Persistent bacterial infections: Identification of immunogenic structures of Borrelia burgdorferi sensu lato and Chlamydophila pneumoniae by phage surface display
Dissertation
zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften an der Universität Konstanz (Fachbereich Biologie) vorgelegt von
Markus Müller
Tag der mündlichen Prüfung: 13.Februar 2004 1. Referent: Prof. Dr. Dr. Thomas Hartung 2. Referent: PD. Dr. Klaus P. Schäfer
for Mom, Dad and my brother
Acknowledgments
The work presented in this thesis was carried out between February 2000 and January
2004 at the chair of Biochemical Pharmacology at the University of Konstanz under the instructions of Prof. Dr. Dr. Thomas Hartung and at the Swiss Institute of Allergy and
Asthma Research (SIAF) in Davos under the instructions of Prof. Dr. Reto Crameri.
I would like to address my thanks to:
Prof. Dr. Dr. Thomas Hartung for the continuous support, providing the excellent working facilities, including the attendance at conferences that contribute substantially to the success of this PhD thesis. I like to thank him for the freedom in developing and implementing my own scientific ideas. His continuing mentorship and support throughout the last years is strongly appreciated.
Prof. Dr. Albrecht Wendel for giving me the opportunity to perform my PhD thesis in his group, his constant encouragement and interest in the work. I like to thank as well for his commitment to the Graduiertenkolleg “Biomedizinische Wirkstoff-Forschung”.
Prof. Dr. Reto Crameri for supporting me all along, his personal encouragement.
I would like to thank for the excellent working facilities offered to me in Davos and the inspiring atmosphere in- and outside of the lab.
Dr. Corinna Hermann for her continuous help and support, valuable scientific discussions, representing an inestimable contribution to this thesis.
Dr. Inge Mühldorfer, Dr. Stefan Postius and Jean-George Thimm from Altana Pharma for their contribution and support to the fruitful development of the animal model.
Dr. Tamara Kleber-Janke and Karen Mähnß from Biovision for the help and cooperation in construction of the phage vector.
All the present and former members of the Graduiertenkolleg “Biomedizinische
Wirkstoff-Forschung” for the help- and fruitful discussion. I am indebted for financial support and the organization of outstanding seminars and courses.
All the present and former members of the chair “Biochemical Pharmacology” and of the Swiss Institute of Allergy and As thma research (SIAF) for technical assistance, helpful discussions and critical comments. They all contributed to the exceptional working atmosphere. I am grateful to Margarete Kreuer-Ullmann and Anne Hildebrand, for excellent technical assistance. Furthermore the general support of Gregor Pinski,
Annette Haas and Ina Seuffert was very helpful.
Thomas Meergans, Isabel Diterich, Sebastian Bunk, Stefan Michelfelder and Rebekka
Munke for their assistance.
Carolin Rauter, Michael Weichel, Claudio Rhyner, Sabine Flückiger, Sven Klunker, Jan
Wohlfahrt, Anja Mayer, Verena Tautorat and Astrid Leja for activities in- and outside the lab, which contribute to this productive and enjoyable time.
Dr. Derya Shimshek, Dr. Sonja v. Aulock and Laura Stamp for the critical reading of the manuscript, Wolf-Dieter Weissenbühler, Gerhard Hönig and Jürgen Müller for the assistance in problems with “Microsoft” and the hardware.
All my friends for going with me this long way. Sonja Lotz for being at my side.
My parents and my brother for supporting me all along List of Publications
Major parts of this thesis are submitted for publications:
M. Mueller, S. Postius, J. G. Thimm, K. Gueinzius, I. Muehldorfer, T. Hartung, and C
Hermann. Toll-like receptor 2 and 4 do not contribute to clearance of Chlamydophila pneumoniae in mice, but are necessary for release of cytokines by macrophages
(submitted to Infect Immun.)
M. Mueller, I. Diterich, M. Weichel, C. Rauter, Dieter Hassler, Reto Crameri and
Thomas Hartung. Phage surface display as a tool to identify novel Borrelia antigens for serodiagnosis (revised to J. Clin. Microbiol.)
M. Mueller, S. Michelfelder, I. Muehldorfer, K. Maehnss, M. Weichel, Reto Crameri, T.
Hartung and C. Hermann. Identification of antigenic peptides from a genomic random phage surface display library of Chlamydophila pneumoniae (submitted to J. Clin.
Microbiol.)
M. Mueller, R. Crameri, T. Hartung. The use of phage display affinity selection in the post-genome era (submitted to trends Mol. Med.).
Table of Contents
1 Introduction...... 1
1.1 Persistent pathogens ...... 1
1.1.1 Borrelia burgdorferi sensu lato...... 1
1.1.2 Chlamydophila pneumoniae...... 4
1.1.3 Starting point...... 7
1.2 General aspects of display technologies...... 7
1.2.1 In vitro display systems ...... 8
1.2.2 Eukaryotic display systems ...... 9
1.2.3 Prokaryotic display systems ...... 10
1.3 Overview of phage display ...... 10
1.4 Aim of the thesis...... 12
2 The use of phage display affinity selection in the post-genome era ...... 15
2.1 Abstract ...... 15
2.2 General aspects of display technologies...... 16
2.3 General aspects of phage display...... 17
2.4 Components of phage display...... 19
2.5 Principle and applications of phage libraries ...... 22
2.5.1 Random peptide libraries ...... 22
2.5.2 Antibody libraries ...... 23
2.5.3 cDNA libraries ...... 26
2.5.4 Whole genome libraries...... 27
2.6 Affinity selection strategies ...... 28
2.7 Summary of phage display...... 32 3 Phage surface display as a tool to identify novel Borrelia antigens for serodiagnosis...... 35
3.1 Abstract ...... 35
3.2 Introduction...... 36
3.3 Materials and Methods ...... 38
3.4 Results ...... 43
3.5 Discussion...... 48
3.6 Acknowledgments ...... 48
4 Identification of antigenic peptides from a genomic random phage surface display library of Chlamydophila pneumoniae...... 53
4.1 Abstract ...... 53
4.2 Introduction...... 54
4.3 Materials and Methods ...... 56
4.4 Results ...... 63
4.5 Discussion...... 68
4.6 Acknowledgments ...... 70
5 Toll-like receptor 2 and 4 do not contribute to clearance of Chlamydophila pneumoniae in mice, but are necessary for release of cytokines by macrophages .....71
5.1 Abstract ...... 71
5.2 Introduction...... 72
5.3 Results ...... 73
5.4 Discussion...... 79
5.5 Materials and Methods ...... 81 5.6 Acknowledgments ...... 86
6 Summarizing discussion...... 87
6.1 Phage surface display and antigen identification in persistent infection...... 89
6.2 The murine C. pneumoniae infection model...... 92
7 Summary ...... 95
8 Zusammenfassung...... 99
9 Abbreviations ...... 103
10 References ...... 105
1 Introduction
1.1 Persistent pathogens
The two bacteria Borrelia burgdorferi sensu lato (B. burgdorferi s.l.) and Chlamydophila pneumoniae (C. pneumoniae) can cause persistent infections in human beings. These infections are correlated with chronic, clinical manifestations. The diagnosis of infection with these bacteria is made on the basis of serological tests. Nearly all these tests use as basis crude extract derived from bacterial cultures leading to many false-negative and false-positive results. Therefore, the serodiagnosis based on crude extracts lacks a standardization to improve both sensitivity and specificity. Recently, there were some reports where recombinant proteins were used for diagnostic applications indicating that recombinant antigens might have a great potential to improve the diagnosis of B. burdorferi s.l. and C. pneumoniae infections. However, until to date none of these recombinant proteins has been used in routine diagnostics.
1.1.1 Borrelia burgdorferi sensu lato
B. burgdorferi s.l., the causative agent of Lyme Borreliosis, is a Gram-negative corkscrew shaped, microaerophilic bacterium of the family of Spirochaetaceae.
B. burgdorferi was first described in 1982 by W. Burgdorfer (31). In Europe, there are at least three species pathogenic for humans (B. burgdorferi sensu stricto (B. burgdorferi s.s.), B. afzelii and B. garinii). B. valaisiana might also be pathogenic for humans, as suggested by positive PCR results obtained from a skin biopsy (300). The pathogen is transmitted into man by hard ticks (Ixodidae). At the site of the tick bite the infection
2 1 Introduction
starts primarily with a local skin infection (Erythema migrans (EM)), then the spirochetes disseminate into the whole body. They can persist for years if untreated and may result in a range of clinical symptoms such as arthritis, neurological disorders, skin manifestations and arrhythmia (333). There are studies which showed an indirect evidence for the association of B. garinii with neurological symptoms (79), while infections with B. burgdorferi s.s. and B. afzelii tend to lead to arthritic symptoms (356) and cutaneous manifestations, respectively (35).
According to the Centre of Disease Control and Prevention, Lyme Borreliosis (LB) accounts for 95% of all reported vector-borne diseases in the United States and incidence estimations in endemic areas range between 16 and 140 / 100,000 inhabitants per year (161, 377). Individuals with a high risk of tick exposure (forest workers) frequently have significantly increased antibody titers against the pathogen
(262, 375).
At present, the diagnosis of LB is made on the basis of the clinical picture and serological tests (102). For serodiagnosis a combination of a screening enzyme-linked immunosorbent assay (ELISA) as first step and a Western blot for confirmation as second step are recommended (44). In Western blot analyses antibodies against individual Borrelia antigens, which have been separated by gel electrophoresis, can be detected. However, a positive serological result without any clinical symptoms is not sufficient for the diagnosis of LB. Other than serological methods for detection of the pathogen like cultivation of Borrelia from patients’ specimen is difficult, since the pathogen occurs at low number in infected tissue and is difficult to cultivate due to long doubling time and the need of complex media (12, 61, 242, 322). Only for patients presenting an EM the cultivation of Borrelia or the direct detection via PCR from skin biopsies is a suitable method (203, 295, 322). But all these methods are confined to their special indications. 1 Introduction 3
The interpretation, especially of Western blot bands and their intensity, is difficult, labor-intensive and not standardized (160). Many tests use crude extracts from the cultured Borrelia (different strains, different antigen preparations), which leads to further problems. One major problem is cross reactions with antibodies against other bacteria like Treponema, Ehrlichia or Epstein-Barr-virus and furthermore Borrelia proteins which are expressed only under human immune pressure are missed in these tests. In summary, the tests available are not standardized and the results of different test are not comparable due to these problems.
Commercial serological tests or in-house produced ones can not distinguish between active and inactive infection, because the IgG and IgM antibodies remain detectable over years at high levels, even after a successful antibiotic treatment (333). There is a hope that recombinant antigens might overcome these limitations.
Recombinant antigens would probably contribute to improve specificity and sensitivity of the serodiagnosis of LB. They would offer the advantage of easier identification of the bands in the immunoblot, since specific antigens can be selected, antigens from different strains can be combined, the test would be standardizable and the missing antigens could be added (378). Furthermore, by the use of truncated proteins cross reactions can be avoided. In the last years, there were many efforts in the identification of recombinant antigens and many different antigens were reported (118, 119, 142,
144, 203, 217, 232, 233, 277, 278). The first test with promising results was reported by Gomez et al. (118). They used chimeric recombinant proteins of outer surface protein A (OspA), p93, OspB, OspC and p41. The recombinant VlsE seems to be another very promising and useful antigen (142, 217, 233). In EM patients a higher sensitivity than those obtained with commercial ELISA was reached with the recombinant antigen BBK32 (143, 203). Despite the advantages of recombinant antigens and identical specificity, the recombinant blot has not yet shown the equal sensitivity of the whole-cell lysate blot. At present, the diagnosis is still far away from 4 1 Introduction
the standardized serological test with high sensitivity and specificity. Further recombinant antigens will be needed to succeed.
LB is treated with antibiotics, but results are poor for treatments at late stages of the disease (220, 269, 334, 337, 338, 384). The difficulties in treatment of late stages and the high sero-prevalence of LB (268) call for a vaccination against Borrelia.
Immunizations with several different recombinant B. burgdorferi s.l. proteins have been performed. Immunization with OspA was found to be safe and effective in a large clinical trial in the United States (335). The vaccine efficacy in preventing clinical LB was 49% after two doses of the vaccine and 76% after three injections (327). The vaccine was approved by the Food and Drug Administration in 1998, but in 2002 the vaccine was withdrawn from the market. During this time, the vaccine was not tested in
Europe, due to the presence of three B. burgdorferi species (in the United States only
B. burgdorferi s.s. is found) resulting in heterogeneity of the OspA protein. The OspA vaccine gives rise to the hope that a combination of different recombinant proteins can lead to the development of a safe and worldwide usable vaccine.
1.1.2 Chlamydophila pneumoniae
C. pneumoniae, a Gram-negative, obligate intracellular pathogen was first isolated
1965 in Taiwan (125) and was classified in 1989 as a new species of the genus
Chlamydiaceae within the species Chlamydia, and was named Chlamydia pneumoniae
(now Chlamydophila). The organism represents a common respiratory pathogen, leading to sinusitis, bronchitis and pneumonia (122) and is believed to be responsible for about 10% of community-acquired pneumonia (4, 85, 122, 180). The pathogen occurs worldwide with a high sero-prevalence (up to 70% in elder adults), with primary infection in teenage years and rising prevalence with age (123). The high prevalence of antibodies against C. pneumoniae suggests that re-infections often occur (4, 123), but 1 Introduction 5
among the sero-postive individuals there is an assumed persistence up to 80% (136,
230). Persisting C. pneumoniae have been found in vivo in blood monocytes (18, 22,
230). The development of persistence in vitro is characterized by a reduction of intracellular growth and by the appearance of morphologically aberrant reticular bodies
(non-infectious but metabolic active replicating stage of the pathogen) (198). C. pneumoniae is still metabolic active in this stage (1, 36, 246), but nothing is known about the duration and the mechanism of persistence.
Recent attention has focused on the association of C. pneumoniae and several chronic and destructive diseases of the lung (asthma) (5, 58, 207), the nervous system (331,
349, 390) and atherosclerosis (121, 222, 312-314, 364). Especially in the field of atherosclerosis there is a controversial discussion. Evidences for a link come from sero-epidemiological studies (i) and direct identification of the pathogen in the atherosclerotic plaques (ii). The only causal evidence comes from animal models (iii).
(i) sero-epidemiological studies
The microimmunofluorecence (MIF) test is the best established serological test for determining C. peumoniae infections and is considered as the current gold standard
(83). Primarily, the MIF was developed for C. trachomatis, but was later adopted for the serodiagnosis of C. pneumoniae (126, 372). The MIF uses formalin-fixed chlamydial elementary bodies (EB) (infectious but non-replicating stage of the pathogen) immobilized to glass slides as antigens. The MIF allows the quantitative determination of specific IgA and IgG antibodies of human sera, but the MIF itself shows several limitations like variability of antigen preparation, requiring experience of the performing person and interlaboratory variations (281). Additionally, the specificity of MIF has been questioned by several investigators (135, 180, 186, 274). In recent years, C. pneumoniae specific ELISA and EIA have been developed, which are more objective, standardized and easier to perform. However, a comparison of 11 serological assays, including MIF and ELISA, showed high variations in sensitivity and specificity (146). 6 1 Introduction
Proving the link between atherosclerosis and C. pneumoniae infection by serology is difficult, because the epidemiological studies so far did not use standardized serological methods. As a result there are opposing findings (47, 71, 313) which can be explained by the different accuracies of the diagnostic methods used in these studies, strongly influencing the composition of the different collectives. A real understanding of the role of C. pneumoniae in atherosclerosis needs standardization of the performance of the serological tests.
(ii) direct identification of the pathogen in the atherosclerotic plaque
The first direct identification was reported in 1992 by Shor et al., who identified C. pneumoniae in atherosclerotic material from post mortem examination by electron microscopy and PCR (326). Until today, over 40 different studies reported the detection of the pathogen in atherosclerotic material, whereas the pathogen was never found in healthy tissue (120). Furthermore, viable C. pneumoniae have been isolated and successfully cultured from atheromatous plaques (229). Because C. pneumoniae are only found in atherosclerotic lesions a causal role of C. pneumoniae in the development of atherosclerosis is suggested.
(iii) animal models
The most reliable causal proof for a role of C. pneumoniae in atherosclerosis derives from animal models. Several studies have focused on the use of well-defined animal
(mice and rabbit) models of atherosclerosis to address the putative role of C. pneumoniae infection (37, 39, 157, 247, 255, 256). Campbell et al. showed for example the accelerated formation of atherosclerotic plaques in hypercholesterolemia mice and rabbit models after C. pneumoniae infection (41). All these models use hyperlipidemia or animals with deficiency in the lipid recycling (apolipoprotein-E deficient mice) to show the association between C. pneumoniae infection and atherosclerosis. Cortison treatment was shown to recover C. pneumoniae weeks after the last infection in mice
(236), indicating a persistence of the pathogen. In summary, C. pneumoniae is, like in 1 Introduction 7
humans, found in foam cells of atherosclerotic lesions or at the sites of inflammation in the aorta by PCR, immunohistology and by culture (41). C. pneumoniae infection can accelerate the progression of atherosclerosis in combination with hyperlipidemia and initiate changes in the aorta of mice and rabbits (41, 100, 256). There are also a few other reports, investigating the immunopathogenesis of C. pneumoniae in animals (88,
179, 387, 388).
1.1.3 Starting point
Both pathogens lack a standardized and reliable serodiagnostic method for the detection of infections. Several approaches, e. g. identification by Western blot, have shown that recombinant antigens have the potential to improve the serodiagnosis of B. burgdorferi s.l. and C. pneumoniae, but none are yet used in routine diagnostics. Thus a major goal would be the identification of new and relevant antigens of the pathogens.
The availability of the genome information and the various display and screening technologies offer a great opportunity for identification of protein-protein interactions especially the identification such relevant antigens.
1.2 General aspects of display technologies
The basis for all biological screening approaches relies on the exploitation of molecular interaction through the link between the gene integrated into the host genome and the encoded gene product displayed on host surfaces. They are all based on molecular libraries, differing in complexity and size. Display technology of complex molecular libraries spans two major groups: those based on biological compounds (DNA, RNA, peptides and proteins) and the synthetic ones based on compounds generated by combinatorial chemistry. Regardless of the format, a display library consists of three 8 1 Introduction
elementary components: the displayed entities, a common linker and the corresponding individualized codes, normally a gene or a part of it (figure1) (215). The linkage between the phenotype (displayed entity) and the genotype (code) allows a rapid identification of molecules of interest based on the power of affinity selection. This technological platform speeds up discovery in life sciences because complex and time- consuming experiments at the protein level can be bypassed.
The biological display systems are divided into three different groups of display systems: first in vitro display (see 1.2.1), second eukaryotic display (see 1.2.2) and third prokaryotic display (see 1.2.3).
figure 1: The elementary components of phage display:
The code, the linker and the displayed linker code displayed entity. entity
Despite the effort and success made in the development and optimization of the different display systems, it is unlikely that one single method will replace all the other display technologies. The different requirements of each screening have to be considered in detail to find the optimal solution for the given scientific question. The best result will be achieved by matching the parameters to the desired characteristics of the target and its interaction with the binding partner.
1.2.1 In vitro display systems
These systems are characterized by the absence of a biological host, and are sub- classified into three main types: ribosome display (137), mRNA display (342) and in 1 Introduction 9
vitro compartmentalization (128). For ribosome and mRNA display the code is RNA, and they need an extra step of RNA synthesis in a pro- or eukaryotic system. In vitro compartmentalization uses an external source of transcription and translation, and therefore the size of the library is only limited by the amount of genetic information, that can be added to the cell-free protein synthesis system. Therefore, all the in vitro display systems enable the construction of libraries that are several orders of magnitude larger than using viruses or cell system (359). This is one of the major advantages of these systems, allowing to display extremely large libraries. For the identification of antigens from pathogens like Borrelia and Chlamydophila, with a relatively small amount of different genes (B. burgdorferi s.s. (strain B31) 1701 different genes, C. pneumoniae
(strain TW-183) 1114 different genes), the amount of gene products which can be displayed on the surface, is not limiting the approach. Hence, it is not necessary to choose one of these display systems.
1.2.2 Eukaryotic display systems
The eurokaryotic display systems offer the advantage of high fidelity folding of eukaryotic proteins, and the advantage of eukaryotic post-translational modifications.
There are at least six different display systems, including yeast-two-hybrid (25), yeast- cell-surface-display (21), display on mammalian retroviruses (28), fusion to an integral membrane protein of mammalian cells (52), Baculovirus-display (253) and display on
Baculovirus infected cells (89). However, eukaryotic display systems are strongly limited by the low complexity of the molecular libraries that can be displayed. The complexity of the library size is several orders of magnitude lower than the complexity reached in prokaryotic systems (21, 105, 178). They are also not as easy to adapt for screening against patient’s IgG. Furthermore, the different systems showed several specific limitations, the yeast two-hybrid for example is not applicable to secreted 10 1 Introduction
proteins of the cell-surface (389) and hence not the method of choice to display all bacterial proteins where most of the known antigens are surface located. Due to the lack of post-translational modifications in bacteria and the limitations of eukaryotic display systems none of these systems were chosen.
1.2.3 Prokaryotic display systems
Phage display, peptides-on-plasmid display (70), bacterial cell wall display (51, 115) and bacterial periplasmic display (50) belong to the prokaryotic display systems. From these methods phage display technology, first described by Smith (329), is the most robust and widespread used technology. The phage expresses the entity as a fusion with the coat proteins of the bacteriophage on their surface. The method is easy to handle and allows a rapid identification of binding partners to a ligand out of a large library. Furthermore, patient antibodies are widespread used for the identification of antigens and allergens from pathogens (64). Therefore, it appeared to be the most reliable method for the identification of bacterial antigens through display of all proteins encoded in the bacterial genome, if a cDNA or genomic library was used.
1.3 Overview of phage display
As mentioned, phage display is a powerful in vitro selection technique to study protein ligand interactions and to isolate target-specific ligands. The peptide or protein is genetically fused to a coat protein of a bacteriophage, resulting in display of the fused protein on the surface of the phage, while the DNA encoding the fusion products is integrated within the phage genome. This physical linkage between the displayed protein and the DNA encoding allows a fast screening of enormous numbers of different proteins or peptides (phage library), by a simple in vitro selection procedure 1 Introduction 11
called affinity selection. The affinity selection aims the enrichment and identification of phage displaying protein which bind to a target. The target will be incubated with the phage libraries, non-bound phage are washed away and specifically bound phage particles eluted afterwards with different methods, like pH change (176, 303) or oxidising agents (127). Eluted phage are amplified in an amplification step, which includes infection of E. coli with eluted phage and consecutive rounds of affinity selection can be performed. Phage are analyzed at the end of each affinity selection procedure, to identify the genetic code of the displayed entity (figure 2).
TARGET BINDING PHAGE BINDING WASHING
(iii) phage library
AMPLIFICATION
ampCH1oriR ELUTION (ii) superinfection ampCH1oriR
(i) infection figure 2: Phage display affinity selection cycle in its simplest form (biopanning).
The selection is performed in several steps: Immobilization of the target, secondly incubation of the library with the target and phage binding, thirdly washing to remove non-bound phage. Elution of bound phage is the next step followed by amplification of target-specific phage. The amplification is devided in three steps infection of E. coli (i), followed by an superinfection with helper phage for phage assembly (ii), which results again in a phage library (iii). This library is now more specific for the target and can used for a next cycle of affinity selection. 12 1 Introduction
1.4 Aim of the thesis
New recombinant antigens might improve the serodiagnosis of B burgdorferi s.l. and C. pneumoniae. The phage display technology allows a rapid identification of binding partners to a ligand out of a large library. The aim of the thesis was the identification of new antigens for diagnosis or vaccination purposes by the use of phage display.
In this approach a random genome library instead of a cDNA library was chosen, because not all antigens are expressed during bacterial culture. Hence, the phage display method, using the pJufo vector system (68), was adapted to display whole genomes of Borrelia and Chlamydophila resulting in libraries containing all bacterial proteins in overlapping fragments.
To identify the antigens, serum IgG-antibodies from sero-positive patients with clinical symptoms were used to screen the libraries by affinity selection. Using patient sera only antigenic structures relevant in humans will be enriched (figure 3A).
The identified proteins should be expressed and tested for their specificity and sensitivity with patient and control sera.
For the purpose of possible vaccination studies and to learn more about bacterial infection, animal models were necessary. Since a Borrelia infection model was available in-house, a further aim was to establish a murine C. pneumoniae infection model (figure 3B). 1 Introduction 13
A
A B C D DNA affinity selection
random phage library D D B B bacteria
infection anti anti B D patient antibodies
B
affinity antigens selection mouse model
serodiagnosis vaccination
figure 3: Aim of the PhD thesis.
A: The whole genome of the bacterium (Borrelia or Chlamydophila) was partially digested and ligated into a phage vector to construct a random phage library, presenting all proteins of the bacterium. However, patients produce antibodies against a few of these proteins only. In the affinity selection these antibodies were used for the identification and enrichment of the antigenic proteins.
B: From the affinity selection, antigenic structures were obtained. These antigens might be useful for an improvement of the serodiagnosis, as well as for the vaccination.
2 The use of phage display affinity selection in
the post-genome era
Markus Mueller1, Reto Crameri2, Thomas Hartung1*
1Biochemical Pharmacology, University of Konstanz, Germany
2Swiss Institute of Allergy and Asthma Research, Davos, Switzerland
submitted to Trends Mol. Med.
2.1 Abstract
Phage display is a powerful screening method for the identification of predominantly protein-protein interactions. The peptide or protein is genetically fused to a coat protein of a bacteriophage, resulting in display of the fused protein on the surface of the phage, while the DNA encoding the fusion products is integrated within the phage genome.
This physical linkage between the displayed protein and the DNA encoding it, allows a fast screening of enormous numbers of different proteins or peptides (phage library) and the identification of the genetic code from peptides, proteins or antibodies with a high binding specificity for a desired target structure.
This review explains the basis of phage display and discusses the contribution of the different phage library technologies to the post-genome era.
16 2 The use of Phage display affinity selection in the post-genome era
2.2 General aspects of display technologies
The enormous amount of genetic information generated by genome projects world wide, led to the identification of thousands of uncharacterised open reading frames
(ORFs). Consequently, turning sequence information into function is the major challenge of the post-genomic era and is well depicted by the fact that, for example,
44% of the 223 genes on human chromosome 21 represent ORFs encoding putative proteins with unknown function (138). This new dimension in life science demands methods for a rapid characterisation of gene products and protein-protein interaction networks (213). The post-genomic approach starts from the diversity of molecules encoded in the genomes and searches for biologically relevant networks of interacting molecules. Knowledge about these interactions facilitates rapid progress in life sciences and leads to the rational development of new drugs.
The basis for all biological screening approaches represents the exploitation of molecular interaction through the link between the gene integrated into the host genome and the encoded gene product displayed on the host surface. They are all based on molecular libraries, differing in complexity and size. Display technology of complex molecular libraries spans two major groups: those based on biological compounds (DNA, RNA, peptides and proteins) and the synthetic ones based on compounds generated by combinatorial chemistry. Regardless of the format, a display library consists of three elementary components: the displayed entities, a common linker and the corresponding individualized codes, normally a gene or a part of it (215).
The linkage between phenotype (displayed entity) and the genotype (code) allows a rapid identification of molecules of interest based on the power of affinity selection.
These technological platforms speed up discovery in life science because complex and time-consuming experiments at the protein level can be bypassed. The biological 2 The use of Phage display affinity selection in the post-genome era 17
display systems are divided into three different groups of display systems: in vitro, eukaryotic and prokaryotic display systems.
Despite the effort and success made in the development and optimization of each of these different display systems, it is unlikely that one single method will replace all the other display technologies. The different requirements of each screening have to be considered to find the optimal solution, granting all the methods their place in the field of library screening. The best result will be achieved by matching the characteristics of each technique to the characteristics of the target and its desired interaction with the binding partner. Nevertheless, phage display represent the most often used screening method at the moment.
2.3 General aspects of phage display
Phage display (329) is a versatile in vitro selection technique to study protein ligand interactions and to isolate target-specific ligands. The peptide or protein is genetically fused to a coat protein of a bacteriophage, resulting in display of the fused protein on the surface of the phage, while the DNA, coding for the fusion product, is integrated within the phage genome. This physical linkage between the displayed protein and the
DNA encoding it, allows a fast screening of enormous numbers of different proteins or peptides (phage library), by a simple in vitro selection procedure called "affinity selection" (also "panning"). By the use of this technique, binding partners from a large phage library to a known structure (target) can be identified. During affinity selection, phage, displaying binding proteins, can be separated from those displaying proteins without affinity for the target molecule. Therefore, a desired target will be incubated with the phage library, non-bound phage are washed away and specifically bound phage particles are eluted afterwards with different methods, like pH change (303) or oxidizing agents (127). Eluted phage are amplified in an amplification step, which 18 2 The use of Phage display affinity selection in the post-genome era
includes infection of e.g. E. coli with the eluted phage. Consecutive rounds of affinity selection can be performed, phage are analyzed at the end of each affinity selection procedure, to identify the genetic code of the displayed entity (figure 1).
TARGET BINDING PHAGE BINDING WASHING
(iii) phage library
AMPLIFICATION
ampCH1oriR ELUTION (ii) superinfection ampCH1oriR
(i) infection
Figure 1: The phage display affinity selection cycle.
The cycle has several steps, i.e. immobilization of the target, incubation and binding of phage to the target. Washing steps follow, where non-bound phage are removed, and afterwards specifically bound phage are eluted by conditions that disrupt the protein-target interactions. Eluted phage are amplified by infection of E. coli und superinfection with herlperphage. This new "second" library can be used for a next affinity selection cycle. After several rounds of affinity selection the phage displaying proteins with binding affinity are dominant and selected phage are analyzed individually. 2 The use of Phage display affinity selection in the post-genome era 19
Phage display technology has been used for a broad range of applications like the finding of antagonists or agonist of receptors (17, 82, 148, 317), epitope mapping (151,
261), identification of diagnostic proteins (64, 162, 260), engineering of the binding affinity of proteins (33) or simply for the identification of interacting proteins (45). The wide range of possible applications has established phage surface display technology as one of the most often used technologies in modern molecular biology.
2.4 Components of phage display
Three different components play an essential role in phage display :
(i) The target: Any structure can be used as target molecule in phage display. In most of the cases a component of a known protein/ protein complex or antibodies are used.
(ii) The phage: Different strains (strain M13, fd or f1) from the Ff filamentous phage family are commonly used in phage display. However, most vectors have been developed from the backbone of the fd and M13 filamentous phage.
(iii) The phage library: The quality (size and complexity, up to 1011) and source of a library is important for the success of an affinity selection. The libraries can be divided into different groups: antibody libraries, peptide libraries, cDNA libraries and whole genome libraries.
One of the most important prerequisites for success in phage display is an efficient, smart and discriminative design of the affinity selection strategy. The common rule is that "you get what you select for". Therefore, it is strongly recommended to link the selection criteria as closely as possible to the desired attribute. This can be achieved by different affinity selection strategies.
(i) The Target
As a target for phage display any structure of interest can be used, but most of the applications report to the use of naturally occurring molecules like peptides, proteins 20 2 The use of Phage display affinity selection in the post-genome era
and antibodies. Recently, phage display has been used to identify peptides that selectively bind to a target of inorganic material (376). The immobilization of the target e.g. to a solid phase is necessary to separate the target-phage-complex from the non- bound phage. Different immobilization methods are described in the literature, like immobilization on polysterol surfaces (66, 279) or magnetic immobilization (299, 371).
In general, it is better to have a defined target, whose characteristics and properties are known, than an ill-defined target. But nevertheless, there are reports of successful panning by affinity selection against whole cells (263), or in whole organisms (280), highlighting the versatility of the technology. One of the major goals is to fit the affinity selection procedure to the desired characteristics of the target.
