Gene Expression Strategies of Barley Yellow Dwarf Virus S

Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

1993 Gene expression strategies of barley yellow dwarf virus S. P. Dinesh-Kumar Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Molecular Biology Commons, and the Plant Pathology Commons

Recommended Citation Dinesh-Kumar, S. P., "Gene expression strategies of barley yellow dwarf virus " (1993). Retrospective Theses and Dissertations. 10809. https://lib.dr.iastate.edu/rtd/10809

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. III '«Jwi

MICROFILMED 1994 INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely afreet reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

University Microfilms International A Bell & Howell Infornnation Company 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 313/761-4700 800/521-0600

Order Number 9418969

Gene expression strategies of barley yellow dwarf virus

Dinesh-Kumar, S. P., Ph.D.

Iowa State University, 1993

UMI 300 N. ZeebRd. Ann Arbor, MI 48106

Gene expression strategies of barley yellow dwarf virus

S.P. Dinesh-Kumar

A Dissertation Submitted to the Graduate Faculty in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY

Department: Plant Pathology Interdepartmental Major: Molecular, Cellular, and Devlopmental Biology

Aooroved:

Signature was redacted for privacy.

In Charge of Major Work

Signature was redacted for privacy. For t^ Interdepartrnental Major

Signature was redacted for privacy.

Signature was redacted for privacy. For tl>e^raduate College

Iowa State University Ames, Iowa

1993 Il

3 tieiiuate inte^ertation to

my parents!

^.#uttagkiamp anb #ab%ramma »

ill

TABLE OF CONTENTS

Page

GENERAL INTRODUCTION TO LUTEOVIRUS GENE EXPRESSION 1

Luteoviruses 1 Genome Organization 3 Gene Functions 7 Gene Expression Strategies 16 Explanation of Thesis Format 30

PAPER I PRECISE MAPPING AND IN VITROTRANSLATION OF A TRIFUNCTIONAL SUBGENOMIC RNA OF BARLEY YELLOW DWARF VIRUS 32

ABSTRACT 34

INTRODUCTION 35

MATERIALS AND METHODS 37

Virus and Viral RNA Purification 37 Electroporation of Protoplasts with BYDV RNA 37 Plasmid Construction 38 In vitro Transcription 40 RNA Extraction 41 Northern Blot Analysis 42 RNase Protection 42 Primer Extension 43 In vitro Translation and Immunoprecipitation 43

RESULTS 45

Characteriztion of BYDV-PAV RNAs 45 Identification of the 5' end of sgRNAI 48 In vitro Translation Products of Synthetic Subgenomic RNA 50 iv

DISCUSSION 56

Subgenomic RNA Mapping 56 Translation Initiation at Two Codons 58 Readthrough 64

ACKNOWLEDGMENTS 66

LITERATURE CITED 67

PAPER II CONTROL OF START CODON CHOICE ON A PLANT VIRAL RNA ENCODING OVERLAPPING GENES 74

ABSTRACT 76

INTRODUCTION 78

RESULTS 82

Effects of mutations near the CP start codon on secondary structure 82 Effects of mutations on transiation of CP and 17K ORFs in reticulocyte lysates 89 Effects of mutations on start codon choice in protoplasts 93 Efficient initiation at the 17K AUG is needed for maximum initiation at the CP AUG 99

DISCUSSION 101

Differences between ceil-free and protoplast assay systems 101 Effect of secondary structure 103 Roles of bases at positions -3 and +4 104 Initiation at ACG 105 Ribosome pausing model 105 Regulation of CP and 17K levels in infected cells 110

METHODS 112

Construction of mutant plasmids for in vitro studies 112 Plasmids pAGUSI and pAdhGUS 112 Construction of CP/17K-GUS fusions 114 V

In vitro transcription and translation 115 Secondary structure mapping 115 Protoplasts transformation and GUS assay 116

ACKNOWLEDGMENTS 117

REFERENCES

GENERAL SUMMARY 125

REFERENCES 130

ACKNOWLEDGMENTS 146

APPENDIX I IN VITRO SYNTHESIS OF FULL-LENGTH INFECTIOUS TRANSCRIPTS FROM A cDNA CLONE OF BARLEY YELLOW DWARF VIRUS 147

APPENDIX li OF 39K ORF STOP CODON ON BYDV-PAV FRAMESHIFTING AND REPLICATION 166

APPENDIX III SIGNALS THAT CONTROL TRANSLATIONAL READTHROUGH OF COAT PROTEIN STOP CODON IN BARLEY YELLOW DWARF VIRUS IN VIVO 174 1

GENERAL INTRODUCTION TO LUTEOVIRUS GENE EXPRESSION

Luteoviruses Barley yellow dwarf virus (BYDV) Is the type member of luteovirus group of plant viruses. The virions of members of this group are icosahedral and 24-30 nm in diameter. They are made up of 180 subunlts of a 22 kDa coat protein surrounding one molecule of about 6 kb single-stranded RNA. Based on genome organization, serological relatedness and cytopathological effects, luteoviruses are classified into two subgroups (D'Arcy, 1986). Subgroup I includes: BYDV-MAV, BYDV-PAV, BYDV-SGV, soybean dwarf virus (SDV) and others. Subgroup II includes: BYDV-RPV, beet western yellow virus (BWYV), potato leaf roll virus (PLRV) and others. Luteoviruses are widespread and cause heavy economic losses of sugar beets, potatoes and small grain cereals worldwide (Rochow and Duffus, 1981; Conti et al., 1990). BYDV and PLRV infects all members of the Graminae and So/anaceae respectively. BWYV infects wide range of dicotyledons and some monocotyledons crops (Rochow and Duffus, 1981) Luteoviruses are confined to phloem, mostly in sieve elements, companion cells, and occasionally in phloem parenchyma (Rochow, 1969). They have not been observed in epidermal, mesophyll or xylem tissues of infected plants. However, luteoviruses can replicate efficiently in the protoplasts derived from mesophyll tissues or suspension cells (Barker and Harrison, 1982; Young et al., 1989, 1991; Dinesh-Kumar et. al., 1992; Veldt et al., 1992). Different strains of BYDV induce distinct cytopathological »

events (Gill and Chong, 1979). In cells infected with strains belong to subgroup I, virus particles move from sieve elements through plasmodesmata into adjacent companion cells, new virus accumulates in the cytoplasm near the plasmodesmota, single membraned vesicles containing fibrils appear in the cytoplasm, the nucleus becomes distorted, aggregation and accumulation of densely staining, heterochromatin-like material occurs. In contrast, in cells infected with members of subgroup II, vesicles containing fibrils are bounded by a second membrane which is continuous with the endoplasmic reticulum, virus accumulates in the nucleolus, eventually the heterochromatin slowly disintegrates, extensive wall thickening occurs in the infected parenchyma cells. The cytopathological changes induced by BWYV {Esau and Hoefert, 1972) and PLRV (Shepardson et al., 1980) were the same as those induced by subgroup II strains of BYDV. Luteoviruses are transmitted only by aphid vectors in persistent- circulative manner (Rochow, 1969). Aphids after aquiring the virus, can transmit to plants throughout the life of the aphid, even after molting (Gildow, 1985). Luteovirus particles from infected phloem cells are ingested into the aphid's stylet and accumulate in the hindgut. The virus particles are transported from the haemocoel to the basal membrane of the accessory salivary gland, from which it is exuded into the salivary duct. Virions are then excreted along with salivary cell secretions into the phloem cells of healthy plants during feeding (Gildow, 1982; Gildow and Rochow, 1980). There is a strong evidence that luteoviruses do not replicate in the aphid 3

vectors (Paliwal and Sinha, 1970). Luteoviruses have a high degree of specificity between the virus and the aphid species transmit them. Each iuteovirus is transmitted efficiently by only one or a few species of aphid. Luteoviruses are difficult to control, because of these very specific persistant vector relationships.

Genome Organization The genome of luteoviruses consist of a single positive sense RNA of 5.6-6.0 kb. Some subgroup il viruses, like PLRV and RPV, contain a 5'- terminal genome linked protein (VPg) (IVIayo et al., 1982; Murphy et al., 1989). The 3' end of the genome does not contain a poly(A) tail or t-RNA- like structure. The complete nucleotide sequences of a number of luteoviruses, including BYDV-PAV (Miller et al., 1988a; Ueng et al., 1992), BYDV-RPV (Vincent et al., 1991), BYDV-MAV (Ueng et al., 1992), SDV (Rathjen et al., 1994), PLRV (Mayo et al., 1989; van der Wilk, et al., 1989; Keese et al., 1990), and BWYV (Veldt et al., 1988) are known. Based on the knowledge of nucleotide sequences, subgroup I and subgroup II luteoviruses were found to have different genome organization (Figure 1). Subgroup II viruses possess an open reading frame (ORF 0) at the 5' terminus, which is not present in subgroup I luteos. ORF 0 encodes 28-29 kDa product (PO). The 3' sequence of members of subgroup I is longer (654-687 nt) compare to subgroup II (150 nt). In BYDV-PAV and BYDV- MAV, this results in an additional open reading frame (ORF 6), which encodes a 4.3 to 6.7 kDa product (P6). SDV has no ORFs in this region. »

Luteoviruses Subgroup I fs I22KCP P5(50K> I pol WBBMMI P1(39K) 1^811* @ I 1 I P2(60K) P4(17K) " P6(4.3-6.7K)

-, 3, Subgroup il Is fs 17-1919 I P1 (66-71W I

P0(28-29K) P2(67.72K) ft 5Î 3'

RNA1 PEMV Is fs I P3 • PI (8410 2IKCP P5(33IQ I 1 pol SB^T I k Y % =! rô~1 Y//4V////A t P0(34K) P2(67K) ft _ 3,

T PC. m I 4 I 15K I r~1 P2(65K) f 27K ^ P1(33K) Is 5' 3'

Figure. 1 Genome organization of luteoviruses (Subgroup I and Subgroup II) and enamovirus (pea enation mosaic virus, PEMV). Boxes represents open reading frames (ORFs). Numbering system followed here is similar to that used by Martin, et al., (1990). Homology between ORFs of different groups are represented by similar shading. PO to P6 indicate the translation products of respective ORFs, expected sizes of the product is shown in parentheses, pol, polymerase; CP, coat protein. Translational strategies are indicated by abbreveations, Is, leaky scanning; fs, frameshifting; rt, stop codon readthrough. 5

ORF 0 of subgroup II overlaps extensively with the 0RF1, with the latter being expressed by leaky scanning. ORFs 1 and 2 code for components of the viral RNA-dependent RNA polymerases. 0RF2 is expressed by translational frameshifting (Brault and Miller, 1992; Prufer et al., 1992). ORF 1 of subgroup I codes for a 39 kDa polypeptide (PI), whereas ORF 1 in subgroup II ranges from 66-70 kDa. ORFs 1 and 2 in subgroup I overlap by 13 nt, compared to 298-474 nt in subgroup II. The amino acid sequences of subgroup I polymerases (ORF 2) are more similar to those of diantho-, carmo- and tombusviruses than to the subgroup II polymerases. The polymerases of subgroup II are more similar to those of sobemoviruses than to the subgroup I luteoviruses (Habili and Symons, 1989; Koonin, 1991). This difference in the polymerase divides luteoviruses into two separate subgroups. In all luteoviruses, three ORFs at the 3' end of the genome are expressed from a large single subgenomic RNA (Tacke et al., 1990; Miller and Mayo, 1991; Dinesh-Kumar et al., 1992). The intergenic region between ORF 2 and ORF 3 ranges from 116 nt to 202 nt. ORF 3 encodes viral coat protein (CP) of 22 kDa. ORF 4, which encodes a 17-19 kDa product is nested with in the CP coding sequence but in another reading frame. The overlapping ORF 3 and ORF 4 are expressed by the leaky scanning mechanism (Kozak, 1986; Kozak, 1989; Dinesh-Kumar and Miller, 1993). The CP ORF is followed by a 50 kDa ORF (0RF5) in the same reading frame and separated by a single amber termination codon. ORF 5 is expressed by translational readthrough of the coat protein stop codon (Veidt 6

et al., 1988; Bahner et al., 1990; Tacke et al., 1990; Dinesh-Kumar et al., 1992). Pea enation mosaic mosaic virus (PEMV), a monotypic enamovirus is included in this review because It has some properties similar to luteoviruses. It is transmitted by aphids In a persistant circulative manner. Unlike luteoviruses, it is also mechanically transmissible. The virus is not limited to phloem cells, but it is mostly concentrated in mature phloem sieve elements (de Zoeten and Gaard, 1983). It has bipartite genome with two RNAs, which are encapsidated in separate, morphologically distinct particles (German and de Zoeten, 1975). The 5' end of these RNAs contains a 17.5 kDa genome-linked viral protein (Reisman and de Zoeten, 1982). Like luteoviruses, they also lack a poly(A) tail or t-RNA like structure at the 3'end of the genome (German et al., 1978). Both of these RNAs are required for systemic infection, but they can replicate individually in the protoplasts (Demler et al., 1993). RNA1 has a similar genome organization as luteovirus subgroup II, except for the absence of ORF 4, which is nested with in the CP ORF (ORF 3) (Figure 1). The ORF 5 encodes 33 kDa product compared to the approx. 50 kDa product in luteoviruses. The 5' half of the RNA2 is similar to subgroup I type of luteoviruses. The polymerase (ORF 2) sequence of RNA2 is more similar to luteo-, carmo-, diantho- and tombus virus groups than to RNA1. Thus, PEMV contains two distinct type polymerase-like proteins. The function of the downstream ORFs in RNA2 is unknown. 7

Gene Functions 1. Polvmerase/helicase

Amino acid sequence analyses of ORFs 1 and 2 indicate that these two ORFs code for helicase-like and polymerase-like RNA replication complex (Habili and Symons, 1989). The ORF 2 of both subgroups appears to encode core polymerase, because it contains a highly conserved amino acid sequence; GXXXTXXXN{X)2o.4oGDD, a signature sequence of all RNA- dependent RNA polymerases (Habili and Symons, 1989; Kamer and Argos, 1984). ORFsl and 2 contains amino acid motifs similar to viral and cellular helicases (Habili and Symons, 1989). Nucleic acid helicases (or helicase subunits) are involved in unwinding of double stranded templates during replication and recombination (Gorbalenya et al., 1988). Helicase motifs I, la and 111 are present in ORF 1 of subgroup i , whereas motif IV and VI are present in ORF 2 (Habili and Symons, 1989). In subgroup II motif IV is present in ORF 1 and motif VI in ORF 2. Motif VI present in all known helicases provides NTP-binding domain (Gorbalenya, et al., 1988). In BWYV, frameshift mutations in ORF 1 or ORF 2 were lethal for replication in protoplasts (Reutenauer et al., 1993). Further, the deletion mutants with only ORF 1 and ORF 2 were capable of replication in protoplasts. This indicated that polypeptide encoded by these two ORFs function as viral replicase complex. In contrast. Young et al., (1991) reported that the 0RF1 is dispensable for infection in case of BYDV-PAV (subgroup I). However, our results show that 0RF1 product is essential for 8

infection (DInesh-Kumar, and Miller, unpublished; see Appendix I of this thesis).

2. Coat protein The primary function of the coat protein is as a structural unit of virions. Several findings show that the 0RF3 of both subgroups codes for the 22 kDa polypeptide, and that functions as coat protein. In case of BYDV-PAV the direct amino acid sequence obtained from the tryptic peptides derived from purified viral coat proteins were identical to those deduced from the nucleic acid sequencing (Miller et al., 1988b). Similarly the N-terminal amino acid sequence analysis of the purified PEMV virions were identical to the N terminal nucleotide sequence of the 0RF3 of PEMV (Dernier and de Zoeten, 1991). In BWYV, the antiserum raised against the CP expressed as a fusion protein in bacteria was reactive with coat protein accumulated in BWYV infected protoplasts (Veldt et al., 1992). All these observations indicate that the 0RF3 encodes the 22 kDa coat protein.

3. Genome linked viral protein (VPg) Instead of the commonly found cap structure (m^GpppG) at the 5' end, the RNA of some viruses contains a viral-derived protein called genome-linked viral protein. (VPg). VPg has been suggested to have a role in viral replication (Wimmer, 1982). PLRV (Mayo et al., 1982) and RPV (Murphy et al., 1989) contain VPg's of 7 kDa and 17 kDa respectively. The VPg protein identified for BYDV-RPV corresponds to the size of ORF 4 9

product. Hence ORF 4 which is nested with in the CP ORF has been proposed to encode VPg in iuteoviruses (Miiler et al., 1988a). In the case of PLRV, it has been suggested that the product of ORF 4 may be a precursor protein to VPg, which upon proteolytic cleavage may yield 7 kDa protein, as in case of cowpea mosaic virus (van der Wiiic et ai., 1989). The 17 kDa protein product of ORF 4 in PLRV has nucleic acid binding properties, hence (Tacke et ai., 1991) predicted that it may function as VPg and may play a role in viral replication. However, point mutations introduced in the start codon of ORF 4 of BWYV or BYDV-PAV did not affected the replication in protoplasts, indicating that the ORF 4 may not encode VPg (Reutenauer et al., 1993; Dinesh-Kumar and Miller, unpublished). Furthermore, the antibody raised against the 0RF4 fusion protein, fail to detect any low molecular weight product of about 7 kDa from BWYV infected protoplast extracts (Reutenauer et al., 1993). In the earlier observation Reisman and de Zoeten, 1982 showed that both RNAs of PEIVIV contain VPg of 17.5 kDa at the 5'end of the RNA. The recent sequence data indicate that the 0RF4 that encodes this size protein is absent in PEIVIV genome (Demler et ai., 1993). Hence, authors are doubtful about the presence of VPg on both species of PEIVIV RNA. These observations indicate that the coding capacity elsewhere in the genome may encode VPg in case of PEIVIV and Iuteoviruses (see below). 10

4. Protease The N-terminal region of 0RF1 of PEMV RNA1 and subgroup II luteoviruses posses hydrophobic residues Dernier and de Zoeten, (1991). Hence authors suggested that the ORF 1 and ORF 2 products together can function in replication as membrane-bound replicase system similar to that of picornoviruses (Takeda et al., 1986) and comoviruses (Goldbach and Van Kammen, 1985). The membrane-bound replicase subunit-VPg-protease- polymerase complex carries out VPg-primed replication and leaves behind the VPg after proteolytic cleavage from the protease. The chymotrypsin-like serine proteases of picarno- and comoviruses contain three conserved catalytic sites called a catalytic triad (Gorbalenya et al., 1989). Demler and de Zoeten, (1991) found one catalytic site motif, TR/KXGXSG in PI of PEMV RNA1. We analyzed PI sequences of subgroup II luteoviruses and found that all of them contain the conserved triad catalytic motifs; H(X25)E/D(Xyo.go)TK/RXGXSG (Figure 2). These findings indicate that the 0RF1 product may contain a protease function. However, no proteolytic cleavage products have been detected so far in any subgroup II viral translation products. Therefore careful analysis of the translation products using antibody raised against different regions of the P1/P2 of subgroup II viruses may provide evidence for existence of such a replication complex. Analysis of the P1/P2 sequence of subgroup I did not reveal any protease-like motifs. Therefore one can hypothesize that the membrane- bound VPg based replication occurs only in subgroup II viruses but not in subgroup I. Several findings indirectly support this hypothesis. 1 40 80 bwyv TLKDV SFLAVEKFLW GLTRLWSSLI LASFSALWWL VSNFTTP...... VFCLALL YTVTKYMVKT VSFLFGGLPI plrv SVKEV SLKAASVTLW AIISIWFGLÏ WTLARLITLF LWTFSIE...... AFCLILL GCITSLIYKG VLNLSEHLPV rpv -TASRALKAA FHDLVGKALW LLVLIWTGLL RQLFSAVWSA ITNYSLP...... VCLLISL GIITSWLWKA CRWLFGTLPA peaw ETASSLIRIV TTPLTLIGFL NKTGI..GLI SHCLALTWNM FMTWSLL...... PW.VTLM KMMKILITSS RVLTRSGRPK abmv MTLCATGLW LSTSW SFGIRYVRVR VSPEKTQNRT lYVSSGLPHF DPVYGWKKC EPMGGGPAIE Cons LW

81 120 bwyv QIISIAFSLL KKSFSAL... RSTPKCLYEK AIDGFKSFTI PQSPPKSCVI PITHASGNHA GYASCIKLYN GENALMTATH plrv FLF.. -MSPL KIIWRVA... FSKKNYKNEK AVEGYNGFTV PQKPPKSAVI ELQHENGSHL GYANCVRLYS GENALVTAEB rpv LL...CITLV KNIFRIL... • TFKRFFNEK TVSGYDSYSI PSTPPKRSVI MMRRQNKEHI GYANCIRLFD GRNAIVTYAH pemv RTSSKSLKHK LKISRAIQKK QGKKTPVEER TIPGVQIKKL REDPPKGVIL RCTDQFGDHV GYASAVKLEK GQTGIVLPIH abmv LQVNPSWIHL LPTSPAI... • NKVEVGQES AILG.STYSV VETGGEPKSL VAVKSGDSTL GFGARV.YHE GMDVUIVPHH Cons ———— — — GYA~~V~L~~ G—————B

161 » 200 240 bwyv VLRDCPNAVA VSAKGLKTRI PLAEFKTIAK SDKGDVTLLR GP.PNWEGLL GCKAANVITA ANLAKCKASI YSFDRDG.WV plrv CLEG...AYA ASLKT.GNRI PMKQFFPIFK SAQNDISILT GP.PNWEGLL AVKGAHFLTA DKVGRGPASF YTLEKGE.WM rpv NIEEGCSFYS SRTSG..-SI PITEFRVIFE SKTMDIAILV GP.INWESIL GCKGVHFTTA DRLAECPAAL YLLDSDGQMR pemv VWTD T VYINGPNGKL KMADFTALYE VTNHDSLIMT SAMAGWGSIL GVRPRPLTTI DAVKLKNYSL FT.ERDGKWY abmv VWYNDKPHTA LAKNGRSVDT EDWEVEAACA DPRIDFVLVK VPTAVWAK.L AVRSTKVL.. APVHGTAVQT FGGQDSKQLF ———EF~~""F~ ————L— ~P~~~W~~~L

241 * 280 320 bwyv SSYAEIVGSE GTD.VMVLSH TEGGHSGSPY FNGK.TILGV HSG..ASATG NYN. LM APIPSLPGLT SPTYVFETTA plrv CHSAQLDGAH QQF.VSVLCN TEPGYSGTGF WSSK.TLLGV LKGFPLDEGC NYN. VM SVIPSVPGIT SPNYVFESTH rpv SNSAKICGHF DNF.AQVLSN TKVGHSGAGY FYGK.TLVGL HKGHP.GKDF NFN. LM APLPGIPGLT SPQYWESDP pemv VQAAKCIAPA EGM.FRWSD TRPGDSGLPL FmKMNWAV HRGTWPSERF PEN.....RA FAILPVPDLT ss...... abmv SGLGKAKALD NAWEFTHTAP TAKGWSGTPL Y.TRDGIVGM HTGYVDIGTS NRAINMHFIM SCLVSKMETL PPELGYREIS Cons —— ————V—— T—G-SG F—K——G— N-N— ———M ———P——T SP Figure. 2 Alignment of indicated portions of PI protein of subgroup II luteoviruses (BWYV, PLRV, and RPV) and pea enation mosaic virus RNA1 with putative chymotrypsin-like serine protease of southern bean mosaic virus (SBMV). The derived consensus (Cons) is shown below the aligned sequence. Consensus is defined if similar residue occurs in 4 out of 5 sequences. *, indicate residues which form conserved catalytic triads of H, Histidine; D, Aspartate; and S, serine. References for sequences included in the alignment are BWYV (Veidt et al., 1988), PLRV (Keese et al., 1990), RPV (Vincent et al., 1991), and SBMV (Wu et al., 1987). »

The ultrastructure observation Indicates that subgroup II luteovlruses and PEMV are localized in the continuous membrane systems of the nuclear envelop and endoplasmic reticulum (Esau and Hoefert, 1972; Powell and de Zoeten, 1977; Shepardson et al., 1980). In BWYV (subgroup II), capping of the infectious transcripts results in 20 fold higher infection compare to uncapped transcripts (Veldt et al., 1992). Whereas in BYDV-PAV (subgroup I) capped transcripts are not infectious (Dinesh-Kumar and Miller, unpublished; see Appendix I of this thesis) and interestingly the BYDV-PAV genome translates In a cap-independent manner in wheat germ translation system (Wang and Miller, unpublished).

5. Aohid trnasmission and encapsidation The ORF 5 prduct has been suggested to play a role in specificity of aphid transmission and particle assembly (Massalskl and Harrison 1987; Bahner et al., 1990). The role of readthrough protein in aphid transmission comes from the observation that a possible product of ORF 5 was eliminated from the genome of a aphid transmissible strain of PEMV upon many generations of mechanical inoculation (Hull, 1977; Adam et al., 1979). However, the antibody made against the P5 protein of PLRV aphid transmissible strain detected the same size fusion product of P3 and P5 from the potato tissue infected with aphid transmissible and non-transmissible strains (Bahner et al., 1990). Furthermore, Dernier and de Zoeten, 1991 found ORF 5 (P5, 33 kDa) in RNA1 of both aphid non-transmissible and aphid-transmissible strains of PEMV, which is also separated by amber stop codon from coat protein (P3). These observations argue against the complete loss of P5 in non-aphid transmissible strains. The N-terminal sequence of P5 display great similarity (Mayo et al., 1989; Bahner et al., 1990; Demler and de Zoeten, 1991) but the C-terminal halves are very distinct (Mayo et al., 1989). The C-terminal part of P5 Is proteolytically removed in case of PLRV (Bahner et al., 1990). Because of the lack of C-terminal region of P5 in case of PEMV and proteolytic cleavage of this region in case of other luteoviruses may indicate that the N-terminal part of the P5 may contain a domain responsible for aphid transmission (Bahner et al., 1990; Demler and de Zoeten, 1991). All luteoviruses and PEMV contain amino acid sequence rich in proline residues immediately downstream of the coat protein (see review by Miller et. al., 1994). These proline residues have been suggested to play a role in separating the coat protein domain from the readthrough domain, which may facilitate it to protrude out of the virus particle (Bahner et al., 1990). This protruded readthrough domain may determine aphid specificity by interacting with the receptors in the aphid vector (Bahner et al., 1990). Such protrusions have been observed on the surface of PLRV and BYDV particles (Harrison 1984; Waterhouse et al., 1989). The readthrough of the CP gene and to generate a downstream ORF has been shown to occur in beet necrotic yellow vein virus (BNYVV) (Bouzoubaa et al., 1986) and soil-borne wheat mosaic virus (Hsu and Brakke, 1985). In BNYVV, readthrough protein is required for efficient transmission by the fungal vector (Tamada and Kusume, 1991) and for particle assembly (Schmitt, et al., 1992). The deletion mutants in the readthrough protein of BWYV (Reutenauer et al., 1993) and BYDV-PAV (Dinesh-Kumar and Miller, unpublished; see Appendix I of this thesis) were infectious in protoplasts and in the former case they were able to form virus particles. This indicates that coat protein is sufficient for the luteoviruses particle assembly. These results are in contrast to the observation from Young et al., (1991) who claimed that frameshift mutations in the BYDV-PAV readthrough protein were lethal to the virus replication.

6. Movement Several recent findings indicate that the 17 kDa protein encoded by ORF 4 may function as a phloem specific cell-to-cell movement protein of luteoviruses. The C-terminal domain of the 17 kDa protein of PLRV binds single stranded nucleic acids in a co-operative and sequence non-specific manner (Tacke et al., 1991), similar to that of the well characterized P30 movement protein of tobacco mosaic virus (TMV) (Citovsky et al., 1990). The binding of P30 protein to TMV RNA is proposed to unfold the RNA to facilitate movement through plasmodesmota channels and also to protect it from cellular nucleases (Citovsky et al., 1990). The 17 kDa protein was most abundant in fractions enriched for nuclei, mitochondria, chloroplast and membranous structures but not in cell wall fractions (Tacke et al., 1993). In contrast, TMV movement protein accumulates mainly in the cell wall fraction (Deom et al., 1990). Homodimers of 17 kDa protein were observed in cell extracts of non-transfomed potato plants infected with PLRV and transgenic 15

plants expressing P4. The domain responsible for this dimerization is located in the N-termlnal half of the 17 kDa protein (Tacke et al., 1993). The 17 kDa protein expressed in transgenic plants was a phosphoprotein (Tacke, et al., 1993). This is similar to TMV movement protein, which was shown to be phosporylated by serine/threonine specific protein kinase from cell wall fraction (Citovsky et al., 1993). The phosporylation of the P30 movement protein of TMV has been suggested to represent a mechanism for the host plant to sequester this protein in the cell wall of mature tissue (Citovsky et al., 1993). Based on all these biochemical properties of 17 kDa protein, it is possible that it is involved in cell-to-cell movement of viral RNA as a ribonucleoprotein complex within the phloem tissue.

7. ORF 6 The ORF 6, which encodes 4.3-6.7 kDa protein is present in BYDV- PAV and BYDV-MAV (subgroup I). The frameshift mutation introduced in this ORF showed that this product is required for infection (Young et al., 1991). The subgenomic message for this protein is highly abundant in early part of infection (Young et al., 1991; Dinesh-Kumar et al., 1992). Protein product has not been identified in infected cells. The function of this protein if it exists is not known.

8. ORFO ORF 0 present in subgroup II luteoviruses and PEMV RNA1 encodes protein of 28-29 kDa. The function of this open reading frame is not known. 16

However, it has been suggested that this protein may determine virus host range (Veidt et ai., 1992). There is no sequence homology in this ORF between different subgroup II viruses (Demier and de Zoeten, 1991). Sequence in this ORF has no similarity to heiicase, polymerase, protease and transport related sequences. This ORF was dispensable for replication of BWYV in protoplasts (Veidt et al., 1992).

Gene Expression Strategies Luteoviruses use a variety of unusual gene expression strategies to express their genes (Figure 1) from minimum genetic material. The ORF 2 (polymerase gene) is expressed by translational frameshifting. The coat protein, ORF 4 and ORF 5 are translated from a subgenomic RNA. The overlapping reading frames; CP and ORF 4, and ORF 0 and ORF 1 of subgroup II, and ORF 3 and ORF 4 of PEMV RNA2 are expressed by leaky scanning. ORF 5 is translated by the in-frame readthrough of the amber stop codon of the coat protein.

