Mucopolysaccharidosis Type IIIB and Galnac Transferase Double

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2012 Mucopolysaccharidosis type IIIB and GalNAc Transferase double knockout mice and additional studies in gene therapy and animal models to assess pathogenesis and therapy Eman Elsayed Abass Mohammed Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Genetics Commons, Molecular Biology Commons, and the Nanoscience and Nanotechnology Commons

Recommended Citation Mohammed, Eman Elsayed Abass, "Mucopolysaccharidosis type IIIB and GalNAc Transferase double knockout mice and additional studies in gene therapy and animal models to assess pathogenesis and therapy" (2012). Graduate Theses and Dissertations. 12410. https://lib.dr.iastate.edu/etd/12410

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Mucopolysaccharidosis type IIIB and GalNAc Transferase double knockout mice and additional studies in gene therapy and animal

models to assess pathogenesis and therapy

Eman Mohammed

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Genetics

Program of Study Committee: N. Matthew Ellinwood, Major Professor Anumantha Kanthasamy Donald Sakaguchi M. Heather West Greenlee Elizabeth Whitley Joan Cunnick

Iowa State University Ames, Iowa 2012

Table of Contents

ACKNOWLEDGMENTS ...... viii

ABSTRACT ...... ix

CHAPTER 1: MUCOPOLYSACCHARIDOSIS TYPE IIIB ...... 1

Introduction ...... 1

The NAGLU Gene and Enzyme in the Normal State ...... 2

Human NAGLU gene description ...... 2

NAGLU RNA processing ...... 4

NAGLU mRNA Translation ...... 6

NAGLU and Co-Translational Insertion ...... 7

Naglu Enzyme Folding and Maturation ...... 8

Enzyme Glycosylation ...... 9

Mannose-6-Phosphorylation and Lysosomal Targeting ...... 9

Enzyme Structure and Function ...... 10

Naglu Substrate ...... 11

MPS IIIB: From Gene to Protein ...... 11

Molecular defects underlying MPS IIIB ...... 11

Mutations at the Chromosomal Level ...... 12

Mutations Affecting Promoter Function ...... 12

Mutations Affecting Normal Transcript Maturation and Transport ...... 12

iii

Mutations Affecting Normal Translation ...... 13

Mutations Affecting Normal Protein Folding, Maturation, and Trafficking . 14

Mutations that Affect Catalytic Capacity ...... 15

Therapeutics strategies for the CNS in MPS IIIB ...... 15

Generic and Specific Challenges of MPS IIIB Targeted Therapies ...... 16

Blood Brain Barrier (BBB) ...... 16

Mannose-6-Phosphate tagging ...... 16

Therapeutic Approaches That Address Enzyme Deficiency ...... 17

Gene Therapy ...... 17

Cell Therapy ...... 19

Enzyme Replacement Therapy (ERT) ...... 19

Enzyme Enhancement Therapy (EET) ...... 20

Stop Codon Read-Through Mediated Therapy ...... 20

Therapeutic Approaches That Decrease Substrate Load ...... 21

Drug Therapy ...... 21

Summary/Conclusion: ...... 22

Development of LDSs therapy ...... 24

The β-1, 4-Nacetylgalactosaminyltransferase (GalNAcT) mouse ...... 24

Double Knockout Mice Approach ...... 25

Contributions by Authors in this Work ...... 26

References ...... 27

CHAPTER 2: MPS IIIB AND GalNAcT DOUBLE KNOCKOUT MICE ...... 42

Abstract ...... 43

Introduction: ...... 45

2.0 Materials and methods ...... 47

2.1 Mice ...... 47

2.2 Behavioral and clinical monitoring ...... 49

2.3 Life span ...... 49

2.4 Rota-Rod ...... 50

2.5 Ganglioside ...... 50

2.6 Histology ...... 50

2.7 Gene Therapy ...... 51

2.8 Statistical analysis ...... 51

3.0 Results: ...... 52

3.1 Mouse production, and clinical progression ...... 52

3.2 Survivorship and lifespan ...... 53

3.2 Rota-Rod ...... 54

3.2 Glycosphingolipid Biochemistry ...... 54

3.3 Histology ...... 55

3.4 Gene Therapy ...... 57

Discussion: ...... 58

Acknowledgements ...... 61

References ...... 62

Figure 1...... 68

Figure 2...... 69

Figure 3...... 70

Figure 4...... 71

CHAPTER 3: RECOMBINANT DNA FOR MPS III RESEARCH ...... 73

Introduction ...... 73

Pathology in MPS III; The cellular level in CNS ...... 73

Understanding MPS III; from brain pathology to clinical signs ...... 74

Conditional knockout technique ...... 74

Conditional gene KO approach in the brain ...... 74

New KO technology for MPS III ...... 76

A conditional gene KO model for MPS IIIC disease ...... 76

Combination of therapeutic strategies for MPS III ...... 77

Gene therapy augmented HBCT in mouse models ...... 77

Advantages of the combination of two therapeutic strategies for MPS III .... 78

Plasmid construction ...... 79

Materials and Methods ...... 79

Results ...... 80

Subcloning of the MPS IIIC vector ...... 81

References ...... 83

Figure1...... 86

Figure2...... 87

Figure3...... 88

Figure 4...... 89

CHAPTER 4: CONCLUSIONS AND DISCUSSIONS ...... 91

Conclusions ...... 91

Future studies ...... 94

References ...... 97

APPENDIX A: BIOCHEMICAL ANALYSIS TREATED ANIMAL MODELS ...... 98

Gene Therapy ...... 98

Approaches and Techniques ...... 98

History of Techniques ...... 99

Naglu Enzyme Assay Methods ...... 99

vii

Fluormetric methods ...... 99

References ...... 100

APPENDIX B: SAFE AND EFFICIENT GENE THERAPY IN DOG MODELS ...... 102

Abstract ...... 104

Introduction ...... 105

Results ...... 108

Discussion ...... 116

Materials and Methods ...... 122

Statistical analysis ...... 129

Supplementary material ...... 129

Acknowledgements ...... 129

References ...... 131

Table 1...... 136

Figure1...... 138

Figure2...... 140

Figure3...... 143

Figure 4...... 145

viii

ACKNOWLEDGMENTS

I would like to express my sincere and deepest thanks and appreciation to my advisor and mentor, Dr. N. Matthew Ellinwood for his support, direction, and encouragement during my research, academic work, and my ordinary life. During my research I have learned a lot from Dr. Ellinwood. I would like to acknowledge the past and present Dr. Ellinwood research group members who have given me guidance, assistance, and suggestions. Without Dr. Ellinwood help, this thesis couldn’t have been done. I would like to express my deepest thanks to my committee members; Dr. Anumantha Kanthasamy, Dr. Donald Sakaguchi, Dr.

Elizabeth Whitley, Dr. M Heather West Greenlee, and Dr. Joan Cunnick. They have provided, with kindness, their insight and suggestions, which are precious to me. I would like to thank all professors and faculty who taught and helped me during my studies in the Interdepartmental Genetics Program and Animal Science Department at Iowa State University. Great thanks to my country, Egypt, for funding this scholarship and giving me a great chance to study abroad. Thanks to the Children’s

Medical Research Foundation, the Lauren’s Hope Foundation, the Lysosomal

Storage Disease Research Consortium, the Sanfilippo Children’s Research

Foundation, and the Battel Animal infrastructure and Research Platform for the financial support of this work. Finally, I would like to thank my mother, father, two sisters, brother, two nieces, and nephew for their continuing love, patience, understanding, support, and prayers. Special thanks to all my friends who were like my family here and helped me so much.

ABSTRACT

The Mucopolysaccharidoses (MPSs) are a class of lysosomal storage diseases characterized by lysosomal accumulation of glycosaminoglycan (GAG).

Understanding the pathogenesis of the neuropathic forms of MPS and improving treatment options for these disorders are major areas of research in the laboratory of

Dr. Ellinwood. The neuropathic MPSs include MPS I, II, III (A-D), and VII, all of which have primary storage of heparan sulfate (HS), and a secondary accumulation of

GM2 and GM3 gangliosides. Clinically patients with the severe forms of these disorders have central nervous system defects. Mucopolysaccharidosis III, also known as Sanfilippo syndrome, has four subtypes designated as A-D. These subtypes are due to deficiency of four different and distinct lysosomal enzymes.

Mucopolysaccharidosis type IIIB (MPS IIIB) results from an inherited deficiency of N- acetyl-α-D-glucosaminidase (Naglu) activity which leads to lysosomal accumulation of HS as a primary storage substrate, and secondary accumulation GM2 and GM3 gangliosides. Mucopolysaccharidosis type IIIC is characterized by deficiency of the

HSGNAT gene product, a lysosomal membrane enzyme. No treatment exists for

MPS IIIB, but potential treatments could involve a combination of gene therapy (GT) and hematopoietic stem cell therapy (HSCT). To this end we construction a lentiviral vector containing hNaglu-cDNA under the control of the hPGK promoter. This vector will be used in the future for ex vivo transduction of HSCT to be followed by transplantation into lethally irradiated MPS IIIB mice. While work proceeds on development of therapy there is still a critical need for a better understanding of the disease process in MPS III. Use of mouse models could aid this process very

effectively. To this end we used a double knockout (DKO) approach to test a theory on an approach to improve treatment of MPS IIIB. This approach had as its goal a better understanding of the pathogenesis of MPS IIIB, by targeting, through substrate reduction, ganglioside accumulation at the genetic level. This DKO approach entailed breeding mice deficient in both Naglu (the causative gene in MPS

IIIB) and GalNAcT activity. The latter is the enzyme required for synthesis of GM2 and other complex gangliosides. If the DKO mice showed improvement relative to the single KO MPS IIIB this would provide strong proof or principle to move forward with assessment of substrate deprivation therapy (SDT) targeting gangliosides, for which drugs are available. Contrary to our expectation and to double knockout

(DKO) studies where GalNAcT was knocked out in combination with other LSDs, our

DKO mice showed a drastically shortened lifespan (24.5 ± 1.4 weeks, versus 50.5 ±

0.9 wks (MPS IIIB), and 38.6 ± 1.2wks (GalNAcT)). To confirm that HS storage was the primary element resulting in the accelerated disease in our DKO mice, and not a locus tightly linked to the Naglu gene in the embryonic cell like used to generate these mice, we replicated our study with MPS IIIA mice, and found a virtually identical result (27.5 ± 1.8 weeks, versus 53.8 ± 1.6 wks.). All DKO mice showed motor signs of hind limb ataxia and hyper-extension, which were not seen in single

KO or normal mice. At approximately 5 months of age the MPS IIIB DKO showed a unique pattern of vacuolization and nerve fiber degeneration in the corpus callosum as well as the mild intracytoplasmic vacuolation of neurons and glia typical of MPS

IIIB affected mice at this age. We analyzed motor performance on a rocking Rotor- rod beginning at 3 months of age. The DKO IIIA and DKO IIIB mice showed

impaired performance and were statistically different from all parental lines. In

particular, the DKO MPS IIIB mice were significantly different from the parent MPS

IIIB strains at 3, 5, and 6 months (p ≤0.0245). In conclusion we identified an accelerated form of MPS IIIB within a DKO model system which showed white matter changes, with attendant performance deficits and a drastically shortened lifespan. This was in stark contrast to our expectations of a salutary response to the elimination of GM2. While contrary to our expectations, the accelerated pathology and clinical signs seen in these mice represent an improved system with which to study the MPS IIIB mice and their response to therapies. It may also be a useful model to investigate white matter pathogenesis as well as the role of complex gangliosides in animals with MPS III. Another KO technology which could accelerate

MPS III disease research involves a conditional knockout strategy applied to MPS

IIIC. The HSGNAT gene product which is deficient in MPS IIIC is a membrane bound protein which is not subject to cross-correction from other cells. By using a

Cre-loxP recombination system to conditionally knockout HSGNAT gene in MPS IIIC mice, studies could focus on the specific aspects of the disease, both temporally, and by tissue and cell type. To this end we also constructed a knockout plasmid vector, pBY49 under the control of the PGK promoter, which targeted the HSGNAT mouse locus. Together these studies have potential to contribute important knowledge and resources to MPS targeted research.

CHAPTER 1: MUCOPOLYSACCHARIDOSIS TYPE IIIB

Introduction

Mucopolysaccharidosis type IIIB (MPS IIIB), also known as Sanfilippo syndrome

type B (OMIM 252920), is an inborn error of metabolism which is also classified as a

lysosomal storage disease (LSD) [1]. The disorder is an autosomal recessive

condition caused by mutations in the NAGLU gene which lead to deficient activity of

N-acetyl-α-D-glucosaminidase (Naglu, EC 3.2.1.50), and resultant primary lysosomal

accumulation of the glycosaminoglycan (GAG) known as heparan sulfate (HS) [2].

The clinical phenotype of MPS IIIB includes signs such as behavioral abnormalities

and neurodegeneration, and leads to death in the second decade [1, 2]. Type IIIB is

one of the four biochemical subtypes of MPS III, which are designated IIIA-IIID [2]. In

the aggregate MPS III has an incidence of 1 in 73,000 live births [1]. The genetics,

molecular biology, and enzymology of the NAGLU locus and its enzyme product

have been studied from both normal and MPS IIIB affected subjects, extending from

the DNA to the protein level [1]. As a review and introduction, herein we will discuss

the normal and mutant NAGLU gene and enzyme function including gene structure

and transcription, message production, maturation, and translation, and enzyme

modification, trafficking, and function. This introduction will cover the genetics, cell

and molecular biology of NAGLU gene and its resultant enzyme in the normal and

diseased state, and briefly will introduce the conceptual approaches to treating MPS

IIIB based on the variety of known mutations. Work done on the NAGLU gene or

enzyme will be included, but where no specific examples of NAGLU or MPS IIIB exist in the literature, appropriate work on similar or related LSDs will be included.

The NAGLU Gene and Enzyme in the Normal State

Human NAGLU gene description

The human NAGLU gene was cloned in 1996 [3], and spans 8.5 kbp. The gene maps to chromosome 17q21. The gene has six exons interrupted by five introns [3].

Typical for housekeeping genes, the 5’ flanking region of the NAGLU gene contains a CG rich region, but lacks clearly discernible TATA or CAAT boxes in the expected locations [4]. Transcription of the NAGLU gene has not been studied specifically but doubtless follows transcriptional mechanisms typical of such genes in the nucleus, including three steps; initiation, elongation, and termination. Initiation involves formation of a preinitiation complex of up to a dozen subunits of transcription factors, including TFIID (including the TATA binding protein or the TBP subunit), TFIIA and

TFIIB, and their binding to the sequences upstream of the transcription start site often denoted by a TATA box sequence. The fully mature transcription complex includes RNA polymerase II, and results in melting, or unwinding, of the DNA double helix, the antisense strand of which will serve as the template [5]. Elongation involves ATP fueled RNA polymerase II incorporation of nucleotides to the nascent

RNA [5]. Termination of transcription is seen after the incorporation of a polyadenylation signal sequences and associated termination sequences, at which point RNA polymerase II releases the pre-mRNA and detaches from the DNA [6, 7].

The NAGLU cDNA was cloned and characterized by two research groups.

Weber et al. characterized a cDNA of 2575 bp in length with a 101 bp 5` un- translated sequence (UTR) and 245 bp 3` UTR including polyadenylation signal and poly A tail [3]. Zhao et al. used primer extension to document a 5’ UTR that extended at least 321-332 base pairs upstream of the initiating methionine [2, 3]. These authors also noted that since there was no TATA box or SP1 site upstream of the putative transcription initiation site, that, in fact, the true transcription initiation site may be yet further upstream than 321-332 bp from the initiating methionine [2, 3].

The NAGLU gene is considered a house keeping gene. As such, expression is expected at roughly uniform and ubiquitous levels in different tissues in the body.

Northern blot analysis of multiple tissues shows NAGLU mRNA at detectible levels in all tissues but thymus, with the highest levels seen in liver, ovary, and peripheral blood leukocytes [3]. While the NAGLU promoter has not been studied specifically, similar genes, such as that for sulfamidase, the enzyme deficient in MSP IIIA, have been studied [4]. The sulphamidase gene promoter, similar to observations made regarding the NAGLU promoter, has a CG rich region and lacks a TATA or CAAT box. Other transcriptional binding sites identified by a bioinformatics approach include SYR, MZF1, and Nkx-2.5 binding sites [4].

Four animal models of MPS IIIB have been identified, including emu, bovine, canine, and murine models. The MPS IIIB dog model is a naturally occurring model

[8]. The canine NAGLU gene was isolated and sequenced and shows high homology at the structural and sequence level, with the canine NAGLU gene having

87% identity to the human NAGLU gene and 84% to the mouse NAGLU gene [8]. A knockout mouse model of MPS IIIB was developed in 1999 by disruption of exon 6

[9]. The mouse Naglu gene is located on chromosome 11 and has a length, structure, and sequence with a high level of similarity to the human, canine, and emu genes [9, 10].

NAGLU RNA processing

The NAGLU pre-mRNA undergoes a number of modifications typical for protein coding genes. The first of these is capping, which is a process involving an addition to the 5’ end of the transcript before it is exported to the cytoplasm to protect the pre- mRNA from exonucleases [11, 12]. Capping is a process closely linked with transcription that is catalyzed immediately after initiation by three enzymes: RNA triphosphatase which cleaves a phosphate group off the triphosphate in the 5’ of mRNA chain; guanylyltransferase which binds a GTP derived GMP to the remaining diphosphate at the end of mRNA producing 5’-5’ triphosphate linkage; and two methyltransferases which transfer the methyl group from S-adenosylmethionine

(AdoMet) to the 7-nitrogen of capping guanine and to the methylate 2’-hydroxyl of the penultimate nucleotide [11, 12]. In addition to stabilizing the transcript, the resultant RNA m7G cap is critical for ribosomal recognition and for mature mRNA export from the nucleus [11, 12].

Polyadenylation of the pre-mRNA at the 3’ end is a nuclear post- transcriptional process in which a long chain of AMP is added to the 3’ end by poly

(A) polymerase (PAP) to produce the poly A tail [7, 11, 13-15]. The signal for this

addition is found in the 3’ UTR and is known as the polyadenylation signal sequence, and consists of the hexanucleotide AAUAAA, which usually lies 10-30 bases upstream of the cleavage/polyadenylation site in 3’ end of the pre-mRNA chain [7, 13, 15]. This signal is important for both RNA transcription termination and for the addition of the poly A tail [11, 15]. The addition of the poly A tail aids in export of the mature mRNA, and, by extending the half-life of the mRNA in cytoplasm, it has a regulatory role in translation [7, 13-15].

Before translation of mRNA to protein may proceed, the pre-mRNA must undergo an RNA splicing process [11, 12, 15]. RNA splicing occurs in the nucleus, and involves a specialized structure known as a spliceosome which consists of a complex of U1, U2, U3, U4, U5 and U6 small riboneucleaoproteins (snRNPs) [12,

15]. The RNA splicing process occurs by nucleophilic attack of the 2’-OH of the first nucleotide of the intron forming a lariat intermediate and another attack by the 3’-OH from the free exon on the last nucleotide of the intron then the ends of the exons will be ligated and release the looped intron producing the mature mRNA [12, 15]. The mature mRNA is transferred through pores in the nuclear membrane in a process involving facilitation by proteins specific to mRNA molecules, and then into the cytoplasm for the translation process [12, 15].

Transcripts can undergo processing that involve alternate splicing, thereby leading to proteins of different length and function. The NAGLU gene has not been rigorously studied in this regard, but reports of RT-PCR-derived transcripts from a testis-sourced library yielded alternate transcripts [3]. Alternative splicing of exon 5

was detected, producing two fragments having 250 bp difference [3, 16]. The meaning of this finding is unclear, and likely of little significance since at the level of

Northern blot analysis no alternate species of mRNA were evident [3]. The finding of alternate transcripts in the testis library may be related to the sensitivity of the techniques used, and to potentially different kinetics of splicing in the testis [3]. No physiological role of alternate transcripts has been documented in lysosomal storage disease associated enzymes.

NAGLU mRNA Translation

The NAGLU mRNA translation to protein occurs in the cytoplasm, and involves the mRNA being bound by a ribosomal complex in a process that is common to other proteins. To review, the ribosome consists of two parts, a large subunit (60S) and a small subunit (40S), each of which consists of ribosomal RNA and riboproteins.

These subunits are located free in the cytoplasm and both bind the mRNA. This complex facilitates the binding of the transfer RNA (tRNA), which on one end recognizes the codon on the mRNA strand, while on the other end the tRNA carries the amino acid specific to its respective codon. The mRNA, the aminoacyl tRNA complex, and the ribosomal complex act together to facilitate the mRNA/tRNA base pairing and concomitant elongation of the nascent polypeptide chain. The translation process is completed in three steps: initiation, elongation, and termination.

Translation involves three additional elements; initiation factors 1, 2, and 3 (IF1, IF2, and IF3), which bind to the 40S unit of the ribosome to form the initiation complex.

The pre-initiation complex and the tRNA carrying methionine, amino acid bind to the

mRNA near the start codon. In the case of the NAGLU mRNA, nucleotides -3 to +4

(accAUGG), conform to the “Kozak model” of a strong initiator site for translation

[17], which involves the addition of the first Met residue of the new protein chain. The translation process halts when a so-called stop codon is identified for which there is no corresponding tRNA. In the case of the NAGLU mRNA, the stop codon used is

UGA [15].

The process of mRNA translation by the ribosomal elements is the target of many therapeutic antibiotics which are specific inhibitors of bacterial translation via their ability to selectively inhibit bacterial ribosomal function. This area of study, while seemingly divergent from that of MPS IIIB, has become an important focus of therapeutic development. As will be discussed in greater detail below, mutations that introduce stop codons prematurely usually have serious consequences on translation. However, drug developments based on aminoglycosides, antibiotics which alter normal bacterial ribosomal function, now offer a compelling approach to therapy by aiding in read through of these mutations in eukaryotic cells. Hence, depending on the type of mutation, a broader array of the therapeutic strategies for

MPS IIIB patients may exist in the future.

NAGLU and Co-Translational Insertion

As with all secreted or integral membrane proteins, the growing Naglu peptide undergoes co-translation insertion. As the Naglu protein chain grows to around 30 amino acids, the amino terminal signal sequences of 23 hydrophobic amino acids emerge from the large unit of the ribosome through the exit channel. The signal

sequence is recognized by signal sequence particles (SRP) which then attach to the ribosome, decreasing the rate of the translation process, and forming the ribosome nascent SPR complex. The ribosome nascent SPR complex is moved toward the

ER and attaches to the translocation channel (Sec61) in the ER membrane through the SRP receptor. The Sec61 channel is opened upon the binding of the signal peptide sequence and SPR is released from the ribosome, thereby letting translation proceed to completion with the growing protein chain feeding into the ER through the

Sec61 channel. The signal peptidase complex (SPC) in the ER membrane cleaves off the signal peptide which is released inside the ER lumen [18, 19]. In the case of

Naglu, sequence analysis predicts the 23 amino terminus amino acids are cleaved off. The mature Naglu protein has a predicted length and molecular weight, based on predicted amino acid sequence, of 720 amino acids, and 80 KDa [2].

Naglu Enzyme Folding and Maturation

The Naglu enzyme is converted within the lumen of the ER from the native linear form into the active functional form by appropriate folding into its three dimensional structure. This process is facilitated at the biochemical level by chaperones, an example of which are the Hsp 70 family of proteins. The chaperones, in an ATP- dependent process, bind and stabilize the protein, preventing the aggregation of unfolded chains. Hence, chaperones facilitate the maturation of the proteins.

Molecular chaperones can be general in nature, serving to aid general protein folding and quality control, or can be lectin chaperones, which bind specific glycan moieties. They can exist free in the ER lumen, or as in the case of lectin

chaperones, they may be membrane-anchored. The end result of the concerted action of these chaperones is a properly folded protein [19].

Enzyme Glycosylation

Enzyme glycosylation occurs inside the ER and is catalyzed by an oligosaccharial transferase (OST), itself attached in the ER membrane. This occurs via N-linkage glycosylation by adding an acetyl-glycosyl group to the nitrogen of the aspargine residue in the consensus sequence Asn(N) X Ser(S)/Thr(T) where X is any amino acid except proline. Naglu has six potential glycosylation sites, based on sequence analysis, which are located at aspargine residues 261, 272, 435, 503, 526, and 532.

In addition there are other potential sites with less commonly used sequence recognition; Ans513 and Asn134 [2, 20]. Upon completion of appropriate protein folding and glycosylation in the rough endoplasmic reticulum (RER), Naglu is packaged into cytosolic coat protein II (COPII)-derived vesicles and transported out of the ER to the Golgi [19] for further critical modifications.

Mannose-6-Phosphorylation and Lysosomal Targeting

In the cis-Golgi, Naglu is modified at the terminal oligosaccharide residues by the addition of mannose-6-phosphate (M6P) moieties. This reaction occur in a two-step reaction; the first reaction being the addition of an N-acetylglucosamine phosphate group (PGlcNAc) to the mannose residue of the Naglu enzyme. This is catalyzed by an N-acetylglucosamine (GlcNAc) phosphotransferase, producing a phosphodiester.

The second reaction removes the GlcNAc group leaving the Naglu enzyme carrying a phosphoralyated mannose, which is catalyzed by a phosphodiesterase. The

resultant Naglu carrying an M6P tag binds the M6P receptor in the trans-Golgi

Network (TNG) forming vesicles which detach from the Golgi apparatus and fuse with the endosome which then develops to a mature lysosome [21, 22]. The fused vesicles release the Naglu enzyme inside the lysosome due to the acidic pH, allowing the M6P receptor to recycle to TNG [23-25]. There is an alternate pathway for the Naglu enzyme to be taken directly from the TGN via the M6P receptor bearing vesicles to the plasma cell membrane and hence into the extracellular space

[24]. This secretion is the basis of all in vitro enzyme production, and also allows for transplanted or gene therapy transduced cells to secrete enzyme to be taken up by non-producing cells via cross-correction.

