Artemis Splice Defects Cause Atypical SCID and Can Be Restored in Vitro by an Antisense Oligonucleotide

ORIGINAL ARTICLE Artemis splice defects cause atypical SCID and can be restored in vitro by an antisense oligonucleotide

H IJspeert1,2, AC Lankester3, JM van den Berg4, W Wiegant5, MC van Zelm1, CMR Weemaes6, A Warris6, Q Pan-Hammarstro¨m7, A Pastink5, MJD van Tol3, JJM van Dongen1, DC van Gent8 and M van der Burg1 1Department of Immunology, Erasmus MC, University Medical Center Rotterdam, Rotterdam, The Netherlands; 2Department of Pediatrics, Erasmus MC, University Medical Center Rotterdam, Rotterdam, The Netherlands; 3Department of Pediatrics, Leiden University Medical Center, Leiden, The Netherlands; 4Department of Pediatric Hematology, Immunology and Infectious Diseases, Emma Children’s Hospital, Academic Medical Centre, University of Amsterdam, Amsterdam, The Netherlands; 5Department of Toxicogenetics, Leiden University Medical Center, Leiden, The Netherlands; 6Department of Pediatrics, Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands; 7Department of Laboratory Medicine, Clinical Immunology, Karolinska Institutet at Karolinska University Hospital Huddinge, Stockholm, Sweden and 8Department of Cell biology and Genetics, Erasmus MC, University Medical Center Rotterdam, Rotterdam, The Netherlands

Artemis deficiency is known to result in classical TÀBÀ severe combined immunodeficiency (SCID) in case of Artemis null mutations, or Omenn’s syndrome in case of hypomorphic mutations in the Artemis gene. We describe two unrelated patients with a relatively mild clinical TÀBÀ SCID phenotype, caused by different homozygous Artemis splice-site mutations. The splice-site mutations concern either dysfunction of a 50 splice-site or an intronic point mutation creating a novel 30 splice-site, resulting in mutated Artemis protein with residual activity or low levels of wild type (WT) Artemis transcripts. During the first 10 years of life, the patients suffered from recurrent infections necessitating antibiotic prophylaxis and intravenous immunoglobulins. Both mutations resulted in increased ionizing radiation sensitivity and insufficient variable, diversity and joining (V(D)J) recombination, causing B-lymphopenia and exhaustion of the naive T-cell compartment. The patient with the novel 30 splice-site had progressive granulomatous skin lesions, which disappeared after stem cell transplantation (SCT). We showed that an alternative approach to SCT can, in principle, be used in this case; an antisense oligonucleotide (AON) covering the intronic mutation restored WT Artemis transcript levels and non-homologous end-joining pathway activity in the patient fibroblasts. Genes and Immunity (2011) 12, 434–444; doi:10.1038/gene.2011.16; published online 10 March 2011

Keywords: severe combined immunodeficiency; granulomas; V(D)J recombination; Artemis; antisense oligonucleotides; splicing

