Prenatal Zinc Supplementation Attenuates Lipopolysaccharide

Behavioural Brain Research 377 (2020) 112247

Contents lists available at ScienceDirect

Behavioural Brain Research

journal homepage: www.elsevier.com/locate/bbr

Research report Prenatal zinc supplementation attenuates lipopolysaccharide-induced behavioral impairments in maternal immune activation model T ⁎ Faezeh Alizadeha, Nahid Davoodianb,c, , Haniyeh Kazemib, Maryam Ghasemi-Kasmand,e, Fatemeh Shaerzadehf a Endocrinology and Metabolism Research Center, Hormozgan University of Medical Sciences, Bandar Abbas, Iran b Molecular Medicine Research Center, Hormozgan Health Institute, Hormozgan University of Medical Sciences, Bandar Abbas, Iran c Department of Clinical Biochemistry, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran d Infertility and Reproductive Health Research Center, Health Research Institute, Babol University of Medical Science, Babol, Iran e Cellular and Molecular Biology Research Center, Health Research Institute, Babol University of Medical Sciences, Babol, Iran f Department of Neuroscience, University of Florida College of Medicine and McKnight Brain Institute, Gainesville, FL, 32610, USA

ARTICLE INFO ABSTRACT

Keywords: Maternal infection during pregnancy is considered a key risk factor for developing schizophrenia in offspring. Zinc supplementation There is evidence that maternal exposure to infectious agents is associated with fetal zinc deficiency. Due to the Schizophrenia essential role of zinc in brain function and development, in the present study, we activated maternal immune Lipopolysaccharide system using lipopolysaccharide (LPS) as a model of schizophrenia to examine whether zinc supplementation Working memory throughout pregnancy can reverse LPS-induced deleterious effects. Neurodevelopmental deficits To test the hypothesis, pregnant rats were treated with intraperitoneal injection of either saline or LPS (0.5 mg/kg) at gestational day 15 and 16, and zinc supplementation (30 mg/kg) was administered throughout pregnancy by gavage. At postnatal day 60, Y-maze was used to evaluate working memory of offspring. Moreover, the expression levels of catechol O-methyltransferase (COMT) and glutamate decarboxylase 67 (GAD67) were measured in the frontal cortex of the brain samples. Only male offspring prenatally exposed to LPS showed a significant impairment in working memory. In addition, prenatal LPS exposure causes a moderate decrease in GAD67 expression level in the male pups, while COMT expression was found unchanged. Interestingly, zinc supplementation restored the alterations in working memory as well as GAD67 mRNA level in the male rats. No alteration was detected for neither working memory nor COMT/GAD67 genes expression in female offspring. This study demonstrates that zinc supplementation during pregnancy can attenuate LPS-induced impairments in male pups. These results support the idea to consume zinc supplementation during pregnancy to limit neurodevelopmental deficits induced by infections in offspring.

1. Introduction lack of emotion and interest in life and social withdrawal, while cognitive symptoms are specifically connected to memory, attention, and Schizophrenia is a devastating mental illness affecting an estimated executive functions [3]. one percent of the world’s population with a higher incidence and As a multifactorial mental disease, genetic and environmental fac- earlier onset in males compared to females [1]. Currently, there is no tors have been identified to be involved in the pathogenesis of schizo- single physical or lab test for schizophrenia and diagnosis is typically phrenia [3]. To date, there is a large body of evidence supporting the based on the behavioral criteria [2]. The clinical features of schizo- role for maternal infection and prenatal complications to disturb neu- phrenia, which disturb cognition, behavior, perception, and thought, rodevelopment which is associated with an elevated risk to develop are typically classified into positive, negative, and cognitive symptoms. schizophrenia [4–6]. In line with these findings, animal studies have Positive symptoms, which characterized by the existence of abnormal confirmed that prenatal exposure to infectious agents such as lipopo- behavior, include hallucinations, delusions, and catatonic behavior. lysaccharide (LPS) and viral mimic polyinosinic-polycytidilic acid (Poly Negative symptoms, reflecting the absence of normal functions, include I:C) leads to maternal immune stimulation and ultimately behavioral

