EMILIN-1 Regulates the Amount of Oxytalan Fiber Formation In

EMILIN-1GCTS regulates the amount of oxytalan fiber formation in periodontal ligaments in vitro

YukaEMILIN-1 regulates oxytalan fibers Nakatomi,1 Eichi Tsuruga,2 Kazuki Nakashima,1 Yoshihiko Sawa,2 Hiroyuki Ishikawa1

1Section of Orthodontics, Department of Oral Growth and Development, Division of Clinical Dentistry, Fukuoka Dental College, Fukuoka, Japan, 2Section of Functional Structure, Department of Morphological Biology, Division of Biomedical Sciences, Fukuoka Dental College, Fukuoka, Japan

Abstract The elastic system fibers comprise oxytalan, elaunin, and elastic fibers, differing in their relative microfibril and elastin contents. Among them, human periodontal ligament (PDL) contains only oxytalan fibers (pure microfibrils). Elastin microfibril interface-located protein-1 (EMILIN-1) is localized at the interface between microfibrils and elastin. We hypothesized that EMILIN-1 may contribute to the formation of oxytalan fibers. We used a small interfering RNA (siRNA) for EMILIN-1 in PDL cell culture to examine the extracellular deposition of fibrillin-1 (the major component of microfibrils). EMILIN-1 was labeled on microfibrils positive for fibrillin-1 and was colocalized with fibrillin-1 upon immunoprecipitation assay. EMILIN-1 suppression reduced the level of fibrillin-1 deposition to 23% of the control, and this was responsible for the diminution of fibrillin-1 deposition revealed by immunofluorescence. These results suggest that EMILIN-1 may regulate the formation of oxytalan fibers and play a role in their homeostasis.

Keywords: EMILIN, fibrillin, microfibrils, oxytalan fiber, periodontal ligament

INTRODUCTION PDL fibroblast culture, we clearly showed that pure oxytalan fibers are formed in cell/matrix layers. Elastic system fibers are an integral part of the extra- However, the precise mechanism of oxytalan fiber cellular matrix, which gives flexibility and extensibility For personal use only. development remains unclear. to tissues such as blood vessels, lungs, skin, and periodon- Elastin microfibril interface-located proteins tal tissue [1]. These fibers consist of two distinct com- (EMILINs) are extracellular proteins characterized by ponents: an amorphous core of cross-linked elastin and a unique arrangement of structural domains, including a peripheral mantle of microfibrils [2]. They can be a cysteine-rich domain known as the EMI domain, at classified into three types depending on their relative the N-terminus, followed by a coiled-coil domain and a contents of these components. Elastic fibers contain a gClq-like domain [7]. So far, four family members have high proportion of elastin, whereas elaunin fibers been identified: EMILIN-1, EMILIN-2, EMILIN-3 contain very little elastin, and oxytalan fibers are bundles (multimerin-1), and EMILIN-4 (multimerin-2, of pure microfibrils [3]. Elastic fiber formation is endoglyx-1) [8–11]. Among them, the first protein of thought to begin with the formation of a scaffold of this family, EMILIN-1, initially named GP115, is microfibrils on which the elastin is deposited. Interest- present in a wide variety of connective tissues, particularly ingly, in the periodontal ligament (PDL), only oxytalan

Connect Tissue Res Downloaded from informahealthcare.com by University of Newcastle Upon Tyne on 12/22/14 elastic tissues such as lung and blood vessels [10,12]. fibers, which are pure microfibrils, can be identified, At the ultrastructural level, EMILIN-1 is located at the whereas all three types of fibers are present in the interface between the amorphous core of elastin and gingiva [4]. In the PDL, oxytalan fibers are thought to the surrounding microfibrils [13]. This is the reason have some functional roles, such as support of vascular why this protein was named EMILIN. EMILIN-1 can orientation and regulation of vascular flow [5]. In our interact with tropoelastin [14]. Moreover, experiments series of studies [6], we have demonstrated that human using genetically targeted mice have shown that EMILIN-1 PDL fibroblasts express fibrillin-1 and fibrillin-2 (the is necessary for the biogenesis of elastic fibers [14]. major components of oxytalan fibers) without expression Therefore, EMILIN-1 is thought to be an adaptor for of tropoelastin (the precursor of mature elastin). By

Correspondence: Eichi Tsuruga, Section of Functional Structure, Department of Morphological Biology, Division of Biomedical Sciences, Fukuoka Dental College, 2-15-1 Tamura, Sawara-ku, Fukuoka 814-0193, Japan. E-mail: [email protected] Received 20 April 2010; revised 17 June 2010; accepted 17 June 2010.