Enzyme Structure and Function

The Naglu enzyme was first associated with MPS IIIB by O’brien in 1972 [26]. Since then, the enzyme has been purified and characterized by a variety of laboratories

[27, 28]. A comprehensive list of Naglu evaluations can be found via the Brenda

Enzyme Information System [27, 29]. Highly purified Naglu has an estimated molecular weight of 82 KDa, which is in good agreement with the hypothetical calculation. The pH optimum for enzyme activity is 4.5 ± 0.3, which is consistent with what is known of lysosomal enzymes [27]. The enzyme is inactivated easily by heat

(65 °C), and activity is much diminished at higher pH (pH < 5) [28]. The structure of

Naglu has been predicted based on crystallization of a truncated bacterial homologue of Naglu, both of which are members of the Glycoside Hydrolase 89 family of enzymes [30, 31]. The bacterial homologue reveals a protein with four

distinct domains. There is an N-terminal domain (a family 32 carbohydrate-binding

module), followed by a small catalytic domain of α/β structure. The bulk of the

remaining aspects of the enzyme is composed of an ( α/β)8 barrel.

Naglu Substrate

Naglu functions to degrade HS [32], which is a specific type of GAG. This is accomplished by hydrolytic cleavage of the terminal N-acetylated GlcN residues of

HS within the low pH of the lysosome. The structure of HS consists of repeats of a

sulfated disaccharide unit comprised of a uronic acid (either L-glucuronic acid (GlcA)

or L-iduronic acid (IdoA)) and a GlcN or GlcNAct [33, 34]. The GAGs are presented

to the lysosome for degradation and are first digested by endoglycosidases.

Complete digestion requires activity of enzymes like Naglu which operate by

digestion of sugars in a stepwise fashion form the non-reducing terminus. Laboratory

measurement of Naglu activity can rely on a tritiated natural substrate [35], or a

more frequently used 4-methylluberliferone (4MU) based fluorescent substrate.

Catalytic capacity of approximately 50% of normal levels are well tolerated at the

whole animal level, as carrier individuals, both human and animal, have been

completely normal, lacking any abnormal signs [35].

MPS IIIB: From Gene to Protein

Molecular defects underlying MPS IIIB

Beginning with the human NAGLU gene isolation and cloning of 2.5 kb human

NAGLU cDNA, it became possible to characterize the molecular defects which lead to the clinical phenotype and the brain degeneration in Sanfilippo B patients [2].

Following will be a discussion of examples of the mutations seen in the NAGLU gene and their effects on the natural history of the Human NAGLU gene and the mechanisms that lead to deficient Naglu enzyme activity. More than 100 different mutations of the NAGLU gene have been characterized which are associated with

MPS IIIB patients: 68 missense, 9 nonsense, 21 small deletions, 10 insertion, and 2 splice site mutations [2, 32, 36-39].

Mutations at the Chromosomal Level

Large chromosomal mutations leading to MPS IIIB have not been documented.

Large intragenic deletions have been described only once, leading the elimination of exons 3 and 4. Such a mutation was associated with a severe phenotype, with the affected child succumbing to her disease at the age of 11 [40]. Partial chromosomal deletions are more commonly seen in the similar HS storage disorder Hunter syndrome (MPS II), due to the X-linked nature of the disease [41].

Mutations Affecting Promoter Function

To date, no mutations which affect promoter function have been characterized in

MPS IIIB patients [42]. Given that normal physiology tolerates at least 50% of normal levels of enzyme activity, a promoter mutation would have to be considerable, leading to substantial diminution of activity [42]. Neither have there been any mutations in other MPS or LSD mutations that involve this aspect of the gene [42].

Mutations Affecting Normal Transcript Maturation and Transport

Many processes of normal NAGLU mRNA transcript maturation and transport are generic to mRNA [43]. Sequence-specific effects that may be disrupted by NAGLU

gene mutations could be seen in cases where RNA transcript sequences are critical,

such as splicing and to a lesser extent, polyadenylation [43]. The later has never

been documented, but splicing defects are well-recognized [43]. Depending on the

specific aspects of the mutation and the consequences, various downstream effects

could be seen, including, deletions of large portions of the normal reading frame,

with or without frame shifts [43]. A study involving Naglu has addressed this directly

in the case of an mRNA splicing mutation occurring the intron-exon junction region

(IVS3+1G →A) [43]. This mutation was evaluated in a cell-based system using COS cells. The mutation, which is a substitution of G to A in GT at the splice donor site of intron 3, resulted in the skipping of exon 2 and/or 3 [43]. This disrupted the reading frame and subsequently no detectable NAGLU protein was seen in metabolically labeled COS cells, ostensibly due to stop codon-mediated decay (see below for further discussion) [43].

Mutations Affecting Normal Translation

Point or indel mutations which lead directly to stop codons or frame shifts and subsequent stop codons, can lead to non-sense-mediated decay of the mRNA, which is a quality control system that regulates the destruction of mutant mRNA transcripts containing premature stop codons [44]. Two relatively common nonsense mutations, W147X and R533X, in NAGLU may will lead to stop codon-mediated decay [38].

Mutations Affecting Normal Protein Folding, Maturation, and Trafficking

Many aspects of the process of protein folding, maturation, and trafficking are generic to the RER and the TGN, and one would not expect changes in the Naglu enzyme to affect these. Processes which do depend on the primary protein structure, and hence potentially affected by mutations, involve protein folding and glycosylation. No mutations have been documented to affect glycosylation in Naglu.

Numerous types of mutations including point mutations and small in-frame indels, could theoretically have a serious consequence on normal protein maturation within the RER. Such point mutations may produce misfolded enzyme which fail to be normally matured or transported. Subsequent retention within the lumen of the RER subjects the misfolded protein to a quality control system which distinguishes between well and incompletely folded proteins. Molecular chaperons have an essential role to induce and promote the folding of the newly synthesized protein and also have alternate roles in a “quality control system” for recognizing retained and misfolded proteins. These are targeted for degradation [31]. Molecular chaperons consist of the Hsp 70 family and similar proteins, which lead to misfolded protein ubiquitination by the E3 ubiquitin-protein ligase CHIP, and followed by subsequent degradation via the 26S Proteasome, a large proteolytic complex, in which non- functional proteins are degraded in an ATP dependent process [45]. Metabolic labeling studies have found that a number of missense mutations may lead to protein misfolding and subsequent degradation via the proteosome [43].

Mutations that Affect Catalytic Capacity

Missense mutations that allow for normal enzyme maturation and trafficking which are associated with MPS IIIB could result in two theoretical consequences to the enzyme. Mutations that severely affect the enzyme’s stability could theoretically lead to rapid loss of enzyme activity within the environment of the lysosome. Alternately, the enzyme might be stable but have mutations that affect the active site or otherwise interfere with substrate binding and catabolism. While the exact mechanism has not been studied in these cases, labeling studies of missense mutations have demonstrated enzyme which traffic to the lysosome but which appears inactive [44].

Therapeutics strategies for the CNS in MPS IIIB

Theoretical therapeutic approaches for treatment of MPS IIIB and/or decreasing the lysosomal accumulation of GAGs depend on three basic approaches: enzyme based therapy, substrate deprivation therapy, and drug therapy [46]. Enzyme therapy aims to increases the Naglu catalytic capacity of the lysosome [47]. Substrate deprivation therapy aims to decrease the biosynthesis of the substrate HS, and is, in all likelihood only useful as an adjunct or secondary therapy [48]. Drug therapy is, at this point in time, a highly theoretical process where a drug therapy could target mechanistic effects involved in the clinical signs seen as a consequence of the lysosomal accumulation, and, as with substrate deprivation therapy, would, if developed, likely act only as secondary or adjunct therapy.

Generic and Specific Challenges of MPS IIIB Targeted Therapies

Inherent difficulties and challenges exist for the successful development of

therapeutic approaches for the MPS IIIB. In principle, there are two significant

hurdles currently: one of which is specific to MPS IIIB, and one which is generic to

the neuropathic LSDs.

Blood Brain Barrier (BBB)

The main obstacle for therapy faced by all of the neuropathic LSDs is the BBB since

the brain blood vessels are lined with endothelial cells which are characterized by

tight attachments to each other, which leaves no gaps for the larger charged

molecules to penetrate into the brain [49, 50]. This problem can potentially be

overcome by using one of the following methods: direct injection or indirect delivery

of the therapeutics to the central nervous system , high dose therapy that overcomes the BBB by as yet unknown mechanism , removal of the sugar side chains of the

enzyme , and tagging of the enzyme for active transport across the BBB [51, 52].

Mannose-6-Phosphate tagging

Enzyme Replacement Therapy (ERT) is a viable method to treat MPS IIIB via

intrathecal administration of enzyme. However, for unknown reasons, attempts to

overexpress human recombinant Naglu (rhNaglu) have led to production of enzyme

that has virtually no M6P [2, 3]. Such an enzyme will have very poor ability to diffuse

and be taken up by cells.

Therapeutic Approaches That Address Enzyme Deficiency

Therapy that aims to increase enzyme activity via delivery of the normal gene or enzyme is appropriate for mutations that lead to loss of activity from all possible consequences mentioned above in our treatment of mutational consequences.

Because of the ability of M6P-labeled enzyme to traffic to the extracellular space and be taken up from that space, exogenously sourced enzyme will have therapeutic benefit if the above mentioned production difficulties can be resolved. Certain types of therapy directed at increasing endogenous enzyme, as will be described below, will be useful only for specific types of mutations.

Gene Therapy

The aim of using gene therapy is to deliver the normal gene to deficient cells in the central nervous system [53]. Broadly speaking, there are two types of delivery systems used for gene therapy, viral vectors and non-viral vectors [33]. Following is a discussion of various viral vector systems which have been deployed to treat MPS

IIIB or similar conditions.

Adeno viral vectors (Ad)

An adenoviral vector based on canine adenovirus serotype 2 (CAV-2) was used to reduce the innate immune response commonly seen when using the human adenoviral serotype 5 vectors. MPS IIIA adult mice were treated with the injection of

CAV-based vectors into the thalamus and produced short-term gene expression.

When newborn mice were treated with intra-ventricular injection, it led to long term gene expression, at least 20-weeks, and reduced neuropathology of these mice [54].

Adeno-associated viral vectors (AAVs)

MPS IIIB-affected mice have been treated using AAV2 vectors with the human

NAGLU cDNA via IV injection, IC injection and combination of IV and IC injection

[52]. Expression of Naglu enzyme in the brain of mice in IC and IV+IC was detected, leading to improvement of mice by behavioral performance and life span. Single IV injections of a rAAV9-CMV-hNAGLU vector led to normal or above normal levels of

Naglu in the CNS. The rAAV9-CMV-hNAGLU corrected the neurological defect in the PNS and CNS of the adult MPS IIIB mice and extended their life span and improved their behavioral performance [52]. Use of an AAV vector delivered to the brain by intraparenchymal injections has also been evaluated in the canine MPS IIIB model with a positive result [55].

Retroviral vectors

Mucopolysaccharidosis I-affected mice were treated with a self-inactivating (SIN) γ-

retroviral vectors carrying α-L-iduronidase (IDUA) [56]. The IV injection of SIN γ-RV reduced the clinical manifestation in the MPS I mice and was hypothesized to result in only benign insertional mutagenesis due to the absence of the promoter and enhancer in the viral LTR [56].

Lentiviral vectors (LV)

Lentiviral vector-mediated gene transfer has been used to correct MPS IIIB-deficient

fibroblasts [57]. The mouse model of MPS IIIB was treated with a lentiviral-NAGLU

vector [58], as has been the mouse model of MPS I [59] and the MPS VII mouse

model [60]. There are potential effects which may limit use of lentiviral vectors as

therapeutic approaches in vivo . In short term lentiviral vector treated animals, treatment led to a decrease of GAG accumulation, but in longer term treated animals, there was an antibody response directed against the transduced gene which was detected in the blood. This problem could be seen to be generic to other gene delivery techniques. A concern specific to integrating vectors which are derived from retroviridae based vector systems is the concern surrounding insertional mutagenesis and potential neoplasias associated with such genomic disruptions.

This has been documented in human gene therapy treated patients, and has led to the development of so called self-inactivating (SIN) vectors [61]. Such vectors are being used in combination with stem cell therapy and hold significant promise [62,

63].

Cell Therapy

Hematopoietic cell transplantation therapy (HCT) or its clinical precursor, bone marrow transplantation therapy (BMT), have been used successfully in treating specific types of MPS. It is the standard of care for Hurler forms of MPS I, but has also been evaluated in MPS VI, and MPS VII [33]. But for unknown reasons, HCT as currently practiced is unsuccessful in treating MPS IIIB disease [33].

Enzyme Replacement Therapy (ERT)

The supplementation of MPS IIIB patients with recombinant Naglu enzyme, via IV or intrathecal injections is a possibility, but at this point practical and regulatory issues have not been addressed, since a commercially available product is not available for such therapy. Such a therapy is available or under development for MPS I, II, and

IIIA [64]. As mentioned, a critical hurdle to be overcome is the issue of insufficient

M6P in preliminary studies.

Enzyme Enhancement Therapy (EET)

This therapy, also known as pharmacological chaperonin therapy, pharmacoperone therapy, or small molecule therapy, is based on small molecules used as active-site- directed compounds that may aid in normal protein folding in the RER, working as a functioning template in the RER to protect the enzyme from degradation in the RER by the quality control system. This may allow a cDNA with a point mutation that affects protein folding but not catalytic activity to result in protein that matures normally and reaches the lysosome [33]. Indeed, recent structural analysis of Naglu was aimed at developing this specific type of therapeutic [30, 31]. This therapy, if successfully developed, will possibly only address the defect in a specific set of patients with mutations that may be suitable for this therapy, i.e. patients with point mutations only affecting folding. However there may be generic effects of these compounds that will increase the half-life of the enzyme in the lysosome, and in that regard they may have broad utility as adjuncts to other enzyme based therapies.

Stop Codon Read-Through Mediated Therapy

Stop codon read-through meditated therapy involves the use of a small molecule to induce read-through of the premature stop-codon mutations [44, 46]. This would theoretically be a useful approach in the context of point mutations which lead to stop codons as described above in MPS IIIB patients [44]. Antibiotics such as gentamycin, which target the ribosome, have been used as treatment for MPS I

syndrome [44], and this general approach is under development to identify related

drugs which have more potent effects on stop codon read-through [44, 46].

Therapeutic Approaches That Decrease Substrate Load

The main goal for the substrate reduction therapy is to balance the synthesis and

degradation of the substrate and let the lysosome function normal [48]. Genistein is

a soy derived isoflavone used to inhibit synthesis of HS and consequently the HS

lysosomal accumulation in MPS IIIB [65]. While this therapy is unlikely to provide a

primary therapy to MPS IIIB patients, the basic approach is medically sound for

attenuated forms of some LSDs. An example is the use of N-butyldeoxynojirimycin

(miglustat, Zavesca) which is an approved therapy for non-neuropathic or type I

Gaucher disease [33, 66].

Drug Therapy

Drug therapy involves use of an approved pharmaceutical or other small molecule to treat the clinical signs and symptoms of disease, as opposed to a treatment that addresses the root cause of disease. The recent development of losartan therapy for the treatment of Marfan’s syndrome represents a paradigm shift in the way we think about treatments of genetic diseases [67]. This shift is one from gene replacement or correction to treatments that address the downstream effects of the disease. That a multisystem connective tissue disorder such as Marfan’s syndrome could be treated by a drug based approach has had a profound impact on the way possible treatments are thought of [67-69]. With regards to the MPSs and neuropathic LSDs, isolated application of the drug therapy has been successfully used at the animal

model stage in two LDSs; the skeletal disorder, MPS VI [70], and the neuropathic

LSD NPC disease [71, 72]. In the MPS VI rat model, Remicade®, an autoimmune drug, resulted in significant joint improvement in this model [70]. In Niemann-Pick disease type C1 (NPC), the use of non-steroidal anti-inflammatory drug (NSAID) therapy significantly improved life span and slowed the disease course, ostensibly by reducing CNS inflammation [71]. The use of cyclodextrin therapy also significantly prolonged lifespan, slowed disease progression, and reduced glycosphingolipid storage, apparently by reducing neuronal storage of unesterified cholesterol [72]. It is a reasonable theoretical possibility that some similar therapy could be found for

Sanfilippo syndrome. But, since the studies mentioned above found only that lifespans were improved but not yet normal, it seems reasonable to expect that any future drug therapy will likely play only a secondary or adjunct role in therapy, one in combination with a therapy that targets or prevents the primary metabolic and cellular effects of the diseases.

Summary/Conclusion:

Therapies for the neuropathic LSDs face challenges. The neuropathic diseases face specific hurtles involving the BBB. Some therapies show promising improvement in treating the neurological defect in LSDs while others fall short. The use of ERT has been among the most effective therapy in treating LSDs [73]. High dose of ERT using recombinant enzyme produced improvement in the CNS cells in Gaucher,

Fabry, MPS I, MPS IV, and Pompe disease [74-78]. Hematopoietic cell transplantation therapy (HCT) has limitations in treating LSDs, since it has a risk of

graft-versus host disease and it has shown efficacy only in Krabbe disease [79, 80] and Hurler disease (MPS IH) [81]. Gene therapy using AAV showed efficacy in animal models of NPC, MPS IIIA, MPS IIIB, MPS VII, and Krabbe disease [82-87].

An SRT based therapy with Miglustat showed effective improvement in Gaucher disease [88], the GM1 and GM2 gangliosidoses, and NPC disease [89, 90].

Pharmaceutical chaperons have the ability to lead to production of the deficient enzyme in the brain using a murine model beta-galactosidase deficiency (GM1 gangliosidosis) treated with N-octyl-4-epi-β-valienamine (NOEV) [91, 92]. The combination of more than one therapy has also been shown to enhance the efficacy compared to using only a single therapy [93]. The combination of BMT with SRT (N- butyldeoxynojirimycin (NB-DNJ)) produced a synergetic effect resulting in increased survival of a Sandhoff disease mouse model [94]. In the same model, the combination of an anti-inflammatory drug therapy (NSAIDs) with SRT (NB-DNJ), produce a synergetic effect in increasing the survival in this model and slowing the rate of the disease progression [95]. In the NPC mouse model, the combination of

NSAIDs with SRT (miglustat) result an additive benefit [71]. In conclusion, it seems evident that there is no universally effective therapy either singly or in combination for LSDs. Hence the understanding of the pathologic mechanisms remains an important point which may aid in finding the most effective therapy, whether such a therapy be a single agent or approach, or one which combines various treatments for each of the LSDs. Regardless of what approach to therapy is used, initiating early treatment, aided by new born screening will be a critical development in establishing full treatment effects in patients. [96, 97]. Aided by accurate neonatal

screening and a full understanding of the pathogenesis of disease, newly developed

therapies could be instituted at a stage before irreversible pathology is established,

thus optimizing patient outcomes.

Development of LDSs therapy

The secondary accumulation of gangliosides has been an area of study in the MPSs

and other related disorders [98, 99]. Additionally, the storage of GM2 is seen as a

primary storage substrate in a variety of disorders including Sandhoff disease, Tay-

Sachs disease, and the AB variant [100]. While it is known that GM2 ganglioside is a

secondary accumulation product in the neuropathic MPSs, its clinical significance is

unknown. We focused on the study of the effect of elimination of GM2 ganglioside

accumulation on the pathogenesis of MPS IIIB mouse model. If GM2 accumulations

were eliminated and this showed clinical benefit in the mouse model, it would

support using a substrate reduction therapy with Miglustat to great MPS IIIB.

The β-1, 4-Nacetylgalactosaminyltransferase (GalNAcT) mouse

The enzyme responsible for GM2 ganglioside biosynthesis is β-1, 4-N- acetylgalactosaminyltransferase ( β-1,4-GalNAc-T; EC: 2.4.1.92) and controls the synthesis of brain-enriched complex gangliosides by the conversion of GM3, GD3, and lactosylceramide to GM2, GD2, and asialo-GM2 (GA2) respectively [101]. The

GalNAcT deficient mice are unable to produce GM2 ganglioside and are used as single knockout (SKO) mice to study the role of complex gangliosides in the CNS.

Additionally when used in the context of a double knockout (DKO) approach, these

mice allow for the study of the role of GM2 ganglioside storage in the pathogenesis

of LSDs [102].

Double Knockout Mice Approach

The DKO mice approach using the GalNAcT null mice has been used in neuropathic

LSDs to study the effect of GM2 ganglioside elimination on the pathogenesis of

disease. Sandhoff/GalNAcT DKO mice showed a significant improvement in life

span and motor function over that of the SKO Sandhoff mice [103]. Unlike

Sandhoff/GalNAcT DKO mice, NPC/GalNAcT DKO mice didn’t show improvement in

life span or in the symptoms of the disease [104]. In another study of NPC,

NPC/GalNAcT DKO mice showed reduction in the unesterified cholesterol, which

implicated this accumulation as being GM2 ganglioside dependent [103].

The Ellinwood laboratory has generated a new model consisting of MPS

IIIB/GalNAcT DKO mice which have accumulation of HS as the primary storage

compound, but do not have the ability to produce GM2 ganglioside, and hence, are

unable to store GM2 as a secondary storage compound, which is a characteristic of

MPS IIIB. This DKO model showed shorter life span than the SKOs, hind limb hyperextension and ataxia. Additionally, we generated an MPS IIIA/GalNAcT DKO mice model to confirm that the data from MPS IIIB/GalNAcT DKO mice model resulted from a specifically HS storage dependent effect.

Contributions by Authors in this Work

Chapter 2

All analysis and writing was done by Eman Mohammed. Eman Mohammed performed ganglioside analysis by HPLTC (exclusively), mice colony management

(in collaboration), PCR diagnosis (in collaboration), life span assessments

(exclusively), data analysis (exclusively), statistical analysis (exclusively), and wrote the manuscript. Mice colony management, Rotor-Rod performance, PCR diagnosis was also conducted in collaboration by Elizabeth M. Snella, Michelle M. Rutz-

Mendicino, and Franklin D. Echevarria. Brain tissue histopathology was conducted by Elizabeth M. Whitley with assistance of Eman Mohammed (digital photos and assistance on analysis). Gene therapy injections of DKO mice was conducted by

Rafi Awedikian.

Chapter 3

Cloning of the lentiviral vector and transfection studies were the exclusive work of

Eman Mohammed. The cloning of the pBY49a plasmid was a collaboration between

Eman Mohammed and Rafi Awedikian, who also designed Fig. 4.

Published PAPER (Appendix B)

Eman Mohammed performed all dog brain tissue homogenzation, and enzyme and

GAGs assays.

References

[1] E.F. Neufeld, J. Muenzer, The Mucopolysaccharidoses, in: C.R. Scriver, A.L.

Beaudet, W.S. Sly, D. Valle (Eds.), The Metabolic and Molecular Bases of Inherited

Disease, McGraw-Hill, Health Professions Division, New York, 2001, pp. 3421-3452.

[2] H.G. Zhao, H.H. Li, G. Bach, A. Schmidtchen, E.F. Neufeld, The molecular basis of Sanfilippo syndrome type B Proc Natl Acad Sci U S A 93 (1996) 6101-6105.

[3] B. Weber, L. Blanch, P.R. Clements, H.S. Scott, J.J. Hopwood, Cloning and expression of the gene involved in Sanfilippo B syndrome (mucopolysaccharidosis III

B) Hum Mol Genet 5 (1996) 771-777.

[4] E. Costanzi, T. Beccari, M.C. Aisa, R. Tiribuzi, J.J. Hopwood, A. Orlacchio,

Mouse sulphamidase gene: characterization of the promoter region of the gene and expression in mouse tissues Gene 310 (2003) 143-149.

[5] M. Werner, P. Thuriaux, J. Soutourina, Structure-function analysis of RNA polymerases I and III Curr Opin Struct Biol 19 (2009) 740-745.

[6] P. Richard, J.L. Manley, Transcription termination by nuclear RNA polymerases Genes Dev 23 (2009) 1247-1269.

[7] B. Tian, J. Hu, H. Zhang, C.S. Lutz, A large-scale analysis of mRNA polyadenylation of human and mouse genes Nucleic Acids Res 33 (2005) 201-212.

[8] N.M. Ellinwood, P. Wang, T. Skeen, N.J. Sharp, M. Cesta, S. Decker, N.J.

Edwards, I. Bublot, J.N. Thompson, W. Bush, E. Hardam, M.E. Haskins, U. Giger, A model of mucopolysaccharidosis IIIB (Sanfilippo syndrome type IIIB): N-acetyl- alpha-D-glucosaminidase deficiency in Schipperke dogs J Inherit Metab Dis 26

(2003) 489-504.

[9] H.H. Li, W.H. Yu, N. Rozengurt, H.Z. Zhao, K.M. Lyons, S. Anagnostaras,

M.S. Fanselow, K. Suzuki, M.T. Vanier, E.F. Neufeld, Mouse model of Sanfilippo syndrome type B produced by targeted disruption of the gene encoding alpha-N- acetylglucosaminidase Proc Natl Acad Sci U S A 96 (1999) 14505-14510.