1. Ribosomal frameshifting Expression of a single protein from two or more overlapping reading frames due to translational frameshifting mechanism has been observed in many viruses and retrotransposons (Reviewed in Atkins et al., 1990; Hatfield et al., 1992). According to frameshifting, a portion of ribosomes before terminating translation of an upstream open reading frame, either move backward or forward one nucleotide and resume translation in the overlapping reading frame. Many animal viruses and retrotransposons (Reviewed in (Atkins et al., 1990; Hatfield et al., 1992) and some plant virus including luteoviruses (see review by Miller et al., 1994) induces a -1 translational frameshlft events for synthesis of RNA-dependent RNA polymerase or reverse transcriptase. This may be a regulatory mechanism by which the viruses make the required low amount of polymerase during early stages of infection. Several signals present in the mRNA sequence have been found to play a role in the frameshlft event. First, signal constitutes heptanucleotide sequence or slippery sequence at which actual frameshlft occurs. These sequences include the run of three adenine, uracil or guanine residues followed by either AAAC, UUUA, UUUU (Jacks et al., 1988) or AAAU (Prufer et al., 1992). This shifty sequence facilitates -1 frameshlft event by simultaneous slippage of aminoacyl-tRNA at the ribosomal A site and peptidyl-tRNA at the P site by one nucleotide in the 5' direction (Jacks et al., 1988). Because of this slippage ribosomes resume translation in the new reading frame. The second signal is the presence of the sequence downstream of shifty heptanucleotide which can either form pseudoknot (ten Dam, et al., 1990; Chamorro, et al., 1992; Dinman and Wickner, 1992; Morikawa and Bishop, 1992; Garcia, et al., 1993; Kujawa, et al., 1993) or a stable stem loop structure (Prufer, et al., 1992; Parkin et al., 1992). Presence of such a secondary structure or pseudoknot makes ribsomes to pause at the shifty site, which allows more time for slippage (Tu et al., 1992). However pausing alone was not sufficient for efficient frameshifting. »

The presence of these signal sequences in and around the ORF 1 and ORF 2 overlapping region in luteoviruses and PEMV suggested that the polymerase gene is expressed via a -1 frameshift event. In case of BYDV- PAV and PLRV, -1 frameshift occurs in protoplasts at a frequency of about 1% (Brault and Miller, 1992; Prufer et al., 1992). The frequency of framehsifting in other cases varies from 1 to 50 %. The virion RNA or in vitro synthesized full length infectious transcripts of BYDV-PAV and BWYV, programmed with wheat germ extract gave expected low amount of transframe protein and large quantity of ORF 1 product (Young et al., 1991; Veldt et al., 1992; Di et al., 1993). The sequence following the shifty sequence in case of BYDV-PAV, PLRV and BWYV can adopt two alternative structures; a simple stem loop or a pseudoknot structure. In case of PLRV, the stem-loop structure was necessary for efficient frameshifting in reticulocyte lysate (Prufer et al., 1992). In contrast the recent results on BWYV (Garcia et al., 1993) and PLRV (Kujawa et al., 1993) indicate the requirement of a pseudoknot. However the role of shifty heptanucleotide sequence and any of the structures has yet to be demonstrated for luteoviruses in vivo.

2. Suboenomic RNAs Genomic RNAs of most viruses are polycistronic and expression of internal cistrons is facilitated by its own subgenomic RNAs. These are 5*- truncated copies of the genomic RNA, and are encapsidated in some viruses, but not in others. This strategy allows the differential expression of two or 19

more genes independently from a single genomic RNA. Several in vitro (Miller et al., 1985; Marsh et al., 1988) and in vivo (Gargouri et al., 1989) studies clearly suggest that the subgenomic RNAs arise by internal initiation on the subgenomic promoter on the (-)strand of genomic RNA. Two subgenomic RNAs of about 3 kb and 0.8 kb have been identifed in BYDV-PAV infected tissue or protoplasts (Young, et al., 1991; Dinesh- Kumar et al., 1992). PLRV and BWYV posses only one large subgenomic RNA of about 2.5 kb (Smith and Harris, 1990; Tacke et al., 1990; Miller and Mayo, 1991; Veldt et al., 1992). The non-coding region between ORF 2 and ORF 3 (CP) in all luteovlruses is A-U-rich, which is a characteristic feature of many subgenomic leaders. Further, (Vincent et al., 1991) found two core regions in the leader sequences of luteovlruses similar to that of well-characterized BMV subgenomic promoter (Marsh et al., 1988). The 5' ends of the large subgenomic RNA have been precisely mapped for some luteovlruses. In a German isolate of PLRV the subgenomic start is at 40 nucleotide upstream of CP start codon (Tacke et al., 1990). In contrast, the start site of the PLRV-Scottish isolate was mapped to 212 nucleotide upstream of the CP AUG (Miller and Mayo, 1991). These isolates differ at only five bases in the non-coding region. The sequence ACAAAA at the 5' end of the subgenomic RNA in case of PLRV-Scottish isolate is identical to the sequence at the 5' end of the genomic RNA, suggesting that it is a replicase recognition signal on the (-) strand for the synthesis of subgenomic RNA (Miller and Mayo, 1991). In case of BYDV-PAV (Illinois Isolate), the start of large subgenomic RNA is 89 nucleotides upstream of CP start codon (Dinesh-Kumar et al., 1992). The sequence ACAAAA Is present about 34 nucleotides upstream of the actual start site and the same sequence is present at position 19 In the genomic RNA. Similarly, in maize chlorotic mottle virus an 11 nucleotide tract similar to the 5' end of genomic RNA was found 111 nucleotides upstream of the subgenomic start site (Lommel et al., 1991). Similarity in the sequences at the 5' end of genomic and subgenomic RNAs applies to some viruses, but it is not a common phenomenon. Therefore it is possible that the start site of the subgenomic RNA is different from the polymerase recognition site.

3. Leakv scanning Most eukaryotic mRNAs are monocistronic and protein synthesis starts at the first AUG codon (Kozak, 1989). Usually the 40S ribosomal subunit complex including several initiation factors binds at the 5' end of the mRNA and scans until it reaches the first AUG, at which the initiator tRNA'TiGt and 60S subunit binds to form 80S ribosome and protein synthesis begins (Kozak, 1989; Merrick, 1992). Several mRNA features such as sequences flanking the start codon, secondary structure upstream and downstream of the start codon and mRNA leader length influence the process of initiation (Kozak, 1991b). In many eukaryotes, including plants, the most favorable sequence context for initiation is usually A at -3 and G at +4 position (Kozak, 1986; Lutcke et al., 1987; Cavener and Ray, 1991). If the first AUG on an mRNA is in unfavorable sequence context, then a portion of the 40s ribosomes may bypass that AUG and initiate at the next downstream AUG if 21

latter Is In a favorable context. Such a process is called leaky scanning (Kozak, 1989). Some viral and cellular mRNAs which encode two different proteins from overlapping reading frames have been speculated to use this process during translation (Kozak, 1991a). However, true biclstronic messages are more commonly found in viruses, because this provides a means of minimizing their genome size and allowing more efficient utilization of the coding region. In addition, this also facilitates coordinated expression of two cistrons to produce required molar amounts of two functional products at the level of translation.

ORF 0 and ORF 1

In subgroup II luteoviruses and PEMV RNA 1, the ORF 0 at the 5' end of the genomic RNA overlaps with the 5' terminal half of the 0RF1. The start codons of these two ORFs are about 130 to 148 nucleotides apart in subgroup II luteoviruses and about 79 nucleotides in RNA1 of PEMV. Similarly tymoviruses (TYMV) and MCMV also contain overlapping reading frames at the 5' end of the genome and the start codons are separated by 4 and 16 nucleotides respectively. In all these cases, the start codon of the first ORF is flanked by suboptimal bases compared to that of second ORF start site (Figure. 3A). Hence it is possible that some of the rlbosomes bypass the start codon of the first ORF and initiate at the downstream ORF start codon. In fact expected products from both ORFs were observed upon translation of the genomic RNA of PLRV (Mayo et al., 1989), BWYV (Veldt et al., 1992) and TYMV (Weiland and Dreher, 1989). In in vitro studies with Figure. 3 Nucleotide sequence flanking the dual initiation sites from overlapping reading frames of members of plant viruses. A, overlapping reading frames at the 5' end of the genome; B, overlapping reading frames at the Internal region of the genome. Nucleotide sequence [A/GICNAUGGC] in monocots and AN[A/C]AUGGC, in dicots includes the most frequently used bases at positions -3 through +2 (Cavener and Ray, 1991). A base is defined as sole consensus, if it occurs at specific postion in >50% of the known start codon sequences. If two nucleotides appear at same position (in brackets) and sum of their frequencies is >75%, then both are considered as consensus. Bases that match the consensus are outlined, and flanking bases which appear at specific position <10% of known start codons are shown in lowercase letters. BYDV- PAV(Vic) (Victorian isolate; Miller et al., 1988a), BYDV-PAV(P) (Purdue isolate; Deng et al., 1992), BYDV-MAV (Ueng, et al., 1992), and SDV (soybean dwarf virus; Rathjen et al., 1994) are subgroup I luteoviruses. BYDV-RMV (Domier et al., 1992), BYDV-RPV (Vincent et al., 1991), PLRV-S (potato leaf roll virus, Scottish isolate; Mayo et al., 1989), PLRV-A & C (potato leaf roll virus, Australian and Canadian isolates; Keese et al., 1990), and BWYV (beet western yellow virus; Veldt et al., 1988) are subgroup II luteoviruses. PEMV-RNA1 & -RNA2 (pea enation mosaic virus; (Demler and de Zoeten, 1991; Demler et al., 1993) is a monotypic enamovirus. TYMV (turnip yellow mosaic virus; Weiland and Dreher, 1989), EMV (eggplant mosaic virus; Osirio- Keese et al., 1989), KYMV (kennedy yellow mosaic virus; Ding et al., 1990), and OYMV (ononis yellow mosaic virus; Ding et al., 1989), are tymoviruses. CNV (cucumber necrosis virus; Rochon and Johnston, 1991), TBSV (tomoto bushy stunt virus; Hillman et al., 1989), and CyRSV (cymbidium ring spot virus; Grieco et al., 1989) are tombus viruses. MCMV (maize chlorotic mosaic virus; (Nutter et al., 1989). o 3 "D r- cr m io-ï mc < 9 I < 9 S i§i|| z ado oS 2>

c c c cc§5>c c c c c ç o c o o ~ O c O 0 O c o > c 0C>> o ^ ^ oocc o lO a CO COc > c>> c I I 11 I I 11 I 11 I .i-iii IIII ggâgggg# ÈÈ ÏIÏII I III M S 24

TYMV, mutations in the start codon of the 69K ORF had no effect on the translation of 206K ORF or vice versa (Weiland and Dreher, 1989). This shows that the both start codons were used during translation in separate initiation events. Similarly elimination of ORF 0 start codon of BWYV did not affect the expression of ORF 1 in vitro (Veidt et al., 1992). More detailed analysis of factors including: flanking bases, mRNA features between the two start codons (especially in case of subgroup II luteoviruses and PEMV RNA1) and the leader sequence between the 5' end and the first start codon, are needed to understand translational efficiencies of these overlapping reading frames.

ORF 3 and ORF 4; In luteoviruses, the 17-19K ORF (0RF4) is embedded with in the CP ORF (0RF3) in the internal region of the genome. Similarly in tombusviruses, the 21K and 20K overlapping reading frames exist in an internal region of the genome. These overlapping reading frames are expressed via a single subgenomic RNA message (Tacke et al., 1990; Vincent et al., 1990; Rochon and Johnston, 1991; Dinesh-Kumar et al., 1992). The distance between the two start codons of luteoviruses ranges from 13 to 43 nucleotides and in tombusviruses it is 29 nucleotides. In all these cases the start codon of the second ORF is flanked by more optimal bases compared to start site of the first ORF, with the exception of SDV (Figure. 3B). In addition the start codon of the BYDV-PAV CP ORF is sequestered in a stem-loop structure (Dinesh-Kumar and Miller, 1993). This led us to propose that these RNAs follow leaky scanning mechanism of translation initiation (Miller et al., 1988a; Dinesh-Kumar et al., 1992). In BYDV-PAV using systematic site- directed mutagenesis we demonstrated leaky scanning (see paper II of this thesis).

4. Stop codon readthrouah Many viruses, including luteoviruses, use readthrough suppression to regulate the expression of two ORFs which are separated by single termination codon. This allows synthesis of required low amounts of some essential viral protein products. The UGA stop codon supression in QP phage is the first known example of readthrough (Weiner and Wever, 1971). Whereas, UAG termination in a plant virus, tobacco mosaic virus (TMV) is the first readthrough observed in eukayotes (Pelham, 1978). Later this phenomenon was observed in many eukaryotic viruses including retroviruses (reviewed in Hatfield et al., 1992), alphaviruses (Strauss et al., 1983), and a number of plant viruses: tobamo-, furo-, tymo-, tobra-, carmo-, luteoviruses and MCMV (Skuzeski et al., 1990; and therein). In addition to viruses, some cellular genes like p-globin (Geller and Rich, 1980), glutathione peroxidase (Chambers et al., 1986), and maize zein (Wandelt and Feix, 1989) also use in-frame stop codon readthrough.

0RF5 in luteoviruses and PEMV is in-frame with the CP ORF (0RF3) from which it is separated by single amber termination codon. The comparison of sequence surrounding the stop codon of BYDV-PAV luteovirus with the other viruses which are known to undergo readthrough led to the speculation that 0RF5 is most lll

Failure to detect a primary translation product of ORF 5 or the mRNA message which encodes this size polypeptide in any luteovirus-infected cells provided indirect evidence that the ORF 5 is expressed only from suppression of CP stop codon. The first direct evidence for readthrough in Iuteoviruses comes from an in vitro experiment in which the synthetic BWYV subgenomic RNA containing the entire CP ORF and part of the RT region were capable of synthesizing the CP and CP-RT fusion products in rabbit reticulocyte translation system (Veidt et al., 1988). In later studies synthesis of CP and CP-ORF 5 fusion protein (72 kDa) from single message was Figure. 4 Three groups of readthrough sites in members of plant viruses (updated from Skuzeski et al., 1990). Boxed region includes conserved nucleotide sequence around and downstream of readthrough site. CP, coat protein gene stop codon is involved in readthrough; pol, stop codon in the polymerase gene is involved. References included here are the ones which are not in Skuzeski et al. (1990): PEBV (pea early browning virus, MacFarlane et al., 1989) a tobravirus. BYDV-PAV(P) (Purdue isolate; Ueng et al., 1992), BYDV-MAV (Ueng et al., 1992), and SDV (soybean dwarf virus; Rathjen et al., 1994) are subgroup I luteoviruses. BYDV-RMV (Domier et al., 1992), BYDV-RPV (Vincent et al., 1991), PLRV-S (potato leaf roll virus, Scottish isolate; Mayo et al., 1989), PLRV-A & C (potato leaf roll virus, Australian and Canadian isolates; Keese et al., 1990) are subgroup II luteoviruses. ST9 (Chin et al., 1993) beet western yellow virus associated satellite RNA. PEMV (pea enation mosaic virus; Dernier and de Zoeten, 1991) is a monotypic enamovirus. CARN1 and CARN2 (first and second stop codons in the polymerase gene of carnation mottle virus; Guilley et al., 1985), CCFV (cardamine chlorotic fleck virsu; Skotnicki et al., 1993), and MNSV (melon necrotic spot virus; Riviere and Rochon, 1990) are carmo-viruses. TCV turnip crinkle virus; Carrington et al., 1989). 28

1) TMVC-Am geaggaaoa CAAUAQCAAUUA cagauu BNYW ccaocegga CAAUAQCAAUUA geugou TYMV cacuacguo ICAAUAQ CAAUCA geeeea

2) TRV gagaccgucuu MJQACaOUUUCQQUC PEBV gaugcuaugaa AJQACGQUGUCQQUC

3) — PAV-VIe AcggCCAAA UAQG UaQACua.40nt.aCc CCCCA gcca..44ntCCCCAAAA PAV-P AcggCCAAA UAQG UaGACua.3flnt.caa CCCCA cugcca..44nt. CCCCAAAA MAV AcuoCCAAA UAQG UaGACua.22nt.eaa CCCCA gcca 8DV AaugCuAAA UAQQ UaGACgg.SlntgCa CCCCA accaac RMV AaccCCAAA UAQG UaGAC RPV AaccCaAAA UAQQ UaGACga.38ntcCc CCCCA ccuuca BWW AaccCCAAA UAQG UaGACga.43ntaCa CCCCA aaagaa PLRV'8 AaccCCAAA UAQQ UaGACua.43ntaCu CCCCA gaagca PLRV-A,C&N AaccCCAAA UAQQ UaQACua.43ntaCu CCCCA aaagca — PEMV gccu CCcuc UgaG ggGACga.4ent.cac CCCCA aguccc 8T9 gaaguuAAA UAQQ gcGgCcu..57ntgga CCCCA cgaauc GARNI uuucCCAAA UAQQ ggQgCcu..41ntgCc aCCCA ucagug CARN2 Aagu aCcAg UAQu UgQAaag..66nt«au CCCCA aaccug CCFV uuug uCcgo UAQG gQugCuu..75ntgCc CCCCA aaauac MNSV uugguCAAc UAQQ gQugCcu..75nt.cac aCCCA gacaug MCMV gagu ugAAA UAQQ gQugucu..42ntgCa CCCCA aaacuc TGV uuug uCcgc UAQQ gQugCuu..74ntgCc CCCgA aaauac »

demonstrated using BYDV-PAV full-length synthetic subgenomic RNA containing perfect 3' and 5' termini in rabbit reticulocyte lysates (Dinesh- Kumar et al., 1992). This in vitro synthesized readthrough product reacted with the BYDV-specific antibody indicating that this protein is present in the purified virus particles. The CP-ORF 5 fusion product was identified in PLRV (Bahner et al., 1990) and BWYV (Reutenauer et al., 1993) infected protoplasts and plant tissues using the antibody raised against the CP-0RF5 fusion protein. Despite identification of readthrough products in vivo the actual molar ratio of CP to readthrough product has not been estimated for any luteoviruses. However, in BYDV-PAV efficiency of readthrough in vitro varied from 7-15% depending on the salt concentration (magnesium chloride and/or potassium acetate) in the translation mix (Dinesh-Kumar et al., 1992). Similarly in TMV it was possible to enhance the suppression of stop codon from 10% upto 40% in vitro just by altering the magnesium ion concentration (Pelham, 1978). In PLRV to determine in vivo readthrough efficiency, the region including 18 nucleotides upstream and 21 nucleotides downstream of the CP stop codon was fused to the P-glucuronidase (GUS) reoporter gene under the control of 35S promoter (Taclce et al., 1990). When this construct was electroporated into tobacco and potato protoplasts, the CP stop codon was suppressed at about 1% efficiency. The observed in vivo readthrough efficiency is 7-10 fold lower compared to in vitro translation experiments with BYDV-PAV full length synthetic subgenomic RNA (Dinesh-Kumar et al., 1992). With TMV using the similar approach, the efficiency of readthrough observed in vivo (5%, Skuzeski et al., 1990) was 2-4 fold lower than in vitro (Pelham, 1978). However, in the same experiment (Skuzeski et al., 1990), failed to observe readthrough of MCMV and CarMV stop codons which belong to the luteovirus group of readthrough signals. We were unable to observe readthrough of BYDV-PAV stop using the same approach (Dlnesh- Kumar and Miller, unpublished; see Appendix III of this thesis). Failure to observe readthrough in our experiments is not due to the inefficient expression level in oat protoplast system because our positive control values were comparable with PLRV and TMV experiments. Further, use of diiferent types of constructs even one including entire CP ORF and the part of readthrough ORF did not give any readthrough. However, we were able to detect readthrough using a construct in which GUS gene was inserted downstream of the CP stop codon in a full-length infectious clone of BYDV- PAV (see Appendix III of this thesis).

Explanation of Thesis Format This thesis includes general introduction to luteovirus gene expression, two published papers and three appendixes. The paper I was published in 1992, April issue of Virology and paper II in 1993, June issue of The Plant cell. The Figures 1 and 3 of appendix I is my contribution to the paper published in 1993 August issue of Molecular Plant Microbe interactions by Di, et. al. Appendix II and III include results that will be published after some additional work. Any references cited in the general introduction to »

luteovirus gene expression, appendixes and general summary are included in the reference section that follows the general summary. 32

PRECISE MAPPING AND IN VITRO TRANSLATION OF A TRIFUNCTIONAL SUBGENOMIC RNA OF BARLEY YELLOW DWARF VIRUS 33

Precise mapping and in vitro transiation of a trifunctional subgenomic RNA of bariey yeiiow dwarf virus

DINESH-KUMAR , S. p., M.S. BRAULT, V., Ph. D. MILLER, W. A., Ph. D.

Plant Pathology Department and Molecular, Cellular and Developmental Biology Program Iowa State University Ames, Iowa 50011 »

ABSTRACT

The barley yellow dwarf virus genome consists of a single 5.7kb RNA encoding six open reading frames (ORFs). The four ORFs in the 3* half of the genome were proposed to be expressed via subgenomic mRNAs. Here, we show that the PAV serotype of barley yellow dwarf virus (BYDV-PAV) generates two subgenomic RNAs of 2.9 and O.Skb in infected plants and protoplasts. The 5' end of the larger subgenomic RNA (sgRNAI) was precisely mapped to base 2769 by ribonuclease protection and primer extension methods. Synthetic sgRNAI, containing the exact 5' and 3' ends, was generated by in vitro transcription, translated in vitro, and shown to serve as a message for three ORFs. Translation initiated at the first two AUG codons in sgRNAI, yielding the 22 kilodalton (kDa) viral coat protein (CP) and a 17 kDa protein encoded by an overlapping, out-of-frame ORF. In addition, readthrough of the amber stop codon of the CP ORF gave rise to a 72 kDa fusion product of the CP ORF and an in-frame 50K ORF immediately 3' of the CP termination codon. The O.Skb sgRNA2 was present in greater abundance than sgRNAI and likely serves as a message for a 6.7K ORF at the 3' end of the genome. Sequences that may control subgenomic RNA synthesis and the translational events are compared with those of other plant viruses. 35

INTRODUCTION

Many plant viruses express genes via subgenomic RNAs. These RNAs are S'-truncated forms of the genomic RNA. By bringing the 5' end in proximity with the start codons of genes iocated in the 3' end of the genome, subgenomic RNAs act as efficient messages for these genes. The 5' ends of subgenomic RNAs have been precisely mapped for members of the bromo- (French and Ahlquist, 1988), tymo- (Gargouri et al., 1989), tobamo- (Goelet et al., 1982), tobra- (Goulden et al., 1990), cucumo- (Gould and Symons, 1982), tombus- (Rochon and Johnston, 1991), carmo- (Carrington and Morris, 1986), hordei- (Gustafson et al., 1987) and luteo- (Tacke et al., 1990; Miller and Mayo, 1991) virus groups. The subgenomic RNAs of a tombusvirus (Rochon and Johnston, 1991) and a luteovirus (Tacke et al., 1990) have been shown to act as messages for translation of overlapping genes in which initiation occurs at two nearby out-of-frame AUGs. Luteoviruses have one genomic RNA of about 5.7kb that encodes six open reading frames (ORFs) and is not polyadenylated. Luteoviruses can be divided into two distinct groups (reviewed by Martin et al., 1990). The subject of this paper, the PAV serotype of BYDV (BYDV-PAV, Miller et a/., 1988) has a genome organization as shown in Fig. 1A. In contrast, beet western yellows virus (BWYV, Veldt et al., 1988), potato leafroll virus (PLRV; van der Wilk et ai., 1989; Mayo et al., 1989; Keese et al., 1990) and the RPV serotype of BYDV (BYDV-RPV, Vincent et al., 1991) contain an 36

extra 5'-terminal ORF and lack a homolog to the 6.7K ORF. Moreover, the putative polymerase gene of BYDV-PAV shows more similarity to those of the carmoviruses (Miller et a!., 1988) than to polymerases of the other sequenced luteoviruses. The polymerases of the other luteoviruses are more closely related to those of the sobemoviruses (Veldt et a!., 1988; Habili and Symons, 1989). Gene expression of BYDV has yet to be characterized. Based on its genome organization, BYDV-PAV likely uses several strategies to express its genes. The first two ORFs located at the 5'-half of the BYDV-PAV genome are translated from genomic RNA. The 60 kilodalton (kDa) protein, a putative RNA-dependent RNA polymerase, appears to be expressed by a translational frameshift event (Brault and Miller, 1992), resulting in a 99 kDa fusion protein. We proposed that the 3' half of the genome is expressed from two subgenomic mRNAs, with the 22K, 17K and 50K ORFs all expressed from the large subgenomic RNA (Miller et a!., 1988). The 6.7K ORF of unknown function may be encoded by the small subgenomic RNA. Evidence has been given in support of a similar mechanism for translation of the coat protein and overlapping genes from PLRV (Tacke et a!., 1990). However, due to the distinct differences of BYDV-PAV from PLRV-like luteoviruses described above, we set out to determine the strategy used by BYDV-PAV. MATERIALS AND METHODS

Virus and Virai RIMA Purification Tlie Illinois isolate of BYDV-PAV was kindly provided by Anna Hewings, USDA/ARS, Univ. of Illinois. Virus was propogated in oats (Avena sativa cv. Clintland 64). Virions and viral RNA were extracted as described by Waterhouse eta/. (1986).

Electrotransfection of Protoplasts with BYDV RNA Protoplasts were isolated from an oat {Avena sativa cv.Stout) suspension culture, obtained from H. Rines (USDA/ARS, Univ. of Minnesota), using a method similar to that described for Triticum monococcum by Young et al. (1989) with several modifications. The cells were subcultured weekly in MS medium (Murashige and Skoog, 1962) in a 1:4 ratio of suspension:medium and maintained by shaking at room temperature. Three days after subculture, cells were digested in a 9:1 solution of 0.6 M mannitohartificial sea water (ASW: 311 mM NaCI, 6.9 mM KCI, 18.8 mM MgS04, 16.7 mM MgCl2, 6.8 mM CaCi2, 1.75 mM NaHCOg, 10 mM MES pH 6.0) containing 10 ml of enzyme solution [0.5% Cellulysin (Calbiochem), 0.75% Hemicellulase (Sigma), 0.3% Driselase (Sigma)]. This mixture was incubated for 18 hours at room temperature with shaking at 40 rpm. The protoplasts were then filtered through nylon membranes of 70 mm and 40 mm and sedimented at 100 x gr for 5 min. The protoplasts were washed twice in a solution of 0.6 M mannitol:ASW (1:1). After a final wash in electroporation buffer (EPB: lOmM HEPES, 150mM NaCI, 0.2M mannitol. 38

4mM CaCl2, pH 7.2; Fromm et a!., 1985) the pellet was resuspended In EPB containing 0.2 mM spermidine. Approximately 1-2x10^ protoplasts were incubated on ice for 15 min, and 0.5 pg of viral RNA was added to the protoplasts immediately prior to electroporation using 1 pulse at 250 V and 500 (Gene Puiser, BioRad). After 15 min on ice, protoplasts were diluted 6-fold in a solution of MS:0.6 IVI mannitol (1:1). Transfected protoplasts were incubated at 28° in the dark for 0 to 72 hours before harvesting by centrifugation for 5 min at 100 x g. Infection was verified by ELISA of protoplast extracts using BYDV-PAV- specific antibodies kindly provided by Stewart Gray (USDA/ARS, Cornell Univ.). Plasmid Construction DNA manipulations were performed essentially as described by Sambrook et al. (1989), except where indicated otherwise. All plasmids were cloned in Escherichia coii (strain DH5af'). All nucleotide numbering (nt xxxx) refers to the BYDV-PAV genome (Miller et a!., 1988). (i) Plasmids pSP2, pSPS, pSPIO and pSP16 were used to make probes for northern blot analysis (map positions in Fig.IB). To generate pSP2 and pSPS, Acc\ fragments (nt 2531-2786 and nt 2787-2985, respectively) were Isolated from pPA259 (Miller et a!., 1988). The termini were converted to blunt ends with T4 DNA polymerase and ligated into M>7cll-digested pGEM3Zf( 4- ) [Promega, Madison, Wl]. cDNA clone pPX25 was prepared (Gubler, 1988) from PAV RNA using the primer: 5' CCCGGGTTGCCGAACTGCTCTTTCG 3'. This is complementary to the 3' end of the PAV genome, with the addition of three C residues at the 5' end of the primer to create a unique Sma\ site. Xba\ linkers were iigated to the cDNA, which was then digested with Xba\, and cloned into Xbal-cut pUC18. pPX25 contains the 3'-terminal 1450 bases of BYDV-PAV sequence. pSPIO was constructed by subcloning the complete pPX25 insert into the HindlW and EcoRl sites of pGEM3Zf( + ). To obtain pSP16, the Hinc/\\\-Ssp\ fragment of pPA142 (Miller et a!., 1988), (nt 1591-2739), was introduced into HintM- Sma\ digested pGEM7Zf( + ). (il) pSP9 : To produce antisense probe for RNase protection studies (Fig.IB), piasmid pSP9 was constructed by subcloning an Ssp\-Sal\ fragment (nt 2740-2990) from pPA259 into Sma\-Sal\ digested pGEM3Zf( + ). (Hi) pSP17, pSP4, pSP18 and pSP19: These plasmids were used to synthesize subgenomic RNA transcripts for in vitro translation. Positions to which the clones map in the viral genome are shown in Figures 4A and 5A. Piasmid pSP17 was constructed using polymerase chain reaction (PGR) to obtain transcripts containing the precise 5' end of BYDV-PAV subgenomic RNA. First, piasmid pSPI was generated by cloning the Ssp\-Pst\ fragment of pPA259 (nt 2740-3476, Pst\ site is in the vector) into Smal-fs/l digested pGEM3Zf( + ). Then, an upstreamprimer: 5' GGTCT AG A TAA TA CGA CTCA CT Xl7}4GATAGGGTTTATAGTTAGTATAC 3', containing (5' to 3'): an Xba\ site (underlined), the T7 RNA polymerase promoter (italics) and BYDV-PAV sequence from nt 2769 to 2791; and a downstream primer: 5' TCACACAGGAAACAGCTATGAC 3' (pUC/M13 "reverse" primer) were used with circular pSPI piasmid as a template to amplify an 825 bp fragment by 40

PGR. The PCR-amplifled product was gel-purified, digested with Xba\-Pst\ and cloned into Xba\-Pst\ cut pUC118. To generate pSP4, the sequence upstream of and including the coat protein (CP) start codon was removed from pSPI by digesting with £co/7l. Of the three resulting fragments, the 481bp and 3306bp (vector) fragments were gel purified and religated. The viral sequence in transcripts from pSP4 begins at base 3 of the CP gene (nt 2860 in the genome), and ends at nt 3476 (3* of the CP stop codon). Plasmid pSP18 was constructed to generate the full-length subgenomic transcripts with precise 5' and 3' termini. First pPA8 (Miller et al., 1988) and pSPIO were joined at the Bsm\ site (nt 4600) as follows. The Sa/\-Bsm\ fragment (nt 3308 to nt 4600, Sal\ is in the vector) of pPA8 was cloned into Sal\-Bsm\ cut pSPIO to generate pSPII. Then the 481bp Acc\ fragment of pSPI (nt 2985-3466) was inserted into Xlccl-cut pSPII to create pSP12. Plasmid pSP12 was digested with Xba\ (in the vector), made blunt and digested with Sail (nt 2985). The resulting fragment was Inserted into pSP17, which had been prepared by cleavage with Pst\ in the vector, converted to blunt ends and subsequently digested with San (nt 2985). To obtain transcripts lacking both the CP and 17K ORF start codons, plasmid pSP19 was generated. The Sa/\-Sma\ (nt 2985-5677) fragment of pSP12 was cloned into SanSmaï cut pGEM3Zf(-i-). In Vitro Transcription Synthetic transcripts used for in vitro translation were synthesized from A///7(/lll-linearized pSP17, pSP4 and Smal-linearized pSP18, pSP19 41

using T7 RNA polymerase as described by the manufacturer (Promega, Inc.,). Briefly, 100 pi reactions containing 40mM Tris-CI, pH 7.5, 6mM MgCl2, 2mM spermidine, lOmM NaCI, lOmM dithiothreitol (DTT), 500mM each of the four ribonucleoside triphosphates (rNTPs), 100U RNasin, 8 |ig of linearized plasmid DNA template and 100 U of T7 RNA polymerase were incubated for 1h at 37°. To synthesize capped transcript, 50^M GTP, 500|iM each ATP, CTP, UTP, and SOO^iM m7G(5')ppp(5')G (New England Biolabs) were used. Template DNA was removed by digestion with lU/pg DNA of RQ1 RNase-free DNase I (Promega) for 15 min at 37°. The reaction mixture was extracted twice with phenol-chloroform, and ethanol precipitated. Final RNA concentration was determined spectrophotometrically. Strand-specific RNA probes used for northern hybridizations and RNase protection assay were synthesized as above by including [a-32p]UTP. Plasmids pSP2 and pSP3 were X6al-linearized and pSP9 was Sacl-linearized prior to transcription with SP6 RNA polymerase. Plasmids pSP16 and pSPIO were linearized at Sac\ and Pvul sites, respectively, prior to transcription with T7 RNA polymerase. RNA Extraction Total RNA from 200 mg infected or healthy leaves was isolated as described by Wadsworth et al. (1988). Total nucleic acids from protoplasts were isolated by the method of Young et al. (1989). For northern blot analysis, RNA was separated from DNA by LiCI precipitation of the RNA (Sambrook et a!., 1989). RNA used in primer extension and RNase protection 42

was purified using Chromaspin-1000 columns (Clontech Laboratories, Inc., Palo Alto, CA).