30 EMILIN-1 regulates oxytalan fibers 31

binding tropoelastin to microfibrils for the formation of (Invitrogen) were also run on each blot. Densitometric elastic fibers. analysis of the signals was performed using the Image On the contrary, the developmental expression of J program (National Institutes of Health, Bethesda, EMILIN-1 has not been investigated in elastin-free MD, USA) after finding the linear portion by sequen- tissues. An ultrastructural study of EMILIN-1 immuno- tial dilution of the proteins. Small variations in protein localization revealed that the molecule was clearly loading were corrected by normalization relative to the labeled in oxytalan fibers of the corneal stroma [13]. intensity of the corresponding band of β-actin. Each Moreover, based on the fact that EMILIN-1 can bind value presented is expressed as the mean ± standard with fibulin-5, which is expressed on oxytalan fibers in deviation (SD) and all quantitative results represent at our PDL culture model [15,16], we hypothesized that least three independent analyses. The unpaired EMILIN-1 might contribute to the formation of oxytalan Student’s t-test was used for analyzing the differences fibers in PDL. In the present study, we used a culture between experimental groups. model of pure microfibrils to investigate the role of EMILIN-1 in the development of oxytalan fibers and Immunoprecipitation found that EMILIN-1 colocalizes with oxytalan fibers The cell/matrix layer on day 7 was washed 3 times in and regulates their biogenesis. 1 ml of PBS and proteins were cross-linked with 2-mM 3, 3′-dithiobis(sulfosuccinimidylpropionate) (Pierce Biotechnology, Inc., Rockford, IL, USA) in PBS at MATERIALS AND METHODS 4°C for 30 min under gentle shaking. The cell/matrix Cells and culture layer was washed twice in 1 ml of PBS and taken up in The protocol for these experiments was reviewed and 1 ml of lysis buffer (50 mM Tris, 150 mM NaCl, approved by the Fukuoka Dental College Research 2 mM EDTA, 0.5% Triton X-100, pH 7.5) with a Ethics Committee, and informed consent was obtained proteinase inhibitor cocktail containing 5 mM ethyl- from the tissue donors. enediaminetetraacetic acid, 50 μM N-ethylmaleimide, PDL fibroblasts were isolated from three different and 50 μM phenylmethylsulfonyl fluoride. Centrifugation donors and cultured, as described previously [17]. was performed to remove all debris. Aliquots of the Briefly, connective tissues were obtained surgically cell/matrix extract were incubated with anti-human from the PDL of molar teeth extracted for orthodontic EMILIN-1 monoclonal antibody (Protein Tech Group reasons. After washing in phosphate-buffered saline Inc., Chicago, IL, USA) or control mouse IgG (PBS) supplemented with 100 U/ml penicillin and 100 (Sigma), or without IgG, in the presence of 2% bovine μg/ml streptomycin (Roche Diagnostics, Mannheim, serum albumin (BSA, fraction V; Sigma) for 2 hr at