[10] E.L. Aronovich, J.M. Johnston, P. Wang, U. Giger, C.B. Whitley, Molecular basis of mucopolysaccharidosis type IIIB in emu (Dromaius novaehollandiae): an avian model of Sanfilippo syndrome type B Genomics 74 (2001) 299-305.

[11] J.R. Nevins, J.E. Darnell, Jr., Steps in the processing of Ad2 mRNA: poly(A)+ nuclear sequences are conserved and poly(A) addition precedes splicing Cell 15

(1978) 1477-1493.

[12] K. Scherrer, M.T. Imaizumi-Scherrer, C.A. Reynaud, A. Therwath, On pre- messenger RNA and transcriptions. A review Mol Biol Rep 5 (1979) 5-28.

[13] J.E. Tabaska, M.Q. Zhang, Detection of polyadenylation signals in human

DNA sequences Gene 231 (1999) 77-86.

[14] H. Zhang, J. Hu, M. Recce, B. Tian, PolyA_DB: a database for mammalian mRNA polyadenylation Nucleic Acids Res 33 (2005) D116-120.

[15] S. Hocine., R.H. Singer., D. Grünwald., RNA processing and export. Cold

Spring Harb Perspect Biol. 2 (2010 ) a000752.

[16] G. Yogalingam, J.J. Hopwood, Molecular genetics of mucopolysaccharidosis type IIIA and IIIB: Diagnostic, clinical, and biological implications Hum Mutat 18

(2001) 264-281.

[17] M. Kozak, Point Mutations Define a Sequence Flanking the AUG Initiator

Codon That Modulates Translation by Eukaryotic Ribosomes Cell 44 (1986) 283-

292.

[18] R. Zimmermann, S. Eyrisch, M. Ahmad, V. Helms, Protein translocation across the ER membrane Biochim Biophys Acta. 1808 (2011) 912-924.

[19] D. Hebert, M. Molinari, In and out of the ER: protein folding, quality control, degradation, and related human diseases. Physiol Rev 87 (2007) 1377-1408.

[20] E. Bause, Structural requirements of N-glycosylation of proteins. Studies with proline peptides as conformational probes Biochem. J. 209 (1983) 331-336.

[21] E.F. Neufeld, Lysosomal storage diseases Annu Rev Biochem 60 (1991) 257-

280.

[22] W.S. Lee, J. Rohrer, R. Kornfeld, S. Kornfeld, Multiple signals regulate trafficking of the mannose 6-phosphate-uncovering enzyme J Biol Chem 277 (2002)

3544-3551.

[23] S. Kornfeld, I. Mellman, The biogenesis of lysosomes Annu Rev Cell Biol 5

(1989) 483-525.

[24] R.D. Bagshaw., D.J. Mahuran., J.W. Callahan., Lysosomal membrane proteomics and biogenesis of lysosomes Mol Neurobiol. 32 (2005) 27-41.

[25] J.P. Luzio, V. Poupon, M.R. Lindsay, B.M. Mullock, R.C. Piper, P.R. Pryor,

Membrane dynamics and the biogenesis of lysosomes Mol Membr Biol 20 (2003)

141-154.

[26] "MUCOPOLYSACCHARIDOSIS TYPE IIIB" OMIM ID #252920 http://www.ncbi.nlm.nih.gov/omim/252920 .

[27] K. von Figura, Human alpha-N-acetylglucosaminidase. 1. Purification and properties Eur J Biochem 80 (1977) 523-533.

[28] K. von Figura, Human alpha-n-acetylglucosaminidase. 2. Activity towards natural substrates and multiple recognition forms Eur J Biochem 80 (1977) 535-542.

[29] N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase EC

3.1.4.45 http://www.brenda-enzymes.info/php/result_flat.php4?ecno=3.1.4.45 .

[30] E. Ficko-Blean, K.A. Stubbs, O. Nemirovsky, D.J. Vocadlo, A.B. Boraston,

Structural and mechanistic insight into the basis of mucopolysaccharidosis IIIB Proc

Natl Acad Sci U S A 105 (2008) 6560-6565.

[31] W.J. Welch, C.R. Brown, Influence of molecular and chemical chaperones on protein folding Cell Stress Chaperones. 2 (1996) 109-115.

[32] C.E. Beesley, M. Jackson, E.P. Young, A. Vellodi, B.G. Winchester,

Molecular defects in Sanfilippo syndrome type B (mucopolysaccharidosis IIIB) J

Inherit Metab Dis 28 (2005) 759-767.

[33] M.J. Valstar., G.J.G. Ruijter., O.P.v. Diggelen., B.J. Poorthuis., F.A. Wijburg.,

Sanfilippo syndrome: A mini-review J Inherit Metab Dis 31 (2008) 240-252.

[34] U. Lindahl, M. Kusche-Gullberg, L. Kjellen, Regulated diversity of heparan sulfate J Biol Chem 273 (1998) 24979-24982.

[35] B. Weber, J.J. Hopwood, G. Yogalingam, Expression and characterization of human recombinant and alpha-N-acetylglucosaminidase Protein Expr Purif 21

(2001) 251-259.

[36] A. Schmidtchen, D. Greenberg, H.G. Zhao, H.H. Li, Y. Huang, P. Tieu, H.Z.

Zhao, S. Cheng, Z. Zhao, C.B. Whitley, P. Di Natale, E.F. Neufeld, NAGLU mutations underlying Sanfilippo syndrome type B Am J Hum Genet 62 (1998) 64-69.

[37] C.E. Beesley, E.P. Young, A. Vellodi, B.G. Winchester, Identification of 12 novel mutations in the alpha-N-acetylglucosaminidase gene in 14 patients with

Sanfilippo syndrome type B (mucopolysaccharidosis type IIIB) J Med Genet 35

(1998) 910-914.

[38] M. Mangas, C. Nogueira, M.J. Prata, L. Lacerda, M.J. Coll, G. Soares, G.

Ribeiro, O. Amaral, C. Ferreira, C. Alves, M.F. Coutinho, S. Alves, Molecular analysis of mucopolysaccharidosis type IIIB in Portugal: evidence of a single origin for a common mutation (R234C) in the Iberian Peninsula Clin Genet 73 (2008) 251-

256.

[39] C. Beesley, M. Moraitou, B. Winchester, K. Schulpis, E. Dimitriou, H.

Michelakakis, Sanfilippo B syndrome: molecular defects in Greek patients Clin

Genet 65 (2004) 143-149.

[40] K.J. Champion., M.J. Basehore., T. Wooda., A. Destrée., P. Vannuffel., I.

Maystadt., Identification and characterization of a novel homozygous deletion in the a-N-acetylglucosaminidase gene in a patient with Sanfilippo type B syndrome

(mucopolysaccharidosis IIIB) Molecular Genetics and Metabolism 100 (2010) 51-56.

[41] J. Wraith, A. Cooper, M. Thornley, P. Wilson, P. Nelson, C. Morris, J.

Hopwood, The clinical phenotype of two patients with a complete deletion of the iduronate-2-sulphatase gene (mucopolysaccharidosis II--Hunter syndrome). Hum

Genet. 87 (1991) 205-205.

[42] P. Alfonso, S. Pampin, B. Garcia-Rodriguez, T. Tejedor, C. Dominguez, J.C.

Rodriguez-Rey, P. Giraldo, M. Pocovi, Characterization of the c.(-203)A>G variant in the glucocerebrosidase gene and its association with phenotype in Gaucher disease

Clin Chim Acta 412 (2011) 365-369.

[43] A. Tessitore, G.R. Villani, C. Di Domenico, M. Filocamo, R. Gatti, P. Di

Natale, Molecular defects in the alpha-N-acetylglucosaminidase gene in Italian

Sanfilippo type B patients Hum Genet 107 (2000) 568-576.

[44] D.A. Brooks, V.J. Muller, J.J. Hopwood, Stop-codon read-through for patients affected by a lysosomal storage disorder TRENDS in Molecular Medicine 12 (2006)

367-373.

[45] A.L. Goldberg, Protein degradation and protection against misfolded or damaged proteins Nature. 18 (2003) 895-899.

[46] M. Beck, Therapy for lysosomal storage disorders IUBMB Life 62 (2010) 33-

40.

[47] M. Rohrbach, J.T. Clarke, Treatment of lysosomal storage disorders : progress with enzyme replacement therapy Drugs 67 (2007) 2697-2716.

[48] T.M. Cox, Substrate reduction therapy for lysosomal storage diseases Acta

Paediatr Suppl 94 (2005) 69-75; discussion 57.

[49] D.J. Begley, M.W. Brightman, Structural and functional aspects of the blood- brain barrier Prog Drug Res 61 (2003) 39-78.

[50] W.M. Pardridge, Blood-brain barrier biology and methodology J Neurovirol 5

(1999) 556-569.

[51] W.S. Sly, C. Vogler, J.H. Grubb, B. Levy, N. Galvin, Y. Tan, T. Nishioka, S.

Tomatsu, Enzyme therapy in mannose receptor-null mucopolysaccharidosis VII mice

defines roles for the mannose 6-phosphate and mannose receptors Proc Natl Acad

Sci U S A 103 (2006) 15172-15177.

[52] H. Fu, J. DiRosario, S. Killedar, K. Zaraspe, D.M. McCarty, Correction of

Neurological Disease of Mucopolysaccharidosis IIIB in Adult Mice by rAAV9 Trans-

Blood-Brain Barrier Gene Delivery. Mol Ther. (2011).

[53] W.J. Bowers, X.O. Breakefield, M. Sena-Esteves, Genetic therapy for the

nervous system Hum Mol Genet 20 (2011) R28-41.

[54] A.A. Lau, J.J. Hopwood, E.J. Kremer, K.M. Hemsley, SGSH gene transfer in

mucopolysaccharidosis type IIIA mice using canine adenovirus vectors. Mol Genet

Metab. 100 (2010) 168-175.

[55] N.M. Ellinwood, J. Ausseil, N. Desmaris, S. Bigou, S. Liu, J.K. Jens, E.M.

Snella, E.E. Mohammed, C.B. Thomson, S. Raoul, B. Joussemet, F. Roux, Y.

Cherel, Y. Lajat, M. Piraud, R. Benchaouir, S. Hermening, H. Petry, R. Froissart, M.

Tardieu, C. Ciron, P. Moullier, J. Parkes, K.L. Kline, I. Maire, M.T. Vanier, J.M.

Heard, M.A. Colle, Safe, efficient, and reproducible gene therapy of the brain in the

dog models of Sanfilippo and Hurler syndromes Mol Ther 19 (2011 ) 251-259.

[56] J.A. Metcalf, X. Ma, B. Linders, S. Wu, A. Schambach, K.K. Ohlemiller, A.

Kovacs, M. Bigg, L. He, D.M. Tollefsen, K.P. Ponder, A Self-inactivating γ-Retroviral

Vector Reduces Manifestations of Mucopolysaccharidosis I in Mice. Molecular

Therapy 18 (2010) 334–342.

[57] G.R. Villani, A. Follenzi, B. Vanacore, C. Di Domenico, L. Naldini, P. Di

Natale, Correction of mucopolysaccharidosis type IIIb fibroblasts by lentiviral vector- mediated gene transfer Biochem J 364 (2002) 747-753.

[58] P. Di Natale, C. Di Domenico, N. Gargiulo, S. Castaldo, Y.R.E. Gonzalez, P.

Mithbaokar, M. De Felice, A. Follenzi, L. Naldini, G.R. Villani, Treatment of the mouse model of mucopolysaccharidosis type IIIB with lentiviral-NAGLU vector

Biochem J 388 (2005) 639-646.

[59] C. Di Domenico, G.R. Villani, D. Di Napoli, E.G. Reyero, A. Lombardo, L.

Naldini, P. Di Natale, Gene therapy for a mucopolysaccharidosis type I murine model with lentiviral-IDUA vector Hum Gene Ther 16 (2005) 81-90.

[60] D.J. Watson, J.H. Wolfe, Lentiviral vectors for gene transfer to the central nervous system. Applications in lysosomal storage disease animal models Methods

Mol Med 76 (2003) 383-403.

[61] H. Miyoshi, U. Blomer, M. Takahashi, F.H. Gage, I.M. Verma, Development of a self-inactivating lentivirus vector J Virol 72 (1998) 8150-8157.

[62] Y. Zheng, N. Rozengurt, S. Ryazantsev, D.B. Kohn, N. Satake, E.F. Neufeld,

Treatment of the mouse model of mucopolysaccharidosis I with retrovirally transduced bone marrow Mol Genet Metab 79 (2003) 233-244.

[63] Y. Zheng, S. Ryazantsev, K. Ohmi, H.Z. Zhao, N. Rozengurt, D.B. Kohn, E.F.

Neufeld, Retrovirally transduced bone marrow has a therapeutic effect on brain in the mouse model of mucopolysaccharidosis IIIB Mol Genet Metab 82 (2004) 286-

295.

[64] P. Dickson, Novel treatments and future perspectives: outcomes of intrathecal drug delivery. Int J Clin Pharmacol Ther. ;47 . 47 (2009) Suppl 1:S124-127.

[65] E. Piotrowska, J. Jakobkiewicz-Banecka, S. Baranska, A. Tylki-Szymanska,

B. Czartoryska, A. Wegrzyn, G. Wegrzyn, Genistein-mediated inhibition of glycosaminoglycan synthesis as a basis for gene expression-targeted isoflavone therapy for mucopolysaccharidoses Eur J Hum Genet 14 (2006) 846-852.

[66] T. Cox, R. Lachmann, C. Hollak, J. Aerts, S. van Weely, M. Hrebicek, F. Platt,

T. Butters, R. Dwek, C. Moyses, I. Gow, D. Elstein, A. Zimran, Novel oral treatment of Gaucher's disease with N-butyldeoxynojirimycin (OGT 918) to decrease substrate biosynthesis Lancet 355 (2000) 1481-1485.

[67] J.R. Cook, H. Nistala, F. Ramirez, Drug-based therapies for vascular disease in Marfan syndrome: from mouse models to human patients Mt Sinai J Med 77

(2010) 366-373.

[68] B.S. Brooke, J.P. Habashi, D.P. Judge, N. Patel, B. Loeys, H.C. Dietz, 3rd,

Angiotensin II blockade and aortic-root dilation in Marfan's syndrome N Engl J Med

358 (2008) 2787-2795.

[69] H. Nistala, S. Lee-Arteaga, L. Carta, J.R. Cook, S. Smaldone, G. Siciliano,

A.N. Rifkin, H.C. Dietz, D.B. Rifkin, F. Ramirez, Differential effects of alendronate and losartan therapy on osteopenia and aortic aneurysm in mice with severe Marfan syndrome Hum Mol Genet 19 (2010) 4790-4798.

[70] C.M. Simonaro, Y. Ge, E. Eliyahu, X. He, K.J. Jepsen, E.H. Schuchman,

Involvement of the Toll-like receptor 4 pathway and use of TNF-alpha antagonists for

treatment of the mucopolysaccharidoses Proc Natl Acad Sci U S A 107 (2010) 222-

227.

[71] D. Smith, K. Wallom, I. Williams, M. Jeyakumar, F. Platt, Beneficial effects of anti-inflammatory therapy in a mouse model of Niemann-Pick disease type C1.

Neurobiol Dis. 36 (2009) 242-251.

[72] C. Davidson, N. Ali, M. Micsenyi, G. Stephney, S. Renault, K. Dobrenis, D.

Ory, M. Vanier, S. Walkley, Chronic cyclodextrin treatment of murine Niemann-Pick

C disease ameliorates neuronal cholesterol and glycosphingolipid storage and disease progression. PLoS One. 4 (2009) e6951.

[73] R.O. Brady, Enzyme replacement for lysosomal diseases Annu Rev Med 57

(2006) 283-296.

[74] B. Sun, A. Bird, S.P. Young, P.S. Kishnani, Y.T. Chen, D.D. Koeberl,

Enhanced response to enzyme replacement therapy in Pompe disease after the induction of immune tolerance Am J Hum Genet 81 (2007) 1042-1049.

[75] L.A. Clarke, J.E. Wraith, M. Beck, E.H. Kolodny, G.M. Pastores, J. Muenzer,

D.M. Rapoport, K.I. Berger, M. Sidman, E.D. Kakkis, G.F. Cox, Long-term efficacy and safety of laronidase in the treatment of mucopolysaccharidosis I Pediatrics 123

(2009) 229-240.

[76] J.E. Wraith, M. Scarpa, M. Beck, O.A. Bodamer, L. De Meirleir, N. Guffon, A.

Meldgaard Lund, G. Malm, A.T. Van der Ploeg, J. Zeman, Mucopolysaccharidosis type II (Hunter syndrome): a clinical review and recommendations for treatment in the era of enzyme replacement therapy Eur J Pediatr 167 (2008) 267-277.

[77] P. Harmatz, R. Giugliani, I.V. Schwartz, N. Guffon, E.L. Teles, M.C. Miranda,

J.E. Wraith, M. Beck, L. Arash, M. Scarpa, D. Ketteridge, J.J. Hopwood, B. Plecko,

R. Steiner, C.B. Whitley, P. Kaplan, Z.F. Yu, S.J. Swiedler, C. Decker, Long-term follow-up of endurance and safety outcomes during enzyme replacement therapy for mucopolysaccharidosis VI: Final results of three clinical studies of recombinant human N-acetylgalactosamine 4-sulfatase Mol Genet Metab 94 (2008) 469-475.

[78] E.H. Davies, A. Erikson, T. Collin-Histed, E. Mengel, A. Tylki-Szymanska, A.

Vellodi, Outcome of type III Gaucher disease on enzyme replacement therapy: review of 55 cases J Inherit Metab Dis 30 (2007) 935-942.

[79] P. Luzi, M.A. Rafi, M. Zaka, H.Z. Rao, M. Curtis, M.T. Vanier, D.A. Wenger,

Biochemical and pathological evaluation of long-lived mice with globoid cell leukodystrophy after bone marrow transplantation Mol Genet Metab 86 (2005) 150-

159.

[80] M.L. Escolar, M.D. Poe, J.M. Provenzale, K.C. Richards, J. Allison, S. Wood,

D.A. Wenger, D. Pietryga, D. Wall, M. Champagne, R. Morse, W. Krivit, J.

Kurtzberg, Transplantation of umbilical-cord blood in babies with infantile Krabbe's disease N Engl J Med 352 (2005) 2069-2081.

[81] C. Peters, E.G. Shapiro, J. Anderson, P.J. Henslee-Downey, M.R. Klemperer,

M.J. Cowan, E.F. Saunders, P.A. deAlarcon, C. Twist, J.B. Nachman, G.A. Hale,

R.E. Harris, M.K. Rozans, J. Kurtzberg, G.H. Grayson, T.E. Williams, C. Lenarsky,

J.E. Wagner, W. Krivit, Hurler syndrome: II. Outcome of HLA-genotypically identical sibling and HLA-haploidentical related donor bone marrow transplantation in fifty-

four children. The Storage Disease Collaborative Study Group Blood 91 (1998)

2601-2608.

[82] C. Di Domenico, G.R. Villani, D. Di Napoli, E. Nusco, G. Cali, L. Nitsch, P. Di

Natale, Intracranial gene delivery of LV-NAGLU vector corrects neuropathology in murine MPS IIIB Am J Med Genet A 149A (2009) 1209-1218.

[83] M.A. Rafi, H. Zhi Rao, M.A. Passini, M. Curtis, M.T. Vanier, M. Zaka, P. Luzi,

J.H. Wolfe, D.A. Wenger, AAV-mediated expression of galactocerebrosidase in brain results in attenuated symptoms and extended life span in murine models of globoid cell leukodystrophy Mol Ther 11 (2005) 734-744.

[84] T. Kurai, S. Hisayasu, R. Kitagawa, M. Migita, H. Suzuki, Y. Hirai, T.

Shimada, AAV1 mediated co-expression of formylglycine-generating enzyme and arylsulfatase a efficiently corrects sulfatide storage in a mouse model of metachromatic leukodystrophy Mol Ther 15 (2007) 38-43.

[85] M.A. Passini, J. Bu, J.A. Fidler, R.J. Ziegler, J.W. Foley, J.C. Dodge, W.W.

Yang, J. Clarke, T.V. Taksir, D.A. Griffiths, M.A. Zhao, C.R. O'Riordan, E.H.

Schuchman, L.S. Shihabuddin, S.H. Cheng, Combination brain and systemic injections of AAV provide maximal functional and survival benefits in the Niemann-

Pick mouse Proc Natl Acad Sci U S A 104 (2007) 9505-9510.

[86] A. Fraldi, K. Hemsley, A. Crawley, A. Lombardi, A. Lau, L. Sutherland, A.

Auricchio, A. Ballabio, J.J. Hopwood, Functional correction of CNS lesions in an

MPS-IIIA mouse model by intracerebral AAV-mediated delivery of sulfamidase and

SUMF1 genes Hum Mol Genet 16 (2007) 2693-2702.

[87] C.N. Cearley, J.H. Wolfe, A single injection of an adeno-associated virus vector into nuclei with divergent connections results in widespread vector distribution in the brain and global correction of a neurogenetic disease J Neurosci 27 (2007)

9928-9940.

[88] G.M. Pastores, N.L. Barnett, E.H. Kolodny, An open-label, noncomparative study of miglustat in type I Gaucher disease: efficacy and tolerability over 24 months of treatment Clin Ther 27 (2005) 1215-1227.

[89] E. Elliot-Smith, A.O. Speak, E. Lloyd-Evans, D.A. Smith, A.C. van der Spoel,

M. Jeyakumar, T.D. Butters, R.A. Dwek, A. d'Azzo, F.M. Platt, Beneficial effects of substrate reduction therapy in a mouse model of GM1 gangliosidosis Mol Genet

Metab 94 (2008) 204-211.

[90] M. Jeyakumar, T.D. Butters, M. Cortina-Borja, V. Hunnam, R.L. Proia, V.H.

Perry, R.A. Dwek, F.M. Platt, Delayed symptom onset and increased life expectancy in Sandhoff disease mice treated with N-butyldeoxynojirimycin Proc Natl Acad Sci U

S A 96 (1999) 6388-6393.

[91] R. Schiffmann, Therapeutic approaches for neuronopathic lysosomal storage disorders J Inherit Metab Dis 33 (2010) 373-379.

[92] K.J. Valenzano, R. Khanna, A.C. Powe, R. Boyd, G. Lee, J.J. Flanagan, E.R.

Benjamin, Identification and characterization of pharmacological chaperones to correct enzyme deficiencies in lysosomal storage disorders Assay Drug Dev Technol

9 (2011) 213-235.

[93] J.A. Hawkins-Salsbury, A.S. Reddy, M.S. Sands, Combination therapies for lysosomal storage disease: is the whole greater than the sum of its parts? Hum Mol

Genet 20 (2011) R54-60.

[94] M. Jeyakumar, F. Norflus, C.J. Tifft, M. Cortina-Borja, T.D. Butters, R.L. Proia,

V.H. Perry, R.A. Dwek, F.M. Platt, Enhanced survival in Sandhoff disease mice receiving a combination of substrate deprivation therapy and bone marrow transplantation Blood 97 (2001) 327-329.

[95] M. Jeyakumar, D.A. Smith, I.M. Williams, M.C. Borja, D.C. Neville, T.D.

Butters, R.A. Dwek, F.M. Platt, NSAIDs increase survival in the Sandhoff disease mouse: synergy with N-butyldeoxynojirimycin Ann Neurol 56 (2004) 642-649.

[96] X.K. Zhang, C.S. Elbin, W.L. Chuang, S.K. Cooper, C.A. Marashio, C.

Beauregard, J.M. Keutzer, Multiplex enzyme assay screening of dried blood spots for lysosomal storage disorders by using tandem mass spectrometry Clin Chem 54

(2008) 1725-1728.

[97] B. Wilcken, V. Wiley, Newborn screening Pathology 40 (2008) 104-115.

[98] S.U. Walkley, Secondary accumulation of gangliosides in lysosomal storage disorders Semin Cell Dev Biol 15 (2004) 433-444.

[99] R. McGlynn, K. Dobrenis, S.U. Walkley, Differential subcellular localization of cholesterol, gangliosides, and glycosaminoglycans in murine models of mucopolysaccharide storage disorders J Comp Neurol 480 (2004) 415-426.

[100] R.S. Gravel RA; Kaback MM; Proia, D; Suzuki, Kinuko; Suzuki, Kunihiko, The

GM2 Gangliosidoses, in: C.S. Scriver, WS (Ed.), The Metabolic & Molecular Bases of Inherited Disease, 2001, pp. 3827-3896.

[101] S. Yamashiro, M. Haraguchi, K. Furukawa, K. Takamiya, A. Yamamoto, Y.

Nagata, K.O. Lloyd, H. Shiku, Substrate specificity of beta 1,4-N-

acetylgalactosaminyltransferase in vitro and in cDNA-transfected cells. GM2/GD2 synthase efficiently generates asialo-GM2 in certain cells J Biol Chem 270 (1995)

6149-6155.

[102] K. Furukawa, K. Takamiya, Beta1,4-N-acetylgalactosaminyltransferase--

GM2/GD2 synthase: a key enzyme to control the synthesis of brain-enriched complex gangliosides Biochim Biophys Acta 1573 (2002) 356-362.

[103] Y. Liu, R. Wada, H. Kawai, K. Sango, C. Deng, T. Tai, M.P. McDonald, K.

Araujo, J.N. Crawley, U. Bierfreund, K. Sandhoff, K. Suzuki, R.L. Proia, A genetic model of substrate deprivation therapy for a glycosphingolipid storage disorder J Clin

Invest 103 (1999) 497-505.

[104] Y. Liu, Y.P. Wu, R. Wada, E.B. Neufeld, K.A. Mullin, A.C. Howard, P.G.

