Unraveling the Quorum Sensing System of the Photosynthetic Bacterium Rhodospirillum Rubrum S1H Under Light Anaerobic Conditions

University of Mons Faculty of Sciences

Unraveling the quorum sensing system of the photosynthetic bacterium Rhodospirillum rubrum S1H under light anaerobic conditions

Sandra Liz Condori Catachura

A dissertation presented for the degree of Doctor (PhD) in Science 26th February 2016

Jury

Prof. Dr. P. Flammang, University of Mons - President

Dr. B. Leroy, University of Mons - Secretary

Prof. Dr. Ruddy Wattiez, University of Mons - Promoter

Dr. Felice Mastroleo, SCK·CEN - Mentor

Prof. Dr. Robin Gosh, University of Stuttgart - External member

Prof. Dr., F. Delvigne, University of Liege Gembloux Agro-Biotech - External member

To my family

Abstract

MELiSSA (Micro-Ecological Life Support System Alternative) is a regenerative recycling system that produces oxygen, water and food for long haul space flights, which includes 5 compartments of microorganisms and plants. Rhodospirillum rubrum S1H colonizes compartment II and has a key role in the degradation of the organic waste, metabolizing mainly volatile fatty acids coming from compartment I. Previous studies reported that continuous culture of the bacterium in the MELiSSA photobioreactor could lead to unwanted thick biofilm formation, shading the culture from the incoming light. It was suggested that cell- to-cell communication, also called quorum sensing (QS), could play a role in this phenomenon. In fact, QS is a common behavior in photosynthetic bacteria where cell-to-cell communication is mainly based on production of acyl homoserine lactones (AHLs) as chemical messenger molecules. In nature, QS helps these bacteria to overcome environmental fluctuations such as light availability, nutrient supply and temperature change. Through QS, bacteria can control expression of target genes and mount a co-operative response like biofilm formation.

Our aim was to investigate the unknown QS system of R. rubrum S1H specifically under MELiSSA relevant culture conditions, meaning growing R. rubrum under anaerobic conditions using light and acetate as energy and carbon source respectively.

Bioinformatics analysis revealed genes homologous to the well-known QS system luxIR, in the genome of R. rubrum. Also a second potential AHLs synthase that belongs to the HdtS family, which is not related to LuxI protein family, was identified. The gene Rru_A3396 (named rruI), coding for a putative AHLs synthase enzyme, was knocked out giving rise to a QS-silent mutant named M68. Phenotypic, proteomic and transcriptomic analysis of R. rubrum S1H (wild type, WT) and M68 showed that QS system controls directly or indirectly the biosynthesis of photosynthetic pigments such as carotenoids and bacteriochlorophyll, swimming motility, chemotaxis, carbon metabolism and other cellular functions such as amino acids uptake. Regarding the relationship between QS and biofilm formation, our results showed that QS promotes biofilm

formation under a low shear environment. Altogether these results have shown the functionality and key role (direct or indirect) of QS in R. rubrum.

Currently the use of Genetically Modified Organisms within the MELiSSA loop is prohibited. Nevertheless, the use of a QS-silent mutant in the MELiSSA loop might be a better choice compared to the addition of external biofilm-disrupting compounds that could have a negative impact on the following bioreactors including compartment 3 where the nitrifying community needs to grow as a biofilm. Further investigations are necessary to characterize the QS-silent mutant growing under bioreactor conditions through analysis of the growth kinetics and metabolic output, i.e. the effluent produced by M68 in comparison to WT to insure that such a QS-silent mutant would still perform adequately in the MELiSSA system.

Content

ABSTRACT ...... I

CONTENT ...... III

LIST OF FIGURES ...... XI

LIST OF TABLES ...... XIII

LIST OF ACRONYMS ...... XIV

CHAPTER I: INTRODUCTION ...... 1

I.1. LIFE SUPPORT SYSTEMS ...... 2

I.2. THE MELISSA PROJECT ...... 2 I.2.1. Compartment I (CI): The thermophilic compartment ...... 3 1.2.2. Compartment II (CII): The photoheterotrophic compartment...... 5 I.2.3. Compartment III (CIII): the nitrifying compartment ...... 5 I.2.4. Compartment IVa & b: Photoautotrophic compartment ...... 5 I.2.5. Compartment V: the crew ...... 6

I.3. PHOTOSYNTHETIC BACTERIA: RHODOSPIRILLUM RUBRUM ...... 6 I.3.1. Taxonomy- classification ...... 6 I.3.2. Cell structure ...... 6 I.3.2.1. Lipid composition ...... 6 I.3.2.2. Pigments ...... 7 I.3.3. Genome ...... 7 I.3.4. Modes of growth ...... 8 I.3.5. Metabolism ...... 8 I.3.5.1. Carbon metabolism ...... 8

iii

I.3.5.1.1. Carbon dioxide (CO2) under anaerobic phototrophic growth ...... 8 I.3.5.1.2. Organic acids ...... 9 I.3.5.1.3. Sugars ...... 10 I.3.5.2. Nitrogen metabolism ...... 10 I.3.5.3. Reserve metabolism ...... 11 I.3.5.3.1. Polyhydroxybutyrate (PHB) ...... 11 I.3.5.4. Energy metabolism ...... 11 I.3.5.4.1. Energy derived from chemicals ...... 11 I.3.5.4.1.1. Substrate-level phosphorylation ...... 11 I.3.5.4.1.2. Respiration linked phosphorylation ...... 11 3.5.4.2. Energy derived from light ...... 12 3.5.4.2.1. Photophosphorylation ...... 12

I.4. POTENTIAL INDUSTRIAL USE OF PHOTOSYNTHETIC BACTERIA ...... 15

I.5. QUORUM SENSING IN BACTERIA ...... 16 I.5.1. General model in Gram-negative bacteria ...... 16 I.5.2. General model in Gram-positive bacteria ...... 17 I.5.3. Quorum sensing networks ...... 18 I.5.4. Synthesis of AHL ...... 18 I.5.5. Autoinducers types in Gram-negative and Gram-positive bacteria ...... 19 I.5.6. Quorum sensing in photosynthetic alpha-proteobacteria ...... 21

I.6. BIOFILM FORMATION ...... 25 I.6.1. Biofilm development ...... 26 I.6.2. Biofilm formation in Gram-negative and Gram-positive bacteria ...... 26 I.6.3. Biofilm formation in photosynthetic bacteria ...... 28

6.3. Link between biofilm formation and quorum sensing in gram- negative bacteria...... 29

CHAPTER II: OBJECTIVES OF THE THESIS ...... 31

CHAPTER III: CONSTRUCTION AND PHENOTYPIC CHARACTERIZATION OF M68, A RRUI QUORUM-SENSING KNOCKOUT MUTANT OF THE PHOTOSYNTHETIC ALPHAPROTEOBACTERIUM RHODOSPIRILLUM RUBRUM .. 32

III.1. ABSTRACT ...... 32

III.2. INTRODUCTION ...... 33

III.3. MATERIAL AND METHODS ...... 35 III.3.1. Light system set up for MELiSSA culture conditions ...... 35 III.3.2. Bacterial strains and growth conditions ...... 35 III.3.2.1. Aerobic chemoheterotrophic growth ...... 35 III.3.2.2. Anaerobic photoheterotrophic growth - MELiSSA conditions ...... 35 III.3.2.3. Escherichia coli culture conditions ...... 37 III.3.2.4. Agrobacterium tumefaciens NT1 culture conditions ...... 37 III.3.3. Bioinformatics analysis ...... 37 III.3.4. R. rubrum knockout mutant construction ...... 37 III.3.4.1. Amplification of rruI gene and flanking homologous region .39 III.3.4.2. Vector construction ...... 39 III.3.4.3. Transformation of E. coli S17-1 λ ...... 39 III.3.4.4. Reverse PCR ...... 40 III.3.4.5. Transformation of R. rubrum by conjugation ...... 40 III.3.5. Complementation ...... 41 III.3.5.1. Addition of WT supernatant ...... 41 III.3.5.2. Addition of AHL whole cells extracts ...... 41

III.3.5.3. Addition of synthetic molecules ...... 42 III.3.5.4. Complementation by plasmid ...... 42 III. 3.6. AHLs extraction and identification ...... 43 III.3.6.1. Extraction and identification by thin layer chromatography (TLC) ...... 43 III.3.6.2. AHLs identification by mass spectrometry (MS) ...... 44 III.3.7. QS-mutant phenotype characterization ...... 44 III.3.7.1. Growth under Mel-LAN conditions ...... 44 III.3.7.2. Pigment quantification ...... 44 III.3.7.3. Swimming motility ...... 45 III.3.7.4. Low shear environment in a rotating wall vessel (RWV) ...... 45 III.3.8. Expression of QS genes ...... 46 III.3.8.1. RNA extraction ...... 46 III.3.8.2. Reverse transcription and real time quantitavive PCR ...... 46

III.4. RESULTS ...... 47 III.4.1. R. rubrum S1H possesses a QS system that consists of one LuxI homologue (RruI) and six luxR homologues (RruR) ...... 47 III.4.2. RruI knockout mutant (M68) construction and stability ...... 48 III.4.3. R. rubrum S1H produces unsubstituted and 3-OH substituted HSLs under Mel-LAN conditions ...... 50 III.4.4. Growth curve of WT and M68 under Mel-LAN conditions...... 52 III.4.5. Pigment content and swimming motility are modulated by QS . 53 III.4.6. Complementation ...... 55 III. 4.6.1. Addition of external molecules does not complement M68 55 III. 4.7. Cultivation in low-shear environment ...... 57 III. 4.8. Expression of QS genes ...... 59

III.5. DISCUSSION ...... 61

III.6. CONCLUSIONS AND PERSPECTIVES ...... 64

CHAPTER IV: TRANSCRIPTOMIC AND PROTEOMIC PROFILING OF RHODOSPIRILLUM RUBRUM M68 CULTIVATED IN MELISSA RELATED CULTURE CONDITIONS ...... 65

IV.1. ABSTRACT ...... 65

IV.2. INTRODUCTION ...... 66

IV.3. MATERIAL AND METHODS ...... 68 IV.3.1. Bacterial strains and growth conditions ...... 68 IV.3.2. Transcriptomic approach ...... 68 IV.3.2.1. RNA extraction and microarray analysis ...... 68 IV.3.2.2. Gene analysis ...... 69 IV.3.3. Proteomic approach ...... 69 IV.3.3.1. Protein extraction ...... 69 IV.3.3.2. Proteomic analysis ...... 69

IV.4. RESULTS ...... 71 IV.4.1. Identification of QS-regulated genes by transcriptomic approach ...... 71 VI.4.1.1. Downregulated genes ...... 72 VI.4.1.1.1. Stress-related genes ...... 76 IV.4.1.2. Upregulated genes ...... 79 IV.4.2 Proteomic analysis ...... 80 IV.4.3. Common genes differentially expressed at the transcriptomic and proteomic level ...... 85

IV.6. DISCUSSIONS...... 88 IV.6.1. Genes related to M68 phenotypes ...... 88 IV.6.2. Stress response ...... 90

vii

IV.6.3. Membrane transporters ...... 91 IV.6.4 Carbon metabolism ...... 92

IV.7. CONCLUSIONS AND PERSPECTIVES ...... 92

CHAPTER V: INVESTIGATIONS OF RHODOSPIRILLUM RUBRUM BIOFILM FORMATION UNDER MELISSA CONDITIONS ...... 95

V.1. ABSTRACT ...... 95

V.2. INTRODUCTION ...... 96

V.3. MATERIAL AND METHODS ...... 97 V.3.1. Bacterial culture conditions ...... 97 V.3.2. Flow cytometry ...... 97 V.3.3. Flow cell system ...... 98 V.3.3.1. Flow cell system set up and incubation conditions ...... 98 V.3.3.2. Biofilm visualization ...... 99 V.3.3.3. Testing excess of carbon concentration ...... 99 V.3.4. Microtiter plate set up ...... 99

V.4. RESULTS ...... 101 V.4.1. Correlation of flow cytometry (FCm) and plate count under MELiSSA conditions ...... 101 V.4.2. Biofilm formation under light microaerobic conditions: Flow cell system ...... 102 V.4.2.1. Biofilm formation under excess of carbon and biofilm visualization ...... 104 V.4.3. Biofilm formation under light anaerobic condition-Microtiter plate ...... 106 V.4.3.1. Effect of carbon concentration on R. rubrum WT biofilm formation ...... 106

viii

V.4.3.2. WT and M68 biofilm formation in microtiter plate ...... 107 V.4.3.3. Possible carotenoid effect on biofilm formation? ...... 108

V.5. DISCUSSIONS ...... 111 V.5.1. Flow cytometry counting ...... 111 V.5.2. Biofilm formation in flow cell system ...... 111 V.5.3. Microtiter plate ...... 112

V.6. CONCLUSIONS AND PERSPECTIVES ...... 113

CHAPTER VI: GENERAL DISCUSSIONS ...... 115

VI.1. IS QS SYSTEM OF R. RUBRUM S1H ACTIVE DURING CULTIVATION UNDER MELISSA

CONDITIONS? ...... 116 VI.1.1. Acyl homoserine lactone synthase knockout mutant construction phenotypic characterization under MELiSSA conditions ...... 116 VI.1.2. QS-mutant (M68) phenotypic characterization under MELiSSA conditions ...... 117 VI.1.3. Perspectives ...... 118

VI.2. WHAT IS THE EXTENT OF QS IN R. RUBRUM S1H UNDER MELISSA CONDITIONS

AT THE PHENOTYPIC, TRANSCRIPTOMIC, PROTEOMIC LEVELS? ...... 119 VI.2.1. Perspectives ...... 121

VI.3. IS THERE A LINK BETWEEN QS AND BIOFILM FORMATION IN R. RUBRUM? ...... 121 VI. 3.1 Perspectives ...... 122

VI.4. WHAT ARE THE CONSEQUENCES OF OUR RESULTS FOR FUTURE MELISSA

DEVELOPMENT? ...... 122

VI.5. GENERAL CONCLUSIONS ...... 123

REFERENCES ...... 124

ANNEX ...... 139

1. LIST OF DIFFERENTIALLY EXPRESSED PROTEINS ...... 139

2. LIST OF GENES DIFFERENTIALLY EXPRESSED AT THE TRANSCRIPTOMIC LEVEL ...... 146

ACKNOWLEDGMENTS ...... 1

CURRICULUM VITAE ...... 4

List of figures

Figure 1.1. Plants grown in space...... 1 Figure 1.2. The Micro-Ecological Life support system Alternative (MELiSSA)...... 4 Figure 1.3. Electron transport chain under chemoheterotrophic growth of Rhodobacter sphaeroides...... 12 Figure 1.4. Transmission electron microscopy of R. rubrum...... 13 Figure 1.5. Cyclic and non-cyclic electron flow during photosynthesis in Rb .sphaeroides...... 14 Figure 1.6. The Gram-negative LuxIR-type quorum sensing system...... 17 Figure 1.7. The Gram-negative two-component system-type quorum sensing system...... 18 Figure 1.8. Proposed pathway for AHL synthesis ...... 19 Figure 1.9. Autoinducers described for Gram-negative bacteria...... 20 Figure 1.10. Autoinducers described for Gram-positive bacteria...... 20 Figure 1.11. Stages of biofilm development ...... 26 Figure 1.12. Cultivation of R. rubrum S1H under MELiSSA conditions...... 30 Figure 3.1. Multiple protein sequence alignment of LuxI family members ...... 47 Figure 3.2. Alignment of other lux boxes by CLUSTAL omega for nucleotide sequence shading with program Multiple Align...... 48 Figure 3.3. Replacement of rruI gene...... 49

Figure 3.4. TLC overlay plate showing AHLs from WT and M68 at OD6803...... 50 Figure 3.5 Growth curve of WT and M68...... 53 Figure 3.6. Bacteriochlorophyll (Bcha) and carotenoids (Crt) content in WT and M68...... 54 Figure 3.7. Swimming motility test of R. rubrum WT and M68...... 54 Figure 3.8. Complementation of R. rubrum M68 ...... 55 Figure 3.9. Solvents effect on M68 growth under Sis-DAE conditions...... 56 Figure 3.10. R. rubrum S1H complementation...... 56 Figure 3.11.Complemented M68 do not produce AHL...... 57 Figure 3.12. WT and M68 cultivation using the RWV technology...... 58 Figure 3.13. Expression profile of QS-related genes in WT and M68...... 60 Figure 3.14. Expression of QS-related genes in M68 compared to WT ...... 60 Figure 4.1. COG functional classification of the genes differentially expressed...... 71 Figure 4.2. Chemotaxis genes in R. rubrum ATCC11170...... 73 Figure 4.3. Genes described for flagellar assembly...... 74

Figure 4.4. Genes described for flagellar assembly...... 81 Figure 5.1. Flow cell system setup...... 98 Figure 5.2. Distribution of WT and M68 samples in microtiter plate...... 100 Figure 5.3. WT and M68 attachment to flow cells ...... 102 Figure 5.4. Microscopic view of WT (72 h) and M68 (72 h) ...... 103 Figure 5.5. Microscopic view of WT and M68 grown under different carbon concentrations...... 104 Figure 5.6. Microscopic view of WT biofilms under excess of carbon concentration...... 105 Figure 5.7. Microscopic view of R. rubrum M68 strain...... 106 Figure 5.8. Biofilm formation of R. rubrum S1H (WT) in microtiter plate at 4 carbon concentrations...... 107 Figure 5.9. Biofilm formation in microtiter plate...... 108 Figure 5.10. Biofilm quantification of WT, M68 and the carotenoidless strain G9 grown under different carbon concentration...... 109 Figure 5.11. Microscopic observation of WT, M68 and G9 biofilm formation in microtiter plate grown under different carbon concentration...... 110

xii

List of tables

Table 1.1. Current QS systems described in Alphaproteobacteria...... 22 Table 1.2. Mass spectrometry identification of AHLs in R. rubrum S1 and S1H under different culture conditions and carbon sources...... 24 Table 1.3. Examples of the relation between QS and biofilm development ...... 29 Table 3.1. Bacterial strains and plasmids used in this study ...... 36 Table 3.2. List of primers used in this study ...... 38

Table 3.3. Identified AHLs in R. rubrum S1H grown WT under MELiSSA conditions at OD680 3

compared to OD6802 ...... 51 Table 3.4. Mass spectrometry identification of AHLs in R. rubrum S1 and S1H under different culture conditions and carbon sources...... 52

Table 3.5. OD680, pH and oxygen concentration for WT and M68 during RWV cultivation...... 59 Table 4.1. COG functional categories...... 72 Table 4.2. Chemotaxis, flagellar, photosynthetic and electron transport-related genes downregulated when comparing M68 to WT...... 75 Table 4.3. Downregulated genes related to bacterial stress when comparing M68 to WT...... 76 Table 4.4. Downregulated genes related to ABC transporters or efflux systems when comparing M68 to WT...... 77 Table 4.5. R. rubrum S1H downregulated genes when comparing M68 to WT reported in previous studies ...... 78 Table 4.6. Upregulated genes when comparing M68 to WT at the transcriptomic level...... 79 Table 4.7. Chemotaxis, flagellar and electron transport proteins differentially regulated when comparing M68 to WT...... 82 Table 4.8. Differentially regulated proteins when comparing M68 to WT...... 84 Table 4.9. Common genes identified by transcriptomic and proteomic approach comparing M68 vs WT...... 87 Table 5.1. Ratio of flow cytometry (cells/ml) and plate count (CFU/ml) ...... 101 Table 5.2. Flow cytometry quantification of R. rubrum cells in the flow cell effluent sample after 2 hours of attachment period...... 103

xiii

List of acronyms

ACP: Acyl carrier protein

AHLs: Acyl homoserine lactones

AIP: Autoinducer peptide

ECLSS: Environmental Control and Life Support System

eDNA: extracellular DNA

EPS: Exopolysaccharides

FC: flow cell

FCM: flow cytometry

ISS: International Space Station

Kanamycin: Km

LAN: Light anaerobic

MaGe: Magnifying genomes plataform for gene annotation

MS: Mass spectrometry

MELiSSA: Micro-Ecological Life Support System Alternative

Mel-LAN: Cultures grown under light anaerobic conditions and acetate

PI: Propidium iodide

PNSB: Purple nonsulfur bacteria

QS: Quorum sensing

Sis-DAE: Dark aerobic growth in Sistrom-succinate medium

VFA: Volatile fatty acids

xiv

Chapter I: Introduction

Space has amazed mankind since ancient times. Following this interest, space research has been developed through the years. Therefore human exploration on deep space or to other planets could be feasible. Since 1998, humans are able to have a long-term stay (from 6 months up to 1 year) in space at the International Space Station (ISS). However, one of the main drawbacks for sustaining life in space relies on human needs such as oxygen, water, food and waste disposal. In this sense, over the past years, life support systems were developed in order to overcome these pitfalls. In this sense, one of the recent achievements was to grow for the very first time a lettuce at ISS, which was eaten by the astronauts (Figure 1.1). This achievement settled the basis for long-term sustainability of prospective manned space missions.

Figure 1.1. Plants grown in space. NASA astronauts Kjell Lindgren, left, and Scott Kelly harvest the first red lettuce grown on the ISS as part of the Veggie investigation. This technology and method of growing food could help to sustain astronauts life on space that is a critical step on the path to Mars. Source: https://www.nasa.gov/centers/marshall/news/releases/2015/halftime-in- space-space-station-crew-and-ground-controllers-mark-mid-point-of- one-year.html

I.1. Life support systems

A life support system for space exploration should provide oxygen, water and food in order to ensure life of the crew. Currently, the Environmental Control and Life Support System (ECLSS) at NASA’s Marshall Space Flight Center in Huntsville, Ala., is the institution responsible for the design, construction and testing of regenerative life support systems that support life at the International Space Station. Nowadays, the recycling of wastewater into usable water and the oxygen generation system are located in the “Tranquility” node at ISS. This node bears the life-support equipment required by the crew that include six members [1]. However, for future long-term human manned exploration, it is needed to rely on life support systems that can provide continuously all the requirements to sustain life for years since resupplying from Earth will not be possible.

In this context, during the past 50 years leading institutions have been studying the feasibility of such technology. Several projects have been developed across the world i.e. the closed ecological experiment facility (Japan), the MELiSSA program (Europe), the Bios experiments (Russia) and the Biosphere 2 project (United States). Detailed information of each project can be found in Nelson et al. 2009 [2]. This PhD thesis was done within the framework of the European project MELiSSA.

I.2. The MELiSSA project

The ESA’s Micro-Ecological Life support system Alternative (MELiSSA) concept is to rely on interconnected compartments that will use organic and inorganic waste produced by the crew and transform it into water, oxygen and food in order to sustain life during long manned space missions, for instance to Mars [3]. The system was inspired in the geomicrobiological Earth ecosystem [4] (Figure 1.2). The loop consists of 4 compartments and the crew. The first 3 compartments are colonized by bacteria, the fourth compartment has been split into IVa and IVb and it is colonized by a cyanobacterium and plants respectively. Each microorganism of the MELiSSA loop was selected based on the following specific characteristics:

 Biodegradation capacity of hyperthermophile bacteria (Compartment I).

 The photosynthetic and volatile fatty acid (VFA) uptake capacity of Rhodospirillum rubrum in anaerobic condition (Compartment II).  Nitrosomonas/Nitrobacter consortium with a nitrifying capacity (Compartment III).  The oxygen-producing and carbon dioxide-consuming capacity of the cyanobacterium Arthrospira sp. PC8005 and higher plants (Compartment IV).

Currently, research on these microorganisms is very active through the 15 MELiSSA partners around the world. The MELiSSA consortium has been investigating for 25 years the suitability of the use of microorganisms and plants to sustain life in space. Moreover, the MELiSSA pilot plant is located in Barcelona (Spain) where it is foreseen to assemble the complete loop.

I.2.1. Compartment I (CI): The thermophilic compartment

The aim of this compartment is to degrade waste such as faeces, urine and non-edible part of plants from compartment IVb. This compartment is colonized by a consortium of bacteria selected from fecal material. Degradation must be done under thermophilic (55° C) and anaerobic conditions since oxygen usage inside the MELiSSA loop must be minimized. As a result of anaerobic degradation volatile fatty acids such as acetic, propionic, butyric, isobutyric, valeric and isovaleric acid are formed, and CO2, H2 and H2S and ammonium [3]. Previous studies of compartment CI at pilot scale have shown that it is possible to reach a 90% of degradation efficiency by applying complementary technologies that helps in liquefaction of fiber (using Fibrobacter succinogenes), liquefaction and sanitation of recalcitrant organic matter (by high-pressure and temperature unit) and raw waste using hyper-thermophilic organisms [5].

Figure 1.2. The Micro-Ecological Life support system Alternative (MELiSSA).

Above, graphic representation of the main functional steps in the recycling of organic waste in a natural lake ecosystem, adapted from reference [4]. Below, MELiSSA loop diagram, credits: ESA.

1.2.2. Compartment II (CII): The photoheterotrophic compartment

Compartment II is colonized by R. rubrum S1H (ATCC25903), a spontaneous mutant from R. rubrum S1 (ATCC11170, parent strain). This strain was selected, due to its capacity to metabolize volatile fatty acids (VFAs) coming from compartment I. Also because unlike S1, strain S1H contains an increased amount of L-threonine deaminase (15-20-fold) [6] that can overcome growth inhibition under possible high L-threonine concentrations that could externally enter the loop [3].

I.2.3. Compartment III (CIII): the nitrifying compartment

This compartment is colonized by a co-culture of Nitrosomonas europaea ATCC19178 and Nitrobacter winogradskyi ATCC25391. The aim of this + compartment is to convert NH4 to nitrate, needed in compartment IVa [7]. Ns. europaea oxidizes ammonium to nitrite (NO2-) whereas Nb. winogradskyi converts nitrite to nitrate (NO3-). The bioreactor consists of immobilized cells packed-bed column. This configuration was selected due to the very low bacterial growth rate and that these cells will not be used as food therefore it is not the aim of MELiSSA loop to produce them [8].

I.2.4. Compartment IVa & b: Photoautotrophic compartment

Compartment IV has been divided in IVa and IVb. The aim of this compartment is to produce oxygen, remove CO2 and to produce food [3]. Compartment IVa is colonized by Arthrospira sp PC8005, a filamentous cyanobacterium that photosynthetically fixes CO2 and produces O2. Arthrospira is a natural crucial source of food to many large aquatic organisms, such as fishes. Many Arthrospira species are also edible for man and are used as nutritious and health promoting food supplements.

In compartment IVb higher plants e.g. lettuce, red beet and wheat were included in order to provide a healthy diet and improve the recycling system [7]. Production of water by evapotranspiration of higher plants will be partially used for human consumption and recycled for the loop [8].

I.2.5. Compartment V: the crew

All the previous compartments should be able to provide the needs of the crew such as water, oxygen and food using as starting material the crew organic

(urine, feces, non-edible part of plants, etc.) and inorganic (CO2) waste.

I.3. Photosynthetic bacteria: Rhodospirillum rubrum

I.3.1. Taxonomy- classification

R. rubrum is an alpha-proteobacterium that performs photosynthesis under anaerobic conditions without production of oxygen (anoxygenic photosynthesis) [9]. This bacterium belongs to the phototrophic purple nonsulfur bacteria (PNSB). Despite R. rubrum is called a nonsulfur bacteria [10]; it can tolerate sulfide concentrations (in the range of 0.4 - 0.8 mM) that other PNSB cannot [11]. In nature, R. rubrum can be found in stagnant water bodies, fresh water, sewage and waste lagoons [9].

I.3.2. Cell structure

Regarding morphology cells size ranges from 0.8-1 µm wide and 7-10 µm long. R. rubrum cells display a vibroid-shape to spiral with bipolar flagella which provide swimming motility.[12]. Swarming motility has not been described for R. rubrum. However, other species such as Rhodospirillum centenum are able to swarm under laboratory conditions [13].

I.3.2.1. Lipid composition

Regarding the lipid composition of the photosynthetic membranes, early studies reported the content of acyl lipid and fatty acid composition. The major lipids described in R. rubrum under light anaerobic conditions in Sistrom medium are phosphatidylethanolamine, phosphatidylglycerol and cardiolipin

[14]. Further investigations reported C18:1 as the dominant fatty acid while C16:1/C16:0, C16:0/C18:0 or just C16:0 are additional major components [9].

I.3.2.2. Pigments

The main pigments in R. rubrum are carotenoids and bacteriochlorophylls, the predominant carotenoid produced is spirilloxantin [15]. However, carotenoid composition can change based on culture conditions such as light intensity, oxygen concentration and growth phase [16]. The later was confirmed by studies made under semiaerobic conditions (pO2 < 0.3%) where succinate and fructose were the carbon sources confirmed the linear reaction sequence in mid- exponentially growing cells leading to spirilloxantin [15].

Alpha-proteobacteria use the spirilloxanthin pathway and the ketone pathway for carotenoids synthesis. The genes reported to be involved in carotenoid biosynthesis are crtE, crtB, crtI, crtC and crtD, crtF. Interestingly studies made on R. rubrum deletion mutant (gene crtD) have elucidated alternative side pathways for carotenoid synthesis i.e. the alternative spheroidene and the 3,4- didehydrolycopene pathways [15].

Carotenoids act as photoprotecting agents when oxygen and light are present in photosynthetic bacterial growth. Under these conditions triplet excited bacteriochlorophyll a (exited bacteriochlorophyll with electrons in the higher orbitals) can be formed. This molecule is a potent photosensitizer that reacts with molecular oxygen present in the medium leading to the formation of singlet oxygen (potent oxidizing agent). Carotenoids can prevent the effects of singlet oxygen by quenching the triplet bacteriochlorophyll (preventing formation of singlet oxygen, mainly observed in vivo) or the oxygen singlet directly [17]. Studies made on Rhodobacter sphaeroides R26, a carotenoidless mutant showed that R26 strain was rapidly killed when grown in the presence of light and oxygen, demonstrating the protective effect of carotenoids [18]. Interestingly, no accumulation in the relative amount of carotenoid were observed in Rb. sphaeroides cells exposed to photo-oxidative stress [19].

I.3.3. Genome

R. rubrum strain S1 display one chromosome (4352825 base pairs) with a 65% G+C content and one plasmid (53732 base pairs) with a 60% of G+C content. Both encode a total of 3850 proteins, 83 RNAs. The 72.7% of the

protein-coding genes were assigned with a putative function whereas the remaining ones were annotated as hypothetical proteins [20].

I.3.4. Modes of growth

R. rubrum is capable of phototrophic (photolithoautotrophic and photoheterotrophic) and chemotrophic growth (chemolitotrophic and chemoheterotrophic). The optimal growth temperature ranges from 25 and 30° C [21]. Phototrophic growth is possible in light anaerobic conditions or when the oxygen tension decreases leading to the initiation of intracytoplasmic membrane formation [22]. This membrane bears the light-harvesting system LH1 and the reaction center (RC) [23] (detailed in section 3.5.4.2). R. rubrum can grow in anaerobic photolitoautotrophic mode using CO2 as carbon source and an inorganic electron source such as H2 (detailed information in section I.3.5.1.1) [24]. Whereas under anaerobic photoheterotrophic growth R. rubrum uses organic substrates as carbon source and electron donors. It also grow chemoheterotrophically in the dark, by respiration (O2 as final electron acceptor) using organic compounds as carbon sources. Under dark chemolithoautotrophic growth inorganic chemicals are used as electron donor (H2) and CO2 as carbon source [25].

I.3.5. Metabolism

I.3.5.1. Carbon metabolism

I.3.5.1.1. Carbon dioxide (CO2) under anaerobic phototrophic growth

For photolithoautotrophic mode of growth, from the four CO2 assimilation pathways described for microorganisms, R. rubrum possesses 3 of them i.e. Calvin Benson cycle, reductive tricarboxylic acid (RTCA) cycle [26] and the 3- hydroxypropionate bi-cycle pathway [27].

The main pathway for CO2 fixation is the Calvin-Benson-Bassham (CBB) cycle, however studies under photolithoautotrophic mode of growth, using a Ribulose 1,5-biphosphate carboxylase-oxygenase (RubisCO) deletion mutant i.e. R. rubrum strain I-19 demonstrated that carbon assimilation did not rely only on this cycle. R. rubrum also uses the RTCA cycle where 2 two ferredoxin-linked enzymes, the α-ketoglutarate synthase and pyruvate synthase are key for CO2

assimilation [24]. Under photoheterotrophic growth, CO2 assimilation via the CBB cycle is used as an electron sink to achieve redox balancing (the balance between energy utilizing and energy-supplying activities) in order to remove, dissipate or sequester excess of reducing equivalents [28]. Moreover a carbon monoxide dehydrogenase (CO dehydrogenase) was suggested to contribute to redox balancing when the CBB cycle is not present [27].

I.3.5.1.2. Organic acids

R. rubrum is able to metabolize volatile fatty acids (VFAs) e.g. acetate, propionate and butyrate. Different pathways have been proposed for acetate assimilation under phototrophic conditions, such as the citramalate cycle [29] and the ethylmalonyl-CoA pathway [30].

In the context of the MELiSSA loop, proteomic analysis of photoheterotrophic growth (acetate as carbon source) of R. rubrum S1H confirmed that this strain uses the ethyl malonyl-Coa pathway. Also a possible new pathway for acetate assimilation where glutaryl-CoA dehydrogenase is involved was suggested. Moreover, citramalate was suggested to act as an intermediate of the branched chain amino acid biosynthesis pathway rather than a metabolite of the citramalate cycle. Finally a pyruvate-flavodoxin oxidoreductase (NifJ) that assimilates acetate by carboxylation producing pyruvate, was suggested to represent a potential electron sink [30].

Moreover succinate assimilation under anaerobic dark growth in possible when the carbon source e.g. succinate, malate or acetate are used with DMSO or trimethylamine as electron acceptor [31]. A list of the described organic acids used by R. rubrum and the references for each organic acid can be found in the following list:

Carboxylic acids [9]  Acetate  Propionate  Butyrate  Succinate  Fumarate  Malate

Hydroxy acids [32]  3-hydroxyhexanoic acid  3-hydroxyheptanoic acid  Lactate Keto acids [33]

 Pyruvate

I.3.5.1.3. Sugars

Carbohydrates uptake by R. rubrum is restricted to fructose. that can be fermented into organic acids anaerobically in the dark [34]. It can also grow under anaerobic respiration, using as electron acceptors DMSO (Dimethyl sulfoxide) or TMAO (Trimethylamine N-oxide) [31]. In addition, assimilation of fructose also can generate energy by its fermentation under strict anaerobic conditions, where it does not require an electron acceptor and the products of its fermentation are acetate, propionate, formate, hydrogen, CO2 [31, 34]. Under this mode of growth carbon dioxide fixation influences growth and production of organic acids i.e. succinic acid, acetic acid, propionic acid [34].

I.3.5.2. Nitrogen metabolism

+ R. rubrum assimilates nitrogen in the form of ammonium ion (NH4 ), similar to other bacterial species uptake of ammonium is preferred since its reduction is less energy costly than nitrogen fixation. However when this sources of nitrogen are absent R. rubrum enzymatically reduces molecular nitrogen to ammonia, via the nitrogenase complex (dinitrogenase reductase ADP-ribosyl transferase, DRAT; Dinitrogenase reductase-activating glycohydrolase, DRAG). Later, ammonium (ammonia and/or ammonium ions) is assimilated via the glutamine synthetase (GS)/glutamate:2-oxoglutarate aminotransferase (GOGAT) also named GS/GOGAT cycle and via the glutamate dehydrogenase (GDH). Using both pathways the final products are glutamate and glutamine [35].

I.3.5.3. Reserve metabolism

I.3.5.3.1. Polyhydroxybutyrate (PHB)

PHB accumulates in R. rubrum when growing on acetate under illumination conditions [22]. The genes encoding PHA polymerases are phaC1, phaC2 and phaC3 and the main contributors to PHB are phaC1 and phaC2 [36]. The main PHA reported under photoheterotrophic conditions using malate as carbon source are 3-hydroxybutyrate and 3-hydroxyvalerate [37].

I.3.5.4. Energy metabolism

The versatile metabolism exhibited in PNSB allows them to grow using organic and inorganic electron donors and acceptors. As mentioned above R. rubrum can grow under 4 modes of growth. Under each mode of growth R. rubrum should be able to generate ATP, in the next section we will describe the pathways used by R. rubrum to produce energy.

I.3.5.4.1. Energy derived from chemicals

I.3.5.4.1.1. Substrate-level phosphorylation

This mechanism consists of the transfer of a phosphate group from a phosphorylated carbon substrate to ADP to form ATP, for instance as occurs in glycolysis and fermentation. As mentioned above R. rubrum sugar assimilation is restricted to fructose. Using fructose (according to the glycolysis pathway) 2 ATP are generated.

I.3.5.4.1.2. Respiration linked phosphorylation

In this type of energy generation, ATP is generated via oxidation of reduced organic or inorganic substrates under aerobic (oxygen as terminal electron acceptor) or anaerobic respiration with or without an electron acceptor (DMSO). As a result the proton motive force generated by the extrusion of protons during the electron transport chain across the cytoplasmic membrane is used by the ATP synthase to form ATP from ADP + Pi. The electron transport chain is formed by flavoproteins, Iron-sulfur proteins, cytochromes and quinones. A major requirement in this pathway is the synthesis of cytochrome cbb3 oxidase complex (Figure 1.3).

Figure 1.3. Electron transport chain under chemoheterotrophic growth of Rhodobacter sphaeroides. Unlike Rb. sphaeroides, R. rubrum possesses only high affinity cytochrome cbb3 instead of the cytochrome aa3 oxidase. Figure reproduced from [38]. 3.5.4.2. Energy derived from light

3.5.4.2.1. Photophosphorylation

Photophosphorylation consists on the use of light energy to create proton motive force that leads to the formation of ATP by the transfer of a phosphate group to ADP.

In R. rubrum it is carried out in the photosynthetic apparatus that locates in the intracytoplasmic membrane (Figure 1.4).

Figure 1.4. Transmission electron microscopy of R. rubrum. Arrows indicate the intracytoplasmic membrane in R. rubrum S1 grown under photoheterotrophic conditions. Bar = 0.25 µM [39]. The photosynthetic apparatus consist of a light-harvesting system named LH1 and a reaction center (RC). LH1 consist of 16 alpha and beta complex (αβ)16 that completely enclose the RC conformed by 3 peptides L, H and M [40]. Carotenoids from LH1 gather photons and transfer them to specialized bacteriochlorophylls in the RC, that donates the electrons to the electron transfer chain [23]. The electron transfer chain consists of bacteriopheophytin, ubiquinones, ubiquinone pool, cytochrome bc1 complex and cytochrome C2. During light anaerobic growth, two electron cycles are reported a cyclic and non-cyclic electron flow (Figure 1.5).