⁎ Corresponding author at: Department of Biochemistry, Faculty of Medicine, Hormozgan University of Medical Sciences, Bandar Abbas, Iran. E-mail address: [email protected] (N. Davoodian). https://doi.org/10.1016/j.bbr.2019.112247 Received 7 July 2019; Received in revised form 5 September 2019; Accepted 16 September 2019 Available online 20 September 2019 0166-4328/ © 2019 Elsevier B.V. All rights reserved. F. Alizadeh, et al. Behavioural Brain Research 377 (2020) 112247 and neurobiological abnormalities related to schizophrenia. As such, deficiency which leads to teratogenicity in fetus [25]. Similar findings different protocols in term of infectious agent’s dose, administration at were also reported by Chua et al. showing a reduced maternal plasma various time points during gestation, and single or repeated injections zinc concentration upon LPS administration (0.5 mg/kg, s.c.) on GD16 have been reported by several in vivo studies which suggested maternal in mice [26]. immune activation (MIA) as an excellent model to evaluate the pa- In the present study, we utilized maternal immune activation using thophysiology of this psychiatric disease [7–10]. In this context, it is LPS as a model of schizophrenia to examine whether zinc supple- important to note that MIA animal model is a neurodevelopmental mentation throughout pregnancy can reserve LPS-induced behavioral model with construct validity for both schizophrenia and autism spec- impairments which were performed by Y-maze tests. In addition, we trum disorders (ASD) and predictive validity for schizophrenia. Inter- evaluated the effect of zinc supplementation on LPS mediated changes estingly, MIA offspring exhibit behavioral impairments, abnormalities in GAD67 and COMT mRNA levels in frontal cortex using quantitative in gene expression, and neuropathology associated with both ASD and real-time PCR (qPCR). schizophrenia [11]. Although the particular molecular and cellular mechanisms of schizophrenia are yet to be fully determined, several prominent hy- 2. Material and methods pothesizes including dopaminergic, glutamatergic, immune, gamma aminobutyric acid (GABAergic) and neurodevelopmental hypothesis 2.1. Animal have been identified to be involved in schizophrenia pathophysiology [3]. Of particular interest is dopamine hypothesis which have been Wistar rats (12–16 weeks old, 250–270 g; Hormozgan University of based on the fact that all common antipsychotic drugs block the do- Medical Sciences) were kept in a controlled temperature and humidity pamine D2 receptors. Interestingly, the decreased dopaminergic neu- environment (22 °C/60–70%) with a 12:12 h light-dark cycle (light on: rotransmission in prefrontal cortex (PFC) has been speculated to be 7 a.m. to 7 p.m.) and unlimited access to food and water. Animal care linked to the negative symptoms in schizophrenic patients [12]. In this and experiments were carried out based on National Institutes of Health regard, alterations in gene expression and functional polymorphism of guide for the care and use of laboratory animals and all experimental catechol O-methyltransferase (COMT), a key enzyme involved in do- protocols used in this study were approved by the local Institutional pamine inactivation, have been reported as a risk factor for abnormality Ethics Committee approval (HUMS.REC.1396.45). of dopamine neurotransmission in PFC and schizophrenia development [13,14]. Of additional interest is GABAergic system of brain which has been found to be implicated in the disease pathology. Indeed, dysre- 2.2. Treatment gulation of the 67 kDa isoform of glutamic acid decarboxylase (GAD67), fi which is involved in the GABA biosynthesis, has been reported in pre- The male and female rats were mated and pregnancy was con rmed fi frontal and other brain regions of schizophrenia suffering patients [15]. by detecting spermatozoa in vaginal smears at the rst day after mating fi fi Nutritional deficiencies such as mineral dyshomeostasis and vita- (gestational day 1, GD1). From the rst day of pregnancy con rmation, mins deficiencies has been linked to a number of neurological ab- the pregnant rats were randomly divided into four groups as follows: normalities including schizophrenia [16]. Consistent with this, nu- Group 1 (control + vehicle, 6 litters) and Group 2 (LPS + vehicle, 6 merous investigators have pointed to zinc dyshomeostasis as a key litters): pregnant rats were treated with intraperitoneal (i.p.) injection player in depression and several psychiatric disorders [17–19]. Zinc, as of either saline or LPS (0.5 mg/kg) at GD15 and 16, respectively, and a second the most abundant trace element in human body, is required also gavaged with vehicle (water) throughout their pregnancy [10]. for many biological processes such as immune responses, cell growth Group 3 (LPS + Zinc, 6 litters): pregnant rats were administered i.p. and division, wound healing, development and most importantly ner- injection of LPS (0.5 mg/kg) on GD15-16 and also gavaged with ZnSO4 vous system functions [20]. Zinc dyshomeostasis in the central nervous (30 mg/kg) daily throughout the gestational period [27]. Group 4 system leads to disturbance in synaptic plasticity, cognitive decline, (saline + Zinc, 6 litters): pregnant rats received injection of saline (i.p.) memory and learning impairment [19,21]. In support of this, several on GD15-16 and meanwhile were daily supplemented with ZnSO4 animal studies showing a correlation between prenatal zinc deficiency (30 mg/kg) through 21 days of pregnancy (Fig. 1). ff and offspring behavior, cognitive [22], and immune impairments [23] In the current study, subjects were both female and male o spring have demonstrated that zinc supplementation of pregnant rats can re- which born to these dams. Pups were distributed by sex and treatment cover the mentioned deficits in pups. Added to this, a recent study has on postnatal day (PND) 21 and left undisturbed until behavioral and reported the beneeficial ffect of zinc supplementation on prevention of biochemical experiments at PND 60. For behavioral tests, 2 animals per ff offspring neurochemical, biochemical, and behavioral deficits induced litter was used. However, to avoid litter e ects, the mean of animals by maternal LPS exposure [24]. Of note, it has been shown that ma- within litter was calculated (n = 6). For qPCR, we used one animal per ternal exposure to infectious agents is associated with fetal zinc litter (n = 6). The tissues from the excess animals were processed for other experiments not reported here.

Fig. 1. Experimental design. Pregnant rats were received zinc supplementation (30 mg/kg) throughout pregnancy. LPS (0.5 mg/kg, i.p.) or saline was administrated on GD15 and 16. On PND 60, The resulting oﬀspring were subjected to behavioral tests using Y-maze. Afterwards, all pups were sacriﬁced and the frontal cortex of brain were collected for qPCR. GD: gestational day, PND: postnatal day, LPS: lipopolysaccharide.

2 F. Alizadeh, et al. Behavioural Brain Research 377 (2020) 112247

2.3. Behavioral tests Table 1 Primer sequences for qPCR analysis.

The Y-maze test was conducted to investigate whether prenatal zinc Genes Accession No. Primer Sequences supplementation had any modulating eﬀect on working memory impairment induced by LPS [28]. For this reason, female and male oﬀ- GAD67 NM_017007.1 Sense 5'- GCTGGAAGGCATGGAAGGTTTTA -3' spring were subjected to both novel recognition test and spontaneous Antisense 5'- ACGGGTGCAATTTCATATGTGAACATA -3' COMT NM_012531.2 Sense 5'- CTTGACCACTGGAAAGACCG -3' alteration performance around PND 60. Prior to the tests, the pups were Antisense 5'- CGATGACGTTGTCAGCTAGGA -3' handled for three days (5 min daily) and testing was performed during GAPDH NM_017008.4 Sense 5'- ACGGCAAGTTCAACGGCACAG -3' the light cycle between 9 a.m. to 12 a.m. Antisense 5'- GACATACTCAGCACCAGCATCACC -3'

