K96243 prepared as described previously by Scott et al (66) and
511 delivered via the intraperitoneal route. Mice received 1.1 x 104 CFU B. pseudomallei
512 K96243 and 1.86 104 CFU Bps∆ppiB, 6 in each group. Mice were checked at least twice
513 daily following challenge and clinical signs for each mouse recorded for five weeks post‐
514 infection. Humane end‐points were used throughout these studies to minimise suffering,
515 with culls performed via cervical dislocation at the end‐point. At the end of the study,
516 animals were culled and organs removed for enumeration of bacterial burden (lungs,
24
Downloaded from 517 liver, spleen). These were homogenised through 40 μm sieves into PBS, serially diluted
518 and plated onto LB agar.
519
520 Complementation studies. http://iai.asm.org/
521 The open reading frame of BPSL2246 (ppiB) was amplified from genomic DNA of B.
522 pseudomallei K96243 using the primers ppiB_For/ppiB_Rev
523 (CTGCAGATGGTCGAACTGCATACG/CTGCAGGGACCACGACGGCCTTCT) and the
524 resulting product was ligated into pJR3XFLAG that incorporated a 3XFLAG tag on the on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
525 C-terminal end of the gene. This was then amplified with the primers
526 ppiB_pET_For/BamHI_stop_FLAG_Rev
527 (CATATGGTCGAACTGCATACGAAC/GGATCCTTACTTGTCATCGTCATCCTTAT).
528 The PCR product was inserted into the SmaI/BamHI restriction sites of pBBR1-MCS1.
529 The complementation construct was transformed into E. coli ST18 and conjugated into
530 Bps∆ppiB. Conjugates were selected on LB agar containing 30 μg/mL chloramphenicol.
531 In experiments the complemented mutant strain (Bps∆ppiB/ppiB) was grown in LB broth
532 containing 30 μg/mL chloramphenicol.
533
534 Immunofluorescence. J774A.1 macrophages (seeded at approximately 4 x 105
535 cells/well) were grown overnight on 13 mm round coverslips in a 24 well plate at 37°C
536 with 5% CO2. Macrophages were infected with B. pseudomallei strains at an MOI of 10
537 as described above in the J774.A1 murine macrophage infection assay. At 12 hours
538 post infection monolayers were washed 3 times with PBS for 5 minutes and fixed with 25
Downloaded from 539 100 % methanol for 30 minutes, then washed 3 times with PBS for 5 minutes.
540 Monolayers were stained at room temperature using the following protocol. Monolayers
541 were blocked with 5 % (v/v) FCS/PBS for 2 hours to block non-specific binding and then
542 washed 3 times for 2 minutes each. Cells were incubated with anti-B. pseudomallei-LPS http://iai.asm.org/ 543 at 1 µg/mL (1:100; Mab4VIH12) for 1 hour, after which they underwent 3 times 2
544 minutes washes. Monolayers were incubated with a secondary Anti-mouse-whole IgG-
545 FITC (1:64; Sigma Aldrich) for 1 hour followed by three times 2-minute washes. Nuclei
546 were stained using Hoescht33258 (1:10,000; ThermoFisher Scientific) for 15 minutes on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 547 followed by 2 x 2 minute washes. Coverslips were mounted onto glass slides using
548 Prolong Gold Anti-Fade reagent (Invitrogen). Fluorescence microscopy was performed
549 using a Nikon Eclipse Ts2R microscope and images were acquired using the NIS-
550 Elements software (Nikon).
551
552 Multinucleated Giant Cell enumeration (MNGC). Evaluation of MNCG formation was
553 conducted using fluorescently stained cell monolayers described above. Using
554 previously published metrics (67); 1000 nuclei per coverslip were counted and the
555 percentage of MNGC formation was calculated using the following equation;
number of nuclei within multinucleated cells MNGC (%)= X 100 total nuclei counted
556
557 Protein clean up and In-solution digestion. Cell preparations were solubilized in lysis
558 buffer (4 % SDS, 10 mM DTT, 100 mM Tris pH 8.5) by boiling for 10 minutes and the
26
Downloaded from 559 protein content assess by BCA protein assay according to the manufacturer's
560 instruction. 100 ug of protein from each sample was acetone precipitated by mixing 4
561 volumes of ice-cold acetone with one volume of sample. Samples were precipitated
562 overnight at -20°C and then spun down at 4000 x g for 10 minutes at 4°C. The http://iai.asm.org/ 563 precipitated protein pellets were resuspended with 80 % ice-cold acetone and
564 precipitated for an additional 4 hours at -20°C. Samples were spun down at 17000 x g
565 for 10 minutes at 4°C to collect precipitated protein, the supernatant was discarded and
566 excess acetone driven off at 65°C for 5 minutes. Dried protein pellets were resuspended on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 567 in 6 M urea, 2 M thiourea, 40 mM NH4HCO3 and reduced / alkylated prior to digestion
568 with Lys-C (1/200 w/w) then trypsin (1/50 w/w) overnight as previously described (68).