Figure 1.5. Cyclic and non-cyclic electron flow during photosynthesis in Rb .sphaeroides. Reproduced from [38]. During cyclic electron flow an electron from bacteriochlorophyll (Bcha) 870 is excited and transferred to bacteriopheophytin (BPh), then to ubiquinone molecule (QA) and ubiquinone (QB). At this point the electrons are transferred to the ubiquinone pool in order to reduce it to ubiquinol (QH2) then during the electron transfer to the bc1 complex protons are extruded across the cytoplasmic membrane giving rise to the proton motive force (pmf). Finally, the electron is transferred to a soluble periplasmic protein cytochrome c2 (cyt c2) that delivers the electron to the oxidized bacteriochlorophyll in the reaction center. This cycle produces pmf that is subsequently used to generate ATP.

Non-cyclic electron flow photoreduces NAD (NADP), required for cell biosynthesis. The process is similar to the cyclic electron flow until the ubiquinone pool is reduced to ubiquinol (QH2). At this stage the electron are transferred to NAD+ whereas the oxidation of an organic substrate (electron donor) provide electrons for the cyt c2 reduction. Finally, the electrons are delivering the electron to the oxidized BChl 870 restoring the reaction center to its initial state.

I.4. Potential industrial use of photosynthetic bacteria

Since photosynthesis converts solar energy into biofuels and biomass, research has focused on the improvement of photosynthesis efficiency. A key research area is the understanding of carbon metabolism of photosynthetic bacteria. In this context, depending on the mode of growth R. rubrum represents a microorganism with potential use on industrial applications e.g. as producers of vitamins, coenzymes and photosynthetic pigments such as lycopene [41]. Another field of application relies on the capacity of forming an intracytoplasmic membrane because it can be used as a system for heterologous expression of proteins [42]. In this context R. rubrum has been used as a host for heterologous expression of magnetosome gene cluster from Magnetospirillum gryphiswaldense for the production of magnetic nanoparticles [43].

Nowadays, there is an interest of use biodegradable polyesters produced by some microorganisms as an alternative of plastics [44]. R. rubrum is known to accumulate PHB under certain growth conditions, for instance when butyrate is used as carbon source [45]. This characteristic combined to genetic engineered research have shown that PHB production can be increased 2.5-fold in R. rubrum [36].

Another field of application of purple bacteria is the treatment of wastewater from the textile industry that contains azo dyes which are resistant to light, O2 and chemical degradation due to its azo bond (-N=N-), can be degraded by using a combination of anaerobic followed by aerobic conditions. Initial anaerobic degradation can be achieved using anoxygenic photosynthetic bacteria followed by aerobic biodegradation made by non-photosynthetic filamentous microorganisms that metabolize aromatic amines produced by initial degradation by photosynthetic bacteria [46].

In the environmental field, research is focused in the production of hydrogen

(H2) that has been suggested to be an environmental friendly fuel. The use of hydrogen could help to decrease the adverse effect of hydrocarbon fuels that releases carbon dioxide and other pollutants to the atmosphere. PNSB can produce hydrogen under photo-fermentation through the catalysis of nitrogenase with the consumption of adenosine triphosphate (ATP) and protons [47]. Intensive research has been focused on the design of photobioreactors in order to

increase hydrogen production rate and substrate conversion processes done by PNSB [48] moreover, carbon/nitrogen ratio, immobilization of cells, inoculum age has been also investigated [49].

I.5. Quorum sensing in bacteria

Cell-to-cell communication or quorum sensing (QS) allows bacteria to respond as a population to foreign stimulus by means of communication signal molecules named auto-inducers. These molecules diffuse across the membrane (or bind to membrane-anchored receptors) and once they reach a certain threshold concentration, they bind to specific cytoplasmic proteins. Then the new complex binds to DNA-specific sites, allowing the expression of target genes. QS system in Gram-negative and Gram-positive varies on the type of autoinducers produced by the cell. Gram-negative bacteria produce mainly acyl homoserine lactones (AHLs) whereas gram-positive bacteria produce oligopeptides.

I.5.1. General model in Gram-negative bacteria

QS was described initially in the Gram-negative marine bacterium Vibrio fischeri (now Aliivibrio fischeri) [50], which lives in symbiosis with the marine squid Euprymna scolopes. The QS circuit in this bacterium consists of two genes luxI, luxR and the LuxCDABE operon. LuxI is an acyl homoserine lactone (AHL) synthase and LuxR a transcriptional regulator. When the bacterium is grown at low cell densities it expresses luxI gene at basal levels (low AHL concentration), however when cell density increases the AHLs accumulates and diffuse across the membrane. Once in the cytoplasm, it binds to the LuxR regulator protein. Finally, the complex binds to a specific region in the genome called lux box initiating the expression of the luxCDABE operon that give rise to bioluminescence [51] (Figure 1.6). In Vibrio fischeri the autoinducers diffuse across the membrane, however in other species such as Vibrio harveyi autoinducer membrane receptors have been identified [52].

Figure 1.6. The Gram-negative LuxIR-type quorum sensing system. The red pentagons represents AHLs autoinducers [53] I.5.2. General model in Gram-positive bacteria

As mentioned above, Gram-positive bacteria produce/sense oligopeptides for cell-to-cell communication. In addition to oligopeptides, it also uses a two- component-type membrane bound sensor histidine kinases as receptors system and a response regulator protein that once phosphorylated bind to DNA and allow the expression of QS-regulated genes (Figure 1.7). For instance, in Sphaphylococcus aureus the Agr quorum system consists of an autoinducer (named autoinducing peptide, AIP) encoded by agrD gene, a two-component sensor kinase-response regulator pair: AgrC and AgrA, respectively. The autoinducer is exported by protein AgrB. Once AIP binds to AgrC, AgrA becomes phosphorylated and it induces the expression of the agrBDCA operon and regulatory RNA that represses the expression of cell adhesion factors [51].

Figure 1.7. The Gram-negative two-component system-type quorum sensing system. Blue octagons denote processed/modified peptide autoinducers [53] I.5.3. Quorum sensing networks

Several QS system networks have been described based on the signals molecules, membrane receptors, target genes and mechanisms of signal transduction. In this regard five QS circuits have been described for the most studied species [54]:  A parallel QS circuit in Vibrio harveyi and V. choleare  A QS circuit arranged in series in Pseudomona aeruginosa  A competitive QS circuit in Bacillus subtillis  A QS circuit with on-off switches in Streptococcus pneumoniae  A QS circuit responsive to host cues in Agrobacterium tumefaciens

I.5.4. Synthesis of AHL

The structure of AHL molecules consists of a lactone ring and an acyl chain. The general pathway suggested for AHL synthesis implies 2 precursors: the S- adenosylmethionine (homoserine lactone moiety precursor) and the acyl-acyl carrier protein (acyl-ACP, acyl side chain precursor). After substrate binding to LuxI, further acylation and lactonization steps give rise to the end product, an AHL [55] (Figure 1.8).

Figure 1.8. Proposed pathway for AHL synthesis Reproduced from [55]. I.5.5. Autoinducers types in Gram-negative and Gram-positive bacteria

Since the elucidation of the first autoinducer structure of the AHL type, several autoinducers types have been described for Gram-negative bacteria i.e. N-acylhomoserine lactones (AHLs), 2-alkyl-4-quinolones (AQs), fatty acid methyl esters, Autoinducer-2 (AI-2), furanones derived from dihydroxy- pentanedione (DPD). Acyl chains have from 4 to 18 carbons with 3-OH or 3-oxo substitutions. Normally the acyl chains are saturated, however, unsaturated acyl chains have been also described for some species for instance the 7,8-cis—N- (tetradecenyl) homoserine lactone in Rb. sphaeroides [56] (Figure 1.9).

Figure 1.9. Autoinducers described for Gram-negative bacteria. C6-HSL, homoserine lactone; PQS, Pseudomonas quinolone signal, 2- heptyl-3-hydroxy-4(1H)-quinolone; 3OH PAME, hydroxyl-palmitic acid methyl ester; AI-2, autoinducer-2; DPD, (R)-4,5-dihydroxy-2,3- pentanedione [57]. Similarly to Gram-negative bacteria, Gram-positive bacteria produces AI-2 but also autoinducing peptides (AIPs), γ-butyrolactones, cyclic, modified or linear peptides [58] (Figure 1.10). Interestingly, recently it was proposed that Bacillus subtillis uses volatile acetic acid as signal to coordinate biofilm formation. The signal can be airborne, therefore is advantageous for bacteria that does not grow in an aqueous environment [59] (Figure 1.10).

Figure 1.10. Autoinducers described for Gram-positive bacteria. A-factor, 2-isocapryloyl-3-hydroxymethyl-γ-butyrolactone; ComX, autoinducer peptide from Bacillus subtillis, the asterisk above tryptophane ; CSF, competence and sporulation factor autoinducer peptide; GBAP, gelatinase biosynthesis-activating pheromone [60].

I.5.6. Quorum sensing in photosynthetic alpha-proteobacteria

QS is also active among alpha-proteobacteria. In fact, a genomic survey over 512 completed bacterial genomes showed that 68 out of 265 sequenced proteobacteria genomes displayed complete QS circuits (LuxI and LuxR homologs present). Among those, 45 species exhibited more than one LuxR homologue. Incomplete QS were also found in 45 out of 265 proteobacteria genomes, suggesting that interaction among species is prevalent among Proteobacteria [61]. R. rubrum belongs to the anoxygenic phototrophic purple nonsulfur bacteria group and within this group 18 genera belong to the alpha- proteobacteria and 3 to the beta-proteobacteria. For this reason, based on this classification, we are going to focus mainly on alpha-proteobacteria. However, some representative species of the beta-proteobacteria class will be also included.

A special mention should be done for the Roseobacter clade (aerobic purple bacteria) including 50 described genera [62]. These bacteria carry out phototrophic metabolism only under aerobic conditions in the dark unlike purple nonsulfur bacteria that grow photoautotrophycally only at low oxygen levels and chemoteherotrophically at high oxygen levels. However, since Roseobacter belongs to the Rhodobacterales order which includes Rb. sphaeroides and Rhodobacter capsulatus, some representative species will be included i.e. Phaeobacter inhibens (formerly known as Phaeobacter gallaeciensis), Ruegeria sp. KLH11 and Dinoroseobacter shibae [63]. Moreover a survey of 43 Roseobacter genomes indicate that AHL-based QS is relevant for their environmental success [64].

As shown in Table 1.1, the described QS system is limited to the following species of alpha-proteobacteria: Rb. sphaeroides [56], Rb. capsulatus [65] Rhodovulum sulfidophilum [66, 67] Rhodopseudomonas palustris, [68], Rhodospirillum rubrum [69-71] and the representatives of the Roseobacter clade mentioned above. All the systems described LuxIR homologues and autoinducers of the AHL-type with saturated or unsaturated acyl chains that ranges from 4 to 18 carbons except for Rps. palustris that uses p-coumaroyl-AHL.

Table 1.1. Current QS systems described in Alphaproteobacteria.

Regulatory Organism Signal molecules Phenotype Ref. proteins

Dispersal from bacterial Rhodobacter 7-cis-C -AHL CerI/CerR* aggregates, [56] sphaeroides 14 pigmentation

Rhodobacter AHLs Enhance genetic GtaI/GtaR [65] capsulatus C16 (main), C14 exchange

Possible maintenance of Rhodovulum AHL (C10, C14 Not floc (structured [66] sulfidophilum and C18) described communities)

Rhodopseudomona p-coumaroyl-AHL RpaI/RpaR -- [68] s palustris

Photosynthetic Rhodospirillum [70, AHL RruI/RruR** membrane production, rubrum 71] pigmentation

Synthesis of tropodithietic acid (TDA, Phaeobacter 3-OH-C10-AHL PgaI/PgaR antibiotic) and [72] inhibens pigmentation (yellow- brown)

Indigoine production. Phaeobacter sp. 3-OH-C12:1-AHL PhaI/PhaR Pigment production. [62] Strain Y4I PgaI/PgaR C8-AHL Motiliy. Denser biofilms

3-OH-C14- AHL SsaI/SsaR Activation of flagellar synthesis and swimming Ruegeria sp. KLH11 3-OH-C14:1- AHL SsbI/SsbR [73] motility. Inhibition of 3-OH-C12- AHL SscI biofilm formation

LuxR1/1 Cell morphology and Dinoroseobacter C18-AHL LuxR2/2 flagellar biosynthesis. [63] shibae Type 4 secretion system. LuxI3

Ref.: References. *Display 2 CerR homologues (rcc01088 and rcc01823). ** Display 6 RruI homologues.

The current knowledge of R. rubrum QS system, is based on few studies. The first study identified AHLs by mass spectrometry in supernatant samples grown under light anaerobic conditions using Sistrom-succinate medium [69]. Eight different types of AHLs were identified by mass spectrometry i.e. unsubstituted (C6-, C8- and C10-HSL), 3-oxo-HSL (3-oxo-C8) and 3-OH substituted (3-OH- C6, 3-OH-C8, 3-OH-C10 and 3-OH-C12) homoserine lactones (Table 2). However, no specific phenotype was observed for R. rubrum S1H cells.

A second study revealed that in a simulated microgravity environment, R. rubrum S1H grown in Sistrom-Succinate under dark aerobic conditions produces higher amounts of AHLs (C10-HSL, C12-HSL and 3-OH-C14-HSL) independently of cell density, while associated increased cell pigmentation was observed. Additionally, more AHLs were identified i.e. unsubstituted (C6, C8, C10, C12, C14) and 3-OH-substituted (3-OH-C6, 3-OH-C8, 3-OH-C10, 3-OH- C12, 3-OH-14) increasing the number of AHLs produced by R. rubrum S1H (Table 1.2) [71].

The fact that more AHLs molecules were detected in this study could be the result of using whole cells instead of supernatant samples, compared to the first study. In this sense, it has been suggested that AHLs with longer acyl chains need efflux pumps to pass the cytoplasmic membrane as suggested for P. aeruginosa where a multidrug efflux pump MexAB export 3-oxo-C12-HSL [74]. Moreover, recently in Rhizobium meliloti a FadLsm a predicted beta barrel protein act as a transporter of long AHLs specially for C16:1-HSL [75]. Regarding a possible function of autoinducers in the bacterial cell, it has been demonstrated that another type of autoinducer (the Pseudomonas Quinolone Signal, PQS) from P. aeruginosa interacts with outer membrane lipids and it could stimulate the formation of membrane vesicles. Therefore it shows that QS molecules can play non-signaling functions [76]. To our knowledge, currently there is no information about a similar function of AHL in R. rubrum or photosynthetic bacteria.

Table 1.2. Mass spectrometry identification of AHLs in R. rubrum S1 and S1H under different culture conditions and carbon sources.

Sistrom medium M2SF medium (carbon source: succinate*) (carbon source: succinate and Strain S1H fructose*) Strain S1 Incubation: DAE [71] Incubation: LAN Incubation: MAE [70] Sample: total cells [69] Sample: supernatant Sample: supernatant C6-HSL C6-HSL -- C8-HSL C8-HSL C8-HSL C10-HSL C10-HSL C10-HSL C12-HSL -- -- C14-HSL -- -- 3-OH-C6-HSL 3-OH-C6-HSL 3-OH-C6-HSL 3-OH-C8-HSL (1) 3-OH-C8-HSL (1) 3-OH-C8-HSL (1) 3-OH-C10-HSL 3-OH-C10-HSL 3-OH-C10-HSL 3-OH-C12-HSL 3-OH-C12-HSL 3-OH-C12-HSL 3-OH-C14-HSL ------3-oxo-C8-HSL --

LAN, light anaerobic; DAE, dark aerobic; MAE, microaerobic; --, not detected; (1) most abundant AHL detected.

A third study reported that in R. rubrum S1 (parent strain of SH1), QS influences the growth rate and the photosynthetic membrane production when grown under dark microaerobic conditions using a combination of succinate/fructose as carbon sources (M2SF medium) [77]. They also reported the presence of 6 AHLs, where 3-OH-C8-HSL was the most abundant AHL (Table 1.2) [70]. These studies clearly demonstrated that R. rubrum exhibited a functional QS system since AHL were detected using the biosensor Agrobacterium tumefaciens and mass spectrometry analysis [70, 71]. A. tumefaciens biosensor does not produce AHLs and it harbors a plasmid with a lacZ fusion to traG, a gene that requires the transcriptional activator TraR and an AHL for expression. In consequence the traG::lacZ fusion can be induced when AHLs are externally supplied yielding a blue signal that results from the hydrolysis of X-Gal (supplied in the medium) by the β-galactosidase expressed from the traG::lacZ fusion [78]

As shown in Table 1.1, QS-regulated response in phototrophic bacteria includes pigment production, swimming motility and prevention of aggregation (flocculation). As proposed by Puskas et al [56], from the environmental point of view, if photosynthetic bacteria colonize a niche that favors photoheterotrophic growth it would be advantageous to stay in the planktonic instead of the biofilm lifestyle. In this sense, the evidence suggests that quorum sensing play a key role to keep planktonic state under photoheterotrophic conditions once cells reach high density. As described in Rb. sphaeroides and Rubrivivax gelatinosus QS could prevent flocculation (aggregation) by controlling EPS (exopolysaccharides) expression and swimming motility [56].

The hypothesis that QS favors individualism is supported by the QS system described in Dinoroseobacter shibae. This marine bacterium exhibit variable cell shapes (from ovoid rods to long filaments). Interestingly a QS-mutant showed uniform cell morphology this result lead to the conclusion that QS induces phenotypic individualization that could be beneficial to overcome unpredictably environmental stress conditions and maximize the fitness of the population in the environment [79].

Another primordial characteristic regulated by QS is the ability to reach zones (niches) where the bacteria can growth (suitable energy source) relying on their flagellar motility [80]. On the other hand some PNSB such as Rhodovulum spp. has been shown to form flocs naturally [81]. It is well recognized that bacteria live in communities rather than in the free-living state specially when they have to face environmental stress conditions [80]. Photosynthetic bacteria also exhibit this phenotype, especially when growing in microbial phototrophic mats (in association to diatoms, algae, cyanobacteria, purple and green bacteria and even non-phototrophic microorganisms). The following section will focus on biofilm formation in PNSB.

I.6. Biofilm formation

Biofilm formation has been described in bacteria since Van Leeuwenhoek in 1684, where he reported the presence of “animalcules” on dental plaque [82]. Research over the past years described biofilm lifestyle in plant-associated bacteria [83], human pathogenic bacteria [84] and environmental bacteria [80] with economic importance such as in the food industry [85] and biofouling [86].

In nature can exist biofilm formed by different species, named mixed biofilms, here we will focus on single species biofilm formation.

I.6.1. Biofilm development

Biofilm development consists of sequential stages i.e. initial attachment (reversible) to biotic or abiotic surfaces, irreversible attachment (mediated by EPS production), biofilm maturation (including microcolony formation followed by a fully maturation) and finally dispersion [87] (Figure 1.11). A mature biofilm can vary in shape under different environments e.g. stratified and compacted biofilms in dental plaque, elongated patchy biofilms when grown in turbulent flow cells. Therefore what determines the biofilm structure are the microbial biology and environmental parameters [80].

Figure 1.11. Stages of biofilm development Reproduced from [55]. I.6.2. Biofilm formation in Gram-negative and Gram-positive bacteria

The structure of biofilm mature biofilm has been described in E. coli K-12 macrocolonies showing different physiological zones. Interestingly in the outer biofilm layer small consisted of ovoid cells surrounded of curli fibers, the inner region displayed also heterogeneous cells and the bottom region showed elongated dividing cells [88]. An important component of bacterial biofilms is

the matrix that observed in Gram-negative and Gram-positive bacteria. Bacteria produces extracellular polymeric substances (EPS) such as polysaccharides, nucleic acids, proteins and lipids that increase the cell-to-cell attachment and the adhesion to surfaces [89]. The EPS content in the matrix range between 50-90% of the total organic matter, in Gram-negative where the EPS are neutral or polyanionic whereas in Gram-positive can be different due to their cationic nature [90].

Over the past years knowledge in biofilm formation has increased, the main observation is that depending on the system used to study the biofilm structure the results can variate, for instance:

 Listeria monocytogenes exhibit spherical microcolonies (in continuous flow). Under static conditions display homogeneous layer and/or microcolonies where the biofilm cells similar to the planktonic cells.  Staphylococcus aureus exhibit biofilm of dense layer of cells with an elaborate matrix harboring various types of polymers under continuous flow and static conditions.  Lactobacillus plantarum exhibit dense layer of cells embedded in EPS under continuous flow and static conditions.

Among the mechanisms that control biofilm formation is QS. As described for some Gram-negative species, flagella and motility influence biofilm formation in motile Gram-positive species at the initial stages (attachment to surfaces). This was observed in L. monocytogenes [91], Bacillus cereus (under static conditions) [92] and B. subtillis [93].

Regarding biofilm dispersion it relies on QS (LuxS-based) in some Gram- positive species such as B. cereus and L. rhamnosus reuteri and Staphylococcus epidermidis where AI-2 inhibit biofilm formation and induce the release of cells. Whereas in L rhamnosus QS (LuxS-based) induce biofilm formation [89]. Gram- positive bacteria that display the Agr-based QS system such L. monocitogenes, L. plantarum, control cell adherence and biofilm formation. However, in S. aureus biofilm formation is negatively regulated by this system [94].

I.6.3. Biofilm formation in photosynthetic bacteria

Little research has described the mechanisms of biofilm formation in PNSB. Current research has focused on the optimization of flocculation and biofilm formation induction for hydrogen production [95]. In this context it has been observed that phototaxis can positively influence biofilm formation development and therefore hydrogen production in Rps. palustris W1 [96]. Moreover, the mode of growth (photoheterotrophic or heterotrophic using succinate as carbon source) influence the biofilm architecture [97]. Similar biofilms development has been reported at initial stages in both modes of growth. However, at intermediate stages anaerobic phototrophic biofilms formed the distinctive T or mushroom like shapes whereas aerobic heterotrophic formed pillars structures that reduce their width [97].

Several studies pointed to the importance of biofilm in nature as a protective shelter, due to the presence of EPS matrix that is composed of eDNA, proteins, amyloid fibers polysaccharides and bacteriophages [98]. Interestingly, in the PNSB R. gelatinosus (a betaproteobacterium) the EmsRS (from Extracellular matrix and biofilm) two-component system has been found to prevent biofilm formation and EPS production. This bacterium produces an extracellular matrix in the late stationary phase; leading to cell aggregates formation possibly due to nutrient limitation. As a result, biofilm formation may help R. gelatinosus to overcome such stress condition. In this context the two-component system EmsRS has been suggested to play a role on switching between planktonic and aggregative lifestyle [99].

As observed for other Gram-negative bacteria, motility has been also reported to influence biofilm formation in Rb. sphaeroides, specifically for fliA (anti- sigma factor) and flgM (sigma factor) mutants, under static conditions [100].

Noteworthy that biofilm formation is also impaired when cell shape is not optimum The altered cell shape is the result of a reduction on cardiolipin (CL) phospholipid in Rb. sphaeroides [101]. Therefore membrane lipid composition also influences biofilm formation in photosynthetic bacteria. The same effect was observed in E. coli when grown under different glucose concentration [102]. In addition to cell shape, culture conditions (static incubation) has been found to enhance biofilm formation in the Roseobacter clade [103].

6.3. Link between biofilm formation and quorum sensing in gram-negative bacteria

Quorum sensing has been suggested to play a role in biofilm maturation and dispersal stages in gram-negative bacteria. For instance QS was shown to be involved in biofilm development specifically in biofilm differentiation processes in Pseudomonas aeruginosa [104]. Similarly, the link between QS and biofilm development was described for other gram-negative bacteria such as Serratia liquefasciens, Burkholreria cepacia, Aeromonas hydrophyla [105].

Regarding biofilm dispersion, QS has been shown to control it. Some examples are Yersinia pseudotuberculosis [106], Rb. sphaeroides [56], Xanthomonas campestris [107], Vibrio vulnificus [108, 109], Vibrio cholera [110] among others (Table 1.3). As mentioned before, the current knowledge about QS and biofilm formation is that QS activate in a coordinate manner the dispersion of the biofilm structure [111].

Table 1.3. Examples of the relation between QS and biofilm development

QS positively controls biofilm Species References maturation Regulation of swarming S. liquefasciens motility,.swrI mutant exhibit thin biofilm Biofilms arrested in microcolony [105] B. cepacia stage in cepI or cepR mutants Biofilms structurally less A. hydrophyla differentiated than WT biofilms QS-regulation of cell Species dispersion or biofilm formation Aggregation in liquid culture, ypsR Y. pseudotuberculosis or ypsI knockout mutants exhibit [106] increased swimming motility Aggregation in liquid culture of cerI Rb. sphaeroides [56] knockout mutant V. cholerae QS repress biofilm formation [112]

Besides the link between QS and biofilm dispersion mentioned before, other cues and signals also influence biofilm dispersion i.e. nutrient and oxygen concentration, intracellular content of the nucleotide c-di-GMP and the nitric oxide signaling [98].

Similarly, the evidence suggests that QS plays the same role in PNSB by preventing cell aggregation, EPS production and promoting pigment production and swimming motility among others (Table 1.3). In the context of the MELiSSA project R. rubrum biofilm formation has been observed when cultivated in a bioreactor at laboratory scale (Figure 1.12) when acetate was used at concentration: 0.4 g C/L and light: 3441 µE·m-2·s-1 [113].

Figure 1.12. Cultivation of R. rubrum S1H under MELiSSA conditions. Left, jacketed glass cilindric photobioreactor containing R. rubrum S1H. Right, biofilm formation inside the photobioreactor. Photobioreactor characteristics: capacity 3L (2.4 L of usable volume); agitation 300 RPM; illumination halogen lights (Sylvania, BAB, 38° 12V, 20W, UVB filter code 125) distributed around the cylinder [113]. Pictures credits: Dr. Felice Mastroleo (personal communication). In this thesis we follow the definition of biofilm as a mature community of cell attached to a surface that consist mostly of live cells whereas cell aggregation will be referred as cells that remain together without attachment on a surface.

Chapter II: Objectives of the thesis

Compartment II of the MELiSSA loop is colonized by Rhodospirillum rubrum S1H. Its function is to metabolize products coming from compartment I under light anaerobic conditions. However, continuous culture of the bacterium in photobioreactor showed that irreversible thick biofilm formation can occur shading the rest of the culture from the light source and leading to stop the bioreactor. Since quorum sensing (QS) has been linked to biofilm formation in other bacterial species the aim of this research was to investigate the QS system and its possible relation with biofilm formation in R. rubrum S1H under MELiSSA relevant culture conditions.

To accomplish our aim the following objectives were followed:

 Construction of a QS-silent mutant by knocking out gene Rru_A3396 that encodes an acyl homoserine lactone synthase.  Phenotypic characterization the QS-mutant by comparing it with the WT strain.  Identification of potential genes regulated by QS using transcriptomic and proteomics approaches.  Investigation of the possible link between QS and biofilm formation under MELiSSA conditions.

The data collected in this research will help us to understand and to gain knowledge on the yet unknown QS system in R. rubrum.

Therefore we will be able to answer the following questions:

1. Is QS system of R. rubrum S1H active during cultivation under MELiSSA conditions? 2. What is the extent of QS in R. rubrum S1H under MELiSSA conditions at the phenotypic, transcriptomic and proteomic levels? 3. Is there a link between QS and biofilm formation in R. rubrum? 4. What are the consequences of these results for future MELiSSA development?

Chapter III: Construction and phenotypic characterization of M68, a RruI quorum-sensing knockout mutant of the photosynthetic alphaproteobacterium Rhodospirillum rubrum

III.1. Abstract

Bacteria communicate each another using a complex system named quorum sensing (QS). QS-active bacteria regulate their gene expression in response to cell density. In this study an acyl homoserine lactone synthase (Rru_A3396) knockout mutant (named M68) of Rhodospirillum rubrum S1H (WT) was constructed and characterized phenotypically under MELiSSA-like culture condition (light as energy spurce and acetate as carbon source). Results showed that R. rubrum WT produces unsubstituted, 3-OH and 3-oxo-substituted HSLs with acyl chains ranging from 4 to 14 carbons, with 3-OH-C8 being the most abundant. Growth, pigment content, and swimming motility were found to be under the control of this LuxI-type QS system. In addition, cultivation in low shear environment put forward the aggregative phenotype of M68 and linked biofilm formation to QS in R. rubrum S1H. Only QS-mutant M68 remained producing decreased level of 3-OH-C8-HSL, probably due to the presence of an extra HdtS-type AHL synthase.

Keywords: quorum sensing; pigments; phenotype; biofilm; aggregation; low shear environment; MELiSSA; HdtS.

Chapter redrafted after: Condori S., Atkinson S., Leys N., Wattiez R., and Mastroleo F. Construction and phenotypic characterization of M68, a RruI quorum-sensing knockout mutant of the photosynthetic alpha-proteobacterium Rhodospirillum rubrum. Research in Microbiology. Manuscript accepted for publication with minor revisions

III.2. Introduction

The MELiSSA (Micro-Ecological Life Support System Alternative) loop has been conceived as a recycling system with five compartments containing microorganisms and higher plants for long haul space flights [3]. Within the loop, the alphaproteobacterium Rhodospirillum rubrum S1H colonizes compartment II when cultivated in light anaerobic conditions (LAN) using acetate as carbon source. Previous work reported that continuous culture of the bacterium in a photobioreactor lead to thick biofilm formation, leading to bioreactor arrest [113]. Biofilm formation is a well-known bacterial behavior that has been linked to cell-to-cell communication also known as quorum sensing (QS).

Cell-to-cell communication allows bacteria to respond as a population to foreign stimuli by using as communication signal molecules named autoinducers. In Gram-negative bacteria these molecules exhibit different chemical structures including acyl homoserine lactones (AHLs), furanosyl borate diester, among others. On the other hand, in Gram-positive bacteria the QS signaling molecules are oligopeptides [54]. The principle of QS system has been first described for Vibrio fischeri, a Gram-negative marine bacterium that lives in symbiosis with squid [51]. This bacterium produces autoinducers of the AHL type that are synthesized by an acyl homoserine lactone synthase, LuxI protein. At low cell densities the synthase produces AHLs at basal levels, then as cell density increases the AHLs accumulates and binds to the intracellular LuxR transcriptional regulator protein. Then, the complex binds to a specific region in the genome (namely a lux-box) initiating the expression of luxCDABE operon giving rise to bioluminescence, the community response [51].

QS-community responses vary from pathogenicity, bacterial aggregation, biofilm formation among others [54]. Within the purple nonsulfur (PNS) photosynthetic bacteria, the QS system has been described for Rb. sphaeroides [56], Rhodovulum sulfidophilum [66], Rps. palustris [68], Phaeobacter inhibens [72], Ruegeria sp. [73], Rhodovulum [67] and in the Roseobacter clade [63]. Some QS-related phenotypes observed for PNS bacteria are prevention of cellular aggregates, pigment production and biofilm formation. As previously suggested, cell dispersion and increased pigmentation could be a response to light limitation for photosynthetic organisms [71].

In R. rubrum the QS system functionality was assessed through the identification of acyl homoserine lactone molecules [69-71] Moreover, a QS role in growth and photosynthetic membrane productions at high cell densities has been suggested [70]. Additionally, in the context of space research, cultivation of R. rubrum in low shear modeled microgravity showed that AHLs production is cell density independent and induces photosynthetic pigments production [71].

In this study we have constructed a luxI homologue knockout mutant (named from now on M68) of the life support bacterium R. rubrum S1H (WT). Then characterization of M68 was done at the phenotypic level by comparing M68 and WT under relevant MELiSSA culture conditions (light anaerobic conditions using acetate as carbon source). Results have shown that motility, pigment content and biofilm formation were regulated by QS.

III.3. Material and Methods

III.3.1. Light system set up for MELiSSA culture conditions

Previous study have evaluated and selected halogen lamps as the energy source for the compartment II of the MELiSSA loop [113]. Therefore a light source system using halogen lights was designed at SCK·CEN. It consists of 5 lamps (halogen lamps 20W, 38, BAB) coupled in a steel support. The light system was placed inside the incubator over the shaker at a distance of 58 cm.

The shaker surface area was divided in 21 rectangles of 4.3 x 7.8 cm (area occupied by one 50 ml culture flask) and the light intensity was determined on each rectangle. Light intensity was measured (µmol·m-2·s-1) with a spherical quantum sensor (LI-COR, LI-193) coupled with a light meter (LI-COR 250A). The temperature was kept at ca 30.8 ± 0.8 °C.

III.3.2. Bacterial strains and growth conditions

III.3.2.1. Aerobic chemoheterotrophic growth

R. rubrum strains used in this study are listed in Table 3.1. Sistrom medium [114] was used for dark aerobic chemoheterotrophic growth, namely Sis-DAE. Bacterial cultures were incubated at 30°C under shaking conditions (150 rpm). Culture axenicity was tested in Luria-Bertani (LB) agar medium and plates were incubated at 30°C for at least 3 days. For cloning experiments, Sistrom medium supplemented with peptone and yeast extract (namely SPY) medium was used. When needed medium was supplemented with kanamycin 50 µg ml-1, gentamycin 25 µg ml-1 or rifampicin 15 µg ml-1.

III.3.2.2. Anaerobic photoheterotrophic growth - MELiSSA conditions

Melissa medium [115] containing acetate as sole carbon source was used for R. rubrum S1H photoheterotrophic growth (MELiSSA relevant culture conditions). Cultures were illuminated with a light intensity of 80 µmol·m-2·s-1.

Briefly, 50 ml of cultures were first grown to OD680 0.40 under Sis-DAE conditions. Then, cells were collected by centrifugation, resuspended in 50 ml of Melissa medium and transferred to penicillin bottles that were closed and sealed with rubber stoppers and metallic caps respectively to provide an anaerobic

environment. Cultures were incubated under shaking conditions (150 rpm) at 30° C. Incubation time varies between experiments therefore it is described in each experiment subsection. The described conditions will be mentioned from now on as MELiSSA-like culture conditions (Mel-LAN). Initial batch cultures were done under aerobic conditions, since oxygen will be consumed by the bacterium during the initial hours of growth we did not removed the oxygen present in the new cultures.

Table 3.1. Bacterial strains and plasmids used in this study

Bacterial strain Relevant genotype or description Reference or or plasmid source E. coli TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 S17-1 [116] λpir K12 MA8, host strain for pKNOCK plasmid [117] mcrA D(mrr-hsdRMS-mcrBC, modification-, restriction- DG1 ) f80lacZDM15 DlacX74 recA1 araD139 D(ara-leu)7697 Eurogentec galU galK rpsL endA1 nupG F- mcrB mrr hsdS20(rB- mB-) recA13 leuB6 ara-14 HB101 pRK600 [118] proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- MG1655 RP4-2-Tc::[ΔMu1::aac(3)IV-ΔaphA-Δnic35- MFDpir [119] ΔMu2::zeo] ΔdapA::(erm-pir) ΔrecA A. tumefaciens

NT1 AHLs bioreporter (pZLR4) [78] R. rubrum S1H Wild type strain ATCC 25903 M68 ΔrruI::Km This study Plasmids pKNOCK-Gm Mobilizable suicide vector [117] pKNOCK/rruI- pKNOCK-Gm containing rruI gene and flaking regions This study HR1-2 pKNOCK-HR1/2- pKNOCK containing both HR and Km cassete-HR2 This study Km pACYC177 Kanamycin cassette donor (NEB) pHKT-2 TpR, pBBR1Tp backbone donor [120, 121]

III.3.2.3. Escherichia coli culture conditions

E. coli strains were grown in LB broth or agar plates, when needed gentamycin 25 µg ml-1, kanamicyn 50 µg ml-1, streptomycin 25 µg ml-1 where added to the medium. E. coli S17-1 λ was used as host for cloning procedures and as donor strain in conjugation experiments (see below). Cultures were grown aerobically overnight at 37° C with agitation at 150 rpm.

III.3.2.4. Agrobacterium tumefaciens NT1 culture conditions

A. tumefaciens NT1 (pZLR4) was used as a bioreporter for AHLs detection in thin layer chromatography (TLC) experiments. A. tumefaciens was grown in modified MGM minimal medium (11 g Na2HPO4, 3 g KH2PO4, 0.5 g NaCl, 1 g glutamate, 10 g glucose, 1 mg biotin, 27.8 mg CaCl2, and 246 mg MgSO4 per liter) supplemented with gentamicin 25 µg ml-1. Cultures were grown under DAE conditions at 30° C at 150 rpm of shaking for 48 hours.

III.3.3. Bioinformatics analysis

For bioinformatics analysis R. rubrum S1 [20] genes and proteins sequences publicly available at NCBI gene database were used. Multiple alignments of amino acid sequences from several lux-box and LuxI family members were done using CLUSTAL omega [122] and MultiAlign programs [123]. Shading of conserved amino acids was generated by Multiple Align Show program [124]. For multiple protein sequence alignment of LuxI family members, the following protein sequences were compared: Rru_A3396 (YP_428477.1 named RruI); CerI, Rbr sphaeroides (accession number AAC46022); LuxI, Vibrio fischeri (CAA68562); SolI, Ralstonia solanacearum (030920); RhlI, Pseudomonas aeruginosa (AAC44037)

III.3.4. R. rubrum knockout mutant construction

In order to characterize the QS system in R. rubrum an acyl homoserine lactone synthase knockout mutant was constructed. Primers were designed using software Primer3 [125]. List of primers used in this study are listed in Table 3.2. Cleavage sites for restriction enzymes were added to the 5’-end of each primer. Hairpin structure and primer dimerization were analyzed with NetPrimer program (http://www.premierbiosoft.com/netprimer/index.html).