(ii) The phage
Phage, or more correct bacteriophage were first described in 1915 by Frederick Twort
(354). Because of their ability to lyse their bacterial host they were named bacteriophage, according to the Greek word "phagein" for "to eat". In the following years many phage with different characteristics were discovered.
The non-lytic filamentous phage M13 has been the platform of choice for most phage display applications so far. Other phage display systems have been developed as well, including the phage T4 (170, 238), T7 (72, 156, 216, 381), l (55, 131, 393) and others
(111, 141, 159, 358). Filamentous phage M13 are mainly composed of the major coat protein pVIII, (~2700 copies per phage), which is only 50 residues long, and each of the remaining (minor) coat proteins, pIII, pIV, pVIII and pIX, which occur in low copy number (3-5 per phage) (figure 2) (for review see (310)).
In phage display the recombinant proteins are displayed on the phage surface as a fusion (via a linker or direct) either to the coat protein pIII (11) or the coat protein pVIII
(59, 86, 153, 177, 396). Few reports have used as fusion partners pIV, pIX and pX
(107, 108, 158, 169). The fusion to the phage coat protein can be reached by cloning the respective code (DNA) into the phage genome or into a phage genome vector 2 The use of Phage display affinity selection in the post-genome era 21
(248). If this vector codes only parts of the whole phage (for example only the coat protein used for the fusion) it is named phagemid (13, 155, 250).
900 nm
6 nm
coat protein pIII pVI pVIII pVII pIX genome (single strand)
number 5 4 3000 5 5
kDa 43 12 5 3 3 6500nts
Figure 2: Filamentous phage for displaying foreign peptide or protein.
Cartoon of wild-type Ff phage with the major (pVIII) and minor (pIII, PVI, pVII, PIX) coat proteins (adapted from Irving et al. (163)).
Phagemid vectors, commercial or non-commercial, contain a bacterial origin of DNA replication, a phage coat protein with a multiple cloning site for the code and a phage packing signal (13, 155, 250). This results in the possibility to replicate in the bacterial host as a plasmid, and the ability to be packed into a phagemid particle or recombinant phage upon infection with helper phage (superinfection). The helper phage provides the necessary genes for viral structure proteins, packing and phage assembly, which were not encoded on the phagemid vector. The phagemids offer several advantages compared to vectors with whole phage genome. They are easier to clone and amplify in bacteria, easier to manipulate by molecular biological standard procedures, easier to isolate from bacteria as double stranded DNA directly accessible for further 22 2 The use of Phage display affinity selection in the post-genome era
modifications and they are more stable than filamentous phage which are prone to mutational deletions.
Phagemids are transformed into a bacterial host e.g. E. coli with a F-conjugated plasmid for amplification and/or modification. After infection of phagemids carrying bacteria with natural helper phage, the phagemid DNA is packed into phage particles which display the product of the heterologous inserts as fusion to a phage coat protein on the phage surface. Each vector system can bee classified as type 3 or type 8 depending on wether the fusion links with protein pIII or pVIII (185).
2.5 Principle and applications of phage libraries
2.5.1 Random peptide libraries
Combinatorial peptide libraries obtained by random synthesis of short nucleotides is a powerful tool to study peptide-protein interactions. The pIII coat protein tolerates fusion peptides in the range from six (323) up to 38 (183) amino acids in length. The fusion to pVIII seems to be limited to six to eight amino acids (187). The formation of stable secondary structures is strongly limited by the shortness of the presented peptides.
Several approaches to introduce stable secondary structures have been reported;
O'Neil et al. introduced flanking cystein residues in the oligonucleotide synthesis design for the formation of intramolecular disulfide bridges to generate constrained peptides
(270) whereas others cloned the peptides into the loop of structural scaffold proteins
(244). These libraries have been largely used in finding binding partners to a wide range of biologically relevant targets as reviewed (46, 397). For example, they were used to screen for peptides that bind to pathogen specific antibodies (95, 195, 243,
254, 264, 345, 394) or peptide that bind to bacterial surface, which are of diagnostic 2 The use of Phage display affinity selection in the post-genome era 23
value (162). The selected sequence can together with the genome information of the organism be used for the identification of the natural protein by homology comparison
(184). But in several approaches no correlating protein in the databases could be identified and thus the identified peptides represent immunogenic mimitopes.
Nevertheless, these peptides provide diagnostic tools and are putative vaccine candidates. Ide et al. identified a peptide that binds to H7 flagellin, showing the diagnostic potential of these peptides (162). Furthermore, a neutralizing effect of peptides in animal experiments was shown (80, 353). Together with the availability of genome information and the developing protein-modelling, it may be possible to identify the corresponding proteins and their nonlinear epitopes.
2.5.2 Antibody libraries
The isolation of antibody fragments raised against specific targets still represent the most powerful application of phage display. The first successful affinity selection was reported in 1990 from Mc Cafferty (248). The combinatorial antibody libraries were obtained by cloning the V-genes (genes of variable heavy (VH) and variable light (VL) chains, obtained from B-cells of different lymphoid sources like blood, spleen, tonsils or bone marrow. Two different types of antigen-binding fragments have been displayed on phage (i) the bigger FAB-fragments (110, 155), and (ii) the smaller single chain variable fragments (scFv) (248). Antibody libraries will reduce the time and money required to produce antibodies and to obtain the corresponding gene fragments (75). Many libraries, representing three different types of immune repertoires (immune, naïve, synthetic) have been cloned and displayed on phage. Their immune repertoire is illustrated in figure 3.
24 2 The use of Phage display affinity selection in the post-genome era
Figure 3: Sources of antibody libraries.
The circles represent the immune repertoire of the libraries from different sources. The libraries are from an immunized donor (1), from a naïve donor (2), or represent a library with a synthetic repertoire (3) (adapted from (297)).
(1) Immune repertoires / immunized donor
Libraries with an immune antibody repertoire represent a mirror of the natural immune response. They have the advantage of presenting only antibodies produced against real antigenic structures seen by the immune system. Therefore, relatively small libraries can be used for a successful affinity selection. Furthermore, the antibodies are normally affinity matured, increasing the number of high affinity antibodies (34, 57). On the other hand, an individual has to be immunized with the target and libraries are dependent upon the individual immunresponse of the donor. Additional affinity selection fails for toxic targets, self-antigens and nonimmunogenic structures. The major drawback of immune libraries is that every new target needs a new library.
Libraries from many different donors are described in literature. Mice (6, 57) are most frequently used as donor, but rabbits (206), chicken (385), sheep (49) and primates
(348) and even such exotic animals like dromedary (209) were used as sources for the construction of antibody libraries displayed on phage surface.
(2) Naive repertoires / naive donor
Antibody libraries are constructed with mRNA from B-cells of non-immunized donors.
Therefore, they are independent of the donor's immunological background. Compared to libraries constructed starting from mRNA of immunized donors, naïve libraries offer several advantages: These libraries are not biased to a given antigen-specific immune 2 The use of Phage display affinity selection in the post-genome era 25
response since donors have not been immunised and can be used for selection against different targets. Furthermore, antibodies against self-antigens, toxic structures and non-immunogenic targets can be identified during affinity selection. On the other hand, the complexity of these libraries must be higher (>109) than those derived from immunized donors to obtain high-affinity antibodies (362). So far most of these libraries have been constructed starting from human V-genes. However, there is no technical limitation in constructing V-genes from other species such as mouse, rat or rabbit.
(3) Synthetic repertoire
The antigen bindingsite of an antibody is determined by six complementary determining regions (CDR). Only one (the CDR3 of the heavy chain) of these six CDRs shows high structural variations (53) and contributes up to 70% to the affinity of the antibody to its antigen. Therefore, libraries with a synthetic repertoire are artificially constructed in vitro by assembly of the V and D/J genes randomizing the VH-CDR3 region (9). Other approaches like randomization of light and heavy chain CDR3 (48) and diversification all three loops in one VH-segment (109) were reported. One striking advantage of semi-synthetic antibody repertoire libraries is their antigen-independency, allowing affinity selection of binding molecules raised against almost every target. Although in most cases the selected antibodies are of low affinity, the sequence information can be used as starting point for the development of high affinity binding partners by further randomization of the amino acid sequence of the CDR's followed by further selection against the antigen.
Applications:
Antibodies derived from one of these libraries can be used for a broad range of applications, like ELISA, Immunoprecipitation, Western blot and immunohistochemistry.
Microarray technology for the analysis of protein interactions will be most important in the future (192) and will benefit from antigens or antibodies derived from phage display. 26 2 The use of Phage display affinity selection in the post-genome era
There are calculations that several hundred thousand different antibodies are needed to screen for example the whole human proteome (78, 152). In vitro selection of antibodies seems to be the only rational way for this, promising a great future of antibody phage libraries in the post-genome era. Furthermore, antibodies directed against pathogens, have a great diagnostic and prophylactic impact. Tessmann et al. for example identified high affinity antibody fragments against Hepatitis C virus, with potential diagnostic and therapeutic value (347).
2.5.3 cDNA libraries
The cDNA based phage libraries present the whole diversity of structures expressed by any organism or tissue at the moment of mRNA preparation. The affinity selection can be performed with any desired ligand or protein. An advantage is that cDNA libraries only code for natural ligands thus avoiding selection of ligands that only mimic biological structures with affinity to the target molecule. In many phage display systems, the fusion to the coat protein has to occur at the N-terminal end because the
C-terminus is essential for the integration of the phage gene product into the phage coat. Full length cDNAs carry stop codons at the 3´-end hampering a direct fusion to the N-terminus. Crameri et al. solved this problem by introducing the fos/jun leucin zipper interaction to provide a covalent link between the coat protein and the expressed cDNA products (66, 68). Other approaches for cDNA libraries are described in the literature: Hufton et al. or Jespers et al. for example fused the cDNA to the carboxy- terminal end of the phage coat protein pVI (158, 169), and more recently different fusion approaches aimed to allow display of cDNA libraries on phage surface have been proposed (14, 150, 315). However, their usefulness in practice remains to be demonstrated. 2 The use of Phage display affinity selection in the post-genome era 27
Display of cDNA products on phage surface is limited by the feasibility of expression of the gene products by the bacterial host and the necessity to translocate them into the periplasmic space of the host (245).
One promising application is affinity selection against sera from patients. Nothing has to be known of the interacting partners in this case. Although allergens selected using the serum of sensitised patients has been the major field of this application of cDNA display as exemplified by the successful isolation of IgE-binding proteins from the allergenic sources Aspergillus fumigatus (65, 145), Malassezia furfur (221), Coprinus comatus (26), peanuts (188, 189) and mites (87), many other ligands have been used to screen cDNA expression libraries as recently reviewed (64).
The use of purified protein targets in affinity selection of cDNA libaries, has been employed in large approaches. In the field of pathogens for example interacting
Plasmodium falciparum proteins with the erythrocyte membrane have been identified, leading to better understanding of this infection (208).
2.5.4 Whole genome libraries cDNA libraries represent only the sequences of genes expressed during the mRNA preparation, missing those which are not expressed in culture, e.g. only under the pressure of the host immune response. For some bacteria, like Borrelia, the different expression of proteins is well investigated (42, 320, 386), leading to the absence of a unknown number of proteins. The use of whole genome libraries, obtained from randomly fragmented DNA, will overcome these limitations, because all genes are present in overlapping fragments, independent of their expression level in the donor.
Because phage of whole genome libraries express smaller fragments, they might also overcome some of the limitations the E. coli expression machinery. On the other hand, they contain many fragments in the wrong reading frame or orientation, which increase 28 2 The use of Phage display affinity selection in the post-genome era
the required library size for a successful affinity selection. For small genomes, like bacterial ones, this is not a major concern, but in case of large genomes one needs to overcome these limitation. Zacchi et al developed a method for selecting functional open reading frames, leading to phage display vectors with functional ORFs fused to coat protein gene gIII (391), which might represent a promising way for large genomes.
The application of whole genome libraries so far includes beside the identification of epitopes (94, 276, 302, 379), the identification of yeast interacting proteins (147), the identification of fibrinogen binding proteins (166) and fibronectin and IgG binding partners (165, 166, 223, 259, 260). We identified for example several proteins of
Borrelia with a potential role in diagnosis and vaccination (260).
The field of using whole genome libraries is just at the beginning offering some of the greatest opportunities to phage display technology in the post genome era.
2.6 Affinity selection strategies
The general aim of the affinity selection is the separation of binding clones from the non-binding ones. Depending on the chosen strategy, ligands with different properties will be enriched. The affinity selection strategy determines what will be selected.
Beside the strategy of phage selection, the size of the library has a great impact on the kind of phage which will be affinity-enriched. Va ughan et al. showed an increasing affinity of selected phage antibodies with increased library size (224, 361). Increasing the size of a library from 3x107 up to 1x1010 independent clones enlarges the affinity of selected antibodies from 106-7 M-1 up to 108-10 M-1.
However, the size of any library based on biological information is limited by the number of sequences which can be transformed into biological systems. In nature antibodies undergo "affinity maturation" through natural selection of antibodies with high affinity for the antigen. Several phage display approaches have been developed to 2 The use of Phage display affinity selection in the post-genome era 29
mimic this process. The diversity of a coding sequence can be introduced by several methods, like error-prone PCR (74, 139, 219), passing through mutator E. coli strains
(164, 228), chain- or DNA shuffling (62, 172, 241, 291, 392) or site directed mutagenesis (117, 318, 365). These techniques primarily have been developed for antibody libraries, but analogous techniques have been used to increase the diversity of peptide libraries.
The second great impact on the affinity of selected clones originales from the kind of selection strategy which is chosen for the affinity selection of the library. Some of the currently most commonly used selection strategies are illustrated in figure 4 and figure
5. One can distinguish between different forms of the target and the way by which bound phage are eluted. Phage can be eluted either non-specific or specific. For non- specific elution, bound phage particles are eluted with non-specific methods like change of pH (acidic or alkaline, gradient or one step) (176, 303), chaotropic agents or by oxidising agents (127) (see figure 4 (I)). Because non-specific adsorption to the matrix or to the ligand itself occurs, a more specific method, is the competitive elution of bound phage either by an excess of the ligand or by displacement with target specific antibodies (57, 252) (see figure 4 (II)). In different experimental setups binding affinity might not be the major goal and as a consequence thereof, the selection strategy needs to be adapted e.g. to use the properties of the ligand in elution (101)
(see figure 4 (III). All modifications of the elution strategy have the reduction non- specific "background" phage as final goal.
The simplest form of affinity selection is the screening of the library against a solid phase immobilized target, also called “biopanning”. For biopanning the target is immobilized and incubated with the phage library. Non-bound phage are washed away during different washing steps and bound phage particles eluted afterwards (see figure
5 (I)). Other affinity selection strategies to reduce non-specific phage and to raise affinity are the reduction of the target concentration during the different rounds of 30 2 The use of Phage display affinity selection in the post-genome era
affinity selection or increasing the numbers of washing steps or the enhancing of the washing stringency. A higher washing stringency can be achieved by performing the affinity selection on a column carrying the immobilized ligand (see figure 5 (III)) or by introducing an additional selection step via a labeled target (see figure 5 (II)). This approach reduces also conformational changes of the target occurring during direct coating on solid phases and enhance the chance of success. Sometimes the non- specific background phage can overgrow the selected phage population. Therefore, a second affinity selection step can be required without amplification of the phage between the selection rounds (239, 240).
(I) unspecific (II) specific (III) functional
figure 4: Overview of currently most popular elution methods in affinity selection.
After several washing steps elution can be either performed non-specific (I), specific with antibodies or an excess of antigen or (III) by specifc catalysis.
In some cases, it is hard or still not possible to purify the target, and in such cases selection strategies other than biopanning or column selection must be applied.
Methods for affinity selection of cognate phage on tissue, cells or immunoblot have been described (see figure 5 (VI)) for example for the selection of receptor-specific phage using whole cells (see figure 5 (IV)). Cells carrying extremely abundant target molecules, or a biased library will be necessary for successful selections on these complex target systems, otherwise phage binding to irrelevant cellular structures will overgrow the specific ones. Because this is not always possible, a double selection strategy should be performed: substractive selection of the phage libraries on cells with 2 The use of Phage display affinity selection in the post-genome era 31
down regulated expression of the target of interest is the method of choice in such cases (see figure 5 (V)). By subtractive selection, phage specific for other cell surface proteins, are depleted from the library and pre-selected phage can the be used in further rounds of affinity selection of target cells expressing the target of interest. Cells overexpressing a given target can be separated from low expressing cells before elution of specific phage, e.g. via FACS (76), further increasing the chance to isolate target-specific phage. A second method is the change of the cell type during affinity selection, if both cell types express the target of interest. By this procedure, phage specific for other proteins do not find a binding-partner on the second type of cells which express different patterns of surface proteins. However, this method will only lead to success, if the cells differ in most surface proteins. By panning on whole cells, phage binding to yet unknown targets have been isolated (212, 357). Another method, that aims at co-selection of proteins and their associated targets is the selectively infective phage (SIP) (171, 197, 330) (see figure (VIII)). In this case, the infective region of pIII (the last two amino terminal domains) is deleted, so that the phage are no longer infective for E. coli. The infectivity is restored by the conjugation of the target with these two domains. By this way only phage bound to the desired target can infect the bacterial cells and will be amplified, whereas the "background" phage will not be amplified because they are not able to infect the host. However, further understanding of the infection process will probably be needed for further improvements of this method. Pasqualini et al. and others (280,Johns, 2000 #333, 350) performed affinity selections in vivo by injecting a library directly into living mice (see figure 5 (VII)). This approach enables for example the identification of peptides that selectively bind to markers that delineate the vasculature of different organs, or specifically bind to tumors
(for review see (194)).
The best chance for a successful affinity selection of cognate phage is warranted by the use of a well defined and pure target, because selection against complex targets is 32 2 The use of Phage display affinity selection in the post-genome era
more difficult due to small amounts of the target present in a complex mixture leading to high backgrounds of non-specifically bound phage (214). The above described selection strategies represent useful methods to overcome these problems (6).
Cambridge antibody technology's "pathfinder" selection is a novel phage display affinity selection strategy (273) (see figure 5 (IX)). Either the target or a ligand neighboured to it is conjugated with a peroxidase enzyme, which catalyzes the release of biotin tyramine free radicals. Phage bound in the proximity are biotinylated and can be selected with streptavidin. This tequnique has been used for the identification of antibodies specific for receptors (273, 339).
2.7 Summary of phage display
The phage display technology was introduced nearly 20 years ago, but is still at the starting point of its exploitation. Phage display offers a powerful platform technology for the rapid identification of interacting peptides, proteins or antibodies. The molecules can be selected and identified even in 2 to 4 weeks. The possible advantage of phage display technologies has been discussed in several fields. The diagnostic field will benefit from phage libraries, by identification of molecules that are unobtainable in such short time by classical methods. However, other areas like in the field of tumor research (395), in drug discovery (205, 227) or allergen identification (64) represent promising applications. Phage display will play a major role in the post-genome era, where the identification of function and characterisation of proteins are in the focus of research. 2 The use of Phage display affinity selection in the post-genome era 33
bio
magnet coated beads target Strep biotinylated (I) biopanning (II) tagged target (III) antigen column
(IV) direct on cells (V) substractive (VI) on tissue/blots
N-terminus of pIII biotin activated tyramid biotin
binding HR infection coli P F-pilus E. bio no binding no infection
(VII) in vivoantigen (VIII) selective (IX) pathfinder infective phage
figure 5: Overview of currently most popular selection strategies.
(I) The simplest form is the affinity selection on target adsorbed onto a solid support. (II) To avoid conformational changes and crease specifity, selection of specific antibodies to biotinylated antigens is preferable. Bound and unbound phage are separated using streptavidin coated magnetic beads. (III) Immobilization on a column can be performed to allow to increase washing stringency. (IV) Selection on cells can be done directly by performing affinity selection on whole cells (V) or a substractive approach can be performed, e.g the cells of interest are separated via FACS. (VI) If the target is unknown or not purifiable, e.g. blots or even tissues or organs can be used for specific phage affinity selection. (VII) In vivo selection, (VIII) infection- mediated or (IX) the pathfinder method are possible procedures (adapted from Hoogenboom et al. (154)).
3 Phage surface display as a tool to identify
novel Borrelia antigens for serodiagnosis
Markus Mueller1, Michael Weichel2, Isabel Diterich1, Carolin Rauter1, Dieter Hassler3,
Reto Crameri2, Thomas Hartung1
1University of Konstanz, Biochemical Pharmacology, Germany,
2Swiss Institute of Allergy and Asthma Research, Switzerland and
3Private Practice, Kraichtal, Germany
revised to J. Clin. Microbiol.
3.1 Abstract
The serodiagnosis of Lyme Borreliosis (LB), the most common tick-borne disease, is still unsatisfactory. Serological tests using whole Borrelia lysate as antigen have several shortcomings including heterogeneity of antigen preparations and lack of standardization. The serodiagnosis could be substantially improved with recombinant and specific standardized antigens.
Here we present the application of a genomic phage surface display library as a tool to identify antigens with potential diagnostic value. This technique allows rapid isolation of even rare gene products from complex genomic or cDNA libraries by affinity selection using patient sera.
Random, genomic phage surface display libraries were generated from the three pathogenic European Borrelia strains. The libraries (>3x 106 independent clones) were
36 3 Phage surface display of B. burgdorferi s.l.
enriched by affinity selection with a serum IgG pool (panning pool) derived from six patients suffering from different stages and manifestations of LB. Restriction analysis of the clones obtained after affinity enrichment of the phage library revealed nine different
Borrelia proteins. One clone carried an open reading frame coding for the known antigenic protein BBK32 known to be immunogenic in Lyme Borreliosis. From the 9 identified proteins, two proteins (ctc, flgL) were produced sucessfully in E. coli and purified. Ctc showed higher reactivity with sera from 22 LB patients in ELISA than with sera from 13 seronegative controls. These data suggest that this identified protein represent a relevant antigenic structures of Borrelia.
Phage display technology represents a powerful platform technology to identify new antigens from the genome of pathogenic organisms by affinity selection using sera from affected patients.
3.2 Introduction
LB is increasingly recognized to cause chronic disease such as arthritis, neurological disorders, skin manifestations and arhythmia (333). LB is diagnosed based on clinical signs and patient history and confirmed by laboratory tests. Cultivation of Borrelia from patients' specimens is difficult: the pathogen is not found in blood, it occurs at low numbers in infected tissues, it grows slowly with a doubling time of around 20 h, and it requires expensive, complex culture media (61, 242, 322). Other direct methods to detect Borrelia like dark field microscopy or polymerase chain reaction (PCR) lack sensitivity, specificity and/or standardization (27, 118). Serodiagnosis still represents the method of choice despite several shortcomings such as the heterogeneity of the antigen preparations and lack of standardization. In Europe there are at least three species of Borrelia known to be pathogenic for humans, i.e. B. afzelii, B. garinii and B. burgdorferi sensu stricto (s.s.), the latter being the only species found in the United 3 Phage surface display of B. burgdorferi s.l. 37
States (10). The high variability of antigen expressed by each strain, e.g. outer surface protein C (OspC) (202), further complicates the development of suitable diagnostic antigens.
It is well established that Borrelia express different surface components depending on temperature (320), pH (42) and cell density (386). Through differential gene expression the pathogen is able to adapt to different hosts and culture conditions (73, 97, 340).
Therefore the use of antigens derived from Borrelia cultures for serodiagnosis might not represent the antigens which are expressed in the human host. Although some
Borrelia antigens are available as recombinant antigens, crude antigen extracts, i.e. lysates of whole Borrelia cultures, are still used predominantly for serodiagnosis, despite considerable cross-reactivity in ELISA, mainly due to non-specific anti-flagellin antibodies (2, 234). Therefore, ELISA results need confirmation by immunoblot analysis in which individual antigens are separated according to their molecular mass to judge the specificity of the respective antibody response (332). A further limitation of these tests is the lack of discrimination between active and past LB (332). In addition, the variability of the antigen preparations in different serological tests and test kit lots, the lack of immunoblot standardization for both performance and interpretation, results in labor-intensive and subjective outcomes (160) and hampers long-term monitoring of therapeutic effects.
The relevance of LB becomes evident by its high seroprevalence in Europe and the
United States (268, 272, 288), the high rate of infected ticks in endemic areas (up to
35%) (293), the putative link to diverse manifestations (334) and the poor results of antibiotic treatment at late stages of the disease (220, 337, 338, 384), calling for an improvement of diagnostic methods.
Here, a new strategy to identify specific and reliable antigens was developed. Random genomic libraries of three Borrelia species were generated and cloned into a phage surface display vector. The pJuFo phage surface display technology (68, 69) has 38 3 Phage surface display of B. burgdorferi s.l.
previously been successfully applied to identify allergens from cDNA libraries of
Aspergillus fumigatus (65, 145), Malassezia furfur (221), Cladosporium herbarum (373,
374), Alternaria alternata (373), Coprinus comatus (26), peanuts (188, 189) as well as mites (87). Here, we extended this approach to identify phage displayed antigens from genomic Borrelia expression libraries by selecting with patients` IgG.
A pool of sera from patients suffering from LB was used to enrich phage encoding serologically relevant antigens. The respective full-length proteins were deduced from the nucleotide sequence after comparison with the published Borrelia genome (103).
Two proteins (ctc and flgL) were produced recombinantly and tested as to their suitability as antigens for serodiagnosis to show the potential of phage surface display as a rapid method for the identification of diagnostic targets from pathogenic organisms.
3.3 Materials and Methods
Cultivation of Borrelia and DNA purification
The strains B. burgdorferi s.s. (N40), B. afzelii (VS461) and B. garinii (PSTH) were grown at 33°C in BSK-H medium (Sigma-Aldrich, Deisendorf, Germany) to a cell density of >108 cells per ml as described (81). All Borrelia strains were kindly provided by T. Kamradt (Berlin, Germany). Only strains subcultured less than 10 times were used, since experiments with low and high passaged Borrelia have shown, that outer surface protein expression varies and infectivity decreases after 11 to 15 passages of in vitro cultivation (266, 319). The infectivity of the N40 strain was confirmed in mouse experiments (C3H/HeN) by the induction of joint swelling after 40 days. Bacteria were harvested by centrifugation (10000xg, 20 min) and washed twice in 0.9% clinical saline
(Berlin-Chemie AG, Berlin, Germany). Total chromosomal and plasmid DNA was purified with the QiaAmp tissue kit (Qiagen, Hilden, Germany), according to the 3 Phage surface display of B. burgdorferi s.l. 39
manufacturer's recommendations. The DNA was eluted with 100 µl Tris/EDTA buffer, pH 8.0. The concentration of DNA was determined spectrophotometrically using a
GeneQuant II RNA/DNA Calculator (Amersham Biosciences, Freiburg, Germany).
Construction of phage surface display libraries
An independent phage surface display library for each of the three Borrelia strains known to be pathogenic for humans (B. burgdorferi s.s., B. afzelii, B. garinii) was constructed by helper phage superinfection according to the protocol previously published (11). Briefly, 2 µg of Borrelia DNA were partially digested with MboI
(Fermentas, St. Leon-Rot, Germany) and restricted fragments > 500 bp were isolated after separation on preparative electrophoresis gels (1%-agarose). The genomic DNA fragments were ligated into a BglII (Fermentas) restricted pJuFo vector (66, 68) at a molar ratio of 1:3. The precipitated ligation mixture was used for electroporation (Gene
Pulser(tm), BioRad Laboratories, Hercules, CA, USA) of E. coli strain XL1-Blue
(Stratagene, La Jolla, CA, USA). The primary size of the libraries was calculated from the absolute number of independent ampicillin resistant colonies obtained.
Selection of sera for the biopanning
Sera from six patients with clinical manifestations of LB were selected by an experienced general practitioner (D. Hassler). As shown in table 1, all patients suffered from Lyme arthritis. Additional symptoms were myocarditis (patient 1), acrodermatitis chronica atrophicans (patient 4), neuropathy (patient 5) and palpitations (patient 6). All the sera showed positive antibody titers in ELISA and specific bands against Borrelia extract in Western blot (Labor Dr. Selig, Karlsruhe, Germany).
40 3 Phage surface display of B. burgdorferi s.l.
Tick Nr. of Patie bite ELIS WB 2 band AB3 age EM 1 LB symptome nt recal A titer (IgG) therapi l es 1 Lyme arthritis (knee) 61 + + 1:320 39;41;60;66;73;94 extrasystoles, 2 myocarditis Lyme arthritis (knee, 2 1 :80 31;41;60;94 4 35 - - elbow), arthralgia 17;31;34;41;60;73; 3 58 - - 1:640 Lyme arthritis 2 94 4 35 - - 1:<40 60 Lyme arthritis, ACA 1 Lyme arthritis (knee, 5 1:160 31;60;73;94 2 59 + - fingers), neuropathy 25;31;39;41;60;66; Lyme arthritis (knee), 6 28 - - 1:80 - 73;94 palpitationen 1 Erythema migrans 2 Western blot 3Antibiotic
Table 1: Sera used for the panning pool.
Clinical data of the six LB patients, whose sera were used for the panning pool.
Selection of recombinant phage interacting with patients sera
Polystyrene microtiter wells (Greiner, Nürtingen, Germany) were coated with HRP- linked murine anti-human IgG monoclonal antibodies (Zymed Laboratories Inc., San
Francisco, CA, USA). Free binding sites were blocked with Tris-buffered saline (TBS,
2.6 mM KCl, 137 mM NaCl, 25 mM Tris/HCl, pH 7.4) containing 3% skimmed milk powder (Migros, Zürich, Switzerland). Thereafter, 80 µl TBS and 20 µl of the panning pool sera were added to each well and incubated at 4°C overnight. After washing,
1.8x1011 – 1.6x1012 cfu of each of the phage libraries was added to separate wells and incubated for two hours at 37°C. In a parallel setting, a mixture of equal amounts of each of the Borrelia libraries (mixed library) was enriched. The subsequent washing steps, purification and reinfection procedure for further cycles of affinity selection were performed as described (66). Briefly, unspecific phage were eliminated by 10 (cycle 3 Phage surface display of B. burgdorferi s.l. 41
one to three) or 20 (cycle four and five) consecutive washing steps and adherent phage were eluted by a pH-shift (100 mM glycine/HCl, pH 2.2). Eluted phage were titrated and used to reinfect E. coli for a further cycle of affinity enrichment. The enrichment of the phage was monitored by titration of the number of cfu after each cycle of selection and growth (except round 1).
Sequencing of enriched clones
After five cycles of selection, E. coli XL1-Blue were infected with the eluted phage as described above. The phagemid DNA of randomly picked clones was prepared
(standard alkaline lysis) to test the diversity and insert size of the enriched phage by restriction enzyme analysis with PstI (Fermentas). Further, to identify the respective
Borrelia proteins encoded, the inserts differing in their size were sequenced using the
Thermo Sequence Fluorescent Labelled Primer Cycle Kit (Amersham Pharmacia
Bioscience) and an ALFexpressTM machine (Amersham Pharmacia Bioscience). The
5´end of the primer (5´ GGAGTTCATCCTGGCGGC 3´) (MWG, Munich, Germany) was labelled with Cy5. Sequence analysis and all further protein analyses were performed with the OMIGA software package (Accelrys, Cambridge, UK) and the BLAST Search in the National Center for Biotechnology Information (GeneBank) databases.
Production of recombinant proteins
All the newly identified proteins were produced, however, only flgL and ctc resulted in high enough yields for testing. Hence, these two proteins as well as the well known antigen OspC, were produced as N-terminal His6-tagged fusion proteins as described
(26) in E. coli Bl21 codon plus cells (Stratagene). The open reading frames were amplified by PCR using the following cycling conditions: 94°C for 60 s, 56°C for 45 s and 72°C for 80 s over 30 cycles, followed by a terminal extension cycle at 72°C for 10 min with the primers listed in table 2. The amplification products were purified over 42 3 Phage surface display of B. burgdorferi s.l.