569 Digested samples were acidified to a final concentration of 0.5 % formic acid, desalted
570 with homemade C18 stage tips (69, 70), eluted with buffer B (80 % ACN, 0.1 % formic
571 acid) and bound peptides eluted with buffer B then dried.
572
573 LFQ based quantitative proteome LC-MS. Purified peptides were resuspended in
574 Buffer A* and separated using a two-column chromatography set up comprising a
575 PepMap100 C18 20 mm x 75 μm trap and a PepMap C18 500 mm x 75 μm analytical
576 column (ThermoFisher Scientific). Samples were concentrated onto the trap column at 5
577 μl/min for 5 mins and infused into an Orbitrap Elite™ Mass Spectrometer (ThermoFisher
578 Scientific) at 300 nl/min via the analytical column using a Dionex Ultimate 3000 UPLC
579 (ThermoFisher Scientific). 90 min gradients were run altering the buffer composition
580 from 1 % buffer B to 28 % B over 60 mins, then from 28 % B to 40 % B over 10 mins,
581 then from 40 % B to 100 % B over 2 mins, the composition was held at 100 % B for 3
27
Downloaded from 582 mins, and then dropped to 3 % B over 5 mins and held at 3 % B for another 10 mins.
583 The Elite™ Mass Spectrometer was operated in a data-dependent mode automatically
584 switching between the acquisition of a single Orbitrap MS scan (120,000 resolution)
585 followed by 20 data-dependent CID MS-MS events (NCE 35) were allowed with 30 http://iai.asm.org/ 586 seconds dynamic exclusion enabled.
587
588 Mass spectrometry data analysis. Identification of proteins was accomplished using
589 MaxQuant (v1.5.3.1) (71). Searches were performed against the Burkholderia on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 590 pseudomallei strain K96243 (Uniprot proteome id UP000000605, downloaded 10-07-
591 2018, 5,717 entries) proteomes with carbamidomethylation of cysteine set as a fixed
592 modification. Searches were performed with trypsin cleavage specificity allowing 2
593 miscleavage events and the variable modifications of oxidation of methionine and
594 acetylation of protein N-termini. The precursor mass tolerance was set to 20 parts-per-
595 million (ppm) for the first search and 10 ppm for the main search, with a maximum false
596 discovery rate (FDR) of 1.0 % set for protein and peptide identifications. To enhance the
597 identification of peptides between samples the Match Between Runs option was
598 enabled with a precursor match window set to 2 minutes and an alignment window of 10
599 minutes. For label-free quantitation, the MaxLFQ option within Maxquant (72) was
600 enabled in addition to the re-quantification module. The resulting protein group output
601 was processed within the Perseus (v1.4.0.6) (73) analysis environment to remove
602 reverse matches and common protein contaminates prior. GO terms and associated
603 annotation was downloaded from Uniprot (Uniprot proteome id UP000000605,
604 downloaded 10-07-2018). For LFQ comparisons missing values were imputed using
28
Downloaded from 605 Perseus and Pearson correlations visualized using Perseus and R. Determination of
606 significant changes was undertaken using a two-sample t-test within Perseus where
607 proteins were considered significant if the mean difference between groups was great
608 then or less than one-fold change and satisfied a Benjamini-Hochberg multiple http://iai.asm.org/ 609 hypothesis corrected FDR of below 0.05 which corresponds to a -log10(P-value) of 1.73
610 or p-value of 0.018. The mass spectrometry proteomics data have been deposited to
611 the ProteomeXchange Consortium via the PRIDE (74) partner repository with the
612 dataset identifier PXD012956. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 613
614 Statistical Analysis. All numerical results were analysed using Microsoft Excel 2010.
615 Statistical analyses performed using GraphPad Prism version 8.0. For growth curves,
616 motility, biofilm, MIC, intracellular infection and cell cytotoxicity assays, a Mann-Whitney
617 U-test was used to determine the difference between strains. The Log-rank (Mantel-
618 Cox) test was used for the animal studies. A Student’s t-test was used for MNGC
619 formation. Significance is indicated as follows: *, P-value <0.05; **, P-value <0.01; ****,
620 P-value <0.0001.
621
622 Acknowledgements
623 NB was supported by an Australian Government Research Training Program
624 Scholarship. MST and TJJI were funded by NATO (SPF984835). This work was
625 partially supported by National Health and Medical Research Council of Australia
626 (NHMRC) project grants awarded to NES (APP1100164). We would like to thank the
29
Downloaded from 627 Melbourne Mass Spectrometry and Proteomics Facility of The Bio21 Molecular Science
628 and Biotechnology Institute at The University of Melbourne for support, maintenance
629 and access to mass spectrometry infrastructure for proteomic analysis. We would like to
630 thank Dr Nathan Pavlos for providing an aliquot of Hoecsht33258 to use for the http://iai.asm.org/ 631 immunofluorescence studies. We would also like to thank Dr Joshua Ramsay for
632 providing ST18 strain of E. coli used in conjugation as well as the plasmid pJR3XFLAG
633 to help with the construction of the complementation strain.