Pentchev, M.T. Vanier, K. Suzuki, R.L. Proia, Alleviation of neuronal ganglioside storage does not improve the clinical course of the Niemann-Pick C disease mouse

Hum Mol Genet 9 (2000) 1087-1092.

CHAPTER 2: MPS IIIB AND GalNAcT DOUBLE KNOCKOUT MICE

A paper to be submitted to Molecular Genetics & Metabolism

Eman E.A. Mohammed a, Elizabeth M. Snella a, Michelle M. Rutz-Mendicino a, Rafi

Awedikian a, Franklin D. Echevarria a, Elizabeth M. Whitley b, and N. Matthew

Ellinwood a,b

aDepartments of Animal Science, bVeterinary Pathology, and cVeterinary Clinical

Sciences, Iowa State University, Ames, Iowa, USA, 50011

Corresponding Author: N. Matthew Ellinwood, DVM, PhD, Department of Animal

Science, Iowa State University, 2356D Kildee Hall, Ames, Iowa, USA, 50011-3150

(515) 294-5136

(515) 294-4471 FAX

[email protected]

Abstract

Mucopolysaccharidosis type IIIB (MPS IIIB) is a neuropathic lysosomal storage disorder (LSD) resulting from an inherited deficiency of N-acetyl-α-D- glucosaminidase (Naglu) activity, an enzyme required to degrade the glycosaminoglycan heparan sulphate (HS). A deficiency in Naglu activity leads to lysosomal accumulation of HS as a primary storage substrate, and the gangliosides

GM2 and GM3 as secondary accumulation products. To test the effect on neuropathogenesis of ganglioside accumulation, we bred mice deficient in both

Naglu and GalNaAcT activity. The latter is the enzyme required for synthesis of GM2 and other complex gangliosides. Contrary to our expectation and to double knockout

(DKO) studies where GalNAcT was knocked out in combination with other LSDs, our

DKO mice showed a drastically shortened lifespan (24.5 ± 1.4 weeks, versus 50.5 ±

DKO mice showed motor signs of hind limb ataxia and hyper-extension, which were not seen in single KO or normal mice. At approximately 5 months of age the MPS

IIIB DKO showed a unique pattern of vacuolization and nerve fiber degeneration in the corpus callosum as well as the relatively early intracytoplasmic vacuolation of many neurons and glia, the latter being a characteristic of the MPS IIIB mice. We analyzed motor performance on a rocking Rota-Rod beginning at 3 months of age.

The DKO IIIA and DKO IIIB mice showed impaired performance and were

statistically different from all parental lines. In particular, the DKO MPS IIIB mice were significantly different from the parent MPS IIIB strains at 3, 5, and 6 months

(p ≤0.0245). In conclusion we identified an accelerated form of MPS IIIB within a

DKO model system which showed white matter changes, with attendant performance deficits and a drastically shortened lifespan. This was in stark contrast to our expectations of a salutary response to the elimination of GM2. Despite this, the accelerated pathology and clinical signs represent an improved system to study the MPS IIIB response to therapies, and may be important to investigate neuropathogenesis as well as the role of complex gangliosides in normal CNS function.

Keywords: Double knock out models, Mucopolysaccharidosis type IIIB (MPS IIIB),

GalNAc Transferase.

Introduction:

The mucolpoysaccharidoses (MPSs) are inborn errors of metabolism that are classified as lysosomal storage diseases. An individual MPS condition results from deficient activity of a specific lysosomal enzyme, which leads to lysosomal accumulation of glycosaminoglycans (GAGs). Mucopolysaccharidosis type IIIB

(MPS IIIB, OMIM 252920) is an autosomal recessive syndrome characterized by deficiency in N-acetyl-α-D-glucosaminidase (Naglu, EC: 3.2.1.50) activity which leads to lysosomal accumulation of the GAG heparan sulfate (HS). Clinical signs include childhood onset of hyperactivity and progressive mental retardation ending in dementia and premature death, usually in the second decade [1]. In addition to primary storage of HS, MPS IIIB patients and animal models accumulate the gangliosides GM2 and GM3 in the central nervous system (CNS), by as yet imperfectly understood mechanisms. The GM2 ganglioside accumulation has an unknown role in the clinical phenotype of MPS IIIB but given its presence as a primary or secondary storage product in many other lysosomal storage diseases, we pursued a DKO mouse experiment to investigate the role of GM2 accumulation on the murine MPS IIIB phenotype. Importantly, if GM2 accumulation could be found to play a significant clinical role, there exists the theoretical opportunity to limit this accumulation via a drug based substrate reduction therapy using miglustat, a drug approved as an agent for Gaucher disease [2].

All of the neuropathic MPSs (types I, II, IIIA, IIIB, IIIC, IIID, and VII) store HS as a primary substrate. An essential component of the nerve cell membrane as part

of membrane bound proteoglycans, HS, when stored as part of the pathology of the

neuropathic MPSs, causes progressive mental deterioration by incompletely

elucidated pathological mechanisms. Additional to the primary storage of HS, all of

these MPS disorders have lysosomal accumulations of GM2 and GM3 gangliosides

as secondary storage products [1, 3-11]. The accumulation of gangliosides in the

central nervous system is characteristic of two major groups of diseases; diseases

with primary ganglioside storage which include GM1 and GM2 gangliosidosis and

related conditions (Sandhoff, Tay-Sachs, AB variant, etc. ), and diseases with secondary ganglioside storage, which include Niemann-Pick disease, Gaucher disease, the glycoproteinoses, the mucolipidoses, and the neuropathic mucopolysaccharidoses [12]. In the primary gangliosidoses storage disorders, ganglioside accumulation is associated with progressive neurodegeneration. It is unknown what contribution the ganglioside accumulations make when they accumulate as part of a secondary process.

A DKO mouse approach has been used to evaluate lysosomal storage diseases with ganglioside storage in the context of a DKO system involving mice with β-1, 4-N-acetylgalactosaminyltransferase (GalNAcT, EC: 2.4.1.94) deficiency.

This deficiency renders animals unable to produce GM2 and other complex gangliosides, and hence they will be unable to store GM2 as part of any pathological process. The GalNAcT KO mouse has been used as a single KO to investigate the elimination of complex gangliosides on normal function [13-18], as DKO mice to invest the role of complex ganglioside in the CNS [19-21] and to investigate the role

of complex gangliosides in LSDs [19, 22-25]. The elimination of GalNAcT activity

results in a complete block in the production of complex gangliosides which include

GM2, and results in the formation of only GM3 and GD3 and O-Acetylated GM3 [16,

26]. When used as part of a so called genetic substrate elimination therapy, as was

done with the GalNAcT X Sandhoff disease DKO, the results were characterized by

a very marked improvement in the neurologic function and lifespan than that of the

single KO Sandhoff mice [27]. In contrast to the Sandhoff disease DKO mice,

Niemann pick type C (NPC) disease DKO mice didn’t show significant clinical

improvement in the NPC phenotype [28], despite the alleviation of NPC cholesterol

storage, which was shown in this model system to be ganglioside dependent [18,

29].

Herein, we report our findings on the MPS IIIB/GalNAcT DKO model, and

present additional data on extension of this approach to the MPS IIIA mouse model,

and offer preliminary data on the utility of the MPS IIIB/GalNAcT model to be used in

evaluations of MPS IIIB directed therapies.

2.0 Materials and methods

2.1 Mice

Institutional Animal Care and Use Committee and Institutional Biosafety Committee

protocols were approved for all murine studies through the Office for Responsible

Research at Iowa State University. The MPS IIIB mice (B6.129S6-Naglu tm1Efn /J) were supplied by Jackson Laboratory and GalNAcT mice (B6.129S-Galgt1 tm1Rlp ) were supplied by the Consortium for Functional Glycomics, through Dr. Paulson at

The Scripps Research Institute, LA Jolla, California. Breeding and experimental animals were housed in Iowa State University Laboratory Animal Resources facilities. Animal rooms were held at 68-79 °F, with ~ 40% humidity, were equipped with light timers on a 12 hour cycle, and had 10-15 air changes/hr. At or before reaching IACUC approved humane endpoints, mice were euthanized by CO 2 asphyxiation, or, in the case of tissue collection, by exsanguination/perfusion following surgical anesthesia with IP administered triboromoethanol (20 l/g body wt.), both methods approved by the American Veterinary Medical Association guidelines on euthanasia [30].

Genotyping of mice used DNA from 2mm mouse pup tail clippings extracted by the HotSHOT protocol [31]. The resultant samples were used in PCR amplification reactions to genotype mice at the GalNacT and Naglu loci. The primers and sequences used to amplify the Naglu wild type and mutant allele were derived from those used by The Jackson Laboratory. For the normal Naglu allele they were oIMR5056 5`-GTCGTCTCCTGGTTCTGGAC-3` (forward) and oIMR5057 5`-

ACCACTTCATTCTGGCCAAT-3` reverse. For the mutant Naglu allele we used the

Naglu forward primer with a mutation specific neomycin primer, oIMR8162 5`-

TGGATGTGGAATGTGTGCGAG-3`. To amplify the wild type GalNAcT allele we used T7SF ACACGTGGAGCACTACTTCATG (forward) with 8AR

AGGTCCAGGGGCGTCTTCT (reverse). For the GalNAcT mutant allele we used

T7SF with Neo2-ASR CCTGCGTGCAATCCATCTTGTTC (reverse). The conditions for the Naglu reactions were 94 °C 3 min followed by 40 cycles of 20 s at 98 °C, 1

min at 67 °C, and 1 min at 72 °C with a final exten sion step of 10 min at 72 °C. The conditions for the GalNAcT reactions were 10 min at 94 °C, 10 s at 98 °C followed by 45 cycles of 98 °C 20 s, 58 °C 30 s, and 72 °C 30 s wi th a final extension step of

10 min at 72 °C. All reactions were carried out using a Bio-Rad-My Cycler thermal cycler, and consisted of a final volume of 20 µl containing 0.5 unit of Taq polymerase and 4 µl of extracted DNA. Resultant PCR products were run on 2-3% agarose gel and visualized with SYBR® Safe DNA gel stain. Amplification yielded amplicons predicted to be 596 bp (normal GalNAcT) or ~300 bp (mutant GalNAcT) for

GalNAcT, and 250 bp (normal Naglu) or 270 bp (mutant Naglu).

2.2 Behavioral and clinical monitoring

The colony was monitored by visual inspection for pregnancy, births, weaning, injury, and illness. They were checked twice a week by observation of their behavior, movements, body conditions, and size. Humane endpoints for this study involved but were not limited to the following: a severe hunched posture, very low body condition, inability to walk, weakness in the hind limbs, hyperextension of the hind limbs and associated difficulty in movement, severe and grossly observable urine retention, severe and ongoing vaginal or rectal prolapsed. Mice thus observed were euthanized as described above.

2.3 Life span

Survival analysis was done by using the Kaplan-Meier survival method [32] for the live spans of six groups; normal controls, MPS IIIB, GalNAcT, MPS IIIB DKO, MPS

IIIA, and MPS IIIA DKO mice. Animals were included if they had survived past 6

weeks of age (weaning plus 3 weeks). Censored animals included animals euthanized for non-disease associated reasons seen in the background strains such as malocclusion, non-disease associated skin lesions, head tilt, and, in the case of breeding females, dystocia.

2.4 Rota-Rod

Rota-Rod testing was performed as described previously [33]. This method indirectly measures a combination of factors including coordination, balance and strength and employed an Ugo Basile Microprocessor Controlled Rota-Rod Treadmill (Stoelting

Co., Wood Dale, Illinois). The machine parameters were a fixed speed of 10 revolutions per minute with the direction of revolution changing once every complete revolution. The mice were started training at two months of age and every 4 weeks thereafter until death or euthanasia. Time to first fall was recorded. If an animal did not fall, they were scored at 300 seconds, the maximum time on the Rota-Rod. Data assessed statistically was time to fall by month of age.

2.5 Ganglioside

Gangliosides were isolated and analyzed as described [27, 28, 34, 35]. Following total brain homogenization and extraction of polar lipids, brain gangliosides were separated using HPTLC (TLC-silica gel 60 F, Merck, Darmstadt, Germany) according to the published protocols. Plates were then stained and charred to visualize bands.

2.6 Histology

Tissues fixed in 4% paraformaldehyde were derived from drop fixed samples or from

perfused mice, and were paraffin embedded, sectioned (5uM), and stained with hematoxylin and eosin (H&E). Assessment of tissues was done by an American

Board of Veterinary Pathology Diplomated pathologist (EMW).

2.7 Gene Therapy

In a preliminary experiment, one DKO MPS IIIB mouse was treated at birth with an adeno-associated viral vector containing the human Naglu cDNA (AAV-hNaglu) under the control of the hybrid cytomegalovirus enhancer/chicken beta-actin (CAG) promoter and containing the bovine growth hormone polyadenylation signal. The

AAV-Naglu vector used was an AAV2-8 pseudotyped vector and was supplied by the University of Iowa vector core. Vector administration involved intravenous injection via the superficial temporal vein at ~3 days of age with 50 µl containing 5 x

10E10 AAV-Naglu particles. Blood serum was assayed from samples withdrawn approximately weekly via the saphenous vein. The Naglu assay of serum used a

4MU based substrate following published protocols [36].

2.8 Statistical analysis

We employed SAS statistical software and held our statistical level of significance at α = 0.05. The survival analysis was done using the Proc Life test of SAS followed by a log Rank as the post hoc test. The behavioral comparison between the different groups was analyzed by one way ANOVA, followed by Tukey-Kramer post hoc, and a mixed linear model followed by Tukey-Kramer post hoc.

3.0 Results:

3.1 Mouse production, and clinical progression

We evaluated over 1023 mice including 643 unaffected controls, 270 MPS IIIB, 64

GalNAcT, 17 MPS IIIB DKO, 21 MPS IIIA, and 8 MPS IIIA DKO mice. Based on

PCR derived genotypes, the breeding of mice yielded expected frequency of live animals based on Mendelian inheritance. After weaning, the mice were evaluated twice weekly with the following results. The average and approximate clinical signs observed in our six groups were as follows. The MPS IIIB and MPS IIIA mice showed enlarged bladder, often with vaginal or rectal prolapsed at nine months to a year of age, at which time they were euthanized according to the humane endpoints described in Material and Methods. The MPS IIIA and IIIB mice were grossly indistinguishable, and the clinical signs of both included onset at approximately 6 months of age of an absence of a normal adult level of abdominal fat. At approximately 9-12 months of age, bladder enlargements were evident as a palpable abdominal mass which was also grossly observable. Males manifest a rougher than usual pelage at this time. On average these signs continued for approximately one month until animals required euthanasia on humane grounds. As stated these criteria are related to bladder enlargement and included vaginal, penile/preputial, and rectal prolapses, and/or extreme enlargement of the bladder.

On gross necropsy, findings of note included a lack of abdominal fat, extremely large bladders (volumes collected at necropsy approached 5 ml), with occasional hydronephrosis. All the DKO mice manifested grossly observable clinical signs by four to 8 weeks of ages which consisted of a hyperextension of the hind limbs at the

level of the stifle joint, which was prominent at rest, but not grossly evident during ambulation. This manifestation appears stable until approximately 20 weeks, at which time animals appear with severe hind limb weakness and ataxia affecting ambulation, and hence access to food, and a resultant decline in body condition. At this time other signs noted might include rough hair coat which was easily shed, and urine scalding especially in males. From onset these signs progress rapidly over approximately 4 weeks until animals were euthanized for humane considerations. At necropsy grossly observable signs include an enlarged bladder, low body conditioning and lack of body fat. The GalNAcT showed no grossly observable clinical abnormalities at any age.

3.2 Survivorship and lifespan

A Kaplan-Meier survival analysis was done for all mice groups (Fig. 1) as described above (Kaplan & Meier, 1958). The MPS IIIB DKO mice had significantly (P <

0.0001) shortened survival compared to the single knockout MPS IIIB and GalNAcT mice ((24.5 ± 1.4 weeks, versus 50.5 ± 0.9 wks (MPS IIIB), 38.6 ± 1.2 wks

(GalNAcT)). Double KO MPS IIIA mice also had significantly (P <0.0001) shortened survival compared to the single KO MPS IIIA and GalNAcT mice ((27.5 ± 1.8 weeks, versus 53.8 ± 1.6 wks (MPS IIIA), and 38.6 ± 1.2 wks (GalNAcT)). In summary, all

DKO mice had statistically different survival compared to parental strains (P <

0.0001). However the DKO MPS IIIA and MPS IIIB mice were not statistically different in survival (P = 0.20).

3.2 Rota-Rod

Rota-Rod testing was performed as described above and yielded significant results

indicating impaired ability in the DKO groups. We analyzed the Rota-Rod data using

repeated measures ANOVA, assessing six groups of the mice; Normal (unaffected),

MPS IIIA, MPS IIIB, GalNAcT, DKO MPS IIIB, and DKO MPS IIIA. The DKO IIIB

mice were significantly different from the parent MPS IIIB strains at 3, 5, and 6

months (p ≤0.0245), from the normal mice at 3-6 months (p ≤0.0377), and from the

GalNAcT mice at 6 months (p=0.0002). The DKO IIIA mice were significantly

different from the parent MPS IIIA strains at 3-6 months (p ≤0.0004), from the normal mice at 3-6 months (p ≤0.0 38), and from the GalNAcT mice at 4,5 and 6 months

(p=0.0047). The DKO IIIB and DKO IIIA mice were statistically different at 4 months

(P = 0.0146) (Fig.2).

3.2 Glycosphingolipid Biochemistry

To confirm the ganglioside profiles in the brains of our various groups, we assessed whole brain ganglioside content by HPTLC chromatography as described. Among the GalNAcT-/- mice, there was a total absence of GM2, with the predominant species of gangliosides being GM3 and GD3. As observed previously [15, 27, 28], there was a prominent band consistent with O-acetylated GD3 in all strains of mice which lacked GalNAcT activity. The MPS IIIB affected mice had, as expected, visible bands indicating an increase in GM2, GM3, and GD3 (Fig. 3).

3.3 Histology

The histological sections of a 22 week old normal mouse (Fig 4A-4C) showed histologically normal microglia. The neurons ( ≥ 95%), likewise appeared normal.

Purkinje cells were judged to be 90-95% continues, with 100% continuity noted in the dorsal and medial folia, and 90-95% ventral and lateral folia. Within the choroid, scattered cells had small to large vacuoles (10-20%).

In the histological sections of the 22-week-old MPS IIIB affected mouse (Fig

4D-4F), approximately two third of the microglia distributed uniformly throughout the

CNS showed moderate levels of clear vacuolation characterized by multiple large clear vacuoles. This vacuolation was seen in microglia associated with both the perivascular space as well as neurons. Approximately 50% of the neurons throughout the CNS had vacuoles, with generally smaller intracytoplasmic vacuoles than those seen in the microglia. In some large neurons, especially Purkinje cells, the vacuolation approached, in size and number the vacuolation seen in microglia, but the general impression was of vacuoles with a finer granularity relative to the microglia. The neuronal vacuolation was noted in the cortical neurons, Purkinje neurons, hippocampal neurons, and in brain stem nuclei. Purkinje cell numbers appeared adequate and normal. Nuclei populations were variable with some populations showing moderate and some mild levels of vacuolation. White matter throughout, including the corpus callosum, appeared normal, with the exception that approximately 10% of the perivascular microglia showed vacuolation of a sort seen in the gray matter. Choroidal epithelium showed uniform vacuolation over 90% of the

cells with a mix of sometimes single large vacuoles amidst a background of fine vacuolation. Ependymal cells showed regional and intermittent mild fine intracytoplasmic vacuolation. Leptomeniges in virtually all areas of the CNS showed vacuolation in a combination of fibroblast-like and microglial-like cells, which varied from mild to moderate. Endothelial cells showed no notable pathology.

Histological lesions were not observed in the brain of 22-week-old GalNAcT

(Fig 4G-4I) affected mouse. It showed no vacuolation in white matter, and <10% of the choroid cells had a small number of large vacuoles. Neurons showed no vacuolation, and neither were microglia vacuolated. The leptomeninges, neuropil, and ependyma showed no vacuolation or abnormalities.

In the brain of the 21-week-old DKO MPS IIIB mouse (Fig 4J-4L), approximately ~4/5 of the microglia showed moderate to marked levels of clear vacuolation characterized by multiple large clear vacuoles, uniformly through the

CNS, and was seen in microglia associated with both the perivascular space as well as neurons. The general impression is one of greater severity than was seen the similarly aged single knockout. Approximately 80% of the neurons throughout the

CNS had vacuoles, with generally smaller intracytoplasmic vacuoles than seen in the microglia. In Purkinje cells the same degree of vacuolation was also noted with some degree of drop out, with potentially. This loss ranged from 15% in some folia to near normal in others. The overall impression was that the ventral and lateral folia were more severely affected. Hippocampal and brain stem nuclei neurons showed equivalent vacuolation to other neuronal populations. White matter throughout,

including the corpus callosum, showed uniform and marked pallor and vacuolation in both cell bodies and axons, with an impression of tracts with 50% the normal color density expected. Histological finding throughout were severe but may have been slightly worse in the corona radiate than in the corpus callosum. Choroidal epithelium showed uniform vacuolation, with over 90% of the cells showing a fine vacuolation with sometimes a mix which included single large vacuoles. Ependymal cells showed regional moderate fine intracytoplasmic vacuolation. Leptomeniges showed vacuolation in a combination of fibroblast-like cells and microglia, in virtually all areas of the CNS, which varied from moderate to marked. Endothelial cells showed no notable pathology. Neuropil in this animal showed widespread pallor and vacuolation throughout. This was not associated with adjacent neuronal soma, and greater severity was seen in the periventricular regions.

The brain of the 33-week-old, DKO MPS IIIA mouse showed lesions remarkably similar to the MPS IIIB/GalNAcT knockout (data not shown), with marked intracytoplasmic vacuolization in microglia and neurons, and severe vacuolization of the white matter of corpus callosum. There was server regional loss of Purkinje, which ranged from 90-95% loss in the ventral lateral folia, to 10% loss dorsal and medial folia. Vacuolation in white matter was indistinguishable from that of MPS

IIIB/GalNAcT DKO.

3.4 Gene Therapy

An MPS IIIB DK mouse was injected at two days of age. The animal survived to an age of 50 weeks, at which point it was euthanized for complications associated with

urine retention. The assays of Naglu enzyme activity demonstrated persistent and elevated serum activity between carrier and normal levels.

Discussion:

The current study was motivated by the potential to identify a treatment option for MPS IIIB. In stark contrast to our expectations, the genetic elimination of GM2 and other complex gangliosides had a strong synergistic and deleterious effect on the clinical course of murine MPS IIIB. Despite the lack of positive findings in terms of treatment effect, the elimination of complex gangliosides using the DKO approach may prove a valuable tool in both studying the pathology of neuropathic MPS disorders as well as offering an improved model to assess therapy with earlier time points for evaluation, thus improving the speed of proof of principle studies in mice.

In the present study, the elimination of complex gangliosides in the DKO mice showed significant decreases in neurological function and lifespan. By extending the

MPS IIIB study to the MPS IIIA mice we confirmed that this deleterious effect is the direct effect of heparan sulfate storage which exacerbates, in conjunction with a

GalNAcT null phenotype, the clinical course of disease. This is in stark contrast to the findings of the DKO studies involving Sandhoff and NPC disease mice. The exact mechanism of this accelerated MPS III phenotype is at this time unclear.

Potential explanations and subjects for future investigation involve further characterization of the white matter diseases involved. However in some respects the MPS IIIB DKO phenotype can clearly be seen as an accelerated form of MPS

IIIB. The DKO mice showed serious bladder emptying abnormalities far earlier than

those seen in the single knockout mice. This clinical finding is seen in the context of early, novel, and overt neurological disease in the DKO mice. Together these findings argue for a neurogenic origin involving disrupted micturition. Up to this time it has been unclear whether the urine retention seen in MPS III mice was neurogenic in origin or was primarily an outflow obstruction issue. Some literature, based on histological findings, has focused on the later [37]. Data presented herein would argue for a strong neurogenic contribution to the phenotype.

The DKO MPS IIIB mice brain sections showed neuronal vacuolization normal for MPS IIIB mice at this age, and a prominent axonopathy, with nerve fiber degeneration in the corpus callosum (Fig. 4). The later was entirely absent from age matched MPS IIIB controls. Nor was this degree of prominent axonopathy seen in the single GalNAcT KO mice. It was noted to a much lesser degree in an aged and treated MPS IIIB KO mouse. The exact nature of the white matter lesions bears further investigation. It is unclear whether this is primarily a problem of myelination, demyelination, or axonal dropout due to neuronal loss. There was no grossly observable neuronal loss which would support the latter. Examination of mice at younger ages, and use of ultrastructural investigations will prove useful in this regard.

The GalNAcT KO mice model has been shown to have white matter degeneration at the histological level with only mild clinical signs and a normal lifespan [38]. Myelin-Associated Glycoprotein (MAG) and complex gangliosides play an important role in axon stability in both CNS and PNS and the binding by MAG of

complex gangliosides provides long term axon-myelin stability. Elimination of complex gangliosides apparently induces mild white matter degeneration. Like MPS

IIIB DKO mice, GalNAcT X MAG DKO mice had a progressive neuropathy involving loss of axon-myelin stability, axon degeneration, and hind limb ataxia. The DKO mice lacked the shorter life span and enlarged urinary bladder of the MPS IIIB and

IIIA DKO mice, which indicates there is a specific and accelerating effect on the white matter degeneration of the accumulation of HS by a process which remains unknown.