Introduction those with TÀB þ SCID (70%), generally resulting from a T-cell signaling defect and those with TÀBÀ SCID (30%), Severe combined immunodeficiency (SCID) is an inher- mostly due to a defect in recombination of the variable ited primary immunodeficiency. Most SCID patients (V), diversity (D) and joining (J) gene segments.4,5 suffer within months after birth from severe opportunis- Differentiation of lymphoid precursors to mature tic infections, chronic diarrhea and failure to thrive. B and T lymphocytes requires the rearrangement and Antimicrobial prophylaxis and immunoglobulin (Ig) expression of genes encoding the Ig or T-cell receptors. substitution are mandatory in clinical management, but V(D)J gene segments are recombined to form a functional curative treatment can only be obtained by allogeneic V(D)J exon. V(D)J recombination is initiated by the stem cell transplantation (SCT) and, in an experimental lymphoid-specific recombination activating gene 1 setting, gene therapy.1–3 Immunologically, SCID is char- (RAG1) and 2 (RAG2) proteins. These proteins introduce acterized by an absence or dysfunction of T lymphocytes. double strand breaks (DSBs) in the DNA near the SCID patients can be divided into two main categories: recombination signal sequences that flank the V, D and J segments.6,7 Subsequently, the DNA DSBs are repaired by the non-homologous end-joining (NHEJ) pathway. Correspondence: Dr M van der Burg, Department of Immunology, The DNA DSBs are recognized by the DNA-dependent Erasmus MC, Dr Molewaterplein 50, 3015 GE Rotterdam, The protein kinase (DNA-PK) complex, which is composed Netherlands. E-mail: [email protected] of the DNA-PK catalytic subunit (DNA-PKcs) and Received 7 December 2010; revised 25 January 2011; accepted 26 the KU70/KU80 heterodimer that directly binds to the January 2011; published online 10 March 2011 DNA ends.8 Subsequently, the Artemis protein is Artemis splice defects cause atypical SCID H IJspeert et al 435 phosphorylated by DNA-PKcs and opens the hairpin- neg; EBV-VCA IgG pos; anti-EBNA neg). The antibody sealed coding ends.9,10 The coding ends are then further titers after previous vaccination against mumps, measles processed by inclusion of palindromic (P) nucleotides and rubella were in the normal range, IgM anti-Varicella due to asymmetric hairpin opening, loss of nucleotides was negative, IgG was positive. Antibodies against due to exonuclease activity and addition of non- cytomegalovirus (CMV) and PCR for CMV sequences templated (N) nucleotides by terminal deoxynucleotidyl were negative. A high resolution computed tomography transferase.11 In the final step, the coding ends are ligated scan showed minimal brochiectasis, with a normal by the DNA ligase IV (LIG4)/XRCC4 complex, in pulmonary function test. On co-trimoxazole prophylaxis, conjunction with XLF (Cernunnos).12,13 the next 2 years were uneventful, although signs of In approximately 70% of TÀBÀ SCID patients, muta- mild chronic pulmonary inflammation persisted. Be- tions are found in the RAG1 and RAG2 genes.14 The cause of an increase in respiratory complaints, eventually majority of the remaining patients show hypersensitivity IVIG was started, which led to a marked clinical for ionizing radiation (IR), suggesting a defect in the improvement. However, at the age of 9 years, she NHEJ pathway of DNA DSB repair.15 Mutations in the suffered again from frequent respiratory tract infections Artemis, LIG4 and DNA-PKcs genes have been identified and increased exercise intolerance. Laboratory tests in these patients.14,16–19 Furthermore, mutations in the showed a progressive decrease of B cells and naive XLF gene have been found in radiosensitive patients with T lymphocytes. SCT was performed at 11 years of age, growth retardation, microcephaly and immunodeficiency using a matched-unrelated donor and a conditioning due to profound T- and B-cell lymphocytopenia.13 regimen containing busulfan, fludarabin and alemtuzu- Not all mutations in V(D)J recombination genes give mab. rise to the classical SCID phenotype. Hypomorphic mutations in the RAG1, RAG2 and Artemis genes can result in the Omenn’s syndrome.20,21 Similar to SCID Case report patient 2 patients, Omenn’s syndrome patients present, in infancy, This female patient (ID153) of Turkish descent, born from with viral or fungal pneumonitis, chronic diarrhea and consanguineous parents, presented at the age of 4 years, failure to thrive. Unlike classical SCID, patients with with a history of recurrent upper and lower respiratory Omenn’s syndrome have severe erythroderma, tract infections requiring treatment with oral antibiotics. increased IgE levels and eosinophilia.22,23 Hypomorphic After 2 years she developed a severe hypogammaglobu- RAG1 and RAG2 mutations have also been reported to linemia and IVIG substitution was initiated. After the cause primary immunodeficiency disease with granulo- start of IVIG, infection episodes became scarce and mild. matous skin lesions.24 Here, we present two SCID Notably, although a primary EBV infection was experi- patients with different types of Artemis splicing defects, enced without clinical manifestations, recurrent EBV both leading to an atypical Artemis–SCID phenotype, reactivations, measured by plasma EBV-DNA specific characterized by a later onset and milder disease course quantitative PCR, could be documented from the age of 7 and, in one patient, severe localized granulomatous skin years onwards. In addition, the patient had an uncom- lesions. plicated course of chickenpox before the age of 4 years, and spontaneously recovered from Influenza A infection at the age of 9 years. Specific antibodies against Varicella Results zoster virus and H. influenzae (after vaccination in infancy) could be detected. At the age of 5 years, she Case report patient 1 developed skin lesions on the back of her left hand, Patient 1 (ID189) is the second daughter of healthy, which steadily progressed into multiple isolated and consanguineous parents of Turkish descent. She pre- subsequently confluent lesions on the left hand and sented at the age of five, with two episodes of lower arm (Figure 1). Histological analyses showed pneumonia, of which the last one was caused by granulomatous inflammation (reported before25). Influenza A. Adenotomy was performed due to frequent Despite extensive and repetitive pathological, microbio- upper respiratory tract infections. She experienced logical and molecular evaluations, no mycobacterial or chickenpox during infancy, with a normal clinical course. fungal pathogens or other infectious agents could be The patient was generally in a good clinical condition, detected. Furthermore, multiple episodes of empirical with a good psychomotor development and normal treatment with tuberculostatic agents or intralesional growth. The family history revealed one male cousin corticosteroid injections did not affect the progressive who had died in Turkey at the age of 15 years from a behavior of the lesions. On the basis of the T- and hematological malignancy. He had been diagnosed with B-lymphopenia, together with the progressive granulo- common variable immunodeficiency, suffered from matous skin lesions, the decision was made to treat the recurrent infections and had been on intravenous patient with allogeneic SCT. After conditioning with immunoglobulin (IVIG) replacement therapy. Another busulfan, cyclophosphamide and ATG (thymoglobulin), female cousin had been on IVIG therapy for some years a 6/6-allele matched-unrelated cord blood was as a child, but had apparently grown up to be a healthy infused to the patient at the age of 10 years. SCT was adult. Physical examinations showed a healthy girl with considered successful, as all blood myeloid and no dysmorphic features, no lymphadenopathy or sple- lymphoid cells were from the donor origin. Functional nomegaly, remarkably small tonsils and diffuse pulmon- immune reconstitution was observed, documented ary wheezing and rhonchus. Antibody responses to by recovery of naive T cells and normal B-cell pneumococcal polysaccharides and tetanus vaccinations counts, clearance of reactivated EBV, CMV and adeno- were normal. PCR for Epstein Barr virus (EBV) was virus, and regression of the granulomatous skin lesions positive with incomplete seroconversion (EBV-VCA IgM (Figure 1).

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 436 Immunological characteristics support humoral immune responses and to perform Immunological evaluation in patients 1 and 2 revealed cellular immune functions. The serum immunoglobulin decreased numbers of T cells and B cells, but normal levels in patient 1 were normal, except for the decrease in levels of natural killer (NK) cells (Table 1). Within the T- IgG2 and IgG4 levels (Table 1). In patient 2, the cell subsets the numbers of memory and activated T cells immunoglobulin levels were normal at 4 years of age, were normal, whereas the naive (CD45RA þ ) T cells but 2 years later, she developed a severe hypogamma- were low. Apparently, the history of both patients globulinemia (Table 1). We analyzed if the B cells could regarding vaccination responses and dealing with viral undergo somatic hypermutation (SHM) for affinity infections indicates that the T cells present are able to maturation of the antigen receptor, by determining the mutation frequency in IgG and IgA transcripts. The overall mutation frequency in patient 1 at 5 years of age was normal, whereas in patient 2, at 8 years of age the before SCT mutation frequency was significantly lower than in age- 8 yrs matched healthy controls (Figure 2). In both patients, the pattern of SHM was suggestive for the potential to produce an antigen-selected B-cell receptor. Despite the low numbers of B and T cells, the infectious episodes in the patients were limited, especially after initiation of

18 ** ** 16 ** **

after SCT 8 11 yrs 6

4 SHM in VH gene segments (in %) SHM in 2

Control1 Control2 Patient1 Patient2 Patient2 Patient1 Control2 Control1 (n=21) (n=39) (n=30) (n=20) (n=21) (n=29) (n=27) (n=29) VH-Cγ VH-Cα

Figure 2 Analysis of SHM. Frequencies of SHM in the VH-Cg and Figure 1 Granulomatous skin lesions. The left lower arm of patient the VH-Ca transcripts were normal in patient 1 and significantly 2 showing granulomatous skin lesions before SCT at the age of 8 reduced in patient 2, compared with two age-matched controls. years (a) and the regression of the granulomatous skin lesions 1 year ** denotes Po0.01. A full colour version of this figure is available at after SCT at the age of 11 years (b). the Genes and Immunity journal online.