634 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 635 References
636 1. Dance DA. 2000. Ecology of Burkholderia pseudomallei and the interactions
637 between environmental Burkholderia spp. and human-animal hosts. Acta Trop
638 74:159-68.
639 2. Dance DA. 2000. Melioidosis as an emerging global problem. Acta Trop 74:115-
640 9.
641 3. Currie BJ. 2008. Advances and remaining uncertainties in the epidemiology of
642 Burkholderia pseudomallei and melioidosis. Trans R Soc Trop Med Hyg 102:225-
643 7.
644 4. Limmathurotsakul D, Golding N, Dance DA, Messina JP, Pigott DM, Moyes CL,
645 Rolim DB, Bertherat E, Day NP, Peacock SJ, Hay SI. 2016. Predicted global
646 distribution of Burkholderia pseudomallei and burden of melioidosis. Nat
647 Microbiol 1:15008.
30
Downloaded from 648 5. Currie BJ, Ward L, Cheng AC. 2010. The epidemiology and clinical spectrum of
649 melioidosis: 540 cases from the 20 year Darwin prospective study. PLoS Negl
650 Trop Dis 4:e900.
651 6. Limmathurotsakul D, Chaowagul W, Chierakul W, Stepniewska K, Maharjan B, http://iai.asm.org/ 652 Wuthiekanun V, White NJ, Day NP, Peacock SJ. 2006. Risk factors for recurrent
653 melioidosis in northeast Thailand. Clin Infect Dis 43:979-86.
654 7. Pitman MC, Luck T, Marshall CS, Anstey NM, Ward L, Currie BJ. 2015.
655 Intravenous therapy duration and outcomes in melioidosis: a new treatment on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 656 paradigm. PLoS Negl Trop Dis 9:e0003586.
657 8. Wiersinga WJ, Currie BJ, Peacock SJ. 2012. Melioidosis. N Engl J Med
658 367:1035-44.
659 9. Schweizer HP. 2012. Mechanisms of antibiotic resistance in Burkholderia
660 pseudomallei: implications for treatment of melioidosis. Future Microbiol 7:1389-
661 99.
662 10. Sarovich DS, Webb JR, Pitman MC, Viberg LT, Mayo M, Baird RW, Robson JM,
663 Currie BJ, Price EP. 2018. Raising the Stakes: Loss of Efflux Pump Regulation
664 Decreases Meropenem Susceptibility in Burkholderia pseudomallei. Clinical
665 Infectious Diseases 67:243-250.
666 11. Currie BJ, Fisher DA, Howard DM, Burrow JNC, Lo D, Selva-nayagam S, Anstey
667 NM, Huffam SE, Snelling PL, Marks PJ. 2000. Endemic melioidosis in tropical
668 northern Australia: a 10-year prospective study and review of the literature.
669 Clinical Infectious Diseases 31:981-986.
31
Downloaded from 670 12. Kamjumphol W, Chareonsudjai S, Chareonsudjai P, Wongratanacheewin S,
671 Taweechaisupapong S. 2013. Environmental factors affecting Burkholderia
672 pseudomallei biofilm formation. Southeast Asian J Trop Med Public Health 44:72-
673 81. http://iai.asm.org/ 674 13. Kunyanee C, Kamjumphol W, Taweechaisupapong S, Kanthawong S,
675 Wongwajana S, Wongratanacheewin S, Hahnvajanawong C, Chareonsudjai S.
676 2016. Burkholderia pseudomallei Biofilm Promotes Adhesion, Internalization and
677 Stimulates Proinflammatory Cytokines in Human Epithelial A549 Cells. PLoS on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 678 One 11:e0160741.
679 14. Panomket P, Wongsana P, Wanram S, Wongratanacheewin S. 2017.
680 Burkholderia pseudomallei biofilm plays a key role in chronic inflammation in
681 C57BL/6 mice. Southeast Asian J Trop Med Public Health 48:73-82.
682 15. Chua KL, Chan YY, Gan YH. 2003. Flagella are virulence determinants of
683 Burkholderia pseudomallei. Infect Immun 71:1622-9.
684 16. Chuaygud T, Tungpradabkul S, Sirisinha S, Chua KL, Utaisincharoen P. 2008. A
685 role of Burkholderia pseudomallei flagella as a virulent factor. Trans R Soc Trop
686 Med Hyg 102 Suppl 1:S140-4.
687 17. Stevens MP, Wood MW, Taylor LA, Monaghan P, Hawes P, Jones PW, Wallis
688 TS, Galyov EE. 2002. An Inv/Mxi-Spa-like type III protein secretion system in
689 Burkholderia pseudomallei modulates intracellular behaviour of the pathogen.
690 Mol Microbiol 46:649-59.
32
Downloaded from 691 18. Willcocks SJ, Denman CC, Atkins HS, Wren BW. 2016. Intracellular replication of
692 the well-armed pathogen Burkholderia pseudomallei. Curr Opin Microbiol 29:94-
693 103.