For personal use only. Germany), PDL samples were cut into small pieces, 4°C under agitation. Protein G-agarose beads (Pierce plated in petri dishes, and incubated in Minimum Biotechnology), prewashed with PBS containing 2% Essential Medium (MEM) (Invitrogen, Grand Island, BSA, were then added to the sample–antibody mixture NY, USA) supplemented with 10% newborn calf and incubated for 1 hr at 4°C. Then the beads were serum (NCS; Invitrogen) at 37°C in humidified air collected by centrifugation and washed 5 times extensively containing 5% CO2. When outgrowth of the cells with lysis buffer, changing the tube for the last spin. reached confluence, they were harvested with 0.025% The immunoprecipitated protein retained by the trypsin (Invitrogen) in PBS and transferred to plastic washed beads was then eluted with gel electrophoresis culture dishes at a 1:4 split ratio. For experiments, the loading buffer (1% sodium dodecyl sulfate, 10 mM cells were trypsinized and seeded at 1 × 106 cells/ml per Tris, 5% glycerol, and 25% dithiothreitol, pH 7.0), and 35-mm culture dish (Corning Incorporated, Corning, subjected to 4–12% polyacrylamide gel electrophoresis NY, USA) in MEM supplemented with 10% NCS, for Western blotting using an antibody against human 100 U/ml penicillin, and 100 μg/ml streptomycin. PDL fibrillin-1, as described above. Connect Tissue Res Downloaded from informahealthcare.com by University of Newcastle Upon Tyne on 12/22/14 fibroblasts were used from the third to sixth passages in this study. siRNA design and transient transfection siRNA for human EMILIN-1 (accession # NM_ Western blot analysis 007046) was designed and synthesized by Sigma At 7 days of culture, cell/matrix samples were prepared Aldrich Corp. (Tokyo, Japan). The synthesized siRNA as described previously [6]. The proteins (5 μg) were corresponded to the 2199–2221 coding region of subjected to electrophoresis on 4–12% NuPAGE Bis- EMILIN-1. The siRNA sequence for fibulin-5 was Tris gel (Invitrogen) for Western blot analysis, as sense 5′-GUGAACGGUUGGACACUGUGG-3′, described previously [18]. The primary antibodies used antisense 3′-ACAGUGUCCAACCGUUCACAG-5. were those against human fibrillin-1 (Elastin Products Negative control (scrambled order) was sense 5′- Co., Owensville, MO, USA), human EMILIN-1 UCGGUAUGUCGAGUGCAAGTT-3′, antisense 3′- (Sigma, Saint Louis, MO, USA) and β-actin (Sigma) at CUUGCACUCGACAUACCGATT-5′. The sequence 1:5000 dilution. Prestained molecular-weight markers of the negative control was designed as a randomized

sequence of the 2199–2221 coding region of EMILIN- (polyclonal rabbit antibody against human fibrillin-1 1. BLAST searches of the database indicated that this diluted 1:1000; Elastin Products Co., Owensville, MO, siRNA is specific for EMILIN-1 and has no homology USA, goat antibody against human EMILIN-1 diluted with other proteins. Transfection was performed at 1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, days 1 and 4 of culture continuously. The siRNA was USA). Controls included the use of preimmune normal transfected into PDL fibroblasts using X-treme GENE goat or rabbit IgG for incubation with the primary siRNA was transfection reagent (Roche, Mannheim, antibody. After rinsing in PBS, the cells were incubated Germany). First, 237.5 μl of OptiMEM medium/dish with Alexa Fluor® 568-labeled donkey anti-goat IgG (Invitrogen, Grand Island, NY, USA) and 12.5 μl of antibody or Alexa Fluor®488-labeled donkey anti-rab- the transfection reagent were preincubated for 10 min bit IgG antibody (Molecular Probes, Eugene, OR, at room temperature. During this time, 748 μl of USA), diluted 1:1000 with blocking buffer, for 1 hr at OptiMEM medium was mixed with 2 μl of 100 μM room temperature. After the final washing, the cells siRNA. The two mixtures were then combined and were viewed using a confocal microscope (MRC-1024; incubated for 20 min at room temperature to allow Bio-Rad, Hemel Hempstead, UK), equipped with formation of their complex. The entire mixture was DAPI. added to the cells in one dish, resulting in a final concentration of 200 nM for the siRNAs. After 12 hr of RESULTS incubation, the transfection medium was replaced with fresh complete medium (MEM with 10% FCS). Mock EMILIN-1 localization on microfibrils transfection of cultures with the transfection reagent We first examined whether EMILIN-1 was localized on alone was used as a control. PDL fibroblasts were microfibrils (Figure 1A). Positive staining for fibrillin-1 transfected twice with the siRNA duplex (0, 100 nM), was observed on microfibrils, which appeared as networks with a 72-hr interval between, and harvested at 7 days. of fiber patterns. EMILIN-1 was labeled on a proportion of fibrillin-1-immunolabeled microfibrils of human Northern blot analysis PDL fibroblasts cultured for 7 days. Control immune Total RNA was prepared from the cultured PDL fibro- serum produced no labeling (not shown). These results blasts at 7 days using an RNeasy Mini Kit (Qiagen, indicated that EMILIN-1 was colocalized with fibrillin-1 Hilden, Germany). One microgram of RNA was on microfibrils. subjected to northern blot analysis, as described previously We then evaluated protein–protein interaction [17]. The probe for recognition of human fibrillin-1 between EMILIN-1 and fibrillin-1 by carrying out was generated as described previously [6]. To generate immunoprecipitation of EMILIN-1 in the presence of a