Table 1 Lymphocyte subsets and immunoglobulin (sub)classes in peripheral blood of patients 1 and 2

Leukocyte subsets (109/l) Phenotype Patient 1 (10 yrs) Patient 2 (8 yrs) Healthy controls (5–10 yrs)53

Lymphocytes 0.6 1.1 1.1–5.9 T cells CD3+ 0.3 0.66 0.7–4.2 Total CD4+ 0.14 0.15 0.3–2.0 CD4+CD45RA+ 0.02 0.01 0.3–1.2 CD4+CD45RO+ 0.12 0.14 0.2–0.6 Total CD8+ 0.15 0.28 0.3–1.8 CD8+CD45RA+ 0.07 0.12 0.2–0.8 CD8+CD45RO+ 0.12 0.18 0.04–0.3 CD3+TCRgd+ 0.02 0.34 o0.2 B cells CD19+ 0.02 0.10 0.2–1.6 NK cells CD16+CD56+ 0.09 0.21 0.09–0.9

Immunoglobulin (sub)classes (g/l) Patient 1 (5 yrs) Patient 2 (6 yrs) Healthy controls (2–7 yrs)54

IgG1 8.0 2.11 3.5–10.0 IgG2 0.38 0.44 0.6–3.5 IgG3 0.31 0.04 0.14–1.3 IgG4 o0.01 o0.05 o0.3–1.2 IgM 1.34 0.25 0.5–1.8 IgA 0.72 0.08 0.1–1.6

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 437 IVIG, indicating that the immune system is only partially clonogenic survival assay was performed to determine impaired. whether the patients’ fibroblasts, cultured from a skin biopsy were radiosensitive. Fibroblasts from both pa- Precursor B-cell differentiation block and increased ionizing tients showed increased sensitivity to IR (Figure 3b). In radiation sensitivity contrast, peripheral blood mononuclear cell (PBMC) of Both patients showed a combined immunodeficiency patient 2 did not have increased numbers of karyotype with reduced numbers of peripheral B lymphocytes and abnormalities after low doses of ionizing radiation. naive T lymphocytes, which is suggestive for a general Therefore, DSB repair was studied in more detail in differentiation defect of cells belonging to the adaptive patient 2 by counting g-H2AX foci, a DSB marker, at immune system. Therefore, precursor B-cell differentia- various time points after irradiation. The g-H2AX foci tion was studied in bone marrow (BM) samples from disappeared with delayed kinetics in patient 2 and both patients by assessing the relative distribution of Artemis-deficient fibroblasts (Figure 3c). This resulted in pro-B, pre-B-I, pre-B-II and immature B cells. In healthy 15% residual foci after 72 h, suggesting that a comparable children, pro-B and pre-B-I cells constitute 20–25% of the level of unrepairable DSBs remained in patient 2 precursor B cells (Figure 3a). Patients with a complete fibroblasts and in Artemis-deficient cells. These observa- V(D)J recombination defect caused by mutations in tions were indicative for a defect in DSB repair by NHEJ. RAG1/RAG2 or Artemis only have pro-B and pre-B-I cells and completely lack pre-B-II and immature B cells Hypomorphic mutations in Artemis (Figure 3a). In both patients, the pro-B and pre-B-I cell Artemis is the first candidate gene for NHEJ defects. fractions represented approximately 85% of the precur- Therefore, the coding exons and splice-sites of the sor B cells. Analysis of a second BM sample of patient 2 Artemis gene were sequenced. Patient 1 had a homo- after 2 years showed an identical pattern, which zygous mutation in the 50 splice-site of exon 6 indicates that the composition of the precursor B-cell (c.464 þ 1G4A) (Figure 4a). The same mutation was compartment was stable over time. This composition recently described in a patient with an atypical Artemis points towards an incomplete block in precursor B-cell deficiency with chronic inflammatory bowel disease.26 differentiation before the cytoplasmic Igm þ pre-B-II cell This splice-site mutation leads to alternative splicing, stage (Figure 3a), which is characteristic for an incom- yielding two aberrant Artemis transcripts. In the first plete V(D)J recombination defect. Sequence analysis of transcript (Artemis ex5-ex7), exon 6 is skipped, leading RAG1 and RAG2 revealed no mutations. Subsequently, a to an in-frame deletion of 34 amino acids of the b–Lact

Controls 5-10y (n=8) Patient 1 (5y) Patient 2 (7y) Patient 2 (9y) RAG-SCID (n=17) Artemis-SCID (n=7)

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%

Pro-B cell (CD22+/CD19-) Pre-B-I cell (CD19+/CyIgM-) Pre-B-II cell (CyIgM+/SmIgM-) immature B cell (SmIgM+/SmIgD-)

100 35 Control 28 Patient 2 10 Artemis-6 21 1 14

Survival (%) Control foci per cell foci 0.1 Patient 1 Patient 2 7 Artemis-6 0.01 0 0123456 0 24 4872 96 120144 168 192 Dose of X-ray (Gy) repair time (hours) Figure 3 Composition precursor B-cell compartment in BM and DNA DSB repair characteristics. Composition of the precursor B-cell compartment in healthy controls (n ¼ 8), patient 1 (5 years) and patient 2 (7 and 9 years), RAG-deficient (n ¼ 17) and Artemis-deficient (n ¼ 7) patients. Patients 1 and 2 had an incomplete block in precursor B-cell differentiation (a). Clonogenic survival assay showed increased sensitivity to IR of fibroblasts of patient 1 and 2, similar as the Artemis-deficient patient. (b). The numbers of g-H2AX foci per nucleus (average of 40 cells) after radiation with 1 Gy disappeared with delayed kinetics in patient 2 and Artemis-deficient (Artemis-6).27 fibroblasts compared with control (VH10) fibroblasts (c). Error bars represent the SD from three independent experiments.