694 19. Stevens MP, Haque A, Atkins T, Hill J, Wood MW, Easton A, Nelson M, http://iai.asm.org/ 695 Underwood-Fowler C, Titball RW, Bancroft GJ, Galyov EE. 2004. Attenuated
696 virulence and protective efficacy of a Burkholderia pseudomallei bsa type III
697 secretion mutant in murine models of melioidosis. Microbiology 150:2669-76.
698 20. Sun GW, Gan YH. 2010. Unraveling type III secretion systems in the highly on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 699 versatile Burkholderia pseudomallei. Trends Microbiol 18:561-8.
700 21. Warawa J, Woods DE. 2005. Type III secretion system cluster 3 is required for
701 maximal virulence of Burkholderia pseudomallei in a hamster infection model.
702 FEMS Microbiol Lett 242:101-8.
703 22. Allwood EM, Devenish RJ, Prescott M, Adler B, Boyce JD. 2011. Strategies for
704 Intracellular Survival of Burkholderia pseudomallei. Front Microbiol 2:170.
705 23. Pilatz S, Breitbach K, Hein N, Fehlhaber B, Schulze J, Brenneke B, Eberl L,
706 Steinmetz I. 2006. Identification of Burkholderia pseudomallei genes required for
707 the intracellular life cycle and in vivo virulence. Infect Immun 74:3576-86.
708 24. Shalom G, Shaw JG, Thomas MS. 2007. In vivo expression technology identifies
709 a type VI secretion system locus in Burkholderia pseudomallei that is induced
710 upon invasion of macrophages. Microbiology 153:2689-99.
711 25. Lennings J, West TE, Schwarz S. 2018. The Burkholderia Type VI Secretion
712 System 5: Composition, Regulation and Role in Virulence. Front Microbiol
713 9:3339.
33
Downloaded from 714 26. Schwarz S, Singh P, Robertson JD, LeRoux M, Skerrett SJ, Goodlett DR, West
715 TE, Mougous JD. 2014. VgrG-5 is a Burkholderia type VI secretion system-
716 exported protein required for multinucleated giant cell formation and virulence.
717 Infect Immun 82:1445-52. http://iai.asm.org/ 718 27. Burtnick MN, Brett PJ, Harding SV, Ngugi SA, Ribot WJ, Chantratita N, Scorpio
719 A, Milne TS, Dean RE, Fritz DL, Peacock SJ, Prior JL, Atkins TP, Deshazer D.
720 2011. The cluster 1 type VI secretion system is a major virulence determinant in
721 Burkholderia pseudomallei. Infect Immun 79:1512-25. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 722 28. Schell MA, Ulrich RL, Ribot WJ, Brueggemann EE, Hines HB, Chen D, Lipscomb
723 L, Kim HS, Mrázek J, Nierman WC. 2007. Type VI secretion is a major virulence
724 determinant in Burkholderia mallei. Molecular microbiology 64:1466-1485.
725 29. Dimou M, Venieraki A, Katinakis P. 2017. Microbial cyclophilins: specialized
726 functions in virulence and beyond. World Journal of Microbiology and
727 Biotechnology 33:164.
728 30. Lang K, Schmid FX, Fischer G. 1987. Catalysis of protein folding by prolyl
729 isomerase. Nature 329:268-70.
730 31. Zhu Y, Gong Y, Li A, Chen M, Kang D, Liu J, Yuan Y. 2018. Differential
731 Proteomic Analysis Reveals Protein Networks and Pathways that May Contribute
732 to Helicobacter pylori FKBP-Type PPIase-Associated Gastric Diseases.
733 Proteomics Clin Appl 12:e1700127.
734 32. Roset MS, Garcia Fernandez L, DelVecchio VG, Briones G. 2013. Intracellularly
735 induced cyclophilins play an important role in stress adaptation and virulence of
736 Brucella abortus. Infect Immun 81:521-30.
34
Downloaded from 737 33. Schmidt B, Tradler T, Rahfeld JU, Ludwig B, Jain B, Mann K, Rucknagel KP,
738 Janowski B, Schierhorn A, Kullertz G, Hacker J, Fischer G. 1996. A cyclophilin-
739 like peptidyl-prolyl cis/trans isomerase from Legionella pneumophila--
740 characterization, molecular cloning and overexpression. Mol Microbiol 21:1147- http://iai.asm.org/ 741 60.
742 34. Skagia A, Zografou C, Vezyri E, Venieraki A, Katinakis P, Dimou M. 2016.
743 Cyclophilin PpiB is involved in motility and biofilm formation via its functional
744 association with certain proteins. Genes Cells 21:833-51. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 745 35. Skagia A, Zografou C, Venieraki A, Fasseas C, Katinakis P, Dimou M. 2017.
746 Functional analysis of the cyclophilin PpiB role in bacterial cell division. Genes
747 Cells 22:810-824.
748 36. Walsh CT, Zydowsky LD, McKeon FD. 1992. Cyclosporin A, the cyclophilin class
749 of peptidylprolyl isomerases, and blockade of T cell signal transduction. Journal
750 of Biological Chemistry 267:13115-13118.