For personal use only. the probe for human EMILIN-1, a cDNA template reversible crosslinking agent and examining whether was obtained using the reverse-transcription poly- fibrillin-1 was coprecipitated by immunoblotting. As merase chain reaction (RT-PCR) and RNA extracted shown in Figure 1B, anti-EMILIN-1 clearly immuno- from PDL fibroblasts. The primer sequences, which precipitated its own antigen. Fibrillin-1 was coprecipi- include SP6 or T7 RNA polymerase promoters at the tated only with EMILIN-1, but not with the control 5′-end, used for PCR were (reading from 5′ to 3′): mouse IgG or protein G-agarose beads alone, indicating forward, CGTCTTCCACACCACGGCCC; reverse, that the immunoprecipitation was specific. CGCAGGCCTTGCAGCTCCTT. The PCR products were purified, and then SP6 RNA polymerase was Decrease of microfibril assembly by knockdown mixed with digoxigenin (DIG)-labeled nucleotides of EMILIN-1 expression (Roche Molecular Biochemicals, Mannheim, Germany) To investigate the function of EMILIN-1, we used to generate the DIG-labeled 169-bp RNA probes siRNA to suppress EMILIN-1 expression. We trans- (nucleotides 847–1015). The RNA probe for β-actin fected PDL fibroblasts with 100 nM EMILIN-1 Connect Tissue Res Downloaded from informahealthcare.com by University of Newcastle Upon Tyne on 12/22/14 was from Roche Molecular Biochemicals. Densitometric siRNA. Densitometric analysis based on the northern analysis of the signals was also performed using the blot showed that when 100 nM siRNA was used for Image J program. Small variations in RNA loading transfection, the siRNA effectively reduced the level of were corrected by normalization relative to the intensity EMILIN-1 gene expression to about 20% level of the of the corresponding band of the β-actin probe. control (vehicle only) in the PDL fibroblasts at 7 days (Figure 2A). Additionally, transfection with EMILIN-1 Immunofluorescence siRNA did not affect fibrillin-1 gene expression, as At 7 days of culture, PDL fibroblasts were fixed in ice-cold expected. Moreover, scrambled siRNA had no effect 4% paraformaldehyde for 15 min, followed by washing on EMILIN-1 expression, and no difference from the with PBS. Nonspecific immunoreactivity was blocked control was evident (data not shown), proving that this with 1% BSA in PBS for 1 hr at room temperature. siRNA was specific for EMILIN-1. The cell layers were then incubated for 2 hr at room In matrix proteins at 7 days, densitometric analysis temperature with the appropriate primary antibodies based on the Western blot shown identified a 77 ± 8%

Connective Tissue Research EMILIN-1 regulates oxytalan fibers 33

(A) Fibrillin-1 EMILIN-1 Merge

(B) 12 3

Fibrillin-1 350 kDa

EMILIN-1 120 kDa

Figure 1 Immunolocalization of EMILIN-1 to microfibrils. (A) Double immunofluorescence of fibrillin-1/EMILIN-1 in PDL fibroblast cultures. Human PDL fibroblasts were cultured for 7 days, then simultaneously labeled with fibrillin-1 (green, left panel), EMILIN-1 (red, middle panel), and superimposition of both labels (right panel). Nuclei are blue. Bar: 100 μm. (B) Immunoblotting against anti- fibrillin-1 (upper panel) and anti-EMILIN-1 (lower panel) antibodies following immunoprecipitation of PDL culture cell/matrix lysates using anti-EMILIN-1 antibody in the presence of a reversible cross-linking agent. Cell lysates were immunoprecipitated with anti-EMI- LIN-1 antibody conjugated with protein G-agarose beads. The immunoprecipitates were resolved by SDS-PAGE, and proteins coprecipitated with EMILIN-1 were analyzed by immunoblotting with anti-fibrillin-1 antibody. Lane 1, protein G-agarose beads alone; lane 2, control mouse IgG; lane 3, anti-EMILIN-1 antibody.