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 438 Patient 1 Patient 2

c.464+1G>A C ~1kb ~0.7 kb ~0.2 kb ~1kb ~2kb ~2kb DNA 5678 10 11GAG AT CAG GT 12

mRNA 5 7 8 5 6 7 8 10 11 12 10 11 12

Artemis ex5-ex7 Artemis ex6+18nt WT Artemis Artemis ex11+190nt

1 1 WT Artemis fibroblasts WT Artemis fibroblasts Artemis ex5-ex7 Artemis ex11+190nt Artemis ex6+18nt 10-1 10-1

10-2 10-2

10-3 10-3 relative Artemisrelative expression relative Artemisrelative expression nd nd ndnd nd nd nd nd nd nd nd nd nd nd nd 10-4 10-4 Control Patient 1 Artemis Artemis RAG Control Patient 2 Artemis Artemis RAG deficient mutant deficient deficient mutant deficient

1 1 WT Artemis Patient 1 Control WT Artemis Artemis ex5-ex7 Patient 2 Artemis ex6+18nt 10-1 10-1

10-2 10-2

10-3 10-3 relative Artemisrelative expression nd nd nd nd nd WT Artemis expression relative 10-4 10-4 fibroblasts T cells B cells NK cells fibroblasts T cells B cells NK cells

Patient 2 WT Artemis Patient 1 WT Artemis Artemis ex11+190nt 1 Artemis ex5-ex7 1 Artemis ex6+18nt

10-1 10-1

10-2 10-2

10-3 10-3 relative Artemisrelative expression relative Artemisrelative expression nd nd 10-4 10-4 precursor B cells mature B cells precursor B cells mature B cells Figure 4 Artemis mutations and expression of WT and patient-specific Artemis transcripts. Schematic representation of the positions of the splice-site mutations in the Artemis gene and the WT and patient-specific transcripts that are present in patient 1 (left panel) and patient 2 (right panel). The relative Artemis transcript expression was measured by RQ-PCR; locations of the primers used in the RQ-PCRs are indicated (a). For primer and probe sequences see Table 2a. Relative Artemis expression measured in fibroblasts of control (C5RO), patient 1 or 2, an Artemis-deficient patient (Artemis-5)27 lacking exon 1 till 3, a patient expressing mutant Artemis (Artemis-8)27 and a RAG-deficient patient (RAG-SCID-12). WT Artemis transcripts were not expressed in fibroblasts of patient 1. For detection of WT Artemis transcripts in patient 1, a forward primer overlapping the exon 6–7 border (Artemis ex6ex7 F) in combination with a reverse primer in exon 8 (Artemis ex8R) and the probe TR Artemis ex7ex8 (b). WT Artemis transcripts were expressed at low level in fibroblasts of patient 2 (c). T, B and NK cells from patient 1 only expressed patient-specific Artemis transcripts (d). In patient 2, the WT Artemis transcripts expression was higher in T, B and NK cells compared with fibroblasts (e). The expression levels of the patient-specific Artemis transcripts were slightly higher in mature B cells (CD19 þ IgD þ IgM þ ) compared with precursor B cells (CD19 þ IgDÀ) in patient 1 (f), but in patient 2, the WT Artemis expression in mature B cells was much higher compared with precursor B cells (g).

domain (p.M121_R155delinsI). The b–Lact domain is carrying this insertion of 6 amino acids retained residual essential for Artemis activity, as mutants, lacking parts of activity the b–Lact domain, could not complement the Artemis In patient 2, no mutations were found in the coding defect.27 In the second transcript (Artemis ex6 þ 18nt), a exons and splice-sites of the Artemis gene. However, cryptic 50 splice-site, 18 nucleotides downstream of exon polymorphic short-tandem repeat markers up- and 6, was used resulting in the in-frame insertion of six downstream of the Artemis gene showed that this locus amino acids (p.R155_V156insYWGSYR) (Figure 4a). The was homozygous in the patient. As the patient’s parents 6 amino acids are inserted exactly between the b–Lact are consanguineous, Artemis was still considered a and the b–CASP domains, leaving the b–Lact domain candidate gene. Therefore Artemis transcripts were intact. Rohr et al.26 showed that the Artemis protein sequenced. This revealed a 190-bp insertion (cryptic