In an extremely preliminary study we have shown that the DKO model of MPS

IIIB can respond to enzyme based (in this case through a gene therapy delivering the native human cDNA), therapy. This preliminary result indicates that the especially aggressive form of disease in this DKO model may respond to therapy and hence be particularly useful in identifying windows of therapy in the murine model of MPS IIIB. Another valuable use of this approach would be to extend it to the MPS I, II, and VII murine models, all of which store heparan sulfate, and none of which, relative to the orthopedic disease they manifest, have as serious a neurological phenotype as do the MPS IIIB and IIIA single KO mice. In the case of

MPS I and II, these diseases are both more common in children, and there exists

ERT which could potentially treat CNS disease if regulatory issues and problems of the blood brain barrier could be overcome. An animal model system that allows a clearer cut evaluation of the CNS response to therapy would be a valuable resource in this regard.

Acknowledgements

We acknowledge funding from the Center for Integrated Animal Genomics of Iowa

State University, the Lysosomal Storage Disease Research Consortium, and The

Sanfilippo Children’s Research Foundation. We thank Dr. Mark Sands for

consultative support. We also wish to acknowledge the able animal care services of

the Laboratory Animal Resources Office of Iowa State University

References

[1] E.F. Neufeld, J. Muenzer, The Mucopolysaccharidoses, in: C.R. Scriver, A.L.

Beaudet, W.S. Sly, D. Valle (Eds.), The Metabolic and Molecular Bases of Inherited

Disease, McGraw-Hill, Health Professions Division, New York, 2001, pp. 3421-3452.

[2] F.M. Platt, M. Jeyakumar, Substrate reduction therapy Acta Paediatr Suppl 97

(2008) 88-93.

[3] H.H. Li, W.H. Yu, N. Rozengurt, H.Z. Zhao, K.M. Lyons, S. Anagnostaras,

[4] A. Fischer, K.P. Carmichael, J.F. Munnell, P. Jhabvala, J.N. Thompson, R.

Matalon, P.F. Jezyk, P. Wang, U. Giger, Sulfamidase deficiency in a family of

Dachshunds: a canine model of mucopolysaccharidosis IIIA (Sanfilippo A) Pediatr

Res 44 (1998) 74-82.

[5] G. Constantopoulos, R.M. Shull, N. Hastings, E.F. Neufeld, Neurochemical characterization of canine alpha-L-iduronidase deficiency disease (model of human mucopolysaccharidosis I) J Neurochem 45 (1985) 1213-1217.

[6] G. Constantopoulos, K. Iqbal, A.S. Dekaban, Mucopolysaccharidosis types

IH, IS, II, and IIIA: glycosaminoglycans and lipids of isolated brain cells and other fractions from autopsied tissues J Neurochem 34 (1980) 1399-1411.

[7] M.Z. Jones, J. Alroy, J.C. Rutledge, J.W. Taylor, E.C. Alvord, Jr., J. Toone, D.

Applegarth, J.J. Hopwood, E. Skutelsky, C. Ianelli, D. Thorley-Lawson, C. Mitchell-

Herpolsheimer, A. Arias, P. Sharp, W. Evans, D. Sillence, K.T. Cavanagh, Human

mucopolysaccharidosis IIID: clinical, biochemical, morphological and immunohistochemical characteristics J Neuropathol Exp Neurol 56 (1997) 1158-

1167.

[8] M.Z. Jones, J. Alroy, P.J. Boyer, K.T. Cavanagh, K. Johnson, D. Gage, J.

Vorro, J.A. Render, R.S. Common, R.A. Leedle, C. Lowrie, P. Sharp, S.S. Liour, B.

Levene, H. Hoard, R. Lucas, J.J. Hopwood, Caprine mucopolysaccharidosis-IIID: clinical, biochemical, morphological and immunohistochemical characteristics J

Neuropathol Exp Neurol 57 (1998) 148-157.

[9] M. Bhaumik, V.J. Muller, T. Rozaklis, L. Johnson, K. Dobrenis, R.

Bhattacharyya, S. Wurzelmann, P. Finamore, J.J. Hopwood, S.U. Walkley, P.

Stanley, A mouse model for mucopolysaccharidosis type III A (Sanfilippo syndrome)

Glycobiology 9 (1999) 1389-1396.

[10] A.S. Dekaban, V.M. Patton, Hurler's and Sanfilippo's variants of mucopolysaccharidosis. Cerebral pathology and lipid chemistry Arch Pathol 91

(1971) 434-443.

[11] N.M. Ellinwood, L. Verot, M.-A. Colle, U. Giger, M.T. Vanier, M.E. Haskins,

Canine Mucopolysaccharidosis IIIB: Aspects of Visceral and Brain Pathology,

American Society of Human Genetics 54th Annual Meeting, Toronto, Ontario,

Canada, 2004, pp. 317.

[12] S.U. Walkley, K. Suzuki, Consequences of NPC1 and NPC2 loss of function in mammalian neurons Biochim Biophys Acta 1685 (2004) 48-62.

[13] K. Takamiya, A. Yamamoto, K. Furukawa, J. Zhao, S. Fukumoto, S.

Yamashiro, M. Okada, M. Haraguchi, M. Shin, M. Kishikawa, H. Shiku, S. Aizawa, K.

Furukawa, Complex gangliosides are essential in spermatogenesis of mice: possible roles in the transport of testosterone Proc Natl Acad Sci U S A 95 (1998) 12147-

12152.

[14] J. Zhao, K. Furukawa, S. Fukumoto, M. Okada, R. Furugen, H. Miyazaki, K.

Takamiya, S. Aizawa, H. Shiku, T. Matsuyama, K. Furukawa, Attenuation of interleukin 2 signal in the spleen cells of complex ganglioside-lacking mice J Biol

Chem 274 (1999) 13744-13747.

[15] K. Takamiya, A. Yamamoto, K. Furukawa, S. Yamashiro, M. Shin, M. Okada,

S. Fukumoto, M. Haraguchi, N. Takeda, K. Fujimura, M. Sakae, M. Kishikawa, H.

Shiku, S. Aizawa, Mice with disrupted GM2/GD2 synthase gene lack complex gangliosides but exhibit only subtle defects in their nervous system Proc Natl Acad

Sci U S A 93 (1996) 10662-10667.

[16] K.A. Sheikh, J. Sun, Y. Liu, H. Kawai, T.O. Crawford, R.L. Proia, J.W. Griffin,

R.L. Schnaar, Mice lacking complex gangliosides develop Wallerian degeneration and myelination defects Proc Natl Acad Sci U S A 96 (1999) 7532-7537.

[17] K. Furukawa, K. Takamiya, Beta1,4-N-acetylgalactosaminyltransferase--

GM2/GD2 synthase: a key enzyme to control the synthesis of brain-enriched complex gangliosides Biochim Biophys Acta 1573 (2002) 356-362.

[18] S. Chiavegatto, J. Sun, R.J. Nelson, R.L. Schnaar, A functional role for complex gangliosides: motor deficits in GM2/GD2 synthase knockout mice Exp

Neurol 166 (2000) 227-234.

[19] T. Yamashita, Y.P. Wu, R. Sandhoff, N. Werth, H. Mizukami, J.M. Ellis, J.L.

Dupree, R. Geyer, K. Sandhoff, R.L. Proia, Interruption of ganglioside synthesis

produces central nervous system degeneration and altered axon-glial interactions

Proc Natl Acad Sci U S A 102 (2005) 2725-2730.

[20] B. Pan, S.E. Fromholt, E.J. Hess, T.O. Crawford, J.W. Griffin, K.A. Sheikh,

R.L. Schnaar, Myelin-associated glycoprotein and complementary axonal ligands, gangliosides, mediate axon stability in the CNS and PNS: neuropathology and behavioral deficits in single- and double-null mice Exp Neurol 195 (2005) 208-217.

[21] Y. Ohmi, O. Tajima, Y. Ohkawa, A. Mori, Y. Sugiura, K. Furukawa, K.

Furukawa, Gangliosides play pivotal roles in the regulation of complement systems and in the maintenance of integrity in nerve tissues. Proc Natl Acad Sci U S A. 106

(2009) 22405-22410.

[22] S.U. Walkley, Secondary accumulation of gangliosides in lysosomal storage disorders Semin Cell Dev Biol 15 (2004) 433-444.

[23] S.U. Walkley, M. Zervas, S. Wiseman, Gangliosides as modulators of dendritogenesis in normal and storage disease-affected pyramidal neurons Cereb

Cortex 10 (2000) 1028-1037.

[24] S.U. Walkley, Pyramidal neurons with ectopic dendrites in storage diseases exhibit increased GM2 ganglioside immunoreactivity Neuroscience 68 (1995) 1027-

1035.

[25] S.U. Walkley, Neurobiology and cellular pathogenesis of glycolipid storage diseases Philos Trans R Soc Lond B Biol Sci 358 (2003) 893-904.

[26] K. Sango, O.N. Johnson, C.A. Kozak, R.L. Proia, beta-1,4-N-

Acetylgalactosaminyltransferase involved in ganglioside synthesis: cDNA sequence,

expression, and chromosome mapping of the mouse gene Genomics 27 (1995) 362-

365.

[27] Y. Liu, R. Wada, H. Kawai, K. Sango, C. Deng, T. Tai, M.P. McDonald, K.

Araujo, J.N. Crawley, U. Bierfreund, K. Sandhoff, K. Suzuki, R.L. Proia, A genetic model of substrate deprivation therapy for a glycosphingolipid storage disorder J Clin

Invest 103 (1999) 497-505.

[28] Y. Liu, Y.P. Wu, R. Wada, E.B. Neufeld, K.A. Mullin, A.C. Howard, P.G.

Pentchev, M.T. Vanier, K. Suzuki, R.L. Proia, Alleviation of neuronal ganglioside storage does not improve the clinical course of the Niemann-Pick C disease mouse

Hum Mol Genet 9 (2000) 1087-1092.

[29] M.C. Gondre-Lewis, R. McGlynn, S.U. Walkley, Cholesterol accumulation in

NPC1-deficient neurons is ganglioside dependent Curr Biol 13 (2003) 1324-1329.

[30] AVMA, Report of the AVMA Panel on Euthanasia, JAVMA, 2001, pp. 669-

696.

[31] G.E. Truett, P. Heeger, R.L. Mynatt, A.A. Truett, J.A. Walker, M.L. Warman,

Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris

(HotSHOT) Biotechniques 29 (2000) 52, 54.

[32] E.L. Kaplan, M. P, Nonparametric estimation from incomplete observations

Journal of the American Statistical Association 53 (1958) 457-481.

[33] C.D. Heldermon, A.K. Hennig, K.K. Ohlemiller, J.M. Ogilvie, E.D. Herzog, A.

Breidenbach, C. Vogler, D.F. Wozniak, M.S. Sands, Development of sensory, motor and behavioral deficits in the murine model of Sanfilippo syndrome type B PLoS

ONE 2 (2007) e772.

[34] N. Fujita, K. Suzuki, M.T. Vanier, B. Popko, N. Maeda, A. Klein, M. Henseler,

K. Sandhoff, H. Nakayasu, K. Suzuki, Targeted disruption of the mouse sphingolipid activator protein gene: a complex phenotype, including severe leukodystrophy and wide-spread storage of multiple sphingolipids Hum Mol Genet 5 (1996) 711-725.

[35] T. Kyrklund, Two procedures to remove polar contaminants from a crude brain lipid extract by using prepacked reversed-phase columns Lipids 22 (1987) 274-

277.

[36] N.M. Ellinwood, P. Wang, T. Skeen, N.J. Sharp, M. Cesta, S. Decker, N.J.

(2003) 489-504.

[37] S.I. Gografe, P.R. Sanberg, W. Chamizo, H. Monforte, S. Garbuzova-Davis,

Novel pathologic findings associated with urinary retention in a mouse model of mucopolysaccharidosis type IIIB Comp Med 59 (2009) 139-146.

[38] R.L. Schnaar, Brain gangliosides in axon-myelin stability and axon regeneration FEBS Lett 584 (2010) 1741-1747.

Figure 1.

Survival curves by Kaplan -Meier (KM) analysis. The life span of the six phenotype groups from left to right; DKO MPS IIIB/GalNAcT, DKO MPS IIIA/GalNAcT,

GalNAcT, MPS IIIB, MPS IIIA, and Unaffected mice.

Rocking Rotorod

300

250

200 Gal MPS IIIA MPS IIIA/Gal 150 MPS IIIB MPS IIIB/Gal Seconds 100 Unaffected

0 2 3 4 5 6 Months

Figure 2.

Rocking Rota-Rod performance and the age of the six phenotype groups, showing that the DKO MPS IIIA and MPS IIIB have deficits in performance at 4, 5, and 6 months of age versus either SKO.

Figure 3.

Thin Layer Chromatograph (TLC) plate for brain lipid analysis showing ganglioside accumulation for brains from: 16 wks normal (lane 2), 18 wks MPS IIIB (lane 3), 25 wks GalNAcT deficiency mice (lane 4), and 23 wks DKO IIIB mice (lane 5).

Figure 4.

Hematoxylin and eosin (H&E) staining of the brain sections from: a 22 week old normal mouse (A, B, C); a 22 week old MPS IIIB single knockout mouse (D, E, F); a

22 week old GalNAcT single knockout mouse (G, H, I); and a 22 week old MPS IIIB

DKO mouse (J, K, L); Panels A, D, G, and J show cerebral cortex neurons. Panels

B, E, H, and K show cerebellar Purkinje neurons. Panels C, F, I, and L show corpus callosum white matter. All sections of cerebral neurons and Purkinje cells are at 100 x magnification. Corpus callosum white matter images are at 20 x magnification. The

MPS IIIB single knockout mouse shows vacuolization in microglia and neuron cells of the cerebral cortex (4D), vacuolization of Purkinje cells of the cerebellum (4E).

The 21 week-old MPS IIIB DKO mouse shows vacuolization not only in microglia and neuron cells but also in the axons and dendrites of the cerebral cortex which

appear loosely and much paler (J), vacuolization of Purkinje cell body and in the axon and dendrites of the cerebellum (K), and vacuolization of the white matter of the corpus callosum (L).

CHAPTER 3: RECOMBINANT DNA FOR MPS III RESEARCH

Introduction

Our aim in the work presented here was the production of recombinant DNA reagents to aid in the study of the pathogenesis of and to improve therapy for MPS

III. Herein, we focus on two research areas; we generated 1) a conditional knockout vector to generate mice to study MPS III pathogeneses in vivo and 2) a vector to be used ex-vivo to transduce Hematopoietic Stem Cells (HSCT) to improve therapeutic approaches for MPS III.

Pathology in MPS III; The cellular level in CNS

MPS III is characterized by clinical symptoms which start at 2-6 years of age which include; diarrhea, sleep disturbances, hyperactivity, delayed speech, learning disability, and stiff joints without stunted growth. Overall the disease is characterized by mental deterioration and CNS degeneration which are somehow triggered by storage of the primary substrate HS. While lysosomal accumulation of HS is the inciting cause, we do not know the molecular and cellular mechanism of the effect of this storage on the clinical deterioration and its specific effect on the brain pathology.

In previous studies on MPS IIIB mice, vacuolization in both microglia and neurons has been detected in the brain. Also, cytoplasmic inclusion of hyperphosphorylated tau (P-tau) have been found in dentate gyrus neurons so that it appears that MPS

IIIB is a tauopathy syndrome, which a key degenerative feature in Alzheimer disease [1]. Other previous studies showed microglia activation and inflammatory

changes in the brain of MPS IIIB mice [2]. Attenuated plasticity has been shown in neurons and astrocytes in MPS IIIB mice [3]. However the specific mechanisms that connect the cellular findings and the clinical signs remain unclear and is an important area of future research.

Understanding MPS III; from brain pathology to clinical signs

The mechanism of how the brain pathology leads to the clinical symptoms of MPS III syndrome could be better understood by dissecting the stages of the disease pathogenesis or the function of different cell populations within the neurodegenerative process so we can know what the root causes of the disease pathogenesis are For example, which is a more important contributor to the clinical signs: microglial inflammation, neurons or oligodendrocytes dysfunction, etc. By using a conditional KO strategy this may be possible to elucidate.

Conditional knockout technique

Conditional gene KO mice involve the use of tissue-specific or temporally-specific knockout strategies to inactivate or disrupt a specific target gene. The results of this gene disruption will be restricted to a single organ or point in time rather than seen in the whole body or from birth. This allows for greater isolation of pathological effects in an animal model [4, 5].

Conditional gene KO approach in the brain

Conditional KO (cKO) approaches have been successfully done in the developing brain to study different cell type functions and also in neurodegenerative diseases to

understand disease pathogenesis related to specific cell populations. Examples of successful cKO used to answer questions in the developing brain involved the role of progeny of radial glial cells in the developing CNS using Cre/loxP system [6].

Radial glial cells are precursors for the developing CNS and differ from the morphologically similar neuroepithelial cells. A mouse line expressing Cre- recombinase was used with Cre-recombinase under the control of the hGFAP promoter which is expressed in radial glial cell during development of that cell type

[6, 7]. Using a fluorescent protein expressing mouse cross, radial glial cell progeny were isolated from different regions of the CNS including the cortex, ganglionic eminence (GE), and spinal cord. Region-specific radial glia cell findings demonstrated regional-specific neurogenesis from glial cell precursors [6]. An example of a cKO used to elucidate a neurodegenerative diseases can be found in a study of Tubular sclerosis complex (TSC). Tubular sclerosis complex is characterized by a defect in the TSC1 gene. Affected children have mental retardation, autism, cognitive abnormalities, and epilepsy [8]. Using a Cre-IRES-

LacZ mouse line with expression driven under the control of hGFAP promoter, researchers investigated the role of astrocyte disturbances in TSC [8] by astrocyte- specific deletion of Tsc1 expression in mice. The resultant mice showed abnormal neuronal organization, seizures, and early death, findings which support an astrocyte-specific role in TSC pathology in mice [8].

New KO technology for MPS III

Existing murine models of MPS III include a conventional KO model (MPS IIIB), and

a spontaneous model (MPS IIIA) both of which have been used to study the disease

pathogenesis [9, 10]. However conventional KO models of MPS III are limited for

studying the brain dysfunction in a rigorous temporal, spatial, or cell type specific

manner. Use of a cKO approach would make this possible. A hurdle to developing

this approach is the soluble nature for the MPS IIIA and IIIB gene products. Cross

correction between the different cell populations in a cKO would make such an

approach unworkable. But in MPS IIIC we can conditionally KO the gene product

since it is an integral membrane protein, is non-soluble, and hence KOed cells will

remain KOed. In conclusion, use of MPS IIIC would allow for the development of a

conditional KO mouse model with which study MPS III pathogenesis at a cellular and

animal systems level.

A conditional gene KO model for MPS IIIC disease

MPS IIIC is one of four types of MPS III, and caused by deficiency of a non-soluble

lysosomal membrane enzyme, Heparan acetyl CoA: α-glucosaminide acetyltransferase (HSGNAT, N-acetyltransferase; E.C. 2.3.1.3). A conditional gene

KO of MPS IIIC by targeting the HSGNAT gene will allow study of the critical cell populations involved in pathogensis of the disease which may aid in development of potential treatments for MPS III and the other neuropathic MPSs ; MPS I, MPS II,

MPS III, and MPS VII.

Combination of therapeutic strategies for MPS III

Hematopoietic stem cells transplantation (HSCT) research has worked successfully

in MPS I patients if they are transplanted on or before two years of age. Patients

showed improvement in the clinical phenotype and saw a substantially prolonged the

life span. The therapeutic window in MPS I to rescue intellectual function appears to

be before two and half years of age. Later transplants for the Hurler form of MPS I

see little to no correction of the CNS disease [11, 12]. For unknown reasons HBCT

has been unsuccessful in preventing the neurological deterioration in MPS IIIB

patients when transplanted at the much younger age of 8 months [13]. In MPS IIIB,

the therapeutic window is either closed at an earlier age than seen in MPS I, or that

the microglial cells differentiated from the hematopoietic stem cell transplant do not

produce sufficient enzyme needed to treat the MPS IIIB affected CNS.

Gene therapy augmented HBCT in mouse models

Examples of LSDs in which a combination of HBCT and gene therapy (GT) have

been evaluated in mouse models include metachromatic lekuodystrophy (MLD). This

LSD is caused by a deficiency of the lysosomal enzyme arylsulfatase A (ARSA; EC

3.1.6.8) and is characterized by myelin degeneration in both CNS and PNS, with

accumulation of galactosyl-3-sulfate ceramide (sulfatide) in glial cells and neurons.

Transplantation of HSC which had been genetically modified with a lentiviral (LV)

vector containing the ARSA gene, was used to treat As2 -/- mice model and it led to reconstituted activity of arylsulfatase A activity and prevented learning and coordination defects and neuronal pathology of the MLD mice [14]. This approach,

involving the combination of HBCT and GT has shown positive outcome in the improvement in MPS I using the mouse model [15]. The long term purpose of this study was the improvement of MPS IIIB treatment by using a combination of GT modification of HBCT using a lentiviral vector, followed by autologous transplantation into diseased mice, with the goal of producing sufficient activity in the CNS of the deficient Naglu.

Advantages of the combination of two therapeutic strategies for MPS III

Different treatment strategies which have been developed using the MPS IIIB mouse model, as have been described in chapter 1. These strategies, by and large, have been used for treatment evaluations in short term murine studies. Our plan was to use a long term treatment strategy using the combination of HSCT and GT in the

MPS IIIB mouse model. Such a therapy has the potential to lead to a widespread

(including the CNS), stable, and continuous distribution of the recombinant enzyme.

We consider a combination therapy is required since HSCT alone is a therapeutic strategy that has been used in MPS IIIB patients at early age but with very poor outcomes [16]. A combination of HSCT and GT has advantages over either HSCT or

GT may separately. Chief among these advantages include even distribution in the brain based on microglia repopulation. Lentiviral vectors are preferred in this role due to advantages involving safety which are related to the self in-activated vectors which have been develop that inactivate the transcriptional activity of the of the long terminal repeat (LTR).

Plasmid construction

A lentiviral vector was used into which was cloned the human Naglu cDNA. This

vector was designed to be used to transduce bone marrow stem cell ex vivo to be followed by transplantation into lethally-irradiated MPS IIIB. This approach is designed to evaluate the therapeutic outcome of the autologous HSC transduced with a lentiviral vector containing hNaglu on MPS IIIB mice.

The human Naglu cDNA under the control of the CMV promotor (a gift from Dr.

Elizabeth Neufeld) was used was subcloned by EcoRI digestion and subcloning into pBluescript II (pBKS) to create another BamHI restriction site at the 5’end of the

Naglu insert. The BamHI fragment was was ligated 3’ of the human phosphoglecerate kinase (hPGK) promoter of a Lentiviral vector (LV) (a gift of Dr.

Alessandra Biffi [17]) into which a BamHI linker had been inserted. (Fig.1).

Materials and Methods

The lentiviral vector was received from collaborators at the vector core of the

Fondazione San Raffaele del Monte Tabor – Milano, Italy. The vector has size of

7840 bp, with a human phosphateglecerate Kinase promoter (hPGK), a self-

inactivating (sin) gene transfer construct (HIV), the Kanamycin resistance gene

(KANA), the enhanced green fluorescent protein gene (eGFP), a polypurine tract

and the termination sequences enhancing nuclear trans-location (PPT), a

Mutated\Woodchuck\hepatitis\B\virus\Post-transcriptional Regulatory Element

(MW/PRE), the cytomegalovirus promoter (CMV), and the Rev-responsive element

(RRE) as a binding site for Rev protein with the viral RNA. A BamHI linker was used

to create a BamHI restriction site in the lentiviral vector to allow insertional cloning of the hNaglu-cDNA. The Naglu cDNA was in the pCMV plasmid under the control of

Cytomegalao virus CMV promoter. The hNaglu-cDNA was shuttled into pBluescript

II KS to introduce BamHI sites on both sides of the cDNA. This was followed by cloning of the cDNA into the Lentiviral vector.

Results

The efficiency of hNaglu cDNA cloning in the Lentiviral vector was evaluated by LRT sequencing using primers designed by Lasergene program and sequenced in Iowa

State sequencing unit. The biological activity of the hNaglu cDNA Lentiviral vector was confirmed by the transfection of Human Embryonic Kidney 293 T (hEK) cells by the calcium phosphate Ca 3 (PO 4)2 transfection method. Naglu activity was detected in 1 ml DMEM media collected after hEK cells transfection 24hrs, 48 hrs, and 72 hrs

(Fig 2). Naglu activity was also detected in the cell extract for the transfected hEK cells with the lentiviral vector after 72 hours. The positive control pCMV-hNaglu- cDNA, and the negative control mock transfection hEK cells are shown in (Fig 3).

Cre-Lox recombination system of conditional gene KOs

The Cre-Lox recombination system is a site specific recombination system and is the most common technique used to generate a conditional gene KO mouse. This technique involves the targeted splicing of specific DNA sequences in the target gene. This is accomplished by an enzyme called Cre recombinase which consists of

4 subunits and 2 domains. The splice sight is known as Lox P, isolated from bacteriophage P1, and consists of 34 pb [18].

Subcloning of the MPS IIIC vector

The pBY49a and pBLoxPa vectors were used for cloning the mouse HSGNAT gene.