Northern Blot Analysis RNA (5-10 ng) was electrophoresed on 1.2% agarose gels containing 1.1% formaldehyde, blotted to nitrocellulose filters in 10X SSC (1x SSC is 0.15 M NaCI and 0.015 M sodium citrate, pH 7.0), and fixed by UV crosslinking. Membranes were prehybridized at 52° for at least 2h in 50% formamide, 5x SSC, 20mM sodium phosphate, pH6.5, 0.1% SDS and 0.2mg/ml polyanetholesulfonic acid (Sigma). Hybridization was performed in the same buffer containing 1x10? cpm of 32p.|abeled RNA transcripts for 12-16h at 520. Following hybridization, filters were washed once with lxSSC-0.1 % SDS for 20 min at room temperature, then 3 times for 20 min each, at 68° in 0.1 xSSC-0.1 %SDS. Blots were dried, and exposed to X-ray film with an intensifying screen at -80°. RNase Protection RNase protection was performed as described by Melton et al. (1984). Approximately 1x10^ cpm of labeled RNA transcript was hybridized to 5-10 ng total RNA isolated from protoplasts in 80% formamide, 40mM PIPES, pH6.7, 0.4 M NaCI and ImM EOTA at 42° for 1h. Following hybridization, samples were digested with an RNase A/T1 cocktail (Ambion, Austin, TX) for 30 min at 37°. Digestion was terminated by 0.5%SDS and 100 ^g proteinase K at 37° for 15 min. After phenol-chloroform extraction and ethanol precipitation, protected fragments were denatured in formamide 43

EDTA buffer at 95° for 5 min and analyzed by electrophoresis on a 6% polyacrylamide, 7M urea gel. Primer Extension Primer extension was carried out using oligomer PI : 5' TTGCGCGTCTAGGTCCTCTA 3', complementary to nt 2875 to nt 2894 of BYDV-PAV genomic RNA. This primer was 5' end-labeled with T4 polynucleotide kinase (New England Biolabs, Beverly , MA) and [y-32p]ATP (Sambrook et at., 1989). Radiolabeled primer (2x10^ cpm) was annealed to 5-10 lag of total RNA isolated from protoplasts in 50mM Tris-CI, pH8.3 and 75mM KCI containing lU/ml RNasin (Promega) for 30 min at 65°. Annealed primer was then extended by addition of 20mM DTT, ImM of all four deoxynucleoside triphosphates and 200 units of MMLV H' reverse transcriptase (Superscript, BRL) and incubating at 48° for 30 min. Extended products were ethanol precipitated and resuspended in 80%formamide- 20mM EDTA-0.1% xylene cyanol-0.1% bromophenol blue. After heating for 5 min at 95°, samples were eletrophoresed through a 6% polyacrylamide/7M urea sequencing gel and visualized by autoradiography. The sequencing ladder was generated by double stranded sequencing (Sanger, 1977) of pSP9 using the above primer (PI). In vitro Translation and Immunoprecipitation Approximately 1 ^g of transcript was translated in 20 |il reaction volume in the presence of [35s]-methionine (NEN) using nuclease treated rabbit reticulocyte lysate as described by the manufacturer (Promega). In some cases the lysate was supplemented with extra MgCl2 and potassium 44

acetate. Translation products were immunoprecipitated (Ball, 1990) using PAV-specific antibodies. One tenth volume of the products was electrophoresed through 5% stacking/12% resolving poiyacrylamide-SDS denaturing gels using discontinuous buffer system (Laemmli, 1970). Gels were fixed overnight, stained and either autoradiographed or fluorographed (Hames, 1990). Radioactivity in the gels was quantified using a Phosphorlmager 400E (Molecular Dynamics, CA). 45

RESULTS

Characterization of BYDV-PAV RNAs Northern blots were employed to determine the number, approximate size and location of subgenomic RNAs generated during BYDV-PAV infection. Total RNA from infected leaves or transfected oat protoplasts was hybridized with labeled, strand-specific RNA probes spanning different regions of the genome (Fig IB & C). None of these probes hybridized to RNA from healthy leaves or mock-inoculated protoplasts, demonstrating the specificity of these probes for BYDV-PAV RNA. Initial experiments used total RNA from infected plants, but protoplasts were used subsequently due to ease of RNA isolation. The ratio of subgenomic RNAs to genomic RNA was higher in protoplast-derived RNA than plant-derived RNA. (Fig 1C and data not shown). All of the probes hybridized to genomic length RNA of about 5.7kb. Probe pSPIO, covering the 3' end of the genome, detected a 2.9kb subgenomic RNA (sgRNAI) and much higher amounts of a O.Skb subgenomic RNA (sgRNA2) in protoplasts (Fig. 1C) and plants (data not shown), whereas hybridization with probe pSP16, corresponding to an internal part of the putative polymerase gene (60K ORF), did not detect these RNAs. Probe pSP2, covering the 3' end of 60K ORF and part of the following intergenic region up to nt 2786, revealed only one subgenomic RNA of 2.9kb. RNA of this size was also detected with a probe (pSP3) encompassing part of the CP/17K sequence and the intergenic region 3' of nt 2786. The ratio of subgenomic to genomic RNAs was reduced in RNA FIG. 1. Characterization of BYDV-PAV RNA in infected ceils. A. Genome organization of BYDV-PAV Indicating sites of proposed abnormal translational events. Boxes represent open reading frames (ORFs). POL = polymerase; CP=coat protein; VPg = possible genome linlced viral protein. B. Relative positions of strand-specific RNA probes and oligonucleotide primer. UAA indicates stop codon of 60K ORF. AUGs indicate start codons of CP and 17K ORFs. Positions of (-) strand RNA transcripts used in northern hybridization (open boxes) and RNase protection assay (solid box) are shown below the expanded portions of the genome. Numbers at ends of bars and ORFs Indicate positions in BYDV-PAV genome (iVIIIIer et a!., 1988). Primer PI (arrowhead) is the 20 base oligomer used for primer extension. C. Northern blot analysis of total RNA from mock (H) and BYDV-PAV Infected (I) oat protoplasts (pSP16 and pSPIO) and plants (pSP2 and pSP3). RNA was extracted at 36h and 72h after inoculation of protoplasts. Blots were hybridized with 32p.|abeled strand-specific probes representing different portions of genome (panel B). Positions of genomic RNA (G), subgenomic RNA1 (sgRNAI), and subgenomic RNA2 (sgRNA2) and mobilities of RNA markers (BRL) are shown beside autoradiographs. 47

Readtlirough Frameshift CP 22K 50K 60K(POL) 1 17K • 39K fVPg? 6.7K 5' Internal initiation 3' •sgRNAI •sgRNA2 .J I

2858 1 SaoK UAA AUQ 22Ka 1 1 2901

1 1 1 • 1 1 > Sad Aod Sipi Aod Aod r / Pvul Smal pSP16 Sa> pSPIO a, 2453 2730 5318 5677 pSP9 pSP2 2740 2800 2931 27M pSP3 2787 2965

Probe: pSP16 pSPIO pSP2 pSP3 36 h 72 h 36 h 72 h 1 r 1 r H H H H MW(kb) H I H I - 7.46 - G - 4.40 - sgRNAI f - 2.37 - 1 -1.35- sgRNA2 • # - 0.24 - samples extracted from plants. However, the O.Skb was always In vast excess relative to the 2.9kb sgRNAI (data not shown). These observations suggest that sgRNAI is synthesized both in infected leaves and protoplasts and that the 5' end of sgRNAI is within the 47 nucleotide region upstream of the Acc\ site (3* end of pSP2) at base 2786 and downstream of the Ssp\ site (3' end of pSP16) at base 2739. Identification of the 5' end of sgRNAI To more precisely map the 5' end of sgRNAI, RNase protection analysis was used. Labeled antisense probe pSP9 (Fig. IB), representing the full intergenic region between the 60K ORF and coat protein gene and part of the CP/17K coding region (corresponding to BYDV-PAV sequence 2740 to 2990), was hybridized to total RNA from mock- and BYDV-PAV-inoculated protoplasts. The RNA was then treated with ribonuclease. Major RNA probe fragments of 250 and 221 nt were protected by RNA isolated from protoplasts 36h and 72h after inoculation with BYDV RNA (Fig. 2A). In contrast, the probes were not protected by RNA from BYDV RNA-inoculated protoplasts at 0 h or mock-inoculated protoplasts at any time point. The 250 nt band is equal in size to the portion of the probe containing viral sequence and represents the fragment protected by genomic RNA. The 221 nt protected fragment is in the expected size range for a fragment protected by sgRNAI. This leads to a predicted 5' end of sgRNAI very near base 2769. A faint band of approximately 165 nt was also protected. However, northern analysis and primer extension (below) provide no evidence for an additional sgRNA of this size. >

Oh 36h 72h MARKERS

(G)2S0 (sgRNA1)221

FIG. 2. Mapping of BYDV-PAV subgenomic RNA1 (sgRNAI) 5' end. A. RNase protection analysis of total RNA from mock (H) and BYDV-PAV RNA (1) transfected oat protoplasts at 0, 36, and 72h post-inoculation. RNA was hybridized with 32p.|abeled antisense probe pSPS (Fig IB) and digested with RNases A and T1. Protected fragments were analysed on a 6% polyacrylamide gel containing 7M urea. Sizes of fragments protected by genomic (G) and subgenomic (sgRNAI) RNA are indicated at left, whereas those on the right indicate sizes of in vitro transcribed RNA markers. N indicates no RNA is included in hybridization mixture. B. Primer extension analysis of RNA from mock (H) and BYDV-PAV RNA (I) transfected oat protoplasts. Total RNA was annealed to end-labeled primer PI and extended with reverse transcriptase (Fig. IB). The elongation products were separated on a 6% sequencing gel. The arrow indicates the 5' terminus of the subgenomic RNA1 deduced from the gel. Sequencing ladder shown on the left is generated from double stranded DNA plasmid pSP9 using primer PI (Fig. IB). N indicates no RNA included in annealing mixture. 50

To confirm the 5' end of subgenomic RNA1, primer extension analysis was performed. End-labeled primer (PI, Fig. IB) was annealed to total RNA from mock- and BYDV-PAV RNA-infected protoplasts and extended by reverse transcriptase. An extension product was detected in the RNA samples prepared from infected protoplasts (Fig. 28), whose size suggested that it was due to reverse transcriptase reaching the 5' end of sgRNAI. The 5' end at base 2769 is clearly revealed by comparision with the adjacent DNA sequencing ladder generated with the same primer on cDNA clone pSP9. Other, fainter high molecular weight bands were also seen. No band with a 5' end at position 2769 was detected when primer extension was performed on virion RNA (data not shown). These findings verified the results of RNase protection analysis, indicating that the sgRNAI start site corresponds to the guanosine residue at nucleotide 2769. This corresponds to an 89 nucleotide 5'-untranslated leader upstream of the coat protein start codon AUG at nt 2858. In vitro Translation Products of Synthetic Subgenomic RNA Once the precise 5' end of the sgRNAI was determined, cDNA clones were constructed from which sgRNAI containing perfect 5' ends could be transcribed for in vitro translation assays. To test the hypothesis that coat protein and 17K ORFs are translated by initiation at two separate AUG codons in the same subgenomic RNA, transcript pSP17 (containing start codons of both ORFs) and transcript pSP4 (containing only the 17K start codon) were translated in a cell-free rabbit reticulocyte lysate system (Fig. 3A). Translation of the pSP17 transcript resulted in large amounts of a I

Subgenomic Start = 5' end pSP17 (+CP/+17K) r m JâêS 2769 AUG 22K(CP) UAG AUG 17K UAG 2901 3362

6' end pSP4 (.CP/+17K)

B pSP17 pSP4

1 P' N 'T I P' —110 — 84

— 47 ' —33

—24 17K ê % —16 2 3 4 5 6 7

FIG. 3. In vitro translation of BYDV-PAV synthetic subgenomic RNAs containing CP and 17K ORFs. A. Schematic representation of the pSP17 and pSP4 transcripts used for in vitro translation. The ' + ' or indicates the presence or absence of AUG start codon of the indicated ORF. B. Translation products of transcripts from pSP17 (T, lanel) and from pSP4 (T, lane 5) were obtained in a cell-free rabbit reticulocyte system. Translation products were immunoprecepitated with BYDV-PAV antiserum (I, lanes 2 and 6) or with preimmune serum (P, lanes 3 and 7). Negative control shows products with no added RNA (N, lane 4). Products were separated by 12% polyacrylamide-SDS gel electrophoresis (Laemmli, 1970) and visualized by autoradiography. On the left, positions of coat protein (CP) and 17K protein bands are indicated. Mobilities of molecular weight standards (in kDa) are at the right. 17 kDa polypeptide and less accumulation of a 22 kDa polypeptide (Fig. 3B, lanel). In contrast, translation of pSP4 transcript in which the coat protein AUG was deleted, resulted in only the 17 kDa polypeptide (Fig. 3B, lane 5). This shows that the 17K ORF is likely to be translated by initiation at the second AUG (base 2901) in sgRNAI. These translation products were further characterized by immunoprecipitation with BYDV-PAV-specific antiserum. Antiserum reacted with 22 kDa product but not the 17 kDa product, indicating that the former is indeed BYDV-PAV coat protein (Fig. 3B, lanes 2 and 6). None of the products was precipitated by preimmune serum (Fig. SB, lanes 3 and 7). Translation of capped transcripts of pSP17 and pSP4 gave the same pattern of polypeptides as uncapped transcripts (data not shown). To study translation of the 50K ORF, a full-length subgenomic transcript (pSPIS) and a 5'-truncated transcript (pSP19) were translated in rabbit reticulocyte lysates (Fig. 4A). As with the previous constructs, 17K and CP gene products were produced in the initial translation conditions, yet no product (72 kDa polypeptide) consistent with readthrough of the CP stop codon was detected (Fig. 4B, lane 1). Instead, an unexpected additional polypeptide of about 42 kDa was produced, possibly by initiation at an internal AUG located in the 50K ORF at position 3665 in the genome (Fig. 4A). This is supported by the observation that the 42 kDa polypeptide was also translated from an RNA lacking both the CP and 17K start codons (Fig.48, Iane2). 53

Subgenomic Start = 5' end pSP18 2858 3460 3665 4613 5677 AUG 22K UAQ AUQ 50K UQA 2769 AUQ 17K UAQ 6.7K 2901 3362 L ' end pSP19 2985 B mMMgCl2: 0.5 1.2 1.9 2.6 1.5 1.9 mM K Ac: yg yg 79 79 239 159 1 r 1 r 1 r r ® % pSP18 pSP19 oc m & II PSP: 18 19 18 19 18 19 18 19 OL d T I P T I P i

AUG3665 — AUG3665

= # CP 17K 123456 789

FIG. 4. In vitro translation of synthetic subgenomic RNA1 of BYDV-PAV. A. Schematic representation of pSP18 and pSP19 transcripts used for in vitro translation. Numbers indicate the nucleotide positions of ends of ORFs and transcripts. UAG at 3460 indicates the leaky stop codon separating CP and 50K proteins. B. Influence of MgCl2 concentration on translation of synthetic subgenomic RNAs. pSP18 and pSP19 transcripts were translated in a rabbit reticulocyte system with the indicated concentrations of MgCl2. Indicated on the left are positions of the 17K and CP translation products, and bands consistent with initiation at AUG 3665 and readthrough of the CP stop codon. 0. Influence of MgCl2 and potassium acetate (K Ac) on in vitro translation of synthetic subgenomic RNAs. Translation products of transcripts pSPIS (T, lanes 1 and 3) and pSPIS (T, lanes 2 and 6) in the presence of different concentration of MgCl2 and K Ac as indicated. These products were immunoprecipitated with BYDV-PAV antiserumd, lanes 4 and 7) and with preimmune serum (P, lanes 5 and 8). I

Magnesium chloride and potassium acetate concentrations were increased in attempts to observe readthrough (Pelham, 1978; Carrington and Morris, 1985). Readthrough-size polypeptide (72 kDa) was observed with addition of MgCl2 to the translation mix (Fig. 4B, lanes 3 and 5), clearly indicating that synthesis of the 72 kDa polypeptide was sensitive to changes in MgCl2 concentration. The relative amount of 72 kDa product was 7.3% of CP product at a MgCl2 concentration of 1.9 mM (Fig. 5). This ratio was further increased to 15-16% of CP when 159mM potassium acetate was combined with MgCl2> Overall, the CP, 17 kDa and 42 kDa protein synthesis was decreased with increased potassium acetate and MgCl2 concentrations. To determine the identity of the 72 kDa polypeptide, the translation products were immunoprecipitated with BYDV-PAV-specific antiserum. Antiserum reacted with the 72 kDa polypeptide, indicating that this peptide is present in the purified virus preparation (Fig. 4C, lane 4). Lesser amounts of other translation products were immunoprecipitated. They may have arisen as a result of internal initiation or premature termination of translation at many sites along the template (Fig. 4C, lane 4). None of the products was immunoprecipitated with preimmune serum (Fig. 4C, lanes 5 and 8). >

10.00

• cp 0 17K • RT W 42K

mMMgCl2: 0.5 1.2 1.9 2.6 1.5 1.9 mMKAc: 79 79 79 79 239 159

FIG. 5. Quantification of effects of MgCl2 and KAc on relative translation of various polypeptides from pSP18 transcript. Gels in Figs. 5B and 5C were scanned using a Phosphorimager. Log of the molar ratios of 17K, readthrough (RT), and 42K proteins with respect to CP were plotted at the indicated concentrations of MgCl2 and K Ac. 56

DISCUSSION

Subgenomic RNA Mapping Due to the ease of extraction and increase in proportion of viral RNAs, mapping of the subgenomic RNAs was facilitated by the use of infected protoplasts. Electroporation and PEG have been used previously to efficiently infect protoplasts from Triticum monococcum and barley (Young et a!., 1989; Larkin et a!., 1991), but oat protoplasts had not been inoculated efficiently (Barnett et al., 1981). The increased ratio of sgRNAs to genomic RNA in protoplast-derived RNA relative to plant-derived RNA probably indicates that more virus particles, which contain only genomic RNA, accumulated in plants from which RNA was isolated 10 days after inoculation. In addition, the nonencapsidated and thus unprotected, sgRNAs are likely to have been degraded preferentially during the more prolonged extraction procedure from whole plants than from protoplasts. The two sgRNAs identified by northern hybridization are in agreement with previous studies (Miller et a/., 1988; Young et a!., 1991), which revealed but did not map RNAs of these sizes in infected tissue. Young et at. (1991) detected an additional band of about 1.8 kb that is neither present in our gels, nor predicted from the genome organization. The sizes of the sgRNAs are similar to the predominant dsRNAs detected in BYDV-PAV- infected plants (Gildow et a!., 1983), which may represent replicative forms of the sgRNAs. No evidence for a separate sgRNA for translation of the 17K ORF was obtained. This supports the hypothesis that the two overlapping ORFs are translated from a single message (Miller et aL, 1988; Veldt et ai, 1988; Smith and Harris, 1990; Tacke et a!., 1990; Vincent et a!., 1990). Based on sequence similarities, Tacke et at. (1990) predicted that the 5' end of BYDV-PAV sgRNAI would map to position -40 (nt 2818). More recently, Miller and Mayo (1991) reported the subgenomic RNA of a Scottish isolate of PLRV to be 172 nucleotides longer at its 5' end than that predicted by Tacke et al. The 5' end of the PLRV subgenomic RNA, which is located within the 3' end of the polymerase ORF, has the sequence ACAAAA. This sequence is also present at the 5' terminus of PLRV geomic RNA, suggesting that it is the complement of an origin of ( + ) strand synthesis on the (-) strand (Miller and Mayo, 1991). BYDV-PAV has this sequence at the same relative position (nt 2729) in the 3' end of the putative polymerase ORF, and at position 19 in the genomic RNA. Yet we present three independent lines of evidence in support of a start of sgRNAI at nt 2769. sgRNAI was detected in northern blots with probe pSP2 which cannot hybridize to bases 5' of nt 2786 (-72 relative to CP AUG). Conversely, probe pSP16 which extends 5' from base 2739 detected no sgRNAI. These hybridization patterns suggest that the 5' end of subgenomic RNA1 is located between nt 2739 and nt 2786 (-119 to -72 relative to the CP AUG). RNase protection and run-off reverse transcription both predict that the 5' end initiates at nt 2769. A shadow band at position 2768 (Fig. 2B) may indicate presence of a m^G cap that is not copied well by reverse transcriptase (Ahlquist and Janda, 1984). We detected no bands corresponding to position -40 as predicted by Tacke et al., or at -130 as predicted by Miller and Mayo (1991). The ACAAAA sequence may be required for polymerase recognition but may not specify a precise initiation site. Because of the unrelatedness of the polymerase genes of PLRV and BYDV-PAV, it is possible that the viral replicases recognize different subgenomic RNA initiation signals. Yet, Vincent et al. (1991) found another region of homology immediately upstream of the PAV start site in which 9 out of 12 bases at nt -102 to -91 match in all five known luteovirus sequences. We searched for similarities between the two putative subgenomic promoter regions within the BYDV-PAV genome. Although sgRNA2 was not precisely mapped, its size suggests that the 5' end is slightly upstream of the 6.7K ORF start codon. This ORF is required for infection (Young et al., 1991). A short alignment, including a sequence immediately 5' of the sgRNAI start site is possible (Fig. 6). This includes a subset of the ACAAAA sequence: CAAA at the 5' end of the matching sequences. In the vicinity are identical 10 nt tracts located 20 bases upstream of the CP AUG and 80 bases upstream of the 6.7K AUG. Lack of more significant homology between the two subgenomic promoter regions is not surprising because they are regulated quite differently; sgRNA2 accumulates to much higher levels than sgRNAI (Fig. 1; and Young et al.,1991). More detailed comparison awaits precise mapping of the 5' end of sgRNA2. Translation Initiation at Two AUG Codons. A synthetic subgenomic RNA1 containing a precise 5' end was constructed to rule out spurious effects on translation in vitro due to a truncated leader or one containing vector bases. This experiments differs »

2780 2740 I 2837 2888 C^UCUUAG • CUQGGUUUGGQATAG-03 nt-IACACCACDÂGV-7tnt- AUG CP lACACCACUAdCACAAAUCGGAUCCUGGGAAACAGQCAQ aSnt AUG 8.7K 4810 4021

FIG. 6. Possible alignment between subgenomic promoter regions of BYDV- PAV sgRNAs. Arrow indicates 5' end of sgRNAI (from Fig. 2). Underlined bases are conserved among known luteoviruses in the intercistronic region between polymerase and CP genes (Vincent et a!., 1991). Boxed regions represent 10 base perfect repeats. Italicized numbers indicate number of bases not shown. Start codons of CP and 6.7K ORFs (nt 2858 and 4921, respectively) are shown at right. from those of other studies (Carrington and Morris, 1985; Tacl 50% of the known start codons. Two bases are shown at one position (in brackets) if one or the other is present >75% of the time. Those bases that match the consensus are outlined, those which are found at that position flanking <10% of known start codons are in lower case letters. In the case of luteoviruses, the first ORF is the CP gene, the second is the homolog of the 17K ORF in BYDV-PAV. The BYDV-MAV and BYDV-RPV sequences are from Ueng et al. (1992) and Vincent et al. (1991), respectively. TYMV (turnip yellow mosaic virus, Weiland and Dreher, 1989), EMV (eggplant mosaic virus, Osorio-keese et a!., 1989), KYMV (Kennedya yellow mosaic virus, Ding et a!., 1990) and OYMV (oronis yellow mosaic virus. Ding et a!., 1989) are tymoviruses. The first and second AUGs in tymovirai genomes are functional start codons, located five bases apart giving rise to large out-of-frame overlapping genes. CNV (cucumber necrosis virus, Rochon and Johnston, 1991), and TBSV (tomato bushy stunt virus, Hillman et a!., 1989) are tombusviruses. The AUGs in the tombusviruses give rise to 21 and 20K out-of-frame ORFs expressed from a subgenomic RNA. B. Possible secondary structure in the 5' end of BYDV-PAV sgRNAI. Free energies (in kcal/mol) shown beside each helix were calculated as in Frier et al. (1986) using the program RNASE (Cedergren et a!., 1988). Start codons of the CP and 17K ORFs are in bold, underlined text. Boxed region is the 10 base conserved sequence in Fig. 6. 63

IstORF 2nd ORF BYDV-PAV uQAMmAA BYDV-MAV uGAMi)@AA @QAmm@8 BYDV-RPV uuAMD^AG c@Amm@© BWYV uCAmg@A PLRV QAAmmu© TYMV oAAmSAQ EMV lo© ouismmes KYMV oAAmm@© OYMV uu@m@u@ CNV uu©mg@A ^C©MJI@@A TBSV

U AG =-14.2

Q" u A A U-G CP ORF Start A-U U-A AG =-( U-A U U U CAAUAAAGU^"^^ 3 =-9.2 U-A G-C bUUAUUUCA AG =-9.6 G-C G-C G-C A-U AG =-6.8 C-G '(Vf U-G G-C A-U C-G, 5'...G • ACAUUAGCUCU ' CAAAUCAAAAUGGCA.

Transcription Start 17K0RF Start 64

contributions of sequence context and secondary structure to the translational activity of the two start codons. Readthrough A commercial rabbit reticulocyte translation mix was satisfactory for translation of the CP and 17K ORFs, but translation of the 72K ORF could not be observed under standard conditions. By changing the concentrations of MgCl2 and potassium acetate in the translation mix, synthesis of the 72 kDa readthrough polypeptide increased greatly (Fig. 4). Similar increases in stop codon readthrough due to addition of MgCl2 and/or potassium acetate have been reported previously (Pelham, 1978; Carrington and Morris, 1985). These observations from BYDV-PAV synthetic sgRNAI indicate that readthrough of the CP stop codon occurs at least in vitro. Evidence consistent with readthrough has also been observed in vitro for BWYV luteovirus (Veldt et a!., 1988). The level of readthrough in vivo has been quantitated for only a few plant viruses and it is much lower than that found in vitro. Using a reporter gene, readthrough of the TMV 126K ORF stop codon was shown to be 5% (Skuzeski et a/., 1990) and in the case of PLRV it was 0.9-1.3% (Tacke et ai., 1990). The lower percentage readthrough in vivo may be due to a different population of suppressor tRNAs from than present in vitro (Beier et ai., 1984). The 72 kDa readthrough polypeptide was bound specifically by BYDV- PAV antiserum, indicating it is likely fused to the CP. This is supported by studies of PLRV (Bahner et ai., 1990) and BYDV-PAV (Waterhouse et ai., 1989), in which antibody made against readthrough protein alone reacted only with the readthrough fusion protein and not with the CP, whereas antibodies against CP detected both proteins. The mechanism involved in the readthrough process is not clearly understood. TMV readthrough seems to be mediated by a tRNA which reads the UAG as a tyrosine codon (Beier et a!., 1984) and In case of Moloney Murine leukemia virus (Mo-MuLV) as glutamine (Yoshinaka et a!., 1985). Extensive mutagenesis showed that the 6 bases 3' of the UAG are required for efficient readthrough of the 126K ORF of TMV (Skuzeski et a!., 1991). Because this region shows little similarity with that of luteoviruses, all of which have the sequence AAAUAGGUAGA (the underlined UAG is the CP stop codon; Vincent et a!., 1991), it is likely that luteoviruses use different signals than TMV. In addition, yet another c/s-acting 3' sequence has been implicated for readthrough of a UAG in Mo-MuLV (Honigman et a!., 1991). Site-directed mutagenesis is underway to understand the roles if any of the flanking bases on CP stop codon readthrough. 66

ACKNOWLEDGMENTS The authors are grateful for technical assistance of Amy Morrow and Jean-Francois Bonnet. We thank Richard Lister and Mike Mayo for providing results prior to publication, and Adrlanna Hewlngs and Stewart Gray for generously providing source material and valuable advice. This work was funded by a McKnIght Foundation Individual Research Award in Plant Biology and USDA/CSRS grant no. 8900627. This Is paper no. J-14666 of the Iowa Agriculture and Home Economics Experiment Station. Project numbers 2904 and 2936. 67

LITERATURE CITED

AHLQUIST, p., AND JANDA, M. (1984). cDNA cloning and in vitro transcription of the compiete brome mosaic virus genome. Mot. Cell. Biol. 4, 2876- 2882.

BANNER, I., LAMB J., MAYO,M. A., AND HAY, R. T. (1990). Expression of the genome of potato leaf roll virus: readthrough of the coat protein termination codon in vivo. J.Gen. Virol. 71, 2251-2256.

BALL, E. (1990). Translation product immunoprecipitation. In "Serological methods for detection and identification of viral and bacterial plant pathogens". (R.Hampton., E. Ball., and S. De Boer. Eds.) pp. 343-352. The American Phytopathologicai Society, St. Paul, Minnesota.

BARNETT, A., HAMMOND, J., AND LISTER R. M. (1981). Limited infection of cereal leaf protoplasts by barley yellow dwarf virus. J. Gen. Virol. 57, 397-401.

BEIER, H., BARCISZEWSKA, M., AND SICKINGER, H. D. (1984). The molecular basis for the differential translation of TMV RNA in tobacco protoplasts and wheat germ extracts. EMBO J. 3, 1091-1096.

BRAULT, V., and MILLER, W. A. (1992). Translational frameshifting mediated by a viral sequence in plant cells. Proc. Natl. Acad. Sci. USA, (in press).

CARRINGTON, J. C., AND MORRIS, T. J. (1985). Characterization of the cell-free translation products of carnation mottle virus genomic and subgenomic RNAs. Virology 144, 1-10.

CARRINGTON, J. C., AND MORRIS, T.J. (1986). High resolution mapping of carnation mottle virus-associated RNAs. Virology 150, 196-206.

CAVENER, D. R., AND RAY, S. C. (1991). Eukaryotic start and stop translation sites. Nucleic Acids Res. 19, 3185-3192. r

CEDERGREN, R., GAUTHERET, D., LAPALME, G., AND MAJOR, F. (1988). A secondary and tertiary structure editor for nucieic acids. CABIOS 4, 143-146.

DING, S., KEESE, P., AND GIBBS, A. (1989). Nucleotide sequence of the genome of ononis yellow mosaic tymovirus. Virology 172, 555-563.

DING, S., KEESE, P., AND GIBBS, A. (1990). The nucleotide sequence of the genomic RNA of kennedya yellow mosaic tymovirus-Jervis bay isolate: relationships with potex- and cariaviruses. J. Gen. Virol. 71, 925-931.