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 439 exon) between exons 11 and 12. Genomic sequence Artemis expression could not be explained by reversion alignment showed that the inserted cryptic exon was mutations in T, B and NK cells, as these were excluded part of Artemis intron 11, located B2.0 kb downstream of by sequence analysis of sorted fractions (data not exon 11 (Figure 4a). Sequence analysis of this part of the shown). The 10-fold decrease of WT Artemis in PBMCs intron and the flanking regions in genomic DNA in patient 2 was unexpected, as precursor B cells in BM revealed a homozygous nucleotide substitution had a clear V(D)J recombination defect due to improper (c.972 þ 1997G4C), which introduced a new 30 splice- or insufficient NHEJ activity. Therefore, precursor B cells site consensus sequence. Besides this newly formed 30 (pre-B-I, pre-B-II and immature B cells) and mature B splice-site, a pre-existing cryptic 50 splice-site was used. cells were sorted from BM to determine Artemis At the protein level, a stretch of 61 amino acids was transcript levels. The expression level of WT Artemis inserted after glutamate 324, followed by a stop codon transcripts in precursor B cells was approximately 40- (p.Glu324ins61X). Interestingly, the cryptic 190bp exon fold lower than in mature B cells derived from patient 2 corresponds to the right arm of an Alu element in the (Figure 4g). The expression levels of both mutant Artemis antisense direction (Alu consensus position 90–27928) and transcripts in precursor B cells in patient 1 were only the cryptic 50 splice-site corresponds with Alu consensus slightly lower compared with mature B cells (Figure 4f). position 89. Besides the aberrant Artemis transcripts, In summary, the difference in sensitivity to IR between correctly spliced wild type (WT) Artemis transcripts were fibroblasts and PBMC can be explained by the differ- present. ential expression of Artemis transcripts in fibroblasts versus lymphocyte populations and differences in Differential expression of Artemis transcripts in fibroblasts, expression in B-cell subsets of various differentiation precursor B cells and mature B cells stages. To determine the levels of WT and patient-specific aberrant transcripts in different cell types, real time Effect of the Artemis splice-site mutations on V(D)J quantitative (RQ) PCR was performed. The location and recombination sequences of the primers and probes used to measure the The two patients had different types of Artemis splice-site different transcripts are indicated in Figure 4a and mutations. Patient 1 had a homozygous splice-site Table 2. Fibroblasts of patient 1 only expressed patient- mutation resulting in expression of mutant Artemis specific alternative Artemis transcripts, but no WT protein with residual activity, whereas patient 2 had a Artemis transcripts (Figure 4b). None of the patient- mutation causing severely reduced expression of WT specific Artemis transcripts were expressed in control Artemis transcripts. To understand the effects of the fibroblasts or in fibroblasts of Artemis-deficient or RAG- different hypomorphic Artemis mutations on its function, deficient SCID patients. Fibroblasts of patient 2 ex- we studied Artemis-related processes during B-cell pressed both patient-specific Artemis transcripts (Artemis differentiation. Artemis is involved in V(D)J recombina- ex11 þ190nt) and WT Artemis transcripts, although WT tion, which takes place during precursor B-cell expression was much lower (4300 fold decrease) than in differentiation. Both mutations had effect on V(D)J control fibroblasts (Figure 4c). The respective absence or recombination, given the block in precursor B-cell strong decrease in WT Artemis transcripts in patient 1 differentiation in BM (Figure 3a). Therefore, we studied and 2 explains the sensitivity to IR of the fibroblasts. WT V(D)J recombination in more detail by analyzing the Artemis expression was also absent in sorted T, B and NK coding joints of incomplete IGH gene rearrangements cells of patient 1 (Figure 4d). (that is, DH-JH) in DNA isolated from BM mononuclear The expression of WT Artemis in the sorted lymphocyte cells. Both Artemis- and DNA-PKcs-deficient subsets of patient 2 was only 10-fold decreased com- patients have a defect in DNA hairpin opening and pared with control subsets (Figure 4e). This decrease was show increased P-nucleotides in DH-JH junctions much less than the 4300-fold decrease of WT Artemis (Table 3).18,19,27 In coding joints of both patients, the transcripts in fibroblasts, and could explain why the average number of palindromic (P-) nucleotides per fibroblasts of patient 2 were sensitive for IR while the junction was significantly increased to 1.2 in patient 1, PBMCs of patient 2 were not. This difference in WT and 2.0 in patient 2 compared with healthy controls (0.3

Table 2 Sequences of primers and probes used for real time quantitative PCR

Primer name Primer sequences

Artemis exon 10 F GGAGAAAGGAGCAGAAAAACAAA Artemis exon 12R TGGATATGCGTTCACAGGACA Artemis patient 2 R GGCAATAAAGCGAGACTCCAT Artemis ex6ex7 F ACTCCGGGGGCAGAGTCA Patient 1 ex6nt18 F ACTCCGGGGGCAGGTACT Patient 2 ex5ex7 F ACTGTCCGGGATCAGTTATAGTCA Artemis ex8R GCTTCGGACCAGCTCTAAGACT

Probe name Probe sequences TR Art exon 11 AGCTCTGTATGAACTCTCTCCAGTCCTCACAA TR Artemis ex7ex8 ACACTCCTCCCGACTTGGAATTTGGTAAAA

Sequences are given in the 50 to 30 order.

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 440 Table 3 DH-JH junction characteristics of patients 1 and 2 compared with healthy controls, Artemis-deficient patients and a DNA-PKcs patient

Patient (no. of clones) DH(del) P-nucleotides N-nucleotides P-nucleotides (del)JH Total P-nucleotides Total del

Patient 1(25) 3.1 0.7 6.2 0.5 5.1 1.2** 8.2** Patient 2 (27) 3.9 0.4 4.2 1.6 4.2 2.0*** 8.1** Control (91) 4.5 0.2 9.2 0.1 6.7 0.3 11.2 Artemis (53)27 1.9 3.0 4.0 3.8 1.1 6.8*** 3.0*** DNA-PKcs (23)19 2.3 1.0 4.2 2.0 4.5 3.0*** 6.8***

Abbreviations: DH(del), average number of nucleotides deleted from the 30 end of the DH gene segment per coding joint given as a negative value; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; JH(del) average number of nucleotides deleted from the 50 end of the JH gene segment per coding joint given as a negative value; N, non-templated; P, palindromic; Total del, average of total number of deleted nucleotides per coding junction. Values represent average numbers of nucleotide per junctions. Statistical analysis was performed using unpaired T-test. **Po0.01; ***Po0.001.

Table 4 Characterization of Sm-Sa junctionsa

Perfectly matched short homology

0 bp 1–3 bp 4–6 bp 7–9 bp X10 bp Total No. of S fragments 1-bp insertions No insertions

Patient 1 3 (17%) 2 (11%) 7 (39%) 3 (17%) 1 (6%) 2 (11%) 18 Patient 2 5 (22%) 7 (31%) 4 (17%) 6 (35%) 2 (9%) 0 (0%) 23 Artemis À/À 6 (11%)* 0 (0%)* 10 (19%) 8 (15%) 9 (17%) 21 (39%)*** 54 Controls (1–6 yr) 34 (25%) 24 (18%) 25 (18%) 21 (15%) 11 (8%) 22 (16%) 137 Controls (adults) 39 (25%) 28 (18%) 56 (36%) 15 (10%) 11 (7%) 5 (3%) 154

Abbreviation: S, switched. aThe switch junctions from Artemis-deficient patients were compared with those from age matched controls (1–6 years of age), whereas the switch junctions from patient 1 and 2 were compared with adult controls. *Po0.05; ***Po0.001.