NucleoSpin columns (Machery-Nagel, Düren, Germany), digested with BamHI and
KpnI (Fermentas), ligated to BamHI/KpnI-restricted pQE30 vector (Qiagen) and used for transformation of E. coli Bl21 codon plus cells by electroporation. The gene products from expressing clones were purified under denaturing conditions by Ni2+- chelate affinity chromatography (Qiagen). The fully denaturated proteins were refolded in vitro by stepwise dialysis against TBS / 1 mM EDTA, pH 7.4 (Pectra/Por(r) MWCO
3.500, Spectrum Lab. Houston, TX, USA). Protein concentration was measured using the BioRad protein assay (BioRad, München, Germany) with bovine serum albumin as standard (Fermentas). Purity and molecular mass of the proteins were analyzed by polyacrylamide gradient gels (4-12%, Invitrogen, Groningen, Netherlands) and
Coomassie blue staining, using standard protocols.
product forward primer backward primer OspC 5´CGGGATCCATGAAAAAGAA 5´GG GGTACCTTATTAAGGTTTTT TACATTAAGTGCG 3´ TTGGACTTTC 3´ ctc 5´CGGGATCCGGACGTCGACA 5´GG GGTACCAAATCACTTTATAA A GTGGTAAG 3´ TAACAACTTCC 3´ flgL 5´CGGGATCCATGATAAATAG 5´GG GGTACCCTATTTTATAAAAT AGTAAGTCATCC 3´ CTAATAAAGTC 3 ´
Table 2: Primers used for the amplification of the respective genes.
The forward primers contain a BamHI restriction site with a 3´ nucleotide overhang at the 5´end, the backward primer contains a KpnI restriction site with a 3´ nucleotide overhang at the 5´end. The restriction sites are underlined.
Testing of the antigenicity and specificity of the identified proteins by ELISA
Selective binding of patient antibodies to the newly identified recombinant proteins was analyzed by a direct solid-phase ELISA. Recombinant Borrelia proteins in TBS (10
µg/ml) were coated over night at 4°C to Maxisorp polystyrene microtiter plates
(Greiner). After washing, free binding sites were blocked at 37°C for 1 hour with TBS 3 Phage surface display of B. burgdorferi s.l. 43
containing 3% skimmed milk powder (Migros). The plates were incubated at 37°C for 2 hours with well characterized human patient and control sera (22 patients and 13 seronegative donors) diluted 1:200 in TBS containing 3% Tween (Sigma-Aldrich). The sera were taken from patients with clinical symptoms and positive serodiagnosis
(ELISA and immunoblot), different from those used in the panning pool. Three patients suffered from Acrodermatitis chronica atrophicans (ACA), six showed neurological disorders and 13 suffered from arthritis. All controls were negative in serodiagnosis.
Alkaline phosphatase-conjugated polyclonal mouse anti-human IgG-antibody (Dako
Catomation, Hamburg, Germany) was used as secondary antibody. Plates were washed 5 times between each step with TBST (0.5% Tween20, pH 8.0). The absorbance was measured at 405 nm using a reference wavelength of 690 nm.
Statistic
Statistical analysis was performed using the GraphPad InStat program 3.0 (GraphPad
Software, San Diego, USA). Differences between two groups were assessed by unpaired t test, after confirming Gaussian distribution. In the figure ** and *** represent p values <0.01 and <0.001, respectively.
3.4 Results
Preparation of the phage surface display library
An independent expression library was constructed for each of the three Borrelia strains as described in materials and methods. The size of the libraries varied between
3.3x 106 (B. afzelii) and 7.5x 107 (B. burgdorferi s.s. and B. garinii). The diversity of the libraries was tested by PstI restriction analysis of 12 randomly picked clones of each library. All analyzed fragments showed different sizes, indicating a high diversity of the libraries. 44 3 Phage surface display of B. burgdorferi s.l.
Selective enrichment of phage binding human IgG
The three phage libraries were panned separately in single wells and in addition, a mixture of equal amounts of each Borrelia library was selected. The amount of phage added varied between 1.8x 1011 and 1.6x 1012. The number of phage eluted by pH shift after affinity cycle 5 was up to 9 fold higher than the number washed out in the last wash-fraction, indicating a selective enrichment of specific phage, despite there was no increase in the total number of eluted phage. The number of eluted phage in rounds two to five were between 5.4x 104 and 2.1x 106. There was no significant difference between different libraries during the course of affinity selection. Restriction analysis of selected clones after five cycles of biopanning showed specific enrichment as indicated by an increase in the number of phagemids carrying inserts of identical length in agarose gels. From 124 clones with insert, only 16 different insert sizes were identified.
Identification of proteins
From the 124 clones which contained an insert, two of each insert size were sequenced. Sequence analysis revealed nine distinct inserts showing a high degree of homology with proteins from the Borrelia genome. Six of the open reading frames encoded already described proteins, including BBK32, a novel borrelial protein which has recently been described as a useful antigen for serodiagnosis of LB. The other three inserts revealed predicted, not yet expressed, hypothetical proteins. Protein characteristics and GeneBank accession numbers are summarized in table 3.
In order to determine the number of clones which contained one of the 9 identified proteins, agarose gels of restriction enzyme analyses were evaluated. As shown in table 3 the insert of 71 clones could be matched with one of the 9 identified Borrelia proteins, since they possessed identical length in agarose gels. Of the remaining 53 clones, 50 contained inserts which could be attributed to Borrelia DNA-fragments 3 Phage surface display of B. burgdorferi s.l. 45
inserted in the wrong reading orientation, presumably coding for short peptides. These peptides may represent peptide mimitopes, which could be interesting candidates and will need further investigation. One clone could not be correlated with a published sequence, and two clones coded for a human open reading frame. This might represent cross-contaminations from other libraries (167) used in the same laboratory or sequences not present in the reference strain in the databases.
Production of recombinant antigens
The high level expression vector pQE30 was used for heterologous expression of the selected B. burgdorferi proteins in E. coli. From the identified proteins only flgL and ctc resulted in a sufficient expression rate (about 1 mg/l bacteria culture in LB-medium). In addition, OspC was expressed as a control protein for the ELISA. The purified proteins showed molecular weight consistent with their predicted molecular weight, calculated from the amino acid sequences. The purity and yield of these preparations was high enough to allow testing in ELISA to evaluate their potential for the serodiagnosis of LB.
Pilot evaluation of antigens for serodiagnosis
Antigen was coated to a microtiter plate and incubated with patient and control sera.
Furthermore, a Borrelia lysate mixture from all three human pathogenic strains (B. garinii, B. afzelii, B. burgdorferi s.s.) was treated the same way to compare the data obtained. As shown in figure 1 patients sera showed significantly higher ELISA signals than sera from controls against the OspC protein, the lysate and the ctc protein. For the flgL protein, no difference between control and patient sera was detectable. However, compared to the other three proteins, the signals for the flgL protein were very low
(patients 0.036 +/- 0.01; controls 0.019 +/- 0.01) and might reflect unspecific background. Since those signals were so low, background signals from the bacterial preparations in the other protein preparations can probably be neglected. The signal 46 3 Phage surface display of B. burgdorferi s.l.
intensity of the newly identified protein ctc (patients 0.248 +/- 0.05; controls 0.032 +/-
0.01) was comparable to the signal obtained for OspC (patients 0.229 +/- 0.03; controls
0.03 +/- 0.02) and the lysate (patients 0.326 +/- 0.04, controls 0.042 +/- 0.01). These data show that sera from LB patients contain antibodies against the ctc protein from
Borrelia.
Nr. of clones identified
gene product DB protein refere B.b.- B.g.- B.a.- Mixed accession size nce library library library library number [kDa] BBA26 hypothetical protein AE000790 4.9 (103) 4 5 0 7 BBK32 immunogenic AE000788 39.7 (103) 0 0 0 5 protein P35 BBL38 hypothetical protein AE001580 28.0 (336, 0 0 0 7 43) glycyl-tRNA BB0371 AE001142 50.7 (103) 0 0 0 3 synthetase (glyS) BB0332 oligopeptide ABC transporter, (103, AE001140 33.7 1 0 0 3 ATP-binding 23) protein (oppF)
BB0713 conserved AE001171 29.0 (103) 2 3 1 5 hypothetical protein BB0272 flagellar export AE001129 41.9 (112) 2 2 2 9 protein (flhB) BB0182 flagellar hook- AE001129 46.5 (103, 0 4 1 1 associated protein 3 113) (flgL) BB0786 general stress AE001177 23.6 (103) 1 0 0 3 protein (ctc ) (clones with the (10/24) (14/15) (4/19) (43/66) listed proteins/ total clones with insert
Table 3: List of the Borrelia genes and related products.
The open reading frames which were identified by sequencing the pJuFo vector after enrichment against the panning pool. The number of clones indicates how many of the clones analyzed carried the respective insert. The sequences were applied for an European patent (registration number 02 018 511.2) 3 Phage surface display of B. burgdorferi s.l. 47
OspC lysate 0.50 0.75 *** *** 0.50 405 405 0.25 A A
0.25
0.00 0.00
patient control patient control
ctc flgL 1.25 0.50 1.00 0.50 ** 405 405 0.25 A 0.25 A
0.00 0.00 patient control
patient control
Figure 1: Pilot evaluation of the proteins
ELISA signals of sera from 22 patients (Acrodermatitis chronica athropicans patients as circle, patients with neurological disorders as quad and patients with Arthritis as triangle) and 13 sera from healthy controls in a dilution of 1:200. Signals were expressed as A405 (absorbance at 405nm). Bound antibodies were detected using anti-human IgG labeled with alkaline phosphatase. Data from patient sera are expressed as individual results and group mean. ** and *** represent p values <0.01 and (0.001, respectively. 48 3 Phage surface display of B. burgdorferi s.l.
3.5 Discussion
A comparison of six current diagnostic tests, including skin and blood culture, quantitative PCR, conventional nested PCR and 2-tiered-serologic testing, showed that no single diagnostic modality was suitable for detection of B. burgdorferi s.l. in every patient with erythema migrans (EM) (267). Furthermore, the first report evaluating the accuracy of the diagnostic methods for LB in Germany made it clear that further standardisation of LB serology is needed and that more stringent criteria for the validation of available test kits must be applied (160). Therefore, the main objective of this study was the identification of antigenic structures of B. burgdorferi s.l. by affinity selection of genomic Borrelia phage surface libraries with sera of infected persons. The affinity selection against human IgG led to the enrichment of phages and the identification of nine open reading frames. The encoded gene products might qualify as serodiagnostic antigens.
Several other approaches in the refinement of diagnostic tests for detection of Borrelia have been undertaken. Searching Borrelia DNA in patient specimens by PCR is a diagnostic method tool which has been developed and improved over the past years
(226). Further different methods have been developed to identify the Borrelia species contained in a sample: i.e. reverse line blotting (RLB) (356) or restriction fragment length (77). We have developed a LightCycler-based PCR protocol for the simultaneous identification and quantification of the different B. burgdorferi s.l. species
(293). PCR is useful for the detection of Borrelia, when the localisation of the pathogen is clear, e.g. in patients with EM or acrodermatitis chronica atrophicans (301). However the detection of Borrelia in cerebrospinal fluid (CSF), urine or synovial fluid is more difficult and not yet in routine clinical practice. These methods also have a high susceptibility to contaminations resulting in false positive results. 3 Phage surface display of B. burgdorferi s.l. 49
Another diagnostic approach for the direct detection of Borrelia in a LB patients is the blood culture, but results only become available after 12 weeks and the sensitivity of large-volume blood cultures in patients with early LB has been reported to be as low as
40% (383).
At present, history, clinical signs and serodiagnosis by ELISA and subsequent Western blot analysis represent the "gold standard" for the diagnosis of LB recommended by the
American Center for Disease Control (CDC). The drawback of the current tests lies in the lack of sufficient sensitivity and specificity. Even more important is the fact that to date screening of disease-specific antigens relies on extracts from bacterial cultures.
These approaches miss the antigens which are only expressed within the human organism and are cross-reactive with other species. A alternative solution to crude
Borrelia extracts is the use of pure recombinant pathogen proteins as antigens (217,
231, 275). However up to now this approach has been limited to the proteins (e.g. p18, p39, OspA, OspC, p41) known to represent antigenic determinants in LB and the results obtained with them are not satisfactory.
A similar approach for the detection of disease-relevant antigens for LB serodiagnosis is the use of peptide or cDNA expression libraries for the identification of novel antibody binding structures. Kouzmitcheva et al. used a large random peptide library in phage display format to identify relevant diagnostic peptides. However, of 17 different amino acid sequences with a diagnostically useful binding pattern none could be matched with segments of proteins from Borrelia (195), thus they apparently only represented mimitopes. In a different approach, differential screening of a B. burgdorferi N40 expression library with 2 sets of sera from mice either hyperimmunized with killed spirochetes or infected with Borrelia led to the identification of in vivo expressed antigens including P21, BBK50 (initially named p37) and BBK32 (initially named p35) (96, 340). Recently BBK32 has been shown to be a useful antigen in serologic assays for LB even in early and late stages (203). However, this approach is 50 3 Phage surface display of B. burgdorferi s.l.
limited by the use of murine sera instead of representative sera from patients and by the screening of a B. burgdorferi s.s. library only, thus neglecting antigens of the other
Borrelia strains pathogenic for humans.
In the work presented here we overcome these limitations by using a pool of sera from
LB patients for screening, and including whole genomic libraries from the three relevant human pathogenic strains (B. burgdorferi s.s., B. garinii and B. afzelii). Well characterized laboratory strains were chosen, despite the risk of lacking some plasmids present in clinical isolates. However, the genome of Borrelia is considered to be relatively stable. This might be attributed to the fact that a big portion of the house- keeping genome is actually located on plasmids, rendering them essential for the bacterium (103).
The selection of the sera for the panning pool is a critical step in the procedure. The inclusion of false-positives is of lesser concern, because they do not contribute to the selection of positive clones. However, important antigens might be missed if the panning pool is not representative. Therefore, six patients with confirmed LB were selected by both, clinical inspection by a general practitioner and routine serodiagnosis by ELISA and immunoblot according to the state of art. Up to now, no routine methodology is available to identify the Borrelia species infecting a given patient.
However, our recently published distribution of Borrelia in ticks in Southern Germany shows 53% B. afzelii, 18% B. garinii and 11% B. burgdorferi s.s., 18% double and triple infections (293), as well as multiple infections in patients (324). Therefore, it is likely that the serum pool used in this study included antibodies against all three species.
Furthermore, the primary aim of this study was to identify antigens shared between the different Borrelia species, which should be identified even if not all species were represented in the serum pool used for panning. A major concern, however, is the fact that all sera except one were from LB patients in chronic stages. Therefore, antigens relevant in cases of acute LB might have been missed. This possible limitation to sera 3 Phage surface display of B. burgdorferi s.l. 51
from late-stage disease was chosen because these patients represent a major challenge for diagnosis and treatment (333).
Our screening strategy resulted in a number of antigens which included both the recently identified antigen BBK32, a promising candidate for the use in the laboratory diagnosis of LB (203) and new antigens not yet reported to be immunogenic. Two of the proteins were expressed successfully and tested. One of them (ctc) showed in a pilot evaluation specific binding to patient IgG. No specific binding was observed to the flgL. These findings are in line with the literature, where approximately 20% specific clones with pIII surface display were obtained (167). The antigenic nature of the other identified proteins must be evaluated in further studies. So far, the ctc protein seems to be a specific antigen in LB, and might represent a promising candidate for serodiagnosis, but further evaluation is needed. A major difficulty of such an evaluation will be to define a "gold standard" for comparison. There are patients who have typical clinical symptoms but no serological findings indicative for LB and vice versa (173). To date, we know little about the false-positive rate of Borrelia serodiagnosis. While some cross-reactivity with Treponema pallidum is well-known, though probably of lesser importance, other Treponema species have not been studied in detail. Furthermore, additional B. burgdorferi s.l. species might have to be considered, e.g. B. valaisiana, which is putatively pathogenic for humans (90).
A further application that could be envisaged for the antigens identified here could be the development of a vaccine. The vaccine based on OspA was withdrawn from the US market after 2 years because of side effects and economical considerations. Thus no vaccine is currently available. However, the fact that the natural human immune response is not protective against re-infection with Borrelia dampens expectations.
Nevertheless, the same applied to the above mentioned OspA vaccine which was shown to be effective against B. burgdorferi s.s. in clinical studies (327). 52 3 Phage surface display of B. burgdorferi s.l.
The phage surface display approach to identify antigens has so far been applied to the identification of allergens using patients´ IgE to enrich phage carrying cDNA libraries from organisms associated with allergy (reviewed in (64)). For bacterial pathogens there are a few reports of similar approaches (166, 276, 302). These were mostly based on cDNA libraries, implicating missing the antigens not expressed in culture, which might be relevant human immunogens. Here, the pJuFo phage surface system display technology was successfully applied to identify a novel as well as other putative antigens of B. burgdorferi s.l., indicating the potential of this method for the identification of immunogenic structures. The method might also represent an interesting approach for other infectious diseases which lack adequate serodiagnosis or vaccines.
3.6 Acknowledgments
We thank Claudio Rhyner, Sabine Flückiger and Corinna Hermann for helpful discussions and laboratory/technical support. We thank Sonja von Aulock for the critical reading of the manuscript. Work at SIAF was supported by the Swiss National
Science Foundation Grant no. 3100.063381.00.
4 Identification of antigenic peptides from a
genomic random phage surface display library
of Chlamydophila pneumoniae
Markus Mueller1, Stefan Michelfelder1, Inge Muehldorfer2, Karen Maehnss3, Micheal
Weichel4, Reto Crameri4, Thomas Hartung and Corinna Hermann1*
1Biochemical Pharmacology, University of Konstanz, Germany
2Altana Pharma, Konstanz, Germany
3Novoplant, Gatersleben, Germany
4Swiss Insitute of Allergie and Asthma Research, Davos, Switzerland
submitted to J. Clin. Microbiol.
4.1 Abstract
Chlamydophila pneumoniae is an emerging pathogen with high serological prevalence.
To date, the detection of immunologic responses against C. pneumoniae is based on serological tests with whole elementary bodies as antigen, which are little standardized and subjective with regard to interpretation. The use of pure recombinant and thus well characterized antigens could improve the diagnostic specificity and sensitivity, which are not satisfactory at the moment.
A random phage surface displayed genomic library of C. pneumoniae TW 183 with a complexity of 8.2x106 independent clones was generated and affinity selected by IgG- specific clones, using two different highly sero-positve serum pools. Pool 1 was
54 4 Phage surface display of C. pneumoniae
composed of eight sera from atherosclerosis patients and pool 2 of 20 sera from healthy donors. Restriction analysis and sequencing of affinity enriched clones revealed that the sequence for the polymorphic membrane protein family A (pmp19) was present in ~50% of the clones enriched using both serum pools. Open reading frames encoding porphobilinogen deaminase and serin/threonin protein kinase were present in 11% and 5% of the enriched clones, respectively. Seven other proteins were found at lower frequency. Reverse transcription PCR analysis showed that all enriched sequences were indeed transcribed during infection of HEp-2 cells. The five predominant proteins (pmp 19, porphobilinogen deaminase, serin/threonin protein kinase, deoxyribonuclease V beta, DNA topoisomerase I) might represent promising antigen candidates for the development of diagnostic reagents for the detection of C. pneumoniae infections.
4.2 Introduction
Chlamydophila pneumoniae is an important widespread human respiratory tract pathogen, responsible for about 10% of community-acquired cases of pneumonia (4,
85, 122, 180). Antibodies to this pathogen have a prevalence of 70% in adults, which might be explained by recurrent infection events (4, 123). However, there is also evidence for persistence of C. pneumoniae in the host (135, 136, 230), which most importantly has been implicated in the pathogenesis of chronic inflammatory diseases such as asthma (133), neurological disorders (341, 390), and atherosclerosis (225,
312-314).
Laboratory diagnosis of C. pneumoniae can be carried out by immunostaining or isolation and culture of the organism. PCR is the most sensitive method used for the detection of C. pneumoniae infections, but is not yet routinely applicable (7, 23, 174,
328). Therefore, diagnosis still relays on serology. To date, the 4 Phage surface display of C. pneumoniae 55
microimmunofluorescence test (MIF), although known to be a time-consuming method only reliable if performed in experienced laboratories, still represents the gold standard
(23, 367). Furthermore, multi-center trials have shown a large inter-laboratory variances in the performance of MIF (281). In recent years, partially automated ELISAs became available, however, we have reported that the reliability of these new assays varies a lot (146).
C. pneumoniae are obligate intracellular pathogens, which replicate in a biphasic life cycle. Infection begins with the attachment of the metabolically inactive elementary bodies (EB) to the host cell. After uptake of EB in a vacuole by endocytosis, they develop into the metabolically active reticulate bodies (RB). The MIF relies on the use of whole EB as antigen, while most ELISAs use extracts purified from EB, explaining the inherent problems of the test related to cross-reactivity with other Chlamydia species and further pathogens. These limitations of the current C. pneumoniae diagnosis call for serological tests based on standardized and specific antigens. Many studies were performed during the last decade in order to identify species-specific C. pneumoniae antigens. Several proteins have been identified by immunoblots using human sera from C. pneumoniae-infected patients (54, 91, 104, 168, 201), or sera from immunized rabbits or mice (38, 129, 191, 284, 360). However, so far only the outer membrane proteins MOMP (190, 382), OMP2 (56, 289) PorB protein (181) and
Cpn0980 (40) have been evaluated for their diagnostic potential in humans, but none of these antigens is presently used in routine diagnostics.
The current work therefore describes a differential phage surface display technology as a new strategy to identify specific C. pneumoniae antigens expressed at the different stages of infection. Phage display technology is widely used to identify protein-protein interactions in general and the authors recently identified antigenic peptides of Borrelia burgdorferi using sera from infected patients for the affinity selection (260).
Furthermore, allergens from cDNA libraries of several pathogens like fungi and mites 56 4 Phage surface display of C. pneumoniae
have been identified using patient IgE (64). Here, a random genomic library of C. pneumoniae displayed on phage surface was generated, screened with two serum pools from atherosclerosis patients and from healthy individuals, but containing high levels of anti-C. pneumoniae antibodies. Proteins enriched by affinity selection, thus of diagnostic potential, were identified from the nucleotide sequence carried by the inserts of selected phage via comparison with the published C. pneumoniae genome (175).
4.3 Materials and Methods
Cultivation of C. pneumoniae
Since C. pneumoniae might infect humans via aerosols, C. pneumoniae propagation as well as all following studies were carried out in safety cabinets and using personal air filters. Cultivation of C. pneumonaie, the TWAR-183 isolate (ATCC VR-2282) being used in this study, was performed by intracellular growth of the bacteria in the human epithelial cell line HEp-2 (ATCC CCL-21) (304), as described (306). The multiplication was monitored using the Kallestad Pathfinder system (Sanofi Diagnostics Pasteur,
Redmond, WA, USA). In order to exclude Mycoplasma contamination, cell cultures and chlamydial stocks were routinely monitored by Mycoplasma PCR ELISA (Roche,
Mannheim, Germany).
Extraction of DNA
For the preparation of chlamydial DNA, C. pneumoniae infected HEp-2 cells were harvested, frozen and lysed by sonification. The cell debris was separated by low speed centrifugation (10 min, 900g). The C. pneumoniae in the supernatant were pellet by centrifugation (90 min, 13.000g) and purified by step gradient density centrifugation.
DNA was prepared with the DNeasy Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The concentration of the DNA was determined 4 Phage surface display of C. pneumoniae 57
spectrophotometrically using a GeneQuant II RNA/DNA Calculator (Amersham
Biosciences, Freiburg, Germany).
Quantification of C. pneumoniae by real-time PCR
To quantify the amount of C. pneumoniae a real-time PCR was performed using a
LightCycler rapid thermal cycler system (Roche). Primer and probe sequences were selected from the 16S rRNA of C. pneumoniae (Accession no. U68426). The primers resulted in an amplification product of 640 bp. Primer sequences were for the forward primer 5’-ATGTGGATGGTCTCAACCCCAT-3’ and for the reverse primer
5’-GGCGCCTCTCTCCTATAAATAGG-3’ (Thermo Hybaid/Interactiva Division, Ulm,
Germany). Probe sequences were 5’-ACCTCACGGCACGAGCTGACGA-3’ for the fluorescein labeled probe and 5’-AGCCATGCAGCACCTGTGTATCTGTCC-3’ for the
LC Red640 labeled probe (TIB MOLBIOL Syntheselabor, Berlin, Germany). Real-time
PCR was done in 20 ml with 0.5 mM of each primer, 0.1 mM of each probe, 2 mM MgCl2,
2 ml FastStart DNA Master Hybridization Probes (Roche) and 5 ml DNA (40 ng) template. Thermal cycling was performed in glass capillaries (Roche) according to the manufacturer’s protocol (50 cycles) with an annealing temperature of 65°C and an elongation time of 26 sec. Fluorescence was measured at the end of each annealing phase. The amount of EB in the samples was determined using chlamydial DNA as standard. The concentration of the standard DNA was calculated on the basis that the chlamydial genome consists of 1.2 million base pairs with a weight of 1.3 fg.
Construction of the modified vector (pJuFoII-MM)
In order to intoduce an xba I restriction site into the multiple cloning site of the pJuFo vector (66, 68), the following hybridization probes were designed: 5´p-GAT CTA GAG
ATA TCG GTA CCG 3´ and 5´p-AAT TCG GTA CCG ATA TCT CTA 3´. The two probes were preheated to 95°C for 5 minutes then slowly cooled down to 40°C in a 58 4 Phage surface display of C. pneumoniae
period of 3 hours. The probes possess a phosphorylated nucleotide overhang, so that no digestion for further subcloning was necessary. The hybridized probes were directly ligated into BglII and EcoRI (Fermentas, St. Leon-Rot, Germany) restricted pJuFoII vector at a molar ratio of 1:3. The precipitated ligation mixture was used for electroporation (Gene Pulser™, BioRad Laboratories, Hercules, CA, USA) of
Escherichia coli (E. coli) strain XL1-Blue (Stratagene, La Jolla, CA, USA). The transfectants with inserts were determined as independent ampicillin resistant colonies.
In order to avoid deletions in the fos/jun region, which occur under low selection pressure, an additional antibiotic resistance was cloned into this part of the vector. For this purpose the promoter and the chloramphenicol resistance from the pBC SK+ vector were amplified using the primers 5’tctagctagcgataccgggaagccctgg3’ and
5’tctagctagccaccaataactgccttaa3’. The following cycle conditions were chosen: 94°C for
45 s, 58°C for 30 s and 72°C for 120 s in a total of 30 cycles, followed by a terminal extension cycle at 72°C for 6 min. The amplified gel product (850bp) was digested with
NheI, purified in a preparative electrophoresis (1%-agarose gel). and ligated into the
NheI-modified pJuFoII vector (molar ratio 1:3). The ligation mixture was again precipitated and used for electroporation (Gene Pulser™, BioRad Laboratories) of E. coli XL1-Blue. The newly constructed vector was named pJuFoII-MM. The transfectants with inserts were determined as independent ampicillin and chloramphenicol resistant colonies.
Construction of a C. pneumoniae phage surface display library
One µg of C. pneumoniae DNA was partially digested with MboI (Fermentas).
Restricted fragments >500 bp were isolated with glass milk (Macherey und Nagel,
Düren, Germany) after separation on preparative electrophoresis gels (1%-agarose).
The DNA fragments were ligated into BglII (Fermentas) restricted pJuFoII vector (66,
68) at a molar ratio of 1:3. The precipitated ligation mixture was used for 4 Phage surface display of C. pneumoniae 59
electroporation of competent E. coli XL1-Blue cells. In order to clone the inserted fragments into all three reading frames and both reading orientations the inserted DNA was amplified using the following cycle conditions: 94°C for 45 s, 56°C for 45 s and
72°C for 120 s in a total of 35 cycles, followed by a terminal extension cycle at 72°C for
10 min with all combinations of the primers listed in table 1. The products were separately purified with the MinElute kit (Qiagen) using the manufacturer’s protocol for restriction with XbaI (Fermentas). The restricted fragments were again purified with the
MinElute Kit and ligated into the XbaI restricted pJuFoII-MM vector at a molar ratio of
1:10. Phage surface display libraries were generated by helper phage superinfection as previously described (11).
Selection of sera for biopanning
Two different serum pools were used for biopanning: The first selection pool (pool 1) consisted of sera from eight atherosclerosis patients (a kind gift from Prof. S. Dimmler,
University Frankfurt, Germany) and of 20 sera from healthy volunteers (pool 2). The antibody titers for C. pneumoniae IgG were determined by ELISA (SeroCP Quant,
Savyon Diagnostic, Ashdod, Israel, purchased from Hain Lifescience, Nehren,
Germany) and MIF (SeroFIA MIF, Savyon Diagnostic). All sera were positive for C. pneumoniae and had an antibody titer ³1:512. A sera pool from 12 sero-negative donors in MIF was used as negative control.
60 4 Phage surface display of C. pneumoniae
Forward primer 5´TGTTCTAGAACACGGTGGTTGCAGATC3´ 5´GTGTCTAGACACACGGTGGTTGCAGATC3´ 5´GTTTCTAGAGCACACGGTGGTTGCAGATC3´ Backward primer 5´AGGTCTAGACCTCGATTGCGGCCGCTTAACGAATTC3´ 5´GGTTCTAGAACCTCGATTGCGGCCGCTTAACGAATT C3´ 5´GTTTCTAGAAACCTCGATTGCGGCCGCTTAACGAATTC3´
Table 1: Primers used for the amplification of the C. pneumoniae inserts.
The primer contain an xbaI restriction site with a 3´nucleotide overhang at the 5´end. The restriction sides are underlined.
Selection of recombinant phage interacting with patients’ sera
Polystyrene immunotubes (Greiner, Nürtingen, Germany) were coated with anti-human
IgG monoclonal antibodies (05-4220; Zymed Laboratories Inc., San Francisco, CA,
USA). Free unspecific binding sites were blocked with Tris-buffered saline (TBS; 2.6 mM KCl; 137 mM NaCl; 25 mM Tris/HCl pH 7.4) containing 3% skimmed milk powder
(Migros, Zürich, Switzerland). 1,9 ml TBS and 100 µl of the panning pool sera were added to the immunotube and incubated at 4°C overnight. After washing, 1011 - 1012 cfu of the phage library were added and incubated for two hours at 37°C. The subsequent washing steps, purification and reinfection procedure for further cycles of affinity selection were performed as described (66). Briefly, unspecific phage were eliminated by 10 (round one and two) and 20 (round three to five) consecutive washing steps with 4 ml TBS with 0.1% Tween. Adherent phage were eluted by a pH-shift (100 mM glycin/HCl pH 2,2), titrated and used to reinfect E. coli for a further cycle of affinity enrichment. The enrichment of phage was monitored by titration of the number of colony forming units after each cycle of selection and growth.
4 Phage surface display of C. pneumoniae 61
Sequencing of enriched clones
After five cycles of selection, E. coli XL1-Blue were infected with the eluted phage as described above. The phagemid DNA of 500 randomly picked clones was prepared
(standard alkaline lysis) to test the diversity and insert size of the enriched phage by
PCR analysis with the pJuFOII primers (5´AAAGAAAAGCTGGAGTTCATCCTGGC3´ and 5´CCCAAGCTTGGCCAGTGAATTGTAATACGAC3´) using the following conditions: 94°C for 45 s, 56°C for 45 s and 72°C for 80 s in a total of 35 cycles, followed by a terminal extension cycle at 72°C for 10 min.
Several selected clones differing in size were further characterized by sequencing the relevant inserts of the pJuFo vectors at GATC (GATC, Konstanz, Germany). All sequence analyses were performed with the OMIGA software package (Accelrys,
Cambridge, UK) and the BLAST search in the National Center for Biotechnology
Information (GenBank) databases.
Preparation of m-RNA and reverse transcription
For investigation of gene transcription, HEp-2 cells were infected in quadruplicates.