(A) 1 2 (B) 1 2

Fibrillin-1 9.7 kbp Fibrillin-1 350 kDa

EMILIN-1 3.9 kbp EMILIN-1 120 kDa

β-Actin β-Actin For personal use only.

Northern blot Western blot

Figure 2 EMILIN-1 siRNA suppresses deposition of fibrillin-1. (A) Northern blots of RNA samples (1 μg) extracted from PDL fibroblasts cultured for 7 days after transient transfection with EMILIN-1 siRNA. PDL fibroblasts were transiently mock-transfected (lane 1), or transiently transfected with 100 nM siRNA for EMILIN-1 (lane 2). The blots were probed with fibrillin-1 (upper lanes) and EMILIN-1 (middle lanes). Each of the probes recognized a 9.7- and 3.9-kbp band, respectively. β-Actin was used as an internal control in each lane (lower lane). The intensity of each band was normalized relative to that of β-actin, and quantified using the Image J program. (B) Western blots of cell/matrix lysates (10 μg) of PDL fibroblasts cultured for 7 days after transient transfection with EMILIN-1 siRNA. The blots were probed with anti-fibrillin-1 (upper lanes) and EMILIN-1 (middle lanes) antibodies. Each of the probes recognized a 350- and 120- kDa band, respectively. The intensity of each band was normalized relative to that of β-actin, and quantified using the Image J program.

significant decrease of fibrillin-1 (p = 0.021) (Figure 2B). EMILIN-1 has molecular interaction with fibrillin-1 Connect Tissue Res Downloaded from informahealthcare.com by University of Newcastle Upon Tyne on 12/22/14 EMILIN-1 deposition was decreased to about 40% of and affects the amount of extracellular deposition of the control, coinciding with the decrease of EMILIN-1 fibrillin-1. This is the first report to have focused on a gene expression. function of EMILINs in relation to oxytalan fibers. The immunolabeling data also supported the data Developmental expression of EMILIN-1 has been from Western blotting that the EMILIN-1 suppression investigated in chicken [8] and mice [19]. It is reported reduced the level of fibrillin-1 to 23% of the control. In that EMILIN-1 is expressed not only in elastic-rich cells transfected with 100 nM siRNA, fibrillin-1 staining tissues such as lung, skin, heart, and blood vessels, but was diminished in comparison with the control cells also in nonelastic tissues, from the postnatal to adult (Figure 3). stage [20]. First, EMILIN-1 was detected in elastic fibers at the ultrastructural level, being located at the interface between microfibrils and elastin [13]. There- DISCUSSION fore, this protein was named EMILIN and conse- In the present study using the RNA interference quently became a focus of attention with regard to its technique, we have demonstrated for the first time that relationship with elastic fibers. It has been shown

Control EMILIN siRNA Fibrillin-1 EMILIN-1 Merge

Figure 3 Decrease of oxytalan fibers by suppression of EMILIN-1. Immunofluorescence staining was performed with anti-fibrillin-1 antibody (upper panels), anti-EMILIN-1 antibody (middle panels), and superimposition of both labels (lower panels). Nuclei are blue. Bar: 100 μm. For personal use only.