P-nucleotides per junction) (Table 3). These long stretches controls (Table 4). In summary, expression of mutated of P-nucleotide resulted in significantly less deletions Artemis protein with residual enzymatic activity or compared with controls. The number of non-templated reduced level of WT Artemis had no impact on CSR. (N-) nucleotides was not significantly different from controls. These results show that mutant Artemis with In vitro restoration of the Artemis splice defect by antisense residual activity in patient 1 or low levels of WT Artemis oligonucleotide (AON) exon skipping in patient 2 resulted in defective hairpin opening. The defect in patient 2 was caused by a rare intronic mutation that creates a new splice-site leading to Effect of the Artemis mutations on CSR exonisation of 190 nucleotides of intronic sequence. We In mature B cells, class switch recombination (CSR) attempted to correct this defect by skipping this cryptic allows previously rearranged Ig heavy-chain V domains exon. For this purpose, we used antisense oligonucleo- to be expressed in association with a different constant tides (AONs) to modulate splicing by hiding specific (C) region, leading to production of different isotypes.29 sites essential for exon inclusion from the splicing Artemis has recently been shown to be involved in machinery, without modifying the genome.32 The AONs CSR.23 Switch (S) junctions resulting from in vivo (CSR) used to modulate splicing are different from the events, were cloned and sequenced from B cells of oligonucleotides that are used to achieve downregulation patient 1 and 2. Unique Sm-Sa1 sequences, representing of transcripts. The AONs should not activate RNase H, independent CSR events, were subsequently compared which would degrade the pre-mRNA, and should be with Sm and Sa junctions (n ¼ 154) from healthy adult able to compete with splicing factors for access to the controls.30,31 Previously described Artemis-deficient pa- pre-mRNA. We have applied an AON with 20-O-methyl tients showed a strong dependence on long microhomol- ribose groups and a full-length phosphorothioate back- ogies and a complete lack of ‘direct end-joining’.23 The bone. This AON is RNase H inactive and has a higher average length of microhomology, defined as successive affinity for the target sequence than the 20-deoxy nucleotides that were shared by both the Sm and Sa counterpart. For patient 2, an AON covering the newly regions at the CSR junctions, was not significantly formed 30 splice-site in intron 11 of the Artemis gene was different from control in patient 1 (3.8±5.2 bp versus designed (Figure 5a). Fibroblasts of patient 2 and a 1.8±3.2 bp in controls) and in patient 2 (2.0±2.7 bp healthy control were transfected with a 50 fluorescein- versus 1.8±3.2 bp in controls). Furthermore, the pattern labeled AON. After 24 and 48 h, WT and mutant of Sm-Sa junctions was indistinguishable from that in (Artemis ex11 þ190nt) Artemis transcript levels were

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 441 C strated that AON treatment also partially suppressed the ~1kb~2kb ~2kb sensitivity to IR in the patient fibroblasts (Figure 5c). In pre-mRNA 10 11 12 conclusion, Artemis splice-site defect could be restored by AON mediated cryptic exon skipping.

AON sequence: 5'-GGGCAAUAAAGCGAGACUCCAUCUG-3'

1 Discussion WT Artemis Artemis ex11+190nt In this study, we described two unrelated girls suffering * from recurrent infections during the first 10 years of their 10-1 * lives. The infectious problems associated with decreased B cell and naive T-cell counts in combination with reduced serum Ig isotype and IgG subclass levels 10-2 necessitated IVIG therapy. They had normal psychomotor development and growth. Patient 2 suffered from severe localized granulomatous skin lesions. The clinical 10-3 presentation of both patients was caused by two different types of Artemis splice mutations resulting in residual enzymatic activity in one patient and reduced level of Artemis transcripts (relative to ABL) nd nd WT activity in the other patient. 10-4 Control Patient 2 Control Patient 2 Artemis deficiency normally causes TÀBÀ SCID with 0 nM AON 200 nM AON opportunistic infections already during the first months of life. Although both patients had an Artemis defect, the 100 infectious episodes were limited with a relatively mild Control course, especially after initiation of IVIG. Apparently, the Control + AON T cells present were able to induce cellular immune Patient 2 responses and to support humoral immunity. However, Patient 2 + AON due to a low number of B cells, naive T cells and a 10 potentially limited Ig and T-cell receptor repertoire, clonal selection will be less optimal, giving rise to dysregulation in the immune system. This immune dysregulation might underlie the granulomatous skin lesions in patient 2. Survival (%) Immunodeficiency disease with granulomas has been 1 described previously in patients with hypomorphic mutations in the RAG1 or RAG2 genes.24,33 Similar to patient 2, repeated tests revealed no micro-organisms in the granulomas of these RAG-mutated patients, suggesting that the granulomas were secondary to the impaired 0.1 immune regulation. The granulomatous skin lesions 0246 largely resolved after transplantation and reconstitution Dose X-ray (Gy) of the donor immune system in patient 2, comparable to Figure 5 AON partially suppresses the radiation sensitivity in the patients with hypomorphic RAG mutations.24 Ap- patient 2 fibroblasts. Location of the antisense oligonucleotide parently, V(D)J recombination defects with residual covering the G4C nucleotide substitution. The dotted lines recombination activity can give rise to a variety of represent the splice-sites of the cryptic exon (a). WT Artemis 33 transcripts levels in fibroblasts from patient 2 significantly increased atypical clinical presentations. 24 h after transfection with 200 nmol AON compared with transfec- One (c.464 þ 1G4A) of the two Artemis mutations was tion without AON, whereas the patient-specific Artemis transcripts previously identified in a patient with late onset significantly decreased. The WT Artemis transcript level did not immunodeficiency and inflammatory bowel disease that change in control (C5RO) fibroblasts after tansfection with 200 nmol presented at the age of 9 months.26 The same Artemis AON (b). Sensitivity for IR was partially supressed in fibroblasts of genotype resulted in a different clinical phenotype; this patient 2 after transfection with 100 nmol AON compared to fibroblasts transfected with 0 nmol AON. Transfecting the control might be due to age at the first encounter of infections, (C5RO) fibroblasts did not result in a different sensitivity for ionizing genetic background (for example, modifier genes or radiation (c). Error bars represent the SD from three independent epigenetic factors) or environmental factors.33 experiments. *denotes Po0.05; (nd) not detectable. A full colour The second mutation (c.972 þ 1997G4C) is a unique version of this figure is available at the Genes and Immunity journal homozygous mutation in intron 11 of the Artemis gene online. resulting in exonization of 190 nucleotides from an intronic sequence in Artemis transcripts. The mutation measured by RQ-PCR. The levels of WT Artemis corresponds to a nucleotide substitution at position 279 transcripts in patient 2 were already restored to normal of an Alu consensus sequence.34 Interestingly, it has been levels within 24 h after transfection (Figure 5b). In shown that mutating this specific guanine nucleotide to addition, mutant Artemis expression was approximately any other nucleotide, as is the case in patient 2, results in 10-fold decreased. No effects of AON transfection were exonization of the Alu sequence.34 The Artemis gene has a seen on Artemis expression levels in control fibroblasts. higher transposable element content (45%) than the Moreover, in the clonogenic survival assay, we demon- average of the human genome (37%).35 The most abundant