FREIER, S. M., KIERZEK, R., JAEGER, J. A., SUGIMOTO, N., CARUTHERS, M. H., NEILSON, T., AND TURNER, D. H. (1986). Improved free-energy parameters for predictions of RNA duplex stability. Proc. Natl. Acad. Sci. USA. 83, 9373-9377.

FRENCH, R., AND AHLQUIST, P. (1988). Charcterization and engineering of sequences controlling //? vivo synthesis of brome mosaic virus subgenomic RNA. J. Virol. 62, 2411-2420.

FROMM, M., TAYLOR, L. P., AND WALBOT, V. (1985). Expression of genes transferred into monocot and dicot plant cells by electroporation. Proc. Natl. Acad. Sci. USA. 82, 5824-5828.

GARGOURI, R., JOSHI, R. L., BOL, J. F., ASTIER-MANIFACIER, S., AND HAENNI, A.- L. (1989). Mechanism of synthesis of turnip yellow mosaic virus coat protein subgenomic RNA //7 vivo. Virology 171, 386-393.

GILDOW, F. E., BALLINGER, M. E., AND ROCHOW, W. F. (1983). Identification of double-stranded RNAs associated with barley yellow dwarf virus infection of oats. Phytopathology 73, 1570-1572.

GOELET, P., LOMONOSSOFF, G. P., BUTLER, P. J. G., AKAM, M. E., GAIT, M. J., AND KARN, J. (1982). Nucleotide sequence of tobacco mosaic virus RNA. Proc. Natl. Acad. Sci. USA. 79, 5818-5822.

GOULD, A. R., AND SYMONS, R. H. (1982). Cucumber mosaic virus RNA3: determination of the nucleotide sequence provides the amino acid sequences of protein 3A and viral coat protein. Eur. J. Biochem. 126, 217-226. »

GOULDEN, M. G., LOMONOSSOFF, G. P., DAVIES, J. W., AND WOOD, K. R. (1990). The complete nucleotide sequence of PEBV RNA2 reveals the presence of a novel open reading frame and provides insights into the structure of tobraviral subgenomic promoters. Nucleic Acids Res. 18, 4507-4512.

GUBLER, U. (1988). A one tube reaction for the synthesis of blunt-ended double-stranded cDNA. Nucleic Acids Res. 16, 2726.

GUSTAFSON, G., HUNTER, B., HANAU, R., ARMOUR, S. L., and JACKSON, A. 0. (1987). Nucleotide sequence and genetic organization of barley stripe mosaic virus RNAg. Virology 158, 394-406.

HABILI, N., AND SYMONS, R. (1989). Evolutionary relationships between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Res. 17, 9543-9555.

HAMES, B. D. (1990). An introduction to polyacrylamide gel electrophoresis. In "Gel electrophoresis of proteins: A practical approach". Second edition. (B. D. Hames, and D. Riclcwood, Ed.) pp. 70-75. IRL Press at New York.

HILLMAN, B. I., HEARNE, P., ROCHON, D., AND MORRIS, T. J. (1989). Organization of tomato bushy stunt virus genome: characterization of the coat protein gene and the 3' terminus. Virology 169, 42-50.

HONIGMAN, A.. WOLF, D., YAISH, S., FALK, H., AND PANET, A. (1991). cis Acting RNA sequences control the gag-pol translation readthrough in murine leukemia virus. Virology. 183, 313-319.

KEESE, P., MARTIN, R. R., KAWCHUK, L. M., WATERHOUSE, P. M., AND GERLACH, W. L. (1990). Nucleotide sequences of an Australian and a Canadian isolate of potato leafroll luteovirus and their relationships with two European isolates. J. Gen. Viroi. 71, 719-724.

KOZAK, M. (1986). Regulation of protein synthesis in virus-infected animal cells. Adv. Virus Res. 31, 229-292. 70

KOZAK, M. (1989). Circumstances and meclianisms of inhibition of translation by secondary structure in eucaryotic mRNAs. Mol. Cel. Biol. 9, 5134- 5142.

KOZAK, M. (1990a). Evaluation of the fidelity of initiation of translation in reticulocyte lysates from commercial sources. Nucleic Acids Res. 18, 2828.

KOZAK, M. (1990b). Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes. Proc. Natl. Acad. Scl. USA. 87, 8301-8305.

LAEMMLI, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227, 680-685.

LARKIN, P.J., YOUNG, M.J, GERLACH, W.L., AND WATERHOUSE, P.M. (1991). The expression of Yd2 resistance to barley yellow dwarf virus in barley plants but not their leaf protoplasts. Annals Appi. Biol. 118, 115-125.

LUTCKE, H. A.. CHOW, K. C., MICKEL, F. S., MOSS, K. S., KERN, H. F., AND SCHEELE, G. A. (1987). Selection of AUG initiation codons differs in plants and animals. EMBO J. 6, 43-48.

MARSH, L. E., DREHER, T. W., AND HALL, T. C. (1988). Mutational analysis of the core and modulator sequences of the BMV RNA3 subgenomic promoter. Nucleic Acids Res. 16, 981-995.

MARTIN, R. R., KEESE, P. K., YOUNG, M. J., WATERHOUSE, P. M., AND GERLACH, W. L. (1990). Evolution and molecular biology of luteoviruses. Annu. Rev. Phytopathoi. 28, 341-363.

MAYO, M. A., ROBINSON, D. J., JOLLY, C. A., AND HYMAN, L. (1989). Nucleotide sequence of potato leafroll luteovirus RNA. J. Gen. Virology. 70, 1037-1051.

MELTON, D. A., KRIEG, P. A., REBAGLIATI, M. R., MANIATIS, T., ZINN, K., AND GREEN, M.R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 12, 7035-7056. 71

MILLER, J.S., AND MAYO, M.A. (1991). The location of the 5' end of the potato leafroll luteovirus subgenomic coat protein mRNA. J. Gen. Virol. 72, 2633-2638.

MILLER, W. A., WATERHOUSE, P. M., AND GERLACH, W. L. (1988). Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Res. 16, 6097-6111.

MURASHIGE, T., AND SKOOG, F. (1962). A revised medium for rapid growth bio- assays with tobacco tissue. Physiologia Plantarum 15, 473-497.

MURPHY, J. F., D'ARCY, C. J., AND CLARK, J. M. (1989). Barley yellow dwarf virus RNA has a 5*-terminal genome-linked protein. J. Gen. Virology. 70, 2254-2256.

OSORIO-KEESE, M. E., KEESE, P., ANDGIBBS, A. (1989). Nucleotide sequence of eggplant mosaic tymovirus genome. Virology 172, 547-554.

PELHAM, H. R. B. (1978). Leaky UAG termination codon in tobacco mosaic virus RNA. Nature 272, 469-471.

ROCHON, D. M., AND JOHNSTON, J. C. (1991). Infectious transcripts from cloned cucumber necrosis virus cDNA: evidence for a bifunctional subgenomic mRNA. Virology 181, 656-665.

ROCHOW, W. F. (1970). Barley yellow dwarf virus. Commonwealth Mycological Institute/Association of Applied Biologists Descriptions of Plant Viruses, No. 32. Kew, Surrey, England.

SAMBROOK, J., FRITSCH, E. F., AND MANIATIS, T. (1989). "Molecular cloning, a laboratory manual". Second edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

SANGER, F., NICKLEN, S., AND COULSON, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74, 5463- 5467.

SKUZESKI, J. M., NICHOLS, L. M., AND GESTELAND, R. F. (1990). Analysis of leaky viral translation termination codons in vivo by transient expression of improved b-glucuronidase vectors. Plant Mol. Biol. 15, 65-79. 72

SKUZESKI, J. M., NICHOLS, L. M., GESTELAND, R. F., AND ATKINS, J. F. (1991). The signal for a leaky UAG stop codon In several plant viruses includes the two downstream codons. J. Mot. Biol. 218, 365-373.

SMITH, 0. P., AND HARRIS, K. F. (1990). Potato leaf roll virus 3' genome organization: sequence of the coat protein gene and identification of a viral subgenomic RNA. Phytopathology 80, 609-614.

TACKE, E., PRUFER, D., SALAMINI, F., AND ROHDE, W. (1990). Characterization of a potato leafroll luteovirus subgenomic RNA; differential expression by internal translation initiation and UAG suppression. J. Gen. ViroL 71, 2265-2272.

TACKE, E., PRUFER, D., SCHMITZ, J., AND ROHDE, W. (1991). The potato leafroll luteovirus 17K protein is a single-stranded nucleic acid-binding protein. J. Gen. Virol. 72, 2035-2038.

UENG, P. P., VINCENT, J. R., KAWATA, E. E., LEI, C. H., LISTER, R. M., and LARKINS, B. A. (1992). Nucleotide sequence analysis of the genomes of the MAV-PS1 and P-PAV isolates of barley yellow dwarf virus. J. Gen. ViroL (in press).

VAN DER WILK, F., HUISMAN, M.J., CORNELISSEN, B.J.C., HUTTINGA, H., AND GOLDBACH, R. (1989). Nucleotide sequence and organization of potato leafroll virus genomic RNA. FEBS Lett. 245, 51-56.

VEIDT, I., LOT, H., LEISER, M., SCHEIDECKER, D., GUILLEY, H., RICHARDS, K., AND JONARD, G. (1988). Nucleotide sequence of beet western yellows virus RNA. Nucleic Acids Res. 16, 9917-9932.

VINCENT, J. R., UENG, P. P., LISTER, R. M., AND LARKINS, B. A. (1990). Nucleotide sequences of coat protein genes for three isolates of barley yellow dwarf virus and their relationships to other luteovirus coat protein sequences. J. Gen. ViroL 71, 2791-2799.

VINCENT, J. R., LISTER, R. M., AND LARKINS, B. A. (1991). Nucleotide sequence analysis and genomic organization of the NY-RPV isolate of barley yellow dwarf virus. J. Gen. ViroL, 72, 2347-2355. 73

WADSWORTH, G. J., REDINBAUGH, M. G., AND SCANDALIOS, J. G. (1988). A procedure for the small-scale Isolation of plant RNA suitable for RNA b\QX ^r\B\ys\s. Analytical Biochem. 172, 279-283.

WATERHOUSE, P. M., GERLACH, W. L., AND MILLER, W. A. (1986). Serotype- specific and general luteovirus probes from cloned cDNA sequences of barley yellow dwarf virus. J. Gen. ViroL 67, 1273-1281.

WATERHOUSE, P. M., MARTIN, R. R., AND GERLACH, W. L. (1989). BYDV-PAV virions contain readthrough protein. Phytopathology 79, 1215. (Abstr.).

WEILAND, J. J., AND DREHER, T. W. (1989). Infectious TYMV RNA from cloned cDNA: effects in vitro and In vivo of point substitutions in the initiation codons of two extensively overlapping ORFs. Nucleic Acids Res. 17, 4675-4687.

YOSHINAKA, Y., KATOH, I., COPELAND, T. D., AND OKROSZLAN, S. (1985). Murine leukemia virus protease is encoded by the gag-poi gene and is synthesized through suppression of an amber termination codon. Proc. Natl. Acad. Sci. USA. 82, 1618-1622.

YOUNG, M. J., LARKIN, P. J., MILLER, W. A., WATERHOUSE, P. M., AND GERLACH, W. L. (1989). Infection of Triticum monococcum protoplasts with barley yellow dwarf virus. J. Gen. Viroi. 70, 2245-2251.

YOUNG, M. J., KELLY, L., LARKIN, P. J., WATERHOUSE, P. M., AND GERLACH, W. L. (1991). Infectious in vitro transcripts from a cloned cDNA of barley yellow dwarf virus. Virology 180, 372-379. 74

PAPER II CONTROL OF START CODON CHOICE ON A PLANT VIRAL RNA ENCODING OVERLAPPING GENES 75

Control of start codon choice on a plant viral RNA encoding overlapping genes.

Dinesh-Kumar, S.P., M.S. Miller, W.A., Ph. D.

Plant Pathology Department and Molecular, Cellular, and Developmental Biology Program Iowa State University Ames, Iowa 50011-1020 The signals that control initiation of translation in plants are not well understood. To dissect some of these signals, we used a plant viral mRNA on which protein synthesis initiates at two, out-of-frame start codons. On the large subgenomic RNA (sgRNAD of barley yellow dwarf virus-PAV serotype (BYDV-PAV), the coat protein (CP) and overlapping 17K open reading frames (ORFs) are translated beginning at the first and second AUG codons, respectively. The roles of bases at positions -3 and +4 relative to the AUG codons in efficiency of translation initiation were investigated by translation of sgRNAI mutants in a cell-free extract and by expression of a reporter gene from mutant sgRNAI leaders in protoplasts. The effects of mutations that disrupted and restored secondary structure encompassing the CP AUG independently of, and in combination with, changes to bases -3 and + 4 were also examined. Partial digestion of the 5' end of the sgRNAI leader with structure-sensitive nucleases gave products that were consistent with the predicted secondary structure. Secondary structure had an overall inhibitory effect on translation of both ORFs. In general, the "Kozak rules" of start codon preference predominate in determining start codon choice. Unexpectedly, for a given CP AUG sequence context, changes which decreased initiation at the downstream 17K AUG also reduced initiation at the CP AUG. To explain this observation, we propose a new model in which pausing of the ribosome at the second AUG allows increased initiation at the first AUG. This detailed analysis of the roles of primary and secondary 77

structure in controlling translation initiation should be of value for understanding expression of any plant gene and in the design of artificial constructs. »

INTRODUCTION

Translation can be a major step in the control of eukaryotic gene expression (Kozak, 1991; Merrick, 1992). In plants the control of translation has not been well studied (reviewed by Gallie, 1993). Because most plant viruses have RNA genomes, translation is a particularly important step in regulating gene expression (Sleat and Wilson, 1992). Regulation usually occurs during initiation of translation. According to the scanning model of eukaryotic translation initiation, the 40S ribosomal subunit, with associated factors, binds the m^GpppG cap structure at the 5' end of the mRNA and then scans in the 3' direction until the first AUG is encountered; at this point, translation initiation factor 2 (elF2) escorts the tRNA^et to the AUG codon, the 60S ribosomal subunit binds, and polypeptide synthesis ensues (Kozak, 1989a; Merrick, 1992). Here we define initiation as the steps at which the 60S ribosomal subunit binds and synthesis of the polypeptide chain begins. This is distinct from initiation of 40S subunit binding the mRNA. Translation of 95% of eukaryotic mRNAs initiates at the 5' proximal AUG (Kozak, 1989a). However, certain bases flanking the AUG affect its efficiency as an initiation codon. The most efficient start codons are flanked by a purine, usually adenine, at the -3 position, and a guanine at position + 4, in which the A of the AUG is numbered +1 and bases 5' of this are numbered negatively. These are the most common bases flanking start codons in plant mRNAs (Lutcke, et al., 1987; Cavener and Ray, 1991). If the 5' proximal AUG lacks both of these features, a portion of the scanning 40S subunits may bypass that AUG and initiate at the second AUG If the latter lies in an appropriate context. This process has been dubbed leaky scanning (Kozak, 1986a; 1986b). Leaky scanning has been exploited by simian virus 40 (Sedman and Mertz, 1988), reovirus (Munemitsu and Samuel, 1988), possibly hepatitis B virus (Lin and Lo, 1992), and other vertebrate viruses to regulate translation of truncated or overlapping genes (reviewed by Kozak, 1992). This strategy allows viruses to simultaneously maximize coding capacity from minimal genetic material and to translationally regulate the molar ratios of the gene products. Alteration of the bases at positions -3 and +4 affected relative translation of overlapping reovirus genes as predicted by the leaky scanning model (Munemitsu and Samuel, 1988). Leaky scanning has not been demonstrated in plants. The genome of the PAV serotype of barley yellow dwarf virus (BYDV- PAV) consists of a 5.7-kb RNA encoding at least six open reading frames (ORFs), as shown in Figure 1 A. Three ORFs are expressed from a subgenomic mRNA (sgRNAI), comprising the 3' half of the genome, that is generated in infected cells (Dinesh-Kumar et al., 1992). sgRNAI encodes the coat protein (CP) with a molecular weight of 22,047, an ORF with a molecular weight of 17,147 (17K ORF) that is completely nested within the CP gene, but in a different reading frame, and an ORF with a molecular weight of 49,797 (50K) that is expressed by read-through of the CP stop codon. We showed that the CP and 17K ORFs can be translated in vitro from a single mRNA by initiation at the first two AUG codons (Dinesh-Kumar et al., 1992). The RNAs of other plant viruses, including tymoviruses (Weiland and Dreher, 1989), tombusviruses (Johnston and Rochon, 1990), maize chlorotic mottle virus (Nutter et al., 1989), and other luteoviruses (Veidt et al., 1988; Tacke et al., 1990) also contain overlapping reading frames that are translated by initiation at the first two AUGs of the mRNA. In addition, the 5' proximal AUG is bypassed in favor of a downstream AUG in a more optimal context during translation initiation on RNAs of plum pox virus (Riechmann et al., 1991), maize retroid element Bsl (Jin and Bennetzen, 1989), and some artificial constructs (Hensgens et al., 1992). In all known or suspected cases of initiation at the first two AUGs of a plant viral RNA, the second (5* distal) AUG is in a "better" context (purine at position -3, and/or guanine at +4) than the first AUG (Dinesh-Kumar et al., 1992). This observation supports the notion that leaky scanning occurs. However, the effect of sequence context on start codon choice has not been rigorously examined in plants. In addition to primary structure, several examples exist in which secondary structure 5' of, or including, an AUG inhibits initiation (Kozak, 1989b; Grens and Scheffler, 1990; Fu et al., 1991; Liebhaber et al., 1992). Computer analyses predict that the first (CP) AUG of BYDV-PAV sgRNAI is sequestered in a stem-loop, whereas the second (17K) AUG is in a single- stranded region (Dinesh-Kumar et al., 1992). This observation led us to propose that the secondary structure may inhibit translation initiation at the CP AUG relative to that at the start of the 17K ORF. In this study, we provide evidence for the secondary structure of the 5' end of sgRNAI and its effect on gene expression. We also performed systematic mutagenesis of the -3 and +4 positions flanking both the CP and 17K AUGs and altered the AUG codons themselves. The effects of these mutations on Initiation at each AUG were examined In rabbit reticulocyte lysates (RRL) and by transient expression In oat protoplasts of the Escherichia coli uidA (GUS) gene in frame with either the CP or 17K AUG. Thus, we provide simultaneous comparisons of the effects of primary and secondary structure contexts on translation Initiation at competing AUGs on an mRNA. 82

RESULTS

Figure IB shows the map of previously constructed plasmid pSP17 from which the mRNA encoding the CP and 17K ORFs can be transcribed (Dinesh-Kumar et al., 1992). The resulting transcript has the precise 5' end of the actual sgRNAI that was mapped to base 2769 of the BYDV-PAV genomic RNA. Upon translation in a RRL, both the CP and 17K ORF products accumulated (Dinesh-Kumar et al., 1992).

Effects of mutations near the CP start codon on secondary structure We altered the bases at positions -3 and +4 because those have been shown to have the most influence on start codon efficiency in vertebrates (reviewed by Kozak, 1991), and a purine at position -3 and a guanine at +4 are the most common bases flanking plant start codons (Lutcke, et a!., 1987; Cavener and Ray, 1991). The base changes are shown in Figure 1C. We refer to the presence of an A residue at position -3 and a G at +4 as the optimal context, and U and A at these positions, as is the case with the CP start codon, as the suboptimal context. In mutants Ml, Ml/2, M3, and M8 the bases around the CP AUG were changed from suboptimal to optimal (bases 87 and 93, respectively, when numbered from the 5' end of sgRNAI). With the exception of Ml/2, these changes are also expected to disrupt base pairing around the CP AUG, based on the structure shown in Figure 2. This structure was predicted by the programs STAR (Abrahams et al., 1990) and RNASE (Cedergren et al., 1988) on the full length pSP17 83

R^dthrough Franrwihifl N2!3 i r e.7K L#mky Scanning -•ORNAI -I0RNA2 B pSP17

•gRNA1 start P»tl HIndlll %Q UA^ CP 17K "IRQ

CP ORF M7K ORF 129 SP17 GUGAAUQAA-"-" -CAAAAUQGG Ml Q^QAAUQQA -CAAAAUQGC M2* GUGAAUQAA -CAAAAUQGG Ml/2* QAGAAUQS/k -CAAAAUQGC MS G^GAAUGGA -Cy/kAAUQ^C M4 GUGAAUQAA -Cy/VAAUQAC MS GUGAA£QAA -CAAAAUQGC M6 GUGAACGAA -Cy/VAAUQ^C M7 GUGAAUQAA -CAAAAgpGC M8 GAGAAUQSA -CAAAACpGC M9 GUGAAUQAA -CAAAGCGGC * Mutations not shown: U65-—C and A71-»U Figure 1. Organization of BYDV-PAV sgRNAI and sequences flanicing its first two AUG codons. (A) Genome organization of BYDV-PAV RNA. Locations of unusual translational events (Brault and Miller, 1992; Dinesh- Kumar et al., 1992) are shown. Subgenomic RNAs (sgRNAI and sgRNA2) detected in infected cells but not virions have been mapped previously (Dinesh-Kumaretal., 1992). (B) Map of pSP17 (Dinesh-Kumar et al., 1992). Transcription initiates at the sgRNAI start site immediately adjacent to the T7 polymerase promoter. Bases are numbered from the 5' end of sgRNAI. (C) Mutations flanking CP and 17K ORF start codons. Mutations are underlined. pSP17 is the wild-type in vitro transcription plasmid. Mutations at bases U65 and A71 in M2 and M1/2 are shown in Figure 2. I'

U.Q C-Q A-U

A-U U"AÏ 2 a AM—CP ORF start Q.A-UV y A-"A.ii U-A20 ît?i|C.

30 ti 4Vc-Q~* 110^ g\..Q^ XA^UUAOCUCp'^CAAAUCA^U^^ 3'

SP17 17K ORF Start W \ / W

U-Q u-Q , UQ -f&81 m£S /°A.U* " i>

Ml Ml/2

Figure 2. Nuclease cleavage sites on the predicted secondary structures of the 5' end of sgRNAI. Nuclease-sensitive sites from Figure 3 were superimposed on computer- predicted secondary structures of the 5' ends of mutant and wild-type sgRNAI. Arrows identify sites cleaved by nucleases T1 or T2 (single- stranded). Filled circles show VI cleavage sites (double-stranded). The size of the symbol is proportional to the frequency of cleavage (intensity of band in Figure 3). Only the portions of the mutant transcripts that gave different folding patterns from the wild-type are shown. Bases 1-63 and >98 in all mutants gave patterns identical to the wild-type. transcript. Tlius, differences In translational efficiency in mutant M1 (and M3 and M8) could be due to the effect on immediate sequence context and/or the predicted disruption of the base-paired regions that flank the CP AUG. To distinguish between these two possibilities, a second mutant, M2, was constructed with nucleotides 65 and 71 changed to C and U, respectively. These changes are on the opposite side of the stem from those in M1, thereby causing a similar weakening of secondary structure as in M1, but leaving the wild-type bases at -3 and +4 around the CP AUG. Mutant M1/2, which combines all the mutations in Ml and M2, would have the mutations at positions -3 and +4 as in Ml but is expected to have the wild- type secondary structure. Thus, If the alterations to secondary structure occur as predicted, differences from wild-type start codon efficiency in Ml would be due to primary and/or secondary structure, in M2 it would be due to secondary structure only, and in Ml/2 it would be due to primary structure only. To determine whether the wild-type and mutant transcripts folded as predicted, we treated end-labeled transcripts with structure-sensitive nucleases. The wild-type transcript and mutants Ml, M2, and Ml/2 were digested partially with single strand-specific ribonucleases T1 (cuts after guanosine residues) and T2 (cuts after A>U under our conditions) as well as with nuclease VI which preferentially cuts some but not all phosphodiester bonds of double-stranded regions. To ensure that the structures "seen" by the nucleases were the same as those "seen" by ribosomes, transcripts were digested under the same salt conditions used in the in vitro translation assay »

(Schuiz and Reznikoff, 1990). Comparison of the digestion products with those obtained by nuclease digestion under denaturing conditions, as shown in Figure 3, revealed wide variation In sensitivity of phosphodiester bonds to nuclease. Many bases were not cut by any enzymes, presumably due to steric hindrance by the folded RNA. In Figure 2 the nuclease-sensitive sites are plotted on the predicted structures of the various constructs, indicating that the nuclease-sensitivity correlated closely with the predicted structures. In all transcripts, bases 77-81 were extremely sensitive to single strand-specific nucleases, consistent with their being in a loop. Other predicted single stranded regions also showed sensitivity to nucleases T1 and T2. All bases cut by VI are in predicted helical regions except for bases 38, 134, and 137, which were cut wealdy. The clearest structural differences were reflected in the digestion patterns of G residues by nuclease 71. Bases G68, G92, and G93 became more sensitive to nuclease T1 in Ml, as predicted (arrows. Figure 3). Although G92 and G93 are predicted to be in a helix, it is weaker in Ml (AG =-1.8 kcal/mol) than wild-type (AG = -3.2 kcal/mol) because of the U65-G93 base-pair substitution for the U65-A93 base pair. Therefore, both G residues in Ml are more accessible to T1 nuclease, suggesting that the helix "breathes" or does not exist. In mutant M2, a somewhat greater change is predicted. When compared to the wild- type, this structural change is reflected in greater sensitivity of bases G68 and G92 to T1 (arrows. Figures 2 and 3). Importantly, G92 (the G residue of the CP AUG) was more T1 sensitive in Ml and M2 than in the wild-type or Ml/2. In the regions outside of the predicted changes. Ml and M2 gave Figure 3. Products of partial nuclease digestion of transcripts of wild-type (SP17) and mutants Ml, M2 and M1/2 sgRNAI sequences. After digestion with no nuclease (lanes N), or nucleases T1 (lanes T1), T2 (lanes T2), VI (lanes VI) or fM (lanes f), or with mild alkali (lanes L), products were run on 8% polyacrylamide, 7M urea gels (see Methods). Enzyme digestions were In ionic conditions used for in vitro translation except in lanes marked SEQ, which under denaturing conditions. The nucleotide sequence of the readable portion of the sgRNAI transcript is shown at left of SRI 7 gel. Relevent sequences of mutant transcripts are at right. Prominant bands in the mutants that are absent in SP17 and Ml/2 are marked at left of Ml and M2 gels. Bottom portions of gels of mutant transcript digestions had patterns identical to the wild-type (data not shown). 8 5 8 8 i >5ç>oocoec>o>oo>oooo>ooooo»> co»»cboo> >ccc>o»c»>occco>o>o>oo>oc>e>o>oecooce»co>>cc58 e CO s S g ^ 3 8 8 •a pc>c>ooococ>o>copococopooc>occc : •' ' • I I * & » I I II 1 > • i m i#im ' * I # Il ii.i4 luiin ftiii III •••' til ttiiitl III I . liillltn ilitliUli I

s ô s g ^ g 00 I ! 00 f îf

( I (It ( I I f ill II m I II I I J un m ftii I if ( » I I IMIii«ll II 11. <1B INIn •! lia iwit o-i 3MIM mi i 'iit( (#4 'cioo>o>oic' 'i>o»col? ^»>coo 'i>M>caîd '>»»co 2 2 5 s g g 5 8 8 g nuclease digestion patterns Identical to that of the wild-type transcript. This shows that the mutations introduced no unexpected, long-distance structural changes. The double mutant, M1/2 behaved in a manner identical to the wild-type, which was exactly as predicted. Thus, the structural data obtained on the above mutants agree well with the computer predictions, and we expect that M3 and M8 would also disrupt the secondary structure like M1. Possible alterations to secondary structure by mutations around the 17K AUG cannot be ruled out, as evidenced by the unexpected VI sensitivity of two bases in and near this codon.

Effects of mutations on translation of CP and 17K ORFs in reticulocyte lysates With the secondary structures around the 5' ends of mutant sgRNAs established, we first tested the effects of the base changes on translation in vitro. To facilitate accurate comparisons between reactions, equal amounts of completely intact RNA, shown in Figure 4A, were used as template in all RRL assays. The amount of template (200 ng) should ensure that the mRNA and not some undefined factor was rate limiting in the translation mix. Because the presence of a 5' cap on the transcripts had little effect on translation product amounts or ratios (Dinesh-Kumar et al., 1992), uncapped transcripts were used. The magnesium and potassium concentrations were optimal as determined previously (Dinesh-Kumar et al., 1992). The translation products of the transcripts containing all the mutations shown in Figure 1C are shown in Figure 4B. Histograms of abundance of each band. Figure 4. In vitro translation of In vitro transcripts encoding the CP and AUG ORFs. (A) Ethidium bromide-stained 1% agarose gel of T7 polymerase transcripts obtained from the indicated mutants used for translation in RRL. (B) Fluorograph of RRL translation products of transcripts shown in (A), following electrophoresis on a 12% polyacrylamlde-SDS gel. Mobilities of CP and 17K ORF products are indicated at right. (C) Relative radioactivity measured in bands on gel in (B) by Phosphorlmager and normalized for methionine content. WT, wild- type. »

WT Ml M2M1/2M3 M4 M5 M6 M7 M8 M9 CP/17K! 0.9 6.9 1.9 6.4 11.2 1.2 0.0 - 0.9 9.6 6.1 determined by direct measurement of radioactivity with a Phosphorimager, as well as ratios of CP-to-17K product, are shown in Figure 4C. Two additional repititions of this experiment gave similar results (data not shown). Alteration of the CP AUG context to optimal resulted in increased ratio of CP to 17K products (mutants M1, M1/2, M3, and M8). Mutant M2, in which both AUGs were in wild-type contexts but which weakened base pairing around the CP AUG, gave a similar increase in CP, but an insignificant decrease in 17K protein production relative to the wild-type. In the converse experiment, with the wild-type secondary structure restored but the CP AUG in the optimal context, M1/2 gave the same drastic reduction in 17K product as did Ml alone but gave only wild-type levels of CP. These results suggest that a greater proportion of scanning ribosomes initiated protein synthesis at the first (CP) AUG when it was in a good context, regardless of secondary structure, but that disruption of the secondary structure increased initiation of CP translation regardless of sequence context. With both AUGs in a suboptimal context (M4), translation of both ORFs was halved, maintining the wild-type ratios of CP/17K products. Changing the CP AUG to ACG eliminated initiation at this codon and increased initiation at the 17K AUG (M5). However, combining this mutation with placement of the 17K AUG in a suboptimal context gave no translation products at all (M6). Changing the 17K AUG to ACG, while leaving it and the CP AUG in native contexts (M7), reduced translation of the 17K ORF and the CP ORF by 50%. This mutation, combined with placing the CP AUG in an optimal context (M8), gave higher levels of CP and very little 17K. Finally, to test if 17K initiation could occur at a more extreme deviation from AUG, it was changed to GCG (M9) at which little or no initiation occurred.