Then three wells were harvested at different time points post infection (24 h, 48 h, 72h,
96 h) as described above and mRNA was prepared from three wells. The other wells were used for DNA isolation and quantification of C. pneumoniae. Total mRNA was isolated with the Qiamp RNA Blood Kit (Qiagen) according to manufacturer’s instructions. Contaminating DNA was digested using the RNAse-free DNAse set from
Qiagen. To calculate RNA content, optical density was measured. Reverse transcription for PCR was performed according to the manufacturer’s protocol. Briefly,
6 µl mRNA was reverse transcribed in a sample volume of 20 µl containing 2.5 µM random hexamer (Gibco BRL, custom primer), MgCl2 (5 mM), dNTP (1mM each),
Rnase inhibitor (1 U/µl), reverse transcriptase (2.5 U/µl) in PCR buffer (all PE Applied
Biosystems, Germany). Samples were incubated at 21°C for 10 min, 42°C for 15 min, 62 4 Phage surface display of C. pneumoniae
94°C for 5 min and 5°C for 5 min in a GeneAmp PCR system (Perkin Elmer, Wellesley,
MA, USA).
Analysis of gene expression by real-time PCR
Real-time PCR was performed using a LightCycler rapid thermal cycler system
(Roche). Two µl cDNA (40 - 100 ng) were added to 18 µl PCR master mix (0.5 mM of each primer, 3 mM MgCl2, 10 ml Platinum Sybr Green Super Mix (Invitrogen, Karlsruhe,
Germany), containing 500 nM of each primer, listed in table 2. The following PCR conditions were used: 94°C for 45 s, 60°C for 10 s and 72°C for 18 s in a total of 50 cycles. The PCR products were analyzed by melting curve analysis as well as electrophoresis in 1% agarose gel. Negative controls were included in each run to exclude false-positive results. The different PCR were performed for all time points of harvest as well as for uninfected cells.
Gene Forward primer Backward primer melting point (Tm) * Cpn0048 5´TACACTCTCTCCCGGTAG3´ 5´CTTATCCACGGCCACTT3´ 80,0 CPn0052 5´AATGACCACGGTGGAG3´ 5´ACTTTGGTTCCAGTTAAGC3´ 84,5 CPn0095 5´CTTTAACCACAGCCCTGC3´ 5´GTCGTACCATCGACAAAC3´ 81.0 CPn0406 5´AGGTAGCATTTGTTGCG3´ 5´TTGTCGATCCACCACG3´ 72,5 CPn0539 5´ATAACGATCAGGGTGCC3´ 5´TTTGCATGTAAGCGCAAT3´ 83,5 Cpn0730 5ÁGGGTGAGAACGAACT3´ 5´ATCACGGTTCCTGGAG3´ 81,0 Cpn0738 5´CTGGTGGATAAGCTACTTG3´ 5´CTATGGGTCTCCGAAGTG3´ 79,5 CPn0769 5´TCGGCATAGTGACGGG3´ 5´GCCGCGAAGTGTGAAA3´ 82,5 Cpn0796 5´TTGCCACTTCCGTGTT3´ 5´GTTCCGTCCGGGGTTA3´ 81,0 CPn1030 5´TCTTCGGGTTGGTTGTG3´ 5´CACAACCAACCCGAAGA3´ 84,0
* Tm in °C
Table 2: Primers used for the analysis of gene transcription during the infection cycle. 4 Phage surface display of C. pneumoniae 63
4.4 Results
Construction of the modified pJuFoII vector
Since under low selection pressure the original pJuFo vector led to deletions in the fos/jun region, it was modified at two sites. An additional antibiotic resistance
(chloramphenicol) was introduced to the vector to minimize deletions in the fos/jun region. Since the bacteria grew in chloramphenicol/ampicllin containing media the new resistence gene was apparently maintained during affinity selction cycles. Furthermore, to obtain the option to clone the chlamydial DNA fragments into all three reading frames the multiple cloning site was further changed, to introduce additional restriction site (xbaI). The modified vector sequence was tested by sequencing.
Preparation of a C. pneumoniae phage surface display library
A C. pneumoniae expression library was constructed by cloning the C. pneumoniae
TWAR-183 DNA into the pJuFoII vector. The primary clone size of this first library was
7.2x 105. In order to have the fragments in all reading frames, they were amplified by
PCR and ligated into the new constructed pJuFoII-MM vector. This resulted in a library with a complexity of 8.2 x 106 independent clones. The diversity of the libraries, tested by PCR analysis and gel electrophoresis of 70 clones, showed a high diversity of the library with less than 5% empty vectors.
Selective enrichment of phage binding human IgG
Phage were enriched by affinity selection using two different sera pools from atherosclerosis patients (pool1) and healthy volunteers (pool 2). Phage recovered from the last wash fraction and eluted phage were titrated. At the end of round five for example, there was an increase of eluted phage of 970% for pool 1 and 450% for pool
2, respectively, compared to phage in the last wash fraction. On the other hand a 64 4 Phage surface display of C. pneumoniae
decrease in eluted phage was observed with the negative control sera. The number of eluted phage increased during affinity selection. From the second to the last elution there was an increase in eluted phage by a factor of four for pool 1 and 37 for pool 2
(figure 1).
100000 round 2 round 3 75000 round 4 round 5 50000
total number 25000 of eluted phage
0
atherosclerosis sera healthy control sera
Figure 1: Total number of eluted phage during affinity selection cycles.
Number of phage eluted after several washing steps (10 for round one and two, 20 for round three to five) at the end of each round of affinity selection.
Identification of selected proteins
In order to identify and characterize the enriched inserts, PCR analysis of selected clones obtained after the fifth round of affinity selection were performed. The gel electrophoresis analysis of the PCR products (250 clones from the selection against pool 1, and 250 from the selection against pool 2) revealed that most of the phage contained inserts with a size of about 300 bp (pool 1: 227 clones and pool 2: 199 clones) (table 3). Furthermore, five other clone classes showing different insert sizes 4 Phage surface display of C. pneumoniae 65
were obtained. The sizes varied between 300 bp and 600 bp. 51 clones showed no
PCR product, representing an empty vector or unsuccessful amplification. None of the phage vectors showed any deletions, indicating that the new vector pJuFoII-MM is suitable to enrich phage even under low selection pressure.
PCR product in bp empty 300 330 400 500 550 600 number of pool 1 23 128 35 27 16 17 4 analyzed clones pool 2 28 107 35 36 18 23 3 total 51 235 70 63 34 40 7 number of sequenced total - 15 6 6 6 6 1 clones
identified total - 100% 50% 66% 83% 66% 100% sequences Cpn0539 CPn0769 CPN0095 CPn0052 CPn0052 CPn0796 50% 17% 17% 17% CPn0738 CPn1030 CPn0738 CPn0048 17% 17% CPn0406 CPn0730
Table 3: Numbers of clones and the respective insert sizes.
Number of clones analyzed after the fifth round of affinity selection. To determine the size of the inserts, the clones were analyzed with PCR and gelelectrophoresis. Afterwards the clones were sequenced and a BLAST Search in the National Center for Biotechnology Information (GeneBank) databases performed. The percentage gives the frequency of the respective sequence within one PCR product size.
To identify the respective Chlamydia proteins encoded by selected clones, 20 clones obtained from each affinity selection were sequenced. The nucleotide sequences were analyzed using BLAST search and revealed 10 different chlamydial genes (table 3).
The homology of the sequenced inserts with the published sequences was nearly
100%. The clones with an insert of 300 bp consisted to 100% of the gene fragment
CPn0539, which codes for the polymorphic membrane protein A family gene (pmp19).
Intrestingly, within the sequence enriched for pmp19, the pmp-related, conserved aminoacid repeats GAA and FXXN were found to be encoded three times.
In case of representative clones of the other groups of inserts most of the clones coded for the same gene, other sequences were found within one group only at frequencies 66 4 Phage surface display of C. pneumoniae
below 20%. Among the encoded proteins were 3 membrane proteins (CPn0048,
Cpn0539, CPn0730), as well as hypothetical and well-known proteins. The percentage of phage, obtained after the fifth round of affinity selection, coding for the same gene was calculated (table 4). The most dominant gene was CPn0539 (~50%). The
CPn0052 occurred at a frequency of around 12%, CPn0095, CPn0738 and
CPn0769were present in 9.5%, 9.0 and 8% of the clones, respectively. The other genes had a lower frequency. There was no significant difference in the diversity of genes enriched against pool 1 or pool 2, except for CPn0769 which was only detected in the phage pool obtained from the enrichment against the sera pool 1.
Gene Gene product Calculate Pool 1: % Pool 2: % Total: % of d protein of of enriched size enriched enriched clones [ kDa] clones clones CPn0048 conserved 26,2 1 2 1.5 (yqfF) hypothetical inner membrane protein CPn0052 porphobilinogen 79,1 11 13 12 (hemC) deaminase Cpn0095 serin/threonin 105,8 8 11 9.5 protein kinase CPn0406 enoyl- acyl- carrier 32,0 2 3 2.5 (fabI) protein reductase Cpn0539 polymorphic 103,6 56 48 52 (pmp19) membrane protein A family CPn0730 integral membran 61,9 1 2 1.5 (mviN ) protein CPn0738 protein 121,1 9 9 9 (rec B) deoxyribonucleas e V, beta CPn0769 DNA 98,9 8 8 8 (topA) topoisomerase I CPn0796 hypothetical 72,1 2 1 1.5 protein CPn1030 predicted D - 38,1 2 3 2.5 aminoacid dehydrogenase
S 100 100 100
Table 4: Identified C. pneumonaie related gene products.
According to the size and the total number of clones analyzed the individual frequencie of each open reading frame in the enriched clones was calculated. The protein sizes were calculated with the OMIGA Software package (Acclerys).
4 Phage surface display of C. pneumoniae 67
Transcription of the mRNA during C. pneumoniae infection cycle
In order to clarify whether the identified genes are actually transcribed during chlamydial infection, mRNA from C. pneumoniae-infected HEp-2 cells was isolated and analyzed by RT-PCR and real-time PCR, using specific primers (table 2). All identified genes were transcribed during the infection cycle (figure 2), while non-infected cells did not lead to amplification products
class I 750
500
CPn 0796 250 gene expression
0 24 h 48 h 72 h 96 h
class II 300
200
CPn 0539 100
gene expression n.d.
0 24 h 48 h 72 h 96 h
Figure 2: Analysis of the selected gene transcription.
RNA from infected cells was reverse transcribed and each gene was amplified by PCR using the primers listed in table 2. For each gene the time point 96 h, when most RB have differentiated into EB, was set to 100%. Data were normalized to chlamydial DNA content. The genes could be grouped into two classes: class 1 (CPn0048, CPn0052, CPn0095, CPn0738, CPn0769, CPn0796, CPn1030), as shown for CPn0796, were expressed in early infection and the second class (CPn0406, CPn0539, CPn0730), which were expressed at later timepoints is exemplified by CPn0539 (n.d. means not detectable). 68 4 Phage surface display of C. pneumoniae
4.5 Discussion
The main objective of this study was to identify antigenic structures of C. pneumoniae by affinity selection of a C. pneumoniae phage surface display library with highly sero- positive sera of infected persons. The affinity selection of a C. pneumoniae random genome phage library against human IgG led to an enrichment of phages. In total 10 proteins (CPn0048, CPn0052, CPn0095, CPn0406, CPn0539, CPn730, CPn0738,
CPn0769, CPn0796 and CPn1030) displayed at different frequencies among the enriched clones were identified. The sequence coding for the polymorphic membrane protein family A (pmp 19) was predominant in the affinity-selected clones (~50%). This suggests pmp 19 as a major antigen with a high binding affinity to serum IgG. Pmp 19 belongs to a family of 21 pmp genes of C. pneumoniae, predicted to encode outer membrane proteins (175) and represent 17,5% of the genes expressed by Chlamydia
(305). We found that pmp 19 is expressed during infection of HEp-2 cells at all time points tested which is in line with a previous report (129). The enriched gene fragment originates from the amino-terminal part where the strongly conserved amino acid repeats (GGA and FXXN) of the pmp family are encoded (130, 305), which might elicit immunodominant responses in humans. Attempts to detect pmp19 in EB lysates by immune sera obtained from mice or rabbits failed, suggesting that pmp19 is unstable
(129, 360). However, our approach showed that anti-pmp19 antibodies are present in human sera indicating that pmp19 is expressed at least during human infection and stable enough to elict a humoral response. Furthermore, we have identified the annotated membrane proteins CPn0048 and CPn730, as well as Cpn0796, which was recently found to be surface exposed (257). Together with pmp19 these four membrane proteins are promising immunogenic structures. Six further intracellular or hypothetical proteins (CPn0052, CPn0095, CPn0406, CPn0738, CPn0769 and
CPn1030) were identified as well. CPn0095 codes for a serine/threonin protein kinase, 4 Phage surface display of C. pneumoniae 69
which is upregulated 6-12 hours post-infection (235) and speculated to be a type III effector protein. No further information is available for the other proteins.
The fact that none of the other pmp or known antigens, like MOMP (190, 382), PorB
(181), OMP2 (56, 289) and CPn0980 (40) have been identified with our approach can be explained by different reasons. First of all, many antibodies, generated during C. pneumoniae infection, are directed against conformational epitopes (54) and in particular the immunogenic epitopes of MOMP have been shown to be conformation- dependent (91, 285, 382). Since the phage do only display proteins expressed in E. coli, conformation dependent antigens cannot be detected by the phage display if they are not correctly folded by the E. coli chaperones. In addition, phage from a random genome library display only a part of a protein, may be missing conformation dependent antigens. Furthermore, antigens, that are present in the library at low frequency, can be lost during the affinity selection. Furthermore, it cannot be excluded that some antigens are lost because they are not able to cross the E. coli inner membrane to reach the periplasma where the phage are assembled (245). By using only small random fragments of one protein this limitation is partially revoked.
Furthermore our affinity selection revealed several phage-displayed membrane proteins stressing the consistency of the approach.
C. pneumoniae isolates have shown to differ antigenically and antibodies are not always cross-reactive (129, 168, 369). This problem is overcome by our approach where selection of the phage was performed with sera pools from several donors, which most probably had been infected by different serovars. The identification of specific antigens from C. pneumoniae is the first step to improve serodiagnosis and for vaccine development.
Other phage display approaches for the detection of specific C. pneumoniae antigens have been applied, using e.g random 15-mer peptide phage display libraries (243,
264). Affinity selection was performed with C. pneumoniae specific monoclonal 70 4 Phage surface display of C. pneumoniae
antibodies. In both cases, peptides with reactivity towards C. pneumoniae MIF positive sera were found, but cross-reactivity could not be excluded. Furthermore, no linear sequence identity with any chlamydial protein or DNA sequence was found, showing the limitations of the peptide phage display approach.
The pJuFo phage display approach has so far been successfully applied to identify different allergens and antigenic peptides (64). Here, the pJuFo phage surface display technology was successfully applied to identify putative novel antigens from C. pneumoniae, indicating the potential of this method for the identification of immunogenic structures, also for other infectious diseases which lack adequate serodiagnosis and vaccines.
4.6 Acknowledgments
We thank Tamar Kleber-Janke, Thomas Meergans, Claudio Rhyner and Sabine
Flückiger for helpful discussions and laboratory/technical support. We also thank
Thomas Hartung for helpful discussions and his ideas. We thank Sonja von Aulock for the critical reading of the manuscript. Work at SIAF was supported by the Swiss
National Science Foundation Grant 31-63381.00.
5 Toll-like receptor 2 and 4 do not contribute to
clearance of Chlamydophila pneumoniae in
mice, but are necessary for release of
cytokines by macrophages
Markus Mueller, Stefan Postius*, Jean G. Thimm*, Katja Gueinzius, Inge Muehldorfer*,
Thomas Hartung, and Corinna Hermann
Biochemical Pharmacology, University of Konstanz, Germany
*ALTANA Pharma AG, Konstanz, Germany
submitted to Infect Immun.
5.1 Abstract
Activation of immune cells by Chlamydophila pneumoniae in vitro has been shown to be TLR2-dependent, but TLR4 is also involved to a minor extent. To investigate the role of TLR2 and TLR4 in vivo, a murine model of C. pneumoniae infection was established. Mice were infected intranasally with a low inoculum of 106 C. pneumoniae elementary bodies (EB) and spreading of bacteria was monitored by real-time PCR.
The bronchoalveolar lavage (BAL) showed maximal bacterial load on the day of infection and the lung two days later. By day 95, C. pneumoniae were eradicated completely. In serum, anti-C. pneumoniae IgG became detectable on day 18 by microimmunofluorescence test. The course of infection was mild with no apparent
72 5 Murine infection model for C. pneumoniae
symptoms, lack of acute phase response and no induction of TNFa and IL-6 in BAL, lung supernatants or blood. Infection of TLR2-/- and C3H/HeJ mice revealed no differences in clearance of bacteria and serological responses compared to wild-type controls, even if a dose of 107 EB was used. Intracellular replication of C. pneumoniae in the lungs was proven by the effectivity of antibiotic treatment. These findings indicate that in vivo TLR2 and TLR4 are not important for the development of antibodies and elimination of C. pneumoniae.
5.2 Introduction
C. pneumoniae represents an emerging Gram-negative pathogen identified only 14 years ago (124), which occurs world-wide with a sero-prevalence of 70% in the adult population (123, 211, 311). It is assumed that C. pneumoniae account for 10% of community acquired pneumonia (4, 122, 134), but most infections are asymptomatic
(123, 132) and therefore many people are not aware they have been infected by C. pneumoniae. Due to the obligate intracellular localization of C. pneumonia, they are difficult to treat with antibiotics and often persist in the host organism (116, 132, 199,
200).
During infection, the cells of the innate immune system represent the first barrier against invading pathogens. Primarily conserved bacterial structures, the so called pathogen associated molecular patterns are recognized by specific receptors present on immune cells. The family of toll-like receptors (TLR) has been identified as key receptors involved in pathogen recognition and has been intensively investigated and characterized during the last years (3, 218). TLR4 mediates immune responses to
Gram-negative bacteria initiated via recognition of their lipopolysaccharide (LPS), a major constituent of the outer Gram-negative membrane (15, 16, 366). In contrast,
TLR2 has been shown to be activated by compounds of Gram-positive bacteria like 5 Murine infection model for C. pneumoniae 73
lipoteichoic acid (210), peptidoglycan (321) and lipoproteins from Borrelia (149), treponema (271) and mycoplasma (106).
C. pneumoniae represents a Gram-negative pathogen and carries a LPS, therefore a role of TLR4 in alerting immune responses might be assumed. However, in vitro studies have demonstrated a role of TLR2 in recognition of C. pneumoniae (60, 265,
290), but TLR4 also seems to be involved to some extent (30, 60, 290, 316). Most in vivo models investigate the association of C. pneumoniae with atherosclerosis (37, 39,
157, 247, 255, 256). Only a few reports address immune defense mechanisms. Here, an important role of CD8+T-cells and IFNg-dependent reactions for protection against
C. pneumoniae has been shown (282f, 283, 308, 309, 368). However, so far the role of the TLRs has not been investigated in vivo. Therefore, we established a murine model reflecting the natural course of infection together with monitoring methods for the determination of antibody titers and a highly sensitive, quantitative real-time PCR for the detection of C. pneumoniae burden. The role of TLR2 and TLR4 was investigated with TLR2-deficient (TLR2-/-) and C3H/HeJ mice, which express a non-functional TLR4 receptor.
5.3 Results
Bone marrow derived macrophages from C3H/HeJ and TLR2-/- mice as well as from their respective wild-types were incubated in the presence of 5x106 EB of C. pneumoniae/ml and IL-6 release was measured. As shown in figure 1, cells from TLR2-
/- mice were not able to respond to stimulation with C. pneumoniae, while cells from
C3H/HeJ mice were responsive, but cytokine secretion was significantly reduced compared to C3H/HeN cells. The responsiveness of the C3H/HeJ and of the TLR2-/- cells was confirmed by stimulation with 1 µg/ml LPS and 10 µg/ml LTA, respectively
(data not shown). These in vitro data confirm that although TLR2 is essential for 74 5 Murine infection model for C. pneumoniae
immune recognition of C. pneumoniae, both TLR2 and TLR4 are involved. In order to investigate the role of TLR2 and TLR4 for pathogen recognition and for the course of infection in vivo, we established a murine C. pneumoniae infection model.
125
100
75 ***
50
25
% IL-6 [mean of wildtype= 100%] *** 0 C3H/HeJ TLR2+/+ TLR2-/- C3H/HeN
Figure 1: C. pneumoniae inducible cytokine release by TLR-deficient murine macrophages.
5x105 bone marrow cells from TLR2+/+, TLR2-/- (n=20), C3H/HeN and C3H/HeJ (n=28) mice were incubated in the presence of 5x106 C. pneumoniae per ml for 24 h. The release of IL-6 was determined in the cell-free supernatants by ELISA. ***represents significance versus wild-type cells. Data are means ± SEM.
To reflect the physiological situation, mice were infected intranasally with a very low inoculum of 106 EB of C. pneumoniae and the course of infection was monitored by real time PCR for 95 days. At 15 min and on days two, four, 11, 18, 33 and 95 of infection the C. pneumoniae load of lung and BAL was determined by real-time PCR, the lung was analyzed by histopathology and the cytokine levels of TNFa and IL-6 were determined in BAL and lung supernatants, as well as TNFa, IL-6 and the acute phase protein SAA in blood. Furthermore, the development of anti-C. pneumoniae antibodies was monitored by MIF in the serum of the mice. The MIF analysis revealed that the animals produced anti-C. pneumoniae antibodies of the IgM and later the IgG class, indicating a specific immune response (Fig. 2). IgM was detectable in two 5 Murine infection model for C. pneumoniae 75
animals on day 11 and three animals on day 18, but had vanished in all by day 33.
Accordingly, IgG was detectable first on day 18 in four animals but increased further and was present in all five animals on day 33. Overall, no apparent symptoms of infection were visible. Indeed, neither the cytokines TNFa and IL-6 nor SAA were found at significant levels in serum during the whole course of infection. The levels of these cytokines in BAL and lung supernatants were also below the detection limit at all time points. Histopathology of lung slices revealed that there were no significant signs of interstitial pneumonitis or infiltration of polymorphonuclear leukocytes at any time point after infection. However, C. pneumoniae could be detected in the BAL and lung of all animals for 11 days, in three animal on day 18 and in two animals on day 33 by real- time PCR. Employing a quantitative real-time PCR, the highest numbers of C. pneumoniae were retrieved from the BAL 15 min after infection, which represents the initial inoculum, from the lung two days after infection. C. pneumoniae load then declined steadily, until by day 95, no more C. pneumoniae were detectable (Fig. 3 a+b).
70 60 IgM IgG 50 40
1/titer 30 20 10 0 11 18 33 days after infection
Figure 2: Detection of anti-C. pneumoniae IgM and IgG in C. pneumoniae-infected mice.
Serum was collected from Swiss Webster mice on day 11, 18 and 33 after infection with 106 C. pneumoniae EB. IgM and IgG anti-C. pneumoniae antibodies were determined by MIF. Data are means ± SEM of serum from five mice. 76 5 Murine infection model for C. pneumoniae
Figure 3: Time course of C. 100000 BAL pneumoniae burden in BAL and 75000 50000 lungs of C. pneumoniae-infected 1000 mice. 750
500 a) BAL and b) lung were obtained from
250 Swiss Webster mice at 15 min and on number of C.p./10 µl eluate 0 day two, four, 11, 18, 33 and 95 after 0 5 10 15 20 25 30 35 90 95 100 6 day infection with 10 C. pneumoniae EB. DNA was extracted and the bacterial 350 lung load was determined by real-time PCR 300 at each time-point. Bacterial load of 250 BAL was significantly different 200 (p £ 0.05) from non-infected controls at 150 15 min, on day two and day 11 after 100 infection and for the lung at 15 min, on number of C.p./40 ng DNA 50 day two and day four. Data are means 0 0 5 10 15 20 25 30 35 90 95 100 ± SEM of samples from five mice. day
To examine the role of TLR2 and TLR4 for C. pneumoniae infection in vivo, C3H/HeJ,
TLR2-/- as well as their respective wild-types were infected intranasally with 106 or 107
C. pneumoniae EB and sacrificed at day 18. Swiss Webster mice served as positive controls for the C. pneumoniae infection. Day 18 was chosen since at this time-point bacteria were still detectable in the lung and BAL, but eradication had already started and effectiveness of eradication could be compared. Surprisingly, under both conditions, i.e. infection with 106 EB or 107 EB, the bacterial load of C. pneumoniae in the lung (Fig. 4a) or BAL (Fig. 4b) was not significantly different between the groups and the antibody levels were also comparable (Fig. 4c). It is thus concluded that eradication of C. pneumoniae takes place independent of recognition via TLR2 or
TLR4. After infection with 107 EB a significant amount of IL-6 could be detected in the lung supernatants of all mice and a trend towards reduction of IL-6-release was observed in samples from the TLR2-/- compared to the TLR2+/+ mice. Since this 5 Murine infection model for C. pneumoniae 77
difference was not statistically significant the experiment was repeated and the mice were sacrificed already at day two after infection. The bacterial burden of the lungs of all mice was again at the same level as confirmed by PCR. Again, the IL-6 levels of the lung supernatants of the TLR2-/- mice showed lower IL-6 levels compared to TLR2+/+ mice (TLR2+/+: 947 ± 80 pg/ml vs. TLR2-/-: 769 ± 50 pg/ml, p<0.05, n=5.), while IL-6 levels were similar, in C3H/HeN and HeJ mice (HeN: 253 ± 50 pg/ml vs. HeJ: 272 ± 39 pg/ml, n=5.). Similar results were obtained for TNFa release.
A 1000 BAL
100
10 Cp/10µl eluate
1 HeN HeJ 2+/+ 2-/- SW
B 100 lung Figure 4: Bacterial burden of BAL and lung and C. pneumoniae antibody titer of C. pneumoniae-infected mice. 10 A: BAL and B: lung were obtained from 7
Cp/40ng murine DNA mice at day 18 after infection with 10
1 C. pneumoniae EB. DNA was extracted HeN HeJ 2+/+ 2-/- SW and the bacterial load was determined by real-time PCR. C 1000 antibodies C: Serum was collected from mice at day 18 after infection with 107 C. pneumoniae 100 EB. Anti-C. pneumoniae IgG antibodies were determined by MIF. 10 1/antibody titer Data are medians plus indivi dual values 1 of samples from five mice. HeN HeJ 2+/+ 2-/- SW
78 5 Murine infection model for C. pneumoniae
The lack of major symptoms further raised the question, whether C. pneumoniae had infected the murine tissue or were simply deposited and eliminated by time. To prove that C. pneumoniae actually infect and replicate intracellularly, we studied the effects of a previously reported effective combination of rifampicin and azithromycin (237).
C. pneumoniae are known to be sensitive to antibiotics only during replication.
Treatment started at day two post infection and was carried out p.o. for four days three times daily. On day seven, the bacterial burden was determined in BAL and lung.
Compared to untreated controls, bacterial numbers decreased significantly due to antibiotic treatment indicating that intracellular replication rendered them sensitive to antibiotics.
A 18000 lung
15000
12000 40 ng DNA ./ Figure 5: Effect of antibiotic treatment on
C.p 9000 C. pneumoniae burden in lung and BAL of 6000 C. pneumoniae-infected mice.
number of 3000 * 0 A: BAL and B: lung were obtained from mice untreated Rif./Az. B at day seven after infection with 18000 BAL C. pneumoniae. In addition, the different 15000 groups of mice were either vehicle treated or
12000 10 µl eluat received rifampicin/azithromycin. DNA was
C.p./ 9000 extracted and the bacterial load was
6000 determined by real-time PCR for each time-
number of 3000 point. Data are means ± SEM of samples ** 0 from five mice. untreated Rif./Az. 5 Murine infection model for C. pneumoniae 79
5.4 Discussion
In this study a murine model was established in order to investigate the role of TLR2 and TLR4 for C. pneumoniae infection in vivo. This was initiated with the low inoculum of 106 C. pneumoniae EB, i.e. 104-105 inclusion forming units, via the respiratory tract and the course of infection was monitored both by serology and by bacterial burden of organs. The mild or asymptomatic course of infection in our model appears to reflect the clinic of the human infection. The low potency of C. pneumoniae to elicit an inflammatory cytokine response represents a possible explanation for the often asymptomatic course. Furthermore, in this model, C. pneumoniae infection in mice appears to occur only in the lungs, with no obvious persistence or spread of bacteria to other organs. Swiss Webster mice were chosen for the establishment of the model, because a homogeneous susceptibility towards intranasal C. pneumoniae infection with less individual variation compared to other mouse strains has been reported (388).
The infection-kinetics, self-limitation of infection and development of antibodies as described in the present study were similar to what has been published by others (179,
282, 388). We found that the bacterial load of lung, BAL and antibody development at day 18 after infection was not significantly different between the Swiss Webster and the wild-type mice C3H/HeN and TLR2+/+.
Surprisingly, the course of bacterial infection, bacterial clearance and development of antibodies was not altered in the TLR4- or TLR2-deficient mice compared to the respective wild-types, despite, in line with previous findings, the in vitro stimulated cytokine release was found to be strongly TLR2-dependent and in part TLR4- dependent (290). In contrast, in vivo cytokine release was found to be only TLR2- dependent, but cytokine levels were three-fold lower in C3H/HeN-J mice compared to
TLR2 strains. These findings raise the question whether TLR2 and TLR4 are decisive for immune recognition of C. pneumoniae in vivo. We are not aware of previous studies 80 5 Murine infection model for C. pneumoniae
investigating the role of TLRs in immune recognition of C. pneumoniae and no in vivo data are available so far. However, dysfunction of a given TLR, which is required for pathogen recognition in vitro, is not necessarily detrimental in vivo. The Gram-positive pathogen Listeria monocytogenes induces an inflammatory response via TLR2, but mice deficient in TLR2 are not more susceptible to Listeria infection than wild-type controls (84). Also, for intravenous or peritoneal infection of TLR4-deficient mice with
Escherichia coli it has been shown that TLR4 wild-type and TLR4-deficient animals are equally sensitive (93, 140). These findings can most probably be explained by receptor redundancy (355). Recent studies have shown, that the induction of inflammatory responses is not only mediated by activation of one receptor but by an assembly of multi-component receptor clusters in the membrane (286, 351, 352). TLR of mammalians are known to signal through the cytoplasmatic adapter protein MyD88
(251). The fact that knock out of MyD88 abrogated responses towards bacterial compounds like LPS (182) and peptidoglycan (344) and rendered mice highly sensitive to infections (84, 343) supports the hypothesis that more than one receptor has to be blocked to impair anti-bacterial defense.
Furthermore, the dependence of the course of bacterial infections on TLRs seems to be strongly dependent on the number of bacteria used. For example, while no difference in survival or bacterial proliferation between TLR2+/+ and TLR2-/- mice was observed after a low dose challenge with Staphylococcus aureus, TLR2-/- were significantly more susceptible when a lethal (ten-fold higher) dose was given (343). A recent report by Reiling et al. (296) describes the finding that TLR2- or TLR4-defective mice are as resistant as the wild-type controls to infection with Mycobacterium tuberculosis, while infection with a higher dose rendered TLR2-defective animals more susceptible. However, we found also no TLR-dependence of the course of infection if the inoculum was increased from 106 to 107 C. pneumoniae EB. In case of C. pneumoniae, models of lethal infection do not reflect the human clinics where infection 5 Murine infection model for C. pneumoniae 81
is usually asymptomatic. Invasion of host cells and replication of C. pneumoniae was proven by the effect of antibiotic treatment. The development of antibodies also showed that activation of the innate immune system translated to induction of adaptive immune responses. These findings taken together with the reports for other pathogens indicate that although a given TLR mediates activation of innate responses, in borderline situations, the action of different receptor seems to be redundant.
Furthermore, this challenges the broadly accepted concept of TLR-mediated activation of the innate immune system as the primary line of defense in bacterial infection.