histologically that in EMILIN-1 null mice the alignments their coalescence [16]. In the present study, we showed of elastic fibers in the aorta and tropoelastin (the precur- by immunoprecipitation that EMILIN-1 colocalizes sor of cross-linked elastin) extracted from the aorta are with fibrillin-1. Fibrillin-1 is the principal structural degraded biochemically, suggesting that EMILIN-1 component of microfibrils [2]. This provides strong may play a role in correct deposition of microfibrils. confirmation that EMILIN-1 is localized on oxytalan It remains unclear whether EMILIN-1 affects the fibers. In vitro binding assays have revealed molecular formation of oxytalan fibers, which are pure interactions involving fibrillin and microfibril-associated microfibrils. We demonstrated that EMILIN-1 was molecules, such as MAGP, fibulins and proteoglycans colocalized on a proportion of oxytalan fibers in vitro. [2]. Therefore, other molecules such as fibulin-5 may In a previous immunoelectron microscopy study, be present between EMILIN-1 and fibrillin-1, and the EMILIN-1 was shown to be labeled on oxytalan molecular mass including EMILIN-1 may regulate the Connect Tissue Res Downloaded from informahealthcare.com by University of Newcastle Upon Tyne on 12/22/14 fibers in Descemet’s membrane of the chick corneal quantity of oxytalan fibers. stroma [13]. Although the mechanism of EMILIN-1 We previously demonstrated that integrin αvβ3 on molecule assembly has been clarified [21], the PDL fibroblasts controls the formation of oxytalan function of EMILIN-1 on oxytalan fibers has not fibers [22]. During pericellular events, fibroblasts in been investigated previously. Besides the fact that connective tissues may retain a proportion of oxytalan EMILIN-1 is located at the interface between fibers through cell surface receptors for integrins. PDL microfibrils and elastin, it is speculated that EMILIN-1 fibroblasts express αvβ3 and α5β1 [23]. Considering plays a role in the process of oxytalan fiber formation. that EMILIN-1 does not contain an RGD motif [24], In present study, we demonstrated that EMILIN-1 is it may not make direct contact with the cell membrane. a crucial molecule that regulates the quantity of However, some integrins may contact the RGD motif oxytalan fiber formation. in fibrillin-1 and fibulin-5, which form complexes with It has been reported that EMILIN-1 can bind with EMILIN-1, and these complexes including EMILIN-1, tropoelastin and fibulin-5 [14]. We showed previously as a whole, may exert the regulation of oxytalan fiber that fibulin-5 localizes with oxytalan fibers to control formation.