2.3.1. Y-maze spontaneous alternation performance 2.6. Statistical analysis Spatial working memory was assessed using a symmetrical Y-maze consisting of 3 arms with 50 cm length and 10 cm width as described Statistical analysis was conducted using GraphPad prism 6 software previously [28]. The procedure was a single 8 min session in which (GraphPad software Inc. San Diego, CA, USA). The results of behavioral every rat was randomly placed at the end of one arm and allowed to tests and qPCR were analyzed using 2-way analysis of variance explore all three arms freely. Meanwhile, each series of arm entry (ANOVA) followed by Bonferroni post hoc test with prenatal treatment (deﬁned as when all four paws of the animal were completely within (saline vs LPS) and maternal supplementation (vehicle vs zinc) as be- the arm) was visually recorded. The percentage of spontaneous alter- tween group variables. The data are presented as mean ± SEM and a nation was calculated according to the following formula: Number of value of p < 0.05 was considered to be statistically signiﬁcant. alternations/ (total number of arm entries-2) ×100, in which alternation was considered as the number of successive entries in three different arms (ABC, BCA, CBA, etc.). 3. Results

2.3.2. Y-maze recognition memory test 3.1. Spatial working memory and recognition memory impairments were The recognition memory test is based on an innate curiosity of ro- improved by maternal zinc supplementation dents to explore novel areas. The test was conducted using a Y-maze as previously described by Sarnyai et al. with some modifications [29]. To investigate whether prenatal zinc supplementation has the ca- The test session consisted of two different trials including training and pacity to prevent LPS-induced memory impairment, two memory tasks test trials. During the training trial, rats were allowed to freely explore including spontaneous alternation and recognition memory were per- maze with one blocked arm for 5 min followed by a 15-min inter-trial formed on male and female offspring. While no significant difference in interval. Afterwards, rats were returned to the maze with all accessible spontaneous alternation was observed for the female offspring arms for 2 min (test trial). The time spent within the novel arm was (Fig. 2B), male pups exhibited a moderate decrease in prenatal LPS + recorded and the recognition memory index was calculated as follow: vehicle treated group compared to control + vehicle (F (1, (the time spent in the novel arm / total time spent in all arms during the 26) = 8.594, p < 0.01). Prenatal zinc supplementation, however, sig- first minute of the second trial) ×100. nificantly reversed the working memory impairment induced by LPS (F (1, 26) = 9.270, p < 0.01) (Fig. 2A). A similar trend was also observed for the recognition memory test in 2.4. Tissue collection male offspring with a significant deficient memory in rats prenatally exposed to LPS compared to the control + vehicle group (F (1, On PND 60–62, animals (n = 6 per each group, one animal per litter 29) = 7.933, p < 0.01) (Fig. 2C). As expected, prenatal zinc supple- which selected randomly) were euthanized with asphyxiation by CO2 mentation was able to prevent LPS-induced impairment and pups spent and brain samples were collected for further analysis. For qPCR, frontal more time in the novel arm compared to the LPS + vehicle treated cortex of brain tissues was dissected on ice, immediately snap-frozen in group (F (1, 29) = 4.279, p < 0.05) (Fig. 2C). In contrast, female liquid nitrogen and finally stored at -80 °C until RNA extraction based offspring in all treated group exhibited no different preference for the on a study by Chiu et al [30]. novel arm compared to the control group (Fig. 2D).

2.5. RNA extraction and qPCR 3.2. Maternal zinc supplementation reverses LPS-induced reduction in RNA extraction and qPCR experiments were carried out in ac- GAD67 expression level but has no effect on COMT mRNA level cordance with MIQE guidelines [31]. TRI reagent (Sigma-Aldrich, USA) was used to extract total RNA from the samples. Total RNA con- qPCR was applied to address whether improvement in working centrations and purity were assessed using Nanodrop (Thermo Ficher, memory of LPS + Zinc group was associated with changes in GAD67 USA) and agarose gel electrophoresis, followed by DNase treatment and COMT expression level. To investigate this, total RNA was ex- (Fermentas, USA) according to the manufacturer’s instructions. One tracted from the frontal cortex and the expression level of both genes microgram of RNA samples was submitted to reverse transcription with was measured in offspring of all treated group. As shown in Fig. 3A, a cDNA synthesis kit (Thermo Ficher, USA) using oligo-dT primers GAD67 expression was significantly down-regulated upon prenatal LPS based on the manufacturer’s protocol. In order to evaluate gene ex- exposure by two-fold (F (1, 12) = 11.82, p < 0.01) in male pups. In- pression, cDNA was amplified in triplicate using specific primers tar- terestingly, prenatal zinc supplementation (LPS + Zinc group) was geting GAD67 and COMT (Table 1) in SYBR Premix Ex Taq II (Takara, found to significantly elevate the mRNA level of GAD67 by nearly two- Japan). The reaction was performed in a Mic qPCR system (Australia) fold (F (1, 12) = 15.57, p < 0.05) compared to the LPS + vehicle with a three-step procedure. The PCR cycling was initiated at 95 °C for group (Fig. 3A). No significant change in GAD67 expression was de- 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at tected for the female pups (Fig. 3B) in different experimental groups. 60 °C for 30 s, and extension at 72 °C for 30 s. As a reference gene, the Our data indicated that the mRNA level of COMT remained un- expression of GAPDH was used to normalize the expression levels of changed following prenatal LPS administration, with no significant ef- target genes. Finally, the relative quantification of gene expression was fect of maternal zinc supplementation for both treated male and female −ΔΔCt calculated using the comparative Ct (2 ) method. offspring (Fig. 3C-D).