751 37. Logue CA, Peak IR, Beacham IR. 2009. Facile construction of unmarked deletion
752 mutants in Burkholderia pseudomallei using sacB counter-selection in sucrose-
753 resistant and sucrose-sensitive isolates. J Microbiol Methods 76:320-3.
754 38. Rasch J, Unal CM, Klages A, Karsli U, Heinsohn N, Brouwer R, Richter M,
755 Dellmann A, Steinert M. 2019. Peptidyl-Prolyl-cis/trans-Isomerases Mip and PpiB
756 of Legionella pneumophila Contribute to Surface Translocation, Growth at
757 Suboptimal Temperature, and Infection. Infect Immun 87.
35
Downloaded from 758 39. Dimou M, Venieraki A, Zografou C, Katinakis P. 2012. The cytoplasmic
759 cyclophilin from Azotobacter vinelandii interacts with phosphate acetyltransferase
760 isoforms enhancing their in vitro activity. Mol Biol Rep 39:4135-43.
761 40. Dimou M, Zografou C, Venieraki A, Katinakis P. 2012. Functional interaction of http://iai.asm.org/ 762 Azotobacter vinelandii cytoplasmic cyclophilin with the biotin carboxylase subunit
763 of acetyl-CoA carboxylase. Biochem Biophys Res Commun 424:736-9.
764 41. Skagia A, Vezyri E, Sigala M, Kokkinou A, Karpusas M, Venieraki A, Katinakis P,
765 Dimou M. 2017. Structural and functional analysis of cyclophilin PpiB mutants on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 766 supports an in vivo function not limited to prolyl isomerization activity. Genes
767 Cells 22:32-44.
768 42. Jones AL, Beveridge TJ, Woods DE. 1996. Intracellular survival of Burkholderia
769 pseudomallei. Infect Immun 64:782-90.
770 43. Burtnick MN, Brett PJ, Nair V, Warawa JM, Woods DE, Gherardini FC. 2008.
771 Burkholderia pseudomallei type III secretion system mutants exhibit delayed
772 vacuolar escape phenotypes in RAW 264.7 murine macrophages. Infect Immun
773 76:2991-3000.
774 44. Burtnick MN, DeShazer D, Nair V, Gherardini FC, Brett PJ. 2010. Burkholderia
775 mallei cluster 1 type VI secretion mutants exhibit growth and actin polymerization
776 defects in RAW 264.7 murine macrophages. Infect Immun 78:88-99.
777 45. Gemmill TR, Wu X, Hanes SD. 2005. Vanishingly low levels of Ess1 prolyl-
778 isomerase activity are sufficient for growth in Saccharomyces cerevisiae. J Biol
779 Chem 280:15510-7.
36
Downloaded from 780 46. Toesca IJ, French CT, Miller JF. 2014. The Type VI secretion system spike
781 protein VgrG5 mediates membrane fusion during intercellular spread by
782 pseudomallei group Burkholderia species. Infect Immun 82:1436-44.
783 47. Bernard CS, Brunet YR, Gueguen E, Cascales E. 2010. Nooks and crannies in http://iai.asm.org/ 784 type VI secretion regulation. J Bacteriol 192:3850-60.
785 48. Losada L, Shea AA, DeShazer D. 2018. A MarR family transcriptional regulator
786 and subinhibitory antibiotics regulate type VI secretion gene clusters in
787 Burkholderia pseudomallei. Microbiology 164:1196-1211. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 788 49. Inglis TJJ, Rigby P, Robertson TA, Dutton NS, Henderson M, Chang BJ. 2000.
789 Interaction between Burkholderia pseudomallei and Acanthamoeba species
790 results in coiling phagocytosis, endamebic bacterial survival, and escape.
791 Infection and immunity 68:1681-1686.
792 50. Ünal CM, Karagöz MS, Berges M, Priebe C, de Acuña JMB, Wissing J, Jänsch L,
793 Jahn D, Steinert M. 2019. Pleiotropic Clostridioides difficile cyclophilin PpiB
794 controls cysteine-tolerance, toxin production, the central metabolism and multiple
795 stress responses. Frontiers in Pharmacology 10.
796 51. Parkinson JS, Parker SR, Talbert PB, Houts SE. 1983. Interactions between
797 chemotaxis genes and flagellar genes in Escherichia coli. J Bacteriol 155:265-74.
798 52. Ravid S, Matsumura P, Eisenbach M. 1986. Restoration of flagellar clockwise
799 rotation in bacterial envelopes by insertion of the chemotaxis protein CheY. Proc
800 Natl Acad Sci U S A 83:7157-61.
37
Downloaded from 801 53. Rowsell EH, Smith JM, Wolfe A, Taylor BL. 1995. CheA, CheW, and CheY are
802 required for chemotaxis to oxygen and sugars of the phosphotransferase system
803 in Escherichia coli. J Bacteriol 177:6011-4.
804 54. Stock A, Chen T, Welsh D, Stock J. 1988. CheA protein, a central regulator of http://iai.asm.org/ 805 bacterial chemotaxis, belongs to a family of proteins that control gene expression
806 in response to changing environmental conditions. Proc Natl Acad Sci U S A
807 85:1403-7.