Connective Tissue Research EMILIN-1 regulates oxytalan fibers 35

In summary, we have demonstrated that EMILIN-1 [11] Christian, S., Ahorn, H., Novatchkova, M., Garin-Chesa, P., is colocalized with microfibrils and may regulate the Park, J.E., Weber, G., Eisenhaber, F., Rettig, W.J., and formation of oxytalan fibers. Our findings may provide Lenter, M.C. (2001). Molecular cloning and characterization of EndoGlyx-1, an EMILIN-like multisubunit glycoprotein of a new insight into the homeostasis of oxytalan fibers. vascular endothelium. J. Biol. Chem. 276:48588–48595. [12] Colombatti, A., Poletti, A., Bressan, G.M., Carbone, A., and ACKNOWLEDGMENTS Volpin, D. (1987). Widespread codistribution of glycoprotein This work was supported by the Advanced Science gp 115 and elastin in chick eye and other tissues. Coll. Relat. Res. 7:259–275. Research Center and by Grants-in-Aid for Scientific [13] Bressan, G.M., Daga-Gordini, D., Colombatti, A., Castellani, Research (No. 22592325) from the Ministry of Educa- I., Marigo, V., and Volpin, D. (1993). Emilin, a component of tion, Science, Sports, and Culture of Japan. elastic fibers preferentially located at the elastin-microfibrils interface. J. Cell Biol. 121:201–212. Declaration of interest: The authors report no con- [14] Zanetti, M., Braghetta, P., Sabatelli, P., Mura, I., Doliana, R., Colombatti, A., Volpin, D., Bonaldo, P., and Bressan, G.M. flicts of interest. The authors alone are responsible for (2004). EMILIN-1 deficiency induces elastogenesis and the content and writing of the paper. vascular cell defects. Mol. Cell. Biol. 24:638–650. [15] Hisanaga, Y., Nakashima, K., Tsuruga, E., Nakatomi, Y., Hatakeyama, Y., Ishikawa, H., and Sawa, Y. (2009). Fibulin-5 REFERENCES contributes to microfibril assembly in human periodontal ligament cells. Acta Histochem. Cytochem. 42:151–157. [1] Rosenbloom, J., Abrams, W.R., and Mecham, R. (1993). Extra- [16] Nakashima, K., Tsuruga, E., Hisanaga, Y., Ishikawa, H., and cellular matrix 4: The elastic fiber. FASEB. J. 7:1208–1218. Sawa, Y. (2009). Stretching stimulates fibulin-5 expression [2] Kielty, C.M., Sherratt, M.J., and Shuttleworth, C.A. (2002). and controls microfibril bundles in human periodontal Elastic fibres. J. Cell Sci. 115:2817–2828. ligament cells. J. Periodontal Res. 44:622–627. [3] Böck, P., and Stockinger, L. (1984). Light and electron micro- [17] Tsuruga, E., Irie, K., Sakakura, Y., and Yajima, T. (2002). scopic identification of elastic, elaunin and oxytalan fibers in Expression of fibrillins and tropoelastin by human gingival and human tracheal and bronchial mucosa. Anat. Embryol. (Berl) periodontal ligament fibroblasts in vitro. J. Periodontal Res. 170:145–153. 37:23–28. [4] Chavrier, C., Hartmann, D.J., Couble, M.L., and Herbage, D. [18] Tsuruga, E., Yajima, T., and Irie, K. (2005). Microfibril-associ- (1988). Distribution and organization of the elastic system ated glycoprotein-1 and fibrillin-2 are associated with tropoelastin fibres in healthy human gingiva. Ultrastructural and immuno- deposition in vitro. Int. J. Biochem. Cell Biol. 37:120–129. histochemical study. Histochemistry 89:47–52. [19] Braghetta, P., Ferrari, A., de Gemmis, P., Zanetti, M., Volpin, [5] Sims, M.R. (1975). Oxytalan-vascular relationships observed D., Bonaldo, P., and Bressan, G.M. (2002). Expression of the in histologic examination of the periodontal ligaments of man EMILIN-1 gene during mouse development. Matrix Biol. and mouse. Arch. Oral Biol. 20:713–716. 21:603–609. [6] Tsuruga, E., Irie, K., and Yajima, T. (2002). Gene expression [20] Kelleher, C.M., McLean, S.E., and Mecham, R.P. (2004). and accumulation of fibrillin-1, fibrillin-2, and tropoelastin in Vascular extracellular matrix and aortic development. Curr. For personal use only. cultured periodontal fibroblasts. J. Dent. Res. 81:771–775. Top. Dev. Biol. 62:153–188. [7] Colombatti, A., Doliana, R., Bot, S., Canton, A., Mongiat, M., [21] Mongiat, M., Mungiguerra, G., Bot, S., Mucignat, M.T., Mungiguerra, G., Paron-Cilli, S., and Spessotto, P. (2000). Giacomello, E., Doliana, R., and Colombatti, A. (2000). Self- The EMILIN protein family. Matrix Biol. 19:289–301. assembly and supramolecular organization of EMILIN. [8] Colombatti, A., Bressan, G.M., Castellani, I., and Volpin, D. J. Biol. Chem. 275:25471–25480. (1985). Glycoprotein 115, a glycoprotein isolated from chick [22] Tsuruga, E., Sato, A., Ueki, T., Nakashima, K., Nakatomi, blood vessels, is widely distributed in connective tissue. J. Cell Y., Ishikawa, H., Yajima, T., and Sawa, Y. (2009). Integrin Biol. 100:18–26. avb3 regulates microfibril assembly in human periodontal [9] Hayward, C.P., Hassell, J.A., Denomme, G.A., Rachubinski, ligament cells. Tissue Cell 41:85–89. R.A., Brown, C., and Kelton, J.G. (1995). The cDNA [23] Somerman, M.J., Archer, S.Y., Imm, G.R., and Foster, sequence of human endothelial cell multimerin. A unique pro- R.A. (1988). A comparative study of human periodontal tein with RGDS, coiled-coil, and epidermal growth factor-like ligament cells and gingival fibroblasts in vitro. J. Dent. Res. domains and a carboxyl terminus similar to the globular 67:66–70. domain of complement Clq and collagens type VIII and X. J. [24] Doliana, R., Mongiat, M., Bucciotti, F., Giacomello, E., Biol. Chem. 270:18246–18251. Deutzmann, R., Volpin, D., Bressan, G.M., and Colombatti, A. Connect Tissue Res Downloaded from informahealthcare.com by University of Newcastle Upon Tyne on 12/22/14 [10] Braghetta, P., Ferrari, A., De Gemmis, P., Zanetti, M., (1999). EMILIN, a component of the elastic fiber and a new Volpin, D., Bonaldo, P., and Bressan, G.M. (2004). Overlap- member of the Clq/tumor necrosis factor superfamily of pro- ping, complementary and site-specific expression pattern of genes teins. J. Biol. Chem. 274:16773–16781. of the EMILIN/Multimerin family. Matrix Biol. 22:549–556.

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具