Table 3.2. List of primers used in this study Name Primer sequence (5’ 3’) Restriction Restriction site, *clivage site enzyme Cloning primers P_1_F ATACTGCA*GCAGCTTCCCTTCCTGTGGT PstI P_1_R TTAGGTAC*CGAACTGTGTTACGCCTTCTGG KpnI rPCRud_6_F AATC*TCGAGTGATGAACGGATACGATGAAAC SalI rPCR_7_R AATC*TCGAGTTTCCCAGGGGTACGATG SalI oKm_F AATG*TCGACCATGAACAATAAAACTGTCTGCTTAC SalI oKm_R AATG*TCGACCCGCCGTCCCGTCAAGTCAGCGTAATGC SalI ReversePCR AATT*CTAGATCCTTTGCGAATAATCGCGTAGATCAC XbaI Real time primers rru_A3394_2_ F GGTGATCTCCCAATCAAAGG rru_A3394_2_ R GGTGGAAGAAAACACCAAGG Rv RruA3395 GCTGATCGGCGAGCAAAA Fw RruA3395 GGCATGGCGGTCGAAA o_rru_A3396_1_F CTGCTTGATACCGTCAAACG o_rru_A3396_1_R AAACGGGTCACATCCATCAC Rru_A3397_1_F GACGAGGGAGACGAGATTTG Rru_A3397_1_R GCCTCCTGTTCGAGATAAGC 16S rRNA GTGGAGCATGTGGTTTAATTCG 16S rRNA GGAAGTGTCACGGGATGTCAA Complementation primers cRru_A3396_F_BamHI (pr88) ATATG*GATCCTCTTCGCGCGGATAATAAAC BamHI cRru_A3396_R_ HindIII (pr89) ATATA*AGCTTCAGATCGACGGTTTCATCG HindIII 400_Rru_A3396_3F_BamHI ATATG*GATCCAGCACCTTGTGCATCTGTTG BamHI (pr90) 400_Rru_A3396_3R_HindIII ATATA*AGCTTCTCGTCGACTTCGGGATCT HindIII (pr91) 500-Rru_A3396-97- ATATG*GATCCAGCACCTTGTGCATCTGTTG BamHI 130_6_F_BamHI (pr96) 500-Rru_A3396-97- ATATA*AGCTTGATGGCCTCAATGAAGCAG HindIII 130_6_R_HindIII (pr97) pBBR1MCS-kpn/xba 1 ATATA*AGCTTCACATTAATTGCGTTGCG HindIII F_HindIII (pr98) pBBR1MCS-kpn/xba 1 ATATG*GATCCCATTCAGGTCGAGGTGG BamHI R_BamHI (pr99) pBBR1MCS-kpn/xba 2 ATATA*AGCTTTAATCATGGTCATAGCTGTTTCCTG HindIII F_HindIII(pr100) pBBR1MCS-kpn/xba 2 ATATG*GATCCTATTACGCGCGCTCACTG BamHI R_BamHI(pr101)

III.3.4.1. Amplification of rruI gene and flanking homologous region

Gene Rru_A3396 encodes a putative AHL synthase (rruI) and gene Rru_A3395 encodes a putative transcriptional regulator (LuxR) homolog protein that will be referred from now on as rruR-1. This gene locates upstream of rruI and both are oriented in the same direction. Flanking the rruR-1 and rruI locate genes Rru_A3394 and Rru_A3397, both genes encode hypothetical proteins and only Rru_A3394 is oriented in the opposite direction than rruI (Fig 2).

Primers P_1_F and P_1_R were used to amplify rruI gene (Rru_A3396) and flanking regions that consist of an upstream and downstream regions of 672 (homologous region 1, HR1) and 526 (homologous region 2, HR2) base pairs (bp) respectively. After PCR, the amplicon (named insert, I) that consisted of 1819-bp was purified by spin column (PCR purification kit, Qiagen), eluted in elution buffer (EB, 10 mM Tris-Cl, pH 8.5, Qiagen) and stored at -20°C until use.

III.3.4.2. Vector construction

Vector pKNOCK [117] was isolated from E. coli K12 following manufacture’s protocol (Wizard Plus SV Minipreps DNA Purification System Quick Protocol, Promega). Vector (V) and insert (I) were double digested separately overnight at 37°C with PstI and KpnI restriction enzymes. Next day both samples were cleaned up by spin column (Qiagen PCR clean up Kit) and eluted in EB buffer. Prior to ligation, vector was dephosphorylated (Anthartic phosphatase, Thermo) in order to avoid vector recircularization. Ligation mixture (T4 Ligase, Thermo) was incubated at 22°C for one hour. Enzymatic reaction was stopped at 75°C for 5 minutes. The resultant construct was named pKNOCK/rruI-HR1-2.

III.3.4.3. Transformation of E. coli S17-1 λ

E. coli S17-1 λ competent cells were transformed by heat shock. Briefly 5 µl of ligation mixture (containing pKNOCK/rruI-HR1-2 construct) was added to 100 µl of competent cells and subsequently incubated for 10 minutes on ice followed by 5 minutes at 37º C. LB medium (2 ml) was added to the transformed cells and incubated for 1 hour at 37º C under shaking conditions (150 rpm). Grown samples were centrifuged for 5 minutes at 5,000 rpm, supernatant was

discarded and the pellet was resuspended in 100 µl of LB medium. Resuspended cells were plated out in LB agar plates supplemented with gentamicin (15 µg ml- 1) and incubated overnight at 37º C. Next day, 10 colonies were selected and screened by colony PCR using two pairs of primers ReversePCR/P_1_F and P_1_F/P_1_R that amplified regions of 672-bp and 1819-bp respectively, proving the ligation of insert into the vector.

Two colonies were selected, colony 6 (Col6) and colony (Col7) to propagate the plasmid. Each colony was grown overnight in LB-Gm25, next day plasmids were isolated according to manufacturer’s protocol (Wizard Plus SV Minipreps DNA Purification System Quick Protocol, Promega). Plasmid size was confirmed by agarose gel electrophoresis, after plasmid linearization with SalI restriction enzyme that gave rise to the expected construct size of 3419-bp.

III.3.4.4. Reverse PCR

Gene rruI was deleted by amplification of pKNOCK/rruI-HR1-2 PstI- linearized plasmid, using primers rPCRud_6_F and rPCR_7_R containing restriction sites for SalI. After PCR amplification a linear fragment of 2798-bp, where rruI gene was absent, was obtained. Then this fragment was cleaned up, digested and ligated to a kanamycin (Km) resistant cassette (928-bp) previously amplified from plasmid pACYC177 using primers oKm_F/oKm_R containing restriction sites for SalI. Ligation reaction gave rise to plasmid pKNOCK-HR1/2- Km that was introduced in E. coli S17-1 λ (donor strain) by heat shock transformation. Finally cells were plate out in LB-Km50 and incubated overnight at 37°C. Km resistant colonies were selected.

III.3.4.5. Transformation of R. rubrum by conjugation

E. coli S17-1 λ (donor) containing plasmid pKNOCK-HR1/2-Km was grown -1 to OD600 1 in LB medium supplemented with kanamycin 50 µg ml whereas R. rubrum S1H Rif-resistant was grown to OD680 1 in SPY medium supplemented with rifampicin 15 µg ml-1. Both strains were mixed at 1:1 ratio, centrifuged, resuspended in saline solution and spotted onto a filter membrane (0.45 µm) previously placed onto a Sistrom agar plate. Mating plates were incubated over night at 30°C under DAE conditions. Next day, cells were recovered in 1 ml of saline solution; this suspension was used to prepare ten-fold serial dilutions. Hundred microliters of each dilution was plated out in Sistrom-succinate agar

plates supplemented with rifampicin 15 µg ml-1 and kanamycin 50 µg ml-1. After 7 days of incubation colonies were recovered and resuspended in 100 µl of saline solution. In order to detect double homologous recombination, each colony was inoculated in Sistrom-succinate-Rif-Km and in Sistrom-succinate-Rif-Gm plates separately. Transconjugants sensitive to gentamycin and resistant to kanamycin were selected. Insertion and orientation of the Kanamycin resistant cassette in R. rubrum genome was checked by PCR using combination of primer shown in Fig. 3. In addition insertion site of Km cassette was assessed by sequencing (Macrogen). Since rifampicin was used only for mutant selection it was not included further in our experiments.

III.3.5. Complementation

III.3.5.1. Addition of WT supernatant

Fresh M68 and WT Mel-LAN cultures were started at OD680 0.30 (4 biological replicates for each group). Each well from a culture plate (24 wells) was filled out with 800 µl of each sample plus 200 µl of WT supernatant (previously filtered through 0.2-µm pore size filter). Plate was incubated for 5 days at 150 rpm of shaking under Mel-LAN conditions. Culture plates were placed inside of anaerobic bags (Millipore) in order to reach anaerobic conditions. Complemented strains should not form aggregates. As a control 200 µl of WT supernatant was spotted on a MGM-agar plate and overlaid with A. tumefaciens biosensor. The plate became blue indicating the presence of AHLs in the supernatant.

III.3.5.2. Addition of AHL whole cells extracts

Fresh Mel-LAN cultures were supplemented AHLs extracts dissolved in dichlorometane (DCM). Ten microliters of AHLs whole culture extract was dried and the pellet was resuspended in 10 µl of pure DMSO. Then 1 µl of this solution was added to ach well. For anaerobic conditions culture plates were placed in anaerobic bags (Millipore). Samples were incubated under Mel-LAN conditions for 10 days. Previously the effect of DMSO at final concentration of 2 and 0.05% was tested under Sis-DAE conditions. Growth was followed over time by measuring the optical density at λ 680 every 15 minutes in a Clariostart microplate reader (BMG LAbtech).

III.3.5.3. Addition of synthetic molecules

New Mel-LAN cultures were supplemented with 3-OH-C8- AHLs at 50, 10 and 1 µM of final concentration dissolved in acetone. Culture plates were incubated under Mel-LAN conditions. Complemented strains should not form aggregates. To discard a possible effect on growth by AHLs solvents, M68 growth was followed by measuring initial and final OD680 after 3 days of incubation under Sis-DAE conditions. One microliter of each the following solvents were used: acetone/ethanol (1:1), acetone, ethanol and ethyl acetate.

III.3.5.4. Complementation by plasmid

Three inserts were generated by PCR amplification using Phusion high- fidelity PCR master mix (Thermo Scientific). Amplicons were named o_3396, 4_3396 and 5_3396-97 corresponding to primer pair pr88/pr89, pr90/pr91 and pr96/pr97, respectively (Table 3.2). Each amplicon consisted of gene rruI plus an upstream region of 168, 400 and 500 bp respectively. Forward and reverse primer contained 5’-end restriction sites for HindIII and BamHI respectively. PCR products were purified by spin column following manufacture’s protocol for PCR clean up (Wizard® SV Gel and PCR Clean up System, Promega kit) and eluted in MQ water.

In parallel plasmid pHKT-2, a pBBR1Tp derivative plasmid was isolated from E. coli DH5α following manufacture’s protocol (Wizard Plus SV Minipreps DNA Purification System Quick Protocol, Promega). In order to eliminate the gfp gene (1.6 kb) present in the plasmid pHKT-2 was double digested with KpnI and XbaI restriction enzymes. The digestion mix was incubated overnight and inactivated next day at 80°C for 20 minutes. Samples were run on 0.8 % gel (no star activity was observed) and extracted from it following manufacture’s protocol (Wizard Plus SV Minipreps DNA Purification System Quick Protocol, Promega). Purified DNA was used as template for PCR amplification of remaining plasmid backbone using primers pr98/pr99 and pr100/pr101 with HindIII and BamHI restriction sites on its 5’-end for forward and reverse primer respectively. Backbone plasmid included Trimethoprim resistance cassette (Tp), mob (gene required for plasmid mobilization), rep (gene required for plasmid replication). Two PCR fragments were generated of 4405 and 5064 bp named V1 (vector 1) and V2 (vector 2) respectively.

Ligation of vectors (V1 and V2) and inserts (o_3396, insert 4_3396 and insert 5_3396-97) was performed using T4 DNA ligase (Thermo scientific). Samples were mixed at 1:1 ratio and incubated overnight at 16° C. Two E. coli strains were used as donors, MFDpir and DG1. Each strain was transformed by electroporation and heat shock respectively. In order to check the final construct, plasmid DNA was isolated and digested with HindIII and BamHI restriction enzymes and the size of each fragment was checked by agarose gel. Resultant fragments corresponded to the size of the fragments before ligation.

Biparental mating was performed using donor MFDpir and recipient M68. Sistrom-succinate agar supplemented with kanamycin 50 µg ml-1 and trimethoprim 25 µg ml-1

Triparental mating was performed using helper (E. coli HB101 containing plasmid pRK600 and grown in LB supplemented with chloranphenicol 30 µl ml- 1), donor (E. coli DG1) and recipients (M68) cells. Helper, donor and recipients cells were washed twice and resuspended in 50 µl of saline solution and mixed. The final mix was placed onto a filter previously placed onto Sistrom-succinate agar plate without antibiotic. Next steps followed are as previously described in section III.3.4.5. Selective plates contained Tp 25 µg ml-1 whereas in liquid cultures Tp 0.6 mg ml-1 was used.

In addition of conjugation, transformation was also tested using the construct for complementation. M68 cells were transformed as previously described [126]. Transconjugant and transformants colonies were grown under Sis-DAE conditions. AHL production was tested by extracting AHLs from one milliliter of each culture using dichloromethane. Final extracts were spotted on TLC plates and overlaid with A. tumefaciens biosensor.

III. 3.6. AHLs extraction and identification

III.3.6.1. Extraction and identification by thin layer chromatography (TLC)

AHLs extraction was performed as previously described [71]. Briefly, 200 ml of R. rubrum S1H cultures were grown under MELiSSA conditions to OD680 2 and 3. Cultures were buffered to pH 7.24 ± 0.02 with 50 mM MOPS (3-N- morpholino propanesulphonic acid). Whole cells were extracted twice with an equal volume of dichloromethane (Millipore). Organic phase was recovered and

subsequently filtered over anhydrous magnesium sulphate (Alfaesar). Extracts were dried using a Rotavapor (Buchi Labortechnik, Flawil, Switzerland) and resuspended in 500 µl of dichloromethane (Millipore). For TLC five µl of each synthetic standards (N-butyryl-DL-homoserine lactone, N-hexanoyl-DL- homoserine lactone, N-dodecanoyl-DL-homoserine, Merck) and final extracts were run on C18 reverse-phase chromatography plate (Merck) using as mobile phase methanol/water (60:40 v/v). Biosensor bacterium Agrobacterium tumefasciens grown in MGM medium to OD600 1 was mixed with soft agar (Oxoid) and 40 µg ml-1 X-Gal (Fermentas). Finally, TLC plates were overlaid with the biosensor bacterium and incubated at 30°C for 3 at least days.

III.3.6.2. AHLs identification by mass spectrometry (MS)

For MS identification the remaining extract was dried out and kept at -20 ºC until samples processing. Identification of AHLs was performed as previously described [71].

III.3.7. QS-mutant phenotype characterization

III.3.7.1. Growth under Mel-LAN conditions

Growth was monitored by measuring the optical density at 680 nm (OD680) every ca 24 hours. For comparison of growth kinetics the Gompertz model [127] was fitted to the OD680 data. Therefore, WT and M68 were compared based on the following parameters: maximum specific growth rate (µm), lag time (λ) and maximal biomass at stationary phase (A).

III.3.7.2. Pigment quantification

Pigment content was quantified as previously described [128]. Briefly, 2 ml of culture was collected and centrifuged at 12000 rpm for 10 minutes. The supernatant was discarded and the pellet was washed with MQ water and centrifuged again for 10 minutes at 12000 rpm. Then pellet was resuspended in 2 ml of methanol:acetone (2:7) and subsequently centrifuged for 10 minutes at 12000 rpm to separate pellet from pigment extracts. Finally supernatant were recovered and measured immediately at OD496, OD515 and OD763. Bacteriochlorophyl concentration was calculated using the following formula:

퐶 푂퐷 퐵푐ℎ푙 푎 = 763 휀763 .푙

-1 Where CBChl a: bacteriochlorophyl concentration in g.l , OD763: optical density -1 -1 at 763 nm, ε763: extinction coefficient 82.2 g .l.cm , l: is the path length 1 cm. Carotenoids concentration was determined using the following formula:

퐶 푂퐷 ; 푂퐷 푂퐷 + 푂퐷 , 푐푎푟표푡푒푛표𝑖푑푠 = λ 푎푣 휆 푎푣 = 496 515 휀휆 푎푣 .푙 2

-1 -1 Where ε763 is the extinction coefficient 250 g .l.cm .

III.3.7.3. Swimming motility

Motility was tested under Sis-DAE conditions in 0.3% (w/v) agar plates. Plates were inoculated in the middle of the agar without touching the bottom of the plate with one colony or 5 µl of mid-log phase cultures grown under Sis-DAE conditions. Plates were incubated under DAE conditions for 7 days at 30°C. In addition to swimming, swarming motility was also tested by adding 10 µl of a mid-log phase culture onto 0.8% (w/v) Sistrom agar plates and incubated under DAE conditions for 7 days at 30°C.

III.3.7.4. Low shear environment in a rotating wall vessel (RWV)

To compare the behavior of R. rubrum strains in low-shear environment, the rotating wall vessel (RWV) technology was used [129]. The back of each vessel (Cellon, Bereldange, Luxembourg) was sealed with an acrylic disk in order to obtain anaerobic culture conditions. Each 10 ml vessel was filled to capacity with

R. rubrum cultures at OD680 0.3 as previously described [71]. All vessels were placed in vertical position and rotated at 25 rpm. The light source was placed in front the vessels and each one received ca. 80 µmol·m-2·s-1 of light intensity. Each strain (WT and M68) was tested in biological quadruplicate and samples were incubated at 30°C. WT and M68 samples were stopped after 168 and 408 hours respectively. Oxygen concentration, pH and

OD680 were measured at the end of the test period as indicators of metabolic activity and cell growth.

III.3.8. Expression of QS genes

III.3.8.1. RNA extraction

Five milliliters of cultures grown under Mel-LAN conditions were sampled at

OD680 1 and OD680 2. Samples were mixed with RNAprotect® Bacteria Reagent (Qiagen) following manufacturer’s instructions; pellets were stored at -80 °C until use. For bacterial lysis, stabilized bacterial pellets were resuspended in 100 μl of freshly prepared TE (Tris 10 mM, EDTA 1 mM, pH 8) containing lysozyme 3 mg ml-1 and incubated for 10 minutes at room temperature. RNA extraction was done following a protocol for Gram-negative bacteria according to SV total RNA Isolation system kit (Promega). RNA was quantified using a Nanodrop whereas quality/integrity was assessed using a BioAnalyzer 2100 (Agilent) as previously described [71]. Samples with RNA integrity number value above 8 were used for real time quantitative PCR.

III.3.8.2. Reverse transcription and real time quantitavive PCR

Production of cDNA was performed using TaqMan reverse transcription reagents kit (Life Technologies) as previously described [130]. Primers were designed using OligoPerfectTM Designer (Life Technologies). In silico primer specificity was assessed using the software http://insilico.ehu.es/PCR/ [131]. Primers efficiency was calculated using the following formula: 10(-1/Slope). The slope was calculated from the linear function between the log of dilutions used and their correspondent Ct values, in addition a melting curve was run to assure the presence of a single amplicon. For relative quantification MESAGREEN qPCR Master Mix Plus SYBR® Assay Low Rox kit (Eurogentec) was used. Briefly, 5 µl of cDNA and 2.5 µl of each primer (2 µM) were added to 12.5 µl of reaction buffer 2X. Cycling program was as follow: 5 minutes at 95 °C (MeteorTaq activation) followed by 40 cycles for 45 seconds at 60 °C. Among the potential housekeeping genes tested (23S rRNA, Rru_A2320, Rru_A0743 and 16S rRNA), 16S rRNA showed the lowest variation of expression between control and test conditions. As a consequence, 16S rRNA was chosen as internal reference for normalization. Up and downregulation cutoff values were 2 and 0.5 respectively.

III.4. Results

III.4.1. R. rubrum S1H possesses a QS system that consists of one LuxI homologue (RruI) and six luxR homologues (RruR)

Gene rruI (a LuxI homologue) encodes a protein of 206 amino acids with a predicted molecular weight of 23.06 kDa. A multiple protein sequence alignment analysis of LuxI family members and RruI showed that 9 out of 10 conserved amino acids are present in R. rubrum S1H, only a single conserved substitution E99D was found (Figure 3.1, red box).

Figure 3.1. Multiple protein sequence alignment of LuxI family members Partial view. R. rubrum contain 9 of the 10 invariant amino acids (*) among most LuxI family members. Red square indicates a conserved substitution of a glutamic acid (E) for an aspartic acid (D). Analysis was done using the species listed in the material and methods part.

In order to search for potential lux-box (binding site for LuxR), an intergenic region (156-bp) upstream of rruI gene was aligned with reported lux-box homologues from Ralstonia solaceanarum, Thiobacillus ferrooxidans, Burkloderia cenocepacia, Vibrio fischeri and Pseudomonas aeruginosa. By using

CLUSTAL Omega program, no lux-box was identified, only disrupted lux-box aligned to the intergenic region (alignment not shown). However, using MultAling a putative lux-box was identified from position -59 to -78 upstream of rruI ATG start codon (Figure 3.2).

Figure 3.2. Alignment of other lux boxes by CLUSTAL omega for nucleotide sequence shading with program Multiple Align. luxI, Vibrio fischeri; rhl and las from Pseudomonas aeruginosa; sol, Ralstonia solaceanarum; afe, Thiobacillus ferrooxidan; cep, Burkloderia cenocepacia; rru, R. rubrum.

Regarding LuxR homologues, a total of 6 have been described in R. rubrum S1 genome. Only gene rruR-1 (Rru_A3395) is located upstream of rruI, (and separated from it by an intergenic region of 156-bp) (Figure 3.2) whereas the remaining 5 luxR homologue genes, rruR-2 (Rru_A1935), rruR-3 (Rru_A2179), rruR-4 (Rru_A3229), rruR-5 (Rru_A2603) and rruR-6 (Rru_A2232) are distributed in the genome [70]. A search in the conserved domain database (CDD) showed that the N-terminal domain in RruR-1, RruR-2 and RruR-3 is an autoinducer binding domain, whereas in RruR-4, RruR-5 and RruR-6 is a REC domain, known to receive the signal from its sensor membrane-bound protein partner in a two-component system. Regarding the C-terminal domain, all RruR proteins exhibited the characteristic H-T-H (helix-turn-helix) DNA-binding domain of LuxR-like proteins.

III.4.2. RruI knockout mutant (M68) construction and stability

In order to confirm the function of gene rruI as homoserine lactone synthase, a knockout mutant of rruI was constructed. Gene rruI (621-bp) was successfully replaced by a Km cassette (918-bp), which orientation was assessed by PCR

using two sets of primers Pst_I/oKm_R and Pst_I/oKm_F represented as pairs 1/5 and 1/4 respectively in Figure 3.3. Presence and absence of PCR product using primers 1/5 and 1/4 respectively confirmed that Km cassette was oriented in the same direction than rruR-1, in addition to PCR, sequencing results also confirmed the orientation and exact site of insertion of Km cassette in R. rubrum geome. In the WT, the intergenic region of rruR-1 and rruI consist of 153-bp whereas in M68 consists of 57 base pairs, meaning that 96-bp upsteam the Km cassette were lost during the recombination process (Figure 3.3).

Figure 3.3. Replacement of rruI gene. From top to down, Sequence in lowercase represents the intergenic region of rruR-1 and rruI (156-bp) whereas the sequence in uppercase represents the initial base pairs of rruI. In M68 the sequence in gray lowercase is not present. Primers location is represented by arrows and numbers. Agarose gel showing gene replacement, numbers below bands represent their size in base pairs whereas numbers below gels represents combination of primers used.

Stability of the Km cassette in M68 genome was monitored over time (after every experiment) by plating out aliquot of cultures grown under Mel-LAN conditions without kanamycin on Sis-DAE agar plates supplemented with Kanamycin. Additionally colony PCR using primer 4/5 (Figure 3.3) confirmed the presence of the Km cassette in R. rubrum S1H genome after at least 3 subcultures in Melissa medium without antibiotic selective pressure.

III.4.3. R. rubrum S1H produces unsubstituted and 3-OH substituted HSLs under Mel-LAN conditions

In order to establish the putative AHL synthase function of rruI, the production of AHLs was tested in M68 and compared to the WT. In addition,

WT AHLs production at OD680 2 and 3 was compared. In M68 no AHLs were detected using TLC while the WT produces AHLs molecules with acyl chains ranging from 4 to 12 carbons (Figure 3.4).

Figure. 3.4. TLC overlay plate showing AHLs from WT and M68 at OD6803. C4-HSL, C6-HSL and C12-HSL: AHLs standards.

In WT, the most abundant AHLs at OD6802 are 3-OH-C8-HSL followed by C8-HSL. Notably 3-oxo-HSLs molecules were detected only at OD6802 (Table 3.3). At OD6803, 3-OH-C8–HSL remained the most abundant and, unlike OD6802, the second most abundant AHL was 3-OH-C10-HSL. Previous studies also pointed out 3-OH-C8-HSL as the main AHL produced by R. rubrum regardless of the carbon source used [69-71] (Table 3.4).

Table 3.3. Identified AHLs in R. rubrum S1H grown WT under MELiSSA conditions at OD680 3 compared to OD6802

AHLs FC in OD6803 ±SE p-value C4-HSL OD3 nc nc C6-HSL 0,112* 0,004 <0.0001 C8-HSL 0,118* 0,002 <0.0001 C10-HSL 0,281* 0,032 0,002 C12-HSL OD3 nc nc C14-HSL OD3 nc nc 3-OH-C4-HSL OD3 nc nc 3-OH-C6-HSL 0,518* 0,089 0,033 3-OH-C8-HSL 0,590* 0,027 0,004 3-OH-C10-HSL 0,815 0,065 0,106 3-OH-C12-HSL 1,880 0,237 0,065 3-OH-C14-HSL OD3 nc nc 3-oxo-HSL OD2 nc nc

*Significantly different from OD6802 with P<0.05. SE: standard error; nc, not calculated; OD3: AHLs detected only at OD6803; OD2: AHL detected only at OD6802. N=3 OD6802, N=4 OD6803. (raw data in annex 3 and 4). A significant decrease in the amount of 3-OH-C6-HSL, 3-OH-C8-HSL, C6-

HSL, C8-HSL and C10-HSL at OD6803 in comparison to OD6802 was observed (Table 3.3). The decreased amount of AHLs at OD6803 due to pH-dependent lactonolysis was discarded as pH at OD6803 was ca 7.24. Interestingly, at OD6803 five additional AHLs were identified i.e. C4, C12, C14-HSL and 3-OH-C4 and C14. Therefore R.rubrum S1H (WT) produces unsubstituted and 3-OH- substituted HSLs with acyl chains ranging from 4 to 14 carbons as well as 3-oxo- C8-HSL under the conditions tested (Table 3.4).

Table 3.4. Mass spectrometry identification of AHLs in R. rubrum S1 and S1H under different culture conditions and carbon sources.

Melissa medium Sistrom medium M2SF medium (acetate*) (succinate*) (succinate and Strain S1H Strain S1H fructose*) Strain S1 LAN DAE LAN MAE (this study) [71] [69] [70] Total cells Total cells Supernatant Supernatant C4-HSL ------C6-HSL C6-HSL C6-HSL -- C8-HSL C8-HSL C8-HSL C8-HSL C10-HSL C10-HSL C10-HSL C10-HSL C12-HSL C12-HSL -- -- C14-HSL C14-HSL -- -- 3-OH-C4-HSL ------3-OH-C6-HSL 3-OH-C6-HSL 3-OH-C6-HSL 3-OH-C6-HSL 3-OH-C8-HSL (1) 3-OH-C8-HSL (1) 3-OH-C8-HSL 3-OH-C8-HSL (1) (1) 3-OH-C10-HSL 3-OH-C10-HSL 3-OH-C10-HSL 3-OH-C10-HSL 3-OH-C12-HSL 3-OH-C12-HSL 3-OH-C12-HSL 3-OH-C12-HSL 3-OH-C14-HSL 3-OH-C14-HSL -- -- oxo-C8-HSL -- 3-oxo-C8-HSL --

LAN, light anaerobic; DAE, dark aerobic; MAE, microaerobic; --, not detected; (1) main AHL detected; *carbon source used.

Regarding M68, while gene rruI was deleted, M68 still produces 3-OH-C8- HSL suggesting the presence of a second AHL synthase. No significant difference was found in the amount produced at OD6803 compared to OD6802 (data not shown). Additionally the production of 3-OH-C8-HSL in WT compared to M68 was ca 262- and 5400-fold higher at OD6802 and OD6803 respectively. III.4.4. Growth curve of WT and M68 under Mel-LAN conditions

The growth curve obtained from cultures already adapted to Mel-LAN conditions were fitted with the Gompertz model. Results showed that M68 exhibit a longer lag time (λ) ca 15 hours more (p<0.05) whereas, maximum growth rate (µm) and final biomass (A) values for both strains were similar (Figure 3.5).

Figure 3.5 Growth curve of WT and M68.

Growth under Mel-LAN conditions fitted with the Gompertz model. N=3 for each strain. III.4.5. Pigment content and swimming motility are modulated by QS

Since M68 colonies showed a visible decreased pigmentation compared to WT on Sistrom plates, the pigments content was determined. The QS-mutant M68 contained 48% and 62% less bacteriochlorophyll and carotenoids respectively compared to WT at OD6802 whereas at OD1 no significative differences were found (Figure 3.6).

Figure 3.6. Bacteriochlorophyll (Bcha) and carotenoids (Crt) content in WT and M68.

N=2 for OD6801 and N=3 for OD6802.

Swimming motility was affected (but not halted) in M68 compared to WT. After 7 days of incubation, the diameter reached by M68 was ca 70% less than WT (Figure 3.7).

Figure 3.7. Swimming motility test of R. rubrum WT and M68. Tested in Sistrom plates (agar 0.3%) incubated under DAE conditions

III.4.6. Complementation

III. 4.6.1. Addition of external molecules does not complement M68

Before complementing M68 with AHLs extracted from WT and dissolved in DCM, the effect of DMSO 0.05 and 2% on R. rubrum growth was tested. Cells that grew in the presence of DMSO 2% showed a decreased growth when compared to WT (Figure 3.8, A). Therefore DMSO 0.05% final concentration was used, since cell growth was not affected at this concentration. However, as observed for WT supernatant, no effect on inhibition of bacterial aggregation was observed in M68 after addition of AHLs extracted from WT (Figure 3.8, B)

B WT M68 WT M68

Figure 3.8. Complementation of R. rubrum M68 A, effect of DMSO on R. rubrum S1H growth under Sis-DAE conditions. B, arrows points M68 aggregation in complemented cultures besides the addition of WT supernatant (left) and whole cell extract (right).

Since 3-OH-C8-AHL was the most abundant AHL in R. rubrum S1H under MELiSSA conditions, M68 cultures were supplemented with this molecule. Previously a possible solvent effect on M68 growth was tested, four solvent were tested. Initial and final OD680 was measured. Results showed that growth was not affected by any of the solvents (Figure 3.9). Results also showed that complementation was not successful by addition of 3-OH-C8 at 50, 10 and 1 µM of final concentration.

0,08

0,07

0,06

0,05

0,04

0,03 ODʎ680 initial

0,02 ODʎ680 final Optical Optical Density (OD) 0,01

-0,01 M68 control M68+Ac/Eth M68+Ac M68+Eth M68+EthylAce Solvents Figure 3.9. Solvents effect on M68 growth under Sis-DAE conditions. No significant differences between M68 and M68 supplemented with solvents were found (p=0.7). Addition of synthetic molecule 3-OH-C8-AHL did not restore WT phenotype in M68. The mutant strain was still aggregating (Figure 3.10)

Figure 133.10. R. rubrum S1H complementation. R. rubrum S1H grown under Mel-LAN conditions supplemented with 3-OH-C8-AHL at 50, 10 and 1 µM final concentration. Partial view of culture plate. From left to right: WT/M68-50 µM /M68-10 µM /M68-1 µM /M68/Blank (Melissa medium) Complementation by plasmid was assessed, besides transconjugant grew in the selective medium, when they were screened for AHL production, using 1 ml

of culture at OD 0.5 under Sis-DAE conditions, no AHL signal was detected (Figure 3.11).

Figure 3.11.Complemented M68 do not produce AHL. Blue dot represents AHL from WT supernatant. M68 does not produce AHLs. III. 4.7. Cultivation in low-shear environment

To further explore M68 impaired motility, cultivation under a low-shear environment using the RWV technology was performed. Results showed that WT cultures remained disperse during the first 96 hours while after 16 hours cell- aggregation was observed in M68 (Figure 3.12, hour 16). Interestingly, after 96 hours WT formed aggregate of cells that attached to the RWV wall forming a macroscopic biofilm. Whereas M68 cells remained as a suspended aggregate of cells without forming biofilm even after prolonged incubation time (up to 408 hours) (Figure 3.12).

68 68 h. S1H cultures were stopped at 168 h and M68 after

3.12. WT 3.12. and technology. M68 RWV cultivation using the

Figure

M68 exhibited an aggregative phenotype after 16 h of cultivation. WT cells clump after 96 h and biofilm appeared on the RWV wall at 1 h 408

Figure 3.12. WT and M68 cultivation using the RWV technology.

After 168 hours (7 days), OD680, pH and oxygen concentration were measured in WT and M68. Results showed that WT reached stationary phase and became anaerobic, in contrast, in M68 the three parameters indicated no growth (Table 3.5). Only M68 cultures were returned in to the RWV and after 408 (17 days),

OD680 and pH increased whereas oxygen concentration decreased. Besides the prolonged incubation (408 hours ca 17 days) M68 did not form biofilm.

Table 3.5. OD680, pH and oxygen concentration for WT and M68 during RWV cultivation.

OD Final pH* [0 ] ppm Incubation time Strain 680 2 (mean ± SD) (mean ± SD) (mean ± SD) 168 hours S1H 2.25 ± 0.03 7.53 ± 0.04 2.95 ± 1.26 M68 0.31 ± 0.04 6.82 ± 0.02 7.4 ± 0.30 408 hours M68 2.07 ± 0.05 7.56 ± 0.13 0

* Initial pH at hour 0: 6.80 for all samples. Mean±SD (N=3 at 168h and N=2 at 408h).

III. 4.8. Expression of QS genes

As described in Figure 3.2 gene pair rruIR are flanked by two hypothetical proteins Rru_A3394 and Rru_A3397 that locates up- and downstream respectively. In order to determine the expression profile of the rruRI and the 2 adjacent genes, a quantitative real time PCR experiment was performed at OD680 1 and OD680 2. In the WT, as cell density increases, genes Rru_A3394, rruI (Rru_A3396) and Rru_A3397 showed an increase expression whereas rruR-1 (LuxR regulator homologue – Rru_A3395) remained downregulated (Figure 3.13, left). In M68, genes Rru_A3394 and Rru_A3397 increased its expression in ca 3.21 and 4.08-fold whereas gene rruR-1 remained downregulated as in WT (Figure 3.13 right).

Figure 3.13. Expression profile of QS-related genes in WT and M68.

Left, WT gene expression profile at OD6802 compared to OD6801. Right, M68 gene expression profile at OD6802 compared to OD6801. ND, not detected. * p<0.05, **p <0.01.

When the expression profile of M68 vs WT was compared at OD6801 a significant change in expression was observed only for Rru_A3394 (p<0.03)

Figure 3.14, left). Whereas at OD6802, the only significant change in expression was observed for gene rruR-1 that increased its expression in ca 2-fold times (Figure 3.14, right)

Figure 3.14. Expression of QS-related genes in M68 compared to WT

Left, comparison at OD6801. Right, comparison at OD6802.Values above bars represent the FC compared to WT. ND, not detected. * p<0.05.

Analyzing only WT expression, the results suggest that R. rubrum exhibit a LuxRI system similar to Vibrio fischeri. When cell density increases luxI increases its expression whereas luxR is repressed. Interestingly gene rru_A3397 does not change its expression in M68 at OD6801 and 2 suggesting that rru_A3397 do not decrease its expression in the absence of homoserine lactones (Fig 3.14, right).

III.5. Discussion

Analysis of the Rhodospirillum rubrum S1 genome [20] showed that R. rubrum possesses genes that encode putative proteins from the well-known LuxIR protein family. In fact, in R.rubrum S1 one AHL synthase (LuxI homologue) and 6 regulator proteins (LuxR) have been described [70] however only one of them is located upstream rruI. The presence of LuxR ‘solos’ (term used to define the LuxR proteins without a cognate LuxI) has been described for other Gram-negative bacteria e.g. ExpR of Sinorhizobium meliloti, BisR of Rhizobium leguminosarum bv. viciae and QscR of Pseudomonas aeruginosa [132]. A possible function of these LuxR-type ‘solos’ proteins could be to sense/respond to foreign and intracellular molecules and to extent the AHL QS regulon to other gene targets [132]. For R. rubrum, it was suggested that RruR-1 could be involved in the regulation of genes related to photosynthetic membrane formation, whereas the remaining 5 RruR could be involved in growth modes (aerobic, microaerobic) and regulation of related metabolism [70].

LuxR proteins bind to specific regions (lux-box) in the genome, as observed for other LuxR homologues [133, 134]. Mutational studies in Vibrio fischeri have shown that in a common lux-box sequence 6 out of 20 base pairs remained conserved (XXCTGXXXXXXXXXXCAGXX) [135]. In R. rubrum S1H a potential lux-box suggested in this study differs in one bp at position 4 (where a G replaces a T). However, in R. rubrum the specific binding sites of all RruR proteins remains unknown.

Previously in our lab it was shown that AHLs were produced by R. rubrum S1H in Sistrom-succinate medium under light anaerobic conditions [69] and also in low-shear modeled microgravity in dark aerobic conditions. In R. rubrum S1H low-shear cultivation induced long acyl chain i.e. C10, C12-HSL and 3-OH-C14- HSL production together with higher pigmentation [71]. Moreover presence of AHLs was also reported when grown under LAN, DAE and dark microaerobic conditions using mixed carbon sources i.e. succinate and fructose [70]. This study reports 3-OH-C8-HSL as the main AHL produced under MELiSSA conditions, meaning light anaerobic with acetate as sole carbon source.

MS analysis confirmed that gene rruI (Rru_A3396) is the main AHL synthase in R. rubrum however the presence of 3-OH-C8-HSL in M68 extract indicates

that R. rubrum possesses a second AHL synthase that does not belong to the LuxI, AinS, LuxM or VanM protein family (not found in R. rubrum genome except for LuxI). A search for HtdS-type AHLs synthases described in Pseudomona fluorescences [136] and Acidithiobacillus ferooxidans [137] showed that R. rubrum genome exhibits 2 homologues genes Rru_A3257 (1-acyl-sn- glycerol-3-phosphate acyltransferase) and Rru_A3769 (Lyso ornithine lipid acyl transferase) with 39% and 33% identity respectively. From these two putative proteins, Rru_A3257 has been suggested to have a dual function. Its main function is to catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid, a key phospholipid intermediate in cell membrane synthesis [137]. However it can also be involved in the transfer of an acyl group from acetyl-CoA to S-adenosylmethionine giving rise to AHLs formation [136]. In P. fluorescens F113, Hdts synthesize long (3-OH-C14:1-HSL, C10-HSL) and short (C6-HSL) AHLs. Similar to P. fluorescens, HdtS from A. ferrooxidans mainly synthesize a long AHL (C14-HSL), however, it can also synthesize minor amounts of C6- and C8-HSL [137].

The production of 3-OH-C8-HSL in M68 indicates that R. rubrum S1H possesses 2 independent systems to synthesize this molecule that it might play a key role in R. rubrum, independently of the culture conditions tested. However the specific function of this AHL remains unknown.

Recently, it has been suggested that photoheterotrophic growth in acetate (Mel-LAN conditions) produce a stress condition that increased the lag-phase in R. rubrum S1H. This stress might be the result of a redox imbalance [30]. Similarly, in M68 a longer lag-phase was observed suggesting that QS play a direct or indirect role in the cellular mechanisms for redox balancing as described for Rb sphaeroides [47, 138]. In addition, the decreased pigment content (bacteriochlorophyll and carotenoids) in M68 could also explain the longer lag phase observed since carotenoids have been described to be important in bacterial protection from photodestructive reactions in the presence of oxygen [17]. Indeed, Mel-LAN precultures are started in aerobic conditions. Therefore destructive events in photosynthetic reaction center or light-harvesting pigments could occur.