5.5 Materials and Methods
C. pneumoniae propagation and isolation
Since C. pneumoniae can infect humans via aerosols, C. pneumoniae propagation as well as all following studies were carried out in safety cabinets and using personal air filters. C. pneumoniae HK isolate (a clinical respiratory isolate, generously provided by
Prof. E. Straube, National Consultative Laboratory for Chlamydia, Institute of Medical
Microbiology, University of Jena, Jena, Germany) was used in this study. Cultivation of
C. pneumoniae was performed by intracellular growth of the bacteria in the human epithelial cell line HEp-2 (ATCC CCL-23) (304), as described by Rodel et al. (306). The multiplication was monitored using the Kallestad Pathfinder system (Sanofi Diagnostics
Pasteur, Redmond, WA, USA). In order to exclude Mycoplasma contamination, cell cultures and chlamydial stocks were routinely tested by Mycoplasma PCR ELISA
(Roche Diagnostics GmbH, Mannheim, Germany). The number of C. pneumoniae was quantified by real-time PCR (see below). For this purpose, C. pneumoniae infected
HEp-2 cells were harvested, the cell debris was separated by low speed centrifugation
(10 min x 500g) and DNA was prepared with the DNeasy Tissue Kit (Qiagen, Hilden,
Germany) according to the manufacturer’s protocol. 82 5 Murine infection model for C. pneumoniae
Infection of mice and organ preparation
Four week old, specified pathogen-free female Swiss Webster mice, C3H/HeN mice,
C3H/HeJ mice (Charles River Laboratories, Sulzfeld, Germany), TLR2 wild-type mice
(TLR2+/+) and TLR2-/- mice, generated by homologous recombination by Deltagen
(Menlo Park, CA, USA) and kindly provided by Tularik (South San Francisco, CA, USA) were fed ad libitum with Altromin 1314 (Altromin, Lage an der Lippe, Germany) and kept at 20-22°C, 50-60% air humidity and at a 12 hour day-night cycle. They were inoculated intranasally with 106 or 107 EB of C. pneumoniae HK under light ether anesthesia to induce hyperventilation. One drop (50 ml) of inoculum was delivered onto the nostrils.
Kinetics
At 15 min as well as on days two, four, 11, 18, 33 and 95 after infection, Swiss Webster mice (5 mice per group) were anesthetized (Trapanal i.p. (100 mg/kg), ALTANA
Pharma, Konstanz, Germany), opened along the midline of the abdomen and the abdominal aorta was cannulized and perfused thoroughly for 1 min with approximately
5 ml sterile PBS (PAA Laboratories, Cölbe, Germany) with 1,6 mg/ml EDTA (Sarstedt,
Nümbrecht, Germany) to remove blood from the organs. The blood was collected from the vena cava and the respective dilution was calculated by determination of the hemoglobin content (Hemoglobin test kit, Sigma, Munich, Germany). Samples of BAL, lung, aorta, brain, bladder, spleen and liver were obtained. All organs were weighed and homogenized (except in case of the lung where a specimen for histopathology was removed) in a sterile homogeniser (Medicon, 50 mM Dako Cytometation, Hamburg,
Germany) using a Medimachine (Dako Cytometation) with 1 ml sterile ice cold PBS.
After homogenization the tissue was filtrated through a 50 mM mesh Filcon sterile syringe (Dako Cytometation) to avoid clotting and stored at –70°C.
Antibiotic treatment 5 Murine infection model for C. pneumoniae 83
Swiss Webster mice (n=5) were inoculated intranasally with C. pneumoniae HK as described above. Antibiotic treatment was started two days after inoculation with C. pneumoniae. A mixture of 20 mg kg-1 rifampicin (Sigma) and 20 mg x kg-1 azithromycin
(Pfizer, Karlsruhe, Germany) were administered by gavage thrice at 7 a.m., 1 p.m. and
7 p.m. for four days. All substances were disolved in 1% tylose (Merck, Darmstadt,
Germany) and applied in a volume of 25 ml x kg-1. Mice were killed at day seven after infection and serum, BAL and lung were obtained for further analysis.
Role of TLR
Swiss Webster mice, C3H/HeN mice, C3H/HeJ mice, TLR2+/+ and TLR2-/- mice (n=5) were inoculated intranasally with C. pneumoniae HK as described above. At day 18 after infection mice were killed and BAL and lung were obtained for further analysis.
Histopathology
Histopathology was performed blinded to the infection conditions at the laboratory of
Dr. K. Tuch (ALTANA Pharma, Hamburg, Germany). Lung tissue from infected and control mice was removed as described above and immediately fixed in 8% MOPS- buffered formalin, pH 7.4. Specimens were embedded in paraffin, sectioned and stained with hematoxylin and eosin.
DNA preparation
DNA extraction was carried out using the DNeasy Tissue Kit (Qiagen) according to the manufacturer’s protocol with slight modifications: 40 ml of proteinase K were incubated with 260 ml buffer ATL and 100 ml organ homogenate over-night at 55°C. Then 400 mg
RNAse and 400 ml buffer AL were added and the sample was incubated at 70°C for 10 min. After addition of 400 ml 100% ethanol, 650 ml of the sample were loaded onto the column in two steps and centrifuged. After two wash steps the DNA was eluted using 84 5 Murine infection model for C. pneumoniae
2x 100 ml AE buffer. For extraction of DNA from BAL, 210 ml ATL buffer, 150 ml BAL and 10 mg carrier RNA (Qiagen), the latter of which was used to improve the DNA yield, were mixed and incubated for 3 h at 55°C. No RNAse digestion was performed and the
DNA was eluted using 100 ml AE.
Real-time PCR
Real-time PCR was performed using a LightCycler rapid thermal cycler system
(Roche). Primer and probe sequences were selected from the 16S rRNA of C. pneumoniae (Accession no. U68426). The primers resulted in an amplification product of 640 bp. Primer sequences were for the forward primer
5’-ATGTGGATGGTCTCAACCCCAT-3’ and for the reverse primer
5’-GGCGCCTCTCTCCTATAAATAGG-3’ (Thermo Hybaid/Interactiva Division, Ulm,
Germany). Probe sequences were 5’-ACCTCACGGCACGAGCTGACGA-3’ for the fluorescein labeled probe and 5’-AGCCATGCAGCACCTGTGTATCTGTCC-3’ for the
LC Red640 labeled probe (TIB MOLBIOL Syntheselabor, Berlin, Germany). Real-time
PCR was done in 20 ml with 0.5 mM of each primer, 0.1 mM of each probe, 2 mM MgCl2,
2 ml FastStart DNA Master Hybridization Probes (Roche) and 5 ml DNA (40 ng) template. Thermal cycling was performed in glass capillary tubes (Roche) according to the manufacturer’s protocol (50 cycles) with an annealing temperature of 65°C and an elongation time of 26 sec. Fluorescence was measured at the end of each annealing phase.
Comparison of the selected primers (BLAST search) with the GeneBank sequences
(National Center for Biotechnology Information, NCBI, Microbial Genome Database,
MBGD) (346) revealed no cross-binding activity. We also tested different bacterial strains including Salmonella typhimurium (ATCC 15277), Staphylococcus aureus
(ATCC strain 12598), Escherichia coli (E. coli, K-12 strain JM-109, a kind gift from Dr.
G. Grütz, Charité, Berlin, Germany), Borrelia burgdorferi strain sensu stricto (a kind gift 5 Murine infection model for C. pneumoniae 85
from R. Oehme, LGA Stuttgart, Stuttgart, Germany), Eubacterium acidaminophilum
(DSM strain 3595), Methanospirillum hungatei (a kind gift from Prof. B. Schink,
University of Konstanz, Konstanz, Germany), and samples of murine DNA prepared from BAL, blood, lung, aorta, brain, bladder, spleen and liver to exclude cross-reactivity in the assay. Furthermore, to control for false-negative and false-positive results, a positive and a negative control were included in each run. The amount of EB in the samples was determined using chlamydial DNA as standard. The concentration of the standard DNA was calculated on the basis that the chlamydial genome consists of 1.2 million base pairs weighing 1.3 fg.
Isolation and stimulation of murine macrophages
C3H/HeN mice, C3H/HeJ mice, TLR2+/+ and TLR2-/- mice were put under terminal pentobarbital anesthesia (Narcoren, Merial, Halbergmoos, Germany). Bone marrow macrophages were isolated from the femurs by rinsing with 10 ml ice-cold PBS and were transferred to siliconized glass tubes. After centrifugation, cells were resuspended in medium (RPMI 1640, PAA Laboratories) containing 10% FCS (Roche) and transferred to 96-well cell culture plates (5x 105 cells/well, Greiner, Frickenhausen,
Germany). Murine macrophages were then stimulated with C. pneumoniae, LPS from
Salmonella abortus equi (Sigma) or LTA from Staphylococcus aureus (prepared in house according to Morath et al. (258) and incubated for 24 h at 37°C and 5% CO2.
Serology
Serology was performed at the laboratory of Dr. U. Brunner (Konstanz, Germany).
Serum antibodies were detected by MIF using glass slides with EBs from the C. pneumoniae isolate TWAR-183 (Labsystems, Helsinki, Finnland, purchased from
Merlin, Bornheim, Germany). Murine Ig were detected with fluorescein-conjugated goat antibodies, anti-murine IgM was purchased from Biozol (Eching, Germany) and anti- 86 5 Murine infection model for C. pneumoniae
murine IgG from Sifin (Berlin, Germany). Titers of <1:8 were regarded as negative because of non-specific background reactions.
ELISA
The cytokines tumor necrosis factor a (TNFa) and interleukin 6 (IL-6) were determined in BAL, blood and supernatants of lung homogenates by ELISA based on commercial antibody pairs and standards (TNFa antibodies were purchased from R&D,
Wiesbaden, Germany, IL-6 antibodies and IL-6 and TNFa standards from Pharmingen,
Hamburg, Germany). Serum amyloid A (SAA) was determined in blood using a kit from
Biosource (Solingen, Germany). The detection limits of the ELISAs were 39 pg/ml, 13 pg/ml and 120 ng/ml for TNFa, IL-6 and SAA, respectively.
Statistics
Statistical analysis was performed using the GraphPad InStat program 3.0 (GraphPad
Software, San Diego, USA). Differences between two groups were assessed by unpaired t test. Unpaired samples were assessed by one-way analysis of variance followed by Dunnett’s test. Data were log-transformed to achieve Gaussian distribution.
In the figures *, ** and *** represent p values <0.05, <0.01 and <0.001, respectively.
5.6 Acknowledgments
The authors are most grateful of the skillful technical help from A. Haas, M. Kreuer-
Ullmann and I. Seuffert. The help from T. Rubic, Dr. S. English and Prof. Dr. R.D.
Hesch in establishing the PCR is thankfully appreciated. We thank Dr. K. Tuch for performing the histopathology, Dr. U. Brunner for the adaptation of the human MIF to the mouse and performing of the serology and S. von Aulock for her help with the manuscript.
6 Summarizing discussion
In recent years the medical impact of the two persistent pathogens B. burgdorferi sensu lato and C. pneumoniae became more and more evident. The chronic manifestations of B. burgdorferi s.l., and the likely association of C. pneumonaie to chronic and degenerative diseases like atherosclerosis represent major challenges.
The severe manifestations call for an adequate diagnosis and treatment of patients and for the development of vaccines to prevent infection. Knowledge about relevant antigens and their recombinant availability are the first and important steps to overcome the limitations in serodiagnosis and vaccination. The problems encountered in the serodiognosis of Borrelia and Chlamydophila have prompted approaches for improvement, especially the identification and recombinant production of antigens mainly those known from immunoblots (40, 56, 181, 190, 217, 231, 275, 289, 382).
However there is a fast increase in the availability of sequence information of pathogens emerging from genome projects. Since the first completely sequenced genome in 1995 (Haemophilus influenza) (99) further 139 total bacterial genomes from
114 different species were made available (NCBI databases, January 2004), dozen others are near to completion. For Borrelia (B. burgdorferi s.s. (strain B31)) one strain is sequenced (103) and for C. pneumoniae four different serovars are completely sequenced: C. pneumonaie AR39 (294), C. pneumoniae CWL029 (175),
C. pneumoniae J138 (325) and C. pneumoniae TW-183 (114). Analysis and estimations of the open reading frames indicate that nearly half of the encoded bacterial proteins have to be assigned to proteins with unknown function. Thus the identification, characterization and annotation of the encoded proteins represent a central challenge in post-genomic era. Many sequences of the genome can be of diagnostic value, but the role and function of the encoded proteins must be examined.
88 6 Summarizing discussion
As a consequence, the knowledge about protein-protein interactions and the interaction with other molecules (e.g. DNA or RNA or antibodies) will be of basic importance. This requires technologies to handle large amounts of clones or products in parallel and technologies for selection of specific interacting molecules. The enormous amount of sequence information prompted several approaches for identification of antigens, which are exposed on the surface and of antigenic nature. One common approach is the identification of potential antigens by the use of the gene information and bioinformatics, also named reverse vaccination (292) or the use of expression libraries
(92). The reverse vaccination has been applied to identify potential antigens from
Meningococus (287), Streptococcus pneumoniae (380), Porphyromonas gingivalis
(307), C. pneumoniae (257) and Bacillus anthracis (8). But these approaches need a large bioinformatics facility, need to express the proteins, to immunize animals and to test the surface location of the proteins. Furthermore not all surface located proteins are antigens and vice versa.
The approach of using genome libraries for antigen identification were used in the field of bacterial pathogens for Staphylococcus aureus (92), E. coli (276) and in the present study for B. burgdorferi s.l. (see chapter 2) as well as C. pneumoniae (see chapter 1).
In case of the identification of allergens, the use of cDNA expression libraries have been successfully applied for several allergenic organisms such as Aspergillus fumigatus (63), the yeast Malassezia furfur (221), the fungus Coprinus comatus (26), peanuts (188, 189) and mites (87). This work focused on the application of random genome fragment expression on phage and the identification of relevant antigens by affinity selection against patients sera. 6 Summarizing discussion 89
6.1 Phage surface display and antigen identification in persistent infection
Genomic libraries present all proteins, encoded by the genomic DNA, on their surface and can therefore be used for several affinity selections with different targets. The library can be used for identification of antigens, as well as for the epitope mapping of monoclonal antibodies. Since many ORFs have been identified without known function by sequencing whole genomes, phage display affinity selection is a useful tool to identify their antigenic function, because they are encoded and presented in the genomic phage library.
However, the affinity selection, which relies on the separation of non-binding phages from the binding-ones by the use of a specific target, is restricted by several limitations.
For the affinity selection the target has to be immobilized on solid phase surfaces in the simplest form, also called biopanning (66, 279). During an amplification step, the relatively small number of eluted phage is amplified to form a new large library for the next round of affinity selection. These procedures are limited by several pitfalls: non specific binding of phage, different infectivity of eluted phage, limited amount of target molecules and/or of specific binding clones in the initial library (298). Another limitation comes from the use of polyclonal IgG-antibodies from patients as target, because sera is highly heterogeneous and contains unknown amounts of antibodies raised against different antigens. Hence, the enrichment of each ligand depends on two major factors:
First, the frequency of the specific clone in the original library and second, the number of clone-specific antibodies present in the antibody target pool. The number of clone specific antibodies is dependent upon the antigenicity of the displayed entity and the individual situation (e.g. stage of infection) of each serum donor. Levitan et al. described the thermodynamic and kinetic parameters for affinity selection, and claimed that affinity selection will be only successful with relatively homogeneous but not with 90 6 Summarizing discussion
complex and limited targets (214). In contrast to these calculations our findings demonstrate the successful enrichment of libraries of specific clones with human IgG as target (259, 260).
Because of the problems in affinity selection against a heterologous target some researchers recommend the analysis of large numbers of clones to identify and weight the potency of all enriched sequences (78, 370). High-throughput techniques for identification of large number of clones have been developed and successfully used
(67, 193, 299). However, our affinity selection of the C. pneumoniae library led to an enrichment of the gene for pmp19 in a high frequency. Furthermore, affinity selection of cDNA libraries against sera and the manual analysis of clones have also been applied successfully for both IgE (64, 67, 299) and IgG as target (276), representing a complex target. Furthermore, E. coli expression libraries of Staphylococcus aureus were successfully screened with sera from patients (92). Thus our findings are in line with the literature. In addition we also demonstrate that it is not only possible to enrich clones from cDNA libraries but also from a random genomic library. The successful enrichment is underlined by both, the identification of a known Borrelia antigen
(BBK32) (143, 203) and the finding, that two of the enriched Borrelia proteins showed specific binding with sera from patients. Several of the other identified proteins are located on surface or associated to it. The chlamydial candidate genes look also very promising, because several of them are also known to be surface exposed.
The question to solve is, if it is possible to obtain all dominant antigens by this approach or not. For this purpose, the specific properties of the system have to be considered in more detail. Like all biological display systems, the phage display system shows the limitations of the technology itself. One major limitation is the different phage host, so that the displayed products in our case are restricted to the codon usage of the
E. coli host (249), and the products must be non-toxic for the host (196). Other limitations come from the lifecycle of the phage. The filamentous phage are released 6 Summarizing discussion 91
from the host without breaking the integrity of the host membrane. Therefore, the proteins, which will be displayed on the phage, must cross the lipid layer of the inner membrane (245). As a consequence, display is limited to proteins which can cross the membrane. Therefore, it is unlikely that transmembrane proteins like receptors or other membrane proteins are present in the library. The random genomic approach overcomes some of these limitations, because only parts of the proteins are expressed, which can pass the membrane more easily. This can be underlined by our finding of parts of membrane proteins by affinity selection. The affinity selection of the C. pneumoniae library led to the enrichment of phages presenting parts of pmp19, which has several transmembrane domains. The size limitation of displayed proteins that has been discussed (363), does not play any role for the use of random genomic phage libraries. The limitation of the folding capacity of the E. coli maschinery and chemical characteristics of the periplasmatic space, which may affect folding and stability of the proteins, are of major concern. Nevertheless, the phage display system, especially by displaying cDNA, led to the successful identification of a large repertoire of structures with a great range of properties (298). Furthermore, the random genomic approach overcomes several of the limitations of the phage display system. In summary, it is a powerful tool for antigen identification, but those proteins, which will be not expressed due to systems limitation itself, will be missed. Some other methods for displaying proteins have been developed, which overcome the limitations of phage, but they are as well restricted by their own limitations. For example eukaryotic display systems are limited by the small number of transformants (21, 105, 178). Hence, none of the displayed methods will replace the others. Currently, phage display represents the most powerful display system and is therefore widely used. 92 6 Summarizing discussion
6.2 The murine C. pneumoniae infection model
In order to develop new vaccines, a detailed understanding of the events that are triggered in a host after bacterial, viral or parasitic infection is needed (29). Despite some differences, the immune systems of mice and humans are remarkably similar and they can often be challenged with the same, or similar, pathogens (98). Hence, mice are an ideal organism in which to model human infectious diseases.
The model of C. pneumoniae infection in mice, which was established here, showed a mild or asymptomatic course of infection and appears to reflect therby the clinic of the human infection. The low potency of C. pneumoniae to elicit an inflammatory cytokine response represents a possible explanation for the often asymptomatic course in humans. Several other studies have investigated C. pneumoniae infection of mice in connection with atherosclerosis (19, 20, 39, 157), but only few have addressed the course of infection in normal mice instead of apoE-deficient knock-out mice or normal mice on an atherogenic diet. Hence, the established model seems to reflect more the
“in vivo situation in humans”.
The infection-kinetics, self-limitation of infection and development of antibodies as observed in our model were similar to those of others (179, 282, 388). In contrast to our model, in all these studies determination of bacterial burden was carried out by isolation and subsequent culture of C. pneumoniae from the lung tissue, a technique which is time consuming, prone to false-negative results and difficult to quantify.
Therefore, the quantification by real-time PCR, which is fast, quantitative and safe, offers several advantages and new possibilities for applications like to monitor treatment regimens or to define critical parameters of the infection route. The fact that
C. pneumoniae can be quantified enables assessment of potencies and to determine trends, even if eradication of the pathogen cannot be achieved completely. 6 Summarizing discussion 93
In our murine infection model, C. pneumoniae infection in mice appears to occur only in the lungs, with no obvious persistence or spread of bacteria to other organs. This is in contrast to other models, where C. pneumoniae was found to spread to aorta or spleen after intranasal or intraperitoneal application (32, 256). However all these studies used multiple infections with higher inocula of C. pneumoniae. Furthermore, persistence has only been demonstrated by a single group so far (204).
Persistence represents a key issue to solve the long-lasting debate about the clinical impact of C. pneumoniae in chronic inflammatory and degenerative diseases, however, further steps will have to be done in order to establish an animal model of persistent C. pneumoniae infection. Nevertheless, the model is suitable to test antibiotic treatments, drugs under development and vaccination strategies which represent a very promising concept to prevent infection of C. pneumoniae.
7 Summary
In this study immunogenic (antibody-inducing) properties of Borrelia burgdorferi s.l. and
C. pneumoniae, pathogens that can persist in human beings over years, have been investigated.
B. burgdorferi s.l. is the causative agent of Lyme Borreliosis and persistence in humans can lead to late-stage manifestations such as Acrodermatitis chronica atropicans, arthritis and neuroborreliosis.
C. pneumoniae represents a common respiratory pathogen leading to pneumonia and bronchitis. Infections have been associated with chronic and degenerative diseases including atherosclerosis, asthma, multiple sclerosis and Alzheimer's. Studies point especially to a role of C. pneumoniae in the development of atherosclerosis, but this is still controversially discussed.
The main diagnostic tool for infections with these bacteria is serodiagnosis, which is far from satisfactory. The diagnosis could be improved by the use of relevant recombinant antigens instead of crude bacterial extracts. Therefore, the main objective of this study was the identification of antigenic structures of B. burgdorferi s.l. and C. pneumoniae by affinity selection of genomic phage surface libraries with sera of infected persons.
1. Random genome libraries were generated for both bacteria. Diversity of the
libraries varied between 3.3x 106 for B. afzelii, 8.2x 106 for C. pneumoniae and
7.5x 107 for B. burgdorferi s.s. and B. garinii, and was high enough to represent
all genes encoded in the bacterial genome.
2. The affinity selection protocols and the phage vector were modified, allowing
the enrichment of phage with IgG antibodies of infected persons. The
successful enrichment was observed for example in a five-fold increase in
96 7 Summary
eluted phage compared to the last wash fraction for the Borrelia libraries. The
total number of eluted phage increased over 950% for the Chlamydophila
selection.
3. The enriched phage for Borrelia revealed nine proteins along with the known
antigen BBK32. For C. pneumoniae ten open reading frames were enriched.
Here the “polymorphic membrane protein 19” (pmp19) was the major antigen
identified (~50% of clones), the nine other proteins were detected with lower
frequencies.
4. A pilot evaluation of two Borrelia proteins (ctc, flgL) showed higher reactivity of
ctc with sera from LB patients in ELISA than with sera from seronegative
controls. Hence, the ctc protein has an immunogenic potential in Lyme
Borreliosis.
In summary, the phage surface display technique was successfully applied to screen bacterial libraries against patient IgGs. Several novel immunogenic structures were identified. The successful application is emphasized by the identification of the known antigen BBK32, the identification of several surface located proteins and the pilot evaluation.
In a second part of the thesis a murine C. pneumoniae infection model was established.
1. Mice were infected intranasally with a low dose of Chlamydophila and their
spreading to different organs was monitored with a novel real-time PCR. C.
pneumoniae was only detectable in lung und BAL, with a maximal bacterial load
in the BAL on the day of infection and in the lung tissue two days later. By day
95, C. pneumoniae were completely eradicated. 7 Summary 97
2. The course of infection was mild (no induction of TNFa and IL-6), but IgG
became detectable on day 18 by a micro immunofluorescence test (MIF)
indicating activation of the immune system.
3. The reduction in bacterial burden after antibiotic treatment in the infection model
was shown, indicating the value of the model for treatment studies or for testing
of drugs under development.
4. No differences in clearance of bacteria and serological response were observed
between TLR2-/- mice, TLR4-deficient mice and their respective wild-type
controls.
In summary, a characterized and monitored murine infection model was established, which appears to reflect largely the clinic of the human infection. The model might be suitable to test vaccination strategies, for example with the identified proteins from the phage surface display applications.
Taken together, the application of phage display technology was a successful tool for the identification of new antigens from the genomes of Borrelia and Chlamydophila.
Together with sufficiently characterized animal models this represents a promising approach also for other infectious diseases that lack adequate serodiagnosis or vaccines.
8 Zusammenfassung
In dieser Arbeit wurden die immunogenen (Antikörper induzierenden) Eigenschaften von Borrelia burgdorferi s.l. und Chlamydophila pneumoniae, beides Pathogene, die in
Menschen über Jahre persistieren können, wurden untersucht.
B. burgdorferi s.l. ist der Verursacher der Lyme Borreliose (LB) und Persistenz kann in
Menschen zu Spätmanifestationen wie Acrodermatitis chronica atropicans, Arthritis und
Neuroborreliose führen.
C. pneumoniae stellt ein weit verbreiteter Atemwegserreger dar, der zu
Lungenentzündungen und Bronchitis führen kann. Infektionen wurden mit chronisch, degenerativen Erkrankungen wie Atherosklerose, Asthma, Multiple Sklerose und
Alzheimer assoziiert. Einige Untersuchungen deuten vor allem auf eine Rolle von
C. pneumoniae in der Atheroskleroseentwicklung hin, aber dies wird kontrovers diskutiert.
Die Diagnose einer Infektion mit diesen Bakterien wird hauptsächlich mittels serodiagnostischen Tests erstellt, welche weit davon entfernt sind zufrieden stellend zu sein. Die Diagnose könnte durch die Verwendung passender rekombinanter Antigene anstelle von reinen Bakterien-Extrakt verbessert werden. Daher war die
Hauptfragestellung die Identifizierung von antigenen Strukturen von B. burgdorferi s.l. und C. pneumoniae mittels Affinitätsselektion einer genomischen Phagen Oberflächen
Bibliothek gegen Seren von infizierten Patienten.
1. Zufällige genomische Bibliotheken wurden für beide Bakterien hergestellt. Die
Diversität der Bibliotheken variierte zwischen 3,3x 106 für B. afzelli, 8,2x 106 für
C. pneumonaie und 7,5x 107 für B. burgdorferi s.s und B. garinii, und war
umfassend genug alle Gene die im bakteriellen Genom kodiert sind zu
repräsentieren.
100 8 Zusammenfassung
2. Das Protokoll der Affinitätsselektion und der Phagenvektor wurden verändert,
was eine Anreicherung von Phagen gegen IgG Antikörpern von infizierten
Patienten erlaubte. Die erfolgreiche Anreicherung wurde zum Beispiel in einem
fünffachen Anstieg in der Anzahl eluierter Phagen im Vergleich zur letzten
Waschfraktion für die Borrelien-Bibliothek beobachtet. Die Gesamtzahl eluierter
Phagen stieg für die Chlamydien-Selektion um über 950% an.
3. Die angereicherten Phagen brachten neun Borrelien-Proteine zusammen mit
dem bekannten Antigen BBK32 hervor. Für C. pneumoniae wurden 10 offene
Leserahmen angereichert. Das „polymorphic membrane protein 19“ (pmp19)
wurde als Hauptantigen identifiziert (~50% der Klone), die neun weiteren
Proteine wurden mit geringerer Häufigkeit detektiert.
4. Eine Pilotuntersuchung zweier Borrelien-Proteine (ctc, flgL) zeigte für ctc im
ELISA eine höhere Reaktivität mit den Seren von LB Patienten als mit Seren
von sero-negativen Kontrollen. Deshalb hat das ctc Protein ein immunogenes
Potential in der Borreliose.
Zusammenfassend wurde die Phagenoberflächenpräsentations-Technologie erfolgreich zum Durchsuchen bakterieller Bibliotheken gegen Patienten IgG
übertragen. Einige neue immunogene Strukturen wurden identifiziert. Die erfolgreiche
Anwendung wird durch die Identifizierung des bekannten Antigens BBK32, die
Identifizierung von einigen Oberflächenproteinen und die Pilotuntersuchung hervorgehoben.
In einem zweiten Teil dieser Doktorarbeit wurde ein Mausinfektionsmodel für
C. pneumoniae entwickelt.
1. Mäuse wurden mit einer geringen Dosis an Chlamydien intranasal infiziert und
deren Ausbreitung in verschiedenen Organen mittels einer neuen Real-Time
PCR beobachtet. C. pneumonaie wurde nur in der Lunge und der BAL 8 Zusammenfassung 101
(Broncheoalveolarlavage) gefunden, und zeigten eine maximale bakterielle Last
am Tag der Infektion in der BAL und zwei Tage später in der Lunge. Am Tag 95
war C. pneumoniae vollständig eradiziert.
2. Der Infektionsverlauf war leicht (keine Induktion von TNFa und IL-6), aber IgG-
Antikörper waren ab dem 18. Tag mittels eines Mikroimmunofluoreszenz-Tests
feststellbar, was eine Aktivierung des Immunsystems anzeigte.
3. Die reduzierende Wirkung auf die bakterielle Last durch eine
Antibiotikabehandlung wurde im Infektionsmodel gezeigt, was auf den Wert des
Modells für Behandlungsstudien oder für die Testung von
Arzneimittelkandidaten hinweist.
4. Es waren keine Unterschiede in der Clearence der Bakterien und der
Immunantwort zwischen TLR2-/- Mäusen, TLR4 defekten Mäusen und deren
entsprechenden Wildtypestämmen feststellbar.
Zusammenfassend wurde ein gut beschriebenes und kontrolliertes Infektionsmodell entwickelt welches weitgehend die Klinik der menschlichen Infektion wiederspiegelt.
Das Modell erscheint passend für die Testung von Impfstrategien, zum Beispiel mit den identifizierten Proteinen aus den Phagenbibliothekanwendungen, zu sein.
Abschließend gesehen war die Anwendung der Phage Display Technologie ein erfolgreiches Instrument zur Identifizierung neuer Antigene aus dem Genom von
Borrelien und Chlamydien. Zusammen mit einem ausreichend gut charakterisierten
Tiermodell stellt es auch für andere Infektionskrankheiten, denen es an einer geeigneten Serodiagnose oder an Impfstoffen mangelt, ein viel versprechender Ansatz dar.
9 Abbreviations
ACA acrodermatitis chronica atropicans
AB antibody
BAL bronchealveolar lavage bp base pair
B. afzelii Borrelia afzelii
B. burgdorferi s.s. Borrelia burgdorferi sensu stricto
B. burgdorferi s.l. Borrelia burgdoerferi sensu lato
B. garinii Borrelia garinii
B. valaisiana Borrelia valaisiana bp base pairs cDNA complementary desoxyribonucleic acid
CDR complementary determining region
C. pneumoniae Chlamydophila pneumoniae
CSF cerebrosinal fluid
DNA desoxyribonucleic acid
E. coli Eschericha coli
EB elementary bodies
ELISA enzyme linked immunosorbent assay
EM erythema migrans
IgG immunoglobulin subclass G
IL-6 interleukine 6
IgM immunoglobulin subclass M
LB Lyme Borreliosis
104 9 Abbreviations
LPS lipoplysaccaride
M molar
M13 filamentous phage M13
MIF microimmunofluorecence
MIF test microimmunofluorecence test
MOMP major outer membrane protein mRNA mesenger ribonucleic acid
OMP outer membrane protein
ORF open reading frame
Osp outer surface protein
PCR polymerase chain reaction pmp polymorphic membrane protein
RB reticular bodies
RNA ribonucleic acid
TLR toll-like receptor
TNFa tumor necrose factor a
WB Western blot
10 References
1. Airenne, S., H. M. Surcel, H. Alakarppa, K. Laitinen, J. Paavonen, P. Saikku, and A. Laurila. 1999. Chlamydia pneumoniae infection in human monocytes. Infect Immun 67:1445-9.
2. Akin, E., G. L. McHugh, R. A. Flavell, E. Fikrig, and A. C. Steere. 1999. The immunoglobulin (IgG) antibody response to OspA and OspB correlates with severe and prolonged Lyme arthritis and the IgG response to P35 correlates with mild and brief arthritis. Infect Immun 67:173-81.