The HSGNAT gene is located on chromosome 8 and we cloned fragments which included exons 4 to 6 introduced as 3 fragments; A, B, and C. Two fragment of LoxP sites were inserted into the HSGNAT gene with the positive selection marker (an antibiotic resistance/selection gene; eg. Neomycin resistance gene or Neo) and a negative selection marker (Thmidine Kinase, TK) which was on the boundary between the HSGNAT gene and the vector. One LoxP fragment along with the TK gene was inserted between fragment B and C and cloned into pBLoxPa vector and the other LoxP fragment with Neo gene was inserted between fragment A and B and inserted in pBY49a vector (Fig 4). Plasmids pBY49a and pBYLoxPa were used to generate conditional KO ESC lines at the transgenic core at the University of Iowa.

However this was an unsuccessful effort. By the time our initial homologus recombination attempts were conclude at the University of Iowa, HGSNAT embryonic clones became available from a European consortium of conditional transgenic mouse models, rendering further work in this area redundant on our part.

Conclusions & Future Studies

The combination of GT and HSCT can be used to improve the treatment for MPS

IIIB and to this end we constructed a lentiviral vector containing the hNaglu-cDNA

under the control of hPGK promoter. The lentiviral vector will be used in the future

for ex vivo transduction of HSCT which will then transplanted into lethally irradiated

MPS IIIB mice. Outcomes will be monitored by Naglu activity and GAG level in serum at different ages and also by post mortem biochemical and histopathological tissue analysis.

Studying the single cell populations for function or loss thereof is a valuable tool to understand the pathogenic mechanism for genetic inherited diseases, e.g. the

MPSs. However the conventional KO approach using homologous recombination in embryonic stem cell doesn’t allow for this type of research. Hence we pursued a conditional KO strategy Using a Cre-loxP recombination system and the HSGNAT gene (causative in MPS IIIC) we constructed of a plasmid suitable for homologous recombination. However after we this construction, alternative embryonic stem cell lines have been generated by European consortium rendering further work in this area redundant.

References

[1] K. Ohmi, L.C. Kudo, S. Ryazantsev, H.Z. Zhao, S.L. Karsten, E.F. Neufeld,

Sanfilippo syndrome type B, a lysosomal storage disease, is also a tauopathy Proc

Natl Acad Sci U S A 106 (2009) 8332-8337.

[2] K. Ohmi, D.S. Greenberg, K.S. Rajavel, S. Ryazantsev, H.H. Li, E.F. Neufeld,

Activated microglia in cortex of mouse models of mucopolysaccharidoses I and IIIB

Proc Natl Acad Sci U S A 100 (2003) 1902-1907.

[3] H.H. Li, H.Z. Zhao, E.F. Neufeld, Y. Cai, F. Gomez-Pinilla, Attenuated plasticity in neurons and astrocytes in the mouse model of Sanfilippo syndrome type

B J Neurosci Res 69 (2002) 30-38.

[4] P. Liu, N.A. Jenkins, N.G. Copeland, A highly efficient recombineering-based method for generating conditional knockout mutations Genome Res 13 (2003) 476-

484.

[5] R.H. Friedel, W. Wurst, B. Wefers, R. Kuhn, Generating conditional knockout mice Methods Mol Biol 693 (2011) 205-231.

[6] P. Malatesta, M.A. Hack, E. Hartfuss, H. Kettenmann, W. Klinkert, F.

Kirchhoff, M. Gotz, Neuronal or glial progeny: regional differences in radial glia fate

Neuron 37 (2003) 751-764.

[7] L. Zhuo, M. Theis, I. Alvarez-Maya, M. Brenner, K. Willecke, A. Messing, hGFAP-cre transgenic mice for manipulation of glial and neuronal function in vivo

Genesis 31 (2001) 85-94.

[8] E.J. Uhlmann, M. Wong, R.L. Baldwin, M.L. Bajenaru, H. Onda, D.J.

Kwiatkowski, K. Yamada, D.H. Gutmann, Astrocyte-specific TSC1 conditional

knockout mice exhibit abnormal neuronal organization and seizures Ann Neurol 52

(2002) 285-296.

[9] M. Bhaumik, V.J. Muller, T. Rozaklis, L. Johnson, K. Dobrenis, R.

Bhattacharyya, S. Wurzelmann, P. Finamore, J.J. Hopwood, S.U. Walkley, P.

Stanley, A mouse model for mucopolysaccharidosis type III A (Sanfilippo syndrome)

Glycobiology 9 (1999) 1389-1396.

[10] H.H. Li, W.H. Yu, N. Rozengurt, H.Z. Zhao, K.M. Lyons, S. Anagnostaras,

[11] G. Malm, B. Gustafsson, G. Berglund, M. Lindstrom, K. Naess, B. Borgstrom,

U. von Dobeln, O. Ringden, Outcome in six children with mucopolysaccharidosis type IH, Hurler syndrome, after haematopoietic stem cell transplantation (HSCT)

Acta Paediatr 97 (2008) 1108-1112.

[12] G. Souillet, N. Guffon, I. Maire, M. Pujol, P. Taylor, F. Sevin, N. Bleyzac, C.

Mulier, A. Durin, K. Kebaili, C. Galambrun, Y. Bertrand, R. Froissart, C. Dorche, L.

Gebuhrer, C. Garin, J. Berard, P. Guibaud, Outcome of 27 patients with Hurler's syndrome transplanted from either related or unrelated haematopoietic stem cell sources Bone Marrow Transplant 31 (2003) 1105-1117.

[13] C. Peters, C.G. Steward, Hematopoietic cell transplantation for inherited metabolic diseases: an overview of outcomes and practice guidelines Bone Marrow

Transplant 31 (2003) 229-239.

[14] A. Biffi, M. De Palma, A. Quattrini, U. Del Carro, S. Amadio, I. Visigalli, M.

Sessa, S. Fasano, R. Brambilla, S. Marchesini, C. Bordignon, L. Naldini, Correction of metachromatic leukodystrophy in the mouse model by transplantation of genetically modified hematopoietic stem cells J Clin Invest 113 (2004) 1118-1129.

[15] I. Visigalli, S. Delai, L.S. Politi, C. Di Domenico, F. Cerri, E. Mrak, R. D'Isa, D.

Ungaro, M. Stok, F. Sanvito, E. Mariani, L. Staszewsky, C. Godi, I. Russo, F.

Cecere, U. Del Carro, A. Rubinacci, R. Brambilla, A. Quattrini, P. Di Natale, K.

Ponder, L. Naldini, A. Biffi, Gene therapy augments the efficacy of hematopoietic cell transplantation and fully corrects mucopolysaccharidosis type I phenotype in the mouse model Blood 116 (2010) 5130-5139.

[16] A. Vellodi, E. Young, M. New, C. Pot-Mees, K. Hugh-Jones, Bone marrow transplantation for Sanfilippo disease type B J Inherit Metab Dis 15 (1992) 911-918.

[17] A. Biffi, A. Capotondo, S. Fasano, U. del Carro, S. Marchesini, H. Azuma,

M.C. Malaguti, S. Amadio, R. Brambilla, M. Grompe, C. Bordignon, A. Quattrini, L.

Naldini, Gene therapy of metachromatic leukodystrophy reverses neurological damage and deficits in mice J Clin Invest 116 (2006) 3070-3082.

[18] R.H. Hoess, K. Abremski, Interaction of the bacteriophage P1 recombinase

Cre with the recombining site loxP Proc Natl Acad Sci U S A 81 (1984) 1026-1029.

Figure1.

A lentiviral 5’-3’hNaglu-cDNA plasmid construct-9569 bp with the transgene under the control of human PGK promoter.

1.400 Media 24 hrs 1.200 Media 48 hrs 1.000 n Media 72 hrs 0.800 m 0.600 ol 0.400 e/ 0.200

0.000 293 hEKCs pCMV Naglu pLentiviral

Figure2.

Transfection of 293 hEK cells by the calcium phosphate method.

20.00

15.00

10.00

nmole/ml/hour 5.00

0.00 293 hEKCs pCMV Naglu pLentiviral

Figure3.

Transfection of 293 hEK cells using the calcium phosphate method. Naglu activity was measured in the cell extracts collected from a 6 well plate of the 293 hEK cells transfected with the LV, (right column), the pCMV-hNaglu (middle column), or mock transfected (left column.

Figure 4.

Regions of the HGSNAT gene from exons 4-6, with fragments A, B, and C indicated. b) Methodology for cloning fragments A-C into pBY49a vector. c) HGSNAT gene in murine embryonic stem cells (exons 4-6). d) Homologous recombination between

HGSNAT and targeting vector containing TK negative selection marker, neomycin positive selection marker, and FRT and LoxP sites. e) FRT sites flank neomycin

resistance gene. When bred with FLPe mice, neocmycin resistance gene is removed. f) LoxP sites flank exon 5. When bred with Tissue Specific Cre Mice, exon 5 is removed (g).

CHAPTER 4: CONCLUSIONS AND DISCUSSIONS

Conclusions

There are many theoretical approaches to treat MPS IIIB which included ERT, HCT,

GT, SRT, drug or small molecule therapy, and combinations thereof. Due to the rarity of this disorder, treatments require validation using animal models. But a greater challenge facing development of therapeutics is the delivery of the normal enzyme or gene across the BBB to the CNS, so that one can thereby treat the neurological symptoms of the disease. Also, MPS IIIB is often diagnosed by its signs relatively late. It has not been rigorously proven, but it is considered probable that

CNS deficits, if present as they most often are at diagnosis, would respond poorly to therapy, in that a halt in progression may be the best outcome, with full resolution unlikely. It is quite likely that any fully or maximally effective treatment would require very early initiation, which would only be possible with routine neonatal screening.

The intersection of development of therapy and of diagnostics is a troubling crux, in that large medical infrastructures cannot institute testing without a therapy, and development of a therapy is hampered by not having an optimal patient population to treat.

Since there is at this time no successful treatment strategy which can stop the progression of or treat MPS IIIB disease, we aimed in this study to evaluate a potential treatment approach for MPS IIIB patients. Gangliosides play a crucial role in the development and function of the CNS [1]. However, the abnormal accumulation of gangliosides in the brain can lead to a group of diseases with

characteristic and severe brain degeneration. These diseases include those that store gangliosides as primary substrates of a missing enzyme, and those that accumulate gangliosides as part of a secondary response, the latter group of which includes MPS IIIB. The exact mechanism of this ganglioside triggered disease process and its relationship to ganglioside accumulation is not fully known at a mechanistic level.

As mentioned above, Miglustat (Zavesca) is currently in use as a SRT treatment for non-neuropathic Gaucher disease. It limits the production of normal glycosphingolipids, so that the burden presented to the lysosome is at a level which can be degraded by any residual enzyme capacity, such that the burden of stored substrate is at a level below which one sees disease. Miglustat is a small iminosugar, and acts as a reversible inhibitor of glycosylceramide synthase, the enzyme responsible for catalyzing the first step of glycophospholipid synthesis. This drug can penetrate the BBB and reduce the accumulation of GM2 ganglioside in the

CNS. It has minimal side effects relative to HCT or other potential therapies.

Miglustat has been successfully used in Gaucher type I disease patients [2] and also in NPC disease patients who show improvement and stabilization in the clinical pathology accompanied in the CNS by reduced biosynthesis of glycosphingolipids including glucosylceramide and GM2 ganglioside [3]. In the case of MPS IIIB, the accumulation of GM2 ganglioside could potentially have a crucial role in MPS IIIB neuropathology. If this could be confirmed, substrate reduction therapy with

miglustat might be an effective treatment, limiting the disease’s neurological deterioration.

This was the guiding motivation in our double knockout mouse approach.

However the newly generated DKO MPS IIIB/GalNAcT mice model didn’t show any beneficial improvement in contrast to our expectations. In fact the total genetic elimination of GM2 ganglioside was striking in that it accelerated the clinical course of disease as well as the pathology. It bears mentioning that total genetic elimination of GM2, as we accomplished, might have been predicted to have untoward effects that simply limiting GM2 production to below some accumulation threshold may not have triggered. Regardless of theoretical speculations, since our study was initiated a human clinical trial of miglustat in MPS III patients was conducted, with the finding that there was not significant clinical benefit to miglustat therapy for MPS III [4].

While our model system offers little hope to GM2 targeted therapy in MPS III, the model system has led to findings with two major implications. First, the DKO animals have much more rapid clinical course with drastically shortened lifespans.

This will allow researchers to study the pathogenesis of the disease and response to therapy in a much shorter time frame. The animals also succumb to a clear, rapid, and unambiguous clinical and humane end point. Second, this model has a unique pathological pattern of brain histopathology involving vacuolization of the white matter and neuropil. We feel, given some of the similar clinical findings in our end state DKO mice (urine retention), that this reflects accelerated MPS IIIB associated pathology and not just a novel pathology resulting from the genetic crosses used.

That this model may have utility as a means of testing future therapies is shown by our preliminary gene therapy treated DKO MPS IIIB/GalNAcT mouse, which showed extension in lifespan to nearly one year.

Future studies

The work presented herein is supportive of future study directions. First a rigorous and statistically significant study is required to extend the initial proof of principle work involving the DKO MPS IIIB/GalNAcT gene therapy treated mouse. However, it is critical to consider that even the treated DKO mice had a life span of only a year and didn’t reach a normal life span for the GalNAcT mice. This is suggestive of the need to evaluate very early, i.e. in utero , pathology in MPS IIIB, looking for evidence of HS storage during this period. If found, the possibility of in utero gene therapy is a viable one, to demonstrate if full and complete correction is possible using this model.

Extending the brain histopathology analysis for the DKO MPS IIIB/GalNAcT mice is also warranted. Particularly by examining the brain at different ages with appropriate numbers of affected and control mice, it should be possible to find out whether the defects we see are in development, or if they represent a pathological cascade affecting normally developed white matter. Import also is better characterization of the white matter lesion which could involve transmission electron microscopy to assess axon number and myelination more quantitatively. This could better identify a primary white matter lesion, versus a neuronal lesion that leads to axon drop out.

There is an extant literature on the greater severity of MPS IIIA versus MPS

IIIB. We did see in our model certain time points were the DKO IIIA versus DKO IIIB mice performed worse. A contemporaneous evaluation with larger numbers would be warranted to identify if this phenomena is reproducible and reflects some greater severity in MPS IIIA. The value of this finding might be in helping to identify significant pathological cascades. Gene expression networks that show early or greater changes in activity may help to focus a more hypothesis driven approach to investigating mechanisms.

While we have argued that certain aspects of the clinical presentation of the

DKO model (urine retention) are clearly associated with MPS IIIB, we cannot discount the possibility that some of the pathology of the DKO mice may be related to the GalNAcT null phenotype. It is important to age single knockout animals out to the natural humane end point and to examine brains histologically from these aged animals. This will allow us to conclude whether the DKO pathology is simply an accelerated form of some single knockout pathology (MPS IIIB or GalNAcT), or whether it is has unique characteristics.

The extending the DKO MPS IIIB/GalNAcT mice model to generate a new

DKO mouse model for MPS I/GalNAcT would be of enormous benefit on a number of fronts. First, MPS I is far more common a disease and the model could find application in proof of principle work which could affect very many more individuals.

Second, MPS I is a HS storage disease as well, but with storage of dermatan sulfate that causes a great deal of orthopedic disease. This can complicate the assessment

of the mouse model when researchers wish to focus on the CNS disease. A model with rapidly accelerated disease of the CNS would be of great value. If an MPS I

DKO mouse shows accelerated disease, the same could be expected for MPS II mice, which is a model of another more common neuropathic MPS disorder with HS storage.

The lipid analysis by TLC method documented relatively higher levels of

GM3, GD3, and O-acetylated GD3 gangliosides in the DKO MPS IIIB/GalNAcT mice brain relative to that of SKO GalNAcT mice brain. This provides some potential questions for investigations. There is an extant body of literature on the pathological effect of GD3 at the subcellular level. Investigation of subcellular storage of GD3 in storage diseases has never been undertaken. It is possible that secondary GM2 accumulation has been a red herring, and that the pathological ganglioside is GD3.

Furthermore, the effect of the O-acetylated GD3 is entirely unknown, and bears investigations as well, by both investigating whether it is a pathological accumulation and if so where is the effect, and by evaluating its potential biological effect.

In summary, the newly generated DKO model could be a powerful system to use in the study of the pathogenesis of MPS IIIB disease and also to find appropriate treatment strategies. Also, this model system can be extended to the most common

MPSs like MPS I disease to find an effective treatment for the children affected with this disease.

References

[1] S. Chiavegatto, J. Sun, R.J. Nelson, R.L. Schnaar, A functional role for complex gangliosides: motor deficits in GM2/GD2 synthase knockout mice Exp

Neurol 166 (2000) 227-234.

[2] T. Cox, R. Lachmann, C. Hollak, J. Aerts, S. van Weely, M. Hrebicek, F. Platt,

[3] M.C. Patterson, D. Vecchio, H. Prady, L. Abel, J.E. Wraith, Miglustat for treatment of Niemann-Pick C disease: a randomised controlled study Lancet Neurol

6 (2007) 765-772.

[4] N. Guffon, S. Bin-Dorel, E. Decullier, C. Paillet, J. Guitton, A. Fouilhoux,

Evaluation of Miglustat Treatment in Patients with Type III Mucopolysaccharidosis: A

Randomized, Double-Blind, Placebo-Controlled Study J Pediatr (2011).

APPENDIX A: BIOCHEMICAL ANALYSIS TREATED ANIMAL

MODELS

Gene Therapy

Gene Therapy is a technique used to deliver the genetic material into the cell to treat, prevent or slow the progression of genetic diseases using viral vectors or non- viral vectors methods [1-4]. An adeno-associated viral vector (AAV) containing human Naglu has been evaluated in treatment of MPS IIIB mice by direct injection into the brain [5, 6] and this technique was extended to treat MPS IIIB dogs and evaluate the efficacy via biochemical assays of brain tissue. Direct injection of AAV- hNaglu into the brain of MPS IIIB dogs was conducted to overcome and penetrate the blood brain barrier (BBB) and allow the delivery of the normal gene to the CNS.

The AAV based vectors are very safe, small in size, and can accommodate a small cDNA such as hNaglu. These vectors can be produced in massive production and yield high viral vector concentration. They are non-integrating into the host genome, and elicit very mild immune response in the host. Furthermore, we need not transduce the whole brain since Naglu is easily secreted and taken up by the cells.

Approaches and Techniques

Evaluation of Naglu activity was done in brain samples from dogs described in the attached publication in this appendix. Assays used a fluorometric enzyme assay.

Tissue processing was done by homogenization using the described buffer. Protein

concentration were measured by dye-based absorbance measurement [7] using a

BCA protein assay Kit, and GAG assay was done using alican blue dye method [8].

History of Techniques

Naglu Enzyme Assay Methods

Naglu activity had detected by three different substrate techniques; colorimetric,

radiometric and fluormetric assays. p-nitrophenyl-N-acetyl-α-D-glucosaminide was

used in a Naglu colorimetric assay and the color chage was read using

spectrophotometer at 436 nm (Von Figura K. & Kresse H., 1976). The Naglu enzyme

activity has also been measured using a radiolabelled oligosaccharides substrate

[9]. By far the most sensitive and practical approach however is the 4MU based

fluorometric approach.

Fluormetric methods

Naglu activity was detected in MPS IIIB dogs brain extract by the fluormetric method

using the fluorigenic substrate (4-methylumbelliferyl-α-N-acetylglucosaminide)- 2mM

4-MU in water (50 µl), 0.2M acetate buffer, PH 4.3 (25 µl), and cell extract, which were then incubated for 4 hrs at 37 C. The reaction was stopped by adding 0.5 M

glycine-NaOH buffer, PH 10.3 (1.5 µl) and fluorescence (excitation, 365 nm;

emission; 450 nm) was measured by spectrofluorometer and enzyme activity was

calculated as nanomoles of substrate hydrolyzed per hour per mg protein [10].

100

References

[1] P.J. Xiao, C. Li, A. Neumann, R.J. Samulski, Quantitative 3D Tracing of

Gene-delivery Viral Vectors in Human Cells and Animal Tissues Mol Ther (2011).

[2] A.K. Bevan, S. Duque, K.D. Foust, P.R. Morales, L. Braun, L. Schmelzer,

C.M. Chan, M. McCrate, L.G. Chicoine, B.D. Coley, P.N. Porensky, S.J. Kolb, J.R.

Mendell, A.H. Burghes, B.K. Kaspar, Systemic gene delivery in large species for targeting spinal cord, brain, and peripheral tissues for pediatric disorders Mol Ther

19 (2011) 1971-1980.

[3] X. Xiao, J. Li, T.J. McCown, R.J. Samulski, Gene transfer by adeno- associated virus vectors into the central nervous system Exp Neurol 144 (1997) 113-

124.

[4] W.J. Bowers, X.O. Breakefield, M. Sena-Esteves, Genetic therapy for the nervous system Hum Mol Genet 20 (2011) R28-41.

[5] H. Fu, R.J. Samulski, T.J. McCown, Y.J. Picornell, D. Fletcher, J. Muenzer,

Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery Mol Ther 5 (2002) 42-49.

[6] H. Fu, J. Dirosario, S. Killedar, K. Zaraspe, D.M. McCarty, Correction of neurological disease of mucopolysaccharidosis IIIB in adult mice by rAAV9 trans- blood-brain barrier gene delivery Mol Ther 19 (2011) 1025-1033.

[7] P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D.

Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Measurement of protein using bicinchoninic acid Anal Biochem 150 (1985) 76-85.

101

[8] C.B. Whitley, K.A. Draper, C.M. Dutton, P.A. Brown, S.L. Severson, L.A.

France, Diagnostic test for mucopolysaccharidosis. II. Rapid quantification of glycosaminoglycan in urine samples collected on a paper matrix Clin Chem 35

(1989) 2074-2081.

[9] J.J. Hopwood, H. Elliott, Detection of the Sanfilippo type B syndrome using radiolabelled oligosaccharides as substrates for the estimation of alpha-N- acetylglucosaminidase Clin Chim Acta 120 (1982) 77-86.

[10] J. Marsh, A.H. Fensom, 4-Methylumbelliferyl alpha-N-acetylglucosaminidase activity for diagnosis of Sanfilippo B disease Clin Genet 27 (1985) 258-262.

102

APPENDIX B: SAFE AND EFFICIENT GENE THERAPY IN DOG

MODELS

A paper published in Molecular Therapy

N Matthew Ellinwood 1, 2 , Jérôme Ausseil 3, 4 , Nathalie Desmaris 3, 4 , Stéphanie Bigou 3,

4, Song Liu 3, 4 , Jackie K Jens 1, Elizabeth M Snella 1, Eman EA Mohammed 1,

Christopher B Thomson 1, Sylvie Raoul 5, Béatrice Joussemet 6, Françoise Roux 6, Yan

Chérel 7, Yaouen Lajat 5, Monique Piraud 8, Rachid Benchaouir 9, Stephan

Hermening 9, Harald Petry 9, Roseline Froissart 8, Marc Tardieu 10 , Carine Ciron 11 ,

Philippe Moullier 11 , Jennifer Parkes 2, Karen L Kline 2, Irène Maire 8, Marie-Thérèse

Vanier 12 , Jean-Michel Heard 3,4 and Marie-Anne Colle 7

1Department of Animal Science and the Center for Integrated Animal Genomics,

Iowa State University, Ames, Iowa, USA; 2Department of Veterinary Clinical Science,

Iowa State University, Ames, Iowa, USA; 3Institut Pasteur, Unité Rétrovirus et

Transfert Génétique, Département de Neuroscience, Paris, France; 4INSERM U622,

Paris, France; 5Service de Neurochirurgie, CHU Nord, Nantes, France; 6Centre de

Boisbonne, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes-

Atlantiques (Oniris), Nantes, France; 7UMR INRA 703, Ecole Nationale Vétérinaire,

Agroalimentaire et de l’Alimentation Nantes-Atlantiques (Oniris), Nantes, France;

8Maladies Héréditaire du Métabolisme et Dépistage Néonatal, Centre de Biologie et de Pathologie, Groupement Hospitalier Est, CBPE, Bron, France; 9Amsterdam

103

Molecular Therapeutics (AMT), Amsterdam, The Netherlands; 10 Service de

Neurologie Pédiatrique, Hôpital Bicêtre, Assistance Publique/Hôpitaux de Paris,

INSERM U109, le Kremlin-Bicêtre, France; 11 INSERM U649, Université de Nantes,

Nantes, France; 12 INSERM U820, Faculté de Médecine Laënnec, Lyon, France

Molecular Therapy Vol.19 no.2 Feb. 2011

104

Abstract

Recent trials in patients with neurodegenerative diseases documented the safety of

gene therapy based on adenoassociated virus (AAV) vectors deposited into the

brain. Inborn errors of the metabolism are the most frequent causes of

neurodegeneration in pre-adulthood. In Sanfilippo syndrome, a lysosomal storage

disease in which heparan sulfate oligosaccharides accumulate, the onset of clinical

manifestation is before 5 years. Studies in the mouse model showed that gene

therapy providing the missing enzyme α-N-acetyl-glucosaminidase to brain cells prevents neurodegeneration and improves behavior. We now document safety and efficacy in affected dogs. Animals received eight deposits of a serotype 5 AAV vector, including vector prepared in insect Sf9 cells. As shown previously in dogs with the closely related Hurler syndrome, immunosuppression was necessary to prevent neuroinflammation and elimination of transduced cells. In immunosuppressed dogs, vector was efficiently delivered throughout the brain, induced α-N-acetyl-glucosaminidase production, cleared stored compounds and

storage lesions. The suitability of the procedure for clinical application was further

assessed in Hurler dogs, providing information on reproducibility, tolerance,

appropriate vector type and dosage, and optimal age for treatment in a total number

of 25 treated dogs. Results strongly support projects of human trials aimed at

assessing this treatment in Sanfilippo syndrome.