Previous studies demonstrate the relation between QS and swimming [139- 141]. M68 is 70% less motile than WT indicating that swimming motility it

positively regulated by QS under the conditions tested. Aggregation has been described to be under the control of QS in the free-living photosynthetic bacterium Rb. sphaeroides 2.4.1 [56]. In Rb. sphaeroides aggregation is strong and visible as a floc (when grown in Sistrom medium, succinate as carbon source), whereas in M68 aggregation occurred under a low shear-environment. Moreover, under static conditions M68 cells settled at the bottom of the tube, similar to the plant pathogen Pantoea ananatis K-1 [142]. However whether aggregation in M68 is related to exopolysaccharides production as described for Rb. sphaeriodes remain to be investigated.

In purple nonsulfur bacteria such as Rb. sphaeroides, Ruegeria sp KHL11 sp. Phaeobacter inhibens among other species QS controls pigmentation, swimming motility and prevention of aggregation. Our results support the role of QS in cell dispersion since M68 exhibit a decreased swimming motility. Additionally our results also showed that biofilm formation is QS-regulated under Mel-LAN conditions in a low shear environment. Biofilm development include attachment of planktonic cells onto biotic or abiotic surfaces [143], at this step it was suggested that flagella play an important role [91, 144]. In this sense the decreased motility observed in M68 cells also suggests a possible influence on its biofilm formation capacity.

Biofilm formation has been linked to quorum sensing in many bacterial species such as Vibrio cholerae [110], Serratia liquefaciens MG1 [145], Pantoea stewartii subspecies stewartii [146] among others [147]. However up to now the knowledge on biofilm formation in photosynthetic bacteria is at their initial stage, currently only phenotypic behavior has been described in species of economic and industrial importance e.g hydrogen production [48], biopolymers source [36] and for heterologous protein expression [42, 43]. To our knowledge this is the first study that link QS and biofilm formation in R. rubrum under a low shear environment.

Expression analysis suggest that rruI and rruR genes follow the model described for Vibrio fischeri [51]. As R. rubrum S1H increase cell density, the expression of rruI also increases whereas rruR decreases this result suggest that the RruR-1/HSLs complex represses the expression of the transcriptional regulator rruR. In V. fischeri this negative feedback loop is known to be a compensatory mechanism to control the expression of the bioluminescence

operon luxICDABE [51]. Comparison of relative expression of the Rru_A3394 rruR, rruI and Rru_A3397 in M68 and WT at 2 different optical densities could support this model.

Finally, complementation of M68 strain failed some possible explanations are discussed in the general discussion section (Chapter VI).

III.6. Conclusions and perspectives

We have characterized the QS system in R. rubrum S1H under Mel-LAN conditions (acetate and light as carbon and energy source respectively) in an RruI knockout mutant named M68. Interestingly detection of 3-OH-C8-HSL in M68 indicates the presence of an active secondary AHL synthase (gene Rru_A3257) that could be an HdtS-type synthase. However further investigations on a specific knockout mutant on Rru_A3257, will confirm its putative secondary function. Importantly 3-OH-C8-HSL was found the main AHL in R. rubrum when grown under MELiSSA conditions. In addition, it was also reported to be the main AHL under other carbon (succinate, fructose) and culture conditions (DAE, microaerobic).

Our results showed that QS regulates cell aggregation (under a low shear environment), growth, swimming motility and pigment content. Interestingly besides M68 exhibit a longer lag-phase, growth rate and maximal biomass achieved remained similar to WT. Therefore specific kinetic studies under bioreactor will confirm the possible use of this QS-mutant in the MEliSSA loop. It has been suggested that prevention of biofilm formation can be achieved by using AHLs analogues that blocks the AHL binding site in RruR. However, blocking the QS in R. rubrum implicates to reduce photosynthetic efficiency (pigment content) but more importantly it will allow the entrance of foreign molecules to the loop. This could risk the following compartments, especially C3 where Nitrosomonas sp. grow in biofilms and active QS system has been described for this bacterium.

Finally since extent of the QS- system could go far than the observed phenotype, further studies at the transcriptomics and proteomic levels will help us to understand the complete extent of the QS system in R. rubrum. In addition, the specific role of OH-C8-HSL remains also to be investigated as well as the identification of rru-box upstream of potential QS-controlled genes.

Chapter IV: Transcriptomic and proteomic profiling of Rhodospirillum rubrum M68 cultivated in MELiSSA related culture conditions

IV.1. Abstract

In the context of the Micro-Ecological Life Support System Alternative (MELiSSA) project, the quorum sensing system (QS) of R. rubrum S1H has been shown to rely on acyl homoserine lactones (AHLs) as communication signals. In addition, previous studies in our lab have suggested that pigment content and photosynthetic membrane production could be under the control of QS. In the present study, the transcriptomic and proteomic profiles of a QS-deficient mutant (R. rubrum strain M68) that does not produce AHLs as the WT strain (R. rubrum S1H) were compared when cultivated in light anaerobic conditions using acetate as carbon source.

Transcriptomic and proteomic approaches revealed that 330 genes and 217 proteins were differentially expressed in M68 compared to S1H, indicating that several operons were QS-regulated i.e. flagellar assembly, chemotaxis, photosynthesis, electron transport, stress proteins. These results showed the importance of a functional QS system in R. rubrum.

IV.2. Introduction

Bacteria use a cell-to-cell communication system named quorum sensing (QS) to coordinate expression of specific genes in a cell density manner. Regarding Gram-negative bacteria the communication occurs through small molecules named autoinducers [54].

Rhodospirillum rubrum S1H is an environmental photosynthetic proteobacterium that it used in the Micro-Ecological Life Support System Alternative (MELiSSA) [3]. This recycling system consists of 5 interconnected compartments where R. rubrum S1H colonizes compartment II and where it grows under light anaerobic conditions using a mixture of volatile fatty acids as carbon source. The aim of that system is to provide water, food and oxygen to the crew for long term space exploration missions for instance, to Mars or the Moon.

Over the past years, the clinical and environmental importance of a functional QS system has been put forward for bacteria [148]. In addition, the presence of this system has been reported in a genomic survey. A search over 512 completed bacterial genomes showed the presence of complete (LuxI and LuxR homologs present) and incomplete (only one homologue LuxI or LuxR is present) QS circuits, suggesting that interaction is prevalent among Proteobacteria species [61]. Specifically, environmental bacteria are subjected to changing environments. In this context QS has been suggested to play a crucial role in bacterial adaptation and survival in natural environments [149].

QS has been demonstrated to be active in purple nonsulfur bacteria such as Rb. sphaeroides [56] and Rps. palustris [68]. Regarding R. rubrum, it displays an acyl homoserine lactone-based QS system [69, 71] where AHLs are synthesized mainly by one acyl homoserine lactone synthase, a LuxI-type (named RruI, Chapter III). R. rubrum display one cognate LuxR homologue and five orphan LuxR-type regulators [70].

Increasing the knowledge on QS, a previous study has shown that pigment content could be under the control of QS in low-shear modelled microgravity conditions [71]. Moreover photosynthetic membrane production has been shown to be also under the control of QS at high cell densities [70]. However, the extent of QS on global gene expression has not been assessed.

In this study the transcriptomic and proteomic profiles of R. rubrum M68 under MELiSSA growth conditions has been analyzed.

IV.3. Material and methods

IV.3.1. Bacterial strains and growth conditions

R. rubrum S1H (ATCC25903) and R. rubrum M68 photoheterotrophic growth was performed using Melissa medium with acetate as carbon source (Mel-LAN conditions) [115]. Cultures grown under light anaerobic conditions were used as inoculum. Penicillin bottles (with a capacity of ca 57 ml) were filled with 50 ml of new cultures at initial OD 0.3 and closed with rubber stops leaving a head space in the bottle, therefore oxygen is present in the new cultures. For illumination, halogen lamps (20W, 38, BAB) were used and light intensity was measured with a spherical quantum sensor (LI-COR, LI-193) coupled with a light meter. Cultures were grown under a light intensity of 80 µmol·m-2·s-1 under shaking conditions at 150 RPM.

IV.3.2. Transcriptomic approach

IV.3.2.1. RNA extraction and microarray analysis

The transcriptomic study was performed using whole-genome R. rubrum S1 DNA microarrays [150], in biological and technical triplicates. R. rubrum cultures of S1H and M68 were grown to mid-log phase (ca. OD680 2). Twenty ml of cultures were mixed with RNAprotect® Bacteria Reagent (Qiagen) for total RNA stabilization following manufacturer’s instructions and stored as pellets at - 80 °C until further use. Bacterial lysis was done following the protocol for Gram- negative bacteria of the SV Total RNA Isolation System kit (Promega). Briefly, stabilized bacterial pellets were resuspended in 100 μl of freshly prepared TE (Tris 10 mM, EDTA 1 mM) containing lysozyme 3 mg/ml and incubated for 10 minutes at room temperature. Total RNA isolation was performed using SV total RNA Isolation system (Promega). RNA quality/integrity was assessed using a BioAnalyzer 2100 (Agilent) where samples with a RNA Integrity Number (RIN) value above 8 were used for microarray experiment. RNA quantity was measured using the NanoDrop ND-1000 spectrophotometer (NanoDrop technologies). cDNA synthesis, target hybridization staining, scanning and microarray analysis were performed in the genomic platform facility at SCK•CEN (Mol, Belgium) as previously described [150]. Microarray statistical analysis was done as previously described [150]. Within the microarray analysis, genes were

considered as significantly differentially expressed when the fold change was higher than 2 or lower than 0.5 with (p<0.05).

IV.3.2.2. Gene analysis

Each gene discussed in this study was analyzed using the Magnifying Genomes (MaGe) platform [151]. R. rubrum S1 genome is publicly available as part of the ‘MagnetoScope’ project and was used for analysis and annotation of some genes, as previously done [71, 150, 152]. The Kyoto Encyclopedia of Genes and Genomes (KEGG) database was also consulted in order to identify genes and proteins involved in bacterial pathways [153]

IV.3.3. Proteomic approach

IV.3.3.1. Protein extraction

Quantitative proteomic analysis was performed on proteome extracts of R. rubrum strain M68 and R. rubrum S1H strain as a control. Cells from 5 biological replicates were harvested by centrifugation (13,000×g, 10 min, 4°C) when OD680 reached 2. Proteins were extracted by sonication (3×10 sec, amplitude 40%, IKA U50 sonicator) in 6M guanidinium chloride solution. Extracted proteins were reduced, alkylated and precipitated with acetone. Proteolytic peptides were obtained by overnight enzymatic digestion using trypsin at a ratio of 1:50 (w/w) as previously described [30].

IV.3.3.2. Proteomic analysis

Mass spectrophotometry (MS) experiments were conducted following a label- free strategy on UHPLC-HRMS/MS plateform (Eksigent 2D ultra & AB Sciex TripleTOF™ 5600) in SWATH data independent acquisition (DIA) mode. Two µg of peptides were separated on a C18 column (Acclaim PepMap100, 3 µm, 150 µm × 25 cm, Dionex) with a linear acetonitrile gradient (5 to 35% (v/v), 450 nl.min-1, 30 min) in water containing 0.1% (v/v) formic acid. Each MS survey scan (400-1500 m/z, 50 ms accumulation time) was followed by 34 SWATH acquisition overlapping windows of 25 Da width covering the precursor m/z range. For each window, ions were fragmented using rolling collision energy, and fragment ion spectra were accumulated for 95 ms in high sensitivity mode.

SWATH spectra were identified by comparison to a reference spectral library obtained with traditional data-dependent acquisition (DDA) of experiments on proteins extracted from R. rubrum strain M68 and from R. rubrum S1H cultured on different carbon sources (acetate, succinate, butyrate) [30] [De Meur Q, personal communication]. Sample preparation and separation procedures were identical to the one previously mentioned. DDA spectra were acquired with the following parameters: MS scan (400-1500 m/z, 500 ms accumulation time) in high resolution mode (>35000) followed by 50 MS/MS scans (100-1800 m/z, 50ms accumulation time, intensity treshold at 200 c.p.s). The DDA mass spectrometry data were processed with AB Sciex ProteinPilot™ 4.5 software. Spectra identification was performed by searching against the Rhodospirillum rubrum ATCC11170 UniProt entries with parameters including carbamidomethyl cystein, oxidized methionine, all biological modifications, amino acid substitutions and missed cleavage site. Proteins identified at a false discovery rate below 1% were used as the SWATH reference spectral library.

SWATH wiff files were processed by AB Sciex PeakView 2.1 software and its SWATH™ Acquisition MicroApp. Up to 6 peptides with at least 99% confidence were selected with 6 transitions per peptide. XIC extraction window was set to 25 min, and XIC width to 75 ppm. XIC peak area was extracted and exported in AB Sciex MarkerView™ 1.2 software for normalization and statistical analysis. Proteins were considered as differentially expressed when fold change higher than 1.5 and lower than 0.7 with a p<0.05.

IV.4. Results

IV.4.1. Identification of QS-regulated genes by transcriptomic approach

Transcriptomic approach revealed that 8.6% (330 genes, Annex 1) of R. rubrum S1H genome were differentially expressed. From the differentially expressed genes, 310 were downregulated (FC<0.5) and 20 were found upregulated (FC>2). That represents 93.9% and 6.1% of the differentially expressed genes respectively. 107 hypothetical genes were found differentially expressed that represents 32.4% of the total differentially expressed genes. According to the Clusters of Orthologous Groups of proteins (COGs) database (Table 4.1, http://www.ncbi.nlm.nih.gov/COG/), 207 differentially expressed genes were grouped among 22 COG functional categories (Figure 4.1), the rest of the genes encodes for hypothetical proteins with no COG functional category assigned.

Figure 4.1. COG functional classification of the genes differentially expressed.

Description of each COG category (letters) in Table 4.1.

Table 4.1. COG functional categories.

COG classification Information storage and processing A RNA processing and modification B Chromatin structure and dynamics K Transcription L Replication, recombination and repair Cellular processes D Cell cycle control, cell division, chromosome partitioning V Defense mechanisms T Signal transduction mechanisms M Cell wall/membrane/envelope biogenesis N Cell motility O Posttranslational modification, protein turnover, chaperones U Intracellular trafficking, secretion, and vesicular transport J Translation, ribosomal structure and biogenesis Metabolism C Energy production and conversion G Carbohydrate transport and metabolism E Amino acid transport and metabolism F Nucleotide transport and metabolism H Coenzyme transport and metabolism I Lipid transport and metabolism P Inorganic ion transport and metabolism Q Secondary metabolites biosynthesis, transport and catabolism W Extracellular structures Poorly characterized R General function prediction only S Function unknown Un. Unclassified

VI.4.1.1. Downregulated genes

The majority (93.9%) of the differentially expressed genes were found downregulated including several genes related to motility (chemotaxis and flagellar structure), electron transport and photosynthesis (Table 4.2). According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database [153], the

genes of chemotaxis and flagellar assembly (Figure 4.2, green boxes) could interact in a two-component system. The environmental signal is sensed by the methyl-accepting protein (MCP) and passed to the chemotaxis proteins that will induce or repress the expression of flagellar assembly proteins, specifically trough the C-ring. The C-ring is the site of interaction between the chemosensory machinery that regulates the frequency of the motor [154]. Transcriptomics results showed 3 downregulated genes in this pathway MCP (Rru_A1293), cheA (Rru_A0521) and CheY (Rru_A0522) (Figure 4.2).

Figure 4.2. Chemotaxis genes in R. rubrum ATCC11170. Green boxes represents the genes described in R. rubrum ATCC1170 (KEGG pathway rru02020) and red font represent the genes differentially expressed in this study. Among the 10 genes related to motility, the flagellar structural genes were downregulated. Five out of the 10 genes were identified in the KEGG pathway database (red font in Figure 4.3).

Figure.4.3. Genes described for flagellar assembly. The green boxes represent genes described for R. rubrum ATCC11170 (KEGG pathways, rru_02040). Red font, downregulated genes identified in this study.

The transcriptomic analysis showed the downregulation of Rru_A0615 and Rru_A0616 which belong to a photosynthetic operon (from Rru_A0614 to Rru_A0624) and both encoding photosynthetic assembly proteins. The gene encoding the M protein, which together with the L and H protein conform the reaction center, was also downregulated. The bacteriochlorophyll a synthase gene (Rru_A0627) and genes related to electron transport chain (Table 4.2) were also downregulated.

Table 4.2. Chemotaxis, flagellar, photosynthetic and electron transport-related genes downregulated when comparing M68 to WT. Gene Gene Gene product FC COG number name Chemotaxis genes Rru_A0521 cheA Signal transduction histidine Kinases (STHK) 0.51 N Rru_A0522 - Response regulator receiver domain-containing protein 0.41 T Rru_A1293 - methyl-accepting chemotaxis sensory transducer+ 0.32 N Rru_A1583 - chemotaxis sensory transducer 0.51 N Rru_A2850 cheL chemotactic signal-response protein 0.23 M Rru_A3037 - chemotaxis sensory transducer 0.58 N Flagellar-related genes Rru_A1095 - OmpA/MotB 0.44 M Rru_A0269 - putative outer membrane protein. OmpA/MotB 0.30 M Rru_A0543 - flagellar assembly protein H 0.53 N Rru_A0547 - flagellar hook capping protein 0.25 N Rru_A2528 flgL flagellar hook-associated protein 0.29 N Rru_A2532 flgE flagellar hook protein 0.14 N Rru_A2533 flagellar hook capping protein 0.11 N Rru_A2535 fliD flagellar hook-associated protein 2 (filament cap protein) 0.23 N Rru_A2857 flbT flagellar FlbT 0.37 Un Rru_A3328 - OmpA/MotB 0.13 M Photosynthesis Rru_A0615 - Photosynthetic complex assembly protein 0.55 Un Rru_A0616 - Photosynthetic complex assembly protein 0.43 Un Rru_A0627 - Bacteriochlorophyll/chlorophyll a synthase 0.52 H Rru_A2974 - Photosynthetic reaction center subunit M 0.17 Un Electron transport Rru_A0363 - Cytochrome b/b6-like 0.47 C Rru_A0364 - Ubiquinol-cytochrome c reductase. iron-sulfur subunit 0.57 C Rru_A0560 - Cytochrome bd ubiquinol oxidase. subunit I 0.36 C Rru_A1555 - NADH-ubiquinone/plastoquinone oxidoreductase. chain 3 0.52 C Rru_A1565 - NADH-ubiquinone oxidoreductase. chain 4L 0.51 C Rru_A2264 - Ferredoxin 0.55 C Rru_A2265 - Electron transfer flavoprotein-ubiquinone oxidoreductase 0.24 C Rru_A2266 - Electron transfer flavoprotein 0.27 C Rru_A2267 - Electron transfer flavoprotein subunit beta 0.55 C Rru_A3077 - Electron transfer flavoprotein subunit beta 0.43 C Rru_A3078 - Electron transfer flavoprotein 0.52 C Rru_A3244 - H+-transporting two-sector ATPase. B/B\' subunit 0.54 C Rru_A3245 - H+-transporting two-sector ATPase. C subunit 0.52 C Rru_A3332 - 3-type cytochrome c oxidase subunit I 0.52 O Two component system (TCS) Rru_A2232 - two component LuxR family transcriptional regulator 0.47 K Rru_A2913 - two component transcriptional regulator 0.44 K Rru_A3072 mscS mechanosensitive ion channel 0.26 M Rru_A3285 - two-component response regulator 0.14 T

FC= fold change. COG functional categories: N= cell motility and secretion; T= signal transduction mechanisms; M= cell envelope biogenesis/outer membrane; H= coenzyme metabolism; C= energy production and conversion; O= posttranslational modification, protein turnover, chaperones; Un = Unclassified.

VI.4.1.1.1. Stress-related genes

Four stress resistance genes were found downregulated (Rru_A0891- Rru_A0894) (Table 4.3). Three genes encoding for phage tail collar were also found downregulated. However, their function in purple bacteria remains unknown. Regarding expression of sigma factors, three were downregulated, the RNA polymerase sigma factor RpoE (Rru_A0722), a putative regulatory (anti- sigma) protein (Rru_A3286) and an extra RNA polymerase sigma factor (Rru_A3287), that is homolog to the rpoE from Bradyrhizobium sp. ORS278 according to MaGe curated annotation database. These sigma factors are involved in heat shock and oxidative stress response (Table 4.3) Table 4.3. Downregulated genes related to bacterial stress when comparing M68 to WT. Gene Gene Gene product FC COG number name Rru_A0072 - Chaperone protein htpG 0.52 O Rru_A0161 - Chaperonin Cpn10 0.13 O Rru_A0162 - 60 kDa chaperonin 1 0.45 O Rru_A0205 - Heat shock protein DnaJ-like 0.50 O Rru_A0722 rpoE RNA polymerase sigma factor RpoE 0.44 K Rru_A0753 - Chaperone ClpB 0.49 O Rru_A0891 terB Tellurite resistance TerB 0.33 P Rru_A0892 - Stress protein 0.39 R Rru_A0893 - Stress protein 0.29 T Rru_A0894 - Stress protein 0.19 T Rru_A1453 - Phage tail Collar 0.34 S Rru_A1454 - Phage tail Collar 0.25 S Rru_A1455 - Phage tail Collar 0.12 S Rru_A1521 - Cold-shock DNA-binding protein family 0.53 K protein Rru_A3286 - Putative regulatory (anti-sigma) protein 0.05 Un Rru_A3287 rpoE RNA polymerase sigma factor RpoE 0.19 K Rru_A3554 dnaJ Chaperone protein DnaJ 0.40 O Rru_A3555 dnaK Chaperone protein DnaK 0.48 O

FC= fold change. COG functional categories: O= posttranslational modification, protein turnover, chaperones; P= inorganic ion transport and metabolism; R= general function prediction only; T= signal transduction mechanisms; S= function unknown, K= transcription; Un= Unclassified. Interestingly, 24 genes related to the ABC transport system were also downregulated (Table 4.4). ABC transport system consists of 2 integral membrane proteins: two peripheral proteins that hydrolyze ATP and a periplasmic protein. These three components are known to be encoded by an operon. In R. rubrum from gene Rru_A1747 to Rru_A1751 form a transcription unit where 4 out of these five genes were downregulated. Table 4.4. Downregulated genes related to ABC transporters or efflux systems when comparing M68 to WT.

Gene Gene CO Gene product FC number name G Rru_A0188 - ABC transporter transmembrane region 0.36 V Rru_A0189 - ABC transporter transmembrane region 0.37 V Rru_A0589 - Oligopeptide/dipeptide ABC transporter 0.54 E ATP-binding protein-like Rru_A0592 - Extracellular solute-binding protein 0.31 E Rru_A0598 - Phosphate ABC transporter periplasmic 0.42 P binding protein Rru_A0769 - Extracellular solute-binding protein 0.55 P Rru_A1004 - Lysine-arginine-ornithine-binding 0.45 E periplasmic protein Rru_A1018 - Extracellular solute-binding protein 0.25 E Rru_A1746 - Extracellular ligand-binding receptor 0.31 E Rru_A1747 - Conserved hypothetical protein 0.20 nc (membrane) Rru_A1748 - ABC transporter protein 0.38 E Rru_A1750 - Inner-membrane translocator 0.50 E Rru_A1751 - Inner-membrane translocator 0.31 E Rru_A1954 - Secretion protein HlyD 0.53 V Rru_A2087 - Extracellular solute-binding protein 0.50 E Rru_A2417 metQ Lipoprotein YaeC 0.47 P Rru_A2476 proW Binding-protein dependent transport 0.34 E system inner membrane protein Rru_A2477 proX Glycine betaine transporter periplasmic 0.25 E subunit Rru_A2748 - Lipoprotein-releasing system ATP-binding 0.55 V protein LolD 2

Rru_A3303 livK Amide-urea binding protein 0.22 E Rru_A3304 - ABC transporter protein 0.57 E Rru_A3670 - Potassium efflux system protein 0.59 P Rru_A3677 - Tripartite ATP-independent periplasmic 0.55 G transporter DctQ Rru_A3678 - TRAP dicarboxylate transporter subunit 0.29 G DctP

FC= fold change. COG functional categories: V= defense mechanisms; E= amino acid transport and metabolism; P= inorganic ion transport and metabolism; G= carbohydrate transport and metabolism; Un= Unclassified.

In addition, genes encoding membrane transporters (branched-chain amino acids and amide-urea binding protein) were also downregulated (Table 4.4).

Transcriptomic data revealed several cluster of genes differentially expressed identified in previous studies where R. rubrum S1H cells were exposed to the micropollutant triclosan [155]. Specifically, the most upregulated genes were Rru_A0423 to Rru_A0426. Our results showed downregulation of this operon except for gene Rru_A0425.

Genes Rru_A1353 to 1355 were upregulated under simulated microgravity conditions (random positioning machine) as well as the gene encoding a putative bacteriocin (Rru_A0974) [150]. Table 4.5. R. rubrum S1H downregulated genes when comparing M68 to WT reported in previous studies

Gene Gene Gene product FC COG number name Triclosan induced downregulated genes [155] Rru_A0422 mufA3 Protein of unknown function 0.45 Un Rru_A0423 Inner membrane protein produced as response to mufB 0.25 Un external stimuli Rru_A0424 Membrane protein produced as response to external mufM 0.13 Un stimuli

Rru_A0426 mufA1 Micropollutant upregulated factor A1 0.49 Un Space flight conditions-related genes [150, 156] Rru_A0974 - Linocin_M18 bacteriocin protein 0.21 S Rru_A1353 - Conserved hypothetical protein (outer membrane) 0.05 S Rru_A1355 - Conserved hypothetical protein 0.03 S Rru_A1537 sms Protein of unknown function 0.15 Un

Reserve metabolism [70] Rru_A2413 - Poly(R)-hydroxyalkanoic acid synthase, class I 0.24 I Carbon metabolism [30] RruA0274 - acetyl-CoA acetyltransferase 0,45 I RruA3062 - methylmalonyl-CoA mutase 0,44 I RruA3063 - crotonyl-CoA reductase 0,20 C RruA1040 - leucine dehydrogenase 0,39 E FC= fold change. COG functional categories: C= Energy production and conversion; E= Amino acid transport and metabolism S= function unknown; Un= Unclassified. I= Lipid transport and metabolism.

Genes related to acetate metabolism under MEL-like conditions were found downregulated. Three of them are related to the ethylmalonyl-CoA pathway (acetyl-CoA acetyltransferase , Rru_A0274; Rru_A3062, methylmalonyl-CoA mutase; and Rru_A3063, crotonyl-CoA reductase ). Gene Rru_A1040 that encodes a leucine dehydrogenase is involved in metabolic reactions linked to branched chain amino acid (ilv) biosynthesis Table (4.5).

IV.4.1.2. Upregulated genes

Upregulated genes represent genes that could be directly or indirectly repressed by QS. Among the total number of differentially genes, 20 were found upregulated and 7 of them coded for hypothetical proteins. The remaining 13 genes were related to membrane transport (Rru_A1330, Rru_A1459, Rru_A2130,), transcriptional regulators (Rru_A0976, Rru_A1336, Rru_A1872) and a gene involved in the production of coenzyme B12 (Rru_A0668) (Table 4.6). No gene related to M68 phenotype (motility, pigment- and photosynthesis- related or QS was found upregulated. Among upregulated genes, the top 6 encode for hypothetical proteins, none of them could be further annotated since they do not show homology to any previously described sequences. Table 4.6. Upregulated genes when comparing M68 to WT at the transcriptomic level.

Gene number Gene product FC COG Rru_A3369 Hypothetical protein [71, 150] 5.87 Un Rru_A2933 Hypothetical protein[150] 4.06 Un Rru_A1731 Hypothetical protein[71] 3.76 Un Rru_A1048 Hypothetical protein 2.98 S Rru_A2216 Hypothetical protein 2.94 Un Rru_A1618 Conserved hypothetical protein 2.78 Un

Rru_A1872 TetR family transcriptional regulator 2.63 K Rru_A1379 Acetate kinase 2.54 C Rru_A1336 LacI transcriptional regulator 2.49 G Rru_A1328 Biotin/lipoyl attachment 2.81 I Rru_A0668 Cobalamin-5\'-phosphate synthase 2.50 H Rru_A1327* Phosphoribosyl-dephospho-CoA 2.44 Un Rru_A0176 Acetylornithine aminotransferase 2.42 E Rru_A0670 Adenosylcobinamide kinase 2.35 H Rru_A2781* UPF0261 protein 2.29 S Rru_A0976 Transcriptional modulator of MazE/toxin. MazF 2.27 T Rru_A0166 Hypothetical protein 2.25 Un Rru_A2130 Lysine exporter protein LysE/YggA 2.14 E Rru_A3692 UPF0102 protein 2.02 L Rru_A1459 Major facilitator transporter 2.01 E

The genes were sorted following fold-change value. FC= fold change. COG functional categories: E= amino acid transport and metabolism; L= DNA replication recombination and repair; T= signal transduction mechanisms; S= function unknown; H= coenzyme metabolism; I= lipid metabolism; G= carbohydrate transport and metabolism; K= transcription; Un= Unclassified. *Gene that was reannotated in MaGe.

Two transcriptional regulators were also found upregulated, the LacI (Rru_A1336) and TetR (Rru_A1872). Two transporter genes were also upregulated i.e. Lysine exporter protein (Rru_A2130) and the major facilitator transporter (Rru_A1459). Genes Rru_A0668 and Rru_A0670 that encode two enzymes involved in the adenosylcobalamin salvage pathway were also found upregulated.

IV.4.2 Proteomic analysis

A total of 1518 proteins were identified with at least two peptides, among them 217 proteins were differentially regulated (Annex 2) this amount represents the 14.3% (217/1518) of the proteins identified. From all proteins differentially regulated (217) the 18.9% were proteins of unknown function (21 downregulated and 20 upregulated). Regarding bacterial chemotaxis, 2 chemotaxis sensory transducer proteins were found differentially regulated where Rru_A1160 was downregulated and Rru_A3563 upregulated (Table 4.7). Among genes related to M68 phenotype (decreased motility), 12 proteins or enzymes related to flagellar structure were found differentially regulated (Table 4.7).

Eight out of the 28 proteins related to flagellar structure for R. rubrum (described in KEGG database) were found differentially regulated (Figure 4.4). Four of them are MotA/TolQ/ExbB proton channel proteins (Rru_A0541, Rru_A1074, Rru_A1091, Rru_A1806 respectively) (Table 4.7).

Figure 4.4. Genes described for flagellar assembly. The green boxes represent genes described for R. rubrum ATCC11170 (KEGG pathways, rru_02040). Red font, differentially expressed genes identified in this study.

All the quantified electron transport-related proteins were found downregulated (Table 4.7), as observed in transcriptomic results. All proteins belong to the electron transfer flavoprotein, these proteins transfer electrons received from primary dehydrogenases to terminal respiratory systems [157]. Table 4.7. Chemotaxis, flagellar and electron transport proteins differentially regulated when comparing M68 to WT.

Gene Gene Gene product FC Pep COG number name Chemotaxis-related genes Rru_A1160 - Chemotaxis sensory transducer (Methyl- 0.44 8 T accepting protein) Rru_A3563 - Chemotaxis sensory transducer 5.28 10 N Flagellar-related genes Rru_A2532 flgE flagellar hook protein FlgE 0.48 3 N Rru_A2534 fliC Flagellin-like 0.21 91 N Rru_A0541 motA MotA/TolQ/ExbB proton channel 2.04 3 N Rru_A0542 fliN Flagellar motor switch protein 3.05 12 N Rru_A0544 fliG Flagellar motor switch protein FliG 1.96 16 N Rru_A1073 motB OmpA/MotB 1.86 6 N Rru_A1074 MotA/TolQ/ExbB proton channel family 1.81 7 N - protein Rru_A1091 - MotA/TolQ/ExbB proton channel 2.59 4 U Rru_A1806 motA MotA/TolQ/ExbB proton channel 2.49 5 N Rru_A1843 motB OmpA/MotB 1.94 7 N Rru_A2826 flgB Flagellar basal body rod protein FlgB 2.92 5 N Rru_A2840 fliM Flagellar motor switch protein FliM 2.42 5 N Electron transport Rru_A2264 - Ferredoxin 0.31 6 C Rru_A2265 - Electron transfer flavoprotein-ubiquinone 0.33 37 C oxidoreductase Rru_A2266 - Electron transfer flavoprotein 0.40 25 C Rru_A2267 - Electron transfer flavoprotein beta-subunit 0.45 42 C Rru_A3077 - Electron transfer flavoprotein beta-subunit 0.43 53 C Rru_A3078 - Electron transfer flavoprotein 0.35 45 C FC= fold change. C= Energy production and conversion; N= Motility; T= Signal transduction mechanisms. U= Intracellular trafficking, secretion, and vesicular. Pep: number of identified peptides.

Regarding stress-related genes, proteomic results showed the phage shock genes were more abundant in M68 compared to WT (Table 4.8). At the

transcriptomic level none of the genes coding for these proteins were differentially expressed. In addition, a cold shock (Rru_A1914) and a chaperonin (Rru_A3275) were found downregulated.

Table 4.8. Differentially regulated proteins when comparing M68 to WT.

Gene Gene Group FC Pep COG number name Stress proteins Rru_A1217 pspB Phage shock B 2.15 6 Un Rru_A1218 pspA Phage shock protein A. PspA 2.12 40 K Rru_A2101 - Two component, sigma54 specific, 1.82 5 T transcriptional regulator, Fis family Rru_A1914 - Cold-shock DNA-binding protein family 0.69 12 K Rru_A3275 - 33 kDa chaperonin 0.47 4 O Proteins related to ATP-dependent ABC transporters Rru_A0791 metQ NLPA lipoprotein 0.64 4 H Rru_A1136 fhuD Periplasmic binding protein 0.57 36 P Rru_A2087 gltI Extracellular solute-binding protein. 0.58 26 T family 3 Rru_A2417 metQ Lipoprotein YaeC 0.69 34 P Rru_A2475 proV Glycine betaine/L-proline transport ATP- 0.53 19 E binding subunit Rru_A2477 proX Substrate-binding region of ABC-type 0.70 113 E glycine betaine transport system Rru_A3303 - Amide-urea binding protein 0.53 5 E Rru_A3417 - Extracellular ligand-binding receptor 2.16 6 E Rru_A3725 livF ABC transporter component 2.38 7 E Rru_A3728 livK Extracellular ligand-binding receptor 2.78 75 E Fatty acid β-oxidation I Rru_A1308 - Acyl-CoA dehydrogenase 0.56 53 I Rru_A1309 - 3-hydroxyacyl-CoA dehydrogenase 0.65 56 I Rru_A1310 - Acetyl-CoA C-acyltransferase 0.58 28 I L-glutamine biosythesis Rru_A3175 gatB Aspartyl/glutamyl-tRNA(Asn/Gln) 0.70 71 J amidotransferase subunit B Rru_A3176 gatA Glutamyl-tRNA(Gln) amidotransferase 0.67 59 J subunit A Arginine biosynthesis Rru_A3276 argF Ornithine carbamoyltransferase 0.68 13 E Rru_A3277 argD Acetylornithine aminotransferase 0.65 21 E Rru_A0708 purL Phosphoribosylformylglycinamidine 0.45 32 F synthase subunit Rru_A0709 purQ Phosphoribosylformylglycinamidine 0.44 17 F synthase subunit Rru_A0710 purS Phosphoribosylformylglycinamidine 0.40 8 F synthetase

Rru_A0711 purC Phosphoribosylaminoimidazole- 0.51 11 F succinocarboxamide synthase Carbon metabolism Rru_A3063 Crotonyl-CoA reductase 0,55 38 C Rru_A3064 Isovaleryl-CoA dehydrogenase 0,60 55 I Rru_A0695 2-isopropylmalate synthase 1,80 23 E Rru_A2398 Pyruvate-flavodoxin oxidoreductase 0,22 54 C

FC= fold change. C= Energy production and conversion E= Amino acid transport and metabolism, F= Nucleotide transport and metabolism; H= Coenzyme transport and metabolism; I= Lipid transport and metabolism; J= Translation, ribosomal structure and biogenesis; K= Transcription; O= Posttranslational modification, protein turnover, chaperones; P= Inorganic ion transport and metabolism; T= Signal transduction mechanisms; Un= unclassified. Pep: number of identified peptides.

As observed in the transcriptomic analysis, several genes that belong to the ABC ATP-dependent transporters were quantified as less abundant in M68. e.g. ProXWZ system that is related to the glycine betaine/proline transport [151]. In contrast, 2 proteins of the operon LivFGHMK were found upregulated LivK and LivF (Table 4.8).

Proteins involved in the fatty acid β-oxidation I that belong to one transcription unit (Rru_A1308 - Rru_A1312) were found downregulated as well as proteins involved in L-Glutamine and Arginine biosynthesis (Table 4.8).

Regarding carbon metabolism, specifically for acetate, two proteins reported to be involved in the ethylmalonyl-CoA pathway (Rru_A3063, Crotonyl-CoA reductase and Rru_A3064, Isovaleryl-CoA dehydrogenase) whereas from the two proteins related to the branched amino acid (ilv) biosynthesis one was upregulated (Rru_A0695 and the other downregulated (Rru_A2398, Pyruvate- flavodoxin oxidoreductase) (Table 4.8)

IV.4.3. Common genes differentially expressed at the transcriptomic and proteomic level

Comparing transcriptomic and proteomic results 20 genes were in accordance with proteomic results, 18 of them were downregulated and 2 upregulated. As previously described in the transcriptomic results, proteins related to flagellar structure (flagellar hook protein FlgE, Rru_A2532), ABC transporter (glycine

betaine transporter periplasmic subunit, Rru_A2477) and electron transport (Electron transfer flavoprotein 2 proteins of the operon Rru_A2264-Rru_A2267). Only gene encoding for a crotonyl-CoA reductase that is suggested to be involved in the ethylmalonyl-CoA pathway was found downregulated in both analysis. Finally, evidence of expression for 7 genes coding for hypothetical proteins were found. However no function could be attributed to these proteins (Table 4.9).

Table 4.9. Common genes identified by transcriptomic and proteomic approach comparing M68 vs WT.