3. Akira, S., and H. Hemmi. 2003. Recognition of pathogen-associated molecular patterns by TLR family. Immunol Lett 85:85-95.
4. Aldous, M. B., J. T. Grayston, S. P. Wang, and H. M. Foy. 1992. Seroepidemiology of Chlamydia pneumoniae TWAR infection in Seattle families, 1966-1979. J Infect Dis 166:646-9.
5. Allegra, L., F. Blasi, S. Centanni, R. Cosentini, F. Denti, R. Raccanelli, P. Tarsia, and V. Valenti. 1994. Acute exacerbations of asthma in adults: role of Chlamydia pneumoniae infection. Eur Respir J 7:2165-8.
6. Andersen, P. S., A. Stryhn, B. E. Hansen, L. Fugger, J. Engberg, and S. Buus. 1996. A recombinant antibody with the antigen-specific, major histocompatibility complex-restricted specificity of T cells. Proc Natl Acad Sci U S A 93:1820-4.
7. Apfalter, P., F. Blasi, J. Boman, C. A. Gaydos, M. Kundi, M. Maass, A. Makristathis, A. Meijer, R. Nadrchal, K. Persson, M. L. Rotter, C. Y. Tong, G. Stanek, and A. M. Hirschl. 2001. Multicenter comparison trial of DNA extraction methods and PCR assays for detection of Chlamydia pneumoniae in endarterectomy specimens. J Clin Microbiol 39:519-24.
8. Ariel, N., A. Zvi, H. Grosfeld, O. Gat, Y. Inbar, B. Velan, S. Cohen, and A. Shafferman. 2002. Search for potential vaccine candidate open reading frames in the Bacillus anthracis virulence plasmid pXO1: in silico and in vitro screening. Infect Immun 70:6817-27.
9. Azzazy, H. M., and W. E. Highsmith, Jr. 2002. Phage display technology: clinical applications and recent innovations. Clin Biochem 35:425-45.
10. Baranton, G., D. Postic, I. Saint Girons, P. Boerlin, J. C. Piffaretti, M. Assous, and P. A. Grimont. 1992. Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int J Syst Bacteriol 42:378-83.
11. Barbas, C. F., 3rd, A. S. Kang, R. A. Lerner, and S. J. Benkovic. 1991. Assembly of combinatorial antibody libraries on phage surfaces: the gene III site. Proc Natl Acad Sci U S A 88:7978-82.
12. Barbour, A. G. 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J Biol Med 57:521-5.
13. Bass, S., R. Greene, and J. A. Wells. 1990. Hormone phage: an enrichment method for variant proteins with altered binding properties. Proteins 8:309-14.
14. Beghetto, E., A. Spadoni, W. Buffolano, M. Del Pezzo, O. Minenkova, E. Pavoni, A. Pucci, R. Cortese, F. Felici, and N. Gargano. 2003. Molecular dissection of the human B-cell response against Toxoplasma gondii infection by lambda display of cDNA libraries. Int J Parasitol 33:163- 73.
106 10 References
15. Beutler, B., and E. Beutler. 2002. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med 347:1978-80.
16. Beutler, B., and E. T. Rietschel. 2003. Innate immune sensing and its roots: the story of endotoxin. Nat Rev Immunol 3:169-76.
17. Binetruy-Tournaire, R., C. Demangel, B. Malavaud, R. Vassy, S. Rouyre, M. Kraemer, J. Plouet, C. Derbin, G. Perret, and J. C. Mazie. 2000. Identification of a peptide blocking vascular endothelial growth factor (VEGF)-mediated angiogenesis. Embo J 19:1525-33.
18. Blasi, F., J. Boman, G. Esposito, G. Melissano, R. Chiesa, R. Cosentini, P. Tarsia, Y. Tshomba, M. Betti, M. Alessi, N. Morelli, and L. Allegra. 1999. Chlamydia pneumoniae DNA detection in peripheral blood mononuclear cells is predictive of vascular infection. J Infect Dis 180:2074-6.
19. Blessing, E., L. A. Campbell, M. E. Rosenfeld, N. Chough, and C. C. Kuo. 2001. Chlamydia pneumoniae infection accelerates hyperlipidemia induced atherosclerotic lesion development in C57BL/6J mice. Atherosclerosis 158:13-7.
20. Blessing, E., T. M. Lin, L. A. Campbell, M. E. Rosenfeld, D. Lloyd, and C. Kuo. 2000. Chlam ydia pneumoniae induces inflammatory changes in the heart and aorta of normocholesterolemic C57BL/6J mice. Infect Immun 68:4765-8.
21. Boder, E. T., and K. D. Wittrup. 1997. Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553-7.
22. Bodetti, T. J., and P. Timms. 2000. Detection of Chlamydia pneumoniae DNA and antigen in the circulating mononuclear cell fractions of humans and koalas. Infect Immun 68:2744-7.
23. Boman, J., and M. R. Hammerschlag. 2002. Chlamydia pneumoniae and atherosclerosis: critical assessment of diagnostic methods and relevance to treatment studies. Clin Microbiol Rev 15:1-20.
24. Bono, J. L., K. Tilly, B. Stevenson, D. Hogan, and P. Rosa. 1998. Oligopeptide permease in Borrelia burgdorferi: putative peptide-binding components encoded by both chromosomal and plasmid loci. Microbiology 144 ( Pt 4):1033-44.
25. Brachmann, R. K., and J. D. Boeke. 1997. Tag games in yeast: the two-hybrid system and beyond. Curr Opin Biotechnol 8:561-8.
26. Brander, K. A., P. Borbely, R. Crameri, W. J. Pichler, and A. Helbling. 1999. IgE-binding proliferative responses and skin test reactivity to Cop c 1, the first recombinant allergen from the basidiomycete Coprinus comatus. J Allergy Clin Immunol 104:630-6.
27. Brown, S. L., S. L. Hansen, and J. J. Langone. 1999. Role of serology in the diagnosis of Lyme disease. Jama 282:62-6.
28. Buchholz, C. J., K. W. Peng, F. J. Morling, J. Zhang, F. L. Cosset, and S. J. Russell. 1998. In vivo selection of protease cleavage sites from retrovirus display libraries. Nat Biotechnol 16:951- 4.
29. Buer, J., and R. Balling. 2003. Mice, microbes and models of infection. Nat Rev Genet 4:195- 205.
30. Bulut, Y., E. Faure, L. Thomas, H. Karahashi, K. S. Michelsen, O. Equils, S. G. Morrison, R. P. Morrison, and M. Arditi. 2002. Chlamydial heat shock protein 60 activates macrophages and endothelial cells through Toll-like receptor 4 and MD2 in a MyD88-dependent pathway. J Immunol 168:1435-40. 10 References 107
31. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, and J. P. Davis. 1982. Lyme disease-a tick-borne spirochetosis? Science 216:1317-9.
32. Burnett, M. S., C. A. Gaydos, G. E. Madico, S. M. Glad, B. Paigen, T. C. Quinn, and S. E. Epstein. 2001. Atherosclerosis in apoE knockout mice infected with multiple pathogens. J Infect Dis 183:226-231.
33. Burton, D. R. 1995. Phage display. Immunotechnology 1:87-94.
34. Burton, D. R., C. F. Barbas, 3rd, M. A. Persson, S. Koenig, R. M. Chanock, and R. A. Lerner. 1991. A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals. Proc Natl Acad Sci U S A 88:10134-7.
35. Busch, U., C. Hizo-Teufel, R. Bohmer, V. Fingerle, D. Rossler, B. Wilske, and V. Preac- Mursic. 1996. Borrelia burgdorferi sensu lato strains isolated from cutaneous Lyme borreliosis biopsies differentiated by pulsed-field gel electrophoresis. Scand J Infect Dis 28:583-9.
36. Byrne, G. I., S. P. Ouellette, Z. Wang, J. P. Rao, L. Lu, W. L. Beatty, and A. P. Hudson. 2001. Chlamydia pneumoniae expresses genes required for DNA replication but not cytokinesis during persistent infection of HEp-2 cells. Infect Immun 69:5423-9.
37. Caligiuri, G., M. Rottenberg, A. Nicoletti, H. Wigzell, and G. K. Hansson. 2001. Chlamydia pneumoniae infection does not induce or modify atherosclerosis in mice. Circulation 103:2834-8.
38. Campbell, L. A., C. C. Kuo, and J. T. Grayston. 1990. Structural and antigenic analysis of Chlamydia pneumoniae. Infect Immun 58:93-7.
39. Campbell, L. A., T. C. Moazed, C. C. Kuo, and J. T. Grayston. 1998. Preclinical models for Chlamydia pneumoniae and cardiovascular disease: hypercholesterolemic mice. Clin Microbiol Infect 4 Suppl 4:S23-S32.
40. Campbell, L. A., S. Roberts, S. Inoue, L. Kong, and C. C. Kuo Cc. 2001. Evaluation of Chlamydia pneumoniae 43- and 53-kilodalton recombinant proteins for serodiagnosis by Western Blot. Clin Diagn Lab Immunol 8:1231-3.
41. Campbell, L. A., M. Rosenfeld, and C. C. Kuo. 2000. The role of Chlamydia pneumoniae in atherosclerosis --recent evidence from animal models. Trends Microbiol 8:255-7; discussion 257.
42. Carroll, J. A., C. F. Garon, and T. G. Schwan. 1999. Effects of environmental pH on membrane proteins in Borrelia burgdorferi. Infect Immun 67:3181-7.
43. Casjens, S., R. van Vugt, K. Tilly, P. A. Rosa, and B. Stevenson. 1997. Homology throughout the multiple 32-kilobase circular plasmids present in Lyme disease spirochetes. J Bacteriol 179:217-27.
44. CDC. 1995. Recommendations for test performance and interpretation from the Second National Conference on Serologic Diagnosis of Lyme Disease. MMWR Morb Mortal Wkly Rep 44:590-1.
45. Cesareni, G. 1992. Peptide display on filamentous phage capsids. A new powerful tool to study protein-ligand interaction. FEBS Lett 307:66-70.
46. Cesareni, G., L. Castagnoli, and G. Cestra. 1999. Phage displayed peptide libraries. Comb Chem High Throughput Screen 2:1-17.
47. Chandra, H. R., N. Choudhary, C. O'Neill, J. Boura, G. C. Timmis, and W. W. O'Neill. 2001. Chlamydia pneumoniae exposure and inflammatory markers in acute coronary syndrome (CIMACS). Am J Cardiol 88:214-8. 108 10 References
48. Chang, C., J. Dietrich, A. G. Harpur, J. A. Lindquist, A. Haude, Y. W. Loke, A. King, M. Colonna, J. Trowsdale, and M. J. Wilson. 1999. Cutting edge: KAP10, a novel transmembrane adapter protein genetically linked to DAP12 but with unique signaling properties. J Immunol 163:4651-4.
49. Charlton, K., W. J. Harris, and A. J. Porter. 2001. The isolation of super-sensitive anti-hapten antibodies from combinatorial antibody libraries derived from sheep. Biosens Bioelectron 16:639- 46.
50. Chen, G., A. Hayhurst, J. G. Thomas, B. R. Harvey, B. L. Iverson, and G. Georgiou. 2001. Isolation of high-affinity ligand-binding proteins by periplasmic expression with cytometric screening (PECS). Nat Biotechnol 19:537-42.
51. Chen, W., and G. Georgiou. 2002. Cell-Surface display of heterologous proteins: From high- throughput screening to environmental applications. Biotechnol Bioeng 79:496-503.
52. Chesnut, J. D., A. R. Baytan, M. Russell, M. P. Chang, A. Bernard, I. H. Maxwell, and J. P. Hoeffler. 1996. Selective isolation of transiently transfected cells from a mammalian cell population with vectors expressing a membrane anchored single-chain antibody. J Immunol Methods 193:17-27.
53. Chothia, C., and A. M. Lesk. 1987. Canonical structures for the hypervariable regions of immunoglobulins. J Mol Biol 196:901-17.
54. Christiansen, G., L. Ostergaard, and S. Birkelund. 1997. Molecular biology of the Chlamydia pneumoniae s urface. Scand J Infect Dis Suppl 104:5-10.
55. Cicchini, C., H. Ansuini, L. Amicone, T. Alonzi, A. Nicosia, R. Cortese, M. Tripodi, and A. Luzzago. 2002. Searching for DNA-protein interactions by lambda phage display. J Mol Biol 322:697-706.
56. Ciervo, A., P. Visca, A. Petrucca, L. M. Biasucci, A. Maseri, and A. Cassone. 2002. Antibodies to 60-kilodalton heat shock protein and outer membrane protein 2 of Chlamydia pneumoniae in patients with coronary heart disease. Clin Diagn Lab Immunol 9:66-74.
57. Clackson, T., H. R. Hoogenboom, A. D. Griffiths, and G. Winter. 1991. Making antibody fragments using phage display libraries. Nature 352:624-8.
58. Cook, P. J., P. Davies, W. Tunnicliffe, J. G. Ayres, D. Honeybourne, and R. Wise. 1998. Chlamydia pneumoniae and asthma. Thorax 53:254-9.
59. Corey, D. R., A. K. Shiau, Q. Yang, B. A. Janowski, and C. S. Craik. 1993. Trypsin display on the surface of bacteriophage. Gene 128:129-34.
60. Costa, C. P., C. J. Kirschning, D. Busch, S. Durr, L. Jennen, U. Heinzmann, S. Prebeck, H. Wagner, and T. Miethke. 2002. Role of chlamydial heat shock protein 60 in the stimulation of innate immune cells by Chlamydia pneumoniae. Eur J Immunol 32:2460-70.
61. Coyle, P. K. 1997. Advances and pitfalls in the diagnosis of Lyme disease. FEMS Immunol Med Microbiol 19:103-9.
62. Crameri, A., S. Cwirla, and W. P. Stemmer. 1996. Construction and evolution of antibody-phage libraries by DNA shuffling. Nat Med 2:100-2.
63. Crameri, R. 1998. Recombinant Aspergillus fumigatus allergens: from the nucleotide sequences to clinical applications. Int Arch Allergy Immunol 115:99-114.
64. Crameri, R., G. Achatz, M. Weichel, and C. Rhyner. 2002. Direct selection of cDNAs by phage display. Methods Mol Biol 185:461-9. 10 References 109
65. Crameri, R., and K. Blaser. 1996. Cloning Aspergillus fumigatus allergens by the pJuFo filamentous phage display system. Int Arch Allergy Immunol 110:41-5.
66. Crameri, R., R. Jaussi, G. Menz, and K. Blaser. 1994. Display of expression products of cDNA libraries on phage surfaces. A versatile screening system for selective isolation of genes by specific gene-product/ligand interaction. Eur J Biochem 226:53-8.
67. Crameri, R., and R. Kodzius. 2001. The powerful combination of phage surface display of cDNA libraries and high throughput screening. Comb Chem High Throughput Screen 4:145-55.
68. Crameri, R., and M. Suter. 1993. Display of biologically active proteins on the surface of filamentous phages: a cDNA cloning system for selection of functional gene products linked to the genetic information responsible for their production. Gene 137:69-75.
69. Crameri, R., and M. Suter. 1995. Display of biologically active proteins on the surface of filamentous phages: a cDNA cloning system for the selection of functional gene products linked to the genetic information responsible for their production [Gene 137 (1993) 69-75]. Gene 160:139.
70. Cull, M. G., J. F. Miller, and P. J. Schatz. 1992. Screening for receptor ligands using large libraries of peptides linked to the C terminus of the lac repressor. Proc Natl Acad Sci U S A 89:1865-9.
71. Danesh, J., P. Whincup, M. Walker, L. Lennon, A. Thomson, P. Appleby, Y. Wong, M. Bernardes-Silva, and M. Ward. 2000. Chlamydia pneumoniae IgG titres and coronary heart disease: prospective study and meta-analysis. BMJ 321:208-13.
72. Danner, S., and J. G. Belasco. 2001. T7 phage display: a novel genetic selection system for cloning RNA-binding proteins from cDNA libraries. Proc Natl Acad Sci U S A 98:12954-9.
73. Das, S., S. W. Barthold, S. S. Giles, R. R. Montgomery, S. R. Telford, 3rd, and E. Fikrig. 1997. Temporal pattern of Borrelia burgdorferi p21 expression in ticks and the mammalian host. J Clin Invest 99:987-95.
74. Daugherty, P. S., G. Chen, B. L. Iverson, and G. Georgiou. 2000. Quantitative analysis of the effect of the mutation frequency on the affinity maturation of single chain Fv antibodies. Proc Natl Acad Sci U S A 97:2029-34.
75. de Bruin, R., K. Spelt, J. Mol, R. Koes, and F. Quattrocchio. 1999. Selection of high-affinity phage antibodies from phage display libraries. Nat Biotechnol 17:397-9.
76. de Kruif, J., L. Terstappen, E. Boel, and T. Logtenberg. 1995. Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library. Proc Natl Acad Sci U S A 92:3938-42.
77. De Michelis, S., H. S. Sewell, M. Collares-Pereira, M. Santos-Reis, L. M. Schouls, V. Benes, E. C. Holmes, and K. Kurtenbach. 2000. Genetic diversity of Borrelia burgdorferi sensu lato in ticks from mainland Portugal. J Clin Microbiol 38:2128-33.
78. de Wildt, R. M., C. R. Mundy, B. D. Gorick, and I. M. Tomlinson. 2000. Antibody arrays for high-throughput screening of antibody-antigen interactions. Nat Biotechnol 18:989-94.
79. Demaerschalck, I., A. Ben Messaoud, M. De Kesel, B. Hoyois, Y. Lobet, P. Hoet, G. Bigaignon, A. Bollen, and E. Godfroid. 1995. Simultaneous presence of different Borrelia burgdorferi genospecies in biological fluids of Lyme disease patients. J Clin Microbiol 33:602-8.
80. di Marzo Veronese, F., A. E. Willis, C. Boyer-Thompson, E. Appella, and R. N. Perham. 1994. Structural mimicry and enhanced immunogenicity of peptide epitopes displayed on filamentous bacteriophage. The V3 loop of HIV-1 gp120. J Mol Biol 243:167-72. 110 10 References
81. Diterich, I., L. Härter, D. Hassler, A. Wendel, and T. Hartung. 2001. Modulation of Cytokine Release in Ex Vivo-Stimulated Blood from Borreliosis Patients. Infect Immun 69:687-694.
82. Doorbar, J., and G. Winter. 1994. Isolation of a peptide antagonist to the thrombin receptor using phage display. J Mol Biol 244:361-9.
83. Dowell, S. F., R. W. Peeling, J. Boman, G. M. Carlone, B. S. Fields, J. Guarner, M. R. Hammerschlag, L. A. Jackson, C. C. Kuo, M. Maass, T. O. Messmer, D. F. Talkington, M. L. Tondella, and S. R. Zaki. 2001. Standardizing Chlamydia pneumoniae assays: recommendations from the Centers for Disease Control and Prevention (USA) and the Laboratory Centre for Disease Control (Canada). Clin Infect Dis 33:492-503.
84. Edelson, B. T., and E. R. Unanue. 2002. MyD88-dependent but Toll-like receptor 2-independent innate immunity to Listeria: no role for either in macrophage listericidal activity. J Immunol 169:3869-75.
85. Ekman, M. R., M. Leinonen, H. Syrjala, E. Linnanmaki, P. Kujala, and P. Saikku. 1993. Evaluation of serological methods in the diagnosis of Chlamydia pneumoniae pneumonia during an epidemic in Finland. Eur J Clin Microbiol Infect Dis 12:756-60.
86. Enshell-Seijffers, D., L. Smelyanski, and J. M. Gershoni. 2001. The rational design of a 'type 88' genetically stable peptide display vector in the filamentous bacteriophage fd. Nucleic Acids Res 29:E50-0.
87. Eriksson, T. L., O. Rasool, S. Huecas, P. Whitley, R. Crameri, U. Appenzeller, G. Gafvelin, and M. van Hage-Hamsten. 2001. Cloning of three new allergens from the dust mite Lepidoglyphus destructor using phage surface display technology. Eur J Biochem 268:287-94.
88. Erkkila, L., K. Laitinen, A. Laurila, P. Saikku, and M. Leinonen. 2002. Experimental Chlamydia pneumoniae infection in NIH/S mice: effect of reinoculation with chlamydial or cell preparation on culture, PCR and histological findings of lung tissue. Vaccine 20:2318-24.
89. Ernst, W., R. Grabherr, D. Wegner, N. Borth, A. Grassauer, and H. Katinger. 1998. Baculovirus surface display: construction and screening of a eukaryotic epitope library. Nucleic Acids Res 26:1718-23.
90. Escudero, R., M. Barral, A. Perez, M. M. Vitutia, A. L. Garcia-Perez, S. Jimenez, R. E. Sellek, and P. Anda. 2000. Molecular and pathogenic characterization of Borrelia burgdorferi sensu lato isolates from Spain. J Clin Microbiol 38:4026-33.
91. Essig, A., U. Simnacher, M. Susa, and R. Marre. 1999. Analysis of the humoral immune response to Chlamydia pneumoniae by immunoblotting and immunoprecipitation. Clin Diagn Lab Immunol 6:819-25.
92. Etz, H., D. B. Minh, T. Henics, A. Dryla, B. Winkler, C. Triska, A. P. Boyd, J. Sollner, W. Schmidt, U. von Ahsen, M. Buschle, S. R. Gill, J. Kolonay, H. Khalak, C. M. Fraser, A. von Gabain, E. Nagy, and A. Meinke. 2002. Identification of in vivo expressed vaccine candidate antigens from Staphylococcus aureus. Proc Natl Acad Sci U S A 99:6573-8.
93. Evans, T. J., E. Strivens, A. Carpenter, and J. Cohen. 1993. Differences in cytokine response and induction of nitric oxide synthase in endotoxin-resistant and endotoxin-sensitive mice after intravenous gram -negative infection. J Immunol 150:5033-40.
94. Fehrsen, J., and D. H. du Plessis. 1999. Cross-reactive epitope mimics in a fragmented- genome phage display library derived from the rickettsia, Cowdria ruminantium. Immunotechnology 4:175-84.
95. Ferrer, M., and S. C. Harrison. 1999. Peptide ligands to human immunodeficiency virus type 1 gp120 identified from phage display libraries. J Virol 73:5795-802. 10 References 111
96. Fikrig, E., S. W. Barthold, W. Sun, W. Feng, S. R. Telford, 3rd, and R. A. Flavell. 1997. Borrelia burgdorferi P35 and P37 proteins, expressed in vivo, elicit protective immunity. Immunity 6:531-9.
97. Fingerle, V., U. Hauser, G. Liegl, B. Petko, V. Preac-Mursic, and B. Wilske. 1995. Expression of outer surface proteins A and C of Borrelia burgdorferi in Ixodes ricinus. J Clin Microbiol 33:1867-9.
98. Flajnik, M. F. 2002. Comparative analyses of immunoglobulin genes: surprises and portents. Nat Rev Immunol 2:688-98.
99. Fleischmann, R. D., M. D. Adams, O. White, R. A. Clayton, E. F. Kirkness, A. R. Kerlavage, C. J. Bult, J. F. Tomb, B. A. Dougherty, J. M. Merrick, and et al. 1995. Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269:496-512.
100. Fong, I. W., B. Chiu, E. Viira, D. Jang, and J. B. Mahony. 1999. De Novo induction of atherosclerosis by Chlamydia pneumoniae in a rabbit model. Infect Immun 67:6048-55.
101. Forrer, P., S. Jung, and A. Pluckthun. 1999. Beyond binding: using phage display to select for structure, folding and enzymatic activity in proteins. Curr Opin Struct Biol 9:514-20.
102. Franz, J. K., and A. Krause. 2003. Lyme disease (Lyme borreliosis). Best Pract Res Clin Rheumatol 17:241-64.
103. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, J. C. Venter, and et al. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-6.
104. Freidank, H. M., A. S. Herr, and E. Jacobs. 1993. Identification of Chlamydia pneumoniae- specific protein antigens in immunoblots. Eur J Clin Microbiol Infect Dis 12:947-51.
105. Fuchs, P., F. Breitling, S. Dubel, T. Seehaus, and M. Little. 1991. Targeting recombinant antibodies to the surface of Escherichia coli: fusion to a peptidoglycan associated lipoprotein. Biotechnology (N Y) 9:1369-72.
106. Galanos, C., M. Gumenscheimer, P. Muhlradt, E. Jirillo, and M. Freudenberg. 2000. MALP-2, a Mycoplasma lipopeptide with classical endotoxic properties: end of an era of LPS monopoly? J Endotoxin Res 6:471-6.
107. Gao, C., S. Mao, H. J. Ditzel, L. Farnaes, P. Wirsching, R. A. Lerner, and K. D. Janda. 2002. A cell-penetrating peptide from a novel pVII-pIX phage-displayed random peptide library. Bioorg Med Chem 10:4057-65.
108. Gao, C., S. Mao, G. Kaufmann, P. Wirsching, R. A. Lerner, and K. D. Janda. 2002. A method for the generation of combinatorial antibody libraries using pIX phage display. Proc Natl Acad Sci U S A 99:12612-6.
109. Garrard, L. J., and D. J. Henner. 1993. Selection of an anti-IGF-1 Fab from a Fab phage library created by mutagenesis of multiple CDR loops. Gene 128:103-9.
110. Garrard, L. J., M. Yang, M. P. O'Connell, R. F. Kelley, and D. J. Henner. 1991. Fab assembly and enrichment in a monovalent phage display system. Biotechnology (N Y) 9:1373-7.
111. Gascon, I., J. M. Lazaro, and M. Salas. 2000. Differential functional behavior of viral phi29, Nf and GA-1 SSB proteins. Nucleic Acids Res 28:2034-42.
112. Ge, Y., and N. W. Charon. 1997. Identification of a large motility operon in Borrelia burgdorferi by semi-random PCR chromosome walking. Gene 189:195-201. 112 10 References
113. Ge, Y., I. G. Old, I. S. Girons, and N. W. Charon. 1997. The flgK motility operon of Borrelia burgdorferi is initiated by a sigma 70-like promoter. Microbiology 143 ( Pt 5):1681-90.
114. Geng, M. M., Schuhmacher, A., Muehldorfer,I., Bensch, K.W., Schaefer, K.P., Schneider, S., Pohl, T., Essig, A., Marre, R. and Melchers, K. 2003. The genome sequence of Chlamydia pneumoniae TW183 and comparison with other Chlamydia strains based on whole genome sequence analysis, Konstanz.
115. Georgiou, G., C. Stathopoulos, P. S. Daugherty, A. R. Nayak, B. L. Iverson, and R. Curtiss, 3rd. 1997. Display of heterologous proteins on the surface of microorganisms: from the screening of combinatorial libraries to live recombinant vaccines. Nat Biotechnol 15:29-34.
116. Gieffers, J., H. Fullgraf, J. Jahn, M. Klinger, K. Dalhoff, H. A. Katus, W. Solbach, and M. Maass. 2001. Chlamydia pneumoniae infection in circulating human monocytes is refractory to antibiotic treatment. Circulation 103:351-6.
117. Glaser, S. M., D. E. Yelton, and W. D. Huse. 1992. Antibody engineering by codon-based mutagenesis in a filamentous phage vector system. J Immunol 149:3903-13.
118. Gomes-Solecki, M. J., J. J. Dunn, B. J. Luft, J. Castillo, D. E. Dykhuizen, X. Yang, J. D. Glass, and R. J. Dattwyler. 2000. Recombinant chimeric Borrelia proteins for diagnosis of Lyme disease. J Clin Microbiol 38:2530-5.
119. Gomes-Solecki, M. J., G. P. Wormser, D. H. Persing, B. W. Berger, J. D. Glass, X. Yang, and R. J. Dattwyler. 2001. A first-tier rapid assay for the serodiagnosis of Borrelia burgdorferi infection. Arch Intern Med 161:2015-20.
120. Grayston, J. T. 2000. Background and Current Knowledge of Chlamydia pneumoniae and Atherosclerosis. J Infect Dis 181:S402-S410.
121. Grayston, J. T. 1999. Does Chlamydia pneumoniae cause atherosclerosis? Arch Surg 134:930- 4.
122. Grayston, J. T., M. B. Aldous, A. Easton, S. P. Wang, C. C. Kuo, L. A. Campbell, and J. Altman. 1993. Evidence that Chlamydia pneumoniae causes pneumonia and bronchitis. J Infect Dis 168:1231-5.
123. Grayston, J. T., L. A. Campbell, C. C. Kuo, C. H. Mordhorst, P. Saikku, D. H. Thom, and S. P. Wang. 1990. A new respiratory tract pathogen: Chlamydia pneumoniae strain TWAR. J Infect Dis 161:618-25.
124. Grayston, J. T., C. C. Kuo, L. A. Campbell, and S. P. Wang. 1989. Chlamydia pneumoniae sp. nov. for Chlamydia sp. Strain TWAR. Int J Clin Syst Bacteriol 8:88-90.
125. Grayston, J. T., C. C. Kuo, S. P. Wang, and J. Altman. 1986. A new Chlamydia psittaci strain, TWAR, isolated in acute respiratory tract infections. N Engl J Med 315:161-8.
126. Grayston, J. T., C. Mordhorst, A. L. Bruu, S. Vene, and S. P. Wang. 1989. Countrywide epidemics of Chlamydia pneumoniae, strain TWAR, in Scandinavia, 1981-1983. J Infect Dis 159:1111-4.
127. Griffiths, A. D., M. Malmqvist, J. D. Marks, J. M. Bye, M. J. Embleton, J. McCafferty, M. Baier, K. P. Holliger, B. D. Gorick, N. C. Hughes-Jones, and et al. 1993. Human anti-self antibodies with high specificity from phage display libraries. Embo J 12:725-34.
128. Griffiths, A. D., and D. S. Tawfik. 2000. Man-made enzymes --from design to in vitro compartmentalisation. Curr Opin Biotechnol 11:338-53.
129. Grimwood, J., L. Olinger, and R. S. Stephens. 2001. Expression of Chlamydia pneumoniae polymorphic membrane protein family genes. Infect Immun 69:2383-9. 10 References 113
130. Grimwood, J., and R. S. Stephens. 1999. Computational analysis of the polymorphic membrane protein superfamily of Chlamydia trachomatis and Chlamydia pneumoniae. Microb Comp Genomics 4:187-201.
131. Gupta, A., M. Onda, I. Pastan, S. Adhya, and V. K. Chaudhary. 2003. High-density functional display of proteins on bacteriophage lambda. J Mol Biol 334:241-54.
132. Hahn, D. L., A. A. Azenabor, W. L. Beatty, and G. I. Byrne. 2002. Chlamydia pneumoniae as a respiratory pathogen. Front Biosci 7:66-76.
133. Hahn, D. L., R. W. Peeling, E. Dillon, R. McDonald, and P. Saikku. 2000. Serologic markers for Chlamydia pneumoniae in asthma. Ann Allergy Asthma Immunol 84:227-33.
134. Hammerschlag, M. R. 2000. Chlamydia pneumoniae and the lung. Eur Respir J 16:1001-7.
135. Hammerschlag, M. R. 1992. Chlamydia pneumoniae infections. Pediatr Infect Dis J 12.
136. Hammerschlag, M. R., K. Chirgwin, P. M. Roblin, M. Gelling, W. Dumornay, L. Mandel, P. Smith, and J. Schachter. 1992. Persistent infection with Chlamydia pneumoniae following acute respiratory illness. Clin Infect Dis 14:178-82.
137. Hanes, J., and A. Pluckthun. 1997. In vitro selection and evolution of functional proteins by using ribosome display. Proc Natl Acad Sci U S A 94:4937-42.