808 55. Tunpiboonsak S, Mongkolrob R, Kitudomsub K, Thanwatanaying P, on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 809 Kiettipirodom W, Tungboontina Y, Tungpradabkul S. 2010. Role of a
810 Burkholderia pseudomallei polyphosphate kinase in an oxidative stress
811 response, motilities, and biofilm formation. J Microbiol 48:63-70.
812 56. Chin CY, Hara Y, Ghazali AK, Yap SJ, Kong C, Wong YC, Rozali N, Koh SF,
813 Hoh CC, Puthucheary SD, Nathan S. 2015. Global transcriptional analysis of
814 Burkholderia pseudomallei high and low biofilm producers reveals insights into
815 biofilm production and virulence. BMC Genomics 16:471.
816 57. Babior BM. 2000. Phagocytes and oxidative stress. The American Journal of
817 Medicine 109:33-44.
818 58. Loprasert S, Whangsuk W, Sallabhan R, Mongkolsuk S. 2004. DpsA protects the
819 human pathogen Burkholderia pseudomallei against organic hydroperoxide. Arch
820 Microbiol 182:96-101.
821 59. Lumjiaktase P, Diggle SP, Loprasert S, Tungpradabkul S, Daykin M, Camara M,
822 Williams P, Kunakorn M. 2006. Quorum sensing regulates dpsA and the
38
Downloaded from 823 oxidative stress response in Burkholderia pseudomallei. Microbiology 152:3651-
824 9.
825 60. Viktorov DV, Zakharova IB, Podshivalova MV, Kalinkina EV, Merinova OA,
826 Ageeva NP, Antonov VA, Merinova LK, Alekseev VV. 2008. High-level resistance http://iai.asm.org/ 827 to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely
828 related species. Trans R Soc Trop Med Hyg 102 Suppl 1:S103-10.
829 61. Holden MT, Titball RW, Peacock SJ, Cerdeno-Tarraga AM, Atkins T, Crossman
830 LC, Pitt T, Churcher C, Mungall K, Bentley SD, Sebaihia M, Thomson NR, Bason on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 831 N, Beacham IR, Brooks K, Brown KA, Brown NF, Challis GL, Cherevach I,
832 Chillingworth T, Cronin A, Crossett B, Davis P, DeShazer D, Feltwell T, Fraser A,
833 Hance Z, Hauser H, Holroyd S, Jagels K, Keith KE, Maddison M, Moule S, Price
834 C, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Simmonds M,
835 Songsivilai S, Stevens K, Tumapa S, Vesaratchavest M, Whitehead S, Yeats C,
836 Barrell BG, Oyston PC, Parkhill J. 2004. Genomic plasticity of the causative
837 agent of melioidosis, Burkholderia pseudomallei. Proc Natl Acad Sci U S A
838 101:14240-5.
839 62. Sarovich DS, Price EP. 2014. SPANDx: a genomics pipeline for comparative
840 analysis of large haploid whole genome re-sequencing datasets. BMC Research
841 Notes 7:618.
842 63. Heine HS, England MJ, Waag DM, Byrne WR. 2001. In vitro antibiotic
843 susceptibilities of Burkholderia mallei (causative agent of glanders) determined
844 by broth microdilution and E-test. Antimicrob Agents Chemother 45:2119-21.
39
Downloaded from 845 64. Norville IH, Harmer NJ, Harding SV, Fischer G, Keith KE, Brown KA, Sarkar-
846 Tyson M, Titball RW. 2011. A Burkholderia pseudomallei macrophage infectivity
847 potentiator-like protein has rapamycin-inhibitable peptidylprolyl isomerase activity
848 and pleiotropic effects on virulence. Infect Immun 79:4299-307. http://iai.asm.org/ 849 65. Taweechaisupapong S, Kaewpa C, Arunyanart C, Kanla P, Homchampa P,
850 Sirisinha S, Proungvitaya T, Wongratanacheewin S. 2005. Virulence of
851 Burkholderia pseudomallei does not correlate with biofilm formation. Microb
852 Pathog 39:77-85. on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 853 66. Scott AE, Christ WJ, George AJ, Stokes MG, Lohman GJ, Guo Y, Jones M,
854 Titball RW, Atkins TP, Campbell AS. 2016. Protection against experimental
855 melioidosis with a synthetic manno-heptopyranose hexasaccharide
856 glycoconjugate. Bioconjugate chemistry 27:1435-1446.