Effects of mutations on start codon choice in protopiasts To determine the control of start codon choice in plant cells, the sgRNAI 5' leader, from bases 1 to 170 or 172, was inserted in the £. coH uidA (GUS) gene with either the CP or the 17K AUG In frame with the coding region of the GUS gene, as shown in Figure 5. Expression was driven by a maize alcohol dehydrogenase {Adhi) promoter and first intron (Callis et al., 1987), or by a duplicated cauliflower mosaic virus (CaMV) 35S promoter (Kay et al., 1987), resulting in transcripts containing 141 or 6, respectively, non-viral bases 5' of the start of the sgRNAI leader. For each mutation, two constructs were made, one with the CP AUG in frame with GUS, the other with the 17K AUG In frame. They differ by two bases at the virus-G6/5 sequence fusion that are absent in the 17K constructs (Figure 5B). To verify reproducibility of results, the constructs were tested in duplicate and in more than one experiment, and the insertless vector was used as a positive control for transformation and GUS expression in all experiments, as shown in Table 1. When the wild-type sequence was inserted in pAdhGUS, about half as much b-glucuronidase (GUS) activity was detected in cells containing pCPWT, which has the CP AUG in frame with GUS, as in cells containing pCP17K, which has with the 17K AUG in frame with GUS (Table 1). These constructs gave 63- and 27-fold less GUS activity, respectively, than Figure 5. Vectors for expression of GUS from sgRNAI start codons. (A) Maps of plant expression vectors into which the 5' end of sgRNAI (panel B) was inserted. Black bars (GUS) represent the GUS ORF. 3SS and NOS boxes indicate tandemly repeated CaMV 35S promoter and nos transcription termination sites, respectively. Adhi P and Adhi I indicate the Adhi promoter and first intron, respectively. Arrows below the maps show transcription start sites. The Adhi start codon (ATG) of pAT13 was changed to AGG in pAdhGUS. The multiple cloning site from pAGUSI (Skuzeski et al., 1990) that was inserted into pAT13 contains BamHI (B), Sal! (S), Ncol (N), Hindlll (H) and Apal (A) sites. (B) Sequence of 5' end of sgRNAI inserted in GUS expression vectors between BamHI and Apal sites in pAGUSI or pAdhGUS. Vector-derived bases are in italics. Amino acid sequences of the portions of CP and 17K ORFs Inserted in the vectors are shown, as are the first four amino acids of the GUS ORF (long arrow at bottom). The sequence is shown with CP AUG in frame with the GUS coding region (pCPWT or p35CPWT). The viral bases 171-172 (GU) are absent (D) in plasmids with the 17K AUG in frame with GUS (e.g., p17KWT or p3517KWT). >

Rydthrough Framaihlft i [:;flOK(roL);:i i p 6.7K Laaky Scanning .3' -•gRNAI -•gRNA2 B pSP17

Xba^.agRNAI start PstI HIndIII %Q UAy CP T7 17K mr usa 133

CP ORF 17K ORF 129 SP17 GUGAAUQAA -CAAAAUGGC M1 GAGAAUQGA -CAAAAUQGC M2* GUGAAUQAA -CAAAAUGGC M1/2* GAGAAUQâA -CAAAAUQGC M3 GAGAAUQGA -CUAAAUQAC M4 GUGAAUQAA -CUAAAUQAC M5 GUGAACGAA -CAAAAUQGC M6 GUGAACGAA -CUAAAUQAC M7 GUGAAUQAA -CAAAA£GGC M8 GAGAAUQGA -CAAAAGpGC M9 GUGAAUQAA -CAAAGCGGC

* Mutations not shown: U65*C and A71*U Table 1. Expression of sgRNAI-Gt/S fusions in protoplasts using the Adhi promoter.

Experiment 1 Experiment 2 Experiment 3 GUS GUS GUS CP AUG 17KAUG Piasmid^ units'' CP/17K units CP/17K units CP/17K Salmon Sperm 5 11 7 pADHGUS 13304 16050 12220 pCPWT 212 209 0.46 UGAAUGA AAAAUGG p17KWT 486 0.43 458 pCPMI 1813 1790 56.00 AGAAUGg AAAAUGG P17KM1 40 45.00 32 pCPM2 739 786 UGAAUGAf AAAAUGG P17KM2 1660 0.45 1563 0.50 pCPM1/2 680 588 25.57 AGAAUGgc AAAAUGG P17KM1/2 23 29.57 23 pCPM3 1151 1004 I 92.82 62.75 AGAAUGg UAAAUGA P17KM3 12 16 Î 52 45 0.57 0.52 UGAAUGA UAAAUGA 92 86 pCPM5 8 11 0.01 0.01 UGAAgGA AAAAUGG P17KM5 906 819 18 14 UGAAgGA UAAAUGA 0.14 0.14 a> II 128 105 pCPM7 32 40 3.49 1.50 UGAAUGA AAAACGG P17KM7 9 26 pCPM8 457 539

AAAAgGG I 34.65 26.79 AGAAUGg P17KM8 13 20 I 34 48 UGAAUGA AAAGCGG 5.10 9.41 7 5

^CP or 17K indicates which AUG is in-frame with the GUS coding region. Piasmid maps and sequences of sgRNAl inserts are in Figure 5. All plasmids have the Adhi promoter and first intron. ^Gus units are defined as nanomoles of 4-methyi umbelliferone produced per min per mg protein. All samples except Salmon sperm have had the GUS units obtained in the presence of salmon sperm DNA in that experiment subtracted. All GUS units represent averages from two identically-treated samples. ('Bases at positions -20 and -26 relative to the CP AUG are changed as in Fig. 1C. pAdhGUS that lacked the viral insert, indicating considerable inhibition of GUS expression by the viral insertion. Similar CP/17K AUG initiation ratios (0.4 to 0.5) were obtained whether expression was driven by the Adhi promoter and first intron or the CaMV 35S promoter, although the latter was inhibited less by the insertion of the viral sequence (Table 2). The constant CP/17K ratio, regardless of promoter, indicates that the length of the leader upstream of the viral sequence has little effect on start codon choice. When the CP AUG was in an optimal context and in frame with GUS (pCPIVII, P35CPM1, pCPMI/2, p35CPM1/2, pCPMS and pCPMS, Tables 1 and 2), much higher levels of GUS were obtained than with the wild-type, suboptimal context. Initiation at the CP AUG in mutants Ml, M2 and Ml/2 was five- to ninefold greater than with the wild-type, unlike the RRL results in which a one- to twofold increase was observed. As in RRLs, when the 17K AUG was in frame with GUS in constructs containing the Ml or Ml/2 mutations, the amount of GUS was reduced drastically. The three- to fourfold increase in expression from the CP or 17K AUGs in the M2 mutants shows that relaxation of secondary structure around the CP AUG, with both AUGs in their native contexts, increased expression of GUS initiated at either start codon. The CP/17K AUG initiation ratio was the same as wild-type. Because the effects of mutations on start codon efficiency were similar with both promoters, effects of further mutations were studied in only one vector (pAdhGUS). When the CP AUG was in an optimal context, and the 17K was suboptimal (the opposite of the wild-type situation: mutant MS), initiation Table 2. Expression of sgRNAI -Gt/S fusions in protoplasts using the CaMV 35S promoter.

Seauence context GUS CP AUG 17KAUG Plasmid" units'* CP/17K Salmon Sperm 4 DAGUSI 3506 UGAAUGA AAAAUGG P35CPWT 179 0.51 D3517KWT 348 AGAAUGG AAAAUGG P35CPM1 875 94.59 D3517KM1 9 UGAAUGAC AAAAUGG P35CPM2 786 0.35 D3517KM2 2234 AGAAUGG= AAAAUGG p35CPM1/2 581 36.17 P3517KM1/2 16

"CP or 17K indicates which AUG is in frame with the GUS coding region. Plasmid maps and sequences of sgRNAI inserts are in Figure 5. The 35 indicates that viral sequence was inserted in pAGUS which contains a 35S promoter.

^GUS units are defined as nanomoles of 4-methylumbelliferone produced per min per mg of protein. All samples except salmon sperm have had the GUS units obtained in the presence of salmon sperm DNA in that experiment subtracted. All GUS units represent averages from two identically treated samples.

%ases at positions -20 and -26 relative to the CP AUG are changed as in Fig. 1C. from the 17K AUG was negligible (Table 1), while the CP AUG was fivefold more efficient than it was in the wild-type. With both AUGs in a suboptimal context (M4), the ratios of CP/17K AUG Initiation were unchanged from the wild-type and overall translation from both AUGs was reduced four- to fivefold. Changing the CP AUG to ACG eliminated initiation at that site and doubled levels of GUS activity initiating from the 17K AUG (I\/I5). Combining the CP AUG-to-ACG mutation with placing the 17K AUG in a suboptimal context (M6) reduced Initiation at the 17K AUG to one-eighth the level obtained in with (VIS. There was little or no Initiation at GCG (M9). All the above results agree with those obtained in vitro, but the magnitudes of the effects of mutations were greater In vivo. Protoplast expression differed from RRLs In two other ways: Initiation at ACG failed to occur even In the optimal context of the 17K ORF (IVI7), and (In some cases) the effects of mutations in the 17K AUG context on Initiation at the CP AUG differed (discussed below).

Efficient initiation at the 17K AUG is needed for maximum initiation at the CP AUG In all In vivo assays and In some In vitro assays, any mutation that reduced translation initiation at the 17K start site also reduced initiation of translation at the CP AUG. For example, constructs CPWT, CPM4, CPM7, and CPM9 all have Identical (wild-type) contexts and predicted secondary structure around the CP start codon, differing only In mutations in or flanking the 17K AUG that reduce Initiation at that site. Yet, in all these mutants. translation Initiated at the CP start codon four to sixfold less efficiently than wild-type in vivo, and twofold less efficiently in vitro for all but M9. Similarly, in CPM1, CPM3 and CPM8, the CP AUG is in the optimal context (with corresponding disruption in secondary structure), yet GUS expression when initiated by the CP AUG is substantially lower in M3 and MS, than Ml in vivo. A model to explain these observations is discussed below. 101

DISCUSSION

Differences between cell-free and protoplast assay systems. RRL and transient expression assays each have certain advantages. In RRLs, the full-length CP and 17K genes are translated from a single message and only translational events are observed, but the method suffers from the risic of artifacts induced by salt conditions or loss of important factors during isolation of the cell-free system (Kozak, 1989c). The wild-type CP/17K ratio varies significantly with salt conditions (Dinesh-Kumar et al., 1992). The conditions used here were defined previously as optimal because they permitted efficient readthrough of the CP stop codon as expected, and they minimized initiation at other internal AUGs. Because it may not reflect the natural conditions, we concluded that the in vitro system shows the general trends of the effects of mutations on translation, and what may happen in vivo, but may not be quantitatively accurate. The results of two AUGs competing on a single mRNA are being observed simultaneously in vitro, but initiation at only one at a time is detected in vivo. Presumably, initiation occurs at the out-of-frame AUGs in vivo, resulting in truncated products. In protoplasts, changes in GUS activity due to mutagenesis could result from changes in gene expression at levels other than translation. However, transcriptional effects are unlikely due to the similarity of results obtained with different promoters. Other posttranscriptional variations are unlikely due to the consistency with in vitro results in most constructs. Although only a portion of the viral sequence is present in vivo, this serves as an advantage for studying initation because the same protein (GUS) Is being translated whether the CP or 17K AUG is in frame with GUS. Because differential codon usage in the two ORFs can affect elongation rates of the overlapping ORFs (Fajardo and Shatlcin, 1990), these effects would be seen in the cell-free translation of the in vitro transcript but not in GUS expression in vivo. This may explain why the 17K AUG appears to function more efficiently than the CP AUG in vivo but equal to the CP AUG in vitro; i.e., less efficient elongation in the 17K ORF than the CP ORF would reduce relative levels of 17K product in the RRL. Alternatively, the CP derived amino acids that are fused to GUS may reduce GUS activity more than those derived from the 17K ORF. The fact that the fold increases in initiation at the CP AUG are greater in vivo than in vitro may reflect differences in rate limiting steps, with initiation being rate limiting in vivo and elongation being more limiting in RRLs. These differences are similar to those observed by Kozak (1989b), who showed that effects of alterations to bases flanking start codons were greater in a transient assay in vertebrate ceils than in RRL and by Gallie et al. (1987) and Sleat and Wilson (1992) who found greater enhancement of translation by the tobacco mosaic virus (TIVIV) W sequence in transient expression assays than in RRL. In summary, the in vivo system probably reflects the control of initiation more accurately than RRL (Kozak, 1989c). 103

Effect of secondary structure The nuclease sensitivity results were consistent with the predicted secondary structure of the 5' end of sgRNAI. The fact that the mutations altered the structure only where predicted was important, because unpredicted changes to structure can occur (e.g. Miller and Silver, 1991). Slight weakening of the base pairing without altering the bases immediately flanking the CP AUG (mutant M2) increased translation initiation at that AUG. This agrees with previous observations that stem loops preceding or encompassing a start codon reduces translation efficiency (Kozak, 1988; Rao et al., 1988; Rouault et al., 1988; Yager and Coen, 1988; Liebhaber et al., 1992). In those cases, the stem loops were more stable than those on sgRNAI, but de Smit and van Duin (1990) showed that increasing stabilities of stem loops by as little as 1.4 kcal/mol could drastically decrease initiation of translation in E. coli. In plants, 5' leaders that give highly efficient translation, have little or no secondary structure (Jobiing and Gehrke, 1987; Sleat and Wilson, 1992). Thus, the stem loop at the very 5' end of sgRNAI would be expected to result in a poor template. Consistent with this, insertion of the viral leader in pAdhGUS and pAGUS reduced GUS expression (initiated at the CP AUG) substantially. However, the high-expressing mutant p3517KM2 reduced translation only 1.6-fold relative to the insertless control, even though it has only seven single-stranded bases at the 5' end of the mRNA, prior to the first strong stem-loop. The smaller reduction in GUS activity when driven by the 35S promoter compared to the Adhi promoter differs from observations of Kozak (1989b), who showed that the inhibition 104

of chloramphenicol acetyltransferase gene expression by an artificial stem loop (AG = -30 kcal/mol) was much greater when it was located 12 bases from the 5' end compared to 54 bases away. This may be due to the much more stable stem loop used in that study. The effect of disrupting the 5' proximal stem loop of sgRNAI remains to be tested. Regulation of expression of the CP and 17K ORFs by sequestering of the first AUG in secondary structure does not seem to be a general rule for luteoviral subgenomic RNAs, because such structures are not conserved among luteoviruses (W.A. Miller, unpublished observation). However, such sequestering has also been proposed for the first AUG of kennedya yellow mosaic tymovirus RNA (Ding et al., 1990) in which initiation likely occurs at the first two AUGs. The apparent resemblance of the sgRNAI secondary structure encompassing the CP AUG to a tRNA cloverleaf is of unknown significance. tRNA-like structures serve as origins of replication at the 3' termini of RNAs of viruses in several groups (e.g. Miller et al., 1986). A tRNA-like structure at the 5* end of the E. coli threonyl tRNA synthetase mRNA serves as a signal for feedback inhibition of its own expression (Moine et al., 1990). Because the mRNA mimics tRNA^hr^ the synthetase binds its own mRNA, shutting off translation.

Roles of bases at positions -3 and +4 A purine exists at position -3 in 87%, and a guanine at +4 in 70% of known plant start codons (Cavener and Ray, 1991). The positive effect of A and G at these positions has been demonstrated in transgenic plants (Taylor 105

et al., 1987). Alteration of bases -1 and -2 (McEIroy et al., 1991) or -2, -4, and -5 (Guerineau et al., 1992) in the presence of an A at -3 and a G at +4 had little effect on translation in plants. In the case of BYDV-PAV sgRNAI, the bases at -3 and +4 are much more important than secondary structure in start codon selection. Placing the CP AUG in the optimal context greatly increased the proportion of initiation events at that AUG, regardless of structure. Relative proximity to the 5' end is also important, as significant initiation occurred at the 5' proximal (CP) AUG in the suboptimal context, but only negligibly at the 5' distal 17K AUG in the suboptimal context. These results agree with numerous experiments by Kozak, and on other viral RNAs such as reovirus si RNA which, like BYDV sgRNAI, has two out-of- frame ORFs initiating at the first two AUGs of the RNA (Munemitsu and Samuel, 1988).

Initiation at ACQ Initiation at ACG on M7 RNA in vitro is consistent with other observations in animal (Mehdi et al., 1990; Peabody, 1987) and plant (Schultze et al., 1990) cells. In all examples, initiation at an ACG requires an optimal sequence context and occurs more efficiently in vitro than in vivo. We know of no reports of initiation at GCG.

Ribosome pausing model One unforeseen result was that for a given CP AUG context, the level of initiation at this AUG was reduced if the 17K ORF AUG was in a poor 106

context or eliminated. This reduction is not due to alterations in the CP-GUS fusion, because the single base change: AUG to ACG that eliminated the 17K start codon, did not alter the amino acid sequence of the CP ORF. In the CP ORF, it resulted in a change from AAU to A AC, both of which encode asparagine. Thus we concluded that it is initiation at the CP AUG that is being reduced by negative mutations in and around the 17K AUG. We are unaware of a precedent for initiation at a downstream AUG positively affecting initiation at an upstream AUG. To explain this phenomenon, we propose a model, diagrammed in Figure 6, in which ribosomes pausing at the second AUG enhance initiation at the first AUG. According to this model, the first 40S subunit often scans past the CP AUG until it reaches the 17K start codon, at which the 60S subunit binds and protein synthesis proceeds. The CP AUG would be bypassed for two reasons, first it is in a suboptimal context, second the tendency of the 5' end of sgRNAI to form secondary structure (which is known to reduce initiation: Kozal<, 1989b; Grens and Scheffler, 1990; Fu et al., 1991; Liebhaber et al., 1992), may out-compete the unwinding activity of the 40S subunit and associated factors (elFs 4A, 4B and 4F; Jaramiilo, et al., 1991), causing the 40S subunit to dissociate from the sgRNA. Hence, mutations that reduce secondary structure permit more initiation at the CP AUG. Formation of the 80S complex, or simply pausing of the 40S subunit at the 17K AUG on wild-type sgRNAI, would be expected to melt some of the base pairing upstream of the 17K AUG. Fourteen to 20 bases on either side of the AUG are melted by the 80S complex and are inaccessible to Figure 6. Model for enhancement of translation initiation at the CP AUG by pausing of the ribosome at the 17K AUG. sgRNAI leader structure (Figure 2) is shown as a line with the CP and 17K AUGs in their relative positions. (A) The 40S subunit binds the 5' end of the RNA and scans toward the CP AUG melting secondary structure as* it goes. (B) When the 40S subunit reaches the CP AUG it either (1) dissociates from the RNA due to competing secondary structure (arrow to left), (2) continues scanning due to poor context (arrow to right), or (3) is bound by the 60S subunit and CP synthesis begins (not shown). (C) When a 40S subunit reaches the 17K AUG, it pauses as the 60S subunit binds and the first peptide bond is formed. This keeps the adjacent upstream structure melted, giving the trailing 40S subunit better access to the CP AUG, and momentarily prevents it from continued scanning (striped arrow and vertical bars). (D) The stalled 40S subunit at the CP AUG increases time allowed for it to be bound by the 60S subunit, after which protein synthesis proceeds. I

108

'AUQ

408 B -AUQ •AUQ 408

608

•AUQ' AUG 408 408

608 608

AUG- •AUG 408 408 109

nuclease, during stable monosome formation (Wolin and Walter, 1988; Kozalc, 1989c; Liebhaber et al., 1992). Thus, at least some of the base pairing in the vicinity of the CP AUG would be melted, malcing it more accessible to the next 40S subunit. Scanning ribosomes pause at start codons and trailing ribosomes can stacit up behind a paused ribosome (Doohan and Samuel, 1992; Wolin and Walter, 1988). The first 40S subunit behind the paused 80S complex on the 17K AUG would be located near the CP AUG (43 bases upstream). This slowed-down 40S subunit would have more time to "discover" that it is resting near the CP AUG (which it would have bypassed more frequently, given the poor context) and initiate translation. This is analogous to Kozak's observation that a strong stem loop 14 bases downstream of an AUG, or even GUG or UUG, can increase initiation at that codon, presumably because of the pause in scanning induced by the stem loop (Kozak, 1990a). In support of our interpretation, Doohan and Samuel (1992) observed a pause site 25-30 nucleotides upstream of the second start codon of the dual ORF reovirus si RNA, in addition to the major pause site at the start codon. Pausing at both sites was eliminated when the second start codon was removed. Because the CP AUG is 43 bases upstream of the 17K AUG, perhaps the pausing by the 40S subunit at the 17K AUG, before binding of the 60S subunit, is responsible for increased initiation at the CP AUG because the 40S subunit alone spans about twice as many bases as the 80S subunit (Kozak and Shatkin, 1977; Doohan and Samuel, 1992). Our results lead us to predict that the presence of optimal flanking bases should increase 110

pausing at that AUG. To test this model, ribosomal pause assays need to be performed on the BYDV-PAV sgRNAI mutant and wild-type transcripts.

Regulation of CP and 17K levels In Infected cells The results we have described do not necessarily reflect the ultimate regulation of viral protein levels in infected cells. The relative levels of CP and 17K products during infection are unknown for any luteovirus. In constructs similar to our p35CPWT and p3517KWT, Tacke et al. (1990) found that GUS synthesis initiated from the 17K AUG of potato leafroll luteovirus (PLRV) sevenfold more efficiently than from the PLRV CP AUG, in contrast to the twofold difference we observed. However, the translation efficiencies of the full genes and the stability of their products may differ, f/a/fs-acting viral or virus-induced proteins could also regulate synthesis of these proteins. Because of its function, the CP would be expected to be highly expressed late in infection. Although the function of the 17K ORF is unknown, the homologous protein of PLRV has some properties of the cell- to-cell movement protein of TMV, including the ability to bind single-stranded nucleic acid nonspecifically and a tendency to aggregate (Tacke et al., 1991). Other evidence suggests that it is a 5' genome-linked protein (Keese and Gibbs, 1992). Elucidation of its function would allow better interpretation of the regulation of its expression. Even without this knowledge, our analysis of viral gene expression has allowed a better understanding of translation initiation in plants. From this we uncovered r

111

unexpected interactions between start codons, resulting in a new, testable modification of current models of start codon efficiency in eukaryotes. 112

METHODS

Construction of mutant plasmids for in vitro studies The construction of plasmid pSP17 (Figure IB) has been described previously (Dinesh-Kumar et al., 1992). All mutations listed in Figure 1C were generated by the two-step polymerase chain reaction (PGR) mutagenesis method of Landt et al. (1990) using a mutagenic primer and Ml3 forward and reverse primers as flanking primers. The mutagenic primers and their templates are listed in Table 2. In all cases the PCR- amplified, 825 bp mutagenized fragment was gel purified, digested with Xbai-PstI, and cloned into Xbai-Pstl-cut pUC118. All point mutations were confirmed by plasmid sequencing using a Taq Track sequencing kit (Promega).

Piasmids pAGUSI and pAdhGUS The plasmid pAdhGUS (Figure 5A), was constructed by inserting a multiple cloning site from pAGUSI (a gift from J. Skuzeski, University of Nebraska-Lincoln; Skuzeski et al., 1990) into pAT13 (Figure 5A, a gift from M. Fromm, Plant Gene Expression Center, Albany, CA). pAdhGUS is similar to pAGUSI except that it contains the promoter from a maize alcohol dehydrogenase {Adhi) gene followed by the first intron (Callis et al., 1987). The Adhi initiation codon in pATIS at base 100 of the Adhi mRNA (Dennis et al., 1984; Nick et al., 1986) was changed to AGG in pAdhGUS by PCR mutagenesis using mutagenic primer SPDK7; 5' GGGCAAQGGCGACCGCGG Table 3. Primers and templates used for mutant construction.

Bases Mutant (numbered from generated Template Primer name Sequence^ 5' end of sgRNAI b) (Figure 1C) used

SPDK1: CTGAATÇCATTCICCACCTC 99-80 Ml pSP17 M8 pM7 SPDK2: CTAGTGGAGTCTGGAACT 79-61 M2 pSP17 Ml/2 pMI SPDK3: CTTGTGICATTTAGATTTGCGCGT142-119 M3 pMI M4 pSP17 M6 pM5 SPDK4: CTGAATTCGTTCACCACC 99-82 M5 pSP17 SPDK5: CTTGTGCCGTTTTGATTTGC 142-124 M7 pSP17 SPDK6: CTTGTGCCGÇTTTGATTTGC 142-124 M9 pSP17

^Sequence is in 5' to 3' direction with mismatches to the wild-type sequence underlined.

^All primers are complementary to the viral coding sequence. Numbering is from the

5' end of sgRNAI (base 2769 in viral genome). »

114

3\ which anneals to bases 95-112 from the transcription start site. This resulted in the ATG In the introduced Ncol site (with no Insert) or any ATG introduced into the multiple cloning site (with concomitant removal of the Ncol site) encoding the first AUG on the GUS mRNA.

Construction of CP/17K-GC/S fusions The wild-type and mutant CP or 17K ORFs containing the first 170- 172 bases of sgRNAI were fused to GUS in pAdhGUS or pAGUSI so that either the CP AUG or the 17K AUG was in frame with GUS. The CP AUG In- frame series of plasmids was generated by PCR using upstream primer SPDK8 (5'-CGGG^7CCGATAGGGTTTATAGTTAGTA-3'), which contained a BamHI site (italics) and sgRNAI bases 1-20, and downstream primer SPDK9 (3'-TCTTGTCAAGCCGGTCACCCGGGGAT-5') which contained sgRNAI bases 156-172 and an Apal site (italics) with constructs used in in vitro studies as templates. The 17K AUG in-frame series was constructed using the upstream primer SPDK8 with the downstream primer SPDK10 (3'- TCTTGTCAAGCCGGTCCCGGGAT-5'). This primer differs from SPDK9 only in lacking two bases complementary to the end of the viral insert (nucleotides 171-172 of sgRNAI) adjacent to the Apal site (italics). In both cases the PCR-amplified fragments were digested with BamHI and Apal and cloned into BamHI-Apal-cut pAdhGUS or pAGUSI. All constructs were verified by sequencing the entire insert. 115

In vitro transcription and translation RNA was transcribed from Hindlll-linearized wild-type and mutant plasmids using T7 RNA polymerase as described previously (Dinesh-Kumar et al., 1992). Two hundred nanograms of intact transcripts were translated, and the products were analyzed electrophoretically as described previously (Laemmli, 1970; Dinesh-Kumar et al., 1992) using nuclease-treated rabbit reticulocyte lysate (RRL) (Promega) in the presence of ^^S-labelled methionine. The concentrations of magnesium chloride and potassium acetate were adjusted to 1.9 and 159mM, respectively. Relative amounts of translation products were quantified using a Molecular Dynamics Phosphorimager 400E (Sunnyvale, CA). The ratios of CP to 17K products were determined after adjusting for number of methionine residues in the products (4 in CP, 3 in the 17K ORF).

Secondary structure mapping Unlabeled, sgRNAI transcripts containing nucleotides 1-217 were transcribed from plasmids pWT, pMI, pM2 and pM1/2 after linearizing with Sail. These transcripts were 5' end-labeled with y-^^P-ATP and gel purified as described by Miller and Silver (1991). Partial digestions with 0.05 units of T1 (Gibco-BRL), 0.05 units of T2 (Gibco-BRL), or 0.05 units of VI (Pharmacia) nucleases were performed in 5 ^1 reactions containing approximately 10,000 cpm of gel-purified, end-labeled RNA, 5 ng yeast tRNA, 50mM Tris, pH 8.0, 1.9 mM MgCl2» 159 mM potassium acetate. Reactions were incubated for 10 min at 37°C and terminated by adding an 116

equal volume of 7M urea, 30mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol solution and freezing at -80°C. Products were electrophoresed on 8% polyacrylamlde, 7M urea gels. For size markers, transcripts were sequenced under denaturing conditions using 1 unit of T1 or 0.5 units of fM (cuts A>U) nucleases, as described previously (Miller and Silver, 1991), or they were partially hydrolyzed with sodium carbonate.

Protoplast transformation and GUS assay Protoplasts were isolated from Avena sativa (cv. Stout) suspension culture (cell line S226 obtained from H. Rines, U.S. Department of Agriculture Agricultural Research Service, University of Minnesota, St. Paul) using the procedure described previously (Dinesh-Kumar et al., 1992) as improved by Higgs and Colbert (1993). Approximately 1x10® protoplasts and exactly 80 mg of plasmid DNA or carrier DNA (salmon sperm) were mixed in electroporation buffer (Fromm, et al., 1987). Samples were electroporated by delivering one pulse at 450V and 500^F capacitance using a Bio-Rad Gene Puiser. Electroporated protoplasts were incubated in the dark at room temparature for 24 hr before collection for analysis. GUS activity was determined as described by Jefferson (1987) using a Hitachi F- 2000 fluorescence spectrophotometer. Protein concentrations were determined using the Bio-Rad (Richmond, CA) Bradford Protein Assay kit. Each construct was assayed in duplicate at least in two separate experiments with different batches of protoplasts. 117

ACKNOWLEDGMENTS

The authors thank David Higgs for advice on electroporation of oat cells, Jim Skuzeski for providing pAGUSI, and Mike Fromm and the U.S. Department of Agriculture, Plant Gene Expression Center, Albany, CA for pAT13. This work was funded by USDA National Research Initiative Grant no. 91-37303-6424 and a McKnight Foundation Individual Investigator Research Award in Plant Biology (to WAM). This is paper no. J-15299 of the Iowa Agriculture and Home Economics Experiment Station. Project number 2936. 118

REFERENCES

Abrahams, J.P., van den Berg, M., van Batenburg, E., PleiJ. C. (1990). Prediction of RNA secondary structure, including pseudoknotting, by computer simulation. Nucl. Acids Res. 18, 3035-3044.

Califs, J., Fromm, M., and Waibot, V. (1987). Expression of mRNA electroporated into plant and animal cells. Nucl. Acids Res. 15, 5823- 5831.

Cavener, D R., and Ray, S C. (1991). Eukaryotic start and stop translation sites. Nucl. Acids Res. 19, 3185-3192.

Cedergren, R., Gautheret, D., Lapalme, G., and Major, F. (1988). A secondary and tertiary structure editor for Nucl. Acids. CABIOS 4, 143- 146. de Smit, M.H., and van Duin, J. (1990). Secondary structure of the ribosome binding site determines translational efficiency: a quantitative analysis. Proc. Natl. Acad. Sci. USA 87, 7668-7672.

Dennis, E.S., Gerlach, W.L., Pryor, A.J., Bennetzen, J.L., Inglis, A., Llewellyn, D., Sachs, M.M., Ferl, R.J., and Peacock, W.J. (1984). Molecular analysis of the alcohol dehydrogenase (Adhi) gene of maize. Nucl. Acids Res. 12, 3983-4000.

Dinesh-Kumar, S.P., Brault, V., and Miller, W.A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Virology 187, 711-722.

Ding, S., Keese, P., and Gibbs, A. (1990). The nucleotide sequence of the genomic RNA of kennedya yellow mosaic tymovirus-Jervis Bay isolate: relationships with potex- and carlaviruses. J. Gen. Virology 71, 925-931.

Doohan, J.P., and Samuel, C.E. (1992). Biosynthesis of reovirus-specified polypeptides: ribosome pausing during the translation of reovirus SI mRNA. Virology 186, 409-425. 119

Fajardo, J E., and Shatkin, A.J. (1990). Translation of bicistronic viral mRNA in transfected cells: regulation at the level of elongation. Proc. Natl. Acad. Sci. USA 87, 328-332.

Fromm, M., Callls, J., Taylor, L.P., and Walbot, V. (1987). Electroporation of DNA and RNA into plant protoplasts. Methods Enzymol. 153, 351-366.

Fu, L., Ye, R., Browder, L.W., and Johnston, R.N. (1991). Translational potentiation of messenger RNA with secondary structure in Xenopus. Science 251, 807-810.

Futterer, J., Gordon, K., Sanfacon, H., Bonneville, J.M., and Hohn, T. (1990). Positive and negative control of translation by the leader sequence of cauliflower mosaic virus pregenome 35S RNA. EMBO J. 9, 1697-1707.