Gene Gene Gene product T-FC P-FC Pep COG number name Rru_A0190 - TonB-dependent receptor 0.16 0.50 3 P CRISPR-associated Cse4 family Rru_A0344 - 0.39 0.44 16 Un protein Rru_A0385 - Gamma-glutamyltransferase 1 0.29 0.45 12 E mufA Protein of unknown function Rru_A0422* 0.45 0.23 4 Un 3 Rru_A0565* - Protein of unknown function 0.14 0.50 11 Un Rru_A0974 - Linocin_M18 bacteriocin protein 0.21 0.49 52 S Rru_A1353* - Protein of unknown function 0.05 0.34 12 S Rru_A1446* - Protein of unknown function 0.03 0.44 18 S Rru_A2111* - Protein of unknown function 0.12 0.46 54 Un electron transfer flavoprotein- Rru_A2265 - 0.24 0.33 37 C ubiquinone oxidoreductase Rru_A2266 - electron transfer flavoprotein 0.27 0.40 25 C glycine betaine transporter Rru_A2477 - 0.25 0.70 113 E periplasmic subunit Rru_A2532 flgE flagellar hook protein 0.14 0.48 3 N DNA-directed RNA polymerase Rru_A2664 - 0.27 0.70 33 K subunit alpha Rru_A2666 - 30S ribosomal protein S13 0.26 0.70 19 J Rru_A3063 - Crotonyl-CoA reductase 0.20 0,55 38 C electron transfer flavoprotein Rru_A3077 - 0.43 0.43 53 C subunit beta 3-hydroxybutyryl-CoA Rru_A3079 - 0.50 0.45 32 I dehydrogenase Rru_A3752* - Protein of unknown function 0.48 0.24 4 S Rru_A2781* - Protein of unknown function 2.29 2.62 17 S Periplasmic binding protein/LacI Rru_A1336 - 2.49 1.77 20 G transcriptional regulator

FC = fold change. Un. Unclassified. * = Newly annotated in MaGe. COG functional categories: C= Energy production and conversion; E= amino acid transport and metabolism; G= Carbohydrate transport and metabolism; I= Lipid transport and metabolism; J= Translation, ribosomal structure and biogenesis; K= Transcription; N= Cell motility; P= Inorganic ion transport and metabolism; S= function unknown. Pep: number of identified peptides.

IV.6. Discussions

In the present study we have compared the overall gene expression of R. rubrum M68 mutant, which does not encode an AHL synthase, against S1H (WT).

We showed that at the transcriptomic level, QS regulates directly or indirectly ca 8% of R. rubrum genome under light anaerobic conditions, using acetate as carbon source. This make R. rubrum close to Yersinia pestis and Pseudomonas aeruginosa that have a QS system regulating 7.1% and 10.5% of their genome respectively [158] [159]. On the other hand, previous studies have demonstrated that in Gram-negative bacteria QS can regulate a significant amount of genes, e.g. Pectobacterium atrosepticum (formerly Erwinia carotovora) where 26% of the total genome was differentially expressed [160]. Moreover the effect of lacking functional QS at the proteomic level showed that 14% of the identified proteins (217/1518) were regulated by QS.

IV.6.1. Genes related to M68 phenotypes

Interestingly several genes related to M68 phenotype such as motility and pigment content (Condori et al., 2016, accepted) were found downregulated at the transcriptomic level. On the contrary proteomic results showed upregulation of those genes except for the flagellar hook protein (FlgE) that was downregulated in both analysis. Higher abundance of flagellar proteins in M68 could be explained by the fact that this proteins could be stable (low protein degradation). For instance when Caulobacter crescentus a gram-negative bacteria that switch from swarmer to stalked cell transition, not all their flagellar proteins are degraded, FlgH is stable during the cell cycle [161]. In M68, motility was hampered then is possible that the flagellar proteins are not used anymore, however some could remain on the cell surface and be upregulated (abundant) in comparison to the transcriptomic results (low protein turnover).

In addition genes related to chemotaxis were also found downregulated, in particular the Methyl-accepting chemotaxis sensory transducer (MCP) gene. However different genes encoding for the same protein i.e. Rru_A1293 and Rru_A1106 for transcriptomic and proteomic analysis respectively were found differentially expressed. This could indicate that QS could activate several copies

of the genes. According to the R. rubrum proteome available at Uniprot database, currently there are 13 MCP annotated proteins distributed throughout the genome. In E. coli these proteins have been reported to be important to sense and respond to changing environmental conditions [162].

Regarding genes related to photosynthesis, three were found downregulated i.e. the putative photosynthetic assembly proteins (Rru_A0615 and Rru_A0616), which are probably involved in the reaction center assembly (and the bacteriochlorophyll a synthase (Rru_A0627). This finding supports the phenotype observed in M68, which contain less bacteriocholophyll than the WT [163]. A cerI mutant in Rb. sphaeroides displayed an unpigmented phenotype [56]. Also for some purple bacteria such as Phaeobacter inhibens the pigment content is also under the control of QS [72]. In this sense, R. rubrum S1H showed the same trend.

Bacteria can sense light via photoreceptors, currently there are 6 photoreceptors described for bacteria i.e. bacteriphytochromes, sensory rhodopsin, phototropin-related proteins, BLUF domain proteins, cryptochromes and photoactive yellow proteins. Only bacteriophytochromes have been reported for R. rubrum [25]. Our results did not show any differential expression in genes encoding photoreceptors, making the link between QS and photoreceptors regulation very unlikely. However, bacteria have developed light-dependent responses that do not depend on photoreceptors. It includes the photosynthetic electron transport as described for Rb. capsulatus where the TCS electron transport send signals to the TCS RegA/RegB and this system allow the change in expression of photosynthesis genes [164]. In the present study several components of the electron transport chain were downregulated together with genes involved in the two component system (TCS).

Only one putative LuxR transcriptional regulator (Rru_A2232) was found downregulated. This transcriptional regulator has been proposed to be involved in growth modes and regulation of related metabolism. In addition it was suggested to be involved in the regulation of the gene coding for Poly(R)-hydroxyalkanoic acid synthase (phaC) [70]. Interestingly we also found a downregulation of Poly(R)-hydroxyalkanoic acid synthase. This could indicate that polyhydroxyalkanoic acid metabolism is under the control of QS.

IV.6.2. Stress response

Initial cultures of R. rubrum under Mel-LAN conditions were performed in the presence of oxygen, as a result singlet oxygen might be formed. In this context, the expression profile of M68 showed a downregulation of stress related genes such as sigma factors, chaperonin proteins and genes found upregulated when exposed to triclosan [69] or microgravity conditions [156].

At the transcriptomic level, sigma factor rpoE (Rru_A0722 and Rru_A3287) was found downregulated in M68. Studies made in E. coli K12 showed that rpoE is induced by several conditions such as, heat shock, osmotic shock, metal exposure and hyper osmotic shock, among others. It has been reported that rpoE transcription is increased by unfolded or misfolded periplasmic/outer membrane proteins [165]. Another system that respond to stress condition is the chaperone, which expression was downregulated. Genes encoding for the two major chaperon systems the DnaK/DnaJ (Rru_A3555 and Rru_A3554/Rru_A0205) and the GroES/GroEL (Rru_A0161/Rru_A0162), according to studies in E. coli. DnaK chaperones act by binding and protecting exposed regions on unfolded or partially folded protein chains [166]. Moreover, DnaK chaperone interact with ClpB (clpB, Rru_A0753 downregulated) in reactivating proteins which have become aggregated after heat shock [167]. Finally chaperonin protein HptG (hptG, Rru_A0072 downregulated) that is induced under heat, acid shock and it is dependent on the growth environment [166].

At the proteomic level cold shock DNA-binding protein (Rru_A1914, identified peptides: 12) and 33 kDa chaperonin (Rru_A3275, identified peptides: 4) were downregulated found. The latter is a cytoplasmic chaperone that belongs to the heat shock protein family Hsp33. In E. coli K12, the 33 kDa chaperonin is expressed under heat shock conditions and activated under oxidative stress [168]. Proteomic results showed an upregulation of the phage shock protein PspA (Rru_A1218, identified peptides: 40) and PspB (Rru_A1217, identified peptides: 6). These proteins belong to the pspABCDE operon [169]. In E. coli K12, the expression of the psp genes is driven by RNA polymerase containing the σ54 factor (no σ54 factor protein were found differentially regulated in our results). PspA transcription is induced when protein export is compromised or when the cell undergo osmotic stress conditions. PspB encodes (together with and PspC) an integral inner membrane proteins with a possible sensory function [170]. The

function of psp genes was also reported for Gram-positive bacteria for instance in the pathogenic bacteria Bacillus anthracis these genes are important to overcome reactive oxygen species produced by the host [171].

It is worthy to mention that in our study the specific cluster of stress resistance genes (Rru_A0891-Rru_A0894) were found downregulated, indicating a link between QS and stress resistance regulation. Rru_A0891 is currently wrongly annotated in genome databases since it refers to a tellurite resistance gene terB. These genes are most probably general stress proteins since they were already found to be induced by several culture conditions including low doses of ionizing radiation [150], exposition to the micropollutant Triclosan [155] and simulated microgravity environment [71]. In addition, Rru_A0894 was reported to be the most naturally abundant protein in membrane extract of R. rubrum S1H [150] which is in favor of the general stress protein or chaperonin hypothesis.

Regarding genes previously reported as upregulated under space flight related environmental conditions are the sms gene (Rru_A1537) and the linocin_M18 bacteriocin protein [71] both genes were downregulated in our study. Moreover, genes encoding hypothetical proteins reported as upregulated under simulated microgravity conditions (Rru_A1353 and Rru_A1355 in random positioning machine) [150] were found downregulated in our study, together to Rru_A1352, Rru_A1354. However, no function could be attributed to these genes.

According to our results, it seems that QS induce the expression of stress response genes (tellurite resistance genes, phage tail collar, chaperon proteins and sigma factors, Table 4.3) whereas others like the phage shock proteins are QS repressed. From the environmental point of view these set of genes could help R. rubrum to overcome environmental stress conditions.

IV.6.3. Membrane transporters

The downregulation of the ProVWX (proWX at the transcriptomic level and ProVX at the proteomic level). Under stress conditions, this system is recruited in order to accumulate glycine betaine and other solutes that confer osmo-protection [172, 173]. In addition a major facilitator transporter gene (Ru_A1459) was found upregulated. This gene encodes a single-polypeptide secondary carrier that transport small solutes in response to chemiosmotic ion gradients [174]. These results suggest that M68 cells could undergo disturbances at the level of cell

membrane leading to an unbalance in membrane transporter proteins. However, as far as we know culturing R. rubrum under Mel-LAN conditions do not induce osmotic stress. suggest that QS regulates this system.

IV.6.4 Carbon metabolism

Proteomic analysis of R. rubrum S1H under MEL-like conditions suggested that acetate could be assimilated using the ethylmalonyl pathway [30], moreover the activity of this enzyme is increased in acetate when compared to succinate. In our study four genes and proteins were differentially regulated (Table 4.5 and 4.8 for transcriptomics and proteomic results respectively). Among them, the key enzyme of the ethylmalonyl pathway (Rru_A3063, crotonyl-CoA reductase), which converts crotonyl-CoA in ethylmalonyl-CoA, was found downregulated in both analysis. A second enzyme involved in this pathway was the Isovaleryl-CoA dehydrogenase that oxidizes methylsuccinyl-CoA to mesaconyl-CoA Downregulation of this enzyme will decrease acetate assimilation by the bacterium, therefore this could account to the low motility and delayed growth (lag-phase) observed in M68 mutant. At the proteomic level only isopropylmalate synthase (Rru_A0695) was found upregulated, this protein could be a citramalate synthase since it showed homology to a citramalate synthase of Geobacter sulfurreducens (51% identity with Rru_A0695). This protein has been suggested to be involved in acetate assimilation where the newly synthesized citramalate could be an intermediate of the branched chain amino acid biosynthesis pathway (active during acetate assimilation under MEL-like conditions) rather than a metabolite of the citramalate cycle [30].

IV.7. Conclusions and perspectives

 This study gives an overview of the extent of QS system in R. rubrum under light anaerobic conditions using acetate as carbon source.  Our findings indicate that under initial MELiSSA culture conditions i.e. inoculation under aerobic conditions using acetate as carbon source and light anaerobic incubation could initiate an oxidative stress response that could not be surpassed by the M68 as efficiently as WT. Therefore a functional QS system might be needed in order to overcome stress conditions.

 The fact that several membrane components, flagellum, ATP-dependent transporter systems (ABC transporters), ATP synthase subunits (only transcriptomic results) and specifically several components of the electron transfer chain, could indicate that the proton motive force has been disrupted in M68 as direct or indirect effect of QS.  Among the differentially regulated proteins, the downregulation of key enzyme of the ethylmalonyl-CoA pathway, the crotonyl-CoA reductase (Rru_A3063) could indicate that acetate assimilation is also under direct or indirect control of QS.

Previous results have shown that M68 phenotype is less motile and contains less pigment (Chapter III). Transcriptomic and proteomic results confirmed that proteins related to flagellar structure are under the control of QS, however whether the regulation is direct or indirect, remain to be investigated. A possible strategy to follow could be first, to identify potential lux boxes of selected genes and study gene expression after addition of selected AHLs, in this case only WT samples would be used, since apparently M68 cannot uptake external AHLs added into the medium.

Chapter V: Investigations of Rhodospirillum rubrum biofilm formation under MELiSSA conditions

V.1. Abstract

In nature bacteria live in association forming biofilm. This study investigates the biofilm formation capacity of the WT strain R. rubrum S1H and the QS- deficient mutant M68 using a flow cell system and microtiter plate set up. As previously observed in the RWV experiment, flow cell confirmed that a functional quorum sensing system (QS) is needed to form biofilm. WT cells formed in the flow cell system formed an aggregation-like biofilm. The microtiter plate set up revealed that not only QS can influence biofilm formation in R. rubrum S1H but other factors may be involved. In addition, a flow cytometry (FCM) technique was optimized in order to avoid plate count, a time consuming method which requires more than 10 days of incubation. A flow cytometry/plate count ratio of 2.17 ± 0.31 cell/ml was found.

V.2. Introduction

In nature, bacteria can live in the planktonic state, cell aggregates and in complex structures named biofilms. Bacteria can form suspended aggregates that can be observed microscopically as clumping of cells or as flocculation and settling of cells from static liquid suspensions [175]. For biofilm formation, the process initiates with the attachment of planktonic cells onto biotic or abiotic surfaces followed by the formation of microcolonies and subsequently a mature biofilm [176]. Several factors influence biofilm formation, for instance its structure can be determined by the microbial biology and environmental parameters e.g. nutrient cues [177], shear forces [178] and adhesion and cohesion cell properties [179].

Different systems have been developed to study biofilm formation such as microtiter plate systems [180] and flow cells among others [181]. The flow cell system was developed by Weiss et al. 2011 [182] and it has been used to monitor biofilm formation in real time by microscopic inspection. The system consists of the following interconnected parts: media bottle, pump, bubble traps, the flow cell chambers (glass as substratum) and waste compartment (Figure 5.1). Once the bacterium is inoculated into the flow cell chamber, they are allowed to attach to the flow cell surface. Then the medium flow is started to feed the system with new medium. Attached cells will grow and form a mature biofilm whereas planktonic cells are washed out with the medium flow. This system is suited well for the study of structure of biofilms as it can be incubated for longer periods and biofilms can be observed microscopically.

Static biofilm formation in the microtiter plate system allows the study of initial adherence and microcolony formation (early stages). Despite the fact that nutrient limitation could generate an inability to generate mature biofilms [181], mature biofilms can be formed using microtiter plate [180].

In the context of the MELiSSA project, biofilm formation has been observed when R. rubrum S1H was grown for long period of time in a bioreactor under light anaerobic conditions using acetate as carbon source [113]. In addition, we showed in Chapter III that R. rubrum S1H (WT) was able to form biofilm under a low-shear environment whereas M68 strain was not.

The major purpose of this chapter is to study the biofilm formation capacity of R. rubrum WT and M68, a knockout mutant that has a deficient QS system (Chapter III).

In addition, this chapter also challenges the optimization of flow cytometry in combination with fluorescent dyes SYTO9 and PI (propidium iodine) as an alternative of plate count, a time-consuming technique.

V.3. Material and Methods

V.3.1. Bacterial culture conditions

Three strains were used in this study, R. rubrum S1H (WT), R. rubrum M68 (acyl homoserine lactone synthase knockout mutant) and the carotenoidless strain R. rubrum G9. Bacterial samples were grown in batch cultures to mid-log phase -2 -1 (ca. OD680 2) in Melissa medium under a light intensity of 80 µmol·m ·s . Cultures were diluted to the required optical density for each conditions (further described in each experiment). These samples were used as inoculum for flow cell and microtiter plate experiments.

V.3.2. Flow cytometry

For bacterial cell count, we compared events count by flow cytometry (cells/ml) and the plate count (CFU/ml). R. rubrum was grown in Melissa liquid medium to mid-log phase (OD680 2). One hundred microliters of at least 3 biological replicates were 10-fold diluted in filtered0.85 NaCl (saline tablets, Oxoid) . One hundred microliters of the sample was plated out on Sistrom- succinate agar plates, then the plates were placed in anaerobic bags (Millipore) and incubated at 30 ºC under a light intensity of 80 µmol.m-2.s-1 conditions. In parallel, 1 ml of the dilution was stained with LIVE/DEAD BacLight kit (Molecular probes) using 1.5 µL of each dye SYTO-9 and PI (final concentration 5.01 and 30 µM, respectively) and then incubated 15 minutes in the dark. Live unstained, dead and alive stained cells were used as flow cytometry controls. Dead cells were prepared by heating 1 ml of R. rubrum culture at 75 ºC for 15 minutes.

Stained samples were analyzed usinga BD-Accuri C6 flow cytometer with the following settings: a threshold of 5000 and 1000 in the FSC-H (primary

acquisition channel) and SSC-H trigger channels, respectively. Fluidics was set in fast mode and flow rate was kept below 5000 events/second. Detection of samples was done using the FL1 (530 ± 15nm) and FL3 (670nm long pass) filters.

V.3.3. Flow cell system

Biofilm formation was studied in a flow cell system (Figure 5.1) that has been assembled according to manufacturer’s recommendations [182]. The experiment was carried out under light microaerobic conditions due to technical constraints to make the flow cell system anaerobic as MELiSSA conditions would require.

V.3.3.1. Flow cell system set up and incubation conditions

To determine the optimal attachment time, incubation periods of 2 hours, 24 hours and 48 hours were tested. The flow cells were inoculated with 250 µL of inoculum (1.85x107 cells) of WT and M68, separately. For each strain, biological triplicates were used. The flow cells were incubated up-side down under light microaerobic conditions to allow bacterial cells attachment. After the attachment period, the medium flow was started at 0.032 ml/min and the effluent sample was concentrated by filtration (0.45 µm), stained with SYTO9/PI and analyse in the flow cytometer. The flow cells were incubated under 80 µmol.m-1.s-1 of light intensity for 6 days.

Pump Flow cells Waste

Bubble traps

WT M68

Inoculation site

Figure 5.1. Flow cell system setup.

V.3.3.2. Biofilm visualization

For biofilm visualization the LIVE/DEAD® BacLight™ Bacterial Viability Kit (Molecular probes) was used. However, unlike cell count, the dye concentration was increased in order to visualize the biofilm i.e. 200 µM and 33.40 µM for SYTO9 and PI, respectively. Biofilms formed in the flow cell system were visualized using a Nikon Eclipse Ti (automated inverted wide-field epifluorescence microscope) equipped with a 40X/0.75 (Plan Fluor 0.7) and 60X/0.85 (Plan Fluor 0.7) magnification and a Nikon DS-Qi1Mc camera controlled by a NIS-Elements software. FITC and TRITC filters were used to visualize SYTO9 and PI respectively.

V.3.3.3. Testing excess of carbon concentration

An additional experiment was carried out in order to confirm previous findings suggesting that carbon excess leads to bacterial aggregation in the WT [113]. For this, 2 higher carbon concentrations were also tested i.e. 7.5 (i.e. 2 times the normal carbon concentration, 2C) and 18.75 g/L (i.e. 5 times the normal carbon concentration, i.e. 5C). Each sample was tested in biological duplicates.

V.3.4. Microtiter plate set up

In order to quantify the biofilm formation capacity under static conditions, the microtiter plate (Greiner CELLSTAR, flat bottom polystyrene plate) technique was also evaluated. The method was previously described [180].

Briefly, 100 µl of freshly prepared WT and M68 cultures at OD680 0.4 were added to each well. Plates were incubated for 6 days in an anaerobic chamber (Jacomex) at 29 °C and illuminated with 75 µmol.m-2.s-1 of light intensity provided by an halogen lamp (BAB 38° Silvana), the highest light intensity reached with the system used (Figure 5.2).

Figure 5.2. Distribution of WT and M68 samples in microtiter plate. Set up of microtiter plate assay. For illumination a halogen lamp was used. A temperature of 29° C was kept during the experiment. Five carbon concentrations were tested: 18.75, 7.5, 3.75, 1.875 and 0.75 g/L, based on a previous study which indicates that carbon concentration could lead to aggregation and biofilm formation [113]. For R. rubrum S1H (W) and QS-mutant (M) four biological replicates were used whereas for G9, three. Each biological replicate was tested in 8 technical replicates as follows:

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-1 G9-1 G9-1 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-2 G9-2 G9-2 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-3 G9-3 G9-3 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-4 G9-4 G9-4 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-5 G9-5 G9-5 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-6 G9-6 G9-6 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-7 G9-7 G9-7 C-

W-1 W-2 W-3 W-4 M-1 M-2 M-3 M-4 G9-8 G9-8 G9-8 C-

100

After incubation period, 7 technical replicates of each biological replicate were used to quantify the biofilm by staining them with crystal violet and quantifying its absorbance at 550 nm, as previously described [180]. For analysis, the detection limit was calculated as the average of blank measurement plus three times the standard deviation of blank [183]. Since M68 showed less motility than WT (Chapter III), flat-bottom plates were used instead of round-bottom, which is normally used for motile bacteria.

Biofilm visualization was done using a Nikon Eclipse Ti (Bright field option) equipped with a 20X/0.50 (Plan Fluor) and 40X/0.75 (Plan Fluor) magnification and a Nikon DS-Qi1Mc camera controlled by a NIS-Elements software.

V.4. Results

V.4.1. Correlation of flow cytometry (FCm) and plate count under MELiSSA conditions

In order to use a faster technique for cell count and that allow us to count cells without keeping sterile conditions, for instance using effluent biological samples from flow cells, a comparison of flow cytometry and plate count was done. Results showed that FCm counts slightly overestimate the classical plate count (Table 5.1). We found a ratio FCm/plate count of 2.17 ± 0.31 cell/ml for R. rubrum S1H under light anaerobic conditions.

Table 5.1. Ratio of flow cytometry (cells/ml) and plate count (CFU/ml)

Flow Plate Ratio cytometry count FCm/Plate (FCM) (CFU/ml) count 1.66E+09 8.87Ex08 1.9 6.83E+08 2.67E+08 2.5 1.24E+09 4.94E+08 2.5 4.28E+08 2.21E+08 1.9 4.31E+08 2.21E+08 1.9 4.37E+08 2.21E+08 2.0

101

V.4.2. Biofilm formation under light microaerobic conditions: Flow cell system

In order to study biofilm formation in a controlled system, a flow cell system was used. The first parameter to determine was the attachment period for WT. Only after 48 hours of attachment period, WT cells remained attached to the flow cells and were able to develop biofilm (Figure 5.3, top). When shorter attachment times were assessed, the medium flow washed out all cells as no cell was observed through microscopic inspection within the flow cells (data not shown).

After inoculation of flow cells and using the correct attachment period, the flow was started and effluent samples were collected for 2 hours, time enough to recover the 250 µl volume of the flow cell. Results showed that after 48 hours more M68 cells were recovered in the effluent compared to WT (Figure 5.3, down).

Figure 5.3. WT and M68 attachment to flow cells

Top, microscopic view of WT and M68 after 2 hours of medium flow. Arrow points cells aggregating. Down, flow cytometry plots of WT and

102

M68 effluent samples collected after 48 hours of attachment period. Cells were stained with LIVE/DEAD Baclight kit (Molecular probes) based on SYTO9/PI dyes.

In addition, considering all cells (alive and dead) present in the effluent, M68 attached to the flow cells ca 130-fold less than WT (Table 5.2).

Table 5.2. Flow cytometry quantification of R. rubrum cells in the flow cell effluent sample after 2 hours of attachment period.

Alive Dead Total Ratio

cell/ml ± sd cell/ml ± sd cell/ml ± sd M68/WT

WT 7.22E+05 ± 2.16E+02 1.44E+08 ± 2.15E+02 1.45E+08 ± 3.05E+02 M68 9.56E+06 ± 9.40E+02 1.91E+10 ± 6.53E+02 1.91E+10 ± 1.14E+03 131.7

Since the flow cell system allows monitoring biofilm formation over time, flow cells were inspected after 72 hours of incubation. Results showed that WT cells colonized the flow cell surface (Figure 5.4, left). Regarding M68 mutant continued growing and remained attached to the flow cell however in less number than WT (less than 50%) (Figure 5.4, right).

Figure 5.4. Microscopic view of WT (72 h) and M68 (72 h)

Left, WT showing growth over medium flow. Right, M68 after 72 hours of growth cells covers the flow cell surface.

103

V.4.2.1. Biofilm formation under excess of carbon and biofilm visualization

In order to test the effect of carbon concentration in biofilm formation of WT and M68 using the flow cell system, we assessed growth under 3 carbon concentrations: 3.75 g/L (standard Melissa medium), 7.5 g/L and 18.75 g/L. Results have shown that after 72 hours of incubation of WT, suspended aggregations were present in higher carbon concentration (7.5 and 18.75 g/L) whereas at 3.75 g/L no aggregations were observed (Figure 5.5, top; white arrows). Instead, a group of WT cells attached to the flow cell were observed at the lowest carbon concentration. In M68 the aggregations were present at all carbon concentrations (Figure 5.5, down; white arrows).

WT-72 h – [C] WT-72 h – 2[C] WT-72 h – 5[C]

10 µm 10 µm

M68-72 h – [C] M68-72 h – 2[C] M68-72 h – 5[C]

10 µm

Figure 5.5. Microscopic view of WT and M68 grown under different carbon concentrations. Top, for WT, aggregations were observed for high carbon concentrations. Down, for M68 aggregations were present in all carbon concentrations tested.

After the incubation time was completed (7 days), biofilms were visualized as described in Material and Methods section. WT cells formed biofilms in all carbon concentrations tested 3.75, 7.5 and 18.75 g/L (Figure 5.6). WT biofilms did not show mushroom-like structures which are a common biofilm structure formed by bacteria.

104

Figure 5.6. Microscopic view of WT biofilms under excess of carbon concentration. Biofilm formation under excess of carbon concentration was similar under light microaerobic conditions. Biofilms were stained with SYTO9/PI (Molecular probes).

Concerning M68 samples, after 72 hours, the control sample (M68- 168 h - [C]) resulted contaminated (Figure 5.7), however it was possible to observe a

105

characteristic biofilm formed by the contaminant. All the green sports around the contaminant biofilm were R. rubrum (observed by bright field option). Higher concentration of carbon did not influence the biofilm formation capacity of M68 (Figure 5.7) therefore the experiment was not repeated.

Figure 5.7. Microscopic view of R. rubrum M68 strain. Top, control samples: M68 grown in standard carbon concentration 3.75 g/L in Melissa medium (contaminated samples with a rod-shape bacteria). Down, M68 grown in 7.5 and 18.75 g/L of carbon. No biofilm formation was observed only few cells attached to the FC surface. V.4.3. Biofilm formation under light anaerobic condition-Microtiter plate

V.4.3.1. Effect of carbon concentration on R. rubrum WT biofilm formation

In order to quantify the biofilm formation under static conditions using different amounts of carbon concentrations, the microtiter plate set up was used. Results showed that R. rubrum WT has a poor biofilm formation capacity under static conditions. All spectrophotometric values were slightly above the limit of

106

detection and no significant difference was found on biofilm formation under different carbon concentrations (Figure 5.8, top). In order to confirm that WT cells attached to the bottom of the microtiter well, each well was observed by microscopy after crystal violet staining. Indeed low amount of cells remained attached to the microtiter plate (Figure 5.8, down).

0.03 WT

0.02

0.02 550

OD 0.01

0.01

0.00 C/5 conc C/2 conc [C] conc 2 [C] conc Carbon concentration

Figure 5.8. Biofilm formation of R. rubrum S1H (WT) in microtiter plate at 4 carbon concentrations. Top, WT biofilm quantification using different carbon concentrations. No significant differences were found under different carbon concentrations when compared to the standard carbon concentration used in Melissa medium [C]. Down, microscopic observations of WT samples after crystal violet staining.

V.4.3.2. WT and M68 biofilm formation in microtiter plate

In contrast to our findings in the flow cells setup, M68 biofilm formation capacity was higher than WT (p<0.05) (Figure 5.9, top). M68 formed biofilm at different carbon concentrations with no significant differences among them.

107

Microscopic observation supported biofilm quantification showing that M68 cells covered more area than WT regardless of carbon concentration (Figure 5.9, down).

0.07 WT 0.06 * M68 * * 0.05 *

0.04 550

OD 0.03

0.02

0.01

0 C/5 conc C/2 conc [C] conc 2 [C] conc Carbon concentration

M68 [C/5] [C/2] [C]

[2C] Blank

Figure 5.9. Biofilm formation in microtiter plate.

Top, quantification of biofilms formed by WT and M68. Four carbon concentrations were used. *Significant difference (p<0.05) between WT and M68. Down, microscopic observation of WT samples after crystal violet staining.

V.4.3.3. Possible carotenoid effect on biofilm formation?

Previously, we showed that M68 was not able to form biofilm as WT, though some cells were able to remain attached dispersedly in the flow cell (Figure 5.5). Since M68 also contains less amount of pigments (bacteriochlorophyll and

108

carotenoids), the possible role of carotenoids in biofilm formation was tested. Biofilm formation capacity of WT, M68 and G9 strains were compared under static conditions. M68 and G9 showed an increased biofilm formation compared to WT (Figure 5.10).

0,06 * * 0,05 * * * * 0,04 * * WT 0,03

550 M68 OD 0,02 G9

0,01

0 C/5 conc C/2 conc [C] conc 2 [C] conc Carbon concentration

Figure 5.10. Biofilm quantification of WT, M68 and the carotenoidless strain G9 grown under different carbon concentration.

*significant difference (p<0.05) when compared to WT at each carbon concentration group

Microscopy observation confirmed that biofilm formation in G9 is higher than WT but also compared to M68, under static conditions. We found that G9 forms biofilm regardless the carbon concentration. The same feature was observed for WT and M68. However, WT cells formed microcolonies (white arrows in Figure 5.11) whereas M68 cells covered more area but remained mainly dispersed. Regarding the microcolonies size, the longest WT microcolony measured ca 17 µm whereas for M68 and G9 were in the range of 7-12.5 and 14.5 and 47.5 µm, respectively. In addition, no obvious difference in biofilm formation was found within each strain at the different carbon concentration tested (Figure 5.11) as observed in biofilm quantification (Figure 5.10).

109

Figure 5.11. Microscopic observation of WT, M68 and G9 biofilm formation in microtiter plate grown under different carbon concentration.

Cells were stained with crystal violet and visualized with bright field microscopy.

110

V.5. Discussions

V.5.1. Flow cytometry counting

Flow cytometry in combination with fluorescent dyes has become a widely used tool for bacterial cell counting in the microbiology field such as environmental, clinical and food microbiology. In this chapter we have compared live count by flow cytometry and plate count. Discrimination between live and dead cells population was possible by using the Baclight kit. However, the appearance of intermediate state cells was also observed. Intermediate state cells could represent injured cells at the level of outer membrane [184].

Since our aim was to compare cultivable cell, for the analysis, only alive cells were considered and compared with plate count. Besides the method was optimized for mid-log phase cells under MELiSSA conditions, we cannot exclude that the ratio FCm/plate count change in function of the growth curve. For instance, when R. rubrum S1H was grown under DAE conditions different ratio were reported i.e. 1.55 ± 0.38 and 2.26 ± 0.35 for lag- and log-phase, respectively [185]. This variation may occur due to the staining properties that depend on the physiological state of the bacteria [184]. Therefore, the experiment cells plate count should be optimized for each specific condition or purpose as recommended by Davey et al., 2011 [186].

Overestimation of flow cytometry counts observed in our study is a well- known phenomenon when compared to plate count. So far there is no a specific answer for overestimation, however, it seems to be related to the presence of viable cell but nonculturable population [187]. In, addition optimization of fluorescent dyes is needed in order to avoid spillover e.g. PI signal (dead cells) recognized in the FL-1 channel that normally recognize SYTO9 fluorescence (alive cells) increasing the number of alive cells.

V.5.2. Biofilm formation in flow cell system

Using a flow cell system, we induced biofilm formation in R. rubrum S1H under light microaerobic conditions. The attachment period was optimized using only the WT strain requiring 48 hours to attach on the flow cell substratum

111

(cover glass). Compared to other Gram-negative species such as Serratia marcescens [177], Pseudomonas aeruginosa [182] (attachment period: 1 hour), R. rubrum needs a long incubation of 48 hours.

Interestingly, the weak attachment capacity of R. rubrum was even weaker in M68 strain as reflected by flow cytometry cell count were a higher number of M68 cells were counted in the effluent sample (ratio M68/WT of ca 130-fold). Another observation in the effluent is the fewer amount of WT alive cells (39.2%) compared to M68 (65%), this could indicate that more alive cells remained attached to the flow cell.

A defective motility (Chapter III) may affect the attachment capacity in M68. For instance, Listeria monocytogenes flagellar motility has been proved to be critical for attachment to surfaces and subsequent biofilm formation [91].

After 72 hours microscopic observation showed that WT and M68 formed floating aggregates at high carbon concentrations (7.5 and 18.75 g/L), which were removed by the flow. These aggregates could represent detached groups of cells from formed biofilms. If this was the case, it would imply that M68 is able to weakly attach to the substratum (cover glass) and then during medium flow the cells are washed out from the system. Our findings showed that only M68 formed aggregations at standard carbon concentrations.

Qualitative observation of stained biofilms indicated that under all carbon concentrations tested and with a constant light intensity (80 µmol.m-2.s-1) biofilm was formed. Regarding biofilm structure, WT strain formed an aggregative biofilm structure composed of mostly of live cells (green fluorescence) with an intact cell membrane. We did not observed a mushroom-like commonly found in other species [188]. Regarding the maturation, besides we did not stain the cells to recognize EPS, the main component in a mature biofilm, the fact that we observed detaching cells suggest that after 5 days of incubation R. rubrum forms a mature biofilm.

V.5.3. Microtiter plate

Microtiter plate gives information about identifying factors required for cell/surface attachment [180]. However, it has a disadvantage namely the bacteria face nutrient limitation conditions, therefore could be possible that a mature

112

biofilm cannot be obtained. It is recommended to complement the method with microscopy imaging [181]

In the microtiter plate (static conditions) other factors intervene in cell attachment such as EPS, surface adhesion proteins and cell shape. The later has been suggested to increase the biofilm formation capacity in Rb. sphaeroides, a close relative photosynthetic bacterium. [101]. No differences on cell shape was found (scanning electron microscopy visualization) between WT and M68. M68 cells have similar size to WT but also some long cells in the range of 30-45 µm. We speculate that the higher biofilm formation capacity of M68 under static conditions could be related to the decreased motility (allowing cell sedimentation). Moreover the possible membrane-related differences e.g. exopolysaccharides, LPS [85, 179] could increase the adhesion and cohesion (cell-to-cell attachment) properties. Interestingly, the analysis of the G9 strain indicates that besides QS playing a role (direct or indirect) in biofilm formation, other factors can influence its formation such as carotenoid content. Further investigation is required to determine the factors that promote G9 biofilm formation-like under static conditions.

V.6. Conclusions and perspectives

By using the flow cell system we were able to show that a functional QS system is needed to form biofilm. Regarding carbon concentration, higher carbon concentration did not influence biofilm formation in R. rubrum S1H. In addition, R. rubrum S1H forms an aggregation-like structure. The main advantage of this system with constant medium flow was to avoid nutrient depletion and planktonic cells.

The controversy found using the microtiter plate set up, where M68 adhered more than WT remains unknown for the moment. However, as mentioned above, it could be related to M68-membrane properties, however this suggestion remains to be determined for instance by comparing the exopolysaccharides composition in M68 and compared it with WT. Another possible explanation could be the different materials used. In the flow cell system the substratum is glass whereas in microtriter plate is polystyrene [189].

113

Flow cytometry was used as an alternative method for cell counting. A ratio of 2.17 ± 0.31 cell/ml was found for log-phase cells grown under light anaerobic conditions using acetate as carbon source.

114

Chapter VI: General discussions

The study of life support system to sustain life on space is under current investigation across the world. The European Project MELiSSA (Micro- Ecological Life Support System Alternative) aims to use microbial organisms and higher plants to produce water, oxygen and food to the astronauts during long haul space missions. The fact that microbial organisms are used implies that all aspects needed to provide a stable system on space should be studied. Compartment II of the MELiSSA loop is colonized by R. rubrum S1H and its aim to metabolize products coming from compartment I under light anaerobic conditions. During long term culturing in photobioreactor R. rubrum S1H forms an irreversible thick biofilm. As consequence the rest of the culture is shaded from the light source leading to stop the bioreactor and therefore endangering the functioning of the complete loop.

The study of the interaction within bacteria was not assessed in compartment II. And as described in the literature review (Chapter I), bacteria can communicate with each other by producing and sensing certain types of molecules named autoinducers, this communication system is called quorum sensing. For instance, in Gram-negative bacteria one type of autoinducers are synthesized by one or multiple acyl homoserine lactone synthases, depending on the species. By quorum sensing bacteria jointly control the expression of target genes and mount a co-operative response e.g., biofilm maturation, regulation of virulence and bioluminescence among others.

Since there is evidence between biofilm formation and quorum sensing, it became necessary to investigate first the relatively unknown quorum sensing system of R. rubrum S1H and its possible link to biofilm formation.

115

VI.1. Is QS system of R. rubrum S1H active during cultivation under MELiSSA conditions?

VI.1.1. Acyl homoserine lactone synthase knockout mutant construction phenotypic characterization under MELiSSA conditions

In order to establish a possible link between quorum sensing and biofilm formation, the first step was to construct a “QS-silent” mutant. Several strategies have been used to create QS-silent mutants in other bacterial species such as deleting the homologues genes encoding the key proteins LuxR or LuxI or by blocking or degrading the AHLs produced by the bacterium to be studied.

In the present study we chose to delete the only reported AHL synthase gene (Rru_A3396) in R. rubrum, since the complementation of the obtained strain would be straightforward i.e. addition of AHLs to QS-mutant cultures.