857 67. Kespichayawattana W, Rattanachetkul S, Wanun T, Utaisincharoen P, Sirisinha
858 S. 2000. Burkholderia pseudomallei induces cell fusion and actin-associated
859 membrane protrusion: a possible mechanism for cell-to-cell spreading. Infect
860 Immun 68:5377-84.
861 68. Scott NE, Parker BL, Connolly AM, Paulech J, Edwards AV, Crossett B, Falconer
862 L, Kolarich D, Djordjevic SP, Hojrup P, Packer NH, Larsen MR, Cordwell SJ.
863 2011. Simultaneous glycan-peptide characterization using hydrophilic interaction
864 chromatography and parallel fragmentation by CID, higher energy collisional
865 dissociation, and electron transfer dissociation MS applied to the N-linked
866 glycoproteome of Campylobacter jejuni. Mol Cell Proteomics 10:M000031-
867 MCP201.
40
Downloaded from 868 69. Ishihama Y, Rappsilber J, Mann M. 2006. Modular stop and go extraction tips
869 with stacked disks for parallel and multidimensional Peptide fractionation in
870 proteomics. J Proteome Res 5:988-94.
871 70. Rappsilber J, Mann M, Ishihama Y. 2007. Protocol for micro-purification, http://iai.asm.org/ 872 enrichment, pre-fractionation and storage of peptides for proteomics using
873 StageTips. Nat Protoc 2:1896-906.
874 71. Cox J, Mann M. 2008. MaxQuant enables high peptide identification rates,
875 individualized p.p.b.-range mass accuracies and proteome-wide protein on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 876 quantification. Nat Biotechnol 26:1367-72.
877 72. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. 2014. Accurate
878 proteome-wide label-free quantification by delayed normalization and maximal
879 peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics 13:2513-26.
880 73. Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, Cox J.
881 2016. The Perseus computational platform for comprehensive analysis of
882 (prote)omics data. Nat Methods 13:731-40.
883 74. Perez-Riverol Y, Csordas A, Bai J, Bernal-Llinares M, Hewapathirana S, Kundu
884 DJ, Inuganti A, Griss J, Mayer G, Eisenacher M, Perez E, Uszkoreit J, Pfeuffer J,
885 Sachsenberg T, Yilmaz S, Tiwary S, Cox J, Audain E, Walzer M, Jarnuczak AF,
886 Ternent T, Brazma A, Vizcaino JA. 2019. The PRIDE database and related tools
887 and resources in 2019: improving support for quantification data. Nucleic Acids
888 Res 47:D442-D450.
889 75. Penfold RJ, Pemberton JM. 1992. An improved suicide vector for construction of
890 chromosomal insertion mutations in bacteria. Gene 118:145-146.
41
Downloaded from 891 76. Thoma S, Schobert M. 2009. An improved Escherichia coli donor strain for
892 diparental mating. FEMS Microbiol Lett 294:127-32.
893
894 Figures http://iai.asm.org/
895 Figure 1. BpsΔppiB shows reduced intracellular survival in J774.A1 murine
896 macrophages. (A) Intracellular growth of BpsWT (●) and BpsΔppiB () in J774A.1
897 murine macrophages was infected at an MOI of 10 and intracellular counts taken at 0,
898 3, 6, 9 and 12. Graphs are the mean of five biological replicates with each having two on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
899 technical replicates. The error bars displaying the Standard Error of the Mean. * P-value
900 of 0.0159 by Mann-Whitney U-test.
901
902 Figure 2. BpsΔppiB is attenuated in the BALB/c mouse model of infection. (A)
4 903 BALB/c mice (n=6) were injected intraperitoneally with 1.1 x 10 CFU BpsWT (●) and
4 904 1.86 X 10 CFU of Bps∆ppiB (▲). * P-value 0.0183 by Log-rank test. Weight loss of
905 individual BALB/c mice (labelled 1 – 6) was monitored daily following intraperitoneal
906 infection as a measure of morbidity in (B) B.psWT and (C) B.psΔppiB.
907 908 Figure 3. BpsΔppiB demonstrates reduced formation of multinucleated giant cells
909 in J774 murine macrophages. Fluorescently stained monolayers infected with either
910 (A) BpsWT, (B) BpsΔppiB or (C) BpsΔppiB/ppiB. were stained with Anti-Bps-LPS-FITC
911 and nuclei are stained with Hoescht33258, bar indicates 14µM. (D) Percentage of nuclei
912 associated with a MNGC, BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■). Graphs
42
Downloaded from 913 are the result of three biological repeats with each biological repeat containing two
914 technical repeats. 1000 nuclei were counted from each coverslip with them either being
915 part of a multinucleated cell or mononucleated and then the percentage of
916 multinucleated was calculated. * P-value 0.026 and ** P-value 0.0022 by Mann-Whitney http://iai.asm.org/ 917 U-test.
918 919 Figure 4. Quantitative proteomic analysis of BpsWT vs BpsΔppiB. Label-free
920 quantification was undertaken to compare BpsΔppiB to BpsWT. A) Identified proteins on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 921 are presented as a volcano plot depicting mean label free quantitation (LFQ) intensity
922 ratios of BpsΔppiB versus BpsWT plotted against logarithmic t test p values from four
923 biological experiments of each strain. B) GO terms assigned localization of the 42 out
924 the 213 proteins which undergo statistically significant changes with localization
925 assignment. Only GO localization terms for groups with greater than 3 entries are
926 shown. Complementation of PpiB lead to restoration of proteins observed to (C)
927 increase and (D) decrease to near BpsWT levels.