Gallle, D R. (1993). Posttranscriptional regulation of gene expression in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44 (In press).

Gallle, D.R., Sleat, D.E., Watts, J.W., Turner, P.C., and Wilson, T.M.A. (1987). The 5'-leader sequence of tobacco mosaic virus RNA enhances the expression of foreign gene transcripts in vitro and in vivo. Nucl. Acids Res. 15, 3257-3273.

Grens, A., and Scheffler, I.E. (1990). The 5'- and 3'- untranslated regions of ornithine decarboxylase mRNA affect the translational efficiency. J. Biol. Chem. 265, 11810-11816.

Guerlneau, F., Lucy, A., and Mulllneaux, P. (1992). Effect of two consensus sequences preceding the translation initiator codon on expression in plant protoplasts. Plant Mol. Biol. 18, 815-818.

Hensgens, L.A.M., Fornerod, M.W.J., Rueb, S., Winkler, A.A., van der Veen, S., and Schilperoort, R.A. (1992). Translation controls the expression level of a chimaeric reporter gene. Plant Mol. Biol. 20, 921- 938.

Hlggs, D.C., and Colbert, J.T. (1993). b-glucuronidase gene expression and mRNA stability in oat protoplasts. Plant Cell Reports (In press). 120

Jaramillo, M., Dever, T.E., Merrick, W.C., and Sonenberg, N. (1991). RNA unwinding in transiation: assembly of helicase complex intermediates comprising eukaryotic Initiation factors elF-4F and elF-4B. IVIol. Cell. Biol. 11, 5992-5997.

Jefferson, R.A. (1987). Assaying chimeric genes in plants: the GUS gene fusion system. Plant IVIol. Biol. Rep. 5, 387-405.

Jin, Y.-K., and Bennetzen, J.L. (1989). Structure and coding properties of Bsl, a maize retrovirus-like structure. Proc. Natl. Acad. Sci. USA 88, 6235-6239.

Jobling, S.A., and Gehrke, L. (1987). Enhanced translation of chlmaeric messenger RNAs containing a plant viral untranslated leader sequence. Nature 325, 622-625.

Johnston, J.C., and Rochon, D.M. (1990). Translation of cucumber necrosis virus RNA in vitro. J. Gen. Virol. 71, 2233-2241.

Kay, R., Chan, A., Daly, iVI., and IVIcPherson, J. (1987) Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236, 1299-1302.

Keese, P.K., and Gibbs, A. (1992). Origins of genes: "Big bang" or continuous creation? Proc. Natl. Acad. Sci. USA 89, 9489-9493.

Kozak, IVI. (1986a). Bifunctional messenger RNAs in eukaryotes. Cell 47, 481-483.

Kozak, M. (1986b). Regulation of protein synthesis in virus-infected animal cells. Adv. Virus Res. 31, 229-292.

Kozak, M. (1988). Leader length and secondary structure modulate mRNA function under conditions of stress. Mol. Cell. Biol. 8, 2737-2744.

Kozak, M. (1989a). The scanning model for translation: an update. J. Cell Biol. 108, 229-241.

Kozak, M. (1989b). Circumstances and mechanisms of inhibition of translation by secondary structure in eukaryotic mRNAs. IVIol. Cell. Biol. 9, 5134-5142. 121

Kozak, M. (1989c). Context effects and inefficient initiation at non-AUG codons in eukaryotic cell-free translation system. Mol. Cell. Biol. 9, 5073- 5080.

Kozak, M. (1990a). Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes. Proc. Natl. Acad. Scl. USA 87. 8301-8305.

Kozak, M. (1990b). Evaluation of the fidelity of initiation of translation In reticulocyte lysates from commercial sources. Nucl. Acids Res. 18, 2828.

Kozak, M., and Shatkin, A.J. (1977). Sequences of two 5'-termlnal ribosome-protected fragments from reovirus messenger RNAs. J. Mol. Biol. 112, 75-96.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227, 680-685.

Landt, 0., Grunert, H.-P., and Hahn, U. (1990). A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene 96, 125-128.

Llebhaber, S.A., Cash, F., and Eshleman, S.S. (1992). Translation inhibition by an mRNA coding region secondary structure is determined by its proximity to the AUG initiation codon. J. Mol. Biol. 226, 609-621.

Lin, C.-G. and Lo, S.J. (1992). Evidence for involvement of a ribosomal leaky scanning mechanism in the translation of the hepatitis B virus po! gene from the viral pregenome RNA. Virology 188, 342-352.

Lutcke, H.A., Chow, K.C., Mickel, F.S., Moss, K.A., Kern, H.F., and Scheeler, G.A. (1987). Selection of AUG initiation codons differs in plants and animals. EMBO J. 6, 43-48.

McElroy, D., Blowers, A.D., Jenes, B., and Wu, R. (1991). Construction of expression vectors based on the rice actin 1 (Acti) 5' region for use in monocot transformation. Mol. Gen. Genet. 231, 150-160.

Mehdi, H., Ono, E., and Gupta, K.C. (1990). Initiation of translation at CUG, GUG, and ACG codons in mammalian cells. Gene 91, 173-178. »

122

Merrick, W.C. (1992). Mechanism and regulation of eukaryotic protein sysnthesis. Microbiol. Rev. 56, 291-315.

Miller, W.A., and Silver, S.L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucl. Acids Res. 19, 5313-5320.

Miller, W. A., BuJarskI, J. J., Dreher, T.W., and Hall, T.C. (1986). Minus strand initiation by brome mosaic virus replicase within the 3' tRNA-IIke structure of native and modified RNA templates. J. Mol. Biol. 187, 537- 546.

Molne, H., Romby, P., Springer, M., Grunberg-Manago, M., Ebel, J-P., Ehresmann, B., and Ehresmann, C. (1990). Escherichia coli threonyl-tRNA synthetase and tRNA^hr modulate the binding of the ribosome to the translational initiation site of the ThrS mRNA. J. Mol. Biol. 216, 299-310.

Munemltsu, S.M., and Samuel, C.E. (1988). Biosynthesis of reovirus- specified polypeptides: effect of point mutation of the sequences flanking the 5'-proximal AUG initiation codons of the reovirus 81 and 84 genes on the efficiency of mRNA translation. Virology 163, 643-646.

Nick, H., Bowen, B., Ferl, R.J., and Gilbert, W. (1986). Detection of cytosine methylation in the maize alcohol dehydrogenase gene by genomic sequencing. Nature 319, 243-246.

Nutter, R.C., Scheets, K., Panganiban, L.C., and Lommel, S.A. (1989). The complete nucleotide sequence of the maize chlorotic mottle virus genome. Nucl. Acids Res. 17, 3163-3177.

Peabody, D.S. (1987). Translation initiation at an ACG triplet in mammalian cells. J. Biol. Chem. 262, 11847-11851.

Rao, C.D., Pech, M., Robbins, K.C., and Aaronson, S.A. (1988). The 5' untranslated sequence of the c-s/s/platelet-derived growth factor 2 transcript is a potent translational inhibitor. Mol. Cell. Biol. 8, 284-292.

Riechmann, J.L., Lain, S., Garcia, J.A. (1991). Identification of the initiation codon of plum pox potyvirus genomic RNA. Virology 185, 544-552. 123

Rouault, T A., Hentze, M.W., Caughman, S.W., Harford, J.B., and Klausner, R.D. (1988). Binding of a cytosolic protein to the iron-responsive eiement of human ferritin messenger RNA. Science 241, 1207-1210.

Schultze, M., Hohn, T., and Jiricny, J. (1990). The reverse transcriptase gene of cauiifiower mosaic virus is translated separately from the capsid gene. EMBO J. 9, 1177-1185.

Schuiz, V.P., and Reznikoff, S. (1990). In vitro secondary structure analysis of mRNA from /acZ translation initiation mutants. J. Mol. Biol. 211, 427- 445.

Sedman, S., and Mertz, J. (1988). Mechanisms of synthesis of virion proteins from the functionally bigenic late mRNAs of simian virus 40. J. Virol. 62, 954-981.

SkuzeskI, J.M., Nichols, L.M., and Gesteland, R.F. (1990). Analysis of leaky viral translation termination codons in vivo by transient expression of improved b-glucoronidase vectors. Plant Mol. Biol. 15, 65-79.

Sleat, D.E., and Wilson, T.M.A. (1992). Plant virus genomes as sources of novel functions for genetic manipulations. In Genetic Engineering with Plant Viruses, T.M.A. Wilson and J.W. Davies, eds (Boca Raton, FL: CRC Press), pp. 55-113.

Tacke, E., Prufer, D., Salamini, F., and Rohde, W. (1990). Characterization of a potato leafroll luteovirus subgenomic RNA: differential expression by internal translation initiation and UAG suppression. J. Gen. Virol. 71, 2265-2272.

Tacke, E., Prufer, D., Schmltz, G., and Rohde, W. (1991). The potato leafroll luteovirus 17K is a single-stranded nucleic acid-binding protein. J. Gen. Viroi. 72, 2035-2038.

Taylor, J.L., Jones, J.D.G., Sandler, S., Mueller, G.M., Bedbrook, J., and Dunsmuir, P. (1987). Optimizing the expression of chimeric genes in plant ceils. Mol. Gen. Genet. 210, 572-577.

Veldt, I., Lot, H., Leiser, M., Scheidecker, D., Guilley, H., Richards, K., and Jonard, G. (1988). Nucleotide sequence of beet western yellows virus RNA. Nucl. Acids Res. 16, 9917-9932. 124

Weiland, J. and Dreher, T.W. (1989). Infectious TYMV RNA from cloned cDNA: effects in vitro and in vivo of point substitutions in the initiation codons of two extensively overlapping ORFs. Nucl. Acids Res. 17, 4675- 4687.

Wolin, S.L., and Walter, P. (1988). Ribosome pausing and stacking during translation of a eukaryotic mRNA. EMBO J. 7, 3559-3569.

Yager, D R., and Coen, D.M. (1988). Analysis of the transcript of the herpes simplex virus DNA polymerase gene provides evidence that polymerase expression is inefficient at the level of translation. J. Virol. 62, 2007- 2015. 125

GENERAL SUMMARY

Barley yellow dwarf virus (BYDV-PAV serotype) has a positive sense, 5.7 kb RNA genome encoding at least six open reading frames (ORFs). BYDV uses variety of unusual mechanisms for translation of its genes. These include frameshifting in the polymerase gene, translation of internal gene via. subgenomic RNAs, leaky scanning at the AUGs of the overlapping coat protein (CP) and 17K ORFs, and readthrough of the CP stop codon. In course of this research I have addressed several questions relating to the gene expression strategies of luteoviruses, with specific emphasis on BYDV-PAV. In the first part of my work showed that the BYDV uses subgenomic RNAs to express its internal genes. It generates two subgenomic RNAs in infected plants and protoplasts. I mapped the 5' end of the large subgenomic RNA (sgRNAD to base 2769 using northern hybridization, primer extension and RNase protection methods. Using synthetic transcripts generated from in vitro transcription I first demonstrated that the sgRNAI serves as a tricistronic message, to express CP, 17K and readthrough proteins in vitro. The CP and overlapping 17K ORFs are translated by initiation at two out-of-frame AUGs, and the 50K ORF by in- frame readthrough of the CP stop codon. In the second part of my research, I used CP/17K overlapping reading frames to understand the role of sequences and structures on translation initiation process in plants. In all luteoviruses the 17K open reading frame is embedded with in the coat protein reading frame. The 17K start codon of 126

BYDV-PAV is 43 bases downstream of the CP start codon. The 17K ORF start codon is in the better sequence context compared to the CP start codon and the CP start codon is sequestered with in the stem loop structure at the 5' end of the sgRNAI. I performed systematic mutagenesis to study the effect of start codon fianlting bases and secondary structure on expression of coat protein and 17K ORF. Both in vitro and in vivo, changing the CP start codon context to the optimal resulted in increased initiation at the CP AUG compared to wildtype sequence. Disruption of secondary structure increased expression of both CP and 17K ORFs irrespective of the sequence context and the ratio of the two products was unaltered. These results indicated that the Kozak's leaky scanning mechanism operates also in plants. This is also the first study of simultaneous comparisons of the effects of primary and secondary structure contexts on translation initiation at competing AUGs on an mRNA. Surprisingly any mutations that changed the 17K start codon or its flanking bases into suboptimal context greatly reduced initiation at the CP AUG irrespective of its context. To explain this unusual phenomenon we proposed a new model, in which pausing of ribosomes at the 17K AUG promotes initiation at the CP AUG (see Figure 6 of Paper II of this thesis for details). Recent studies on initiation of translation of the overlapping reading frames on reovirus si RNA support our model (Doohan and Samuel, 1993). Both in vitro and in vivo, ribosomes paused at the start codon and more pausing was observed at the start codon flanked by optimal bases than the AUG in the suboptimal context. Secondary pause sites between the two 127

start codons were observed only in case of overlapping reading frames, whereas in the monoclstronic s4 message ribosomes were uniformly distributed. Application of these ribosome pause assays to luteoviral mRNAs will shed light on regulation of synthesis of CP and 17K ORF in luteovirus and on initiation of translation in plants in general. The above observations of BYDV-PAV have implications on expression of CP in transgenic plants to achieve coat-protein mediated resistance against luteoviruses. In transgenic potato plants expressing an mRNA encoding the overlapping CP and 17K ORFs, coat protein expression was so low as to be barely detected if at all (Kawchuk et al., 1990; Turner, et al., 1991; Barker 1992). in some cases, the plants were virus-resistant, but it is not clear whether the resistance was due to the CP or 17K products or both (Miller and Young, 1994). To assure expression of CP only, transgenic potato plants were engineered which expressed a mutant in which the 17K start codon was deleted (Tumer et al., 1991). Even with this construct, the level of expression of CP was low. Based on my results (paper II of this thesis), any change to the 17K start codon or its context has a direct effect on the expression of CP. Hence, we predict that changing the CP start codon context into optimal sequence while keeping the 17K start codon in its native (optimal) context is necessary to achieve maximum expression of coat protein in transgenic plants. It is important to determine the efficiency of CP and 17K translation in the natural viral context. Such a study has not been done in any luteoviruses. I introduced all the mutations discussed in the paper II of this 128

thesis into full-length infectious clone of BYDV-PAV. I have also generated the antibody to 17K protein, which was expressed in E.coU. These tools will facilitate further understanding of expression of these proteins during infection. I constructed a full-length infectious clone of BYDV-PAV. This clone is highly infectious compared to the one which Is previously published (Young et al., 1991 and pers. communication). The full-length infectious clone was used to demonstrate the requirement of the 39K ORF stop codon at the 3' end of the shifty heptanucleotide. Several deletion mutants were generated to elucidate the function of different ORFs of BYDV-PAV genome. Current studies indicate that the 0RF1, 0RF2 and 1150 nucleotide at the 3' end of the genome or 0RF6 are necessary for BYDV-PAV replication. I have created several mutants of BYDV-PAV genome, this will facilitate understanding replication of BYDV-PAV. Sequences involved in the luteovirus group of readthrough signal has not been studied so far. In my recent experiments I was able to show readthrough of the CP stop codon in vivo, by inserting GUS reporter gene into the full-length BYDV-PAV genome. Such a strategy has been used in other plant viruses to study replication and movement. The constructs containing GUS will provide a guide for mutagenesis studies aimed at elucidating the mechanism of readthrough for the luteovirus class. In addition, these constructs can be used to study luteovirus movement in the plant cells. This will be interesting because luteoviruses are confined to phloem tissues in the infected plants. This can also be used as a vector to 129

express useful products. Such strategy has been demonstrated using TMV readthrough signal to produce Angiotensin-l-converting enzyme (ACE!) peptide, which is found in the tryptic hydroiysate of miiic casein (Hamamoto et. al., 1993). 130

REFERENCES

Adam, G., Sander, E., and Shepherd, R. J. (1979). Structural differences between pea enatlon mosaic virus strains affecting transmissibility by Acyrthosiphon pisum (Hqt'c\s). Virology, 92, 1-14.

Ahlquist, P., French, R., Janda, M., and Loesch-Frles, L. S. (1984). Multicomponent RNA plant virus infection derived from cloned viral cDNA. Proc. Natl. Acad. Set. USA, 81, 7066-7070.

Allison, R. F., Janda, M., and Ahlquist, P. (1988). Infectious in vitro transcripts from Cowpea Chlorotic Mottle Virus cDNA clones and exchange of individual RNA components with Brome Mosaic Virus. J. Virology, 62(10), 3581-3588.

Atkins, J. F., Weiss, R. B., and Gesteland, R. F. (1990). Ribosome gymnastics - degree of difficulty 9.5, style 10.0. Cell, 62, 413-423.

Bahner, I., Lamb, J., Mayo, M. A., and Hay, R. T. (1990). Expression of the genome of potato leafroll virus: readthrough of the coat protein termination codon in vivo. J. Gen. Virol., 71, 2251-2256.

Barker, H., Reavy, B., Kumar, A., Webster, K.D., and Mayo, M.A. (1992). Restricted virus multiplication in potatoes transformed with the coat protein gene of potaot leafroll luteovirus: similarities with a type of host gene-mediated resistance. Arinals of Applied Biology, 120, 55- 64.

Barker, H., and Harrison, B. D. (1982). Infection of potato mesophyll protoplasts with five plant viruses. Plant Cell Rep., 1, 247-249.

Bouzoubaa, S., Ziegler, V., Beck, D., Guilley, H., Richards, K., and Jonard, G. (1986). Nucleotide sequence of beet necrotic yellow vein virus RNA-2. J. Gen. Virol., 67, 1689-1700.

Brault, v., and Miller, W. A. (1992). Translational frameshifting mediated by a viral sequence in plant cells. Proc. Natl. Acad. Sci. USA, 89, 2262- 2266. 131

Brown, C. M., Stockwell, P. A., Trotman, C. N. A., and Tate, W. P. (1990). Sequence analysis suggests that tetra-nucleotides signal the termination of protein synthesis in eukaryotes. Nucleic Acids Res., 18, 6339-6345.

Carrington, J. C., Heaton, L. A., Zuidema, D., Hillman, B. I., and Morris, T. J. (1989). The genome structure of turnip crinkle virus. Viroiogy, 170, 219-226.

Cavener, D. R., and Ray, S. C. (1991). Eukaryotic start and stop translation sites. Nucleic Acids Res., 19, 3185-3192.

Chambers, I., Frampton, J., Goldfarb, P., Affara, N., McBain, W., and Harrison, P. R. (1986). The structure of the moust glutathione peroxidase gene; the selenocysteine in the active site is encoded by the termination codon, UGA. EMBO J, 5, 1221-1227.

Chamorro, M., Parkin, N., and Varmus, H. E. (1992). An RNA pseudoknot and an optimal heptameric shift site are required for highly efficient ribosomal frameshifting on a retroviral messenger RNA. Proc. Natl. Acad. Sci., USA, 89, 713-717.

Chin, L.-S., Foster, J. L., and Falk, B. W. (1993). The beet western yellows virus ST9-associated RNA shares structural and nucleotide sequence homology with carmo-like viruses. Virology, 192, 473-482.

Citovsky, V., Knorr, D., Schuster, G., and Zambryski, P. (1990). The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell, 60, 637-647.

Citovsky, v., McLean, G., Zupan, J. R., and Zambryski, P. (1993). Phosphorylation of tobacco mosaic virus cell-to-cell movement protein by a developmentally regulated plant cell wall-associated protein kinase. Genes and Dev., 7, 904-910.

Conti, M., D'Arcy, C. J., Jedlinski, H., and Burnett, P. A. (1990). The "Yellow plague" cereals, barley yellow dwarf virus, in "World perspectives on barley yellow dwarf" (P.A. Burnett, edj, 1-6.

D'Arcy, C. J. D. (1986). Current problems in the taxonomy of luteoviruses. Microbiological Sciences, 3, 309-313. »

132

Dawson, W. O., Beck, D. L., Knorr, D. A., and Grantham, G. L. (1986). cDNA cloning of the complete genome of tobacco mosaic virus and production of Infectious transcripts. Proc. Natl. Acad. Sci. USA, 83, 1832-1836.

Dawson, W. 0., Lewandowski, D. J., Hilf, M. E., Bubrick, P., Raffo, A. J., Shaw, J. J., Grantham, G. L., and Desjardins, P. R. (1989). A tobacco mosaic virus-hybrid expresses and loses an added gene. Virology, 172, 285-292.

de Zoeten, G. A., and Gaard, G. (1983). Mechanism underlying systemic invasion of pea plants by pea enation mosaic virus. Intervirology, 19, 85-94.

Demler, S. A., and de Zoeten, G. A. (1991). The nucleotide sequence and luteovirus-like nature of RNA1 of an aphid non-transmissible strain of pea enation mosaic virus. J. Gen. Virol., 72, 1819-1834.

Demler, S. A., Pucker, D. G., and de Zoeten, G. A. (1993). The chimeric nature of the genome of pea enation mosaic virus; the Independent replication of RNA2. J. Gen. Virol., 74, 1-14.

Deom, C. M., Schuber, K. R., Wolf, S., Holt, C. A., Lucas, W. J., and Beachy, R. N. (1990). Molecular characterization and biological function of the movement protein of tobacco mosaic virus in transgenic plants. Proc. Natl. Acad. Sci. USA, 87, 3284-3288.

Di, R., Dinesh-Kumar, S. P., and Miller, W. A. (1993). Translational frameshifting by barley yellow dwarf virus (PAV serotype) in Escherichia coil and In eukaryotic cell-free extracts. Mol. Plant Microbe interac., 6, 444-452.

Dinesh-Kumar, S. P., Brault, V., and Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Virology, 187, 711-722.

Dinesh-Kumar, S. P., and Miller, W. A. (1993). Control of start codon choice on a plant viral RNA encoding overlapping genes. Plant Cell, 5, 679- 692. »

133

Ding, S., Keese, P., and Gibbs, A. (1989). Nucleotide sequence of the genome of ononis yellow mosaic tymovirus. Virology, 172, 555-563.

Dinman, J. D., and Wickner, R. B. (1992). Ribosomal frameshifting efficiency and gag/gag-pol ratio are critical for yeast Ml double-stranded RNA virus propagation. J. Virol., 66, 3669-3676.

Doija, v., McBride, H. J., and Carrington, J. C. (1992). Tagging of plant potyvirus replication and movement by insertion of b-glucuronidase into the viral polyprotein. Proc. Nati. Acad. Sci. USA, 89, 10208- 10212.

Domier, L. L., Franklin, K. M., Hunt, A. G., and Rhoads, R. E. (1989). Infectious in vitro transcripts from cloned cDNA of a potyvirus, tobacco vein mottling virus. Proc. Nati. Acad. Sci. USA, 86, 3509- 3513.

Domier, L. L., Lukasheva, L. I., and D'Arcy, C. J. (1992). Variability among isolates of BYDV-RMV. Phytopathology, 82, 1175 (Abstr.).

Donly, B. C., Edgar, C. D., Adamski, F. M., and Tate, W. P. (1990). Frameshift autoregulation in the gene for Escherichia coll release factor 2: partly functional mutants result in frameshift enhancement. Nucleic Acids Res., 18, 6517-6522.

Doohan, J. P. , and Samuel, C. E. (1993). Biosynthesis of reovirus-specified polypeptides: analysis of ribosome pausing during translation of reovirus SI and S4 mRNAs in virus-infected and vectro-transfected cells. J. Biol. Chem., 268, 18313-18320.

Esau, K., and Hoefert, L. L. (1972). Development of infection with beet western yellow virus in the sugarbeet. Virology, 48, 724-738.

Feng, Y. A., Yuan, H., Rein, A., and Levin, J. G. (1992). Bipartite signal for read-through suppression in murine leukamia virus mRNA: an eight- nucleotide purine-rich sequence immediately downstream of the gag 134

termination codon followed by an RNA pseudonknot. J. Virol., 66, 5127-5132.

Frohman, M. A., Dush, M. K., and Martin, G. R. (1988). Rapid production of full-length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Scl. USA, 85, 8998-9002.

Garcia, A., van Duin, J., and Pleij, C. W. A. (1993). Differential response to frameshift signals in eukaryotic and prokaryotic translational systems. Nucleic Acids Res., 21, 401-406.

Gargourl, R., Joshi, R. L., Bol, J. F., Astier-Manifacier, S., and HaennI, A.-L. (1989). Mechanism of synthesis of turnip yellow mosaic virus coat protein subgenomic RNA in vivo. Virology, 171, 386-393.

Geller, A. I., and Rich, A. (1980). A UGA termination suppression tRNATrp active in rabbit reticulocytes. Nature, 283, 41-46.

German, T. L., and de Zoeten, G. A. (1975). Purification and properties of the replicative forms and replicative intermediates of pea enation mosaic virus. Virology, 66, 172-184.

German, T. L., de Zoeten, G. A., and Hall, T. C. (1978). Pea enatin mosaic virus genome RNA contain no polyadenylate sequence and cannot be aminoacylated. Intervirology, 9, 226-230.

Gildow, F. E. (1982). Coated-vesicle transport of luteoviruses through salivary glands of Myzus persicae. Phytopathology, 72, 1289-1296.

Gildow, F. E. (1985). Transcellular transport of barley yellow dwarf virus into the hemocoel of the aphid vector, Rhopalosiphum padi. Phytopathology, 75, 292-297.

Gildow, F. E., and Rochow, W. F. (1980). Role of accessory salivary glands in aphid transmission of barley yellow dwarf virus. Virology, 104, 97- 108.

Gill, C. C., and Chong, J. (1979). Cytopathlogical evidence for the division of barley yellow dwarf virus isolates into two subgroups. Virology, 95, 59-69. 135

Goldbach, R., and Van Kammen, A. (1985). Structure, replication and expression of the bipartite genome of cowpea mosaic virus. In "Molecular Plant Virology" (J.W. Davles, Ed.), Vol.2, pp. 83-120.

Gorbalenya, A. E., Donchenko, A. P., Blinov, V. M., and Koonin, E. V. (1989). Cysteine protease of positive strand RNA viruses and chymotrypsin-like serine proteases. FEBS Lett., 243, 103-114.

Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P., and Blinov, V. M. (1988). A novel superfamily of nucleoside triphosphate-binding motif containing proteins which are probably Involved in duplex unwinding in DNA and RNA replication and recombination. FEBS Lett., 235, 16-24.

Grieco, F., Burgyan, J., and Russo, M. (1989). The nucleotide sequence of cymbidium ringspot virus RNA. Nucleic Adds Res, 17, 6383.

Guilley, H., Carrington, J. C., Baiazs, E., Jonard, G., Richards, K., and Morris, T. J. (1985). Nucleotide sequence and genome organization of carnation mottle virus RNA. Nucleic Acids Res., 13, 6663-6677.

Habili, N., and Symons, R. H. (1989). Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Res., 17, 9543-9555.

Hames, B. D. (1990). An introduction to polyacrylamide gel electrophoresis. In B. D. Hames & D. Rickwood (Eds.), Gei electrophoresis of proteins: a practical approach (pp. 70-75). New York: IRL Press.

Harrison, B. D. (1984). Potato leafroll virus. CMi/AAB Description of Plant Viruses, no. 291.

Hatfield, D. L., Levin, J. G., Rein, A., and Oroszlan, S. (1992). Translationai suppression in retroviral gene expression. Adv. Virus Res., 41, 193- 239.

Hemenway, C., Weiss, J., O'Connell, K., and Turner, N. E. (1990). Characterization of infectious transcripts from a potato virus x cDNA clone. Virology, 175, 365-371. 136

Herlitze, S., and Koenen, M. (1990). A general and rapid mutagenesis method using polymerase chain reaction. Gene, 91, 143-147.

Hillman, B. I., Hearne, P., Rochon, D., and Morris, T. J. (1989). Orgnization of tomato bushy stunt virus genom: characterization of the coat protein gene and the 3' terminus. Virology, 169, 42-50.

Hizi, A., Henderson, L. E., Copeland, T. D., Sowder, R. C., Hixson, C. V., and Oroszlan, S. (1987). Characterization of mouse mammary tumor virus gag-pol gene products and the ribosomal frameshift site by protein sequencing. Proc. Natl. Acad. Sci. USA, 84, 7041-7045.

Hsu, Y. H., and Brakke, M. K. (1985). Cell-free translation of soil-borne wheat mosaic virus RNAs. J. Gen. Virol., 143, 272-279.

Hull, R. (1977). Particle differences related to aphid-transmissibility of a plant virus. J. Gen. Virol., 34, 183-187.

Jacks, T., Madhani, H. D., Masiarz, F. R., and Varmus, H. E. (1988). Signals for ribosomal frameshifting in the rous sarcoma virus gag-pol region. Cell, 55, 447-458.

Jefferson, R. A. (1987). Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep., 5, 387-405.

Kamer, G., and Argos, P. (1984). Primary structural comparison of RNA- dependent RNA polymerases from plant, animal and bacterial viruses. Nucleic Acids Res., 12, 7269-7282.

Kawchuk, L. M., Martin, R. R., and McPherson, J. (1990). Resistance in transgenic potato expressing the potato leafroll virus protein gene. Mo/ec. Plant-Microbe Interact., 3, 301-307.

Keese, P., Martin, R. R., Kawchuk, L. M., Waterhouse, P. M., and Gerlach, W. L. (1990). Nucleotide sequence of an Australian and a Canadian isolate of potato leafroll luteovirus and their relationships with two european isolates. J. Gen. Virol., 71, 719-724.

Kemper, B., and Stolarsky, L. (1977). Dependence on potassium concentration of the inhibition of the translation of messenger 137

ribonucleic acid by 7-methylguanosine 5'-phosphate. Biochemistry, 16, 5676-5680.

Koonin, E. V. (1991). The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses. Journal of Genera! Virology, 72, 2197- 2206.

Kozak, M. (1986). Regulation of protein synthesis in virus-infected animal cells. Adv. Virus Res., 31, 229-292.

Kozak, M. (1989). The scanning model for tranlsation: an update. J. Cell Biol., 108, 229-241.

Kozak, M. (1990). Evaluation of the fidelity of initiation of trnaslation in reticulocyte lysates from commercial sources. Nucleic Acids Res., 18, 2828.

Kozak, M. (1991a). An analysis of vertebrate mRNA sequence: intimations of translational control. J. Cell Biol., 115, 887-903.

Kozak, M. (1991b). Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem., 266, 19867-19870.

Kujawa, A. B., Drugeon, G., Hulanicka, D., and Haenni, A.-L. (1993). Structural requirements for efficient translational frameshifting in the sysnthesis of the putative viral RNA-dependent RNA polymerase of potato leafroll virus. Nucleic Acids Res., 21, 2165-2171.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature, 227, 680.

Landt, 0., Grunert, H.-P., and Hahn, U. (1990). A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene, 96, 125-128.

Li, G., and Rice, C. M. (1993). The signal for trnaslational readthrough of a UGA codon in Sindbis virus RNA involves a single cytidine residue immediately downstream of the termination codon. J. Viroi., 67, 5062-5067. 138

Lommel, S. A., Kendall, T. L., Xiong, Z., and Nutter, R. C. (1991). Identification of the maize chlorotic mottle virus capsid protein cistron and characterization of its subgenomic messenger RNA. Virology, 181, 382-385.

Lutcke, H. A., Chow, K. C., Mickel, F. S., Moss, K. A., Kern, H. F., and Scheeler, G. A. (1987). Selection of AUG initiation codons differs in plants and animals. EMBO J., 6, 43-48

IVIacFarlane, S. A., Taylor, S. C., King, D. I., Hughes, G., and Davies, J. W. (1989). Nucleic Acids Res., 17, 2245-2260.