138. Hattori, M., A. Fujiyama, T. D. Taylor, H. Watanabe, T. Yada, H. S. Park, A. Toyoda, K. Ishii, Y. Totoki, D. K. Choi, Y. Groner, E. Soeda, M. Ohki, T. Takagi, Y. Sakaki, S. Taudien, K. Blechschmidt, A. Polley, U. Menzel, J. Delabar, K. Kumpf, R. Lehmann, D. Patterson, K. Reichwald, A. Rump, M. Schillhabel, A. Schudy, W. Zimmermann, A. Rosenthal, J. Kudoh, K. Schibuya, K. Kawasaki, S. Asakawa, A. Shintani, T. Sasaki, K. Nagamine, S. Mitsuyama, S. E. Antonarakis, S. Minoshima, N. Shimizu, G. Nordsiek, K. Hornischer, P. Brant, M. Scharfe, O. Schon, A. Desario, J. Reichelt, G. Kauer, H. Blocker, J. Ramser, A. Beck, S. Klages, S. Hennig, L. Riesselmann, E. Dagand, T. Haaf, S. Wehrmeyer, K. Borzym, K. Gardiner, D. Nizetic, F. Francis, H. Lehrach, R. Reinhardt, and M. L. Yaspo. 2000. The DNA sequence of human chromosome 21. Nature 405:311-9.
139. Hawkins, R. E., S. J. Russell, and G. Winter. 1992. Selection of phage antibodies by binding affinity. Mimicking affinity maturation. J Mol Biol 226:889-96.
140. Haziot, A., N. Hijiya, S. C. Gangloff, J. Silver, and S. M. Goyert. 2001. Induction of a novel mechanism of accelerated bacterial clearance by lipopolysaccharide in CD14-deficient and Toll- like receptor 4-deficient mice. J Immunol 166:1075-8.
141. Heal, K. G., H. R. Hill, P. G. Stockley, M. R. Hollingdale, and A. W. Taylor-Robinson. 1999. Expression and immunogenicity of a liver stage malaria epitope presented as a foreign peptide on the surface of RNA-free MS2 bacteriophage capsids. Vaccine 18:251-8.
142. Heikkila, T., H. I. Huppertz, I. Seppala, H. Sillanpaa, H. Saxen, and P. Lahdenne. 2003. Recombinant or peptide antigens in the serology of Lyme arthritis in children. J Infect Dis 187:1888-94.
143. Heikkila, T., I. Seppala, H. Saxen, J. Panelius, M. Peltomaa, T. Julin, S. A. Carlsson, and P. Lahdenne. 2002. Recombinant BBK32 protein in serodiagnosis of early and late Lyme borreliosis. J Clin Microbiol 40:1174-80.
144. Heikkila, T., I. Seppala, H. Saxen, J. Panelius, H. Yrjanainen, and P. Lahdenne. 2002. Species -specific serodiagnosis of Lyme arthritis and neuroborreliosis due to Borrelia burgdorferi sensu stricto, B. afzelii, and B. garinii by using decorin binding protein A. J Clin Microbiol 40:453- 60. 114 10 References
145. Hemmann, S., W. H. Nikolaizik, M. H. Schoni, K. Blaser, and R. Crameri. 1998. Differential IgE recognition of recombinant Aspergillus fumigatus allergens by cystic fibrosis patients with allergic bronchopulmonary aspergillosis or Aspergillus allergy. Eur J Immunol 28:1155-60.
146. Hermann, C., K. Graf, A. Groh, E. Straube, and T. Hartung. 2002. Comparison of eleven commercial tests for Chlamydia pneumoniae-specific immunoglobulin G in asymptomatic healthy individuals. J Clin Microbiol 40:1603-9.
147. Hertveldt, K., M. L. Dechassa, J. Robben, and G. Volckaert. 2003. Identification of Gal80p- interacting proteins by Saccharomyces cerevisiae whole genome phage display. Gene 307:141- 9.
148. Hessling, J., M. J. Lohse, and K. N. Klotz. 2003. Peptide G protein agonists from a phage display library. Biochem Pharmacol 65:961-7.
149. Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, and J. J. Weis. 1999. Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by toll-like receptor 2. J Immunol 163:2382-6.
150. Hoess, R. H. 2002. Bacteriophage lambda as a vehicle for peptide and protein display. Curr Pharm Biotechnol 3:23-8.
151. Hollborn, M., J. Kirchberger, G. Birkenmeier, and G. Kopperschlager. 1999. Epitope mapping of a monoclonal antibody directed against the alpha-subunit of phosphofructokinase-1 from Saccharomyces cerevisiae by screening phage display libraries. J Mol Recognit 12:33-7.
152. Holt, L. J., C. Enever, R. M. de Wildt, and I. M. Tomlinson. 2000. The use of recombinant antibodies in proteomics. Curr Opin Biotechnol 11:445-9.
153. Holzem, A., J. M. Nahring, and R. Fischer. 2001. Rapid identification of a tobacco mosaic virus epitope by using a coat protein gene-fragment-pVIII fusion library. J Gen Virol 82:9-15.
154. Hoogenboom, H. R. 2002. Overview of antibody phage-display technology and its applications. Methods Mol Biol 178:1-37.
155. Hoogenboom, H. R., A. D. Griffiths, K. S. Johnson, D. J. Chiswell, P. Hudson, and G. Winter. 1991. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res 19:4133-7.
156. Houshmand, H., and A. Bergqvist. 2003. Interaction of hepatitis C virus NS5A with La protein revealed by T7 phage display. Biochem Biophys Res Commun 309:695-701.
157. Hu, H., G. N. Pierce, and G. Zhong. 1999. The atherogenic effects of chlamydia are dependent on serum cholesterol and specific to Chlamydia pneumoniae. J Clin Invest 103:747-53.
158. Hufton, S. E., P. T. Moerkerk, E. V. Meulemans, A. de Bruine, J. W. Arends, and H. R. Hoogenboom. 1999. Phage display of cDNA repertoires: the pVI display system and its applications for the selection of immunogenic ligands. J Immunol Methods 231:39-51.
159. Huiskonen, J. T., L. Laakkonen, M. Toropainen, M. Sarvas, D. H. Bamford, and J. K. Bamford. 2003. Probing the ability of the coat and vertex protein of the membrane-containing bacteriophage PRD1 to display a meningococcal epitope. Virology 310:267-79.
160. Hunfeld, K. P., G. Stanek, E. Straube, H. J. Hagedorn, C. Schorner, F. Muhlschlegel, and V. Brade. 2002. Quality of Lyme disease serology. Lessons from the German Proficiency Testing Program 1999-2001. A preliminary report. Wien Klin Wochenschr 114:591-600.
161. Huppertz, H. I., M. Bohme, S. M. Standaert, H. Karch, and S. A. Plotkin. 1999. Incidence of Lyme borreliosis in the Wurzburg region of Germany. Eur J Clin Microbiol Infect Dis 18:697-703. 10 References 115
162. Ide, T., S. H. Baik, T. Matsuba, and S. Harayama. 2003. Identification by the phage-display technique of peptides that bind to H7 flagellin of Escherichia coli. Biosci Biotechnol Biochem 67:1335-41.
163. Irving, M. B., O. Pan, and J. K. Scott. 2001. Random -peptide libraries and antigen-fragment libraries for epitope mapping and the development of vaccines and diagnostics. Curr Opin Chem Biol 5:314-24.
164. Irving, R. A., A. A. Kortt, and P. J. Hudson. 1996. Affinity maturation of recombinant antibodies using E. coli mutator cells. Immunotechnology 2:127-43.
165. Jacobsson, K., and L. Frykberg. 1995. Cloning of ligand-binding domains of bacterial receptors by phage display. Biotechniques 18:878-85.
166. Jacobsson, K., and L. Frykberg. 1996. Phage display shot-gun cloning of ligand-binding domains of prokaryotic receptors approaches 100% correct clones. Biotechniques 20:1070-6, 1078, 1080-1.
167. Jacobsson, K., A. Rosander, J. Bjerketorp, and L. Frykberg. 2003. Shotgun Phage Display - Selection for Bacterial Receptins or other Exported Proteins. Biol Proced Online 5:123-135.
168. Jantos, C. A., S. Heck, R. Roggendorf, M. Sen-Gupta, and J. H. Hegemann. 1997. Antigenic and molecular analyses of different Chlamydia pneumoniae strains. J Clin Microbiol 35:620-3.
169. Jespers, L. S., J. H. Messens, A. De Keyser, D. Eeckhout, I. Van den Brande, Y. G. Gansemans, M. J. Lauwereys, G. P. Vlasuk, and P. E. Stanssens. 1995. Surface expression and ligand-based selection of cDNAs fused to filamentous phage gene VI. Biotechnology (N Y) 13:378-82.
170. Jiang, J., L. Abu-Shilbayeh, and V. B. Rao. 1997. Display of a PorA peptide from Neisseria meningitidis on the bacteriophage T4 capsid surface. Infect Immun 65:4770-7.
171. Jung, S., K. M. Arndt, K. M. Muller, and A. Pluckthun. 1999. Selectively infective phage (SIP) technology: scope and limitations. J Immunol Methods 231:93-104.
172. Jung, S., A. Honegger, and A. Pluckthun. 1999. Selection for improved protein stability by phage display. J Mol Biol 294:163-80.
173. Kaiser, R. 2000. False-negative serology in patients with neuroborreliosis and the value of employing of different borrelial strains in serological assays. J Med Microbiol 49:911-5.
174. Kalayoglu, M. V., P. Libby, and G. I. Byrne. 2002. Chlamydia pneumoniae as an emerging risk factor in cardiovascular disease. JAMA 288:2724-31.
175. Kalman, S., W. Mitchell, R. Marathe, C. Lammel, J. Fan, R. W. Hyman, L. Olinger, J. Grimwood, R. W. Davis, and R. S. Stephens. 1999. Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nat Genet 21:385-9.
176. Kang, A. S., C. F. Barbas, K. D. Janda, S. J. Benkovic, and R. A. Lerner. 1991. Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proc Natl Acad Sci U S A 88:4363-6.
177. Kang, C. K., V. Jayasinha, and P. T. Martin. 2003. Identification of peptides that specifically bind Abeta1-40 amyloid in vitro and amyloid plaques in Alzheimer's disease brain using phage display. Neurobiol Dis 14:146-56.
178. Kasahara, N., A. M. Dozy, and Y. W. Kan. 1994. Tissue-specific targeting of retroviral vectors through ligand-receptor interactions. Science 266:1373-6. 116 10 References
179. Kaukoranta-Tolvanen, S. S., A. L. Laurila, P. Saikku, M. Leinonen, L. Liesirova, and K. Laitinen. 1993. Experimental infection of Chlamydia pneumoniae in mice. Microb Pathog 15:293- 302.
180. Kauppinen, M., and P. Saikku. 1995. Pneumonia due to Chlamydia pneumoniae: prevalence, clinical features, diagnosis, and treatment. Clin Infect Dis 21 Suppl 3:S244-52.
181. Kawa, D. E., and R. S. Stephens. 2002. Antigenic topology of chlamydial PorB protein and identification of targets for immune neutralization of infectivity. J Immunol 168:5184-91.
182. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, and S. Akira. 1999. Unresponsiveness of MyD88- deficient mice to endotoxin. Immunity 11:115-22.
183. Kay, B. K., N. B. Adey, Y. S. He, J. P. Manfredi, A. H. Mataragnon, and D. M. Fowlkes. 1993. An M13 phage library displaying random 38-amino-acid peptides as a source of novel sequences with affinity to selected targets. Gene 128:59-65.
184. Kay, B. K., J. Kasanov, S. Knight, and A. Kurakin. 2000. Convergent evolution with combinatorial peptides. FEBS Lett 480:55-62.
185. Kay, B. K., J. Winter, and J. McCafferty. 1996. Phage Display of peptides and proteins: a laboratory manual, San Diego.
186. Kern, D. G., M. A. Neill, and J. Schachter. 1993. A seroepidemiologic study of Chlamydia pneumoniae in Rhode Island. Evidence of serologic cross-reactivity. Chest 104:208-13.
187. Kishchenko, G., H. Batliwala, and L. Makowski. 1994. Structure of a foreign peptide displayed on the surface of bacteriophage M13. J Mol Biol 241:208-13.
188. Kleber-Janke, T., R. Crameri, U. Appenzeller, M. Schlaak, and W. M. Becker. 1999. Selective cloning of peanut allergens, including profilin and 2S albumins, by phage display technology. Int Arch Allergy Immunol 119:265-74.
189. Kleber-Janke, T., R. Crameri, S. Scheurer, S. Vieths, and W. M. Becker. 2001. Patient-tailored cloning of allergens by phage display: peanut (Arachis hypogaea) profilin, a food allergen derived from a rare mRNA. J Chromatogr B Biomed Sci Appl 756:295-305.
190. Klein, M., A. Kotz, K. Bernardo, and M. Kronke. 2003. Detection of Chlamydia pneumoniae- specific antibodies binding to the VD2 and VD3 regions of the major outer membrane protein. J Clin Microbiol 41:1957-62.
191. Knudsen, K., A. S. Madsen, P. Mygind, G. Christiansen, and S. Birkelund. 1999. Identification of two novel genes encoding 97- to 99-kilodalton outer membrane proteins of Chlamydia pneumoniae. Infect Immun 67:375-83.
192. Kodadek, T. 2001. Protein microarrays: prospects and problems. Chem Biol 8:105-15.
193. Kodzius, R., C. Rhyner, Z. Konthur, D. Buczek, H. Lehrach, G. Walter, and R. Crameri. 2003. Rapid identification of allergen-encoding cDNA clones by phage display and high-density arrays. Comb Chem High Throughput Screen 6:147-54.
194. Kolonin, M., R. Pasqualini, and W. Arap. 2001. Molecular addresses in blood vessels as targets for therapy. Curr Opin Chem Biol 5:308-13.
195. Kouzmitcheva, G. A., V. A. Petrenko, and G. P. Smith. 2001. Identifying diagnostic peptides for lyme disease through epitope discovery. Clin Diagn Lab Immunol 8:150-60.
196. Kranendonk, M., A. Laires, J. Rueff, W. R. Estabrook, and N. P. Vermeulen. 2000. Heterologous expression of xenobiotic mammalian-metabolizing enzymes in mutagenicity tester bacteria: an update and practical considerations. Crit Rev Toxicol 30:287-306. 10 References 117
197. Krebber, C., S. Spada, D. Desplancq, A. Krebber, L. Ge, and A. Pluckthun. 1997. Selectively- infective phage (SIP): a mechanistic dissection of a novel in vivo selection for protein-ligand interactions. J Mol Biol 268:607-18.
198. Kutlin, A., C. Flegg, D. Stenzel, T. Reznik, P. M. Roblin, S. Mathews, P. Timms, and M. R. Hammerschlag. 2001. Ultrastructural Study of Chlamydia pneumoniae In a Continuous -Infection Model. J Clin Microbiol 39:3721-3.
199. Kutlin, A., P. M. Roblin, and M. R. Hammerschlag. 2002. Effect of gemifloxacin on viability of Chlamydia pneumoniae (Chlamydophila pneumoniae) in an in vitro continuous infection model. J Antimicrob Chemother 49:763-7.
200. Kutlin, A., P. M. Roblin, and M. R. Hammerschlag. 2002. Effect of prolonged treatment with azithromycin, clarithromycin, or levofloxacin on Chlamydia pneumoniae in a continuous -infection Model. Antimicrob Agents Chemother 46:409-12.
201. Kutlin, A., N. Tsumura, U. Emre, P. M. Roblin, and M. R. Hammerschlag. 1997. Evaluation of Chlamydia immunoglobulin M (IgM), IgG, and IgA rELISAs Medac for diagnosis of Chlamydia pneumoniae infection. Clin Diagn Lab Immunol 4:213-6.
202. Lagal, V., D. Postic, and G. Baranton. 2002. Molecular diversity of the ospC gene in Borrelia. Impact on phylogeny, epidemiology and pathology. Wien Klin Wochenschr 114:562-7.
203. Lahdenne, P., J. Panelius, H. Saxen, T. Heikkila, H. Sillanpaa, M. Peltomaa, M. Arnez, H. I. Huppertz, and I. J. Seppala. 2003. Improved serodiagnosis of erythema migrans using novel recombinant borrelial BBK32 antigens. J Med Microbiol 52:563-7.
204. Laitinen, K., A. L. Laurila, M. Leinonen, and P. Saikku. 1996. Reactivation of Chlamydia pneumoniae infection in mice by cortisone treatment. Infect Immun 64:1488-90.
205. Lambkin, I., and C. Pinilla. 2002. Targeting approaches to oral drug delivery. Expert Opin Biol Ther 2:67-73.
206. Lang, I. M., C. F. Barbas, 3rd, and R. R. Schleef. 1996. Recombinant rabbit Fab with binding activity to type-1 plasminogen activator inhibitor derived from a phage-display library against human alpha-granules. Gene 172:295-8.
207. Laurila, A. L., L. Von Hertzen, and P. Saikku. 1997. Chlamydia pneumoniae and chronic lung diseases. Scand J Infect Dis Suppl 104:34-6.
208. Lauterbach, S. B., R. Lanzillotti, and T. L. Coetzer. 2003. Construction and use of Plasmodium falciparum phage display libraries to identify host parasite interactions. Malar J 2:47.
209. Lauwereys, M., M. Arbabi Ghahroudi, A. Desmyter, J. Kinne, W. Holzer, E. De Genst, L. Wyns, and S. Muyldermans. 1998. Potent enzyme inhibitors derived from dromedary heavy- chain antibodies. Embo J 17:3512-20.
210. Lehner, M. D., S. Morath, K. S. Michelsen, R. R. Schumann, and T. Hartung. 2001. Induction of cross-tolerance by lipopolysaccharide and highly purified lipoteichoic acid via different Toll-like receptors independent of paracrine mediators. J Immunol 166:5161-7.
211. Leinonen, M. 1993. Pathogenetic mechanisms and epidemiology of Chlamydia pneumoniae. Eur Heart J 14 Suppl K:57-61.
212. Lekkerkerker, A., and T. Logtenberg. 1999. Phage antibodies against human dendritic cell subpopulations obtained by flow cytometry-based selection on freshly isolated cells. J Immunol Methods 231:53-63.
213. Lenz, G. R., H. M. Nash, and S. Jindal. 2000. Chemical ligands, genomics and drug discovery. Drug Discov Today 5:145-156. 118 10 References
214. Levitan, B. 1998. Stochastic modeling and optimization of phage display. J Mol Biol 277:893- 916.
215. Li, M. 2000. Applications of display technology in protein analysis. Nat Biotechnol 18:1251-6.
216. Li, Z. J., J. H. Liu, X. W. Gong, Q. H. Qin, H. Huang, P. Deng, J. Z. Wang, S. C. Zhao, X. G. Sun, Y. W. Liu, K. S. Zhao, and Y. Jiang. 2003. Screening and identification of proteins interacting with p38 MAP kinase via T7 phage-display screening system. Di Yi Jun Yi Da Xue Xue Bao 23:1131-3.
217. Liang, F. T., A. C. Steere, A. R. Marques, B. J. Johnson, J. N. Miller, and M. T. Philipp. 1999. Sensitive and specific serodiagnosis of Lyme disease by enzyme-linked immunosorbent assay with a peptide based on an immunodominant conserved region of Borrelia burgdorferi vlsE. J Clin Microbiol 37:3990-6.
218. Lien, E., and R. R. Ingalls. 2002. Toll-like receptors. Crit Care Med 30:S1-S11.
219. Light, J., and R. A. Lerner. 1995. Random mutagenesis of staphylococcal nuclease and phage display selection. Bioorg Med Chem 3:955-67.
220. Limbach, F. X., B. Jaulhac, X. Puechal, H. Monteil, J. L. Kuntz, Y. Piemont, and J. Sibilia. 2001. Treatment resistant Lyme arthritis caused by Borrelia garinii. Ann Rheum Dis 60:284-6.
221. Lindborg, M., C. G. Magnusson, A. Zargari, M. Schmidt, A. Scheynius, R. Crameri, and P. Whitley. 1999. Selective cloning of allergens from the skin colonizing yeast Malassezia furfur by phage surface display technology. J Invest Dermatol 113:156-61.
222. Lindholt, J. S., H. Fasting, E. W. Henneberg, and L. Ostergaard. 1999. A review of Chlamydia pneumoniae and atherosclerosis. Eur J Vasc Endovasc Surg 17:283-9.
223. Lindmark, H., and B. Guss. 1999. SFS, a novel fibronectin-binding protein from Streptococcus equi, inhibits the binding between fibronectin and collagen. Infect Immun 67:2383-8.
224. Ling, M. M. 2003. Large antibody display libraries for isolation of high-affinity antibodies. Comb Chem High Throughput Screen 6:421-32.
225. Linnanmaki, E., M. Leinonen, K. Mattila, M. S. Nieminen, V. Valtonen, and P. Saikku. 1993. Chlamydia pneumoniae-specific circulating immune complexes in patients with chronic coronary heart disease. Circulation 87:1130-4.
226. Liveris, D., G. Wang, G. Girao, D. W. Byrne, J. Nowakowski, D. McKenna, R. Nadelman, G. P. Wormser, and I. Schwartz. 2002. Quantitative Detection of Borrelia burgdorferi in 2-Millimeter Skin Samples of Erythema Migrans Lesions: Correlation of Results with Clinical and Laboratory Findings. J Clin Microbiol 40:1249-53.
227. Lohse, P. A., and M. C. Wright. 2001. In vitro protein display in drug discovery. Curr Opin Drug Discov Devel 4:198-204.
228. Low, N. M., P. H. Holliger, and G. Winter. 1996. Mimicking somatic hypermutation: affinity maturation of antibodies displayed on bacteriophage using a bacterial mutator strain. J Mol Biol 260:359-68.
229. Maass, M., C. Bartels, P. M. Engel, U. Mamat, and H. H. Sievers. 1998. Endovascular presence of viable Chlamydia pneumoniae is a common phenomenon in coronary artery disease. J Am Coll Cardiol 31:827-32.
230. Maass, M., J. Jahn, J. Gieffers, K. Dalhoff, H. A. Katus, and W. Solbach. 2000. Detection of Chlamydia pneumoniae within peripheral blood monocytes of patients with unstable angina or myocardial infarction. J Infect Dis 181 Suppl 3:S449-51. 10 References 119
231. Magnarelli, L. A., E. Fikrig, S. J. Padula, J. F. Anderson, and R. A. Flavell. 1996. Use of recombinant antigens of Borrelia burgdorferi in serologic tests for diagnosis of lyme borreliosis. J Clin Microbiol 34:237-40.
232. Magnarelli, L. A., J. W. Ijdo, S. J. Padula, R. A. Flavell, and E. Fikrig. 2000. Serologic diagnosis of Lyme borreliosis by using enzyme-linked immunosorbent assays with recombinant antigens. J Clin Microbiol 38:1735-9.
233. Magnarelli, L. A., M. Lawrenz, S. J. Norris, and E. Fikrig. 2002. Comparative reactivity of human sera to recombinant VlsE and other Borrelia burgdorferi antigens in class-specific enzyme-linked immunosorbent assays for Lyme borreliosis. J Med Microbiol 51:649-55.
234. Magnarelli, L. A., J. N. Miller, J. F. Anderson, and G. R. Riviere. 1990. Cross-reactivity of nonspecific treponemal antibody in serologic tests for Lyme disease. J Clin Microbiol 28:1276-9.
235. Mahony, J. B. 2002. Chlamydiae host cell interactions revealed using DNA microarrays. Ann N Y Acad Sci 975:192-201.
236. Malinverni, R., C. C. Kuo, L. A. Campbell, and J. T. Grayston. 1995. Reactivation of Chlamydia pneumoniae lung infection in mice by cortisone. J Infect Dis 172:593-4.
237. Malinverni, R., C. C. Kuo, L. A. Campbell, A. Lee, and T. J. Grayston. 1995. Effect of two antibiotic regimens on course and persistence of experimental Chlamydia pneumoniae TWAR pneumonitis. Antimicrob. Agents Chemother. 39:45-49.
238. Malys, N., D. Y. Chang, R. G. Baumann, D. Xie, and L. W. Black. 2002. A bipartite bacteriophage T4 SOC and HOC randomized peptide display library: detection and analysis of phage T4 terminase (gp17) and late sigma factor (gp55) interaction. J Mol Biol 319:289-304.
239. Markland, W., A. C. Ley, and R. C. Ladner. 1996. Iterative optimization of high-affinity protease inhibitors using phage display. 2. Plasma kallikrein and thrombin. Biochemistry 35:8058-67.
240. Markland, W., A. C. Ley, S. W. Lee, and R. C. Ladner. 1996. Iterative optimization of high- affinity proteases inhibitors using phage display. 1. Plasmin. Biochemistry 35:8045-57.
241. Marks, J. D., A. D. Griffiths, M. Malmqvist, T. P. Clackson, J. M. Bye, and G. Winter. 1992. By-passing immunization: building high affinity human antibodies by chain shuffling. Biotechnology (N Y) 10:779-83.
242. Marques, A. R., F. Stock, and V. Gill. 2000. Evaluation of a new culture medium for Borrelia burgdorferi. J Clin Microbiol 38:4239-41.
243. Marston, E. L., A. V. James, J. T. Parker, J. C. Hart, T. M. Brown, T. O. Messmer, D. L. Jue, C. M. Black, G. M. Carlone, E. W. Ades, and J. Sampson. 2002. Newly characterized species - specific immunogenic Chlamydophila pneumoniae peptide reactive with murine monoclonal and human serum antibodies. Clin Diagn Lab Immunol 9:446-52.
244. Martin, F., C. Toniatti, A. L. Salvati, S. Venturini, G. Ciliberto, R. Cortese, and M. Sollazzo. 1994. The affinity-selection of a minibody polypeptide inhibitor of human interleukin-6. Embo J 13:5303-9.
245. Marvin, D. A. 1998. Filamentous phage structure, infection and assembly. Curr Opin Struct Biol 8:150-8.
246. Mathews, S., C. George, C. Flegg, D. Stenzel, and P. Timms. 2001. Differential expression of ompA, ompB, pyk, nlpD and Cpn0585 genes between normal and interferon-gamma treated cultures of Chlamydia pneumoniae. Microb Pathog 30:337-45.
247. May, A. E., V. Redecke, S. Gruner, R. Schmidt, S. Massberg, T. Miethke, B. Ryba, C. Prazeres Da Costa, A. Schomig, and F. J. Neumann. 2003. Recruitment of Chlamydia 120 10 References
pneumoniae-Infected Macrophages to the Carotid Artery Wall in Noninfected, Nonatherosclerotic Mice. Arterioscler Thromb Vasc Biol 23:789-94.
248. McCafferty, J., A. D. Griffiths, G. Winter, and D. J. Chiswell. 1990. Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348:552-4.
249. McVean, G. A., and G. D. Hurst. 2000. Evolutionary lability of context-dependent codon bias in bacteria. J Mol Evol 50:264-75.
250. Mead, D. A., and B. Kemper. 1988. Chimeric single-stranded DNA phage-plasmid cloning vectors. Biotechnology 10:85-102.
251. Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh, and C. A. Janeway, Jr. 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol Cell 2:253-8.
252. Meulemans, E. V., R. Slobbe, P. Wasterval, F. C. Ramaekers, and G. J. van Eys. 1994. Selection of phage-displayed antibodies specific for a cytoskeletal antigen by competitive elution with a monoclonal antibody. J Mol Biol 244:353-60.
253. Miller, L. K. 1988. Baculoviruses as gene expression vectors. Annu Rev Microbiol 42:177-99.
254. Minenkova, O., N. Gargano, A. De Tomassi, F. Bellintani, A. Pucci, P. Fortugno, E. Fuscaldi, A. Pessi, M. Rapicetta, M. Miceli, P. Iudicone, R. Cortese, F. Felici, and P. Monaci. 2001. ADAM-HCV, a new-concept diagnostic assay for antibodies to hepatitis C virus in serum. Eur J Biochem 268:4758-68.
255. Moazed, T. C., L. A. Campbell, M. E. Rosenfeld, J. T. Grayston, and C. C. Kuo. 1999. Chlamydia pneumoniae infection accelerates the progression of atherosclerosis in apolipoprotein E-deficient mice. J Infect Dis 180:238-41.
256. Moazed, T. C., C. Kuo, J. T. Grayston, and L. A. Campbell. 1997. Murine models of Chlamydia pneumoniae infection and atherosclerosis. J Infect Dis 175:883-90.
257. Montigiani, S., F. Falugi, M. Scarselli, O. Finco, R. Petracca, G. Galli, M. Mariani, R. Manetti, M. Agnusdei, R. Cevenini, M. Donati, R. Nogarotto, N. Norais, I. Garaguso, S. Nuti, G. Saletti, D. Rosa, G. Ratti, and G. Grandi. 2002. Genomic approach for analysis of surface proteins in Chlamydia pneumoniae. Infect Immun 70:368-79.
258. Morath, S., A. Geyer, and T. Hartung. 2001. Structure-function relationship of cytokine induction by lipoteichoic acid from Staphylococcus aureus. J Exp Med 193:393-7.
259. Mueller, M., I. Muehldorfer, K. Maehnss, M. Weichel, R. Crameri, T. Hartung, and C. Hermann. 2003. Identification of antigenic peptides from a genomic random phage library of Chlamydophila pneumoniae, Chlamydial antigen identification by Phage Display, Konstanz.
260. Mueller, M., M. Weichel, I. Diterich, C. Rauter, D. Hassler, R. Crameri, and T. Hartung. 2003. Phage surface display as a tool to identify novel Borrelia antigens for serodiagnosis, Antigen identification by Phage Display, Konstanz.
261. Mullaney, B. P., M. G. Pallavicini, and J. D. Marks. 2001. Epitope mapping of neutralizing botulinum neurotoxin A antibodies by phage display. Infect Immun 69:6511-4.
262. Munchhoff, P., B. Wilske, V. Preac-Mursic, and G. Schierz. 1987. Antibodies against Borrelia burgdorferi in Bavarian forest workers. Zentralbl Bakteriol Mikrobiol Hyg [A] 263:412-9.
263. Muruganandam, A. V., S. K. Bhattacharya, and S. Ghosal. 2001. Antidepressant activity of hyperforin conjugates of the St. John's wort, Hypericum perforatum Linn.: an experimental study. Indian J Exp Biol 39:1302-4. 10 References 121
264. Naidu, B. R., Y. F. Ngeow, L. F. Wang, L. Chan, Z. J. Yao, and T. Pang. 1998. An immunogenic epitope of Chlamydia pneumoniae from a random phage display peptide library is reactive with both monoclonal antibody and patients sera. Immunol Lett 62:111-5.
265. Netea, M. G., B. J. Kullberg, J. M. Galama, A. F. Stalenhoef, C. A. Dinarello, and J. W. Van der Meer. 2002. Non-LPS components of Chlamydia pneumoniae stimulate cytokine production through Toll-like receptor 2-dependent pathways. Eur J Immunol 32:1188-95.
266. Norris, S. J., C. J. Carter, J. K. Howell, and A. G. Barbour. 1992. Low-passage-associated proteins of Borrelia burgdorferi B31: characterization and molecular cloning of OspD, a surface- exposed, plasmid-encoded lipoprotein. Infect Immun 60:4662-72.
267. Nowakowski, J., I. Schwartz, D. Liveris, G. Wang, M. E. Aguero-Rosenfeld, G. Girao, D. McKenna, R. B. Nadelman, L. F. Cavaliere, and G. P. Wormser. 2001. Laboratory diagnostic techniques for patients with early Lyme disease associated with erythema migrans: a comparison of different techniques. Clin Infect Dis 33:2023-7.
268. Oehme, R., K. Hartelt, H. Backe, S. Brockmann, and P. Kimmig. 2002. Foci of tick-borne diseases in southwest Germany. Int J Med Microbiol 291 Suppl 33:22-9.
269. Oksi, J., M. Marjamaki, J. Nikoskelainen, and M. K. Viljanen. 1999. Borrelia burgdorferi detected by culture and PCR in clinical relapse of disseminated Lyme borreliosis. Ann Med 31:225-32.
270. O'Neil, K. T., R. H. Hoess, S. A. Jackson, N. S. Ramachandran, S. A. Mousa, and W. F. DeGrado. 1992. Identification of novel peptide antagonists for GPIIb/IIIa from a conformationally constrained phage peptide library. Proteins 14:509-15.