105

Introduction

Several recent human gene therapy trials for the treatment of neurodegenerative diseases relied on the deposit of adeno-associated virus (AAV) vectors directly into the brain. Results of phase I and phase II studies in Parkinson disease [1-3] and of phase I studies in pediatric neurodegenerative diseases [4, 5] indicated that this procedure is safe.

Lysosomal storage diseases represent the most frequent cause of neurodegeneration in pre-adulthood. AAV-mediated direct gene transfer to the brain has been considered for the treatment of several neuropathic lysosomal storage diseases [6]. This approach is a particularly appropriate treatment option for most forms of Mucopolysaccharidosis type III (MPSIII, i.e. , Sanfilippo syndrome). This disease is a heterogeneous condition caused by the deficiency of one of the lysosomal enzymes specifically required for the degradation of heparan sulfate glycosaminoglycans (GAGs) [7, 8]. Four genetic forms of MPSIII have been described. Type A (MPSIIIA, OMIM #252900), due to sulfamidase (SGSH; EC

3.10.1.1) deficiency, and type B (MPSIIIB, OMIM #252920), due to α-N- acetylglucosaminidase (NAGLU; EC 3.2.1.50) deficiency, are the most frequent. The accumulation of incompletely degraded GAGs in affected cells and tissues is the unique cause of cascades of pathological events. They include the secondary accumulation of gangliosides (GM2 and GM3), which possibly participate in neuropathology [9], and the progressive storage of intracellular vacuoles with lysosomal characteristics throughout the central nervous system [10]. Disease onset is before 5 years marked by hyperactivity and progressive mental impairment and

106

loss of social interaction. The severe neurological consequences of the disease are in stark contrast to the relatively mild somatic disease. By 10–15 years of age, affected children are disabled, often nonambulatory, requiring nutritional support, and in a semivegetative state. They often succumb to their disease in their mid- teens. Correction of the enzyme deficiency in the brain and subsequent clearance of

GAGs, GM2/GM3, and storage lesions will presumably prevent or reduce the most severe clinical manifestations of the disease. Indeed, AAV-mediated gene therapy in the brain of the mouse models of MPSIIIA [11] or MPSIIIB [12, 13] improved neuropathology and animal behavior.

In order to translate proof-of-concept of efficacy from mouse models to human application, we previously explored AAV mediated gene therapy in the brain in seven dogs with MPSI [14], a disease closely related to MPSIII, in which a defect of the lysosomal enzyme α-iduronidase (IDUA; EC 3.2.1.76) interrupts the degradation of both heparan and dermatan sulfate [15]. MPSI (OMIM#607014) differs from MPSIII by severe skeletal involvement and by the relative efficacy of treatments based on hematopoietic stem cell transplantation [7, 8]. Therefore, MPSI is not as attractive a candidate for brain-directed AAV-mediated gene therapy as is

MPSIII. The dog model of MPSI is nevertheless relevant for assessing tolerance and efficacy of gene therapy in a large animal developing MPS-related brain pathology.

Herein, we describe completion of this treatment approach in 10 additional MPSI dogs, in which different treatment protocols were explored. Results reported here emphasize the efficacy and of vector type, vector dose, and age at treatment.

107

At the onset of AAV therapy evaluation in the MPSI dog, no large animal model of MPSIII was available. However, since that time a canine model has been identified and characterized for MPSIIIB [16], which we have used in the present study to assess the safety and efficacy of brain-directed AAV-mediated gene therapy for the treatment of children with MPSIIIB. Affected animals do not express clinical manifestations of the disease until ataxia occurs at late and varying age (18–30 months). Like MPSI dogs, MPSIIIB dogs tolerated AAV mediated gene therapy well.

Biochemical and pathological markers of the disease were improved in the entire brain of treated animals. We also confirmed that the combination of gene therapy with efficient immunosuppression was required for treatment efficacy.

108

Results

Treatment protocol and tolerance

The tolerance and efficacy of AAV-mediated gene therapy in the brain was assessed

in 25 young adult dogs with MPSIIIB ( n = 9), MPSI ( n = 14), or not affected ( n = 2).

Analyses in MPSIIIB dogs were performed in 12.2–18.5-month-old animals. Studied

animals belonged to three groups: untreated dogs ( n = 3), dogs treated with the

AAV2.5NAGLU vector without full immunosuppression (age at treatment: 9.5 and

10.8 months, n = 2), and dogs treated with AAV2.5NAGLU vector and

immunosuppression (age at treatment: 7.6–14.1 months, n = 7). The latter group included two dogs that received vector prepared in insect Sf9 cells using baculovirus vectors (B12 and B15). Analyses in MPSI dogs were performed in 4.2–16.0-month- old animals. Studied animals belonged to four groups: untreated dogs ( n = 5, including one dog that received immunosuppressant), dogs treated with the

AAV5.5IDUA vector and immunosuppressant as young adults (age at treatment:

3.4–4.8 months, n = 4, partial data on these dogs have been previously reported but are shown again to facilitate comparison with new animals that received different treatment protocols15), dogs treated with AAV2.5IDUA vector and immunosuppressant as young adults (age at treatment: 3.9–5.2 months, n = 6), and

dogs treated with the AAV2.5IDUA vector and immunosuppressant at older age (age

at treatment: 7.3–10.0 months, n = 4). Analyses of nonaffected dogs were performed

at 1.6–17.0 months of age ( n = 7). Studied animals belonged to two groups:

109

untreated dogs ( n = 5), and dogs treated with the AAV2.5IDUA vector and immunosuppressant (age at treatment 3.6 and 3.8 months, n = 2).

Treatment consisted of intracerebral deposits of AAV vector. The surgical procedure was similar in all treated dogs. It consisted of four stereotactic tracks with two 50-l vector deposits at different depth per track (total volume 320 l, flow 2

l/mn). The eight successive vector deposits necessitated animal anesthesia for about 4 hours. Surgery was well tolerated. Minor side effects were observed

(hypotension, bradycardia, tachycardia, and hyperthermia), which were transitory and easily accommodated by anesthesia protocol adjustment. Animals experiencing this episode had not significant postoperative issues. Transient diminution of palpebral reflexes, fever and unstable blood pressure, and respiration frequency, which spontaneously reversed after 2–3 days, were observed in three animals. One dog (B99) with a suspected hemostatic disorder not related to MPSIIIB after a completely unremarkable surgery experienced semiparesis and proprioceptive deficit that were fully resolved at 1 month.

Based on our previous observations, the administration of immunosuppressant (a combination of cyclosporine and mycophenolate mofetil) was mandatory to prevent immune response against the therapeutic enzyme in MPSI dogs.15 Immunosuppression was associated with frequent side effects, including the development of papillomas (13 dogs, 52%), gingivitis (4 dogs, 16%), diarrhea (19 dogs, 76%). Disability resulting from papillomas necessitated euthanasia in five

MPSI dogs with severe skeletal manifestations of the disease. Reactions to

110

immunosuppression had less severe consequences in MPSIIIB dogs (papillomas in

three dogs), which appeared healthy at the time of treatment and during follow-up.

Treated MPSIIIB dogs were killed after 3.7–4.4 months. The duration of

follow-up of treated MPSI dogs was determined by the health status and varied from

0.7 to 8.3 months. Brain tissue was investigated to assess gene transfer efficiency

and treatment efficacy. Analyses consisted of vector genome (vg) quantification by

quantitative PCR (qPCR), assay of therapeutic enzyme activity, dosage of primary

and secondary storage products (GAG, GM2 and GM3), and histopathology

examination. Storage lesion density was determined on histological sections stained

by hematein–eosin or luxol fast blue in order to provide an exhaustive view of

pathology throughout the brain. A semiquantitative scoring system (0 indicating the

absence of lesion, with 3 indicating severe pathology) was used for cerebrum and

cerebellum. The number of luxol-positive storage lesions was determined in a

defined surface area of the caudate nucleus. Results are summarized in Table 1,

shown in Figures 1–4, and commented upon below.

AAV genome delivery

Efficient treatment of neuropathology in lysosomal storage diseases supposes broad

vector delivery to brain tissues. We previously showed in MPSI dogs (D6, D7, D8,

and D9) that AAV5 capsids allow delivery of vg to large portions of the brain [15]. We

confirmed these findings in the additional MPSI dogs enrolled in the present study

and showed a similarly efficient spreading of the AAV2.5NAGLU vector in the brain

of MPSIIIB dogs (Table 1 and Supplementary Figure S1).

111

The proportion of brain tissue samples in which vg were detected by qPCR

did not significantly differ between treated MPSI, MPSIIIB, and normal dogs (Figure

1a, P = 0.057). We nevertheless noticed that vg were more frequently detected in

the most caudal brain sections in MPSIIIB than in MPSI dogs. Vector distribution did

not differ between MPSI dogs treated with AAV5.5IDUA or AAV2.5IDUA vectors

(Figure 1a, P = 0.32), and when the AAV2.5IDUA vector was injected in young or

older MPSI dogs (Figure 1b, P = 0.136).

All dogs received a total vector dose of 5 × 1011 vg, with three exceptions

(D16, D17, and D23). The quantification of vg copy numbers in brain tissue showed large variations depending on the animal (Supplementary Figure S1). Maximal values ranged from 81 to 3,289 genome copies/cell in MPSI dogs and from 52 to

2,480 genome copies/cell in MPSIIIB dogs, without significant difference between these groups. Very low genome copy numbers were detected in B54 (<1 genome copy/cell), a MPSIIIB dog that did not receive immunosuppressant. Genome copy numbers were also low in B89 (maximal value 39 genome copies/cell), a MPSIIIB dog in which immunosuppression was halted 2 months before sacrifice due to digital papillomatosis. The highest vg copy numbers among treated MPSIIIB dogs were measured in the two animals that received vector prepared in Sf9 cells, indicating that this preparation method generates particles capable of efficient penetration of target cells. Whereas vg copy number in D16 (dose: 8 × 1011 vg, maximal value 109 genome copies/cell) and D23 (dose: 20 × 1011 vg, maximal value 602 genome copies/cell) did not differ from the mean value in dogs treated with the standard dose

(5 × 1011 vg, maximal value 477 ± 261 genome copies/cell), significantly higher

112

copy numbers were measured in D17 (dose 21 × 1011 vg, maximal value 1,603

genome copies/cell, P = 0.001, one-sample t-test).

Disease correction in MPSIIIB dogs

When compared to non-affected animals, pathology in the brain of 1-year-old

untreated MPSIIIB dogs was characterized by high levels of GAG, GM2/GM3

gangliosides, high scores in semi-quantitative scoring of storage lesions, and a high

density of quantitatively measured luxol-positive storage lesions in the caudate

nucleus (Table 1 and Figures 2–4).

As previously observed for IDUA delivery in the brain of MPSI dogs [15],

NAGLU was detected in large parts of the brain in treated MPSIIIB dogs that

received immunosuppression (>70% in four out of the five dogs in which analysis

was performed (Table 1 and Supplementary Figure S2). However, NAGLU activity remained low or undetectable in the most rostral and most caudal regions of the brain (especially in the cerebellum). Surprisingly, certain distal areas in which

NAGLU was not detected contained vg, as shown by qPCR, suggesting that catalytic activity was too low for detection by the enzyme assay, the sensitivity of which is actually poor ( ≥0.1 U/mg of protein).

All pathology markers were improved in MPSIIIB dogs that received immunosuppression, in comparison to untreated MPSIIIB dogs (Table 1 and Figures

2 and 3). However, values remained higher than in nonaffected dogs (GAG, P =

0.003; GM2, P = 0.048; GM3, P = 0.005; storage lesions in the caudate nucleus, P =

0.018, Figure 2). Moreover, storage lesions persisted unchanged in the cerebellum

and were partially and inconsistently improved in the meninges (Table 1).

113

Consistently with our previous observations in treated MPSI dogs that

received low immunosuppressant regimen [15], NAGLU activity was not detected in

the brain of two dogs (B54 and B89) that did not receive full immunosuppressant

regimen (Table 1 and Supplementary Figure S2). In B54, which never received

immunosuppressant, GAG levels and storage lesions were comparable to untreated

MPSIIIB dogs. GM2 and GM3 accumulations were nevertheless significantly

reduced (Table 1, P = 0.012 and P = 0.018, respectively, one-sample t-test).

However, pathology was not corrected and intense inflammation was observed in the thalamus (Figure 3). In B89, which received immunosuppressant for 2 months followed by 2 months without immunosuppressant, GAG ( P = 0.048), GM2 ( P =

0.015), GM3 ( P = 0.022), and storage lesions in the caudate nucleus ( P = 0.032, one-sample t-test) were significantly reduced, as compared to untreated MPSIIIB dogs. However, inflammation was prominent in the thalamus, perivascular spaces were infiltrated with macrophages, and storage lesions were unchanged as compared to untreated MPSIIIB dogs in the frontal and occipital cortex. These results confirmed that immunosuppression was mandatory to preventing inflammatory response and allowing disease correction in the brain of treated

MPSIIIB dogs.

Disease correction in MPSI dogs

When compared to non-affected animals, pathology in the brain of untreated MPSI dogs was marked by high levels of GAG, GM2/GM3 gangliosides, high scores in the semi-quantitative scoring of storage lesions, and high density of luxol fast blue positive storage lesions in the caudate nucleus (Table 1 and Figures 2 and 3). When

114

comparing approximately age-matched animals (7–12 months), GAG storage and

GM3 accumulation were more marked in MPSIIIB than in MPSI dog (Figure 2, P =

0.036 and P = 0.053, respectively).

With the exception of one dog (D29), all pathology markers were improved in

MPSI dogs treated at early stage of the disease. Values were not significantly

different between MPSI dogs treated with AAV5.5IDUA or AAV2.5IDUA (Table 1 and

Figure 2). However, considering these two groups of treated MPSI dogs together, as

observed for treated MPSIIIB dogs, values remained higher than in non-affected

dogs, indicating persistent low level of GAG storage ( P = 0.005), GM2/GM3

ganglioside accumulation ( P = 0.001 and P = 0.040) and storage lesions in the caudate nucleus ( P = 0.003). Storage lesions persisted in the cerebellum and were only partially improved in the meninges (Table 1).

One animal (D29) showed a contrasting result. Whereas histology was not improved compared to untreated MPSI dogs (Table 1 and Figure 3), GAG, GM2, and GM3 values were lower than in untreated MPSI dogs (Table 1, P < 0.001, P =

0.015, P = 0.011, and P = 0.011, respectively, one-sample t-test). We assume that this dissociated phenotype was related to the short delay between treatment and analysis (0.7 months).

Noticeably, whereas disease correction was fully effective in MPSIIIB dogs treated between 7 and 14.1 months of age, markers of pathology were either not improved or only partially improved in MPSI dogs that received treatment after the age of 7 months, especially with regards to histological lesions (Table 1 and Figure

3). In D15, which was treated at 8.9 months and analyzed shortly after (1.3 months),

115

biomarkers and histology did not show improvement as compared with untreated

MPSI dogs. In D17, which was treated at 10 months and followed up for 6 months, biomarkers were improved but histology indicated major residual lesions. In D16 and

D25, which were treated at 7.3 and 8.3 months and followed up for 4.4 and 1.8 months, respectively, biomarkers were normalized, residual lesions were minimal in the caudate nucleus, but storage lesions persisted at other locations.

116

Discussion

We report herein on a comprehensive study of 25 adult dogs that underwent AAV- mediated direct gene therapy in the brain and 13 untreated control dogs. This study extends and confirms our previous conclusions about the safety and efficacy of this treatment in dog models of MPS [15]. We provide evidence for tolerance and phenotypic improvement in MPSIIIB, a disease that represents a good candidate for clinical evaluation of gene therapy. Results obtained in the two investigated dog models are fully consistent. The high number of animals that were safely and successfully treated emphasizes the reproducibility of the procedure and its suitability for human application.

AAV vector delivery to the brain

Efficient spreading of vector particles in the brain is crucial for the treatment of

diseases like many of the MPSs in which pathology is widespread in the central

nervous system. We previously showed in mice [13], dogs [15], and monkeys [17]

that surgical deposits of AAV5 vectors particles in the brain ensures efficient

spreading of vg throughout the cerebrum. These observations were fully confirmed

in the present study performed in a large number of dogs. Results showed that after

eight deposits of AAV5 particles in the brain through four stereotactic tracks, the

average proportion of the dog brain in which vg were detected was in the range of

85%. Eight dogs showed vg at all investigated territories. Similar spreading was

observed when AAV2 or AAV5 genomes were packaged in AAV5 particles. Two

dogs that received a fourfold higher vector dose were positive throughout the brain,

117

but only one showed higher mean vg copy numbers than the mean value in the 23 animals treated with the regular dose of 5 × 1011 vg, suggesting that the efficiency of vector delivery to brain tissues was not strictly related to the amount of deposited vector particles. For the same vector batch, vg copy numbers in tissues were actually highly variable depending on the animal and the examined brain territory.

The analysis of two normal dogs, which received the AAV2.5IDUA vector and were followed up for ~1 year, indicated that high-vector copy number and widespread distribution in the brain persisted over the long term.

Vector particle deposition was well tolerated. Examination of injection sites at various time points after vector deposition (from 3 weeks to 13.5 months) did not reveal, in the presence of concurrent immunosuppression, either persistent local inflammation, or sequel of inflammatory reaction, even in the animals that received the highest vector dose (2 × 1011 vg at each deposit site). Thus, a deposit of 2 ×

1011 vg was well tolerated. This finding is important when discussing the adequate vector dosing for treating human patients. Vector tolerance was equally good and spreading equally efficient in the two MPSIIIB dogs that received vector particles produced in insect cells using baculovirus vectors, as compared to dogs that received AAV vector prepared by co-transfection of human embryonic kidney 293 human cells with plasmid DNA. The AAV vector production method based on the use of baculovirus vectors to deliver packaging components to Sf9 cells is well adapted to large scale manufacturing processes required for clinical batches preparation [18]. Our results indicate that this method of production should be considered for human trials.

118

Disease correction

MPSI or MPSIIIB dogs do not express clinical manifestations of central nervous system disease at the ages animals were treated and followed-up. Whereas ataxia occurs at advanced stage of the disease in MPSIIIB dogs, animal age at onset is not a reliable clinical marker because of major variations among affected animals and of the absence of an appropriate description of the natural history of the canine disease. Life span, which depends on the affection of peripheral organs in MPSI dogs and of humane decision in MPSIIIB dogs developing ataxia, is also not an adequate clinical marker. We therefore relied on biochemical markers (GAGs and

GM2/GM3 levels) and histological markers to assessing disease severity in dog brain. As pathology associated to MPSI and MPSIIIB is spread throughout the central nervous system, these markers were investigated in the entire brain using adequate methodologies.

Biochemical and histological markers were consistently improved in the almost entire brain in all treated dogs that received immunosuppressant (16 dogs).

Improvement of biochemical markers with persistent histological lesions was observed in few dogs, D29 which was examined early after treatment (0.7 months), three MPSI dogs that were treated after the age of 7.3 months of age (D16, D17,

D25), and two MPSIIIB dogs that did not receive immunosuppressant (B54, B89).

These results suggest that clearance was more rapid and more easily obtained for stored products than for storage lesions. We do not know which of these markers is the most relevant to clinical manifestations in children. With respect to future therapeutic trials, GAG and GM2/GM3 ganglioside concentrations in the

119

cerebrospinal fluid (CSF) represent potential surrogate markers of pathology severity in the brain, and therefore potential end points for the assessment of treatment efficacy in human trials. The observation of a possible dissociation between biochemical and histological markers emphasizes the importance of considering clinical end points in complement to biomarker assays on CSF to assess treatment efficacy in children.

Although biochemical and histological markers were consistently improved in

16 treated dogs that received immunosuppressant, treatment did not result in the complete resolution of disease-associated storage in the brain. Whereas GAG and

GM2/GM3 gangliosides levels were close to normal values, they remained elevated relative to those of normal dogs, and residual histological lesions persisted. We do not know whether this residual disease will result in clinical symptoms in treated children. Treatment efficacy was also limited by the lack of improvement in the cerebellum, which was consistent with the almost total absence of vg in this tissue.

We presume that an additional local vector deposit will be necessary to treat cerebellar disease and associated signs in children.

The age of MPSI dogs at the time of treatment affected efficacy. The four

MPSI dogs treated after the age of 7.3 months showed either no improvement

(D15), improvement of biological markers only (D17), or improvement of biological markers and histological lesions near vector deposition sites but not at distant locations (D16 and D25). These results may represent an age corollary in the canine model to young severely affected MPSI patients, where it is recognized that hematopoietic stem cell transplantation is not efficacious for patients older than 24

120

months [8]. In contrast, MPSIIIB dogs responded fully to treatment when treatment was initiated at 9.2 ± 2.2 months. This result suggests different kinetics of disease progression may apply to canine MPSI and MPSIIIB.

Immunosuppression

A major determinant of treatment safety and efficacy was immunosuppression.

Confirming our previous observations in MPSI dogs that received low immunosuppressant regimen [15], we show that absence (B54), or interruption (B89) of immunosuppressant in MPSIIIB dogs resulted in low vector copy numbers, absence of detectable NAGLU activity in brain extracts, almost unchanged pathology severity and marked inflammatory reaction. These results unambiguously indicate that effective immunosuppression will be mandatory for treatment safety and efficacy in children. Immunization against the therapeutic recombinant enzyme is frequent in children receiving enzyme replacement therapy, including in patients with residual enzyme activity [19].Thus, the synthesis of a mutant protein does not necessarily induce tolerance to the wild type molecule. We previously showed that the immune response was directed against both the vector components and the therapeutic enzyme IDUA in treated MPSI dogs [15]. We therefore presume that a similar reaction occurred against NAGLU in treated MPSIIIB dogs. However, the presence of anti-NAGLU antibodies in treated dog brain extracts could not be documented because antibodies are not available to designing appropriate assays.

Low vg copy numbers in dogs that did not receive immunosuppressant is consistent with the immune elimination of transgenic cells. Interestingly, the improvement of biological markers in B54 and B89 suggests that transient delivery of the therapeutic

121

enzyme preceding immune reaction might have been sufficient to clear primary storage products (GAGs), at least partially and transiently.

This extensive study in dogs provides large animal validation for a treatment of central nervous system manifestations of MPSI and MPSIIIB in affected children using AAV-mediated gene therapy directed to the brain. Patients with MPSIII represent the group of neuropathic MPS patients with the most urgent need for an effective treatment that targets the brain. Indeed, in contrast to MPSI, MPSIII does not appear to be improved by hematopoietic stem cell transplantation and is not associated with severe peripheral manifestations. The devastating natural course of this disease may mitigate consideration of such an approach to therapy, in spite of the known or potential and unforeseeable risks of gene therapy, in addition to the well-documented risks of immunosuppression.

122

Materials and Methods

AAV vector structure, construction, and production

The structure of the AAV5.5-hIDUA vector was previously reported [20]. Briefly, this

vector contains the murine phosphoglycerate kinase ( pgk ) gene promoter, the human complementary DNA (cDNA) coding for IDUA, the woodchuck posttranslational response element and the bovine hormone polyadenylation site.

The AAV2.5-hIDUA has a similar structure in an AAV2 backbone. The AAV2.5- hNAGLU contains the murine phosphoglycerate kinase gene promoter, the human cDNA coding for NAGLU and the bovine hormone polyadenylation site, but does not contain woodchuck post-translational response element. Vector production in human embryonic kidney 293 cells was performed as previously described [20].

For production in Sf9 cells, the human NAGLU cDNA was previously cloned into a pUC-derived plasmid, pKAAV-PGK-hNAGLU-pA, which contains the hNAGLU cDNA under the control of the mouse PGK gene promoter and the bovine hormone polyadenylation site. The fragment containing the ITR and the hNAGLU expression cassette was cloned into the pPSC10 transfer plasmid (Protein Science, Meriden,

CT). The sequence of the final clone was verified by DNA sequencing. A recombinant hNAGLU baculo virus (BAC-hNAGLU) was generated by co- transfection of Sf9 cells with the pPSC10-hNAGLU transfer plasmid and the linearized polyhedron gene-deficient AcNPV virus genome. Titration and integrity testing of BAC-hNAGLU was performed by qPCR. The rAAV5-hNAGLU vector was produced by triple-infection of Sf9 cells with BAC-Rep, BAC-Cap5 and the BAC-

123

hNAGLU, as described [18]. Seventy-two hours before infection, baculovirus stock

was amplified by infection of Sf9 cells. Seventy-two hours Post infection, Sf9 cells

were counted to determine the percentage of viability, and were harvested by

centrifugation (1,900 g for 15 minutes at 4 °C). Cells were lysed at 28 °C for 1 hour under agitation and then treated with Benzonase (Merck, Lyon, France) for 1 hour at

37 °C. Supernatant was clarified by centrifugation at 1,900 g for 15 minutes at 4 °C and further purified by affinity chromatography using AVB Sepharose High-

Performance affinity medium (GE Healthcare, Velizy, France). A second purification step was added using a discontinuous iodixanol gradient protocol as previously described [21]. The fraction containing the higher quantity of vg (determined by qPCR) was ultrafiltrated trough Vivaspin 15 centrifugal tubes (30000 MWCO;

Sartorius Stedim, Aubagne, France) and diafiltrated. The final product was formulated in a solution of phosphate-buffered saline with 5% sucrose.

MPSIIIB dogs

The canine model of MPSIIIB has been previously described [16]. All animal studies

involving MPSIIIB were conducted at Iowa State University and followed both

National Institutes of Health and United States Department of Agriculture guidelines

for the care and use of dogs in research. All protocols were conducted according to

protocols reviewed and approved by the Iowa State University IACUC committee.