3 F. Alizadeh, et al. Behavioural Brain Research 377 (2020) 112247

Fig. 2. Behavioral impairments were improved by maternal zinc supplementation in male offspring prenatally exposed to LPS. Prenatally exposed to LPS induced a significant decrease in both spontaneous alternation and recognition memory tests compared to control. These deficits were reversed by zinc supplementation throughout pregnancy (A, C). No significant behavioral impairments were observed for female offspring (B, D). Data are expressed as mean ± SEM, n = 6. **p < 0.01 relative to control + vehicle group. #p < 0.05, ##p < 0.01 relative to LPS + vehicle group. LPS: lipopolysaccharide.

4. Discussion phenotype associated with schizophrenia in the offspring. In contrast, no alteration in working memory was observed in LPS-exposed female As a devastating psychiatric disorder, schizophrenia has been found offspring. However, the general consensus from the literatures is that to be related to both genetic and environmental risk factors [3]. In males display an earlier symptoms onset of the disease compared to the particular, environmental factors including prenatal infection, mal- females [1], there are controversial results about the sex difference in nutrition, drug abuse, and birth complications have become the focus of cognitive performance of schizophrenic patients. While Roesch-Ely investigation in recent years with regard to schizophrenia etiology et al. reported a lack of any significant gender difference in working [3,32]. An increasing number of studies have revealed a tight connec- memory related to PFC [36], a recent study has documented more tion between the altered level of trace elements and an increased risk cognitive impairments in working memory in the male than female for schizophrenia [33–35]. In the present study, we investigated the schizophrenic patients [37]. Similar to the human studies, conflicting beneficial effects of zinc supplementation on both male and female results have been observed in animal models of schizophrenia. In line offspring prenatally exposed to maternal LPS. The main findings of the with our results, signifi cant deficits in working memory was reported in study are as follow: (1) the prenatal treatment with LPS resulted in the male offspring prenatally exposed to LPS (0.5 mg/kg, s.c.) at GD10/ significant working memory impairments as well as a decreased ex- 11 [9]. Using a similar protocol with a different LPS dose (0.1 mg/kg, pression level of GAD67 in the frontal cortex of male offspring. (2) i.p., GD15/16), however, Santos-Toscano et al. showed that female prenatal zinc supplementation was able to ameliorate the mentioned pups exhibited worse impairments in working memory than males upon deficits induced by maternal LPS exposure. (3) by contrast, LPS ex- maternal LPS treatment [8]. Further research in the model of MIA posure was ineffective on behavioral phenotype, GAD67, and COMT found that prenatal treatment with Poly I:C (5 mg/kg, i.v., GD7) in- expression level in female offspring. duces impairment in spatial working memory of male pups using the Morris water maze [38]. The discrepancies observed in these studies ff 4.1. The effects of prenatal treatment with LPS may be due to the di erences in methodology, infectious agents, animal strains, and the age of the animals. According to the neurodevelopmental hypothesis, maternal infec- Given the important role of PFC in cognition as well as the im- – tion during pregnancy is a key risk factor for the development of plication of neurotransmitters in particular dopamine and GABA in the fi schizophrenia in the offspring [3]. Based on this evidence, a number of pathophysiology of schizophrenia, for the rst time, we evaluated the studies did provide support for the use of MIA as a model to study the expression levels of GAD and COMT in frontal cortex in a MIA model of pathophysiology of schizophrenia. These studies also demonstrated that schizophrenia. Of note, due to the inconsistency in anatomical and fi ffi animals prenatally exposed to infectious agents such as LPS, showed functional de nition of PFC area in rat [39], it was di cult to isolate significant behavioral impairments, evident in a variety of behavioral the exact area. Therefore, in the present study, frontal cortex was dis- experiments including Morris water maze, T-maze, and pre-pulse in- sected which contains PFC for gene expression analysis. hibition (PPI) [7–10]. Consistent with these reports, we showed the Evidence has presented GAD67 as an important gene involved in the impaired working memory in LPS-exposed male pups confirming that pathophysiology of schizophrenia [3]. The majority of postmortem maternal infection induced by LPS makes a long-lasting behavioral studies have consistently found the diminished mRNA level of GAD67