271. Opitz, B., N. W. Schroder, I. Spreitzer, K. S. Michelsen, C. J. Kirschning, W. Hallatschek, U. Zahringer, T. Hartung, U. B. Gobel, and R. R. Schumann. 2001. Toll-like receptor-2 mediates Treponema glycolipid and lipoteichoic acid-induced NF-kappaB translocation. J Biol Chem 276:22041-7.
272. Orloski, K. A., E. B. Hayes, G. L. Campbell, and D. T. Dennis. 2000. Surveillance for Lyme disease-United States, 1992-1998. Mor Mortal Wkly Rep CDC Surveill Summ 49:1-11.
273. Osbourn, J. K., E. J. Derbyshire, T. J. Vaughan, A. W. Field, and K. S. Johnson. 1998. Pathfinder selection: in situ isolation of novel antibodies. Immunotechnology 3:293-302.
274. Ozanne, G., and J. Lefebvre. 1992. Specificity of the microimmunofluorescence assay for the serodiagnosis of Chlamydia pneumoniae infections. Can J Microbiol 38:1185-9.
275. Padula, S. J., F. Dias, A. Sampieri, R. B. Craven, and R. W. Ryan. 1994. Use of recombinant OspC from Borrelia burgdorferi for serodiagnosis of early Lyme disease. J Clin Microbiol 32:1733- 8.
276. Palzkill, T., W. Huang, and G. M. Weinstock. 1998. Mapping protein-ligand interactions using whole genome phage display libraries. Gene 221:79-83.
277. Panelius, J., P. Lahdenne, T. Heikkila, M. Peltomaa, J. Oksi, and I. Seppala. 2002. Recombinant OspC from Borrelia burgdorferi sensu stricto, B. afzelii and B. garinii in the serodiagnosis of Lyme borreliosis. J Med Microbiol 51:731-9.
278. Panelius, J., P. Lahdenne, H. Saxen, T. Heikkila, and I. Seppala. 2001. Recombinant flagellin A proteins from Borrelia burgdorferi sensu stricto, B. afzelii, and B. garinii in serodiagnosis of Lyme borreliosis. J Clin Microbiol 39:4013-9.
279. Parmley, S. F., and G. P. Smith. 1988. Antibody-selectable filamentous fd phage vectors: affinity purification of target genes. Gene 73:305-18. 122 10 References
280. Pasqualini, R., and E. Ruoslahti. 1996. Organ targeting in vivo using phage display peptide libraries. Nature 380:364-6.
281. Peeling, R. W., S. P. Wang, J. T. Grayston, F. Blasi, J. Boman, A. Clad, H. Freidank, C. A. Gaydos, J. Gnarpe, T. Hagiwara, R. B. Jones, J. Orfila, K. Persson, M. Puolakkainen, P. Saikku, and J. Schachter. 2000. Chlamydia pneumoniae serology: interlaboratory variation in microimmunofluorescence assay results. J Infect Dis 181 Suppl 3:S426-9.
282. Penttila, J. M., M. Anttila, M. Puolakkainen, A. Laurila, K. Varkila, M. Sarvas, P. H. Makela, and N. Rautonen. 1998. Local immune responses to Chlamydia pneumoniae in the lungs of BALB/c mice during primary infection and reinfection. Infect Immun 66:5113-8.
283. Penttila, J. M., M. Anttila, K. Varkila, M. Puolakkainen, M. Sarvas, P. H. Makela, and N. Rautonen. 1999. Depletion of CD8+ cells abolishes memory in acquired immunity against Chlamydia pneumoniae in BALB/c mice. Immunology 97:490-6.
284. Perez Melgosa, M., C. C. Kuo, and L. A. Campbell. 1994. Isolation and characterization of a gene encoding a Chlamydia pneumoniae 76-kilodalton protein containing a species -specific epitope. Infect Immun 62:880-6.
285. Peterson, E. M., X. Cheng, Z. Qu, and L. M. de La Maza. 1996. Characterization of the murine antibody response to peptides representing the variable domains of the major outer membrane protein of Chlamydia pneumoniae. Infect Immun 64:3354-9.
286. Pfeiffer, A., A. Bottcher, E. Orso, M. Kapinsky, P. Nagy, A. Bodnar, I. Spreitzer, G. Liebisch, W. Drobnik, K. Gempel, M. Horn, S. Holmer, T. Hartung, G. Multhoff, G. Schutz, H. Schindler, A. J. Ulmer, H. Heine, F. Stelter, C. Schutt, G. Rothe, J. Szollosi, S. Damjanovich, and G. Schmitz. 2001. Lipopolysaccharide and ceramide docking to CD14 provokes ligand- specific receptor clustering in rafts. Eur J Immunol 31:3153-64.
287. Pizza, M., V. Scarlato, V. Masignani, M. M. Giuliani, B. Arico, M. Comanducci, G. T. Jennings, L. Baldi, E. Bartolini, B. Capecchi, C. L. Galeotti, E. Luzzi, R. Manetti, E. Marchetti, M. Mora, S. Nuti, G. Ratti, L. Santini, S. Savino, M. Scarselli, E. Storni, P. Zuo, M. Broeker, E. Hundt, B. Knapp, E. Blair, T. Mason, H. Tettelin, D. W. Hood, A. C. Jeffries, N. J. Saunders, D. M. Granoff, J. C. Venter, E. R. Moxon, G. Grandi, and R. Rappuoli. 2000. Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science 287:1816-20.
288. Poland, G. A. 2001. Prevention of Lyme disease: a review of the evidence. Mayo Clin Proc 76:713-24.
289. Portig, I., J. C. Goodall, R. L. Bailey, and J. S. Gaston. 2003. Characterization of the humoral immune response to Chlamydia outer membrane protein 2 in chlamydial infection. Clin Diagn Lab Immunol 10:103-7.
290. Prebeck, S., C. Kirschning, S. Durr, C. da Costa, B. Donath, K. Brand, V. Redecke, H. Wagner, and T. Miethke. 2001. Predominant role of toll-like receptor 2 versus 4 in Chlamydia pneumoniae-induced activation of dendritic cells. J Immunol 167:3316-23.
291. Proulx, C., L. Boyer, I. St-Amour, R. Bazin, and R. Lemieux. 2002. Higher affinity human D MoAb prepared by light-chain shuffling and selected by phage display. Transfusion 42:59-65.
292. Rappuoli, R. 2001. Reverse vaccinology, a genome-based approach to vaccine development. Vaccine 19:2688-91.
293. Rauter, C., R. Oehme, I. Diterich, M. Engele, and T. Hartung. 2002. Distribution of clinically relevant Borrelia genospecies in ticks assessed by a novel, single-run, real-time PCR. J Clin Microbiol 40:36-43.
294. Read, T. D., R. C. Brunham, C. Shen, S. R. Gill, J. F. Heidelberg, O. White, E. K. Hickey, J. Peterson, T. Utterback, K. Berry, S. Bass, K. Linher, J. Weidman, H. Khouri, B. Craven, C. 10 References 123
Bowman, R. Dodson, M. Gwinn, W. Nelson, R. DeBoy, J. Kolonay, G. McClarty, S. L. Salzberg, J. Eisen, and C. M. Fraser. 2000. Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Res 28:1397-406.
295. Reed, K. D. 2002. Laboratory testing for Lyme disease: possibilities and practicalities. J Clin Microbiol 40:319-24.
296. Reiling, N., C. Holscher, A. Fehrenbach, S. Kroger, C. J. Kirschning, S. Goyert, and S. Ehlers. 2002. Cutting edge: Toll-like receptor (TLR)2- and TLR4-mediated pathogen recognition in resistance to airborne infection with Mycobacterium tuberculosis. J Immunol 169:3480-4.
297. Rhyner, C. 2003. The application of phage surface displayed cDNA and antibody libraries in allergy research. Universität Zürich, Davos.
298. Rhyner, C., R. Kodzius, and R. Crameri. 2002. Direct selection of cDNAs from filamentous phage surface display libraries: potential and limitations. Curr Pharm Biotechnol 3:13-21.
299. Rhyner, C., Z. Konthur, K. Blaser, and R. Crameri. 2003. High-throughput isolation of recombinant antibodies against recombinant allergens. Biotechniques 35:672-4.
300. Rijpkema, S. G., D. J. Tazelaar, M. J. Molkenboer, G. T. Noordhoek, G. Plantinga, L. M. Schouls, and J. F. Schellekens. 1997. Detection of Borrelia afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema migrans and acrodermatitis chronica atrophicans. Clin Microbiol Infect 3:109-116.
301. Rijpkema, S. G., D. J. Tazelaar, M. J. Molkenboer, G. T. Noordhoek, G. Plantinga, L. M. Schouls, and J. F. Schellekens. 1996. Detection of Borrelia afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema migrans and acrodermatitis chronica atrophicans. Clin Microbiol Infect 3:109-116.
302. Robben, J., K. Hertveldt, E. Bosmans, and G. Volckaert. 2002. Selection and identification of dense granule antigen GRA3 by Toxoplasma gondii whole genome phage display. J Biol Chem 277:17544-7.
303. Roberts, B. L., W. Markland, K. Siranosian, M. J. Saxena, S. K. Guterman, and R. C. Ladner. 1992. Protease inhibitor display M13 phage: selection of high-affinity neutrophil elastase inhibitors. Gene 121:9-15.
304. Roblin, P. M., W. Dumornay, and M. R. Hammerschlag. 1992. Use of HEp-2 cells for improved isolation and passage of Chlamydia pneumoniae. J Clin Microbiol 30:1968-71.
305. Rockey, D. D., J. Lenart, and R. S. Stephens. 2000. Genome sequencing and our understanding of chlamydiae. Infect Immun 68:5473-9.
306. Rodel, J., M. Woytas, A. Groh, K. H. Schmidt, M. Hartmann, M. Lehmann, and E. Straube. 2000. Production of basic fibroblast growth factor and interleukin 6 by human smooth muscle cells following infection with Chlamydia pneumoniae. Infect Immun 68:3635-41.
307. Ross, B. C., L. Czajkowski, D. Hocking, M. Margetts, E. Webb, L. Rothel, M. Patterson, C. Agius, S. Camuglia, E. Reynolds, T. Littlejohn, B. Gaeta, A. Ng, E. S. Kuczek, J. S. Mattick, D. Gearing, and I. G. Barr. 2001. Identification of vaccine candidate antigens from a genomic analysis of Porphyromonas gingivalis. Vaccine 19:4135-42.
308. Rottenberg, M. E., A. Gigliotti Rothfuchs, D. Gigliotti, M. Ceausu, C. Une, V. Levitsky, and H. Wigzell. 2000. Regulation and role of IFN-gamma in the innate resistance to infection with Chlamydia pneumoniae. J Immunol 164:4812-8.
309. Rottenberg, M. E., A. C. Gigliotti Rothfuchs, D. Gigliotti, C. Svanholm, L. Bandholtz, and H. Wigzell. 1999. Role of innate and adaptive immunity in the outcome of primary infection with Chlamydia pneumoniae, as analyzed in genetically modified mice. J Immunol 162:2829-36. 124 10 References
310. Russel, M. 1991. Filamentous phage assembly. Mol Microbiol 5:1607-13.
311. Saikku, P. 1992. The epidemiology and significance of Chlamydia pneumoniae. J Infect 25 Suppl 1:27-34.
312. Saikku, P., M. Leinonen, K. Mattila, M. R. Ekman, M. S. Nieminen, P. H. Makela, J. K. Huttunen, and V. Valtonen. 1988. Serological evidence of an association of a novel Chlamydia, TWAR, with chronic coronary heart disease and acute myocardial infarction. Lancet 2:983-6.
313. Saikku, P., M. Leinonen, L. Tenkanen, E. Linnanmaki, M. R. Ekman, V. Manninen, M. Manttari, M. H. Frick, and J. K. Huttunen. 1992. Chronic Chlamydia pneumoniae infection as a risk factor for coronary heart disease in the Helsinki Heart Study. Ann Intern Med 116:273-8.
314. Sander, D., K. Winbeck, J. Klingelhofer, T. Etgen, and B. Conrad. 2001. Enhanced progression of early carotid atherosclerosis is related to Chlamydia pneumoniae (Taiwan acute respiratory) seropositivity. Circulation 103:1390-5.
315. Santini, C., D. Brennan, C. Mennuni, R. H. Hoess, A. Nicosia, R. Cortese, and A. Luzzago. 1998. Efficient display of an HCV cDNA expression library as C-terminal fusion to the capsid protein D of bacteriophage lambda. J Mol Biol 282:125-35.
316. Sasu, S., D. LaVerda, N. Qureshi, D. T. Golenbock, and D. Beasley. 2001. Chlamydia pneumoniae and chlamydial heat shock protein 60 stimulate proliferation of human vascular smooth muscle cells via toll-like receptor 4 and p44/p42 mitogen-activated protein kinase activation. Circ Res 89:244-50.
317. Sato, A., and S. Sone. 2003. A peptide mimetic of human interferon (IFN)-beta. Biochem J 371:603-8.
318. Schier, R., J. Bye, G. Apell, A. McCall, G. P. Adams, M. Malmqvist, L. M. Weiner, and J. D. Marks. 1996. Isolation of high-affinity monomeric human anti-c-erbB-2 single chain Fv using affinity-driven selection. J Mol Biol 255:28-43.
319. Schwan, T. G., W. Burgdorfer, and C. F. Garon. 1988. Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation. Infect Immun 56(8):1831-1836.
320. Schwan, T. G., J. Piesman, W. T. Golde, M. C. Dolan, and P. A. Rosa. 1995. Induction of an outer surface protein on Borrelia burgdorferi during tick feeding. Proc Natl Acad Sci U S A 92(7):2909-13.
321. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, and C. J. Kirschning. 1999. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem 274:17406-9.
322. Schwartz, I., G. P. Wormser, J. J. Schwartz, D. Cooper, P. Weissensee, A. Gazumyan, E. Zimmermann, N. S. Goldberg, S. Bittker, G. L. Campbell, and et al. 1992. Diagnosis of early Lyme disease by polymerase chain reaction amplification and culture of skin biopsies from erythema migrans lesions. J Clin Microbiol 30:3082-8.
323. Scott, J. K., and G. P. Smith. 1990. Searching for peptide ligands with an epitope library. Science 249:386-90.
324. Seinost, G., W. T. Golde, B. W. Berger, J. J. Dunn, D. Qiu, D. S. Dunkin, D. E. Dykhuizen, B. J. Luft, and R. J. Dattwyler. 1999. Infection with multiple strains of Borrelia burgdorferi sensu stricto in patients with Lyme disease. Arch Dermatol 135:1329-33.
325. Shirai, M., H. Hirakawa, M. Kimoto, M. Tabuchi, F. Kishi, K. Ouchi, T. Shiba, K. Ishii, M. Hattori, S. Kuhara, and T. Nakazawa. 2000. Comparison of whole genome sequences of Chlamydia pneumoniae J138 from Japan and CWL029 from USA. Nucleic Acids Res 28:2311-4. 10 References 125
326. Shor, A., C. C. Kuo, and D. L. Patton. 1992. Detection of Chlamydia pneumoniae in coronary arterial fatty streaks and atheromatous plaques. S Afr Med J 82:158-61.
327. Sigal, L. H., J. M. Zahradnik, P. Lavin, S. J. Patella, G. Bryant, R. Haselby, E. Hilton, M. Kunkel, D. Adler-Klein, T. Doherty, J. Evans, P. J. Molloy, A. L. Seidner, J. R. Sabetta, H. J. Simon, M. S. Klempner, J. Mays, D. Marks, and S. E. Malawista. 1998. A vaccine consisting of recombinant Borrelia burgdorferi outer-surface protein A to prevent Lyme disease. Recombinant Outer-Surface Protein A Lyme Disease Vaccine Study Consortium. N Engl J Med 339:216-22.
328. Smieja, M., J. B. Mahony, C. H. Goldsmith, S. Chong, A. Petrich, and M. Chernesky. 2001. Replicate PCR testing and probit analysis for detection and quantitation of Chlamydia pneumoniae in clinical specimens. J Clin Microbiol 39:1796-801.
329. Smith, G. P. 1985. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228:1315-7.
330. Spada, S., C. Krebber, and A. Pluckthun. 1997. Selectively infective phages (SIP). Biol Chem 378:445-56.
331. Sriram, S., W. Mitchell, and C. Stratton. 1998. Multiple sclerosis associated with Chlamydia pneumoniae infection of the CNS. Neurology 50:571-2.
332. Steere, A. C. 1997. Diagnosis and treatment of Lyme arthritis. Med Clin North Am 81:179-94.
333. Steere, A. C. 2001. Lyme disease. N Engl J Med 345:115-25.
334. Steere, A. C., R. T. Schoen, and E. Taylor. 1987. The clinical evolution of Lyme arthritis. Ann Intern Med 107(5):725-31.
335. Steere, A. C., V. K. Sikand, F. Meurice, D. L. Parenti, E. Fikrig, R. T. Schoen, J. Nowakowski, C. H. Schmid, S. Laukamp, C. Buscarino, and D. S. Krause. 1998. Vaccination against Lyme disease with recombinant Borrelia burgdorferi outer-surface lipoprotein A with adjuvant. Lyme Disease Vaccine Study Group. N Engl J Med 339:209-15.
336. Stevenson, B., K. Tilly, and P. A. Rosa. 1996. A family of genes located on four separate 32- kilobase circular plasmids in Borrelia burgdorferi B31. J Bacteriol 178:3508-16.
337. Stricker, R. B., J. Burrascano, and E. Winger. 2002. Longterm decrease in the CD57 lymphocyte subset in a patient with chronic Lyme Disease. Ann Agric Environ Med 9:111-3.
338. Stricker, R. B., and E. E. Winger. 2001. Decreased CD57 lymphocyte subset in patients with chronic Lyme disease. Immunol Lett 76:43-8.
339. Sui, J., J. Bai, A. St Clair Tallarico, C. Xu, and W. A. Marasco. 2003. Identification of CD4 and transferrin receptor antibodies by CXCR4 antibody-guided Pathfinder selection. Eur J Biochem 270:4497-506.
340. Suk, K., S. Das, W. Sun, B. Jwang, S. W. Barthold, R. A. Flavell, and E. Fikrig. 1995. Borrelia burgdorferi genes selectively expressed in the infected host. Proc Natl Acad Sci U S A 92:4269- 73.
341. Swanborg, R. H., J. A. Whittum-Hudson, and A. P. Hudson. 2003. Infectious agents and multiple sclerosis --are Chlamydia pneumoniae and human herpes virus 6 involved? J Neuroimmunol 136:1-8.
342. Takahashi, T. T., R. J. Austin, and R. W. Roberts. 2003. mRNA display: ligand discovery, interaction analysis and beyond. Trends Biochem Sci 28:159-65.
343. Takeuchi, O., K. Hoshino, and S. Akira. 2000. Cutting edge: TLR2-deficient and MyD88- deficient mice are highly susceptible to Staphylococcus aureus infection. J Immunol 165:5392-6. 126 10 References
344. Takeuchi, O., K. Takeda, K. Hoshino, O. Adachi, T. Ogawa, and S. Akira. 2000. Cellular responses to bacterial cell wall components are mediated through MyD88-dependent signaling cascades. Int Immunol 12:113-7.
345. Tang, S. S., W. S. Tan, S. Devi, L. F. Wang, T. Pang, and K. L. Thong. 2003. Mimotopes of the Vi antigen of Salmonella enterica serovar typhi identified from phage display peptide library. Clin Diagn Lab Immunol 10:1078-84.
346. Tatusova, T. A., and T. L. Madden. 1999. Blast 2 sequences - a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett 174:247-250.
347. Tessmann, K., A. Erhardt, D. Haussinger, and T. Heintges. 2002. Cloning and molecular characterization of human high affinity antibody fragments against Hepatitis C virus NS3 helicase. J Virol Methods 103:75-88.
348. Tordsson, J. M., L. G. Ohlsson, L. B. Abrahmsen, P. J. Karlstrom, P. A. Lando, and T. N. Brodin. 2000. Phage-selected primate antibodies fused to superantigens for immunotherapy of malignant melanoma. Cancer Immunol Immunother 48:691-702.
349. Treib, J., A. Haass, W. Stille, M. Maass, C. Stephan, G. Holzer, M. Morgenthaler, R. Woessner, and M. T. Grauer. 2000. Multiple sclerosis and Chlamydia pneumoniae. Ann Neurol 47:408; author reply 409-11.
350. Trepel, M., W. Arap, and R. Pasqualini. 2002. In vivo phage display and vascular heterogeneity: implications for targeted medicine. Curr Opin Chem Biol 6:399-404.
351. Triantafilou, K., M. Triantafilou, and R. L. Dedrick. 2001. A CD14-independent LPS receptor cluster. Nat Immunol 2:338-45.
352. Triantafilou, M., and K. Triantafilou. 2002. Lipopolysaccharide recognition: CD14, TLRs and the LPS-activation cluster. Trends Immunol 23:301-4.
353. Tumanova, O., V. N. Kuvshinov, I. A. Orlovskaia, T. R. Proniaeva, A. G. Pokrovskii, A. A. Il'ichev, and L. S. Sandakhchiev. 2003. [Immunogenetic properties of peptides mimicking a human immunodeficiency virus gp41 (HIV-1) epitope recognized by virus-neutralizing antibody 2F5]. Mol Biol (Mosk) 37:556-60.
354. Twort, F. W. 1915. An Iinvestigation on the nature of ultra-microscopic viruses. The Lancet 189:1241-1243.
355. Underhill, D. M. 2003. Toll-like receptors: networking for success. Eur J Immunol 33:1767-75.
356. van der Heijden, I. M., B. Wilbrink, S. G. Rijpkema, L. M. Schouls, P. H. Heymans, J. D. van Embden, F. C. Breedveld, and P. P. Tak. 1999. Detection of Borrelia burgdorferi sensu stricto by reverse line blot in the joints of Dutch patients with Lyme arthritis. Arthritis Rheum 42:1473-80.
357. Van Ewijk, W., J. de Kruif, W. T. Germeraad, P. Berendes, C. Ropke, P. P. Platenburg, and T. Logtenberg. 1997. Subtractive isolation of phage-displayed single-chain antibodies to thymic stromal cells by using intact thymic fragments. Proc Natl Acad Sci U S A 94:3903-8.
358. van Meerten, D., R. C. Olsthoorn, J. van Duin, and R. M. Verhaert. 2001. Peptide display on live MS2 phage: restrictions at the RNA genome level. J Gen Virol 82:1797-805.
359. VanAntwerp, J. J., and K. D. Wittrup. 2000. Fine affinity discrimination by yeast surface display and flow cytometry. Biotechnol Prog 16:31-7.
360. Vandahl, B. B., A. S. Pedersen, K. Gevaert, A. Holm, J. Vandekerckhove, G. Christiansen, and S. Birkelund. 2002. The expression, processing and localization of polymorphic membrane proteins in Chlamydia pneumoniae strain CWL029. BMC Microbiol 2:36. 10 References 127
361. Vaughan, T. J., J. K. Osbourn, and P. R. Tempest. 1998. Human antibodies by design. Nat Biotechnol 16:535-9.
362. Vaughan, T. J., A. J. Williams, K. Pritchard, J. K. Osbourn, A. R. Pope, J. C. Earnshaw, J. McCafferty, R. A. Hodits, J. Wilton, and K. S. Johnson. 1996. Human antibodies with sub- nanomolar affinities isolated from a large non-immunized phage display library. Nat Biotechnol 14:309-14.
363. Verhaert, R. M., J. Van Duin, and W. J. Quax. 1999. Processing and functional display of the 86 kDa heterodimeric penicillin G acylase on the surface of phage fd. Biochem J 342 ( Pt 2):415-22.
364. Vink, A., M. Poppen, A. H. Schoneveld, P. J. Roholl, D. P. de Kleijn, C. Borst, and G. Pasterkamp. 2001. Distribution of Chlamydia pneumoniae in the human arterial system and its relation to the local amount of atherosclerosis within the individual. Circulation 103:1613-7.
365. Virnekas, B., L. Ge, A. Pluckthun, K. C. Schneider, G. Wellnhofer, and S. E. Moroney. 1994. Trinucleotide phosphoramidites: ideal reagents for the synthesis of mixed oligonucleotides for random mutagenesis. Nucleic Acids Res 22:5600-7.
366. Vogel, S. N. 2000. Lps: another piece in the puzzle. J Endotoxin Res 6:295-300; discussion 301- 2.
367. von, H. L. 2002. Role of persistent infection in the control and severity of asthma: focus on Chlamydia pneumoniae. Eur Respir J 19:546-56.
368. Vuola, J. M., V. Puurula, M. Anttila, P. H. Makela, and N. Rautonen. 2000. Acquired immunity to Chlamydia pneumoniae is dependent on gamma interferon in two mouse strains that initially differ in this respect after primary challenge. Infect Immun 68:960-4.
369. Wagels, G., S. Rasmussen, and P. Timms. 1994. Comparison of Chlamydia pneumoniae isolates by western blot (immunoblot) analysis and DNA sequencing of the omp 2 gene. J Clin Microbiol 32:2820-3.
370. Walter, G., K. Bussow, D. Cahill, A. Lueking, and H. Lehrach. 2000. Protein arrays for gene expression and molecular interaction screening. Curr Opin Microbiol 3:298-302.
371. Walter, G., Z. Konthur, and H. Lehrach. 2001. High-throughput s creening of surface displayed gene products. Comb Chem High Throughput Screen 4:193-205.
372. Wang, S. P., and J. T. Grayston. 1970. Immunologic relationship between genital TRIC, lymphogranuloma venereum, and related organisms in a new microtiter indirect immunofluorescence test. Am J Ophthalmol 70:367-74.
373. Weichel, M., P. Schmid-Grendelmeier, S. Fluckiger, M. Breitenbach, K. Blaser, and R. Crameri. 2003. Nuclear transport factor 2 represents a novel cross-reactive fungal allergen. Allergy 58:198-206.
374. Weichel, M., P. Schmid-Grendelmeier, C. Rhyner, G. Achatz, K. Blaser, and R. Crameri. 2003. Immunoglobulin E-binding and skin test reactivity to hydrophobin HCh-1 from Cladosporium herbarum, the first allergenic cell wall component of fungi. Clin Exp Allergy 33:72- 7.
375. Werner, M., P. Nordin, B. Arnholm, B. Elgefors, and I. Krantz. 2001. Borrelia burgdorferi antibodies in outdoor and indoor workers in south-west Sweden. Scand J Infect Dis 33:128-31.
376. Whaley, S. R., D. S. English, E. L. Hu, P. F. Barbara, and A. M. Belcher. 2000. Selection of peptides with semiconductor binding specificity for directed nanocrystal assembly. Nature 405:665-8. 128 10 References
377. Wilske, B., and V. Fingerle. 2000. [Diagnosis of Lyme borreliosis. How to corroborate suspected borreliosis]. MMW Fortschr Med 142:28-31.
378. Wilske, B., V. Fingerle, V. Preac-Mursic, S. Jauris-Heipke, A. Hofmann, H. Loy, H. W. Pfister, D. Rossler, and E. Soutschek. 1994. Immunoblot using recombinant antigens derived from different genospecies of Borrelia burgdorferi sensu lato. Med Microbiol Immunol (Berl) 183:43-59.
379. Wilson, D. R., A. Siebers, and B. B. Finlay. 1998. Antigenic analysis of Bordetella pertussis filamentous hemagglutinin with phage display libraries and rabbit anti-filamentous hemagglutinin polyclonal antibodies. Infect Immun 66:4884-94.
380. Wizemann, T. M., J. H. Heinrichs, J. E. Adamou, A. L. Erwin, C. Kunsch, G. H. Choi, S. C. Barash, C. A. Rosen, H. R. Masure, E. Tuomanen, A. Gayle, Y. A. Brewah, W. Walsh, P. Barren, R. Lathigra, M. Hanson, S. Langermann, S. Johnson, and S. Koenig. 2001. Use of a whole genome approach to identify vaccine molecules affording protection against Streptococcus pneumoniae infection. Infect Immun 69:1593-8.
381. Woiwode, T. F., J. E. Haggerty, R. Katz, M. A. Gallop, R. W. Barrett, W. J. Dower, and S. E. Cwirla. 2003. Synthetic compound libraries displayed on the surface of encoded bacteriophage. Chem Biol 10:847-58.
382. Wolf, K., E. Fischer, D. Mead, G. Zhong, R. Peeling, B. Whitmire, and H. D. Caldwell. 2001. Chlamydia pneumoniae major outer membrane protein is a surface-exposed antigen that elicits antibodies primarily directed against conformation-dependent determinants. Infect Immun 69:3082-91.
383. Wormser, G. P., S. Bittker, D. Cooper, J. Nowakowski, R. B. Nadelman, and C. Pavia. 2001. Yield of large-volume blood cultures in patients with early Lyme disease. J Infect Dis 184:1070-2.
384. Wormser, G. P., R. B. Nadelman, R. J. Dattwyler, D. T. Dennis, E. D. Shapiro, A. C. Steere, T. J. Rush, D. W. Rahn, P. K. Coyle, D. H. Persing, D. Fish, and B. J. Luft. 2000. Practice guidelines for the treatment of Lyme disease. The Infectious Diseases Society of America. Clin Infect Dis 31 Suppl 1:1-14.
385. Yamanaka, H. I., T. Inoue, and O. Ikeda-Tanaka. 1996. Chicken monoclonal antibody isolated by a phage display system. J Immunol 157:1156-62.
386. Yang, X. F., A. Hubner, T. G. Popova, K. E. Hagman, and M. V. Norgard. 2003. Regulation of expression of the paralogous Mlp family in Borrelia burgdorferi. Infect Immun 71:5012-20.
387. Yang, Z. P., P. K. Cummings, D. L. Patton, and C. C. Kuo. 1994. Ultrastructural lung pathology of experimental Chlamydia pneumoniae pneumonitis in mice. J Infect Dis 170:464-7.
388. Yang, Z. P., C. C. Kuo, and J. T. Grayston. 1993. A mouse m odel of Chlamydia pneumoniae strain TWAR pneumonitis. Infect Immun 61:2037-40.
389. Young, K. H., and B. A. Ozenberger. 1995. Investigation of ligand binding to members of the cytokine receptor family within a microbial system. Ann N Y Acad Sci 766:279-81.
390. Yucesan, C., and S. Sriram. 2001. Chlamydia pneumoniae infection of the central nervous system. Curr Opin Neurol 14:355-9.
391. Zacchi, P., D. Sblattero, F. Florian, R. Marzari, and A. R. Bradbury. 2003. Selecting open reading frames from DNA. Genome Res 13:980-90.
392. Zhang, X. X., Q. Deng, S. Y. Zhang, J. Liu, Q. Cai, Z. M. Lu, and Y. Wang. 2003. Broadly cross-reactive mimotope of hypervariable region 1 of hepatitis C virus derived from DNA shuffling and screened by phage display library. J Med Virol 71:511-7. 10 References 129
393. Zhang, Y., J. W. Pak, I. N. Maruyama, and M. Machida. 2000. Affinity selection of DNA-binding proteins displayed on bacteriophage lambda. J Biochem (Tokyo) 127:1057-63.
394. Zhong, G., G. P. Smith, J. Berry, and R. C. Brunham. 1994. Conformational mimicry of a chlamydial neutralization epitope on filamentous phage. J Biol Chem 269:24183-8.
395. Zurita, A. J., W. Arap, and R. Pasqualini. 2003. Mapping tumor vascular diversity by screening phage display libraries. J Control Release 91:183-6.
396. Zwick, M. B., L. L. Bonnycastle, K. A. Noren, S. Venturini, E. Leong, C. F. Barbas, 3rd, C. J. Noren, and J. K. Scott. 1998. The maltose-binding protein as a scaffold for monovalent display of peptides derived from phage libraries. Anal Biochem 264:87-97.
397. Zwick, M. B., J. Shen, and J. K. Scott. 1998. Phage-displayed peptide libraries. Curr Opin Biotechnol 9:427-36.