928
929 Figure 5. KEGG Pathway analysis of proteins differentially present in BpsWT vs
930 BpsΔppiB. Proteins that were differentially present by proteomics (Supplementary
931 Table 1) were manually curated using the Kyoto Encyclopaedia of Genes and Genomes
932 (KEGG) database against the Burkholderia pseudomallei K96243 genome (entry
933 number T00203) and assigned a KEGG Orthology (KO). Proteins in red were increased
934 in BpsΔppiB relative to BpsWT, while proteins in blue were decreased. Numerous
43
Downloaded from 935 proteins were predicted to be in other functional groups but only the highest KO was
936 taken down.
937 938 Figure 6. BpsΔppiB has significantly reduced motility and biofilm formation. (A) http://iai.asm.org/ 939 Swarming motility of BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■) through 0.3 %
940 agarose plates. Values are the diameter of spread with readings taken at 24 hours post-
941 inoculation. Results are of three biological replicates. ** P-value 0.0022 by Mann
942 Whitney U-test. (B) Biofilm forming capacity of BpsWT (●), BpsΔppiB () and on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 943 BpsΔppiB/ppiB (■) in nutrient LB broth. Biofilms were allowed to form over a 48 hour
944 period before being fixed with methanol and stained with crystal violet to determine
945 bacterial biomass. Crystal violet was solubilised with 33 % glacial acetic acid and optical
946 density was read with a spectrophotometer (BioRad Xmark) at 590 nm. Bars are
947 representative of the mean optical density with individual values plotted. Six biological
948 replicates with 6 technical repeats were conducted. ** P-value by Mann-Whitney U-test.
949 950 Figure 7. BpsΔppiB demonstrates greater sensitivity towards oxidative stress.
951 Survival of BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■) in increasing
952 concentrations of hydrogen peroxide. Values are the mean MIC of three biological
953 replicates. Concentrations are in µL/mL of 30% Hydrogen Peroxide (BioVar) solution.
954 MIC was determined by measuring the optical density (OD 590 nm) at 24 hours post
955 hydrogen peroxide exposure and MIC was called as the lowest concentration which
956 resulted in less than 20 % growth (dotted line) of the unexposed control on that plate.
44
Downloaded from 957
Antibiotic BpsWT BpsΔppiB BpsΔppiB/ppiB
Ceftriaxone 128 8 16
Meropenem 2 0.5 1
Tetracycline 2 0.5 1 http://iai.asm.org/
Doxycycline 1 <0.25 0.5
958 959 Table 1. Minimum Inhibitory Concentration (MIC) as determined by broth
960 microdilutions. Values are the mean MIC of three biological replicates. Concentrations on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
961 are in µg/mL for antibiotics. MIC was determined by measuring the optical density (OD
962 590 nm) at 24 hours post antibiotic exposure and MIC was called as the lowest
963 concentration which resulted in less than 20 % growth of the unexposed control on that
964 plate.
965
966
967
968
969
970
971
972
973
Strain or plasmid Genotype or description Source or
45
Downloaded from reference
Escherichia coli
TOP10® Chemically competent cloning strain Invitrogen
S17-1 λpir S17-1 with a λ prophage carrying the pir gene, (75)
conjugal strain for the movement of pDM4 http://iai.asm.org/
ST18 S17-1 λpirΔhemA, conjugal strain for the (76)
movement of pBBR1-MCS1
Burkholderia pseudomallei
K96243 (WT) Clinical isolate Dstl, (61) on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 ∆ppiB K96243 derivative; unmarked deletion ∆ppiB This study
∆ppiB/ppiB K96243 derivative; unmarked deletion ∆ppiB; This study
ppiB_3XFLAG_pBBR1-MCS1
974
975 Table 2. Bacterial strains and plasmids used in this study
46
Downloaded from http://iai.asm.org/ on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 Downloaded from A
*
http://iai.asm.org/
B 22 1 on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 20 2 18 3 4 16 5
Weight (g) 14 6 12
-5 0 5 10 15 20 25 30 35 Days post challenge
C 22 1 20 2 18 3 4 16 5
Weight (g) 14 6 12
-5 0 5 10 15 20 25 30 35 Days post challenge Downloaded from http://iai.asm.org/ on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 A B Downloaded from
http://iai.asm.org/
C D
on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
Downloaded from http://iai.asm.org/ on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209
Downloaded from
Hypothetical Protein Unassigned Not Included in Pathway Cellular Processes Human Disease Genetic Information Processing
Signalling and Cellular Processes http://iai.asm.org/ Environmental Information Processing Metabolism
0 50 100 150 200 250 Number of proteins Increased Decreased
on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 Downloaded from http://iai.asm.org/ on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209 Downloaded from
100
80
60
40 http://iai.asm.org/ % Growth
20
0 0.32 0.16 0.08 0.04 0.02 0.01 0.005 0.0025
Concentration (µL/mL) on September 16, 2019 at UNIV OF WESTERN AUSTRALIA M209