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 442 transposable elements found in Artemis are Alu short- Cell lines and tissue culture interspersed elements (23% of total gene sequence), Primary fibroblasts were cultured from a skin biopsy of making Artemis prone to exonization of Alu elements in patient 1 and 2. Furthermore, fibroblasts from controls mRNA during splicing. (C5RO and VH10), Artemis-deficient patients (Artemis-5 As expected from the V(D)J recombination defect, the and Artemis-6; both having genomic deletions of exon 1- expression level of mutant and WT Artemis transcripts in 327), a patient with mutant Artemis (Artemis-8 patient 1 and 2 was strongly reduced in precursor B cells (c.1391_1395delGAATC)) and a RAG-deficient patient and fibroblasts. However, mature B cells had only mildly (RAG-SCID12) (c.1782C4A)) were used. Fibroblasts reduced levels of Artemis transcripts. The different splicing were cultured in Dulbecco’s modified Eagle medium patterns between fibroblasts, precursor B cells, mature B (BioWhittaker, Walkersville, MD, USA), supplemented cells, T cells and NK cells might be caused by cell type and with 10% fetal calf serum, penicillin (100 U/ml) and tissue-specific patterns of alternative splicing.36,37 How- streptomycin (100 mg/ml). ever, differences in the various B-cell subsets might also reflect positive selection of a limited number of precursor Radiation sensitivity assays B-cell clones that had a higher Artemis expression and Clonogenic survival assay and the X-ray-induced gH2AX were therefore able to generate a functional B-cell receptor foci assay were performed as previously described.18,19,27 and differentiate into mature B cells. To dissect the functional impact of the hypomorphic Sequencing and STR marker analysis Artemis mutations, we studied Artemis-related processes Sequence analysis of genes involved in V(D)J recombina- during B-cell development. In precursor B cells the tion and NHEJ was performed by PCR analysis (for reduced Artemis activity or low level of WT Artemis RAG1 (NCBI M29474), RAG2 (NCBI M94633), Artemis/ protein resulted in inefficient V(D)J recombination. In 23,38 DCLRE1C (NCBI NM 001033855), XLF/NHEJ1 (NCBI mature B cells, Artemis is involved in CSR. Artemis- AJ972687) and LIG4 (NCBI X83441) or RT-PCR analysis deficiency results in CSR characterized by strong (for Artemis/DCLRE1C) of the coding regions with the dependence of long microhomologies in the S junctions TaqGold amplification system (Applied Biosystems, and a complete lack of ‘‘direct end-joining’’. We showed Foster City, CA, USA), followed by direct sequencing. that reduced levels of WT Artemis and residual Artemis Primer sequences are available upon request. STR activity resulted in normal S-junction formation. 39 marker analysis was performed as previously de- Current treatments for SCID patients include SCT scribed.19 and gene therapy for some conditions.40 However, SCT is still associated with significant treatment-related mor- bidity and mortality, especially when material from Real-time quantitative PCR (RQ-PCR) unrelated and HLA-mismatched donors is used.41 Gene Primers and probe (Table 2) were designed to amplify therapy is currently limited by technical difficulties and WT or patient-specific Artemis transcripts using Taqman- the risk of side effects.42 New approaches for treatment of based RQ-PCR. The RQ-PCR was performed on the ABIPRISM 7700 sequence detection system (Applied primary immunodeficiencies have been described, in- 46 cluding the use of antisense morpholino oligonucleo- Biosystems), as described previously. tides.43 In this study, we used 20-O-methyl-modified AONs to restore the expression of WT Artemis tran- Analysis of coding joints and SHM scripts, without modifying the genome. AON treatment DH-JH junctions were analyzed as previously de- has also been successfully used in gene correction scribed.19,27 SHM was studied in VH3-Ca,VH4-Ca,VH3- therapy to restore the reading frame in Duchenne Cg and VH4-Cg fragments, amplified from PBMC cDNA muscular dystrophy patients.44 Our in vitro results and cloned into pGEM-T easy vector (Promega, Madison, showed the potential for AON treatment as therapeutical WI, USA). IMGT nomenclature (http://imgt.cines.fr/) approach for patients with specific splice defects. was used to assign the V, D and J segments, and to In conclusion, patients with an Artemis defect can identify somatic mutations.47 The mutation frequency present as an atypical SCID with granulomatous skin was determined for the VH gene segment of each lesions in the absence of life-threatening infections. transcript. Therefore, an NHEJ defect needs also to be considered in patients having reduced number of naive T cells and B Characterization of switch recombination junctions cells in the circulation, who presented with milder Genomic DNA was purified from PBMCs using standard clinical symptoms than classical TÀBÀ SCID. Further- methods. The amplification of Sm-Sa fragments from in more, this study illustrates that AON treatment is a vivo S cells was performed, as described previously,30,48 promising approach to treat patients with primary except that a modified version of Taq polymerase (Go immunodeficiencies and other diseases caused by Taq, Promega) was used in the PCR reactions. With this intronic splice-site mutations. modification, a 2–4-fold increase in sensitivity was achieved. The PCR amplified S fragments were gel Materials and methods purified (Qiagen, Hilden, Germany), cloned into a modified version of the pGEM-5zf ( þ ) vector and Cell samples and flow cytometric immunophenotyping sequenced by an automated fluorescent sequencer in Peripheral blood, BM and a skin biopsy were obtained Macrogen (Seoul, Korea). The S recombination break- with informed consent and according to the guidelines of points were determined by aligning the S fragment the local Medical Ethics Committees. Flow cytometric sequences with the corresponding reference sequences analysis of peripheral blood and BM was performed as (Sm, X54713; Sa1, L19121; Sa2, AF030305), as described previously described.16,18,45 previously.30,49