Marsh, L. E., Dreher, T. W., and Hall, T. C. (1988). Mutational analysis of the core and modulator sequences of the BMV RNA3 subgenomic promoter. Nucleic Acids Res., 16, 981-995.

Martin, R. R., Keese, P. K., Young, M. J., Waterhouse, P. M., and Gerlach, W. L. (1990). Evolution and molecular biology of luteoviruses. Annual Reviews in Phytopathology, 28, 341-363.

Massalski, P. R., and Harrison, B. D. (1987). Properties of monoclonal antibodies to potato leafroll luteovirus and their use to distinguish virus isolates differing in aphid transmissibility. J. Gen. Virol., 68, 1813- 1821.

Mayo, M. A., Barker, H., Robinson, D. J., Tamada, T., and Harrison, B. D. (1982). Evidence that potato leafroll virus RNA is positive-stranded, is linked to a small protein and does not contain polyadenylate. J. Gen. Viroi., 59, 163-167.

Mayo, M. A., Robinson, D. J., Jolly, C. A., and Hyman, L. (1989). Nucleotide sequcne of potato leafroll luteovirus RNA. J. Gen. Virol., 70, 1037-1051.

Merrick, W. C. (1992). Mechanism and regulation of eukaryotic protein sysnthesis. Microbiological Reviews, 56, 291-315.

Meshi, T., Ishikawa, M., Motoyoshi, F., Semba, K., and Okada, Y. (1986). In vitro transcription of infectious RNA's from full-length cDNAs of tobacco mosaic virus. Proc. Natl. Acad. Sci. USA, 83, 5043-5047. 139

Miller, J. S., and Mayo, M. A. (1991). The location of the 5' end of the potato leafroll luteovirus subgenomic coat protein mRNA. J. Gen. Virol., 72, 2633-2638.

Miller, W. A., Dinesh-Kumar, S. P., and Paul, C. P. (1994). Luteovirus gene expression. CRC Review in Plant Biology (in press}.

Miller, W. A., Dreher, T. W., and Hall, T. C. (1985). Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on (-) sense genomic RNA. Nature, 313, 68-70.

Miller, W. A., Waterhouse, P. M., and Gerlach, W. L. (1988a). Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Res., 16, 6097-6111.

Miller, W. A., Waterhouse, P. M., Kortt, A. A., and Gerlach, W. L. (1988b). Sequence and identification of the barley yellow dwarf virus coat protein gene. Virology, 165, 306-309.

Miller, W. A., and Young, M. J. (1994). Prospects for genetically engineered resistance to barley yellow dwarf virus. In "forty years of progress in barley yellow dwarf virus" (in press).

Morikawa, S., and Bishop, D. H. L. (1992). Identification and analysis of the gag-pol ribosomal frameshift site of feline immunodeficiency virus. Virology, 186, 389-397.

Murphy, J. F., D'Arcy, C. J., and Clark, J. M. J. (1989). Barley yellow dwarf virus RNA has a 5'-terminal genome-linked protein. J. Gen. Viroi., 70, 2253-2256.

Nutter, R. C., Scheets, K., Panganiban, L. C., and Lommel, S. A. (1989). The complete nucleotide sequence of the maize chlorotic mottle virus genome. Nucleic Acids Res., 17, 3163-3177.

Osirio-Keese, M. E., Keese, P., and Gibbs, A. (1989). Nucleotide sequence of eggplant mosaic tymovirus genome. Virology, 172, 547-554.

Paliwal, Y. C., and Sinha, R. C. (1970). On the mechanism of persistence and distribution of barley yellow dwarf virus in an aphid vector. Virology, 42, 668-680. 140

Parkin, N. T., Chamorro, M., and Varmus, H. E. (1992). Human immunodeficiency virus type 1 gag-poi frameshifting is dependent on downstream mRNA secondary structure: demonstration by expression in vivo. J. ViroL, 66, 5147-5151.

Pelliam, H. R. B. (1978). Leaky UAG temination codon in tobacco virus RNA. Nature, 272, 469-471.

Powell, C. A., and de Zoeten, G. A. (1977). Replication of pea enation mosaic virus RNA in isolated pea nuclei. Proc. Natl. Acad. Sci. USA, 74, 2919-2922.

Prufer, D., Tacke, E., Schmitz, J., Kull, B., Kaufmann, A., and Rohde, W. (1992). Ribosomal frameshifting in plants: a novel signal directs the - 1 frameshift in the synthesis of the putative viral replicase of potato leafroll luteovirus. EMBOJ., 11, 1111-1117.

Rathjen, J. P., Karageorgos, L. E., Habili, N., Waterhouse, P. M., and Symons, R. H. (1994). Soybean dwarf luteovirus contains the third variant genome type in the luteovirus group. Virology, (In press).

Reisman, D., and de Zoeten, G. A. (1982). A covalently linked protein at the S'-ends of the genomic RNAs of pea enation mosaic virus. J. Gen. Virol., 62, 187-190.

Reutenauer, A., Ziegler-Graff, V., Lot, H., Scheidecker, D., Guilley, H., Richards, K., and Jonard, G. (1993). Identification of beet western yellows luteovirus genes implicated in viral replication and particle morphogenesis. Virology, 195, 692-699.

Rice, C. M., Levis, R., Strauss, J. H., and Huang, H. V. (1987). Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker and in vitro mutagenesis to generate defined mutants. J. Virol., 61, 3809- 3819.

Riviere, C. J., and Rochon, D. M. (1990). Nucleotide sequence and genomic organization of melon necrotic spot virus. J. Gen. Virol., 71, 1887- 1896. 141

Rochon, D. M., and Johnston, J. C. (1991). Infectious transcripts from cloned cucumber necrosis virus cDNA: evidence for a bifunctional subgenomic mRNA. Virology, 181, 656-665.

Rochow, W. F. (1969). In "viruses, vectors, and vegetation (K. Maramorosch, éd.), pp175-198. Wiley (Interscience), New York.

Rochow, W. F., and Duffus, J. E. (1981). Luteoviruses and yellows diseases. In "Handbook of plant virus infections and comparative diagnosis " (E. Kurstak, Ed.), 147-170.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual (Second ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. H., and Roe, B. A. (1980). Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Moi. Biol., 143, 161-178.

Schmitt, C., Balmori, E., Jonard, G., Richards, K. E., and Guilley, H. (1992). In vitro mutagenesis of biologically active transcripts of beet necrotic yellow vein virus RNA2: evidence that a domain of the 74 kDa readthorugh protein is important for efficient virus assembly. Proc. Natl. Acad. Sci. USA, 89, 5715-5719.

Shaklee, P. N., Miglietta, J. J., Palmenberg, A. C., and Kaesberg, P. (1988). Infectious positive- and negative-strand transcript RNAs from bacteriophage Qb cDNA clones. Virology, 163, 209-213.

Shepardson, S., Esau, K., and Mccrum, R. (1980). Ultrastructure of potato leaf phloem infected with potato leafroll virus. Virology, 105, 379- 392.

Skotnicki, M. L., Mackenzie, A. M., Torronen, M., and Gibbs, A. J. (1993). The genomic sequence of cardamine fleck carmovirus. J. Gen ViroL, 74, 1933-1937.

Skuzeski, J. M., Nichols, L. M., and Gesteland, R. F. (1990). Analysis of leaky viral translation termination codons in vivo by transient expression of improved b-glucoronidase vectors. Plant Moi. Biol., 15, 65-79. 142

Skuzeski, J. M., Nichols, L. M., Gesteland, R. F., and Atkins, J. F. (1991). The signal for a leaky UAG stop codon in several plant viruses includes the two downstream codons. J. MoL Biol., 218, 365-373.

Smith, 0. P., and Harris, K. F. (1990). Potato leafroll virus 3' genome organization; Sequence of the coat protein gene and identification of a viral subgenomic RNA. Phytopathology, 80, 609-614.

Strauss, E. G., Rice, C. M., and Strauss, J. H. (1983). Sequence coding for the alphavirus nonstructural proteins is interrupted by an opal termination codon. Proc. Natl. Acad. Sci. USA, 80, 5271-5275.

Tacke, E., Prufer, D., Schmitz, G., and Rohde, W. (1991). The potato leafroll luteovirus 17K is a single-stranded nucleic acid-binding protein. J. Gen. Virol., 72, 2035-2038.

Tacke, E., Schmitz, J., Prufer, D., and Rohde, W. (1993). Mutational analysis of the nucleic acid-binding 17 kDa phosphoprotein of potato leafroll luteovirus identifies an amphipathic a-helix as the domain for protein/protein interactions. Virology, 197, 274-282.

Takeda, N., Kuhn, R. J., Yang, C. F., Takegami, T., and Wimmer, E. (1986). Initiation of poliovirus plus-strand RNA synthesis in a membrane complex of infected HeLa cells. J. Virol., 60, 43-53.

Tamada, T., and Kusume, T. (1991). Evidence that the 75K readthrough protein of beet necrotic yellow vein virus RNA-2 is essential for transmission by the fungus Polymyxa betae. J. Gen. Virol., 72, 1497- 1504. ten Dam, E. B., Pleij, C. W. A., and Bosch, L. (1990). RNA pseudoknots: translational frameshifting and readthrough on viral RNAs. Virus Genes, 4, 121-136. 143

Tu, C., Tzeng, T. W., and Bruenn, J. A. (1992). Ribosomal movement impeded at a pseudolcnot required for frameshifting. Proc. Natl. Acad. Se/. USA, 89, 8636-8640.

Turner, N. E., Lawson, C., Hemenway, C., Weiss, J., Kaniewslci, W., Nida, D., Anderson, J., and Sammons, B. (1991). Engineering resistance to potato leafroil virus in russet burbanic potato. Third International Congress of the International Society for Plant Molecular Biology (Abstr. 1164).

Deng, P. P., Vincent, J. P., Kawata, E. E., Lei, C.-H., Lister, R. M., and Larkins, 8. A. (1992). Nucleotide sequence analysis of the genomes of the MAV-PS1 and P-PAV isolates of barley yellow dwarf virus. J. Gen. Virol., 73, 487-492.

van der Werf, S., Bradley, J., Wimmer, E., Studier, F. W., and Dunn, J. J. (1986). Synthesis of infectious poliovirus RNA by pruified T7 RNA polymerase. Proc. Natl. Acad. Sci. USA, 83, 2330-2334.

van der Wilk, F., Huisman, M. J., Cornelissen, B. J. C., Huttinga, H., and Goldbach, R. (1989). Nucleotide sequence and organization of potato leafroil virus genomic RNA. FEBS iett., 245, 51-56.

Veidt, I., Bouzoubaa, S. E., Leiser, R.-M., Ziegler-Graff, V., Guilley, H., Richards, K., and Jonard, G. (1992). Synthesis of full-length transcripts of beet western yellows virus RNA" messenger properties and biological activity in protoplasts. Virology, 186, 192-200.

Veidt, I., Lot, H., Leiser, M., Scheidecker, D., Guilley, H., Richards, K., and Jonard, G. (1988). Nucleotide sequence of beet western yellows virus RNA. Nucleic Acids Res., 16, 9917-9932.

Vincent, J. R., Lister, R. M., and Larkins, B. A. (1991). Nucleotide sequence analysis and genomic organization of the NY-RPV isolate of barley yellow dwarf virus. J. Gen. Virol., 72, 2347-2355.

Vincent, J. R., Deng, P. P., Lister, R. M., and Larkins, B. A. (1990). Nucleotide sequences of coat protein genes for three isolates of barley yellow dwarf virus and their relationships to other luteovirus coat protein sequences. J. Gen. Virol., 71, 2791-2799. 144

Wandelt, C., and Feix, G. (1989). Sequence of a 21 kd zein gene from maize containing an in-frame stop codon. Nucleic Acids Res., 17, 2354.

Waterliouse, P. M., Martin, R. R., and Geriach, W. L. (1989). BYDV-PAV virions contain readthrough protein. Phytopathology (Abstract), 79, 1215.

Weiland, J., and Dreher, T.W. (1989). Infectious TYMV RNA from cioned cDNA; effects in vitro and in vivo of point substitutions in the initiation codons of two extensively overlapping ORFs. Nucleic Acids Res., 17, 4675-4687.

Weiner, A. M., and Wever, K. (1971). Natural read-through at the UGA termination signal of Qbeta coat protein cistron. Nature New Biology, 234, 206-208.

Weiss, R. B., Dunn, D. M., Atkins, J. F., and Gesteland, R. F. (1987). Slippery runs, shifty stops, backward steps, and forward hops: -2, -1, + 1, +2, +5, and +6 ribosomal frameshifting. Cold Spring Harbor Symposia on Quantitative Biology, 52, 687-693.

Weiss, R. B., Dunn, D. M., Atkins, J. F., and Gesteland, R. F. (1990). Ribosomal frameshifting from -2 to +50 nucleotides. Progress in Nucleic Acids Research and Molecular Biology, 39, 159-183.

Wills, N. M., Gesteland, R. F., and Atkins, J. F. (1991). Evidence that a downstrem pseudoknot Is required for trnaslational read-through of the Moloney murine leukemia virus gag stop codon. Proc. Natl. Acad. Sci. USA, 88, 6991-6995.

Wimmer, E. (1982). Genome-linked proteins of viruses. Cell, 28, 199-.

Wu, S., Rinehart, C. A., and Kaesberg, P. (1987). Sequence and organization of southern bean mosaic virus genomic RNA. Virology, 161, 73-80.

Xiong, Z., and Lommel, S. A. (1989). The complete nucleotide sequence and genome organization of red clover necrotic mosaic virus RNA-1. Virology, 171, 543-554. 145

Young, M. J., Kelly, L., Larkin, P. J., Waterhouse, P. M., and Gerlach, W. L. (1991). Infectious In vitro transcripts from a cloned cDNA of barley yellow dwarf virus. Virology, 180, 372-379.

Young, M. J., Larkin, P. J., Miller, W. A., Waterhouse, P. M., and Gerlach, W. L. (1989). Infection of Triticum monococcum protoplasts with barley yellow dwarf virus. J. Gen. Virol., 70, 2245-2251. 146

ACKNOWLEDGMENTS

I am indebted to Dr. W. Allen Miller, my major professor and mentor, for his continuous help, support and encouragement during the course of my graduate studies. I thank my program of study committee members; Dr. John H. Hill, Dr. James T. Colbert, Dr. Eric Henderson and Dr. Robert Benbow for helpful discussion and advice. I appreciate Dr. Steven R. Rodermel, Dr. Susan L. Carpenter, Dr. John H. Hill and Dr. James T. Colbert, for critical reading of the manuscripts before submission to the journals. I thank Dr. Rich DeScenzo for advice and help with computers. I would like to thank my colleagues and friends; Dr. Veronique Brault, Dr. Stanley L. Silver, Dr. Di Rong, Dr. Jayaram, Dr. Cindy Paul, Mohan, Shanping Wang, Lada Rasochova, Alan Eggenberger, Michael Omunyin, Amy Marrow, Randy Beckett, Jan Seibel, Holly Sipes, David Higgs, Vijay Thatiparthi and Manzoor Mohideen, for helpful discussions and collaborations. I extend my appreciation to my parents, sisters (Swarna and Ranjini), brother (Prashantha), granny, uncles (Gururaj and Sthyanarayana), aunts (Shashikala and Ambuja), and my relatives for their patience and encouragement during this study. 147

IN VITRO SYNTHESIS OF FULL-LENGTH INFECTIOUS TRANSCRIPTS FROM A cDNA CLONE OF BARLEY YELLOW DWARF VIRUS t

148

Production of infectious RNA transcripts from fuil-length cDNA clones has become an essential tool for molecular genetic studies of RNA viruses. This approach has been utilized for several RNA viruses including a range of plant viruses (Ahlquist et al., 1984; Dawson et al., 1986; Meshi et al., 1986; Allison et al., 1988; Domier et al., 1989; Hemenway et al., 1990; Rochon and Johnston, 1991; Weiland and Dreher, 1989), animal viruses (van der Werf et al., 1986; Rice et al., 1987) and bacteriophage Qb (Shakiee et al., 1988). This technique provides an unlimited, homogeneous supply of inoculum. In addition, it provide means to examine gene expression and functions of various viral gene products by modifying biologically active cDNA clones using site-directed mutagenesis. Construction of infectious cDNA clone is very useful in luteoviruses, because they are phloem-limited and attain very low concentration in the infected tissue and they are not mechanically transmissible. Two infectious clones have been reported for members of the luteoviruses, namely barley yellow dwarf virus (BYDV-PAV serotype) (Young et al., 1991) and beet western yellows virus (BWYV) (Veidt et al., 1992). In this appendix, I describe construction of a full-length cDNA clone of BYDV-PAV to understand functions of viral genes, and the roles of specific sequences in translation, replication and encapsidation. The in vitro synthesized transcripts were infectious when introduced into oat protoplasts. Using several site-specific and deletion mutants we show that the ORF 1, ORF 2 and either 0RF6 or 1157 nucleotides at the 3' end of the genome are 149

required for efficient replication in protoplasts. These results contradict the published results from Young et al., (1991).

Construction of full-length cDNA clone of BYDV-PAV RNA A full-length clone of BYDV-PAV RNA was constructed for in vitro transcription (Figure 1). The protocol of (Frohman et al., 1988) was used to amplify the 5' end of PAV-IL RNA. The oligonucleotide: 3' - CCAGTGTCTGCCTCGGGCCGA^GJ^CTJJCG/K^JCCCCG GGAAC- 5', containing sequence complementary to bases 1225-1246 (italics) and added BspHI, Hindlll and Apal restriction sites (underlined) was used to prime first-strand cDNA synthesis using MMLV RNase H" reverse transcriptase (Superscript, BRL) (Sambrook et al., 1989). The upstream primer, 5'-ACGCGGCCGCTAATACGACTCACTAT/JGACTGAAGATTG ACCATCTTCACA-3' was similar to that used by Young et al., (1991). It contained (5* to 3') a NotI site (underlined), the bacteriophage T7 DNA- dependent RNA polymerase promoter sequence (italics), followed by a G residue and the first 23 nucleotides of the 5' end of the virion RNA. The amplified product was gel-purified and cloned into Notl-Apal-cut pGEM5Zf( + ) (Promega), resulting in plasmid pPAVI (Figure 1). To obtain pPAV2, the Clal-Hindlll fragment of pSP15 (bases 1044-1591, Dinesh-Kumar et. al., 1992) was cloned into pPAVI that had been digested with the same enzymes. To generate pPAV3, the Hindlll-Apal fragment of pSP15 comprising 1591-2860 (Apal site is in the vector) was cloned into Hindlll- Apal-cut pPAV2. Plasmid pPAV4 was constructed by cloning the »

150

FRAME8HIFT CP 23KT 50K I I eOKtPOU "aiR imr & TTÎ T 10446 1200* :*MÉ pPAVlb

PPAV2 pPAV3^

pPAV4b- 8t T7

pPAVS Ba E 8m pPAVO^-

Figure. 1 Genome organization of BYDV-PAV RNA and schematic diagram of full-length clone assembly. Large ORFs are indicated above relevant restriction sites, numbered as in Miller, et al., (1988a). Maps of inserts in intermediate plasmids used to assemble full-length clone (see text) are diagrammed below the genome organization. Boxes at left end of the maps represent the 17 RNA polymerase promoter; solid bars depict the portion from BYDV-PAV-IL, the remainder (open bars) is from the Australian isolate of BYDV-PAV (Miller et al., 1988a). Abbreviations: A, Aval; C, Clal; E, EcoRI; H, Hindlll; Sa, Sail; Sm, Smal; Ss, Sspl. 151

481 base pair (bp) EcoRI fragment (bases 2860-2985) of pSP17 (Dlnesh- Kumar et al., 1992) into EcoRI-cut pPAV3. Intermediate cloning vector pUC118-1180-H3 was constructed by cloning the Sacl-Sall fragment of pSL1180 (Pharmacia, Milwaukee, Wl) into pUC118 from which the Hindlll site had been deleted. Then the Sall-Smal fragment of pSP18 (Dinesh-Kumar et al., 1992) was cloned into pUC 118- 1180-H3, resulting in pPAV5. Finally, the Notl-Sall fragment of pPAV4 was cloned into Notl-Sall-cut pPAV5 to obtain pPAVG, which contains a full length cDNA copy of BYDV-PAV (Figure 1). All the cloning junctions were confirmed by double-stranded DNA sequencing (Taq Track sequencing kit, Promega).

Construction of plasmid pFLFSM4 The BYDV-PAV sequence from nucleotide 1044 (Clal site) to 1591 (Hindlll site) was cloned into pUC118-1180-H3 to create plasmid pPAV(C-H). Mutations were made by the method of Herlitze and Koenen, (1990), using Ml 3 forward and reverse primers and mutagenic primer DIFS1: 5'- AGAGCCCCTCTGAAAAACCCAC- 3' (inserted base underlined). Primer DIFS1 changed the 39K stop codon from UAG to UCAG, creating in-frame 99K fusion of the 39K and 60K ORFs. After mutagenesis, the Clal-Hindlll fragment was subcloned into pPAV2, then the Notl-Hindlll fragment was cloned back into the full-length clone to create plasmid pFLFSM4. 152

Sequence of 5' terminal 1044 nucleotides of BYDV-PAV-lllinois strain and comparison with the other BYDV-PAV strains The full-length clone of BYDV-PAV described here is a chimera with the 5'-terminal 1044 nucleotides derived from Illinois strain of BYDV-PAV (PAV-IL), while the remainder is from the sequenced Australian isolate (Miller et al., 1988b). To determine the sequence of the 5* end of PAV-IL strain, four subclones were generated from pPAVI. These subclones were sequenced by dideoxy method (Sanger et al., 1980) using Taq Track double stranded sequencing kit (Promega). Figure 2 shows the 5' terminal 1044 nucleotide sequence of BYDV- PAV-IL and its alignment with sequenced Australian (BYDV-PAV-Aust), and Purdue (BYDV-PAV-P) strains. The sequences were analyzed using computer programs GCG sequence analysis software package version 6 and an IBM-compatible program by W.R. Bottomley (CSiRO, Division of Plant Industry, Canberra, Australia). The nucleotide sequence of PAV-IL has 93.1% identity to the Australian strain and 93.6% identity to the Purdue strain (Figure 2). At the amino acid sequence level, PAV-IL was 97.7% identical to Australian strain and 98.7% identical to the Purdue strain (data not shown). Despite the differences, the full-length chimeric transcript was highly infectious in oat protoplasts (see below).

In vitro translation of full-length BYDV-PAV RNA The translation properties of the full-length transcripts and virion RNA were analyzed in eukaryotic cell-free translation systems. Full-length and >

153

1 so Auat AGTGAAGATT GACCATCTCA CAAAAGCTGT TACG-TGCTT GTAACACACT IL - P ? C 51 100 Auab ACGCGCCCGT TTTGTATTCG GGAAGTAGTT GCGAAAACGG TCCCCTTATT 111 • * A » A* T * A# •••••••• • « A# C * ••••••«••• P ..A.A.T G.. .. A A.C 101 150 Auat GCCTGACAAG CTAAGGGCCA CCCTTCTTTC CCCACCGCCA TCATGTTTTT 1%, G....G A C C.. P G A A 151 200 Auat CGAAATACTA ATAGGTGCTA GCGCCAAGGC GGTCAAAGAC TTCATTAGCC IL T A T..A A C P T A T C... .

201 250 Auat ATTGCTATTC TAGATTGAAA TCTATATACT ATTCTTTCAA GCGATGGCTA IL .C.T A T T.. A G P .. . .T. .C. . .C.T T A G 251 300 Auat ATGGAGATAT CAGGGCAATT TAAGGCCCAC GACGCCTTTG TCAACATGTG IL G T P T G 301 350 Auat CTTTGGGCAC ATGGCTGACA TTGAGGACTT CGAGGCGGAA CTCGCTGAGG IL ...C A P ...C A..G

351 400 Auat AGTTCGCCGA GAGGGAGGAT GAGGTGGAAG AGGCGAGGAG CCTCTTGAAA IL T A..A P T A 401 450 Auat CTGCTGGTCG CCCAAAAATC TAAATCTGGG GTGACCGAGG CTTGGACCGA IL C P T A 451 500 Auat CTTTTTTACA AAGTCGAGAG GTGGTGTTTA CGCACCACTT TCCTGCGAGC IL .. .C G C..C. .C. . T..G P .. .C G C..C. . T..G

501 550 Auat CTACCAGGCA GGAGCTAGAA GTCAAGAGTG AGAAACTCGA GCGACTTCTA IL CA ....G AAA P CT C G AAAG

551 600 Auat GAAGAGCAGC ACCAATTTGA GGTGCGAGCG GCCAAGAAAT ACATCAAGGA IL A C T P A C T

601 650 Auat AAAGGGCCGC GGCTTCATCA ACTGCTGGAA CGACTTGCGG AGTCGTCTCA IL P ...A T »

154

6S1 700 Auat GGTTGGTGAA GGACGTCAAG GACGAGGCGA AGGACAACGC CAGAGCTGCT IL ..C A P ..C

701 750 AUSt GCCAAGATTG GAGCAGAAAT GTTCGCCCCT GTTGACGTGC AGGACCTCTA II. c c c 9 C C A

751 800 Auat CAGTTTCACG GAGGTCAAGA AGGTGGAGAC CGGCCTCATG AAGGAGGTCG IL T..A P A 001 850 Auat TGAAAGAGAA AAACGGCGAA GAAGAGAAAC ACCTCGAACC CATCATGGAA IL G G P G G

851 900 Auat GAGGTGAGGT CCATCAAGGA CACCGCCGAA GCCAGGGACG CCGCCTCCAC IL ••••••••A* P A. .T T T

901 950 Auat TTGGATAACA GAGACAGTTA AGCTGAAGAA CGCAACGCTT AACGCAGATG IL C T P TT.T T..C... . 951 1000 Auat AACTGTCTCT TGCCACCATC GCCCGCTACG TTGAAAACGT AGGGGACAAG IL .G G A P ..T G C A 1001 1050 Auat TTCAAACTCG ACATTGCTAG TAAAACATAT CTAAAGCAAG TCGCATCGAT IL C..G P C..G

Figure. 2 Alignment of 5'-terminal 1044 nucleotide sequence of Australian (Aust), Illinois (IL), and Purdue (P) isolates of barley yellow dwarf virus. Complete sequence of Australian isolate is shown. In Illinois and Purdue isolates only the bases that are different from Australian isolate are shown. 155

mutant RNA transcripts were synthesized by in vitro transcription of Smal- iinearized pPAV6 and mutant clones with the T7 Megascript kit (Ambion, TX). In vitro translation was carried out with 200 ng of uncapped transcripts or virion RNA. One-fifth of the in vitro translation reaction mix was electrophoresed through 5% stacking and 10% resolving polyacrylamide- SDS gels using a discontinuous buffer system (Laemmli, 1970). Gels were fixed and fluorographed (Hames, 1990). The relative radioactivity in each gel band was measured using Imagequant 3.0 software on a Phosphorimager 400E (IVIolecular Dynamics, Sunnyvale, CA). Frameshift rate was calculated as: (relative radioactivity in 99K band/28) X 100/[(relative radioactivity in 39K band/10) + (relative radioactivity in 99K band/28)]. This normalized the radioactivity for the 28 methionine residues in the (39K + 60K) = 99K transframe ORF and the 10 methionine residues in the 39K ORF alone. When BYDV-PAV virion RNA or full-length transcripts were translated under optimal ionic conditions (below) in a wheat germ extract, an abundant peptide was produced that migrated at an apparent molecular weight of 47 kDa, using BMV translation products as markers (Figure 3, lanes 2, 3). We believe that this is the product of the 39K ORF. A less abundant product that migrated as a 95 kDa polypeptide was also visible. This is close to the size and abundance expected for the transframe protein (39K + 60K = 99K). To verify this, a deoxycytidilate residue was inserted in the stop codon of the 39K ORF (mutant pFLFSM4) to destroy the stop codon and place the 60K ORF in the same frame as the 39K ORF, resulting in a single 99K ORF. As expected, the translation product of this RNA comigrated with 156

1 23 45678910

20-

Figure. 3 Fluorograph of in vitro translation products of BMV RNA (lanes 1, 6), BYDV-PAV virion RNA (lanes 2, 7), transcripts of Smal-linearized pPAV6 (lanes 3, 8) and pFLFSM4 (lanes 4, 9) and no added RNA (lanes 5, 10), following SDS-PAGE. Lanes 1-5: wheat germ translation products (2.5 |al aliquots of BMV RNA reaction, 5 |il aliquots of BYDV-PAV RNA reactions). Lanes 6-10: rabbit reticulocyte lysate products (2.5 |il aliquot of BMV RNA reaction, 10 ni aliquots of BYDV-PAV RNA reactions). All reactions contained 0.2 mg of RNA template in 25 |il reaction mixture with 1,071 Ci/mmoie ^^S-methionine. Details are in the text. Molbilities (in kilodaltons) of BMV products are shown on the left: expected sizes of BYDV-PAV products are on the right. 157

the approximately 95 kDa product from wild-type RNA but was present in much greater abundance (Figure 3, lane 4). Concomitantly, little or no 47 l

158

this would affect the amount of frameshift product. Increasing the potassium acetate concentration from 54 mM, supplied by the manufacturer, to 154 mM dramatically improved translation efficiency. Wheat germ translation shown in Figure. 3 was performed in 154 mM potassium acetate. Despite the extensive optimization of the magnesium and potassium concentrations in the reticulocyte lysate, the rate of frameshifting remained substantially below that in wheat germ extracts (Figure 3).

Biological activity of BYDV-PAV transcripts Oat protoplasts were isolated and electroporated with viral RNA or full- length transcripts (Dinesh-Kumar et al., 1992; Dinesh-Kumar and Miller, 1994). Infection was verified by ELISA of protoplast extracts using BYDV- PAV-specific antibodies. Synthesis of viral coat protein from protoplasts electroporated with 5 mg of full-length transcripts or 100 ng of virion RNA could be readily detected 24 hr. after inoculation and continued to accumulate to at least 48 hr (Figure 4). The coat protein levels revealed by high ELISA readings indicate that subgenomic RNA (message for CP) is synthesized as a result of virus replication and the CP is not from the inoculum RNA. Five mg of transcript gave approximately the same amount of coat protein expression after 48 hr as 100 ng of virion RNA (Figure 4). This indicates that the full- length infectious transcripts were approximately 50-fold less infectious compare to equivalent amount of virion RNA. This full-length transcript is more highly infectious than that reported t

159

PAV6 (uncap) 0.8- <

0.4-

PAV6 (cap) No RNA 0 24 48 Mrs. after inoculation

Figure. 4 Expression of BYDV-PAV coat protein in oat protoplasts electroporated with 500 ng of virion RNA (viral RNA), 5 ng of capped and uncapped full-length transcripts derived from Smal-linearized pPAV6, and no RNA. ELISA values were determined at 0, 24 and 48 hr after inoculation. 160

previously (Young et al., 1991), in which coat protein was first detected 72 hr after inoculation in Triticum monococcum ceils. Coat protein was not detected from protoplast extracts when capped full-length transcripts were used for infection (Figure 4). Most viral RNAs contain either cap structure or genome-linked viral protein (VPg) at the 5' end. In both cases capping enhances infectivity. Failure of capped transcripts to replicate in case of BYDV-PAV may indicate the lack of a cap or cap-like structure at the 5' end of the RNA. This is supported by the observation that the BYDV-PAV genome translates in a cap-independent manner in a wheat germ translation system (Wang and Miller, unpublished). Furthermore, the RNA-dependent RNA polymerase of BYDV-PAV is more similar to the polymerases of tombus-, carmo- and dianthoviruses that lack VPg's than to those which have VPg's (BYDV-RPV and other subgroup II luteoviruses). In contrast to our findings, Young et al., (1991) reported two fold higher infection with capped BYDV-PAV transcripts compared to uncapped transcripts, but later said capping made no difference (pers. communication).