4 F. Alizadeh, et al. Behavioural Brain Research 377 (2020) 112247

Fig. 3. Reduction in GAD67 mRNA level was reversed by maternal zinc supplementation in male offspring prenatally exposed to LPS. Maternal LPS treatment led to a significant decrease in the expression level of GAD67 in the frontal cortex of male offspring. This reduction was reversed by zinc supplementation throughout pregnancy (A). No significant difference in GAD67 expression level was detected for female offspring (B). COMT mRNA level was unchanged between the groups for both male and female pups (C, D). GAPDH expression was used for normalization of the target genes. Data are expressed as mean ± SEM, n = 6. **p < 0.01 relative to control + vehicle group. #p < 0.05 relative to LPS + vehicle group. LPS: lipopolysaccharide, GAD67: glutamate decarboxylase 67, COMT: catechol O-methyltransferase. in the dorsolateral PFC (DLPFC) region which results in decreased at 12 weeks [47]. The reason for this discrepancy might be explained by GABA concentrations and eventually cognitive impairment in schizo- the difference in animal model and the age of testing. phrenic patients [40]. Our results also showed a significant decrease in GAD67 expression in frontal cortex of the male rats prenatally treated ff with LPS. In agreement with this finding, Bullock et al. also demon- 4.2. The e ects of prenatal zinc supplementation strated the reduced expression of GAD67 in the cerebellum in phencyclidine (PCP) treated rat model. In addition, they reported the similar It is well-known that zinc, having critical role in many cellular results in lateral cerebellar hemisphere of patients suffering from processes, is an essential trace element for normal brain growth and fi schizophrenia [41]. Added to this, Sandhu et al. described disruption of functions [48]. In this regard, zinc dyshomeostasis has been identi ed ff social behavior as well as reduced intermale aggression in male GAD67 to strongly a ect cognition which ultimately results in neurological haplodeficient mice [42]. These findings provide strong support for the abnormalities [17,18]. Added to this, several studies have demon- fi idea that GABAergic interneurons may be responsible for some of strated an intimate connection between zinc de ciency and impair- cognitive impairments observed in schizophrenia. ments in learning and working memory, in which reduction in Brain- Several studies demonstrated the role of dopaminergic impairments derived neurotrophic factor (BDNF) has been suggested as a possible in prefrontal brain regions of schizophrenic patients [3]. COMT, which mechanism [21,22]. Another possible mechanism is that zinc, acting as has been identified as being involved in cognition, is expressed sig- an antagonist, is capable of inducing functional changes in N-methyl-D- nificantly at the higher level in the PFC compared to the dopaminergic aspartate (NMDA) receptor [49 ] and is therefore considered as a pu- areas of brain, striatum, and brainstem [43]. Despite of apparent in- tative modulator of neuronal signaling. Interestingly, an animal study consistency in the literature, numerous studies have described the as- has shown that gestational exposure to LPS leads to a sharp reduction in sociation between COMT polymorphism and cognitive impairments in maternal zinc plasma level which induces abnormalities in fetuses patients with schizophrenia [44,45]. A recent meta-analysis by Gon- [25,26]. Another study by the same group demonstrated that zinc zález-Castro et al. have reported a statistical relation between COMT supplementation throughout pregnancy can prevent the memory im- genotype and the risk of schizophrenia [46]. Interestingly, no evidence pairment induced by prenatal LPS exposure (0.3 mg/kg, s.c., GD8) [50]. was found for the relation between COMT mRNA level and COMT Likewise, our results revealed that zinc supplementation given from the fi genotype in this disease [13,14] supporting that enzyme activity is rst day of pregnancy attenuated spatial working memory impairment fi more critical parameter than mRNA and protein levels. In line with this as well as recognition memory de cit in the male pups prenatally finding, our result also showed unchanged COMT mRNA level between treated with LPS. Similar trends were also presented by more recent treated groups. In an animal model of prenatal asphyxia, however, in- study in which zinc supplementation during pregnancy was found to ff creased COMT expression was observed in medial PFC of male offspring reverse the e ects of LPS (0.2 mg/kg, i.p., GD14) on behavioral, neurochemical, and biochemical parameters in the offspring [24]. In