During the experimental approach for the mutant construction, two key procedures were crucial to obtain the mutant strain. The first one was the construction of the plasmid containing the kanamycin cassette, and the second was the method for plasmid delivery into R. rubrum. For plasmid construction, we chose the broad-host-range mobilizable suicide vector pKNOCK containing a gentamicin resistance cassette (pKNOCK-Gm) [117]. Delivery of plasmid into any bacterium can be done by transformation, electroporation or conjugation. Since there is no protocol described for R. rubrum successful electroporation and there is only one protocol described for transformation [126], we chose conjugation (using a donor strain, E. coli S17-1 λ) as reported to be successful in previous studies [42, 190]. In order to be sure to not miss any potential knockout mutant all transconjugants colonies (ca 1500 colonies) were screened for its resistance to kanamycin and sensitivity to gentamicin. In this way we were sure to not miss any potential QS-mutant. Once the desired mutant was selected and grown under Mel-LAN conditions, it showed an aggregative phenotype (Chapter III).

As mentioned before, complementation was done by addition of: WT filtered supernatants, synthetic AHLs molecules, AHLs extracts from WT (Chapter III). However all the experiments fail to arrest cell aggregation in M68. In addition complementation by plasmid was also done (Chapter III), a plasmid containing a

116

trimethoprim resistance cassette was used since this antibiotic do not show toxicity under light incubation conditions [191]. However, after delivery of the plasmid into M68, it continued aggregating. A possible explanation to this observation could be a possible function of gene Rru_A3397 which expression could be transcriptionally coupled to Rru_A3396 (rruI) [71]. The same result was observed when the expression of Rru_A3396 and Rru_A3397 genes were assessed by qReal Time PCR in the WT (Chapter III). In addition, transcriptomic results showed a downregulation of both genes (Chapter IV). Therefore it might be possible that this gene play a role in QS. However further studies are needed to confirm this hypothesis.

Another possible explanation for the non-complementation is the fact that gene Rru_A1313 was found downregulated. This gene encodes a membrane protein involved in aromatic hydrocarbon degradation. A proteins BLAST of

Rru_A1313 and FadL from E. coli K12 (FadLec) showed that this protein is homolog (Identity 30%, E-value 3e-51). FadL, a homologue of FadLec protein has been suggested to play a role in the transport of long-chain AHL such as C16:1-HSL across the outer membrane [75]. A downregulation of this proteins has been found at the proteomic level, in contrast no differential expression has been found at the transcriptomic level.

VI.1.2. QS-mutant (M68) phenotypic characterization under MELiSSA conditions

The knockout mutant lacking gene Rru_A3396 (named in this study rruI) has been phenotypic and genotypically characterized. The mutant strain was named M68 do not encode an acyl homoserine lactone synthase (Chapter II). In the WT, this enzyme synthesizes a wide range of AHLs ranging from C4 to C12 of unsubstituted and 3-OH-substituted whereas only 3-oxo-C8-HSL was identified under Mel-LAN conditions. In accordance to previous studies that used other carbon sources i.e. succinate [69, 71] and fructose/succinate [70] the predominant AHL lactone identified was 3-OH-C8-HSL, suggesting a key role of this AHL. Interestingly R. rubrum S1H possesses more than one AHL synthase since 3-OH-

C8-HSL was also identified in M68 extracts (250-fold higher in WT at OD6802). However, we could not find homologues genes reported to encode AHLs

117

synthases from a different protein family i.e. AinS, LuxM and VanM (Chapter II).

Interestingly a homologue of HtdS-type AHL synthase previously reported in Pseudomona fluorescences [136] and Acidithiobacillus ferooxidans [137] was found in R. rubrum S1 genome (1-acyl-sn-glycerol-3-phosphate acyltransferase, Rru_A3257). This protein could represent an alternative (or parallel) pathway from the commonly accepted AHL synthesis pathway that involves a LuxI synthase, acyl carrier protein (ACP) and S-adenosylmethionine (SAM) [55]. However, the HtdS-type AHL was not found differentially expressed at the transcriptomic and proteomic level. We can speculate that, since R. rubrum is an environmental bacterium it could be subjected to possible quorum quenching mechanisms elicited by other bacteria. Therefore a possible strategy to avoid quorum quenching could be to keep a basal expression of a parallel QS system (i.e. HtdS-type) keeping the production of 3-OH-C8-HSL independent of possible quorum quenching mechanisms (based on annulling of RruI).

VI.1.3. Perspectives

Regarding the possible function of Rru_A3397 gene in QS, it would be interesting to complement M68 with both genes rruI and Rru_A3397 and evaluate if WT phenotype is recovered. A positive result would indicate a direct role of Rru_A3397.

As shown in Chapter III, R. rubrum display a potential second AHL synthase, an HtdS-type AHL. In order to confirm this observation, a double knockout mutant can be constructed by using M68 as “WT”. Two approaches can be used, an insertional mutagenesis or double homologous recombination (as performed for M68, Chapter III). Unlike the first one, the latter is labor intensive but stable in the absence of antibiotic. However, the stability of insertional mutagenesis can be followed during the performance of the experiments then the results obtained can be validated. According to our experience genetic manipulation of R. rubrum was not straightforward. Recent techniques could help to overcome labor intensive genetic manipulation techniques, for instance GeneArt (Thermofisher).

Interestingly, R. rubrum display a high number of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). CRIPRs appear to provide acquired resistance against mobile genetic elements (viruses, transposable

118

elements and conjugative plasmids) [192]. A search on the CRISPR data base (last update 05-04-2014) [193] showed that R.rubrum ATCC11170 is among the bacteria that display the highest number of CRISPR genes (12 CRISPR) when compared to other close related bacterium such as Rb. sphaeroides 2.4.1 (0 CRISPR), Rb. capsulatus SB 1003 (6 CRISPR) and Rps. palustris BisB18 (1 CRISPR) or E. coli W (highest CRISPR among E. coli species: 4). We could speculate that the presence of this CRISPR could play a role against genetic manipulation of R. rubrum.

In order to gain a deeper knowledge on QS, it would be interesting to identify which of the six LuxR homologues (RruR1-RruR6) described for R. rubrum [70] respond to AHLs. According to conserved domain database (CDD) three of them displayed an N-terminal for AHLs binding whereas the rest displayed a REC domain, known to receive the signal from its sensor membrane-bound protein partner in a two-component system. Identifying which regulators respond to AHLs, can be used as a potential quorum quenching strategy to be used in the MELiSSA loop for instance by the addition of AHLs analogue molecules that blocks RruR function.

VI.2. What is the extent of QS in R. rubrum S1H under MELiSSA conditions at the phenotypic, transcriptomic, proteomic levels?

The QS-mutant M68 displayed marked phenotypes i.e. decreased pigment content (bacteriochlorophyll and carotenoids), motility and a longer lag-phase during growth (Chapter III). QS-regulation of pigment content and motility seems to be a common strategy followed by purple nonsulfur bacteria e.g. Rb. sphaeroides [56] and Phaeobacter inhibens [72] (Chapter I). As suggested for Rb. sphaeroides QS induce motility and pigment production whereas cell aggregation is prevented [56]. It could be beneficial for this type of bacteria to promote motility in order to find new niches with suitable energy source. In this sense, individualism would be favored under certain stress environmental conditions.

Decreased swimming motility phenotype was confirmed by transcriptomic analysis (downregulation of several genes involved in flagellar structure and motility) whereas proteomic analysis showed upregulation of flagellar proteins. This opposite result could be related to the stability of flagellar proteins (Chapter

119

IV, discussion). The only common result by both analysis was found for gene Rru_A2532 (dowregulation) which encodes the flagellar hook protein FlgE therefore suggesting its key role in swimming R. rubrum motility and its regulation by QS. Studies on other bacteria, supporting the possible key role of FlgE, Rb. sphaeroides flgE mutant (partial deletion of the gene) showed an atypical swimming behavior (less motility) [194] whereas complete deletion of flgE in Mesorhizobium tianshanense showed a complete loss of swimming ability [195].

Mel-LAN conditions imply the use of acetate, light under anaerobic conditions. Anaerobic condition was achieved by sealing the culture bottles with rubber stops (Chapter III). However, oxygen was present at the moment of inoculation (because cultures were inoculated in cabinet flow using a inoculum grown in Melissa conditions. Therefore during the initial hours of incubation, the new culture grew in the presence of oxygen. Combination of oxygen and light leads to the formation of triplet exited bacteriochlorophyll that can react with molecular oxygen generating singlet oxygen, a powerful oxidizing agent that kill cells exposed to it [17]. The fact that M68 contains less carotenoid may indicate a higher sensitiveness to oxidative stress under light conditions. However, R. rubrum is able to overcome the stress conditions and succeed in growth where the only difference in growth is the longer lag-phase of M68 (ca 15 hours more than WT, Chapter III). This difference in time is not fixed, as shown in annex 5, lag phase could change, however M68 exhibit a longer lag-phase than WT. For instance in cultures where the initial inoculum is 0.33 the WT start to grow in the initial 5 hours whereas M68 after 24 hours. When the inoculum is lower i.e. 0.25 WT start growth after 17 hours whereas M68 after ca 50 hours. Besides the difference in lag-phase is not a fixed time between experiments, the difference in time within experiments where WT and M68 were compared was consistent.

Another possible explanation for the longer lag-phase could be a potential redox imbalance undergone when acetate is used as carbon source. A proposed pathway to overcome this redox imbalance is the accumulation of PHB [30]. PHB is probably produced by the increased levels of NAD(P)H as a result of NAD+ photoreduction [30] that has been reported to increase bacterial fitness and stress resistance [196]. In fact the phasin protein (Rru_A2817) has been found downregulated in M68. In addition NifJ has been also proposed to play a role in redox imbalance. In this regard our proteomic analysis showed that NifJ was

120

downregulated indicating that it is under the control of QS sensing system and that it might be needed to surpass redox imbalance reported under Mel-LAN conditions [30].

VI.2.1. Perspectives

However further studies are needed to identify genes regulated directly by QS in R. rubrum. This can be done by identifying the potential lux-box (Chapter III) in upstream genes found differentially expressed by transcriptomic and proteomic analysis (Chapter IV). Then this potential regions can be fused for instance with a gfp gene (green fluorescence protein), then by addition of synthetic AHL we can determine the expression of gfp. Expression of gfp represents direct interaction of RruI/AHL and lux-box. In this way we can also identify which genes are under the control of which AHLs.

VI.3. Is there a link between QS and biofilm formation in R. rubrum?

As mentioned in Chapter II, we also wanted to elucidate if there was a link between QS and biofilm formation. Several recent studies have linked biofilm formation to quorum sensing in plant-associated bacteria such as Agrobacterium, Erwinia, Pantoea as well as [83] in human-associated species such as Burkholderia cenocepacia H111, Pseudomonas aeruginosa [197].

The fact that M68 did not attached to the RWV surface showed us that QS played a role in biofilm formation under Mel-LAN conditions (Chapter III). Moreover, besides that only microaerobic conditions could be achieved in a flow cell system it was also clear the relation between QS and biofilm formation (qualitative observation) under MELiSSA-like culture conditions (light and acetate as energy and carbon source) (Chapter V). However, in an attempt to quantify R. rubrum biofilms, biofilm formation was assessed using the microtiter plate set up (Chapter V) under static conditions [180]. In contrast to flow cell results, a higher biofilm formation capacity was determined for M68. This behavior could be the result of a decreased motility in M68. Once inoculated in the microtiter plate, WT cells could remain motile and swimming whereas M68 probably precipitated to the bottom of the wells. Once together, M68 cells could adhere to the microplate bottom surface giving rise to cells that strongly attached to it [179].

121

It is worthwhile to note that biofilm can be influenced by several factors such as bacterial surface properties and substratum used (glass or plastics). Throughout this research biofilm development was observed macroscopically in the RWV vessels where the substratum is plastic and the shearing conditions were low (25 RPM). Also during all the experiment no input of new media was done. Whereas in the flow cell system the substratum was glass and the cells were incubated under a constant culture medium flow allowing the cells to form a mature biofilm observed by fluorescent microscopic. Besides biofilm was observed in both systems we must take into account that in other species biofilm formation can differ depending on the system used for its study i.e. static or flow conditions. In this sense, the result obtained in the microtiter plate set up where M68 attached more than WT to the microtiter plate surface represent a good example of the discrepancies among methods for biofilm studies.

VI. 3.1 Perspectives

The opposite results on biofilm formation between WT and M68 using 2 different setups. However to confirm this suggestion further studies on exopolysaccharides content in M68 and QS should be determined, due to EPS has been reported to be an important factor on biofilm development [83]. Then it is not discarded that it can be under the control of QS As observed for Rb. sphaeroides [56]

VI.4. What are the consequences of our results for future MELiSSA development?

The mutant strain could be used in order to avoid biofilm formation in the bioreactor however as described in Chapter IV, several biological functions affected would interfere in its task in the MELiSSA loop. Nevertheless, the use of a QS-silent mutant in the MELiSSA loop might be a better choice compared to the addition of external biofilm-disrupting compounds. Since the compartments will be interconnected there could be an effect of such biofilm-disrupting compounds in the other reactors, e.g. a negative effect on compartment III, where the nitrifying community needs to grow in biofilm. However, if compartment IV is contaminated with AHLs, since this compartment is kept at alkaline pH (up to pH 10) [71] the potential effects on AHL can be minimal due to AHL lactonolysis at high pH [198].

122

In any case more studies are needed under bioreactor conditions, to further analyse the growth kinetics and metabolic output, i.e. the effluent produced, by M68 in comparison to WT, to assure if such a QS-silent mutant would still perform adequate in the MELiSSA system.

VI.5. General Conclusions

In summary:

 We have created a stable rruI knockout mutant named M68 that display decreased swimming motility and pigment content (bacteriochlorophyll and carotenoids) and a longer lag-phase than WT when grown under Mel- LAN conditions.  Transcriptomic and proteomic analysis revealed that several genes and proteins were under the control of QS (Chapter IV) i.e. photosynthesis-, flagellar structure-, bacterial stress-, ABC transporters-, electron transport chain-, two component system- and fatty acid β-oxidation-related genes.  In R. rubrum biofilm formation is under the control of QS as demonstrated in the rotating wall vessel (RWV) and in the flow cell system.  In addition, the question about a possible interaction of compartment II with adjacent compartment III and IV through AHL molecules, still remains to be investigated. Still many questions remain to be investigated such as the fate of AHLs in MELiSSA loop and its possible detrimental effects.

123

References

1. NASA, F., International Space Station-Environmental Control and Life Support System FS–2008–05–83–MSFC. 2008, NASA MSFC. p. 4.

2. Mark Nelson, N.S.P., John P. Allen, Lydia A Somova, and Josef I. Gitelson, Environmental Biotechnology. Closed Ecological Systems, Space Life Support and Biospherics. Vol. 10. 2009, New York Humana Press. 48.

3. Hendrickx, L., et al., Microbial ecology of the closed artificial ecosystem MELiSSA (Micro-Ecological Life Support System Alternative): reinventing and compartmentalizing the Earth's food and oxygen regeneration system for long-haul space exploration missions. Res Microbiol, 2006. 157(1): p. 77-86.

4. Hendrickx, L. and M. Mergeay, From the deep sea to the stars: human life support through minimal communities. Curr Opin Microbiol, 2007. 10(3): p. 231-7.

5. C. Lasseur, J.B., H. de Weever, M. Dixon, G. Dussap, F. Godia, and M.M. N. Leys, D. Van Der Straeten, MELiSSA: THE EUROPEAN PROJECT OF CLOSED LIFE SUPPORT SYSTEM Gravitational and Space Biology, 2010. 23(2): p. 12.

6. Ning, C. and H. Gest, Regulation of L-isoleucine biosynthesis in the photosynthetic bacterium rhodospirillum rubrum. Proc Natl Acad Sci U S A, 1966. 56(6): p. 1823-7.

7. Gòdia, F., et al., The MELISSA pilot plant facility as an integration test-bed for advanced life support systems. Advances in Space Research, 2004. 34(7): p. 1483- 1493.

8. Godia, F., et al., MELISSA: a loop of interconnected bioreactors to develop life support in space. J Biotechnol, 2002. 99(3): p. 319-30.

9. Garrity, G.M., ed. Bergey's Manual of Systematic Bacteriology. 2 ed. The Proteobacteria, ed. N.R.K. Don J. Brenner, James T. Staley. Vol. 2 2004, Springer US: US. LXXXII, 2816.

10. van Niel, C.B., The Culture, General Physiology, Morphology, and Classification of the Non-Sulfur Purple and Brown Bacteria. Bacteriol Rev, 1944. 8(1): p. 1-118.

11. Hansen, T.A. and H. van Gemerden, Sulfide utilization by purple nonsulfur bacteria. Arch Mikrobiol, 1972. 86(1): p. 49-56.

124

12. Lee, A.G. and J.T. Fitzsimons, Motility in normal and filamentous forms of Rhodospirillum rubrum. J Gen Microbiol, 1976. 93(2): p. 346-54.

13. Jiang, Z.Y. and C.E. Bauer, Component of the Rhodospirillum centenum photosensory apparatus with structural and functional similarity to methyl- accepting chemotaxis protein chemoreceptors. J Bacteriol, 2001. 183(1): p. 171-7.

14. Russell, N.J. and J.L. Harwood, Changes in the acyl lipid composition of photosynthetic bacteria grown under photosynthetic and non-photosynthetic conditions. Biochem J, 1979. 181(2): p. 339-45.

15. Bona-Lovasz, J., et al., A rapid method for the extraction and analysis of carotenoids and other hydrophobic substances suitable for systems biology studies with photosynthetic bacteria. Metabolites, 2013. 3(4): p. 912-30.

16. Schwerzmann, R.U. and R. Bachofen, Carotenoid Profiles in Pigment-Protein Complexes of Rhodospirillum rubrum. Plant and Cell Physiology, 1989. 30(4): p. 497-504.

17. Cogdell, R.J., et al., How carotenoids protect bacterial photosynthesis. Philos Trans R Soc Lond B Biol Sci, 2000. 355(1402): p. 1345-9.

18. Griffiths, M., et al., Function of Carotenoids in Photosynthesis. Nature, 1955. 176(4495): p. 1211-1214.

19. Glaeser, J. and G. Klug, Photo-oxidative stress in Rhodobacter sphaeroides: protective role of carotenoids and expression of selected genes. Microbiology, 2005. 151(Pt 6): p. 1927-38.

20. Munk, A.C., et al., Complete genome sequence of Rhodospirillum rubrum type strain (S1). Stand Genomic Sci, 2011. 4(3): p. 293-302.

21. Oelze, I.K.a.J., Growth and Adaptation to Phototrophic Conditions of Rhodospirillum rubrum and Rhodopseudomonas sphaeroides at Different Temperatures. Arch. Microbiol., 1980. 126: p. 8.

22. Cohen-Bazire, G. and R. Kunisawa, The fine structure of Rhodospirillum rubrum. J Cell Biol, 1963. 16: p. 401-19.

23. Karrasch, S., P.A. Bullough, and R. Ghosh, The 8.5 A projection map of the light- harvesting complex I from Rhodospirillum rubrum reveals a ring composed of 16 subunits. EMBO J, 1995. 14(4): p. 631-8.

24. Wang, X., H.V. Modak, and F.R. Tabita, Photolithoautotrophic growth and control of CO2 fixation in Rhodobacter sphaeroides and Rhodospirillum rubrum in the absence of ribulose bisphosphate carboxylase-oxygenase. J Bacteriol, 1993. 175(21): p. 7109-14.

125

25. C. Neil Hunter, F.D., Marion C. Thurnauer, J. Thomas Beatty., The Purple Phototrophic Bacteria. Advances in Photosynthesis and Respiration, ed. GOVINDJEE. Vol. 28. 2008: Springer.

26. Buchanan, B.B., M.C. Evans, and D.I. Arnon, Ferredoxin-dependent carbon assimilation in Rhodospirillum rubrum. Arch Mikrobiol, 1967. 59(1): p. 32-40.

27. Joshi, H.M. and F.R. Tabita, Induction of carbon monoxide dehydrogenase to facilitate redox balancing in a ribulose bisphosphate carboxylase/oxygenase- deficient mutant strain of Rhodospirillum rubrum. Archives of Microbiology, 2000. 173(3): p. 193-199.

28. Wang, X., D.L. Falcone, and F.R. Tabita, Reductive pentose phosphate-independent CO2 fixation in Rhodobacter sphaeroides and evidence that ribulose bisphosphate carboxylase/oxygenase activity serves to maintain the redox balance of the cell. J Bacteriol, 1993. 175(11): p. 3372-9.

29. Berg, I.A. and R.N. Ivanovsky, Enzymes of the citramalate cycle in Rhodospirillum rubrum. Microbiology, 2009. 78(1): p. 16-24.

30. Leroy, B., et al., New insight into the photoheterotrophic growth of the isocytrate lyase-lacking purple bacterium Rhodospirillum rubrum on acetate. Microbiology, 2015. 161(Pt 5): p. 1061-72.

31. Schultz, J.E. and P.F. Weaver, Fermentation and anaerobic respiration by Rhodospirillum rubrum and Rhodopseudomonas capsulata. J Bacteriol, 1982. 149(1): p. 181-90.

32. Ballistreri, A., et al., Characterization by mass spectrometry of poly(3- hydroxyalkanoates) produced by Rhodospirillum rubrum from 3-hydroxyacids. International Journal of Biological Macromolecules, 1999. 26(2–3): p. 201-211.

33. Uffen, R.L. and R.S. Wolfe, Anaerobic growth of purple nonsulfur bacteria under dark conditions. J Bacteriol, 1970. 104(1): p. 462-72.

34. Rudolf, C. and H. Grammel, Fructose metabolism of the purple non-sulfur bacterium Rhodospirillum rubrum: effect of carbon dioxide on growth, and production of bacteriochlorophyll and organic acids. Enzyme Microb Technol, 2012. 50(4-5): p. 238-46.

35. Teixeira, P.F., H. Wang, and S. Nordlund, Nitrogenase switch-off and regulation of ammonium assimilation in response to light deprivation in Rhodospirillum rubrum are influenced by the nitrogen source used during growth. J Bacteriol, 2010. 192(5): p. 1463-6.

36. Jin, H. and B.J. Nikolau, Evaluating PHA productivity of bioengineered Rhodosprillum rubrum. PLoS One, 2014. 9(5): p. e96621.

126

37. Jin, H. and B.J. Nikolau, Role of genetic redundancy in polyhydroxyalkanoate (PHA) polymerases in PHA biosynthesis in Rhodospirillum rubrum. J Bacteriol, 2012. 194(20): p. 5522-9.

38. Stanley, J.T., et al., Microbial life. 2007: Sinauer Associates, Incorporated. 1066.

39. Lupo, D. and R. Ghosh, The reaction center H subunit is not required for high levels of light-harvesting complex 1 in Rhodospirillum rubrum mutants. J Bacteriol, 2004. 186(17): p. 5585-95.

40. Fotiadis, D., et al., Structural analysis of the reaction center light-harvesting complex I photosynthetic core complex of Rhodospirillum rubrum using atomic force microscopy. J Biol Chem, 2004. 279(3): p. 2063-8.

41. Wang, G.S., et al., High-level production of the industrial product lycopene by the photosynthetic bacterium Rhodospirillum rubrum. Appl Environ Microbiol, 2012. 78(20): p. 7205-15.

42. Butzin, N.C., H.A. Owen, and M.L. Collins, A new system for heterologous expression of membrane proteins: Rhodospirillum rubrum. Protein Expr Purif, 2010. 70(1): p. 88-94.

43. Kolinko, I., et al., Biosynthesis of magnetic nanostructures in a foreign organism by transfer of bacterial magnetosome gene clusters. Nat Nanotechnol, 2014. 9(3): p. 193-7.

44. Nomura, C.T., et al., Expression of 3-ketoacyl-acyl carrier protein reductase (fabG) genes enhances production of polyhydroxyalkanoate copolymer from glucose in recombinant Escherichia coli JM109. Appl Environ Microbiol, 2005. 71(8): p. 4297- 306.

45. Brandl, H., et al., Ability of the phototrophic bacterium Rhodospirillum rubrum to produce various poly (beta-hydroxyalkanoates): potential sources for biodegradable polyesters. Int J Biol Macromol, 1989. 11(1): p. 49-55.

46. Wang, X., et al., Formation characteristics of an anoxygenic photosynthetic bacterial biofilm in a photorotating biological contactor for azo dye wastewater treatment. Journal of Chemical Technology & Biotechnology, 2015. 90(1): p. 176- 184.

47. Kim, M.S., et al., Effect of carbon and nitrogen sources on photo-fermentative H2 production associated with nitrogenase, uptake hydrogenase activity, and PHB accumulation in Rhodobacter sphaeroides KD131. Bioresour Technol, 2012. 116: p. 179-83.

127

48. Adessi, A. and R. De Philippis, Photobioreactor design and illumination systems for H2 production with anoxygenic photosynthetic bacteria: A review. International Journal of Hydrogen Energy, 2014. 39(7): p. 3127-3141.

49. Basak, N., et al., Photofermentative molecular biohydrogen production by purple- non-sulfur (PNS) bacteria in various modes: The present progress and future perspective. International Journal of Hydrogen Energy, 2014. 39(13): p. 6853-6871.

50. Nealson, K.H. and J.W. Hastings, Bacterial bioluminescence: its control and ecological significance. Microbiol Rev, 1979. 43(4): p. 496-518.

51. Miller, M.B. and B.L. Bassler, Quorum sensing in bacteria. Annu Rev Microbiol, 2001. 55: p. 165-99.

52. Henke, J.M. and B.L. Bassler, Three parallel quorum-sensing systems regulate gene expression in Vibrio harveyi. J Bacteriol, 2004. 186(20): p. 6902-14.

53. Ng, W.L. and B.L. Bassler, Bacterial quorum-sensing network architectures. Annu Rev Genet, 2009. 43: p. 197-222.

54. Waters, C.M. and B.L. Bassler, Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol, 2005. 21: p. 319-46.

55. Fuqua, C. and E.P. Greenberg, Listening in on bacteria: acyl-homoserine lactone signalling. Nat Rev Mol Cell Biol, 2002. 3(9): p. 685-95.

56. Puskas A., E.P.G., S. Kaplan, and A. L. Schaefer, A Quorum-Sensing System in the Free-Living Photosynthetic Bacterium Rhodobacter sphaeroides. Journal of Bacteriology, 1997. 179(23): p. 8.

57. Williams, P., et al., Look who's talking: communication and quorum sensing in the bacterial world. Philos Trans R Soc Lond B Biol Sci, 2007. 362(1483): p. 1119-34.

58. Williams, P., Quorum sensing, communication and cross-kingdom signalling in the bacterial world. Microbiology, 2007. 153(Pt 12): p. 3923-38.

59. Chen, Y., et al., Acetic Acid Acts as a Volatile Signal To Stimulate Bacterial Biofilm Formation. MBio, 2015. 6(3): p. e00392.

60. Taga, M.E. and B.L. Bassler, Chemical communication among bacteria. Proceedings of the National Academy of Sciences, 2003. 100(suppl 2): p. 14549-14554.

61. Case, R.J., M. Labbate, and S. Kjelleberg, AHL-driven quorum-sensing circuits: their frequency and function among the Proteobacteria. ISME J, 2008. 2(4): p. 345-9.

62. Cude, W.N., et al., Phaeobacter sp. strain Y4I utilizes two separate cell-to-cell communication systems to regulate production of the antimicrobial indigoidine. Appl Environ Microbiol, 2015. 81(4): p. 1417-25.

128

63. Zan, J., et al., Acyl-homoserine lactone quorum sensing in the Roseobacter clade. Int J Mol Sci, 2014. 15(1): p. 654-69.

64. Cude, W.N. and A. Buchan, Acyl-homoserine lactone-based quorum sensing in the Roseobacter clade: complex cell-to-cell communication controls multiple physiologies. Front Microbiol, 2013. 4: p. 336.

65. Schaefer, A.L., et al., Long-Chain Acyl-Homoserine Lactone Quorum-Sensing Regulation of Rhodobacter capsulatus Gene Transfer Agent Production. Journal of Bacteriology, 2002. 184(23): p. 6515-6521.

66. Suzuki, H., et al., Characterization of extracellular DNA production and flocculation of the marine photosynthetic bacterium Rhodovulum sulfidophilum. Appl Microbiol Biotechnol, 2009. 84(2): p. 349-56.

67. T. Terada, Y.K., S. Umekage, Improved bioassay for detecting autoinducer of Rhodovulum sulfidophilum. AIP Conference Proceedings, 2015. 1649(67).

68. Schaefer, A.L., et al., A new class of homoserine lactone quorum-sensing signals. Nature, 2008. 454(7204): p. 595-9.

69. Pycke, B., The fate and effects of micropollutants in a biological life support system. 2009, Ghent University: Belgium.

70. Carius, L., et al., Quorum sensing influences growth and photosynthetic membrane production in high-cell-density cultivations of Rhodospirillum rubrum. BMC Microbiol, 2013. 13(1): p. 189.

71. Mastroleo, F., et al., Modelled microgravity cultivation modulates N- acylhomoserine lactone production in Rhodospirillum rubrum S1H independently of cell density. Microbiology, 2013. 159(Pt 12): p. 2456-66.

72. Berger, M., et al., Tropodithietic acid production in Phaeobacter gallaeciensis is regulated by N-acyl homoserine lactone-mediated quorum sensing. J Bacteriol, 2011. 193(23): p. 6576-85.

73. Zan, J., et al., A complex LuxR-LuxI type quorum sensing network in a roseobacterial marine sponge symbiont activates flagellar motility and inhibits biofilm formation. Mol Microbiol, 2012. 85(5): p. 916-33.

74. Pearson, J.P., C. Van Delden, and B.H. Iglewski, Active efflux and diffusion are involved in transport of Pseudomonas aeruginosa cell-to-cell signals. J Bacteriol, 1999. 181(4): p. 1203-10.

75. Krol, E. and A. Becker, Rhizobial homologs of the fatty acid transporter FadL facilitate perception of long-chain acyl-homoserine lactone signals. Proc Natl Acad Sci U S A, 2014. 111(29): p. 10702-7.

129

76. Mashburn-Warren, L., et al., Interaction of quorum signals with outer membrane lipids: insights into prokaryotic membrane vesicle formation. Mol Microbiol, 2008. 69(2): p. 491-502.

77. Ghosh, R., et al., Optimization of the Sistrom Culture Medium for Large-Scale Batch Cultivation of Rhodospirillum rubrum under Semiaerobic Conditions with Maximal Yield of Photosynthetic Membranes. Appl Environ Microbiol, 1994. 60(5): p. 1698- 700.

78. Shaw, P.D., Ping, G., Daly, S. L., Cha, C., Cronan, J. E., Jr, Rinehart, K. L. & Farrand, S. K., Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography. Proc. Natl. Acad. Sci. USA, 1997. 94: p. 6036-6041.

79. Patzelt, D., et al., You are what you talk: quorum sensing induces individual morphologies and cell division modes in Dinoroseobacter shibae. ISME J, 2013. 7(12): p. 2274-86.

80. Davey, M.E. and A. O'Toole G, Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev, 2000. 64(4): p. 847-67.

81. Watanabe M., S.K., Nakashimada Y., Kakizono T., Noparatnaraporn N., Nishio N., Growth and flocculation of a marine photosynthetic bacterium Rhodovulum sp. Appl Microbiol Biotechnol, 1998. 50: p. 9.

82. Donlan, R.M., Biofilms: microbial life on surfaces. Emerg Infect Dis, 2002. 8(9): p. 881-90.

83. Carlier A, P.G., Eberl L., Microbial Biofilms and Quorum Sensing, in Principles of Plant-Microbe Interactions, B. Lugtenberg, Editor. 2015, Springer International Publishing: Switzerland. p. 45-52.

84. Hoiby, N., et al., Antibiotic resistance of bacterial biofilms. Int J Antimicrob Agents, 2010. 35(4): p. 322-32.

85. Van Houdt, R. and C.W. Michiels, Biofilm formation and the food industry, a focus on the bacterial outer surface. J Appl Microbiol, 2010. 109(4): p. 1117-31.

86. Zardus, J.D., et al., Microbial biofilms facilitate adhesion in biofouling invertebrates. Biol Bull, 2008. 214(1): p. 91-8.

87. Stoodley, P., et al., Biofilms as complex differentiated communities. Annu Rev Microbiol, 2002. 56: p. 187-209.

88. Serra, D.O., et al., Microanatomy at cellular resolution and spatial order of physiological differentiation in a bacterial biofilm. MBio, 2013. 4(2): p. e00103-13.

89. Abee, T., et al., Biofilm formation and dispersal in Gram-positive bacteria. Current Opinion in Biotechnology, 2011. 22(2): p. 172-179.

130

90. Vu, B., et al., Bacterial extracellular polysaccharides involved in biofilm formation. Molecules, 2009. 14(7): p. 2535-54.

91. Lemon, K.P., D.E. Higgins, and R. Kolter, Flagellar motility is critical for Listeria monocytogenes biofilm formation. J Bacteriol, 2007. 189(12): p. 4418-24.

92. Houry, A., et al., Involvement of motility and flagella in Bacillus cereus biofilm formation. Microbiology, 2010. 156(Pt 4): p. 1009-18.

93. Blair, K.M., et al., A molecular clutch disables flagella in the Bacillus subtilis biofilm. Science, 2008. 320(5883): p. 1636-8.

94. Boles, B.R. and A.R. Horswill, Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog, 2008. 4(4): p. e1000052.

95. Guo-Jun Xie, B.-F.L., Hong-Yu Ren, De-Feng Xing, Jun Nan, Nan-Qi Ren, Material flow analysis of feedstock for enhancing its conversion efficiency during continuous photo-hydrogen production. GCB Bioenergy, 2014. 6: p. 8.

96. Xingzu Wang, K.X., Xiang Cheng, Yiwei Ren , Chunli Wan, Biofilm formation of anoxygenic photosynthetic bacteria induced by phototaxis for enhancing hydrogen production. Environ. Sci.: Water Res. Technol., 2015. 1: p. 11.

97. Kernan, C., et al., Experimental and Computational Investigation of Biofilm Formation by Rhodopseudomonas palustris Growth under Two Metabolic Modes. PLoS One, 2015. 10(6): p. e0129354.

98. McDougald, D., et al., Should we stay or should we go: mechanisms and ecological consequences for biofilm dispersal. Nat Rev Microbiol, 2012. 10(1): p. 39-50.

99. Steunou, A.S., et al., EmbRS a new two-component system that inhibits biofilm formation and saves Rubrivivax gelatinosus from sinking. Microbiologyopen, 2013. 2(3): p. 431-46.

100. Wilkinson, D.A., et al., Regulation of flagellum number by FliA and FlgM and role in biofilm formation by Rhodobacter sphaeroides. J Bacteriol, 2011. 193(15): p. 4010- 4.

101. Lin, T.Y., et al., A cardiolipin-deficient mutant of Rhodobacter sphaeroides has an altered cell shape and is impaired in biofilm formation. J Bacteriol, 2015.

102. Eboigbodin, K.E., J.J. Ojeda, and C.A. Biggs, Investigating the surface properties of Escherichia coli under glucose controlled conditions and its effect on aggregation. Langmuir, 2007. 23(12): p. 6691-7.

103. Bruhn, J.B., L. Gram, and R. Belas, Production of antibacterial compounds and biofilm formation by Roseobacter species are influenced by culture conditions. Appl Environ Microbiol, 2007. 73(2): p. 442-50.

131

104. Davies, D.G., et al., The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science, 1998. 280(5361): p. 295-8.

105. Parsek, M.R. and E.P. Greenberg, Sociomicrobiology: the connections between quorum sensing and biofilms. Trends Microbiol, 2005. 13(1): p. 27-33.

106. Atkinson, S., et al., A hierarchical quorum-sensing system in Yersinia pseudotuberculosis is involved in the regulation of motility and clumping. Mol Microbiol, 1999. 33(6): p. 1267-77.

107. Crossman, L. and J.M. Dow, Biofilm formation and dispersal in Xanthomonas campestris. Microbes Infect, 2004. 6(6): p. 623-9.

108. Lee, K.J., et al., Role of capsular polysaccharide (CPS) in biofilm formation and regulation of CPS production by quorum-sensing in Vibrio vulnificus. Mol Microbiol, 2013. 90(4): p. 841-57.

109. Kim, S.M., et al., LuxR homologue SmcR is essential for Vibrio vulnificus pathogenesis and biofilm detachment, and its expression is induced by host cells. Infect Immun, 2013. 81(10): p. 3721-30.

110. Hammer, B.K. and B.L. Bassler, Quorum sensing controls biofilm formation in Vibrio cholerae. Molecular Microbiology, 2003. 50(1): p. 101-104.

111. Solano, C., M. Echeverz, and I. Lasa, Biofilm dispersion and quorum sensing. Curr Opin Microbiol, 2014. 18: p. 96-104.

112. Waters, C.M., et al., Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT. J Bacteriol, 2008. 190(7): p. 2527-36.

113. Cabello, F., Cultivo en bioreactores de Rhodospirillum rubrum en condiciones fotoheterotróficas, in Departament d'Enginyeria Quimica. 2007, Universitat Autònoma de Barcelona: Barcelona. p. 348.

114. Sistrom, W.R., A Requirement for Sodium in the Growth of Rhodopseudomonas sphaeroides. J. gen. Microbiol, 1960(22): p. 8.

115. Segers, L. and W. Verstraete, Conversion of organic acids to h(2) by Rhodospirillaceae grown with glutamate or dinitrogen as nitrogen source. Biotechnol Bioeng, 1983. 25(12): p. 2843-53.

116. Simon, R., U. Priefer, and A. Puhler, A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat Biotech, 1983. 1(9): p. 784-791.

132

117. Alexeyev, M.F., The pKNOCK series of broad-host-range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of Gram- negative bacteria. Biotechniques, 1999. 26(5): p. 824-828.

118. Boyer, H.W. and D. Roulland-dussoix, A complementation analysis of the restriction and modification of DNA in Escherichia coli. Journal of Molecular Biology, 1969. 41(3): p. 459-472.

119. Ferrières, L., et al., Silent Mischief: Bacteriophage Mu Insertions Contaminate Products of Escherichia coli Random Mutagenesis Performed Using Suicidal Transposon Delivery Plasmids Mobilized by Broad-Host-Range RP4 Conjugative Machinery. Journal of Bacteriology, 2010. 192(24): p. 6418-6427.

120. Tomlin, K.L., S.R.D. Clark, and H. Ceri, Green and red fluorescent protein vectors for use in biofilm studies of the intrinsically resistant Burkholderia cepacia complex. Journal of Microbiological Methods, 2004. 57(1): p. 95-106.

121. DeShazer, D. and D.E. Woods, Broad-host-range cloning and cassette vectors based on the R388 trimethoprim resistance gene. BioTechniques, 1996. 20(5): p. 762-764.

122. Sievers, F., et al., Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol, 2011. 7: p. 539.

123. Corpet, F., Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res, 1988. 16(22): p. 10881-90.

124. Stothard, P., The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques, 2000. 28(6): p. 1102, 1104.

125. Untergasser, A., et al., Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res, 2007. 35(Web Server issue): p. W71-4.

126. Fitzmaurice, W. and G. Roberts, Artificial DNA-mediated genetic transformation of the photosynthetic nitrogen-fixing bacterium Rhodospirillum rubrum. Archives of Microbiology, 1991. 156(2): p. 142-144.