Heterozygous and affected MPSIIIB breeders were used to produce affected

MPSIIIB dogs. Dogs were diagnosed at birth by a PCR assay for the mutant NAGLU

allele. The natural history of the disease in these dogs is such that animals are

apparently healthy until 18–30 months, after which they progressively develop

124

severe ataxia. This dog colony carries an additional genetic defect (von Willebrand deficiency), that is unrelated to MPSIIIB and which was identified after the first three dogs were treated (B54, B77, and B99). Subsequent animals were tested to confirm their nonaffected status with regard to von Willebrand factor.

MPSI dogs

Heterozygous MPSI breeders were obtained from Dr E. Kakkis (BioMarin Pharm,

Novato, CA) and Dr H.P. Kiem (Fred Hutchinson Cancer Research Center, Seattle,

WA). Dogs carrying the recessive mutation underlying canine MPSI [22] were bred at the Centre de Boisbonne of the National Veterinary School of Nantes.

Homozygous puppies (MPSI dogs) were diagnosed at birth by IDUA assay showing the absence of detectable activity in peripheral blood lymphocyte extracts. Clinical symptoms of MPSI were noticed soon after birth in most severely affected dogs and before 3 months of age in all MPSI dogs. Symptoms included corneal clouding, facial dysmorphism, dysostosis multiplex, umbilical hernia, liver failure, and holosystolic cardiac murmur. The Institutional Animal Care and Use Committee of the National Veterinary School of Nantes and the University of Nantes approved experiments, which were performed by authorized investigators.

Surgery

MPSI dogs were anesthetized with a combination of medetomidine (Domitor; Pfizer,

Paris, France), morphine (Morphine; Aguettant, Lyon, France), and ketamine

(Imalgène; Merial, Villeurbanne, France) given intravenously as induction drugs.

After endotracheal intubation, anesthesia was maintained with 1.5% isoflurane. For

MPSIIIB dogs, anesthesia consisted of isoflurane inhalation (3% vol/vol) and

125

morphine injection (0.1 mg/kg). Dogs were monitored by clinical observations,

respiratory rate measurement, temperature measurement, electrocardiography,

pulse oximetry, and capnography. Vector was deposited at two locations (four

deposits) in each brain hemisphere during a single session. Tracks targeted the

putamen and the centrum semiovalae (0.2 mm rostral and 10 mm caudal,

respectively, 15 mm lateral to the bregma, depth 10 and 20 mm). All treated animals

received the same vector suspension volume (8 × 40 l) at the same injection flow

(2 l/minute). Amounts of deposited vector depended on vector concentrations in the

deposited suspension (5 × 1011 vg, 1.5 × 1012 vg/ml; 8 × 1011 vg, 2.5 × 1012

vg/ml; 20 × 1011 vg, 6.5 × 1012 vg/ml). No immediate or early severe side effect

presumed to be directly related to surgery or vector deposits was noticed.

Immunosuppression

Immunosuppressants consisted in the combination of mycophenolate mofetil (800

mg/m2/day) and a weekly-adjusted dose of cyclosporine to maintain

cyclosporinemia >300 ng/ml.

Tissue processing

MPSI dogs were killed by over anesthesia when they become unable to stand on

their legs or stop taking food. MPSIIIB dogs were killed ~4 months after surgery.

Anesthetized animals were perfused with 150 ml of phosphate-buffered saline and

600 ml of 4% paraformaldehyde in phosphate-buffered saline. Brain hemispheres

were immediately cut into 4-mm thick coronal slabs ( n = 15–17). Every third slab was used for vg and NAGLU or IDUA activity detection, GAG and ganglioside assays, and histology, respectively. Slabs used for genome detection and enzyme

126

assays were divided in dorsal lateral, dorsal median, ventral lateral, and ventral

median quarters. Each quarter was cut into ~100 mg fragments, which were

submitted to three freeze-thaw cycles after the addition of water (200 l). DNA was extracted from nuclear pellets, and pools corresponding to each entire quarter were used for qPCR. Pools of supernatants were similarly used for enzyme assay. We usually recovered in the range of 40 g of DNA and 15–20 mg of protein/gram of tissue. Much lower values suggested that tissue fixation had been too intense to allow efficient extraction and did not allow reliable vector detection (B63, B71), or enzyme assay (D29, D30, D31, D33, D37, B63, B71). For GAG and gangliosides assays, four samples were analyzed for each dog brain. Each sample consisted in the mixture of two slabs (two rostral left, two rostral right, two dorsal left, and two dorsal right). Values indicated in Table 1 and Figure 2 are means ± SEM of the four

measured values.

Determination of vg copy numbers by qPCR analysis

Sequences from the human NAGLU cDNA, the human IDUA cDNA and the canine

β-glucuronidase gene were amplified. Vg copy numbers were determined by qPCR.

Sequences from the human NAGLU cDNA or human IDUA cDNA were amplified

using either SyberGreen (D6, D7, D8, D9), or Taqman (other dogs) qPCR methods.

Equivalent efficiency of the Taqman and SyberGreen methods was previously

documented in this context [15]. Reference curves were established by determining

cycle threshold (Ct) values for the amplification of serial dilutions of plasmid DNA

containing the human NAGLU [23] or IDUA [24] cDNA (38–6 × 105 copies). The same sequences were simultaneously amplified from serial dilutions of dog brain

127

genomic DNA (0.156–50 ng of DNA/reaction). Vg copy numbers were calculated for

every Ct according to reference curves and expressed for 2N genomes according to

measured canine β-glucuronidase gene copy numbers. Primers and probes: human

NAGLU cDNA, 5 ′-CAGTGCTGCCTGCATTCG-3′ (forward), 5 ′-

GTGACATTGACCTGCATTCG-3′ (reverse), 5 ′-FAM-

TTCCCGAGGCTGTCACCAGG-TAMRA-3′ (probe); human IDUA cDNA, 5 ′-

ACTTGGACCTTCTCAGGGAGAAC-3′ (forward), 5 ′-

CACCTGCTTGTCCTCAAAGTCA-3′ (reverse), 5 ′-FAM-

CAGCGCCTCGGGCCACTTCA-TAMRA-3′ (probe); canine β-glucuronidase gene exon 9, 5 ′-ACGCTGATTGCTCACACCAA-3′ (forward), 5 ′-

CCCCAGGTCTGCTTCATAGTTG-3′ (reverse), 5 ′-FAM-

CCCGGCCCGTGACCTTTGTGA-TAMRA-3′ (probe). Amplification parameters were as previously described [15]. The assay sensitivity threshold was 0.1 copies per diploid genome.

α-N-acetyl glucosaminidase and α-l-iduronidase assays

NAGLU and IDUA assays were performed as described [25, 26]. Tissue was

homogenized in water, submitted to three freeze/thaw cycles and centrifuged at

13,000 r.p.m. for 3 minutes. Detection threshold enzyme activity in tissue extract

was 0.1 U/mg of protein.

Histology

Neuropathology was assessed on full-hemisphere coronal slabs that had been fixed

in 4% paraformaldehyde, embedded in paraffin, and cut into 4-m sections. In

treated dogs, sections were prepared from slabs adjacent to those in which vg and

128

IDUA or NAGLU were assayed, providing information about gene and enzyme

delivery at the examined locations. Sections were stained either with hematoxylin–

eosin for semiquantitative analyses or with periodic acid-Schiff APS and luxol fast

blue associated to Bodian’s silver impregnation for quantitative analysis of residual

lesions.

Storage lesions quantification

Semiquantitative analyses were performed in four neuroanatomic areas (frontal cortex, caudate nucleus, thalamus, and occipital cortex). Lysosomal distension was scored according to the percentage of vacuolated cells (absence = 0; presence in up to 20% of the cells = 1; up to 50% = 2; >50% = 3). For quantitative analysis of storage lesions, neuronal profiles were scored as positive when their cytoplasm contained luxol-stained granules. A 97.7% scoring reliability was measured using materials from five untreated MPSI dogs. Lesions were not detected in non-affected dogs.

Analysis of gangliosides

Samples were homogenized with a minimum volume of water (10% vol./weight).

Total lipids were extracted from water homogenates [27] isolated and desalted using

reverse-phase Bond Elut C18 columns (Varian, Buc, France) [28]. Gangliosides

were separated on G60 high-performance thin-layer chromatography plates (Merck),

visualized by resorcinol/HCl and quantified by densitometry. Data (mean of

duplicates) were expressed as molar percentage of total gangliosides.

GAG assay

129

Frozen samples were homogenized with a minimum volume of water (10%

vol./weight). Defatted pellets were dried and weighed. Dried residues were digested

overnight at 65 °C with papain (0.3% wt.:vol.) in 3 ml of 100 mmol/l sodium acetate

buffer pH 5.5 containing 5 mmol/l cysteine and 5 mmol/l EDTA. After centrifugation,

GAGs were measured in the supernatant with a dimethylmethylene blue dye-binding

assay. Briefly, 200 l of the supernatant was added to 2.5 ml of dimethylmethylene blue reagent [29] and the absorbance at 535 nm was measured. Heparan sulfate

(H7640; Sigma-Aldrich, St Quentin-Fallavier, France) was used as standard. Data

(mean of duplicates) were expressed as g of GAGs per mg of dried pellet.

Statistical analysis

Statistics were performed using the SPSS software (SPSS). The assumption that

the values follow normal distribution was verified by the Shapiro–Wilk’s test.

Indicated P values were calculated using Student’s t-test, except when specified

otherwise.

Supplementary material

Figure S1. Spreading of AAV vectors in treated dog brains.

Figure S2. Spreading of IDUA or NaGlu activity in treated dog brains.

Acknowledgements

We are grateful to Drs E. Kakkis and H.P. Kiem for the generous gift of MPSI

breeder dogs. We thank Dr L. Vérot, Dr M. Perrocheau, F. Thouron, Jérêrome

Amiaud, and Johan Deniaud for technical help, and a cadre of Iowa State University

undergraduate students for assistance with animal production and care. This work

130

was supported by a join program of the Association Française contre les

Myopathies, the Institut Pasteur and the Institut National de la Santé et de la

Recherche Médicale (Programme AAVMPS), by a grant from the Conny Maeva

Charitable Foundation, the Sanfilippo Children’s Research Foundation, and by

Amsterdam Molecular Therapeutics.

131

References

[1] J.L. Eberling, W.J. Jagust, C.W. Christine, P. Starr, P. Larson, K.S.

Bankiewicz, M.J. Aminoff, Results from a phase I safety trial of hAADC gene therapy for Parkinson disease Neurology 70 (2008) 1980-1983.

[2] M.G. Kaplitt, A. Feigin, C. Tang, H.L. Fitzsimons, P. Mattis, P.A. Lawlor, R.J.

Bland, D. Young, K. Strybing, D. Eidelberg, M.J. During, Safety and tolerability of gene therapy with an adeno-associated virus (AAV) borne GAD gene for Parkinson's disease: an open label, phase I trial Lancet 369 (2007) 2097-2105.

[3] W.J. Marks, Jr., J.L. Ostrem, L. Verhagen, P.A. Starr, P.S. Larson, R.A.

Bakay, R. Taylor, D.A. Cahn-Weiner, A.J. Stoessl, C.W. Olanow, R.T. Bartus, Safety and tolerability of intraputaminal delivery of CERE-120 (adeno-associated virus serotype 2-neurturin) to patients with idiopathic Parkinson's disease: an open-label, phase I trial Lancet Neurol 7 (2008) 400-408.

[4] S. Worgall, D. Sondhi, N.R. Hackett, B. Kosofsky, M.V. Kekatpure, N. Neyzi,

J.P. Dyke, D. Ballon, L. Heier, B.M. Greenwald, P. Christos, M. Mazumdar, M.M.

Souweidane, M.G. Kaplitt, R.G. Crystal, Treatment of late infantile neuronal ceroid lipofuscinosis by CNS administration of a serotype 2 adeno-associated virus expressing CLN2 cDNA Hum Gene Ther 19 (2008) 463-474.

[5] S.W. McPhee, C.G. Janson, C. Li, R.J. Samulski, A.S. Camp, J. Francis, D.

Shera, L. Lioutermann, M. Feely, A. Freese, P. Leone, Immune responses to AAV in a phase I study for Canavan disease J Gene Med 8 (2006) 577-588.

132

[6] N.M. Ellinwood, C.H. Vite, M.E. Haskins, Gene therapy for lysosomal storage diseases: the lessons and promise of animal models J Gene Med 6 (2004) 481-506.

[7] E.F. Neufeld, J. Muenzer, The Mucopolysaccharidoses, in: C.R. Scriver, A.L.

Beaudet, W.S. Sly, D. Valle (Eds.), The Metabolic and Molecular Bases of Inherited

Disease, McGraw-Hill, Health Professions Division, New York, 2001, pp. 3421-3452.

[8] G.M. Pastores, P. Arn, M. Beck, J.T. Clarke, N. Guffon, P. Kaplan, J.

Muenzer, D.Y. Norato, E. Shapiro, J. Thomas, D. Viskochil, J.E. Wraith, The MPS I registry: design, methodology, and early findings of a global disease registry for monitoring patients with Mucopolysaccharidosis Type I Mol Genet Metab 91 (2007)

37-47.

[9] S.U. Walkley, Secondary accumulation of gangliosides in lysosomal storage disorders Semin Cell Dev Biol 15 (2004) 433-444.

[10] H.H. Li, W.H. Yu, N. Rozengurt, H.Z. Zhao, K.M. Lyons, S. Anagnostaras,

[11] A. Fraldi, K. Hemsley, A. Crawley, A. Lombardi, A. Lau, L. Sutherland, A.

Auricchio, A. Ballabio, J.J. Hopwood, Functional correction of CNS lesions in an

MPS-IIIA mouse model by intracerebral AAV-mediated delivery of sulfamidase and

SUMF1 genes Hum Mol Genet 16 (2007) 2693-2702.

[12] H. Fu, R.J. Samulski, T.J. McCown, Y.J. Picornell, D. Fletcher, J. Muenzer,

Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery Mol Ther 5 (2002) 42-49.

133

[13] A. Cressant, N. Desmaris, L. Verot, T. Brejot, R. Froissart, M.T. Vanier, I.

Maire, J.M. Heard, Improved behavior and neuropathology in the mouse model of

Sanfilippo type IIIB disease after adeno-associated virus-mediated gene transfer in the striatum Journal of Neuroscience 24 (2004) 10229-10239.

[14] R.M. Shull, R.J. Munger, E. Spellacy, C.W. Hall, G. Constantopoulos, E.F.

Neufeld, Canine alpha-L-iduronidase deficiency. A model of mucopolysaccharidosis

I Am J Pathol 109 (1982) 244-248.

[15] C. Ciron, N. Desmaris, M.A. Colle, S. Raoul, B. Joussemet, L. Verot, J.

Ausseil, R. Froissart, F. Roux, Y. Cherel, N. Ferry, Y. Lajat, B. Schwartz, M.T.

Vanier, I. Maire, M. Tardieu, P. Moullier, J.M. Heard, Gene therapy of the brain in the dog model of Hurler's syndrome Ann Neurol 60 (2006) 204-213.

[16] N.M. Ellinwood, P. Wang, T. Skeen, N.J. Sharp, M. Cesta, S. Decker, N.J.

(2003) 489-504.

[17] C. Ciron, A. Cressant, F. Roux, S. Raoul, Y. Cherel, P. Hantraye, N. Deglon,

B. Schwartz, M. Barkats, J.M. Heard, M. Tardieu, P. Moullier, M.A. Colle, Human alpha-iduronidase gene transfer mediated by adeno-associated virus types 1, 2, and

5 in the brain of nonhuman primates: vector diffusion and biodistribution Hum Gene

Ther 20 (2009) 350-360.

[18] M. Urabe, C. Ding, R.M. Kotin, Insect cells as a factory to produce adeno- associated virus type 2 vectors Hum Gene Ther 13 (2002) 1935-1943.

134

[19] R. Kakavanos, C.T. Turner, J.J. Hopwood, E.D. Kakkis, D.A. Brooks, Immune tolerance after long-term enzyme-replacement therapy among patients who have mucopolysaccharidosis I Lancet 361 (2003) 1608-1613.

[20] N. Desmaris, L. Verot, J.P. Puech, C. Caillaud, M.T. Vanier, J.M. Heard,

Prevention of neuropathology in the mouse model of Hurler syndrome Ann Neurol

56 (2004) 68-76.

[21] S. Zolotukhin, B.J. Byrne, E. Mason, I. Zolotukhin, M. Potter, K. Chesnut, C.

Summerford, R.J. Samulski, N. Muzyczka, Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield Gene Ther 6

(1999) 973-985.

[22] K.P. Menon, P.T. Tieu, E.F. Neufeld, Architecture of the canine IDUA gene and mutation underlying canine mucopolysaccharidosis I Genomics 14 (1992) 763-

768.

[23] B. Weber, L. Blanch, P.R. Clements, H.S. Scott, J.J. Hopwood, Cloning and expression of the gene involved in Sanfilippo B syndrome (mucopolysaccharidosis III

B) Hum Mol Genet 5 (1996) 771-777.

[24] H.S. Scott, D.S. Anson, A.M. Orsborn, P.V. Nelson, P.R. Clements, C.P.

Morris, J.J. Hopwood, Human alpha-L-iduronidase: cDNA isolation and expression

Proc Natl Acad Sci U S A 88 (1991) 9695-9699.

[25] E.D. Kakkis, A. Matynia, A.J. Jonas, E.F. Neufeld, Overexpression of the human lysosomal enzyme alpha-L-iduronidase in Chinese hamster ovary cells

Protein Expr Purif 5 (1994) 225-232.

135

[26] J. Marsh, A.H. Fensom, 4-Methylumbelliferyl alpha-N-acetylglucosaminidase activity for diagnosis of Sanfilippo B disease Clin Genet 27 (1985) 258-262.

[27] N. Fujita, K. Suzuki, M.T. Vanier, B. Popko, N. Maeda, A. Klein, M. Henseler,

[28] T. Kyrklund, Two procedures to remove polar contaminants from a crude brain lipid extract by using prepacked reversed-phase columns Lipids 22 (1987) 274-

277.

[29] C.B. Whitley, M.D. Ridnour, K.A. Draper, C.M. Dutton, J.P. Neglia, Diagnostic test for mucopolysaccharidosis. I. Direct method for quantifying excessive urinary glycosaminoglycan excretion Clin Chem 35 (1989) 374-379.

136

Table 1.

Overview of investigated dog groups, treatment conditions, and disease markers.

Abbreviations: AAV, adeno-associated virus; IDUA, α-iduronidase; MPSIII,

137

mucopolysaccharidosis type III; NAGLU, α-N-acetylglucosaminidase; ND, not determined. This table provides information about the severity of the disease (Cli. exp.: A, absent; M, moderate; S, severe), the age (in months, mo) at treatment (age inject.), the age at euthanasia (age anal.), the duration of follow-up (follow-up), the injected AAV vector type (AAV vector type, asterisks indicate the two dogs that received vector prepared in Sf9 cells, B12 and B15), the total amount of vector genomes deposited in the brain (Vect. dose), the immunosuppressive treatment (IS), the proportion of brain fragments in which >0.1 vector genome copy was detected

(Genome % frag. > 0.1 copy), the proportion of brain fragments in which >0.1 unit of

IDUA (MPSI dogs) or NAGLU (MPSIIIB dogs) per mg of protein was measured

(Enzyme % frag. > 0.1 U), the mean values of GAG, GM2 and GM3 assays (4 determinations per dog, SEM are omitted here for clarity and shown in Figure 2), the mean of the semiquantitative pathology scores determined at four locations (frontal cortex, occipital cortex, thalamus and caudate nucleus) in the brain (mean path. score brain, SEM are omitted here for clarity and shown in Figure 2), the semiquantitative pathology score determined in the cerebellum (mean path. score cereb.), the semiquantitative pathology score determined in the meninges (mean path. score menin.), the number of luxol fast blue positive lesions scored in a predefined area of the caudate nucleus (Lesions luxol + caud. Nucleus). NA: not available. For genomes and enzyme (D30, D31, D33, D37, D29, B63, B71) missing values are due to inappropriate tissue fixation (see Materials and Methods section).

For pathology score in the cerebellum (B89), the missing value is due to the lack of fragment with cerebellar tissue.

138

Figure1.

AAV vector genome spreading in dog brains. MPSI or MPSIIIB dogs received AAV-

mediated gene therapy and immunosuppressive treatment. Brains were cut in 4–8

coronal slabs, which were further divided in four fragments, producing 16–32

fragments per dog brain. Copy numbers of the endogenous β-glucuronidase gene or

AAV vector genomes were determined by quantitative PCR in DNA extracted from

each fragment. The ratio of these two values indicates the number of vector genome

copies/cell. Supplementary Figure S1 shows the distribution in the brain of

fragments containing >0.1 vector genome copies/cell. (a) Histograms indicate the proportion of brain fragments in which >0.1 vector genome copy/cell was measured

139

in each group of treated dog: MPSI dogs treated with AAV5.5IDUA vector ( n = 4),

MPSI dogs treated with AAV2.5IDUA vector ( n = 10), MPSIIIB dogs treated with

AAV2.5NaGlu vector ( n = 7). Data are means ± SEM and not significantly different between groups. Equivalent proportions indicate equivalent spreading of the different vectors used in this study in dog brain. ( b) Mean ± SEM of the proportion of fragments in which >0.1 vector genome copy/cell was measured in MPSI dogs treated with AAV2.5IDUA vector before 5.2 months (D23, D29, D30, D31, D33, D37) or after 7.3 months (D15, D16, D17, D25) of age. Data are not significantly different between groups. AAV, adeno-associated virus; IDUA, α-iduronidase; MPSIII, mucopolysaccharidosis type III; NAGLU, α-N-acetylglucosaminidase.

140

Figure2.

Improvement of disease markers in treated dog brains. Biochemical and histological

markers of disease severity in the brain were measured in untreated normal dogs ( n

= 5), untreated MPSI dogs ( n = 5), MPSI dogs treated with AAV5.5IDUA vector ( n =

4), MPSI dogs treated with AAV2.5IDUA vector ( n = 10), untreated MPSIIIB dogs ( n

141

= 3), and MPSIIIB dogs treated with AAV2.5NaGlu vector ( n = 7). All treated dogs received immunosuppressants (data from B54 and B89, which were not fully immunosuppressed, are not included). ( a–c) Biochemical markers. ( a) GAG, ( b)

GM2, and ( c) GM3 amounts were measured in brain extracts. Four values corresponding to four brain regions were determined in each dog. Data are means ±

SEM of all determined values in each dog group. ( d,e) Histological markers. Brain coronal slabs were processed for 4-µm paraffin sections. ( d) Sections from the frontal cortex, the occipital cortex, the thalamus, or the caudate nucleus were stained with hematoxylin–eosin. Cell vacuolation was scored semiquantitatively from zero to three for each of these four regions in each dog, zero indicating absence of observed storage lesions, 1 up to 20% of affected cells, 2 up to 50%, 3 >50%

(scores of individual animals at each location are shown in Figure 3). A global score represented by the mean of the four values was attributed to each dog. Histograms indicate means ± SEM of global scores in each dog group. ( e) Sections of the caudate nucleus were stained with luxol fast blue, which stains storage lesions in blue. The total number of luxol fast blue positive lesions was scored in a surface of

10.45 ± 0.47 mm 2 covering a region located between the internal capsule to the brain surface. Data are means ± SEM of values determined in each dog group.

Asterisks indicate significant differences between groups (P < 0.05, Mann and

Whitney test). AAV, adeno-associated virus; GAG, glycosaminoglycan; IDUA, α- iduronidase; MPSIII, mucopolysaccharidosis type III; NAGLU, α-N- acetylglucosaminidase.

142

143

Figure3.

Reduction of cell vacuolation in treated dog brains. Brain coronal slabs were

processed for 4-µm paraffin sections. Sections were stained with hematoxylin–eosin

and cell vacuolation was scored semiquantitatively from zero to three in the frontal

cortex, the occipital cortex, the thalamus and the caudate nucleus (1: up to 20% of

affected cells; 2: up to 50%; 3: >50%). ( a) Examples of frontal cortex sections scored

1 or 3 in treated (D30) or untreated (D14) MPSI dog, respectively, and in treated

(B18) or untreated (B98) MPSIIIB dogs, respectively. (b) A color code indicates scores at each location for each treated or untreated dog examined in this study. A global score represented by the mean of the four determined scores is shown on the right (mean score). This score is used in Table 1 and Figure 2d. All treated dogs received immunosuppressant except B54, which did not receive immunosuppressant, and B89, in which immunosuppressant was halted two months before analysis. AAV, adeno-associated virus; MPSIII, mucopolysaccharidosis type

III.

144

145

Figure 4.

Residual lesions in dog brains. Four-micrometer paraffin sections of the caudate nucleus were stained with silver impregnation and luxol fast blue, which reveals intracytoplasmic accumulation of glycosaminoglycans and gangliosides. Luxol fast blue positive accumulation is visible in untreated MPSIIIB (D98) and MPSI (D14) dogs (left column), as well as in B54, a MPSIIIB dogs that did not receive immunosuppressant (middle, upper row) and in D17, a MPSI dog that was treated at the age of 10.0 months (right, bottom row). In contrast, luxol fast blue positive staining is not visible in B18, a MPSIIIB treated dog that received immunosuppressant (right, upper row) and D30, a MPSI dog that was treated at the age of 4.1 months (bottom, middle row). Bar = 50 µm. AAV, adeno-associated virus;

IDUA, α-iduronidase; IS, immunosuppression; MPSIII, mucopolysaccharidosis type

III; NAGLU, α-N-acetylglucosaminidase.