5 F. Alizadeh, et al. Behavioural Brain Research 377 (2020) 112247 addition to this work, results from Kirsten et al. also suggested a ben- [4] A.S. Brown, E.J. Derkits, Prenatal infection and schizophrenia: a review of epide- eficial effect of maternal zinc supplementation to prevent communica- miologic and translational studies, Am. J. Psychiatry 167 (3) (2009) 261–280, ff https://doi.org/10.1176/appi.ajp.2009.09030361. tion impairment and BDNF hyperactivity in the o spring prenatally [5] A.S. Brown, J. Hooton, C.A. Schaefer, H. Zhang, E. Petkova, V. Babulas, M. Perrin, exposed to LPS (0.1 mg/kg, i.p., GD9.5) [51]. The molecular mechan- J.M. Gorman, E.S. Susser, Elevated maternal interleukin-8 levels and risk of schi- isms how zinc exerts a protective effect on the cognition deficits in- zophrenia in adult offspring, Am. J. Psychiatry 161 (5) (2004) 889–895, https:// doi.org/10.1176/appi.ajp.161.5.889. duced by LPS remain largely elusive. One potential mechanism is that [6] S.L. Buka, M.T. Tsuang, E.F. Torrey, M.A. Klebanoff, R.L. Wagner, R.H. Yolken, zinc supplementation may prevent the fetal zinc deficiency induced by Maternal cytokine levels during pregnancy and adult psychosis, Brain Behav. maternal infection. There is evidence that maternal treatment with LPS Immun. 15 (4) (2001) 411–420 https://linkinghub.elsevier.com/retrieve/pii/ induces a dramatic increase in hepatic metallothionein, a zinc-binding S0889159101906440. [7] D. Mattei, A. Djodari-Irani, R. Hadar, A. Pelz, L.F. de Cossío, T. Goetz, M. Matyash, protein, followed by the movement of zinc from plasma to the liver and H. Kettenmann, C. Winter, S.A. Wolf, Minocycline rescues decrease in neurogenesis, eventually reduction in available zinc for fetal transfer [25]. Another increase in microglia cytokines and deficits in sensorimotor gating in an animal – mechanism for the protective effect of zinc might be due to its anti- model of schizophrenia, Brain Behav. Immun. 38 (2014) 175 184, https://doi.org/ ff 10.1016/j.bbi.2014.01.019. oxidant property by which it can modulate the adverse e ects induced [8] R. Santos-Toscano, É. Borcel, M. Ucha, J. Orihuel, R. Capellán, D. Roura-Martínez, by LPS [52]. E. Ambrosio, A. Higuera-Matas, Unaltered cocaine self-administration in the pre- In addition, our study revealed that zinc supplementation restored natal LPS rat model of schizophrenia, Prog. Neuropsychopharmacol. Biol. Psychiatry 69 (2016) 38–48, https://doi.org/10.1016/j.pnpbp.2016.04.008. the expression of GAD67 disrupted by prenatally exposed to LPS [9] U. Waterhouse, V.E. Roper, K.A. Brennan, B.A. Ellenbroek, Nicotine ameliorates treatment in male pups. As of today, a significant number of studies schizophrenia-like cognitive deficits induced by maternal LPS exposure: a study in have highlighted the dysregulation of GAD67 in multiple brain regions, rats, Dis. Model. Mech. 9 (10) (2016) 1159–1167, https://doi.org/10.1242/dmm. 025072. in particular, the PFC of schizophrenia subjects [15,53]. However, there [10] L. Wischhof, E. Irrsack, C. Osorio, M. Koch, Prenatal LPS-exposure–a neurodeve- are a few studies which have examined the effect of pharmacological lopmental rat model of schizophrenia–differentially affects cognitive functions, treatments to prevent this impairment [54,55]. The underlying me- myelination and parvalbumin expression in male and female offspring, Prog. Neuropsychopharmacol. Biol. Psychiatry 57 (2015) 17–30, https://doi.org/10. chanisms how zinc supplementation could improve the GAD67 ex- 1016/j.pnpbp.2014.10.004. pression in the male rats exposed prenatally to LPS is not clear, al- [11] J. Prata, S.G. Santos, M.I. Almeida, R. Coelho, M.A. Barbosa, Bridging Autism though several possible mechanisms may account for this result. Zinc Spectrum disorders and Schizophrenia through inflammation and biomarkers-pre- fl serves as an essential component of many proteins structure, in parti- clinical and clinical investigations, J. Neuroin ammation 14 (1) (2017) 179, https://doi.org/10.1186/s12974-017-0938-y. cular RNA polymerase and zinc-finger proteins, a large family of tran- [12] O.D. Howes, S. Kapur, The dopamine hypothesis of schizophrenia: version III—the scription factors, which are of utmost importance for gene expression final common pathway, Schizophr. Bull. 35 (3) (2009) 549–562, https://doi.org/ [56]. Additionally, it should be noted that zinc efficiently involves in 10.1093/schbul/sbp006. fi [13] M. Matsumoto, C.S. Weickert, S. Beltaifa, B. Kolachana, J. Chen, T.M. Hyde, neurogenesis during brain development. As zinc de ciency leads to the M.M. Herman, D.R. Weinberger, J.E. Kleinman, Catechol O-methyltransferase reduction in cell proliferation and increase in apoptosis, consequently (COMT) mRNA expression in the dorsolateral prefrontal cortex of patients with results in the neurogenesis impairment and decreased number of cells schizophrenia, Neuropsychopharmacology 28 (8) (2003) 1521, https://doi.org/10. 