127. Zwietering, M.H., et al., Modeling of the bacterial growth curve. Appl Environ Microbiol, 1990. 56(6): p. 1875-81.

128. Favier-Teodorescu, L., Etude cinétique et stoechiométrique de la croissance de Rhodospirillum rubrum en photobioréacteur, in Ecole Doctorale. 2004, Université Blaise Pascal: France. p. 365.

129. Hammond, T.G. and J.M. Hammond, Optimized suspension culture: the rotating- wall vessel. Am J Physiol Renal Physiol, 2001. 281(1): p. F12-25.

133

130. Crabbe, A., et al., Use of the rotating wall vessel technology to study the effect of shear stress on growth behaviour of Pseudomonas aeruginosa PA01. Environ Microbiol, 2008. 10(8): p. 2098-110.

131. Bikandi, J., et al., In silico analysis of complete bacterial genomes: PCR, AFLP-PCR and endonuclease restriction. Bioinformatics, 2004. 20(5): p. 798-9.

132. Subramoni, S. and V. Venturi, LuxR-family 'solos': bachelor sensors/regulators of signalling molecules. Microbiology, 2009. 155(Pt 5): p. 1377-85.

133. Chambers, C.E., et al., Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome. BMC Microbiol, 2006. 6: p. 104.

134. Lee, D.H., et al., A consensus sequence for binding of SmcR, a Vibrio vulnificus LuxR homologue, and genome-wide identification of the SmcR regulon. J Biol Chem, 2008. 283(35): p. 23610-8.

135. Antunes, L.C., et al., A mutational analysis defines Vibrio fischeri LuxR binding sites. J Bacteriol, 2008. 190(13): p. 4392-7.

136. Laue, B.E., et al., The biocontrol strain Pseudomonas fluorescens F113 produces the Rhizobium small bacteriocin, N-(3-hydroxy-7-cis-tetradecenoyl)homoserine lactone, via HdtS, a putative novel N-acylhomoserine lactone synthase. Microbiology, 2000. 146 ( Pt 10): p. 2469-80.

137. Rivas, M., et al., Second acyl homoserine lactone production system in the extreme acidophile Acidithiobacillus ferrooxidans. Appl Environ Microbiol, 2007. 73(10): p. 3225-31.

138. Laguna, R., F.R. Tabita, and B.E. Alber, Acetate-dependent photoheterotrophic growth and the differential requirement for the Calvin-Benson-Bassham reductive pentose phosphate cycle in Rhodobacter sphaeroides and Rhodopseudomonas palustris. Arch Microbiol, 2011. 193(2): p. 151-4.

139. Yang, Q. and T. Defoirdt, Quorum sensing positively regulates flagellar motility in pathogenic Vibrio harveyi. Environ Microbiol, 2015. 17(4): p. 960-8.

140. Liu, X., et al., Characterisation of two quorum sensing systems in the endophytic Serratia plymuthica strain G3: differential control of motility and biofilm formation according to life-style. BMC Microbiol, 2011. 11(1): p. 26.

141. Guttenplan, S.B. and D.B. Kearns, Regulation of flagellar motility during biofilm formation. FEMS Microbiol Rev, 2013. 37(6): p. 849-71.

134

142. Morohoshi, T., Y. Ogata, and T. Ikeda, Cell aggregation is negatively regulated by N- acylhomoserine lactone-mediated quorum sensing in Pantoea ananatis SK-1. J Biosci Bioeng, 2011. 112(6): p. 566-9.

143. Sauer, K., The genomics and proteomics of biofilm formation. Genome Biol, 2003. 4(6): p. 219.

144. Merritt, P.M., T. Danhorn, and C. Fuqua, Motility and chemotaxis in Agrobacterium tumefaciens surface attachment and biofilm formation. J Bacteriol, 2007. 189(22): p. 8005-14.

145. Labbate, M., et al., Quorum Sensing-Controlled Biofilm Development in Serratia liquefaciens MG1. Journal of Bacteriology, 2004. 186(3): p. 692-698.

146. Koutsoudis, M.D., et al., Quorum-sensing regulation governs bacterial adhesion, biofilm development, and host colonization in Pantoea stewartii subspecies stewartii. Proc Natl Acad Sci U S A, 2006. 103(15): p. 5983-8.

147. Atkinson S., C.M., Williams P., N-acylhomoserine lactones, quorum sensing and biofilm development in Gram-negative bacteria. The biofilm mode of life. Mechanisms and adaptations, ed. G.M. Kjellberg S. 2007, Wymondham. 27.

148. de Kievit, T.R. and B.H. Iglewski, Bacterial quorum sensing in pathogenic relationships. Infect Immun, 2000. 68(9): p. 4839-49.

149. Montgomery, K., et al., Quorum sensing in extreme environments. Life (Basel), 2013. 3(1): p. 131-48.

150. Mastroleo, F., et al., Experimental design and environmental parameters affect Rhodospirillum rubrum S1H response to space flight. ISME J, 2009. 3(12): p. 1402- 19.

151. Vallenet, D., et al., MaGe: a microbial genome annotation system supported by synteny results. Nucleic Acids Res, 2006. 34(1): p. 53-65.

152. Pycke, B.F., et al., Characterization of triclosan-resistant mutants reveals multiple antimicrobial resistance mechanisms in Rhodospirillum rubrum S1H. Appl Environ Microbiol, 2010. 76(10): p. 3116-23.

153. Kanehisa, M. and S. Goto, KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res, 2000. 28(1): p. 27-30.

154. Thomas, D.R., et al., The three-dimensional structure of the flagellar rotor from a clockwise-locked mutant of Salmonella enterica serovar Typhimurium. J Bacteriol, 2006. 188(20): p. 7039-48.

155. Pycke, B.F., et al., Toxicogenomic response of Rhodospirillum rubrum S1H to the micropollutant triclosan. Appl Environ Microbiol, 2010. 76(11): p. 3503-13.

135

156. Mastroleo, F., Molecular characterization of the life support bacterium Rhodospirillum rubrum S1H cultivated under space related environmental conditions. 2009, Université de Mons-Hainaut. p. 171.

157. Finocchiaro, G., et al., Biosynthesis, molecular cloning and sequencing of electron transfer flavoprotein. Progress in clinical and biological research, 1990. 321: p. 637- 652.

158. LaRock CN, Y.J., Horswill AR, Parsek MR, Minion FC, Transcriptome Analysis of Acetyl-Homoserine Lactone-Based Quorum Sensing Regulation in Yersinia pestis. PLoS ONE, 2013. 8(4): p. 8.

159. Wagner, V.E., et al., Microarray Analysis of Pseudomonas aeruginosa Quorum- Sensing Regulons: Effects of Growth Phase and Environment. Journal of Bacteriology, 2003. 185(7): p. 2080-2095.

160. Liu, H., et al., Quorum sensing coordinates brute force and stealth modes of infection in the plant pathogen Pectobacterium atrosepticum. PLoS Pathog, 2008. 4(6): p. e1000093.

161. Mohr, C.D., U. Jenal, and L. Shapiro, Flagellar assembly in Caulobacter crescentus: a basal body P-ring null mutation affects stability of the L-ring protein. Journal of Bacteriology, 1996. 178(3): p. 675-682.

162. Derr, P., E. Boder, and M. Goulian, Changing the Specificity of a Bacterial Chemoreceptor. Journal of Molecular Biology, 2006. 355(5): p. 923-932.

163. Condori S., A.S., Leys N., Wattiez R., and Mastroleo F., Construction and phenotypic characterization of M68, a RruI quorum-sensing knockout mutant of the photosynthetic alpha-proteobacterium Rhodospirillum rubrum. Research in Microbiology (Accepted), 2016.

164. Elsen, S., et al., RegB/RegA, a highly conserved redox-responding global two- component regulatory system. Microbiol Mol Biol Rev, 2004. 68(2): p. 263-79.

165. Mecsas, J., et al., The activity of sigma E, an Escherichia coli heat-inducible sigma- factor, is modulated by expression of outer membrane proteins. Genes Dev, 1993. 7(12B): p. 2618-28.

166. Lund, P.A., Microbial molecular chaperones. Adv Microb Physiol, 2001. 44: p. 93- 140.

167. Lee, S., et al., The Structure of ClpB. Cell. 115(2): p. 229-240.

168. Jakob, U., et al., Chaperone Activity with a Redox Switch. Cell. 96(3): p. 341-352.

169. Kleerebezem, M. and J. Tommassen, Expression of the pspA gene stimulates efficient protein export in Escherichia coli. Mol Microbiol, 1993. 7(6): p. 947-56.

136

170. Darwin, A.J., The phage-shock-protein response. Mol Microbiol, 2005. 57(3): p. 621- 8.

171. Franks, S.E., et al., Novel role for the yceGH tellurite resistance genes in the pathogenesis of Bacillus anthracis. Infect Immun, 2014. 82(3): p. 1132-40.

172. Haardt, M., et al., The osmoprotectant proline betaine is a major substrate for the binding-protein-dependent transport system ProU of Escherichia coli K-12. Molecular & general genetics : MGG, 1995. 246(6): p. 783-786.

173. Lucht, J.M. and E. Bremer, Adaptation of Escherichia coli to high osmolarity environments: Osmoregulation of the high-affinity glycine betaine transport system ProU. FEMS Microbiology Reviews, 1994. 14(1): p. 3-20.

174. Pao, S.S., I.T. Paulsen, and M.H. Saier, Major facilitator superfamily. Microbiology and molecular biology reviews : MMBR, 1998. 62(1): p. 1-34.

175. Schembri, M.A., G. Christiansen, and P. Klemm, FimH-mediated autoaggregation of Escherichia coli. Molecular Microbiology, 2001. 41(6): p. 1419-1430.

176. O'Toole, G., H.B. Kaplan, and R. Kolter, Biofilm formation as microbial development. Annu Rev Microbiol, 2000. 54: p. 49-79.

177. Rice, S.A., et al., Biofilm formation and sloughing in Serratia marcescens are controlled by quorum sensing and nutrient cues. J Bacteriol, 2005. 187(10): p. 3477- 85.

178. Lynch, S.V., et al., Escherichia coli biofilms formed under low-shear modeled microgravity in a ground-based system. Appl Environ Microbiol, 2006. 72(12): p. 7701-10.

179. Garrett, T.R., M. Bhakoo, and Z. Zhang, Bacterial adhesion and biofilms on surfaces. Progress in Natural Science, 2008. 18(9): p. 1049-1056.

180. O'Toole, G.A., Microtiter dish biofilm formation assay. J Vis Exp, 2011(47).

181. Merritt, J.H., D.E. Kadouri, and G.A. O'Toole, Growing and Analyzing Static Biofilms. 2011.

182. Weiss Nielsen, M., et al., Pseudomonas aeruginosa and Saccharomyces cerevisiae biofilm in flow cells. J Vis Exp, 2011(47).

183. Armbruster, D.A. and T. Pry, Limit of blank, limit of detection and limit of quantitation. Clin Biochem Rev, 2008. 29 Suppl 1: p. S49-52.

184. Berney, M., et al., Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight Kit in combination with flow cytometry. Appl Environ Microbiol, 2007. 73(10): p. 3283-90.

137

185. Vitaline, D.G., Caractérisation génotypique et phénotypique des souches S1 et S1H de la bactérie Rhodospirillum rubrum dans le cadre du projet MELiSSA. 2014, Haute Ecole Louvain en Hainaut: Belgium.

186. Davey, H.M., Life, Death, and In-Between: Meanings and Methods in Microbiology. Applied and Environmental Microbiology, 2011. 77(16): p. 5571-5576.

187. Amor, K.B., et al., Multiparametric flow cytometry and cell sorting for the assessment of viable, injured, and dead bifidobacterium cells during bile salt stress. Appl Environ Microbiol, 2002. 68(11): p. 5209-16.

188. Kirov, S.M., et al., Biofilm differentiation and dispersal in mucoid Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Microbiology, 2007. 153(Pt 10): p. 3264-74.

189. van Loosdrecht, M.M., et al., Hydrophobic and electrostatic parameters in bacterial adhesion. Aquatic Sciences, 1990. 52(1): p. 103-114.

190. Hessner, M.J., P.J. Wejksnora, and M.L. Collins, Construction, characterization, and complementation of Rhodospirillum rubrum puf region mutants. J Bacteriol, 1991. 173(18): p. 5712-22.

191. Mather, M.W., L.M. McReynolds, and C.A. Yu, An enhanced broad-host-range vector for gram-negative bacteria: avoiding tetracycline phototoxicity during the growth of photosynthetic bacteria. Gene, 1995. 156(1): p. 85-8.

192. Kunin, V., R. Sorek, and P. Hugenholtz, Evolutionary conservation of sequence and secondary structures in CRISPR repeats. Genome Biol, 2007. 8(4): p. R61.

193. Grissa, I., G. Vergnaud, and C. Pourcel, The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics, 2007. 8: p. 172.

194. Ballado, T., et al., The hook gene (flgE) is expressed from the flgBCDEF operon in Rhodobacter sphaeroides: study of an flgE mutant. J Bacteriol, 2001. 183(5): p. 1680-7.

195. Zheng, H., et al., Flagellar-dependent motility in Mesorhizobium tianshanense is involved in the early stage of plant host interaction: study of an flgE mutant. Curr Microbiol, 2015. 70(2): p. 219-27.

196. de Almeida, A., et al., Effects of granule-associated protein PhaP on glycerol- dependent growth and polymer production in poly(3-hydroxybutyrate)-producing Escherichia coli. Applied and environmental microbiology, 2007. 73(24): p. 7912- 7916.

138

197. Inhulsen, S., et al., Identification of functions linking quorum sensing with biofilm formation in Burkholderia cenocepacia H111. Microbiologyopen, 2012. 1(2): p. 225-42.

198. Yates, E.A., et al., N-Acylhomoserine Lactones Undergo Lactonolysis in a pH-, Temperature-, and Acyl Chain Length-Dependent Manner during Growth of Yersinia pseudotuberculosis and Pseudomonas aeruginosa. Infection and Immunity, 2002. 70(10): p. 5635-5646.

Annex

1. List of differentially expressed proteins

Uniprot Fold accession Locus Tag p-value Pep Description Change number Glutamate synthase (NADPH) large Q2RYH1 Rru_A0019 0,0121200 68 0,57 subunit Q2RYF7 Rru_A0033 0,0150500 3 1,88 Cytochrome C biogenesis protein Cytochrome c-type biogenesis protein Q2RYF4 Rru_A0036 0,0001700 5 1,81 CcmE Q2RY92 Rru_A0098 0,0064800 16 1,98 Cystathionine gamma-synthase Q2RY77 Rru_A0113 0,0004900 21 2,78 Type II secretion system protein E Q2RY48 Rru_A0142 0,0040200 15 3,30 Putative cyclase Q2RY18 Rru_A0172 0,0187400 6 0,37 CRISPR-associated protein, Cse4 family Q2RY00 Rru_A0190 0,0062000 3 0,50 TonB-dependent receptor Q2RXY3 Rru_A0207 0,0291400 18 1,73 Cobalt chelatase, CobT subunit Q2RXY0 Rru_A0210 0,0438100 17 0,57 50S rib omal protein L28 Q2RXX7 Rru_A0213 0,0003800 18 2,00 Uncharacterized protein Q2RXU9 Rru_A0241 0,0091400 10 2,39 DNA methylase N-4/N-6 Q2RXS2 Rru_A0268 0,0001500 19 1,77 Molybdopterin binding domain Q2RXR9 Rru_A0271 0,0161800 14 0,69 GTP cyclohydrolase 1 Q2RXJ6 Rru_A0344 0,0008800 16 0,44 CRISPR-associated protein, Cse4 family Gamma-glutamyltransferase 1. Threonine Q2RXF5 Rru_A0385 0,0000009 12 0,45 peptidase. MEROPS family T03 Q2RXC6 Rru_A0414 0,0000083 34 0,64 30S rib omal protein S6 Q2RXB8 Rru_A0422 0,0521100 4 0,23 Uncharacterized protein Q2RXB5 Rru_A0425 0,0309400 6 0,36 Uncharacterized protein Q2RX57 Rru_A0483 0,0497900 3,10 Uncharacterized protein Q2RX12 Rru_A0529 0,0001800 6 2,94 Uncharacterized protein

139

Q2RX00 Rru_A0541 0,0054000 3 2,04 MotA/TolQ/ExbB proton channel Surface presentation of antigens (SPOA) Q2RWZ9 Rru_A0542 0,0012900 12 3,05 protein Q2RWZ7 Rru_A0544 0,0458200 16 1,96 Flagellar motor switch protein FliG Q2RWY6 Rru_A0555 0,0049600 7 0,36 Nitrogen regulatory protein P-II Q2RWX6 Rru_A0565 0,0244200 11 0,50 Uncharacterized protein Light-independent protochlorophyllide Q2RWS1 Rru_A0620 0,0095600 15 0,69 reductase iron-sulfur ATP-binding protein Q2RWM0 Rru_A0671 0,0086400 11 0,65 Cobalamin synthesis CobW protein 3-deoxy-D-arabinoheptul onate-7-ph Q2RWK8 Rru_A0683 0,0163400 33 0,70 phate synthase Q2RWK7 Rru_A0684 0,0064600 13 0,45 Uncharacterized protein Q2RWJ6 Rru_A0695 0,0003800 23 1,80 2-isopropylmalate synthase Ph phorib ylformylglycinamidine synthase Q2RWI3 Rru_A0708 0,0004600 32 0,45 subunit PurL Ph phorib ylformylglycinamidine synthase Q2RWI2 Rru_A0709 0,0005100 17 0,44 subunit PurQ Ph phorib ylformylglycinamidine Q2RWI1 Rru_A0710 0,0000667 8 0,40 synthetase PurS Ph phorib ylaminoimidazole- Q2RWI0 Rru_A0711 0,0000603 11 0,51 succinocarboxamide synthase Q2RWE1 Rru_A0750 0,0007700 13 0,66 Peptide chain release factor 1 Q2RWD9 Rru_A0752 0,0068800 7 0,62 Uncharacterized protein Q2RWA0 Rru_A0791 0,0414500 4 0,64 NLPA lipoprotein Q2RVV0 Rru_A0944 0,0005700 54 1,78 Cell division protein FtsZ UDP-N-acetylmuramoyl-L-alanyl-D- Q2RVT9 Rru_A0955 0,0005600 18 1,86 glutamate--2,6-diaminopimelate ligase Q2RVS2 Rru_A0972 0,0139400 16 0,57 Prephenate dehydrogenase Q2RVS1 Rru_A0973 0,0006700 13 0,56 Uncharacterized protein Q2RVS0 Rru_A0974 0,0007100 52 0,49 Linocin_M18 bacteriocin protein Q2RVJ7 Rru_A1047 0,0002800 48 1,91 6-ph phofructokinase Q2RVI7 Rru_A1057 0,0075800 18 0,50 3-hydroxybutyrate dehydrogenase Q2RVI6 Rru_A1058 0,0292600 1 0,55 Putative thioesterase Q2RVH1 Rru_A1073 0,0358600 6 1,86 OmpA/MotB MotA/TolQ/ExbB proton channel family Q2RVH0 Rru_A1074 0,0040500 7 1,81 protein Q2RVF9 Rru_A1085 0,0138100 8 0,65 Metalloph phoesterase Q2RVF3 Rru_A1091 0,0005000 4 2,59 MotA/TolQ/ExbB proton channel Q2RVF2 Rru_A1092 0,0022700 7 1,84 Biopolymer transport protein ExbD/TolR Q2RVE4 Rru_A1100 0,0043600 8 0,68 Ph phogluc amine mutase

140

Q2RVA8 Rru_A1136 0,0122900 36 0,57 Periplasmic binding protein Q2RV95 Rru_A1149 0,0480200 17 0,66 Uncharacterized protein Q2RV84 Rru_A1160 0,0002200 8 0,44 Chemotaxis sensory transducer Q2RV70 Rru_A1174 0,0211000 2 1,78 Endoribonuclease L-PSP Q2RV69 Rru_A1175 0,0383600 9 0,58 CsbD-like Q2RV63 Rru_A1181 0,0001700 22 0,63 Signal recognition particle receptor FtsY Q2RV56 Rru_A1188 0,0004000 16 0,67 50S rib omal protein L19 Q2RV27 Rru_A1217 0,0039700 6 2,15 Phage shock B Q2RV26 Rru_A1218 0,0048200 40 2,12 Phage shock protein A, PspA Q2RV02 Rru_A1242 0,0018600 9 0,59 50S rib omal protein L21 Trimethylamine-N-oxide reductase Q2RUV7 Rru_A1287 0,0000014 22 5,19 (Cytochrome c) Q2RUT6 Rru_A1308 0,0197700 53 0,56 Acyl-CoA dehydrogenase Q2RUT5 Rru_A1309 0,0145300 56 0,65 3-hydroxyacyl-CoA dehydrogenase Q2RUT4 Rru_A1310 0,0056800 28 0,58 Acetyl-CoA C-acyltransferase Membrane protein involved in aromatic Q2RUT1 Rru_A1313 0,0236500 46 0,53 hydrocarbon degradation Q2RUT0 Rru_A1314 0,0149500 15 0,65 Uncharacterized protein Q2RUR0 Rru_A1334 0,0201700 2 2,18 Rib e-5-ph phate isomerase Periplasmic binding protein/LacI Q2RUQ8 Rru_A1336 0,0016100 20 1,77 transcriptional regulator Q2RUP3 Rru_A1351 0,0000603 2,58 Membrane protein, putative Q2RUP1 Rru_A1353 0,0037500 12 0,34 Uncharacterized protein Q2RUE8 Rru_A1446 0,0223400 18 0,44 Uncharacterized protein Butyryl-CoA:acetoacetate CoA- Q2RUC2 Rru_A1472 0,0001300 5 2,42 transferase alpha subunit Q2RUC0 Rru_A1474 0,0004700 14 1,72 Uncharacterized protein Q2RUA7 Rru_A1487 0,0188700 4 2,05 Polysaccharide export protein Q2RU07 Rru_A1588 0,0000046 13 0,65 Uridylate kinase 1-deoxy-D-xylul e 5-ph phate Q2RU03 Rru_A1592 0,0152400 6 1,71 reductoisomerase Nitrogen metabolism transcriptional Q2RTR7 Rru_A1678 0,0000009 13 0,42 regulator, NtrC, Fis family Q2RTR0 Rru_A1685 0,0387100 13 0,55 GTPase HflX Q2RTK0 Rru_A1745 0,0193800 11 0,69 Single-stranded DNA-binding protein Deoxyguan inetriph phate triph Q2RTG5 Rru_A1780 0,0000003 7 9,25 phohydrolase-like protein Q2RTE8 Rru_A1797 0,0423500 4 2,67 Uncharacterized protein Q2RTD9 Rru_A1806 0,0012700 5 2,49 MotA/TolQ/ExbB proton channel Q2RTB7 Rru_A1828 0,0033100 16 0,67 Rib e-5-ph phate isomerase

141

Q2RTA2 Rru_A1843 0,0430700 7 1,94 OmpA/MotB DNA-directed RNA polymerase subunit Q2RT88 Rru_A1857 0,0401200 11 0,68 omega Q2RT38 Rru_A1907 0,0028900 7 0,61 Protein-methionine-S-oxide reductase Q2RT32 Rru_A1913 0,0000468 8 1,94 Uncharacterized protein Q2RT31 Rru_A1914 0,0249100 12 0,69 Cold-shock DNA-binding protein family Q2RT30 Rru_A1915 0,0391400 3 0,56 DEAD/DEAH box helicase Q2RT14 Rru_A1931 0,0017000 7 0,69 Ferredoxin--nitrite reductase Q2RSR5 Rru_A2030 0,0387500 10 0,64 Uncharacterized protein Extracellular solute-binding protein, Q2RSP8 Rru_A2047 0,0007300 28 1,99 family 1 Q2RSN4 Rru_A2061 0,0496400 95 0,67 Uncharacterized protein Q2RSL1 Rru_A2084 0,0220700 6 1,93 Aminotransferase Extracellular solute-binding protein, Q2RSK8 Rru_A2087 0,0003000 26 0,58 family 3 Two component, sigma54 specific, Q2RSJ4 Rru_A2101 0,0000926 5 1,82 transcriptional regulator, Fis family Q2RSI4 Rru_A2111 0,0001600 54 0,46 Uncharacterized protein Q2RSI3 Rru_A2112 0,0016600 6 2,12 Uncharacterized protein Q2RSE3 Rru_A2152 0,0006200 15 0,53 50S rib omal protein L13 Extracellular solute-binding protein, Q2RSB7 Rru_A2178 0,0005200 8 1,82 family 5 Ph phoglycerate/bisph phoglycerate Q2RS85 Rru_A2210 0,0000468 19 0,69 mutase Q2RS51 Rru_A2244 0,0001500 42 1,70 Alpha-1,4 glucan ph phorylase Extracellular solute-binding protein, Q2RS44 Rru_A2251 0,0001700 70 1,86 family 3 Q2RS37 Rru_A2258 0,0534900 17 0,69 Uncharacterized protein Q2RS31 Rru_A2264 0,0045700 6 0,31 Ferredoxin Electron transfer flavoprotein-ubiquinone Q2RS30 Rru_A2265 0,0001800 37 0,33 oxidoreductase Q2RS29 Rru_A2266 0,0008400 25 0,40 Electron transfer flavoprotein Electron transfer flavoprotein beta- Q2RS28 Rru_A2267 0,0047800 42 0,45 subunit Q2RRY6 Rru_A2309 0,0001700 28 0,50 NADH peroxidase Q53046 Rru_A2398 0,0000062 54 0,22 Pyruvate-flavodoxin oxidoreductase Q2RRP3 Rru_A2402 0,0175700 18 0,68 Ribul e-ph phate 3-epimerase Q2RRP1 Rru_A2404 0,0027900 34 0,69 Ph phoribulokinase Q2RRP0 Rru_A2405 0,0269400 63 0,58 Transketolase Q2RRM8 Rru_A2417 0,0066100 34 0,69 Lipoprotein YaeC

142

Q2RRM5 Rru_A2420 0,0037800 2 2,06 Transferase hexapeptide repeat Q2RRH3 Rru_A2472 0,0063800 9 2,06 Uncharacterized protein Glycine betaine/L-proline transport ATP- Q2RRH0 Rru_A2475 0,0028500 19 0,53 binding subunit Binding-protein-dependent transport Q2RRG9 Rru_A2476 0,0533700 1 0,55 systems inner membrane component Substrate-binding region of ABC-type Q2RRG8 Rru_A2477 0,0008200 113 0,70 glycine betaine transport system Q2RRB9 Rru_A2526 0,0066600 5 0,48 Uncharacterized protein Q2RRB3 Rru_A2532 0,0513200 3 0,48 flagellar hook protein FlgE Q2RRB1 Rru_A2534 0,0083600 91 0,21 Flagellin-like Methylase involved in Q2RR92 Rru_A2553 0,0063700 4 1,80 ubiquinone/menaquinone bi ynthesis-like Predicted periplasmic lipoprotein Q2RR50 Rru_A2598 0,0037700 19 2,14 involved in iron transport Q2RR49 Rru_A2599 0,0012400 18 2,45 Tat-translocated enzyme Extracellular endo alpha-1 4 polygalact aminidase or related polysaccharide Q2RQZ9 Rru_A2649 0,0026000 8 2,75 hydrolase-like Q2RQY6 Rru_A2662 0,0176000 10 0,63 Peptidase S1C, Do Q2RQY5 Rru_A2663 0,0004700 15 0,64 50S rib omal protein L17 DNA-directed RNA polymerase subunit Q2RQY4 Rru_A2664 0,0043500 33 0,70 alpha Q2RQY2 Rru_A2666 0,0147200 19 0,70 30S rib omal protein S13 Q2RQX9 Rru_A2669 0,0087300 20 0,67 50S rib omal protein L15 Q2RQX8 Rru_A2670 0,0024800 10 0,65 50S rib omal protein L30 Q2RQX7 Rru_A2671 0,0068400 20 0,67 30S rib omal protein S5 Q2RQX6 Rru_A2672 0,0006300 16 0,63 50S rib omal protein L18 Q2RQX5 Rru_A2673 0,0004700 27 0,69 50S rib omal protein L6 Q2RQX1 Rru_A2677 0,0001300 18 0,68 50S rib omal protein L24 Q2RQX0 Rru_A2678 0,0030800 14 0,66 50S rib omal protein L14 Q2RQW8 Rru_A2680 0,0209500 8 0,60 50S rib omal protein L29 Q2RQW6 Rru_A2682 0,0411600 34 0,69 30S rib omal protein S3 Q2RQW5 Rru_A2683 0,0001600 9 0,61 50S rib omal protein L22 Q2RQW3 Rru_A2685 0,0005000 35 0,68 50S rib omal protein L2 Q2RQW2 Rru_A2686 0,0131100 9 0,60 50S rib omal protein L23 Q2RQW1 Rru_A2687 0,0001900 24 0,64 50S rib omal protein L4 Q2RQW0 Rru_A2688 0,0003400 26 0,66 50S rib omal protein L3 DNA-directed RNA polymerase subunit Q2RQV4 Rru_A2694 0,0030300 113 0,68 beta'

143

Transcription termination/antitermination protein Q2RQU8 Rru_A2700 0,0001800 15 0,66 NusG Q2RQN8 Rru_A2760 0,0000841 9 2,25 Uncharacterized protein Q2RQL8 Rru_A2780 0,0000116 28 1,84 Uncharacterized protein Q2RQL7 Rru_A2781 0,0000005 17 2,62 UPF0261 protein Rru_A2781 Q2RQK1 Rru_A2797 0,0122500 46 1,70 Uncharacterized protein Cyclic pyranopterin monoph phate Q2RQI5 Rru_A2813 0,0241700 7 0,66 synthase accessory protein Q2RQI1 Rru_A2817 0,0016200 25 0,36 Phasin Q2RQH2 Rru_A2826 0,0015600 5 2,92 Flagellar basal body rod protein FlgB Q2RQH0 Rru_A2828 0,0004300 7 3,06 Uncharacterized protein Q2RQF9 Rru_A2839 0,0017100 6 2,90 Uncharacterized protein Q2RQF8 Rru_A2840 0,0010700 5 2,42 Flagellar motor switch protein FliM Flagellar basal body-associated protein Q2RQF7 Rru_A2841 0,0016400 14 3,29 FliL Q2RQB6 Rru_A2882 0,0004900 27 0,59 RNA polymerase sigma factor RpoD Q2RQ76 Rru_A2922 0,0164200 4 1,85 Uncharacterized protein Q2RQ17 Rru_A2983 0,0390200 4 1,89 Farnesyl-diph phate synthase Q2RQ06 Rru_A2994 0,0024600 4 1,76 Uncharacterized protein Q2RPZ6 Rru_A3004 0,0000051 21 2,55 Aminotransferase, class I and II Q2RPY2 Rru_A3018 0,0474000 2 0,53 Uncharacterized protein Probable glycine dehydrogenase Q2RPV1 Rru_A3049 0,0000487 11 1,80 (decarboxylating) subunit 1 Q2RPT9 Rru_A3061 0,0003100 4 0,61 Uncharacterized protein Q2RPT7 Rru_A3063 0,0021000 38 0,55 Crotonyl-CoA reductase Q2RPT6 Rru_A3064 0,0003600 55 0,60 Isovaleryl-CoA dehydrogenase Q2RPT3 Rru_A3067 0,0388400 2 0,28 Transcriptional regulator, TetR family Q2RPS4 Rru_A3076 0,0000194 16 0,32 ATP:cob(I)alamin aden yltransferase Electron transfer flavoprotein beta- Q2RPS3 Rru_A3077 0,0049000 53 0,43 subunit Q2RPS2 Rru_A3078 0,0000013 45 0,35 Electron transfer flavoprotein Q2RPS1 Rru_A3079 0,0010300 32 0,45 3-hydroxyacyl-CoA dehydrogenase Q2RPR7 Rru_A3083 0,0000003 15 0,34 NADPH-dependent FMN reductase Q2RPR6 Rru_A3084 0,0446700 23 0,58 GTPase Der Q2RPR5 Rru_A3085 0,0019200 16 0,57 Pyrrolo-quinoline quinone Q2RPQ5 Rru_A3095 0,0387900 2 0,25 Uncharacterized protein Q2RPK4 Rru_A3146 0,0160000 4 0,68 Uncharacterized protein Aspartyl/glutamyl-tRNA(Asn/Gln) Q2RPH5 Rru_A3175 0,0195000 71 0,70 amidotransferase subunit B

144

Glutamyl-tRNA(Gln) amidotransferase Q2RPH4 Rru_A3176 0,0094300 59 0,67 subunit A Q2RPE5 Rru_A3205 0,0030600 4 0,63 50S rib omal protein L33 Q2RP97 Rru_A3253 0,0094600 9 1,77 MJ0042 finger-like region Q2RP75 Rru_A3275 0,0385700 4 0,47 33 kDa chaperonin Q2RP74 Rru_A3276 0,0363600 13 0,68 Ornithine carbamoyltransferase Q2RP73 Rru_A3277 0,0005500 21 0,65 Acetylornithine aminotransferase Q2RP66 Rru_A3284 0,0042500 11 0,64 Secretion chaperone CsaA Response regulator receiver domain Q2RP65 Rru_A3285 0,0060200 41 0,54 protein (CheY) Q2RP47 Rru_A3303 0,0224600 5 0,53 Amide-urea binding protein Q2RNU2 Rru_A3409 0,0050500 4 1,70 Uncharacterized protein Q2RNT4 Rru_A3417 0,0023000 6 2,16 Extracellular ligand-binding receptor Q2RNT0 Rru_A3421 0,0000015 17 1,97 Uncharacterized protein Q2RNR0 Rru_A3441 0,0448200 10 1,76 Transcriptional regulator, PadR family Q2RNP9 Rru_A3452 0,0010100 47 2,41 TonB-dependent receptor Q2RNP5 Rru_A3456 0,0091700 18 2,17 Uncharacterized protein Q2RNN5 Rru_A3466 0,0330400 9 1,70 Ornithine aminotransferase Q2RNN2 Rru_A3469 0,0221100 11 0,55 Uncharacterized protein Q2RNI9 Rru_A3512 0,0007200 6 0,56 Glutamine amidotransferase class-I Q2RNI0 Rru_A3521 0,0003200 5 0,68 50S rib omal protein L35 Q2RNH9 Rru_A3522 0,0003600 13 0,57 50S rib omal protein L20 Q2RND8 Rru_A3563 0,0000020 10 5,28 Chemotaxis sensory transducer Twin-arginine translocation pathway Q2RN71 Rru_A3630 0,0059100 2 0,26 signal Q2RN39 Rru_A3662 0,0458700 4 1,82 Uncharacterized protein Q2RN33 Rru_A3668 0,0355700 7 2,21 Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase Protein translocase subunit secD / Q2RN30 Rru_A3671 0,0193800 36 1,76 protein translocase subunit secF Q2RN21 Rru_A3680 0,0007900 2 1,94 Integral membrane protein TerC 2-octaprenyl-3-methyl-6-methoxy-1,4- benzoquinol hydroxylase / 2-octaprenyl- Q2RMZ4 Rru_A3707 0,0000099 21 0,59 6-methoxyphenol hydroxylase Q2RMX6 Rru_A3725 0,0000192 7 2,38 ABC transporter component Q2RMX3 Rru_A3728 0,0000259 75 2,78 Extracellular ligand-binding receptor Q2RMX2 Rru_A3729 0,0002900 26 3,24 Creatininase Q2RMX1 Rru_A3730 0,0123700 8 1,91 Asparaginase Q2RMV2 Rru_A3749 0,0155100 5 1,83 Uncharacterized protein Q2RMU9 Rru_A3752 0,0014600 4 0,24 Uncharacterized protein Q2RMT1 Rru_A3770 0,0396400 1 1,93 tRNA-2-methylthio-N(6)-

145

dimethylallyladen ine synthase Q2RMS3 Rru_A3778 0,0001300 9 0,59 Rib ome maturation factor RimP Q2RMS1 Rru_A3780 0,0002100 4 0,58 LSU rib omal protein L7AE Q2RML9 Rru_B0030 0,0000354 29 2,70 Hemolysin-type calcium-binding region

Pep: number of identified peptides

2. List of genes differentially expressed at the Transcriptomic level

Gene Fold p-value Gene product number change Rru_A0002 0.0013 0.38 DNA polymerase III subunit beta Rru_A0006 0.0027 0.47 plasmid maintenance system antidote protein Rru_A0009 0.0009 0.40 PTS IIA-like nitrogen-regulatory protein PtsN Rru_A0015 0.0036 0.39 3\'-5\' exonuclease Rru_A0055 0.0427 0.37 VacJ-like lipoprotein Rru_A0060 0.0171 0.50 radical SAM family protein Rru_A0071 0.0212 0.40 hypothetical protein Rru_A0078 0.0200 0.37 hypothetical protein Rru_A0160 0.0005 0.24 conserved hypothetical protein (usg-like) Rru_A0161 0.0002 0.13 chaperonin Cpn10 Rru_A0162 0.0012 0.45 60 kDa chaperonin 1 Rru_A0166 0.0045 2.25 hypothetical protein Rru_A0176 0.0375 2.42 acetylornithine aminotransferase Rru_A0182 0.0008 0.31 hypothetical protein Rru_A0188 0.0063 0.36 ABC transporter transmembrane region Rru_A0189 0.0013 0.37 ABC transporter transmembrane region Rru_A0190 0.0011 0.16 TonB-dependent receptor Rru_A0192 0.0007 0.35 multi anti extrusion protein MatE Rru_A0194 0.0003 0.28 hypothetical protein Rru_A0195 0.0076 0.46 hypothetical protein Rru_A0205 0.0042 0.50 heat shock protein DnaJ-like Rru_A0219 0.0017 0.39 hypothetical protein Rru_A0234 0.0085 0.46 hypothetical protein Rru_A0269 0.0025 0.30 putative outer membrane protein, OmpA/MotB Rru_A0274 0.0103 0.45 acetyl-CoA acetyltransferase Rru_A0291 0.0154 0.43 hypothetical protein Rru_A0334 0.0061 0.37 LysR family transcriptional regulator Rru_A0344 0.0023 0.39 CRISPR-associated Cse4 family protein Rru_A0363 0.0097 0.47 cytochrome b/b6-like