Effect of deletions in ORFs 1, 5 and 6 on BYDV-PAV Infection Deletion mutants created from pPAVG are shown in Figure 5. To determine whether the 39 kDa protein expressed from 0RF1 is required for replication, two clones pPAV19 and pPAV26 were generated. To create plasmid pPAV19, first the plasmid pPAV6 was cut with Csp45l (nt 148), and I

161

39K 4.3-6.7K 5* 3' ~1 BJi Ball HpW Sell BamHI Bell 8rL(se77) BomHI (3785) (4513) (4837) (5190) Xmal(5677) (1135) (1740) B EUSA values

PAVfl - 1.22

PAV18 - - 0.02

PAV2fl — - 0.01

PAV13 — 1.22

PAV22 — - 0.02

PAV24 — - 0.02

Viral ANA 1.22 No ANA 0.01

Figure. 5 Infectivity of BYDV-PAV RNA transcripts containing deletions in ORFsl, 5 and 6 in oat protoplasts. A. Genome organization of BYDV-PAV. Restriction sites used in creating deletion mutants with corresponding position in the BYDV-PAV genome (Miller et. al., 1988; and Figure. 2 of this chapter) are shown below the genomic RNA. B. Accumulation of BYDV- PAV coat protein in oat protoplasts electroporated with 5-10 mg of transcripts derived from Smal-linearized full-length and mutant clones. Gap in mutants indicates deletion sites. ELISA values are average of two replicates. 162

filled in with Klenow fragment of DNA polymerase I, and then cut with Eco72l (1135) prior to recircularization. The resulting plasmid pPAV19 contain a deletion in the 0RF1 (nts 148-1135) (Figure 5). When transcript derived from pPAV19 was translated in wheat germ extract, expression of 0RF2 (60 kDa polymerase protein) was also affected in addition to 0RF1 (data not shown). To overcome this effect, plasmid pPAV26, containing a smaller deletion in the 0RF1 (nts 578-959), was generated by digesting the plasmid pPAV6 with Ball and religation. Transcripts derived from PAV19 and PAV26 were inoculated into oat protoplasts. The ELISA readings indicate that these transcripts fail to accumulate coat protein (Figure 5B). Thus 39 kDa product of 0RF1 appears to be indispensable for replication of BYDV-PAV RNA in protoplasts. This result was expected because 39 kDa protein and the frameshift protein (99 kDa) contain conserved sequence motifs characteristic of viral and cellular helicases and RNA-dependent RNA polymerases (Habill and Symons, 1989). This contrasts with the findings of Young et al., (1991), in which frameshift mutation in ORF 1 did not affected the accumulation of BYDV-PAV coat protein. To address the role of the readthrough protein (0RF5) in viral replication, plasmids pPAV13, pPAV22 were generated (Figure SB). pPAV13, which carries a deletion in the 0RF5 from nt 3785-4513 was constructed by inserting the Scal-Xmai fragment (nts 4513-5677) from pPAV6 between Hpal-Xmal (nt 3785-5677) sites of pPAV6. pPAV22 was obtained by cloning the klenow filled in BamHI- Xmal fragment (nts 4837- 163

5677) from pPAV6 into the Hpal-Xmal cut (nts 3785-5677) pPAV6. This plasmid carries a deletion in 0RF5 from nt 3785-4813 and an additional 23 nt 3' of 0RF5. The coat protein accumulated to the wildtype level in protoplasts electroporated with transcripts derived from pPAV13 (Figure 5B). This shows that the readthrough protein is not involved in replication or coat protein synthesis or virus assembly. This is in agreement with the findings in BWYV, in which frameshift mutations or deletion mutants in the readthrough region did not affected viral RNA replication (Reutenauer et al., 1993). In contrast. Young, et al., (1991) claimed that frameshift mutations in the BYDV-PAV readthrough region eliminated infectivity. Subsequently he found they did not (pers. communication). When transcripts derived from pPAV22 were inoculated into oat protoplasts, there was no accumulation of coat protein (Figure 5B). This indicate that the region between Seal and BamHI is required for BYDV-PAV replication. Furthermore, translation of pPAV22 transcript in wheat germ extract resulted in no 39 kDa protein or 99 kDa frameshift product (data not shown). This region is also required for cap-independent translation in wheat germ extracts (Wang and Miller, unpublished). Since uncapped transcripts are used for inoculation of the protoplasts, lack of synthesis of ORF 1 and ORF 2 products in vivo might be the reason for pPAV22 transcript being non-infectious. To determine whether ORF 6 is required for infection, plasmid pPAV24 containing a deletion in ORF 6 from nt 4837-5190 was generated (Figure. 164

5B). First plasmid pPAVB was cut with BamHI and Bell. Of the three resulting fragments two large fragments of size 3097 (in the PAV genome) and 4967 (PAV genome and the vector sequence) were gel-purified and religated. Transcripts derived from this plasmid fail to infect oat protoplasts (Figure. SB), which implies that expression of ORF 6 may be required for replication of BYDV-PAV RNA. But it is not clear whether the protein or the nucleotide sequence is required for replication, because the deletion of this region in the full-length clone may inhibit the synthesis of the second subgenomic RNA (message for ORF 6). Findings reported by (Young, et al., 1991) indicate that the expression of this protein is required for replication because frameshift mutation introduced in this protein abolished infectivity in protoplasts, but many of our previous results contradict their's. We believe that the cis-sequence in this region is required for efficient replication, because when these uncapped transcripts are translated in wheat germ extract, they fail to express 0RF1 and 0RF2 products. Furthermore, part of this deletion up to PstI site (nt 5009) is required for cap-independent translation in wheat germ extract (Wang and Miller, unpublished). It is interesting to see whether capping of pPAV22 and pPAV24 transcripts will rescue the replication properties in oat protoplasts. Future work Several additional deletions in the different part of the BYDV-PAV genome were generated (Figure 6). This will facilitate in identification of different cis-sequences and viral trans-factors that are required for BYDV- PAV replication. »

165

1 4.3-6.7K 5* 3' I Ball ClP4«l (678) (9M) Btt1107l EcolCRI Hpal Ndil ScalBamHI Bdl Smal P7*Q ECORI (4513) (4837) (5190) (6«77)

PAV6

PAV25

PAV27

PAV28

PAV29

PAV10

PAV12

PAV23

PAV30 ACQ PAV31 ACQ PAV32

GCQ

Figure. 6 Diagram of various point and deletion mutants of BYDV-PAV genome. A. Restriction sites used in creating deletion mutants with corresponding position in the BYDV-PAV genome (Miller et al., 1988a; and Figure. 2 of this chapter). B. Structure of point and deletion mutants. PAV6 represents the full-length infectious clone. Gap in mutants indicate deletions in the full-length genome. In PAV30, ORFs 3, 4 and 5 are deleted and the start codon of the 0RF6 is changed to ACG. The start codon of ORFS (CP) is modified to ACG in PAV31, and start codon of 0RF4 is changed to GCG In PAV32. »

166

APPENDIX II ROLE OF 39K ORF STOP CODON ON BYDV-PAV FRAMESHIFTING AND REPLICATION »

167

A shifty heptanucleotide sequence followed by a stem-loop structure or pseudoknot structure on the mRNA are two most important cis-signals found to play a major role in the translational frameshlft event (reviewed in Atkins et al., 1990; Hatfield et al., 1992). Another signal which might play a role in frameshifting is stop codon of the zero reading frame (Weiss et al., 1987; Brault and Miller, 1992). In BYDV-PAV changing the stop codon(UAG) of 39K ORF into UCG completely abolished frameshiting in plant cells. In synthetic constructs, insertion of a stop codon next to shifty heptanucleotide sequence resulted in enhancement of frameshift efficiency in Escherichia coli (Weiss et al., 1987; Weiss et al., 1990). In some eukaryotic viruses including BYDV-PAV, red clover necrotic mosaic virus (RCNMV, Xiong and Lommel, 1989), rous sarcoma virus (RSV, Jacks et al., 1988) and mouse mammary tumor virus (MIVITV, Hizi et al., 1987), the stop codon is located immediately 3' to the shifty heptanucleotide sequence (Figure 1). The stop codon might cause pausing of ribosomes, which may give more time for ribosomes to shift at the slippery site. In E coli, the gene for polypeptide release factor 2 (RF-2) contains an in-frame stop codon. To produce full-length RF-2 product, it uses +1 frameshift event. In this case, ribosomal pausing at the in-frame stop codon plays a crucial role in directing the efficient frameshift event (Donly et al., 1990). Recently it has been shown that in case of reovirus monocistronic s4 RNA translation, the ribosomes pause more at start and stop codons both in vitro and irt vivo (Doohan and Samuel, 1993). »

168

39K/pol GGGUUUUUAG BYDV-PAV

27Kfpol GGAUUUU UAG RCNMV gag/pol AAAUUUA UAG RSV

gag/pol GGAUUUAUGA MMTV

Figure. 1 Euloryotic viruses that contain upstream reading frame stop codon immediately 3' to the shifty heptanucieotide. pot, reverse transcriptase (in RSV and MMTV), or RNA-dependent RNA polymerase in (BYDV-PAV and RCNMV). gag, virus core protein. 169

To understand the role of stop codon on frameshift event in full-length natural context of BYDV-PAV RNA, I introduced several mutations in the 39 K stop codon (see below).

Construction of 39K ORF stop codon mutants The UAG stop codon of 39K ORF was replaced by several sense and other stop codons by two step polymerase chain reaction (PGR) mutagenesis method of (Landt et al., 1990) using a subclone pPAV(C-H) (see Appendix I). Mutations were made by using a mutagenic primer (see table 1) and Ml3 forward and reverse primers as flanking primers. After mutagenesis, the Clal-Hindlll fragment was subcloned into pPAV2 (see Appendix I), then the Notl-Hindlll fragment was cloned back into the full-length clone pPAV6 (see Appendix I; Di et al., 1993). All mutations were confirmed by double stranded sequence analysis. Table 1. Primers used for 39K ORF stop codon mutant construction

Primer name mutagenic primer^ mutant expected change (underiined bases are modified) generated in 39K stop codon ks3696 AGAGCCCCTTIIGIAAAAACCCAC pFLFSMI UAA

PFLFSM2 UGA ks5077 ACAGAGCCCCTCGAAAAACCCAC pFLFSM3 UCG ks3697 AGAGCCCCTCÊISAIAAAACCCAC pFLFSMS CGG

pFLFSM6 UGG

^ All primers are complementary to the viral bases 1170 to 1150 170

Role of 39K ORF stop codon on frameshifting and BYDV-PAV infection Transcripts were generated from Smal-llnearlzed full-length infectious clone pPAV6 and clones containing mutations in the 39K ORF stop codon using T7 megascript kit (Ambion, TX). Two hundred nanograms of transcripts were translated in wheat germ extract In the presence of 35s- labeled methionine, and frameshift percentage was calculated as described previously (see Appendix I). Changing the stop codon of the 39K ORF to sense codons (UCG, CGG, UGG) or another stop codon (UAA or UAG) had no effect on frameshifting efficiency (Figure 2). The 39K ORF reading frame Is extended by 132 nucleotides in those mutations that convert the stop codon to a sense codon. This resulted in production of a 42 kDa protein instead of 39 kDa (Figure 2). These in vitro results indicate that the stop codon of the 39K ORF is not required for frameshifting. This is similar to RSV, in which mutations in the gag terminator did not affect frameshift efficiency in reticulocyte lysate (Jacks et al., 1988). But it differs from the in vivo reporter gene (GUS) expression in protoplasts, in which the frameshift was abolished when the 39K ORF stop codon was changed to UCG (Brault and Miller, 1992) or other sense codons (Paul and Miller, unbublished). To investigate the role of 39 K stop codon on BYDV-PAV infection, 5- 10 mg of full-length wildtype and mutant transcripts were electroporated into oat protoplasts (Dinesh-Kumar et al., 1992; Dinesh-Kumar and Miller, 1993). Infection was analyzed by ELISA using BYDV-PAV specific antiserum. Accumulation of coat protein was similar to that of wild type level when the »

171

110_! 3 M###"* -39 35— —»

20- «m

(^ n,k

Figure. 2 In vitro translation of full-length and 39K stop codon mutant transcripts. Two hundred nanograms of intact transcripts were translated in wheat germ extract in the presence of ^Sg methionine. Products were separated on 10% polyacrylamide-SDS gel and visualized after fluorography. Mobilities (in kDa) of BMV translation products are shown on the left: expected sizes of BYDV-PAV products are shown on the right. Calculated frameshift rate are shown below. »

172

UAG stop codon of 39K ORF was changed to UAA or UGA stop codons (Figure 3A). Mutant transcripts in which the 39K ORF stop codon was changed to the sense codons UCG, CGG or UGG or UCAG abolished infectivity (Figure 3A). Replication of mutant and wild type transcripts were determined by Northern blots of total RNA extracts using viral RNA probes (Figure 3B). Only those transcripts with 39K ORF stop codon replicated in oat protoplasts (Figure 3B). The results of replication and infection studies are consistent with the in vivo GUS expression assay (Brault and Miller, 1992)

Conclusions

It is difficult to explain the differences between in vitro and in vivo results. Since any change of the stop codon of 39K ORF to a sense codon abolishes infection indicate that the stop codon may be required for efficient frameshifting in vivo to express the RNA-dependent RNA polymerase product (P1/P2). Alternatively frameshifting may occur normally in infected cells but addition of extra C-terminal amino acids into the 39kDa protein may inactivate its function. Deletion analysis reported in Appendix I shows that the 39 icDa protein is essential for infection. However, when same sense mutations were introduced into 39K ORF stop codon, they failed to express GUS in oat protoplast system (Paul and Miller, unpublished). This suggests that the stop codon may play an essential role in frameshifting \n vivo in BYDV-PAV. It is interesting to see whether these mutants can be rescued for replication by providing functional polymerase in trans. >

173

Virion RNA PAV6(UAG) MI(UAA) M2(UGA) M3(UCG) M4(UCAG) IVI5(CGG)- M6(UGG) NoRNA

Virion RNA PAVe(UAG) MI(UAA) M2(UGA) M3(UCG) M4(UCAG) M5(CGG)- M6(UGG) NoRNA

*405

Q ###

Figure. 3 Infection and replication of full-length and 39K stop codon mutant transcripts. Approximately 5-10 pg of transcripts derived from Smal- linearized full-length PAV6 and mutant clones were electroporated into oat protoplasts. A. Accumulation of coat protein 24 and 48 hr after inoculation was determined using BYDV-PAV specific antiserum. B. Replication was detected by Northern hybridization of total RNA, extracted 48 hr after inoculation using 32p.|abeled RNA probe complementary to the 5' end of the genome. G, position of genomic RNA. I

174

APPENDIX III SIGNALS THAT CONTROL TRANSLATIONAL READTHROUGH OF COAT PROTEIN STOP CODON IN BARLEY YELLOW DWARF VIRUS IN VIVO 175

Signals involved in luteovirus coat protein (CP) stop codon readthrough have not been investigated. In in vitro translation experiments with full-length synthetic subgenomic RNA of BYDV-PAV in reticulocyte lysates, the CP stop codon is suppressed at about 7 to 15% (Dinesh-Kumar et al., 1992). However, in vitro readthrough efficiency was highly susceptible to changes in salt concentration (magnesium chloride and potassium acetate). Hence I decided to determine the signals that are required for efficient readthrough in vivo using the oat protoplast system.

Effect of different amounts of viral sequence spanning CP stop codon on readthrough using GUS expression system To monitor readthrough, we inserted various amounts of sequence spanning the CP stop codon region between the start codon and the rest of the coding region of Escherichia coii uidA (GUS) gene in pAdh-GUS (Dinesh- Kumar and Miller, 1993) and pAGUSI (Skuzeski et al., 1990) expression vectors. Expression of GUS gene requires transiational readthrough of the CP stop codon. Plasmid pAdh-GUS contains the promoter from maize alcohol dehydrogenase (Adhi) gene and first intron, whereas pAGUSI contains a duplicated cauliflower mosaic virus 35S promoter. Two types of CP stop codon downstream sequences were included in various constructs. One with the C-rich sequence which is present downstream of the CP stop codon in all luteoviruses and another without the C-rich sequence. The C- rich sequence results in protein product in which every other amino acid is proline. This proline-rich domain has been suggested to play a role in >

176

separating the coat protein domain from tlie readtlirough domain (Bahner et ai., 1990). Plasmids pRTI to pRT4 (Figure 1 ) were obtained by PGR, using pPAV6 full-lengtli BYDV-PAV piasmid as template and different pairs of upstream and downstream primers (see Table 1). In all cases the Ncol-Apal cut PGR amplified fragment was gel purified and cloned into pAdh-GUS that had been cut with the same enzymes. The pairs of primers used were ks 3598 and ks3597 for pRTI; ks3598 and ks1644 for pRT2; ks 3596 and ks3597 for pRT3; ks 3596 and ks1644 for pRT4. Plasmids pRTI and pRT3 include the proline rich sequence downstream of CP stop codon. To determine the readthrough percentage, plasmids pRT5 to pRTB were generated, in which the GP stop codon was changed Into a sense codon (GAG, glutamate). This was achieved by the two step PGR method of Landt et al. (1990) using pRTI to pRT4 as templates and respective pairs of upstream and downstream primers and mutagenic primer ks5079, 5' GAGGAGTGTAGGT£TTTGGGGG 3', (modified nucleotide is underlined).

Table 1. Primers used for construction of readthrough plasmids

Primer Name Sequence bases in BYDV-PAV

ks3596 CGCCATGGTCATTACGATGAGTGTCAGT^ 3423 to 3442

ks3598 CGCCATGGTCCAGGAATCAACGATA* 3345 to 3361

ks3597 ATGGGCCCCCGATATACTCGAAGAA^ 3591 to 3575

ks1644 TAGGGCCCGGTGTTGAGGAGTCTA^ 3477 to 3462

^ Ncol site is underlined ^ Apal site is underlined. Primers are complementary to the viral RNA. Figure. 1 GUS activity from piasmids with various amounts of coat protein stop codon spanning region. Approximately 80 ng of piasmid was eiectroporated into oat protoplasts and GUS activity was measured after 24 hr. Each GUS activity value is the mean of two replicates. Percent readthrough was calculated as the percentage of GUS activity of each stop codon containing constructs with its control construct that differed only by the replacement of CP UAG with GAG. Calculations were made after subtracting background value in cells electroporated with salmon sperm DNA. »

178

GUS activity % Read- Adh Promoter (fluorescence units) through — pRT1 17.0 0.15

10926.2

3346 3477 pRT2 15.6 0.09

pRT6 17536.2

3423 35M pRT3 22.0 0.08 pRT7 25541.2

3423 3477 I pRT4 22.4 0.09

I pRT8 23461.2

pAGUSI 20710.0

Salmon DNA 23.8 358 Promoter 3346 3591 pRT9 10.0 0.28

pRT13 3505.0

3345 3477 pRTIO 11.6 0.25

pRT14 4615.6

3423 3591 pRT11 9.6 0.23 imm^m pRT15 4121.6

3423 3477 rm pRTi2 4.4 0.1

M pRT16 4384.1

pAGUSI 4335.6

Salmon DNA 19.5

GUS CP stop gene codon C-rioh 179

Approximately 10^ oat protoplasts were electroporated with 80 mg of plasmid DNA (Dinesh-Kumar and Miller, 1993) and GUS activity was determined after 24 hr. of incubation in the dark (Jefferson, 1987). The results are summarized in Figure 1. In none of the constructs containing the CP stop codon was termination suppressed, because observed GUS activity was only about 50% higher than the background. Rate of readthrough observed was about 0.1 to 0.15 %, which is 70 to 100 fold less than that observed in vitro (Dinesh-Kumar et al., 1992). A similar approach was used to study tobacco mosaic virus (TMV) class of readthrough signals and the efficiency observed was about 5% in vivo (Skuzeski et al., 1990). However they failed to detect readthrough of maize chlorotic mottle virus (MCMV) and carnation mottle virus (CarMV) stop codons which belong to the luteovirus group of readthrough signals. In potato leaf roll luteovirus (PLRV), the construct similar to our pRT4 resulted in suppression of about 1 % in tobacco and potato protoplasts (Tacke et al., 1990). Failure to observe readthrough in our experiments is not due inefficient expression level in oat protoplast system because our positive control values (Figure 1) were comparable with PLRV and TMV experiments. Transcripts from constructs pRTI to pRT8 contain 141 non viral bases from the Adhi promoter. To avoid this, Ncol-Apal fragment from pRTI to pRT8 were inserted into pAGUSI to generate plasmids pRT9 to pRT16 which used the CaMV 35S promoter (Figure 1). Transcripts from these plasmids contain only 11 non viral bases. These constructs were also unable to suppress the CP stop codon (Figure 1 ). 180

Effect of the entire CP coding sequence on efficiency of suppression To see whether more extensive sequence eiements are required than those used in the above constructs, we cloned the entire subgenomic RNA ieader, CP coding region and part of readthrough region into pAdh-GUS and pAGUSI (Figure 2). Plasmids pRT17 and pRT19 were generated by PCR using pPAV6 as tempiate and upstream primer SPDK8 (5' CGGGATCCGATAGGGTTTATAGTTAGTA 3'), which contained a BamHi site (underlined) and sgRNAI bases 1 to 20, and ks3597 as downstream primer (table 1). Plasmids pRT18 and pRT20 were generated using SPDK8 as upstream primer and ks1644 as downstream primer. Positive control plasmids pRT21 to pRT24 were generated using the mutagenic primer ks5079 as explained above. In all cases the PCR-amplified fragments were digested with BamHI-Apal and cloned into pAdh-GUS or pAGUSI that had been cut with the same enzymes These plasmids were electroporated into oat protoplasts and GUS activity was measured after 24 hr. Results are summarized in Figure 3. Although percent readthrough observed is higher in this experiment, it is difficult to accept these values because the GUS activity due to the CP suppression is only about one-third higher than that of the background. Higher readthrough percentage in case of pRT18 is a result of very low GUS activity from positive control construct (pRT22). The positive control values from the construct pRT22 is approximately 100 fold less compared to the positive control values obtained from constructs pRT4 to pRT8 in Figure 1. It indicates that the longer sequence at the N-terminal GUS coding region is t

181

GUS activity Adh Promoter T™'

2858 3477 M pRT17 8.1 0.64

fjm pRT21 1263.7

2858 3591 PRTIB 8.7 4.5

pRT22 192.7

pAdhGUS 26988.5 Salmon DNA 24.8 35S Promoter

2858 3477 im pRTi9 13.7 0.39

ym pRT23 3444.2

2858 3591 PpRT20RT20 13.i13.1 0.5

fm PRT24 2426.2

pPAGUSI 6970.5 Salmon DNA 24.8

Oco'R

Figure. 2 GUS activity from plasmids containing subgenomic leader, entire coat protein coding region and part of readthrough. Approximately 80 mg of plasmid was electroporated into oat protoplasts and GUS acitivity was measured after 24 hr. Each GUS activity value is the mean of two replicates. Percent readthrough was calculated as in Figure 1. 182

detrimental to its expression. However, in 35S constructs, pRT23 and pRT24 the reduction in the expression was only about 0.5 to 1 fold. The difference between Adh and 35S constructs is Adh constructs include more non viral bases, and requires processing of an intron.

Insertion of GUS gene downstream of CP stop codon in BYDV-PAV genome to study the signals Involved In readthrough Hybrid viruses consisting of the complete viral genome and extra genes like GUS or chloramphenicol acetyltransferase (CAT) have been shown to replicate efficiently and assemble into virions (Dawson et al., 1989; Doija et al., 1992). To study readthrough signals of luteoviruses in the full viral context I inserted the GUS gene downstream of the CP stop codon in BYDV-PAV full-length infectious clone. Expression of GUS in these constructs requires the synthesis of large subgenomic RNA through virus replication process. From the large subgenomic RNA it can be expressed only by translational readthrough of the CP stop codon. Plasmids pPAVGUSRTI, pPAVGUSRT2, pPAVGUSRT3, and pPAVGUSRT4 (Figure 3) were generated by ligating Aflll-blunt-Sall fragment of pRT19, pRT20, pRT23, and pRT24 respectively into Sall-Hpal cut pPAV6. The Sall-Aflll fragment contains the viral CP and part of readthrough and the entire GUS coding region. Plasmid pPAVGUSRT2 includes the C-rich sequence. pPAVGUSRT3 and pPAVGUSRT4 are control plasmids for pPAVGUSRTI and pPAVGUSRT2 respectively. Transcripts from these 183

Hpal (3785)

4.M.7K

sgRNAI

pmoi MU/mg/min % RT GUS 296.8 8.30

11 11 3588.0

9.8 0.23

fmF\ 4285.7

GUS I CP stop gene codon

Figure. 3 Suppression of coat protein stop codon in vivo. A. genome organization of BYDV-PAV. GUS gene was inserted downstream of the CP stop codon in fuil-lengtli infectious clone pPAVG (see text for details). B. Approximately 5-10 mg of transcripts derived from Smal-linearized full-length clone pPAV6 or clones containing GUS gene were electroporated into oat protoplasts, and GUS activity was measured after 24 hr. GUS activity is expressed as pmoi of methylumbelliferone (MU) synthesized per mg of total protein per min. Each GUS activity value is the mean of two replicates. Percent readthrough was calculated as in Figure 1. 184

plasmids were synthesized using T7 Megascript kit (Ambion, TX). About 5- 10 mg of transcripts were electroporated into oat protoplasts and GUS activity was determined. Transcripts derived from pPAVGUSRT2 which contained the C-rlch sequence downstream of CP stop codon, expressed GUS at a level of 8.27% of that of positive control transcript derived from pPAVGUSRT4, in which CP stop codon is changed to sense codon (GAG) (Figure 3). The percentage suppression observed from the transcripts derived from the plasmid pPAVGUSRTI, in which GUS inserted upstream of the C-rich sequence was about 0.23% (Figure 3). The level of GUS activity in cells infected with pPAVGUSRT2 transcript was about 100 fold higher than the protoplasts inoculated with pPAV6 full-length transcript without the GUS gene. The level of GUS activity observed in plasmid pPAVGUSRTI was only about 3 fold higher than the control. These results indicate that the CP stop codon is suppressed in oat protoplasts at the level of 8%, and the C rich sequence present downstream of the CP stop codon is necessary for efficient readthrough. The efficiency of readthrough observed here is about the same as observed in reticulocyte lysate (7-15%; Dinesh-Kumar et al., 1992). These results could indicate possible role of viral or viral induced trans-acting factors (e.g. specific suppresser tRNAs). However, this seems very unlikely because of the fact that the readthrough occurs in rabbit reticulocyte lysates. 185

Possible readthrough signals

The luteovirus CP stop codon is followed by a guanosine residue (Figure 4A), which is the most favored nucleotide in the eukaryotic tetranucleotide stop signal (Brown, et al., 1990). Thus it should be a strong rather than a leaky stop signal. This implies that sequences beyond this position are required for efficient readthrough like in gag gene stop codon suppression of mammalian type C retroviruses (reviewed in Hatfield et al., 1992). Mammalian type C retroviruses also have a guanosine residue following the stop codon (Figure 4B), and the readthrough signal is located in nucleotide sequence downstream of the stop codon (Feng et al., 1992). The six C residues beginning 19 nucleotides downstream of the stop codon and a pseudoknot 3' to the stop codon are required for efficient readthrough (Feng et al., 1992; Wills et al., 1991). Similarly in BYDV-PAV, the C-rich sequence downstream of CP stop codon which is conserved in all luteoviruses and PEMV is required for efficient readthrough (Figure 4A). This C-rich nucleotide sequence results in translation product in which every other amino acid is proline. It is not clear whether the nucleotide sequence per se, or involvement of proline tRNAS are required for readthrough. The most striking downstream sequence conserved sequence in all the viruses of this group, is the pentanucleotide: CCCCA (Figure 4A). Upon extensive analysis we were unable to find any kind of secondary structure or pseudoknot structure like in case of type C retroviruses. These conserved sequence provide a guide for t

186

PAV-VIo AcggCCAAA UAQG UaGACua.40ntaCo CCCCA gcea..44nt.CCCCAAAA PAVP AeggCCAAA UAQG UaGACuo.,a8nt.eM CCCCA eugcca..44ntCCCCAAAA MAV AcuoCCAAA UAQG U«GACu&.22nt.caa CCCCA gcca 80V AaugCuAAA UAQG UaOACgai.SlntgCa CCCCA accaao RMV AacoCCAAA UAQG UaOAC RPV AaeoCaAAA UAQG UaGAC0&.S8ntjeCo CCCCA ccuuea BWYV AacoCCAAA UAQG UaGACge..43nt.ACft CCCCA aaagaa PLRV-8 AaccCCAAA UAQG UaGACua.4Snt.ACu CCCCA gaagca r-A,C&N AacoCCAAA UAQG UaGACua.43nt.«Cu CCCCA aaagca PEMV gccuCCcuo UgaG ggGACga..49nt.cao CCCCA agueco 8T9 gaaguuAAA UAQG goQgCcu..57ni.gga CCCCA cgaauo GARNI uuuoCCAAA UAQG ggGgCcu..41nt«Co aCCCA ucagug CARN2 AaguaCcAg UAQu UgGAaag,.56nt..aau CCCCA aaceug CCFV uuug uCcgo UAQG gQugCuu,.75nigCe CCCCA aaauac MN8V uugguCAAo UAQG gGugCeu.,75ni.cao aCCCA gaoaug MCMV gaguugAAA UAQG gGugucu..42ntaCa CCCCA aaaeuo TCV uuug uCcge UAQG gGugCuu..74nt.gCo CCCgA aaauao B Mo-MuLV gaugao UAQGG agGUCAGGGUcaggago CCCCCC ..2ent.GGGQGGCA AKR-MuLV gaogao UAQGG ggGUCAGGGUcaggago CCCCCC ..2ent..QQQGGQCA 8NV uuacaa UAQGG ccGUCAGGGUucucccg CCCuCC ..20nt..QQGQQQCA BaEV agcgaa UAQGG guGUCAGGGc ucuggag CCCCCC ..26nt..GGGGGGCA

SIN GgaggACugaAuac UQAC UAacCgGGGuaGG MID GuuuaACgucAgea UQAC UAgaCcGGGcgGG

TMVC-Ain gcaflgaaoaCAAjUAQCAAUUAlcagauu

Figure. 4 Possible signals of stop codon readthrough in various plant and animal viruses (boxed region). 187

mutagenesis studies aimed at elucidating the mechanism of readthrough for the luteovirus class.

The signals required for readthrough in other classes seems to be very simple. The stop codons of TMV, TRV and alpha virus group of readthrough is followed immediately by a cytosine residue (Figure 4C and 4D), the rarest base in eukaryotic tetranucleotide stop signals (Brown et al., 1990). Hence, this may favor slow decoding, and enhanced suppression. In case of TMV (Skuzesiti et al., 1991) and Sindbis virus (Li and Rice, 1993) changing this C resulted in complete abolishment of the readthrough efficiency. In Sindbis virus this C alone is sufficient to mediate the readthrough level of 10% (Li and Rice, 1993). In TMV the sequence CAR-YYA (R = purine, Y = pyrimidine) adjacent to the UAG codon is required for efficient readthrough (Skuzeski et al., 1991).