1038/sj.npp.1300218. [48]. Therefore, this evidence leads to the assumption that zinc sup- [14] E. Tunbridge, P.W. Burnet, M.S. Sodhi, P.J. Harrison, Catechol‐o‐methyltransferase plementation indirectly affects the expression of GAD67 in LPS + zinc (COMT) and proline dehydrogenase (PRODH) mRNAs in the dorsolateral prefrontal group. cortex in schizophrenia, bipolar disorder, and major depression, Synapse 51 (2) (2004) 112–118, https://doi.org/10.1002/syn.10286. Taken together, the present study demonstrates that maternal LPS [15] S. Akbarian, H.-S. Huang, Molecular and cellular mechanisms of altered GAD1/ exposure causes working memory impairments and decrease in the GAD67 expression in schizophrenia and related disorders, Brain Res. Rev. 52 (2) expression of GAD67, without altering COMT expression in male off- (2006) 293–304, https://doi.org/10.1016/j.brainresrev.2006.04.001. fi [16] H.E. Brown, J.L. Roffman, Vitamin supplementation in the treatment of schizo- spring compared to the control. However, no signi cant changes in phrenia, CNS Drugs 28 (7) (2014) 611–622 https://link.springer.com/article/10. working memory and the expression levels of GAD67 and COMT was 1007%2Fs40263-014-0172-4. detected for female pups. Given that females display later age of [17] O. Grønli, J.M. Kvamme, O. Friborg, R. Wynn, Zinc deficiency is common in several symptoms onset compared to the males [1], the evaluation of beha- psychiatric disorders, PLoS One 8 (12) (2013) e82793, https://doi.org/10.1371/ journal.pone.0082793. vioral tests and genes expression in the older female pups would be of [18] M.A. Petrilli, T.M. Kranz, K. Kleinhaus, P. Joe, M. Getz, P. Johnson, M.V. Chao, interest. In addition, the present data highlights the therapeutic effect D. Malaspina, The emerging role for zinc in depression and psychosis, Front. Pharmacol. 8 (2017) 414, https://doi.org/10.3389/fphar.2017.00414. of zinc supplementation throughout pregnancy to limit neurodevelop- ’ fi [19] S.M. Hancock, D.I. Finkelstein, P.A. Adlard, Glia and zinc in ageing and Alzheimer s mental de cits in fetus induced by infectious agents. disease: a mechanism for cognitive decline? Front. Aging Neurosci. 6 (2014) 137, https://doi.org/10.3389/fnagi.2014.00137. Declaration of Competing Interest [20] A. Prakash, K. Bharti, A.B.A. Majeed, Zinc: indications in brain disorders, Fundam. Clin. Pharmacol. 29 (2) (2015) 131–149, https://doi.org/10.1111/fcp.12110. [21] V. Frazzini, A. Granzotto, M. Bomba, N. Massetti, V. Castelli, M. d’Aurora, M. Punzi, The Authors declare no conflict of interest. M. Iorio, A. Mosca, S.D. Pizzi, The pharmacological perturbation of brain zinc impairs BDNF-related signaling and the cognitive performances of young mice, Sci. Rep. 8 (1) (2018) 9768, https://doi.org/10.1038/s41598-018-28083-9. Acknowledgements [22] X. Yu, W. Chen, Z. Wei, T. Ren, X. Yang, X. Yu, Effects of maternal mild zinc deficiency and different ways of zinc supplementation for offspring on learning and This research was supported by a grant [No. 960105] from Research memory, Food Nutr. Res. 60 (1) (2016) 29467, https://doi.org/10.3402/fnr.v60. 29467. Vice-Chancellor of Hormozgan University of Medical Sciences (HUMS), [23] R. Raqib, M.B. Hossain, S.L. Kelleher, C.B. Stephensen, B. Lönnerdal, Zinc supple- Iran and was done as a part of Master of Science thesis in Clinical mentation of pregnant rats with adequate zinc nutriture suppresses immune func- Biochemistry. tions in their offspring, J. Nutr. 137 (4) (2007) 1037–1042, https://doi.org/10. 1093/jn/137.4.1037. [24] N. Sharma, P. Arora, B. Nehru, Prenatal zinc supplementation to lipopolysaccharide References infected female rats prevents neurochemical, behavioral and biochemical deficits produced in infants, Neuroimmunol Neuroinflammation. 4 (4) (2017) 33–45, https://doi.org/10.20517/2347-8659.2016.38. [1] J.J. McGrath, F.P. Féron, T.H. Burne, A. Mackay-Sim, D.W. Eyles, The neurodeve- [25] L.C. Carey, P.L. Berbée, P. Coyle, J.C. Philcox, A.M. Rofe, Zinc treatment prevents lopmental hypothesis of schizophrenia: a review of recent developments, Ann. Med. lipopolysaccharide‐induced teratogenicity in mice, Birth Defects Res A Clin Mol 35 (2) (2003) 86–93. Teratol. 67 (4) (2003) 240–245, https://doi.org/10.1002/bdra.10035. [2] A.P. Association, Diagnostic and Statistical Manual of Mental Disorders (DSM-5®), [26] J.S. Chua, C.J. Cowley, J. Manavis, A.M. Rofe, P. Coyle, Prenatal exposure to li- American Psychiatric Pub, 2013. popolysaccharide results in neurodevelopmental damage that is ameliorated by zinc [3] U.E. Lang, I. Puls, D.J. Müller, N. Strutz-Seebohm, J. Gallinat, Molecular mechan- in mice, Brain Behav. Immun. 26 (2) (2012) 326–336, https://doi.org/10.1016/j. isms of schizophrenia, Cell. Physiol. Biochem. 20 (6) (2007) 687–702, https://doi. bbi.2011.10.002. org/10.1159/000110430. [27] A. Moazedi, Z. Ghotbeddin, G. Parham, Comparison of the effects of dose-dependent