146

Rru_A0379 0.0013 0.35 flavodoxin FldA Rru_A0385 0.0006 0.29 gamma-glutamyltransferase 1 Rru_A0391 0.0082 0.50 hypothetical protein Rru_A0414 0.0113 0.42 30S ribosomal protein S6 Rru_A0418 0.0122 0.37 3-oxoacyl-(acyl carrier protein) synthase II Rru_A0422 0.0168 0.45 hypothetical protein (secreted; MufA3)) inner membrane protein produced as response to external Rru_A0423 0.0089 0.25 stimuli MufB membrane protein produced as response to external Rru_A0424 0.0119 0.13 stimuli MufM Rru_A0426 0.0122 0.49 hypothetical protein MufA1 Rru_A0434 0.0120 0.33 organic solvent tolerance protein OstA-like Rru_A0436 0.0059 0.46 conserved hypothetical protein (secreted) Rru_A0458 0.0111 0.49 hypothetical protein Rru_A0459 0.0241 0.44 hypothetical protein Rru_A0462 0.0001 0.10 aldehyde dehydrogenase Rru_A0477 0.0049 0.34 hypothetical protein Rru_A0480 0.0052 0.37 hypothetical protein Rru_A0483 0.0010 0.40 hypothetical protein binding-protein dependent transport system inner Rru_A0499 0.0086 0.31 membrane protein Rru_A0502 0.0119 0.40 hypothetical protein Rru_A0503 0.0011 0.37 lysyl-tRNA synthetase Rru_A0510 0.0029 0.36 hypothetical protein Rru_A0512 0.0003 0.12 hypothetical protein Rru_A0522 0.0023 0.41 response regulator receiver domain-containing protein Rru_A0531 0.0034 0.45 Putative DNA polymerase III Rru_A0546 0.0544 0.37 hypothetical protein Rru_A0547 0.0243 0.25 flagellar hook capping protein Rru_A0559 0.0019 0.44 alpha/beta hydrolase fold Rru_A0560 0.0111 0.36 cytochrome bd ubiquinol oxidase, subunit I Rru_A0565 0.0001 0.14 hypothetical protein Rru_A0592 0.0022 0.31 extracellular solute-binding protein Rru_A0596 0.0037 0.46 fructose-1,6-bisphosphate aldolase Rru_A0598 0.0109 0.42 phosphate ABC transporter periplasmic binding protein Rru_A0616 0.0116 0.43 photosynthetic complex assembly protein Rru_A0621 0.0020 0.42 magnesium chelatase subunit H Rru_A0625 0.0042 0.44 hypothetical protein Rru_A0663 0.0364 0.38 cold-shock DNA-binding protein family protein Rru_A0665 0.0022 0.34 response regulator receiver domain-containing protein

147

Rru_A0668 0.0103 2.50 cobalamin-5\'-phosphate synthase Rru_A0670 0.0036 2.35 adenosylcobinamide kinase Rru_A0701 0.0019 0.48 30S ribosomal protein S4 phosphoribosylaminoimidazole-succinocarboxamide Rru_A0711 0.0015 0.42 synthase Rru_A0722 0.0011 0.44 RNA polymerase sigma factor RpoE Rru_A0727 0.0006 0.21 hypothetical protein Rru_A0753 0.0142 0.49 chaperone clpB Rru_A0760 0.0014 0.43 hypothetical protein Rru_A0761 0.0024 0.48 radical SAM family protein Rru_A0770 0.0022 0.34 peptidase M23B Rru_A0792 0.0010 0.27 serine O-acetyltransferase Rru_A0809 0.0048 0.47 hypothetical protein Rru_A0810 0.0027 0.37 hypothetical protein Rru_A0837 0.0024 0.41 leucine-rich repeat-containing protein Rru_A0873 0.0070 0.34 hypothetical protein Rru_A0891 0.0036 0.33 tellurite resistance TerB Rru_A0892 0.0016 0.39 tellurite resistance TerA (Benny) Rru_A0893 0.0023 0.29 tellurium resistance protein TerZ Rru_A0894 0.0011 0.19 tellurium resistance protein TerE UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine Rru_A0943 0.0059 0.38 deacetylase Rru_A0944 0.0073 0.46 cell division protein FtsZ Rru_A0973 0.0015 0.37 hypothetical protein Rru_A0974 0.0016 0.21 Linocin_M18 bacteriocin protein Rru_A0976 0.0205 2.27 transcriptional modulator of MazE/toxin, MazF Rru_A1004 0.0070 0.45 lysine-arginine-ornithine-binding periplasmic protein Rru_A1018 0.0016 0.25 extracellular solute-binding protein Rru_A1033 0.0001 0.05 hypothetical protein Rru_A1040 0.0021 0.39 leucine dehydrogenase Rru_A1048 0.0027 2.98 hypothetical protein Rru_A1058 0.0049 0.46 putative thioesterase Rru_A1094 0.0020 0.45 Protein tolB Rru_A1095 0.0070 0.44 OmpA/MotB Rru_A1098 0.0339 0.46 membrane protease FtsH catalytic subunit Rru_A1175 0.0001 0.12 general stress response protein, CsbD-like Rru_A1189 0.0027 0.34 3-isopropylmalate dehydratase large subunit Rru_A1202 0.0034 0.47 succinate dehydrogenase subunit C Rru_A1211 0.0082 0.50 Succinyl-CoA ligase [ADP-forming] subunit beta Rru_A1228 0.0001 0.07 putative ribonucleotide reductase

148

Rru_A1232 0.0049 0.45 C-terminal processing peptidase S41A Rru_A1262 0.0027 0.20 extracellular solute-binding protein Rru_A1265 0.0046 0.50 DeoR family transcriptional regulator Rru_A1285 0.0115 0.40 WD-40 repeat-containing protein Rru_A1286 0.0209 0.43 conserved hypothetical protein Rru_A1293 0.0443 0.32 methyl-accepting chemotaxis sensory transducer Rru_A1322 0.0443 0.32 subunit alpha of malonate decarboxylase Rru_A1327 0.0200 2.44 Phosphoribosyl-dehpospho-CoA Rru_A1328 0.0098 2.81 biotin/lipoyl attachment Rru_A1336 0.0022 2.49 periplasmic binding protein/LacI transcriptional regulator Rru_A1352 0.0001 0.06 conserved hypothetical protein Rru_A1353 0.0003 0.05 conserved hypothetical protein (outer membrane) Rru_A1354 0.0003 0.05 conserved hypothetical protein Rru_A1355 0.0001 0.03 conserved hypothetical protein Rru_A1356 0.0011 0.35 catalase Rru_A1371 0.0091 0.46 hypothetical protein Rru_A1379 0.0329 2.54 acetate kinase Rru_A1417 0.0009 0.30 thioredoxin-disulfide reductase alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Rru_A1418 0.0002 0.19 Mal allergen Rru_A1446 0.0003 0.03 hypothetical protein Rru_A1453 0.0022 0.34 phage tail Collar Rru_A1454 0.0008 0.25 phage tail Collar Rru_A1455 0.0003 0.12 phage tail Collar Rru_A1459 0.0034 2.01 major facilitator transporter Rru_A1479 0.0073 0.48 hypothetical protein Rru_A1495 0.0084 0.47 conserved hypothetical protein (membrane) Rru_A1501 0.0009 0.06 transport-associated protein (secreted) Rru_A1502 0.0053 0.19 conserved hypothetical protein (secreted) protein involved in the response to spaceflight and Rru_A1537 0.0071 0.15 simulated microgravity (RPM) conditions Rru_A1586 0.0017 0.30 30S ribosomal protein S2 Rru_A1587 0.0017 0.44 Elongation factor Ts Rru_A1603 0.0103 0.37 PhoH-like protein Rru_A1604 0.0001 0.08 Alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase Rru_A1605 0.0002 0.16 alpha amylase, catalytic region Rru_A1618 0.0118 2.78 conserved hypothetical protein Rru_A1665 0.0157 0.41 50S ribosomal protein L32 Rru_A1684 0.0006 0.31 Protein hfq Rru_A1692 0.0011 0.42 s-adenosylmethionine decarboxylase-like protein

149

Rru_A1731 0.0037 3.76 hypothetical protein Rru_A1746 0.0037 0.31 extracellular ligand-binding receptor Rru_A1747 0.0008 0.20 conserved hypothetical protein (membrane) Rru_A1748 0.0048 0.38 ABC transporter protein Rru_A1750 0.0059 0.50 inner-membrane translocator Rru_A1751 0.0013 0.31 inner-membrane translocator Rru_A1755 0.0030 0.49 hypothetical protein Rru_A1760 0.0006 0.30 superoxide dismutase Rru_A1778 0.0024 0.37 hypothetical protein Rru_A1782 0.0067 0.46 copper/Zinc superoxide dismutase Rru_A1817 0.0059 0.44 TPR repeat-containing protein Rru_A1818 0.0094 0.43 K(+)-insensitive pyrophosphate-energized proton pump Rru_A1857 0.0013 0.42 DNA-directed RNA polymerase subunit omega Rru_A1861 0.0090 0.41 hypothetical protein Rru_A1863 0.0025 0.41 glutathione peroxidase Rru_A1872 0.0031 2.63 TetR family transcriptional regulator Rru_A1908 0.0061 0.46 response regulator receiver modulated diguanylate cyclase Rru_A1942 0.0038 0.50 methylglutaconyl-CoA hydratase Rru_A1988 0.0005 0.31 GCN5-related N-acetyltransferase Rru_A1991 0.0047 0.46 conserved hypothetical protein (membrane) Rru_A2001 0.0001 0.10 outer membrane protein Rru_A2061 0.0001 0.03 hypothetical protein Rru_A2062 0.0076 0.47 hypothetical protein Rru_A2086 0.0046 0.26 L-glutamine synthetase Rru_A2087 0.0023 0.50 extracellular solute-binding protein Rru_A2091 0.0024 0.13 hypothetical protein Rru_A2092 0.0042 0.22 hypothetical protein Rru_A2102 0.0060 0.41 hypothetical protein Rru_A2110 0.0050 0.34 ATP-dependent Clp protease adaptor protein ClpS Rru_A2111 0.0030 0.12 hypothetical protein Rru_A2117 0.0019 0.47 UDP-glucose pyrophosphorylase Rru_A2130 0.0016 2.14 lysine exporter protein LysE/YggA Rru_A2152 0.0056 0.35 50S ribosomal protein L13 Rru_A2183 0.0035 0.43 NAD(P) transhydrogenase subunit alpha part 1 Rru_A2187 0.0066 0.42 serine/threonine protein kinase Rru_A2192 0.0023 0.38 peptidase M3B, oligoendopeptidase-related clade 3 Rru_A2195 0.0011 0.41 bacterioferritin Rru_A2202 0.0011 0.40 Protein hflC, cofactor of ATP-dependent protease FtsH Rru_A2208 0.0001 0.07 arylsulfate sulfotransferase-like protein Rru_A2216 0.0015 2.94 hypothetical protein

150

Rru_A2232 0.0083 0.47 two component LuxR family transcriptional regulator Rru_A2246 0.0054 0.36 Glucose-1-phosphate adenylyltransferase Rru_A2247 0.0008 0.35 hypothetical protein Rru_A2258 0.0002 0.17 hypothetical protein Rru_A2259 0.0048 0.49 conserved hypothetical protein Rru_A2260 0.0011 0.13 conserved hypothetical protein Rru_A2261 0.0009 0.28 hypothetical protein (secreted) Rru_A2265 0.0006 0.24 electron transfer flavoprotein-ubiquinone oxidoreductase Rru_A2266 0.0024 0.27 electron transfer flavoprotein Rru_A2295 0.0013 0.45 malto-oligosyltrehalose trehalohydrolase Rru_A2386 0.0019 0.20 hypothetical protein Rru_A2413 0.0002 0.24 Poly(R)-hydroxyalkanoic acid synthase, class I Rru_A2417 0.0138 0.47 lipoprotein YaeC Rru_A2429 0.0098 0.48 plasmid maintenance system killer Rru_A2450 0.0007 0.19 peptidase M48, Ste24p Rru_A2461 0.0024 0.27 hypothetical protein binding-protein dependent transport system inner Rru_A2476 0.0012 0.34 membrane protein Rru_A2477 0.0012 0.25 glycine betaine transporter periplasmic subunit Rru_A2481 0.0020 0.47 hypothetical protein Rru_A2485 0.0046 0.46 alpha,alpha-trehalose-phosphate synthase (UDP-forming) Rru_A2508 0.0063 0.31 5-aminolevulinate synthase Rru_A2509 0.0019 0.26 fructose-bisphosphate aldolase Rru_A2519 0.0025 0.31 hypothetical protein Rru_A2528 0.0119 0.29 flagellar hook-associated protein FlgL Rru_A2529 0.0110 0.29 hypothetical protein Rru_A2531 0.0358 0.38 hypothetical protein Rru_A2532 0.0136 0.14 flagellar hook protein FlgE Rru_A2533 0.0110 0.11 flagellar hook capping protein flagellar hook-associated protein 2 (FliD, filament cap Rru_A2535 0.0067 0.23 protein) Rru_A2536 0.0085 0.37 hypothetical protein Rru_A2542 0.0002 0.16 circadian clock protein KaiC Rru_A2543 0.0003 0.21 KaiB Rru_A2570 0.0017 0.49 cysteine desulfurase Rru_A2572 0.0034 0.44 FeS assembly ATPase SufC Rru_A2574 0.0016 0.42 BadM/Rrf2 family transcriptional regulator 1,4-alpha-glucan-branching enzyme (Glycogen-branching Rru_A2576 0.0004 0.15 enzyme) (BE) (1,4-alpha-D-glucan:1,4-alpha-D-glucan 6- glucosyl- transferase)

151

Rru_A2578 0.0025 0.49 hypothetical protein Rru_A2638 0.0114 0.35 hypothetical protein Rru_A2641 0.0020 0.39 hypothetical protein Rru_A2664 0.0046 0.27 DNA-directed RNA polymerase subunit alpha Rru_A2665 0.0037 0.33 30S ribosomal protein S11 Rru_A2666 0.0013 0.26 30S ribosomal protein S13 Rru_A2667 0.0015 0.49 adenylate kinase Rru_A2668 0.0062 0.42 preprotein translocase subunit SecY Rru_A2671 0.0019 0.50 30S ribosomal protein S5 Rru_A2675 0.0047 0.48 30S ribosomal protein S14 Rru_A2676 0.0009 0.39 50S ribosomal protein L5 Rru_A2678 0.0013 0.40 50S ribosomal protein L14 Rru_A2679 0.0054 0.40 30S ribosomal protein S17 Rru_A2680 0.0129 0.50 50S ribosomal protein L29 Rru_A2683 0.0073 0.46 50S ribosomal protein L22 Rru_A2684 0.0141 0.38 30S ribosomal protein S19 Rru_A2685 0.0180 0.49 50S ribosomal protein L2 Rru_A2686 0.0119 0.32 50S ribosomal protein L23 Rru_A2694 0.0028 0.36 DNA-directed RNA polymerase subunit beta\' Rru_A2696 0.0011 0.35 50S ribosomal protein L7/L12 Rru_A2697 0.0046 0.48 50S ribosomal protein L10 Rru_A2700 0.0011 0.45 transcription antitermination protein NusG Rru_A2714 0.0032 0.49 conserved hypothetical protein Rru_A2730 0.0066 0.47 conserved hypothetical protein Rru_A2781 0.0069 2.29 hypothetical protein Rru_A2790 0.0103 0.36 MarR family transcriptional regulator Rru_A2832 0.0025 0.33 hypothetical protein Rru_A2842 0.0229 0.35 hypothetical protein Rru_A2850 0.0198 0.23 chemotactic signal-response protein CheL Rru_A2851 0.0362 0.38 hypothetical protein Rru_A2852 0.0259 0.28 hypothetical protein Rru_A2853 0.0300 0.25 hypothetical protein Rru_A2857 0.0065 0.37 flagellar FlbT Rru_A2868 0.0039 0.49 diguanylate cyclase Rru_A2885 0.0229 0.47 carbamoyl-phosphate synthase small subunit Rru_A2888 0.0146 0.43 hypothetical protein Rru_A2913 0.0129 0.44 two component transcriptional regulator Rru_A2921 0.0207 0.50 TPR repeat-containing protein Rru_A2933 0.0062 4.06 hypothetical protein Rru_A2947 0.0016 0.36 Glucose-6-phosphate isomerase

152

Rru_A2955 0.0095 0.45 Glycine--tRNA ligase beta subunit Rru_A2974 0.0113 0.17 photosynthetic reaction center subunit M Rru_A2976 0.0502 0.29 antenna complex, alpha/beta subunit Rru_A2978 0.0015 0.32 chlorophyllide reductase subunit Z Rru_A2980 0.0013 0.25 chlorophyllide reductase iron protein subunit X Rru_A2993 0.0023 0.40 hypothetical protein Rru_A2994 0.0108 0.45 hypothetical protein Rru_A2995 0.0048 0.32 hypothetical protein Rru_A3000 0.0114 0.49 formate acetyltransferase Rru_A3019 0.0001 0.03 conserved hypothetical protein Rru_A3020 0.0027 0.40 hypothetical protein Rru_A3021 0.0013 0.43 hypothetical protein Rru_A3038 0.0004 0.25 conserved hypothetical protein Rru_A3039 0.0016 0.43 PAS/PAC sensor hybrid histidine kinase Rru_A3062 0.0031 0.44 methylmalonyl-CoA mutase Rru_A3063 0.0073 0.20 crotonyl-CoA reductase Rru_A3072 0.0003 0.26 MscS mechanosensitive ion channel Rru_A3077 0.0016 0.43 electron transfer flavoprotein subunit beta Rru_A3079 0.0095 0.50 3-hydroxybutyryl-CoA dehydrogenase Rru_A3118 0.0013 0.41 lipopolysaccharide biosynthesis Rru_A3147 0.0135 0.46 hypothetical protein Rru_A3171 0.0006 0.22 hypothetical protein (secreted) Rru_A3189 0.0025 0.24 hypothetical protein (secreted) Rru_A3226 0.0025 0.41 enoyl-(acyl carrier protein) reductase Rru_A3285 0.0003 0.14 two-component response regulator Rru_A3286 0.0003 0.05 putative regulatory (anti-sigma)protein Rru_A3287 0.0002 0.19 RNA polymerase sigma-E factor (Sigma-24) protein Rru_A3288 0.0009 0.39 Signal transduction histidine kinase Rru_A3303 0.0064 0.22 amide-urea binding protein Rru_A3328 0.0028 0.13 OmpA/MotB Rru_A3329 0.0066 0.50 Ribosomal RNA large subunit methyltransferase N Rru_A3333 0.0053 0.49 SAM-dependent methyltransferase Rru_A3369 0.0088 5.87 hypothetical protein Rru_A3390 0.0038 0.30 hypothetical protein Rru_A3396 0.0001 0.00 autoinducer synthesis protein Rru_A3397 0.0001 0.04 hypothetical protein Rru_A3429 0.0362 0.28 hypothetical protein Rru_A3449 0.0006 0.33 Hpr(Ser) kinase/phosphatase Rru_A3452 0.0014 0.42 TonB-dependent receptor Rru_A3462 0.0175 0.41 cold-shock DNA-binding protein family protein

153

Rru_A3463 0.0030 0.48 AsnC family transcriptional regulator Rru_A3464 0.0221 0.43 transcriptional regulator Rru_A3469 0.0001 0.08 hypothetical protein (secreted) Rru_A3534 0.0013 0.29 conserved hypothetical protein magnesium-protoporphyrin IX monomethyl ester Rru_A3548 0.0122 0.50 anaerobic oxidative cyclase Rru_A3554 0.0022 0.40 chaperone protein DnaJ Rru_A3555 0.0121 0.48 Chaperone protein DnaK Rru_A3558 0.0008 0.20 conserved hypothetical protein (membrane/transport) Rru_A3567 0.0099 0.48 uroporphyrinogen III synthase HEM4 Rru_A3573 0.0015 0.45 hypothetical protein Rru_A3575 0.0022 0.44 acetyl-coenzyme A synthetase Rru_A3579 0.0083 0.49 Protease HtpX homolog Rru_A3584 0.0016 0.50 CDP-diacylglycerol--serine O-phosphatidyltransferase Rru_A3585 0.0007 0.33 Phosphatidylserine decarboxylase proenzyme Rru_A3598 0.0048 0.48 XRE family transcriptional regulator Rru_A3608 0.0016 0.40 hypothetical protein Rru_A3622 0.0016 0.49 hypothetical protein Rru_A3636 0.0395 0.45 hypothetical protein Rru_A3667 0.0033 0.45 short-chain dehydrogenase/reductase sDR Rru_A3678 0.0103 0.29 TRAP dicarboxylate transporter subunit DctP Rru_A3680 0.0031 0.41 integral membrane protein TerC Rru_A3692 0.0143 2.02 UPF0102 protein Rru_A3692 Rru_A3715 0.0121 0.45 lipopolysaccharide biosynthesis Rru_A3737 0.0024 0.34 KAP P-loop Rru_A3752 0.0037 0.48 hypothetical protein Rru_A3776 0.0013 0.46 S-adenosylmethionine synthase 2 Rru_B0010 0.0084 0.31 resolvase Rru_B0011 0.0037 0.23 hypothetical protein Rru_B0012 0.0119 0.24 DNA polymerase, beta-like region Rru_B0013 0.0037 0.22 hypothetical protein Rru_B0029 0.0037 0.38 plasmid encoded RepA protein Rru_B0041 0.0352 0.45 XRE family transcriptional regulator

Genes in the results but with FC values out of the cut off (dowregulated FC>0.50; upregulated FC>2.0):

 Rru_A0615 (photosynthetic assembly protein) and Rru_A0627 (bacteriochlorophyll a synthase)3. Detection of AHL in WT

154

3. MS detection of AHL in WT cultivated under Mel-like conditions

4,87E+03

0,00E+00

9,94E+03

0,00E+00

7,92E+03

4,00E+03

1,44E+04

1,35E+04

0,00E+00

OH-C14-HSL

1,83E+04

7,01E+03

4,74E+04

2,49E+04

4,88E+04

2,29E+04

6,72E+04

5,05E+04

1,69E+04

2,98E+04

2,81E+04

OH-C12-HSL

6,82E+05

8,53E+05

2,91E+06

3,57E+06

2,89E+06

2,05E+06

3,71E+06

2,98E+06

2,59E+06

4,02E+06

4,11E+06

OH-C10-HSL

1,01E+06

2,84E+06

1,64E+07

2,81E+07

1,58E+07

1,56E+07

1,79E+07

1,62E+07

2,48E+07

2,94E+07

3,00E+07

OH-C8-HSL

4,25E+05

8,81E+05

1,68E+06

3,54E+06

1,22E+06

1,95E+06

2,12E+06

1,43E+06

2,60E+06

4,35E+06

3,66E+06

OH-C6-HSL

1,08E+03

0,00E+00

8,52E+02

0,00E+00

2,25E+03

1,16E+03

0,00E+00

OH-C4-HSL

0,00E+00

Oxo-C14-HSL

0,00E+00

Oxo-C12-HSL

0,00E+00

Oxo-C10-HSL

0,00E+00

4,96E+03

0,00E+00

1,38E+04

0,00E+00

9,10E+03

1,34E+04

1,90E+04

Oxo-C8-HSL

0,00E+00

Oxo-C6-HSL

0,00E+00

Oxo-C4-HSL

C14-HSL

3,34E+02

0,00E+00

1,21E+03

0,00E+00

1,60E+03

7,91E+02

1,27E+03

1,17E+03

0,00E+00

. OD: optical density optical OD: .

C12-HSL

6,13E+02

0,00E+00

1,51E+03

0,00E+00

2,13E+03

7,63E+02

1,28E+03

1,88E+03

0,00E+00

C10-HSL

1,89E+04

6,33E+04

5,89E+04

1,81E+05

8,32E+04

3,72E+04

5,92E+04

5,61E+04

1,24E+05

2,49E+05

1,69E+05

C8-HSL

2,24E+05

1,61E+06

1,22E+06

9,59E+06

1,48E+06

9,51E+05

1,30E+06

1,14E+06

7,83E+06

1,10E+07

9,93E+06

C6-HSL

4,19E+04

4,16E+05

2,71E+05

2,27E+06

3,21E+05

2,19E+05

2,76E+05

2,67E+05

1,81E+06

2,62E+06

2,38E+06

sd: standard sd: deviation

. .

C4-HSL

4,04E+02

0,00E+00

5,76E+03

0,00E+00

5,98E+03

5,16E+03

5,87E+03

6,03E+03

0,00E+00

av: average av:

WT4_OD3

WT3_OD3

WT2_OD3

WT1_OD3

WT3_OD2

WT2_OD2

WT1_OD2

sd_WT_OD3

sd_WT_OD2

av_WT_OD3 av_WT_OD2 Sample Name

155

4.MS detection of AHL in M68 cultivated under Mel-like conditions

0,00E+00

OH-C14-AHL

0,00E+00

OH-C12-AHL

0,00E+00

OH-C10-AHL

2,84E+03

9,23E+04

2,99E+03

1,07E+05

0,00E+00

9,85E+02

5,00E+03

2,08E+05

8,57E+04

2,71E+04

OH-C8-AHL

0,00E+00

OH-C6-AHL

0,00E+00

OH-C4-AHL

0,00E+00

Oxo-C14-AHL

0,00E+00

Oxo-C12-AHL

0,00E+00

Oxo-C10-AHL

0,00E+00

Oxo-C8-AHL

0,00E+00

Oxo-C6-AHL

0,00E+00

Oxo-C4-AHL

. OD: optical density optical OD: .

C14-AHL

0,00E+00

C12-AHL

0,00E+00

C10-AHL

0,00E+00

C8-AHL

0,00E+00

sd: standard sd: deviation

. .

C6-AHL

0,00E+00

C4-AHL

0,00E+00

av: average av:

M68_OD3

M68_OD2

sd_M68_OD3

sd_M68_OD2 av_M68_OD3 av_M68_OD2

156

5. Partial growth curve showing difference in lag-phase

N_WT=4; N_M68=3. Initial inoculum OD 0.33

N_WT=3; N_M68=4. Initial inoculum OD 0.25

157

Acknowledgments

Firstly, I would like to express my sincere gratitude to my mentor Dr. Felice Mastroleo for giving me the opportunity to perform my PhD. I am grateful for his patience, guidance and motivation during these 4 years, especially during the writing process. I would also thank my promoter Prof. Dr. Ruddy Wattiez for his continuous support, in particular during the last 2 years of my PhD. I also would like to thanks to Dr. Natalie Leys for her support, guidance and personal advices that helped me throughout these years. Without they precious support it would not be possible to conduct this research.

I would also like to thank to the thesis committee: Prof. Dr. Flammang, Prof. Dr. Robin Gosh, Prof. Dr. Delvigne and Dr. Leroy, for their insightful comments and suggestions that helped me to improve this thesis.

At SCK-CEN, my sincere thanks also goes to Dr. Rob Van Houdt, for his advices regarding mutant construction techniques and for being available to discuss about it when I needed advice. A especial thanks to Ilse Coninx, Ann Janssen and Dr. Pieter Monsieur for their help during the microarray sample preparation and analysis respectively. I would also express my gratitude to Dr. Hugo Moors, Dr. Katinka Wouters, Ann Provost, Dr. Paul Janssen, Patrick Boven that were very kind and helpful during all theses 4 years.

I thank my lab fellows at the Proteomic and microbiology lab in Mons: Quentin de Meur, Melanie Beraud and Frédéric Deschoenmaeker for all their help and nice company during my stay in Mons.

Honestly, I never thought that I would be involved in a project related to space research. However if I recall, in the city where I was born (Arequipa) I lived in a place named Field of Mars. Years later, my family and I moved to Lima (the capital of Peru) and we ended up living in front of a Park named Field of Mars (what a coincidence!). In

addition, while living in Lima I went to a school called “Pedro Paulet”. Pedro Paulet was a Peruvian scientist that was the first person to build a liquid-fuel rocket engine in 1895 and a modern rocket propulsion system in 1900. I consider this a nice coincidence… by the way Pedro Paulet was also born in Arequipa and lived in Antwerp for some time! Anyway I am really happy to have been involved in the MELiSSA project. I really hope that all the knowledge generated can be used in Space but also on Earth, as is the case for some technologies already applied in our beautiful planet.

These years have passed so fast! Especially in the lab where 8 hours days were never enough, even the working during the weekend was not enough! The time I spent in the lab was really pleasant because the radio was always ON! It was also pleasant to share the office with Joachim Vandecraen and Dr. Charlotte Rombouts. Thank you very much guys for your company and for taking me to the station in your car or even in your own bike! I also would like to thank Merel Van Walleghem and Rhagda Ramadan for the nice moments shared in the office. Thanks Bo Byloos for being so nice every time I needed your help, for instance when you helped me with my presentation for the COSPAR meeting. Bo, I wish that you continue winning lots and lots of travel grants!. I would also like to thank to Dr. Sarah Baatout, Björn Baselet, Ellina Macaeva with whom I enjoyed nice moments at SCK- CEN.

Another group of wonderful people I met are the “train community” from my daily journey Antwerp-SCK·CEN (Mol)-Antwerp. Borja Gonzalez and Virginia Gómez, I really enjoyed the time in the train with you guys. I will always remember our chats (even when Borja fall asleep sometimes in the middle of them), the mornings during the winter of 2012 when we froze at Mol station while we were waiting for the bus (sometimes it never arrived!). Good and funny memories that makes me smile when I remember them. I also had the opportunity to meet Vesna Middelkoop who many times surprised me knowing more about my country than myself. Thanks for the nice moments in the train and at your place dear Vesna.

I would like to thank one of my best friends, Monica Ticlla. Mamacha! thanks for everything! You know what everything means! Having you as a friend was really important for me. You and Federico became my family in Belgium. Thanks also to my very good

friends in Belgium Gonzalo Parra, Cynthia Vargas and Maria Pariona with whom I spent great funny crazy moments during my stay in Leuven.

Especial thanks to my family: A mi madre Natalia Catachura, quiero que sepas mami que sin tu ejemplo de perseverancia y esfuerzo jamás hubiera podido lograr mis objetivos. Cada vez que sentí que ya no podía más, cuando me he sentido muy mal, pensaba en ti, en que tú sí podrías y eso me daban ánimos para seguir adelante. Te quiero mucho mami. Gracias a mis hermana Alicia, quien en una época familiar muy difícil se convirtió en el pilar que sostuvo la familia. Sin ti hermanita tampoco hubiera podido lograr desarrollarme como profesional. Por eso te estaré agradecida toda la vida. Thanks to my little brother Oscar for believe always in me, now that you are studying English you can understand . Querida familia esta tesis se las dedico a ustedes! y a Kiara tambien! Los amo!

Finally, I would like to thank to my life partner and husband Christopher. I remember when we were 19 years old and we started together this journey, I never tough that it was going to last more than 3 months lol. I am grateful that we stayed together, that we grew up together. I am cheerful knowing that very soon we will have in our arms our little “recombinant”.

Curriculum vitae

Personal information

Name: Sandra Liz

Surname: Condori Catachura

Citizenship: Peruvian

Address: Britselei 3 bus 3. BE-2000.

Antwerp. Belgium

Tel: +32488155452

E-mail: [email protected]

Education

January 2016: Doctor in Sciences (SCK-CEN, Mol/ University of Mons, Mons, Belgium)

September 2011: Master in Molecular Biology (Interuniversity Program in Molecular Biology at Free University of Brussels, Catholic University of Leuven and the University of Antwerp, Belgium).

March 2009: Licentiate in Biology (Universidad Nacional Federico Villarreal, Lima-Peru)

January 2006: Bachelor in Biology (Universidad Nacional Federico Villarreal, Lima-Peru

Honors and Awards

2013 – 2015: PhD grant from UMons, Mons, Belgium

2011 – 2013: PhD grant from SCK-CEN, Mol, Belgium.

2009 – 2011: Full scholarship for 2-years Master in Molecular Biology IPMB given by VLIR-OUS (Vlaamse Interuniversitaire Raad)-Belgium.

Research experience

2008 - 2009: Molecular genotyping of Mycobacterium tuberculosis. Epidemiology Unit of Tuberculosis. Institute of Tropical Medicine Alexander von Humboldt. Lima, Peru.

2007 - 2008: Diagnostic of Mycobacterium tuberculosis using MODS (Microscopic Observation Drug Susceptibility) assay. Laboratory of Mycobacterium Tuberculosis. Laboratory of Research and Development. Peruvian University Cayetano Heredia. Lima, Peru.

2006 - 2007: Development of in vitro susceptibility and molecular diagnostic techniques of Leptospira spp. Laboratory of Zoonotic Bacteria. National Institute of Health of Peru. Lima, Peru.

Supervision of students/coaching

 Training on knockout mutant construction of R. rubrum. June 2013.  Laboratory training on molecular biology techniques during Bachelor thesis of De Greef Vitaline. Caractérisation génotypique et phénotypique des souches S1 et S1H de la bactérie Rhodospirillum rubrum dans le cadre du project MELiSSA. Haute Ecole Louvain en Hainaut, Fleurus, Belgium. February-May 2014.  Laboratory guidance during Bachelor thesis of Garufo Salvatore. Caractérisation des souches mutantes de Rhodospirillum rubrum auxquelles il manque des pigments photosynthétiques. Haute Ecole de la Ville de Liège, Liège, Belgium. February-May 2014.  Lab training teacher for the course on “Molecular Biology techniques applied to the diagnostic of infectious tropical diseases (PCR, q-PCR y Sequencing)”. Molecular Epidemiology Unit. Institute of Tropical Medicine Alexander von Humboldt (IMTAvH). Lima-Peru. February 2009.

Training

 Bibliographic research in Web of Knowledge, SciVerse (Science Direct) and End notes, SCK•CEN, Mol, Belgium 10/01/2012.  Scientific Writing and Speaking, SCK•CEN, Mol, Belgium 28/02, 06/03, 13/03, 21/10 and 27/03/2012.  Upgrade your Written English, SCK•CEN, Mol, Belgium 19/04, 03/05 and 04/05/2012.  Training on diagnostic techniques in Parasitology, immunology, molecular biology. Laboratory of Research and Development. Universidad Peruana Cayetano Heredia. September 2007.  Bacterial Vaginosis Training Course. Laboratory of Sexually transmitted diseases. Organized by University of Washington- Center for AIDS and STD and Peruvian University Cayetano Peruana. July 2006.  Training on basic molecular biology techniques. Laboratory of Molecular Biology. Faculty of Oceanography Fishery and Alimentary Sciences. National University FedericoVillarreal. December 2005.

Scientific production

Theses

 Condori, S. 2016. Unraveling the quorum sensing system of the photosynthetic bacterium Rhodospirillum rubrum S1H under light anaerobic conditions. Thesis to obtain the Degree of Doctor in Sciences. SCK-CEN / UMons. Belgium.  Condori, S. 2011. Putative lectins from Lactobacillus rhamnosus GG and their potential role for pathogen exclusion. Thesis to obtain the Degree of MSc. in Molecular Biology. VUB-KUL-UA. Belgium.  Condori, S. 2009. In vitro susceptibility of Leptospira spp. against ampicillin and ceftriaxone. Thesis to obtain the degree of Licentiate in Biology. Universidad Nacional Federico Villarreal. Lima, Peru.

Publications with peer review

 Condori Catachura S., Atkinson S., Leys N., Wattiez R., Mastroleo F., Construction and phenotypic characterization of M68, a RruI quorum- sensing knockout mutant of the photosynthetic alphaproteobacterium

Rhodospirillum rubrum. Accepted with minor revisions . Research in Microbiology.  Condori Catachura S., Leys N., Mastroleo F., Wattiez R. Transcriptomic and proteomic profiling of Rhodospirillum rubrum M68 cultivated in MELiSSA related culture conditions (in preparation)  Condori Catachura S., Leys N., Wattiez R., Mastroleo F., Biofilm formation in the alpha-proteobacterium Rhodospirillum rubrum under light anaerobic conditions. In preparation, BMC microbiology.

Participation in scientific events

Poster presentations

 Condori Catachura S., Mastroleo F., Leys N., Wattiez R. Characterization of the cell-to-cell communication system of the life support bacterium Rhodospirillum rubrum S1H. PhD day, Mol, Belgium, 26 October 2012.  Mastroleo F., Condori Catachura S., Coninx I., Wattiez R., Leys N. Flow cytometry analysis of MELiSSA life support organisms. XVIe congrès de l’Association Française de Cytométrie 2012. Toulouse, France, 14-16 November 2012.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. First insight into the cell-to-cell communication system of the life support bacterium Rhodospirillum rubrum S1H. Posttranscriptional regulation and epigenetics in microorganisms. Brussels, Belgium, 30 November 2012.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. First insight into the cell-to-cell communication system of the life support bacterium Rhodospirillum rubrum S1H. Conference of Bacterial Networks (bacnet13). European Science Foundation (ESF)-European Molecular Biology Organization (EMBO). Polonia Castle in Pultusk, Poland. March 16 - 21, 2013.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. Quorum sensing is needed for Rhodospirillum rubrum cell dispersion. Eurobiofilms. Gent, Belgium. September 9 – 12, 2013.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. Quorum sensing is needed for Rhodospirillum rubrum cell dispersion. Microbial

Diversity for Science and Industry. Belgian Society for Microbiology. Brussels, Belgium. November 26-27, 2013.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F., Acyl homoserine lactone-based quorum sensing and biofilm formation in the photosynthetic bacterium Rhodospirillum rubrum S1H. 6th Congress of European Microbiologist-FEMS 2015, Maastricht, Netherlands. 7-11 June 2015.

Oral presentations

 Mastroleo F., Condori Catachura S., Coninx I., Wattiez R., Leys N. Flow cytometry analysis of MELiSSA life support organisms. XVIe congrès de l’Association Française de Cytométrie 2012. Toulouse, France, 14-16 November 2012.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. Characterization of the cell-to-cell communication system of the life support bacterium Rhodospirillum rubrum S1H. PhD day, Mol, Belgium, 23 October 2013.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. Quorum sensing is needed for Rhodospirillum rubrum cell dispersion. 1st meeting of the Belgian Interdisciplinary Biofilm Research Group, Louvain-la- Neuve, Belgium, 20 December 2013.  Condori Catachura S., Leys N., Byloos B, Wattiez R., Mastroleo F. The influence of Quorum sensing in compartment II of the MELiSSA loop. 40th COSPAR Scientific Assembly, Moscow, Russia, 2-10 August 2014.  Condori Catachura S., Leys N., Wattiez R., Mastroleo F. The cell-to-cell communication system of the photosynthetic bacterium Rhodospirillum rubrum S1H. PhD day, Mol, Belgium, 29 October 2015.

As organizer

 Update Course on Laboratory Process of Brucellosis. Laboratory of Zoonotic Bacteria. National Institute of Health of Peru. Lima-Peru, August 2007.  VI National Congress of Students of Biology. Organized by National University Federico Villarreal. Professional School of Biologists of Peru. Lima-Peru, October 2005.

 Workshop Course (Pre-Congress) “Molecular Research and Diagnostics of Anthrax”. Organized by the Professional School of Biologists of Peru. Lima-Peru, August 2005  Activities for “The Earth Day” Organized by Faculty of Natural Science and Math. National University Federico Villarreal. Lima-Peru, April 2002.

Languages

 Spanish: Mother tongue  English: Fluently spoken, read and written.  French: Basic knowledge.  Dutch: Basic knowledge