6 F. Alizadeh, et al. Behavioural Brain Research 377 (2020) 112247

zinc chloride on short-term and long-term memory in young male rats, Pak. J. Biol. D. Weinberger, Catechol O-methyltransferase mRNA expression in human and rat Sci. 10 (16) (2007) 2704–2708. brain: evidence for a role in cortical neuronal function, Neuroscience 116 (1) [28] M. Ghasemi‐Kasman, L. Zare, H. Baharvand, M. Javan, In vivo conversion of as- (2003) 127–137, https://doi.org/10.1016/S0306-4522(02)00556-0. trocytes to myelinating cells by miR‐302/367 and valproate to enhance myelin [44] K.E. Lewandowski, Relationship of catechol-O-methyltransferase to schizophrenia repair, J. Tissue Eng. Regen. Med. 12 (1) (2018) e462–e472, https://doi.org/10. and its correlates: evidence for associations and complex interactions, Harv. Rev. 1002/term.2276. Psychiatry 15 (5) (2007) 233–244, https://doi.org/10.1080/10673220701650409. [29] Z. Sarnyai, E.L. Sibille, C. Pavlides, R.J. Fenster, B.S. McEwen, M. Tóth, Impaired [45] C.T. Matsuzaka, D. Christofolini, V.K. Ota, A. Gadelha, A.A. Berberian, C. Noto, hippocampal-dependent learning and functional abnormalities in the hippocampus D.R. Mazzotti, L.M. Spindola, P.N. Moretti, M.A. Smith, Catechol-O-methyl- in mice lacking serotonin1A receptors, Proc. Natl. Acad. Sci. U.S.A. 97 (26) (2000) transferase (COMT) polymorphisms modulate working memory in individuals with 14731–14736, https://doi.org/10.1073/pnas.97.26.14731. schizophrenia and healthy controls, Braz J Psychiatry. 39 (4) (2017) 302–308, [30] K. Chiu, W.M. Lau, H.T. Lau, K.-F. So, R.C.-C. Chang, Micro-dissection of rat brain https://doi.org/10.1590/1516-4446-2016-1987. for RNA or protein extraction from specific brain region, J. Vis. Exp. 7 (2007) 269, [46] T.B. González-Castro, Y. Hernandez-Diaz, I.E. Juárez-Rojop, M.L. López-Narváez, https://doi.org/10.3791/269. C.A. Tovilla-Zárate, A. Fresan, The role of a Catechol-O-Methyltransferase (COMT) [31] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, Val158Met genetic polymorphism in schizophrenia: a systematic review and up- T. Nolan, M.W. Pfaffl, G.L. Shipley, The MIQE guidelines: minimum information for dated meta-analysis on 32,816 subjects, Neuromolecular Med. 18 (2) (2016) publication of quantitative real-time PCR experiments, Clin. Chem. 55 (4) (2009) 216–231, https://doi.org/10.1007/s12017-016-8392-z. 611–622, https://doi.org/10.1373/clinchem.2008.112797. [47] T. Wakuda, K. Iwata, Y. Iwata, A. Anitha, T. Takahashi, K. Yamada, M.M. Vasu, [32] K.I. Vadakkan, A structure-function mechanism for schizophrenia, Front. Psychiatry H. Matsuzaki, K. Suzuki, N. Mori, Perinatal asphyxia alters neuregulin-1 and COMT 3 (2012) 108, https://doi.org/10.3389/fpsyt.2012.00108. gene expression in the medial prefrontal cortex in rats, Prog. [33] L. Cai, T. Chen, J. Yang, K. Zhou, X. Yan, W. Chen, L. Sun, L. Li, S. Qin, P. Wang, Neuropsychopharmacol. Biol. Psychiatry 56 (2015) 149–154, https://doi.org/10. Serum trace element differences between Schizophrenia patients and controls in the 1016/j.pnpbp.2014.08.002. Han Chinese population, Sci. Rep. 5 (2015) 15013, https://doi.org/10.1038/ [48] C.W. Levenson, D. Morris, Zinc and neurogenesis: making new neurons from de- srep15013. velopment to adulthood, Adv. Nutr. 2 (2) (2011) 96–100, https://doi.org/10.3945/ [34] P. Joe, M. Petrilli, D. Malaspina, J. Weissman, Zinc in schizophrenia: a meta-ana- an.110.000174. lysis, Gen. Hosp. Psychiatry 53 (2018) 19–24, https://doi.org/10.1016/j. [49] R.E. Sirrieh, D.M. MacLean, V. Jayaraman, Amino-terminal domain tetramer or- genhosppsych.2018.04.004. ganization and structural effects of zinc binding in the N-methyl-D-aspartate [35] M. Yanik, A. Kocyigit, H. Tutkun, H. Vural, H. Herken, Plasma manganese, sele- (NMDA) receptor, J. Biol. Chem. 288 (31) (2013) 22555–22564, https://doi.org/ nium, zinc, copper, and iron concentrations in patients with schizophrenia, Biol. 10.1074/jbc.M113.482356. Trace Elem. Res. 98 (2) (2004) 109–117, https://doi.org/10.1385/BTER:98:2:109. [50] P. Coyle, N. Tran, J.N. Fung, B.L. Summers, A.M. Rofe, Maternal dietary zinc sup- [36] D. Roesch-Ely, E. Hornberger, S. Weiland, C. Hornstein, P. Parzer, C. Thomas, plementation prevents aberrant behaviour in an object recognition task in mice M. Weisbrod, Do sex differences affect prefrontal cortex associated cognition in offspring exposed to LPS in early pregnancy, Behav. Brain Res. 197 (1) (2009) schizophrenia? Schizophr. Res. 107 (2-3) (2009) 255–261, https://doi.org/10. 210–218, https://doi.org/10.1016/j.bbr.2008.08.022. 1016/j.schres.2008.09.021. [51] T.B. Kirsten, N. Queiroz-Hazarbassanov, M.M. Bernardi, L.F. Felicio, Prenatal zinc [37] B. Zhang, M. Han, S. Tan, F. De Yang, Y. Tan, S. Jiang, X. Zhang, X.-F. Huang, prevents communication impairments and BDNF disturbance in a rat model of Gender differences measured by the MATRICS consensus cognitive battery in autism induced by prenatal lipopolysaccharide exposure, Life Sci. 130 (2015) chronic schizophrenia patients, Sci. Rep. 7 (1) (2017) 11821, https://doi.org/10. 12–17, https://doi.org/10.1016/j.lfs.2015.02.027. 1038/s41598-017-12027-w. [52] G.G. Mackenzie, M.P. Zago, L. Aimo, P.I. Oteiza, Zinc deficiency in neuronal [38] U. Meyer, I. Knuesel, M. Nyffeler, J. Feldon, Chronic clozapine treatment improves biology, IUBMB Life 59 (4-5) (2007) 299–307, https://doi.org/10.1080/ prenatal infection-induced working memory deficits without influencing adult 15216540701225966. hippocampal neurogenesis, Psychopharmacology (Berl.) 208 (4) (2010) 531–543, [53] A.C. Mitchell, Y. Jiang, C. Peter, S. Akbarian, Transcriptional regulation of GAD1 https://doi.org/10.1007/s00213-009-1754-6. GABA synthesis gene in the prefrontal cortex of subjects with schizophrenia, [39] H.B. Uylings, H.J. Groenewegen, B. Kolb, Do rats have a prefrontal cortex? Behav. Schizophr. Res. 167 (1-3) (2015) 28–34, https://doi.org/10.1016/j.schres.2014.10. Brain Res. 146 (1-2) (2003) 3–17, https://doi.org/10.1016/j.bbr.2003.09.028. 020. [40] J.C. de Jonge, C.H. Vinkers, H. Pol, E. Hilleke, A. Marsman, GABAergic mechanisms [54] N. Goto, R. Yoshimura, S. Kakeda, J. Moriya, H. Hori, K. Hayashi, A. Ikenouchi- in schizophrenia: linking postmortem and in vivo studies, Front. Psychiatry 8 Sugita, W. Nakano-Umene, A. Katsuki, J. Nishimura, No alterations of brain GABA (2017) 118, https://doi.org/10.3389/fpsyt.2017.00118. after 6 months of treatment with atypical antipsychotic drugs in early-stage first- [41] W.M. Bullock, F. Bolognani, P. Botta, C.F. Valenzuela, N.I. Perrone-Bizzozero, episode schizophrenia, Prog. Neuropsychopharmacol. Biol. Psychiatry 34 (8) Schizophrenia-like GABAergic gene expression deficits in cerebellar Golgi cells from (2010) 1480–1483, https://doi.org/10.1016/j.pnpbp.2010.08.007. rats chronically exposed to low-dose phencyclidine, Neurochem. Int. 55 (8) (2009) [55] O. Kelemen, I. Kiss, G. Benedek, S. Kéri, Perceptual and cognitive effects of anti- 775–782, https://doi.org/10.1016/j.neuint.2009.07.010. psychotics in first-episode schizophrenia: the potential impact of GABA con- [42] K. Sandhu, D. Lang, B. Müller, S. Nullmeier, Y. Yanagawa, H. Schwegler, O. Stork, centration in the visual cortex, Prog. Neuropsychopharmacol. Biol. Psychiatry 47 Glutamic acid decarboxylase 67 haplodeficiency impairs social behavior in mice, (2013) 13–19, https://doi.org/10.1016/j.pnpbp.2013.07.024. Genes Brain Behav. 13 (4) (2014) 439–450, https://doi.org/10.1111/gbb.12131. [56] T.V. O’halloran, Transition metals in control of gene expression, Science 261 (5122) [43] M. Matsumoto, C.S. Weickert, M. Akil, B. Lipska, T. Hyde, M. Herman, J. Kleinman, (1993) 715–725, https://doi.org/10.1126/science.8342038.