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 443 AON design and transfection requires only RAG1 and RAG2 proteins and occurs in two The AON was designed according to the guidelines for steps. Cell 1995; 83: 387–395. AON design using the mfold version 3.2 server program, 7 van Gent DC, McBlane JF, Ramsden DA, Sadofsky MJ, Hesse as described before.50,51 The AON was synthesized with JE, Gellert M. Initiation of V(D)J recombination in a cell-free the following chemical modifications: a 50 fluorescein system. Cell 1995; 81: 925–934. group (6-FAM), a full-length phosphorothioate backbone 8 Weterings E, van Gent DC. The mechanism of non-homo- and 20-O-methyl-modified ribose groups (Eurogentec, logous end-joining: a synopsis of synapsis. DNA Repair (Amst) 3 Seraing, Belgium). Fibroblasts from patient 2 and control 2004; : 1425–1435. 9 Douglas P, Sapkota GP, Morrice N, Yu Y, Goodarzi AA, Merkle (C5RO) were seeded; after 24 h, they were transfected D et al. Identification of in vitro and in vivo phosphorylation with 200 nmol AON for 3 h, using 2 ml polyethylenimine sites in the catalytic subunit of the DNA-dependent protein (ExGen500; MBI Fermentas, St Leon-Rot, Germany) per kinase. Biochem J 2002; 368: 243–251. mg of transfected AON. At 24 h post-transfection, RNA 10 Ma Y, Pannicke U, Schwarz K, Lieber MR. Hairpin opening was isolated using Rneasy minikit (Qiagen, Valencia, CA, and overhang processing by an Artemis/DNA-dependent USA) and all RNA was used for reverse transcription, as protein kinase complex in nonhomologous end joining and described previously.52 V(D)J recombination. Cell 2002; 108: 781–794. 11 Benedict CL, Gilfillan S, Thai TH, Kearney JF. Terminal Statistics deoxynucleotidyl transferase and repertoire development. Immunol Rev 2000; 175: 150–157. Differences in numbers of P-nucleotides and mutation 12 Ahnesorg P, Smith P, Jackson SP. XLF interacts with the frequencies in SHM were analyzed using the nonpara- XRCC4-DNA ligase IV complex to promote DNA nonhomo- metric Mann–Whitney U-test (1-tailed) and transcripts logous end-joining. Cell 2006; 124: 301–313. expression differences were analyzed by the two-tailed 13 Buck D, Malivert L, de Chasseval R, Barraud A, Fondaneche T-test for independent samples (Po0.05 was considered MC, Sanal O et al. Cernunnos, a novel nonhomologous end- significant) in the GraphPad Prism program (GraphPad joining factor, is mutated in human immunodeficiency with Software). Statistical analysis for the S junctions was microcephaly. Cell 2006; 124: 287–299. performed using w2-test. 14 Moshous D, Callebaut I, de Chasseval R, Corneo B, Cavazza- na-Calvo M, Le Deist F et al. Artemis, a novel DNA double- strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell 2001; 105: Conflict of interest 177–186. The authors declare no conflict of interest. 15 van Gent DC, van der Burg M. Non-homologous end-joining, a sticky affair. Oncogene 2007; 26: 7731–7740. 16 Noordzij JG, Verkaik NS, van der Burg M, van Veelen LR, de Bruin-Versteeg S, Wiegant W et al. Radiosensitive SCID Acknowledgements patients with Artemis gene mutations show a complete B- cell differentiation arrest at the pre-B-cell receptor checkpoint We thank Dr A Aartsma-Rus for support with the AON in bone marrow. Blood 2003; 101: 1446–1452. design, WM Comans-Bitter and S de Bruin-Versteeg for 17 O0Driscoll M, Gennery AR, Seidel J, Concannon P, Jeggo PA. making the figures and L Du and MA Berkowska for An overview of three new disorders associated with genetic support with analyzing the switch junctions. This work instability: LIG4 syndrome, RS-SCID and ATR-Seckel syn- was supported by grants from the foundation ‘Sophia drome. DNA Repair (Amst) 2004; 3: 1227–1235. Kinderziekenhuis Fonds’ (grant 589 H IJspeert and M 18 van der Burg M, van Veelen LR, Verkaik NS, Wiegant WW, van der Burg). Hartwig NG, Barendregt BH et al. A new type of radiosensitive T-B-NK+ severe combined immunodeficiency caused by a LIG4 mutation. J Clin Invest 2006; 116: 137–145. 19 van der Burg M, Ijspeert H, Verkaik NS, Turul T, Wiegant WW, References Morotomi-Yano K et al. A DNA-PKcs mutation in a radiosensitive T-B- SCID patient inhibits Artemis activation and 1 Cowan MJ, Neven B, Cavazanna-Calvo M, Fischer A, Puck J. nonhomologous end-joining. J Clin Invest 2009; 119: 91–98. Hematopoietic stem cell transplantation for severe combined 20 Villa A, Santagata S, Bozzi F, Giliani S, Frattini A, Imberti L immunodeficiency diseases. Biol Blood Marrow Transplant 2008; et al. Partial V(D)J recombination activity leads to Omenn 14: 73–75. syndrome. Cell 1998; 93: 885–896. 2 Pike-Overzet K, van der Burg M, Wagemaker G, van Dongen 21 Ege M, Ma Y, Manfras B, Kalwak K, Lu H, Lieber MR et al. JJ, Staal FJ. New insights and unresolved issues regarding Omenn syndrome due to ARTEMIS mutations. Blood 2005; insertional mutagenesis in X-linked SCID gene therapy. Mol 105: 4179–4186. Ther 2007; 15: 1910–1916. 22 de Saint-Basile G, Le Deist F, de Villartay JP, Cerf-Bensussan N, 3 Cavazzana-Calvo M, Fischer A. Gene therapy for severe Journet O, Brousse N et al. Restricted heterogeneity of T combined immunodeficiency: are we there yet? J Clin Invest lymphocytes in combined immunodeficiency with hypereosi- 2007; 117: 1456–1465. nophilia (Omenn0ssyndrome).J Clin Invest 1991; 87: 1352–1359. 4 Buckley RH, Schiff RI, Schiff SE, Markert ML, Williams LW, 23 Du L, van der Burg M, Popov SW, Kotnis A, van Dongen JJ, Harville TO et al. Human severe combined immunodeficiency: Gennery AR et al. Involvement of Artemis in nonhomologous genetic, phenotypic, and functional diversity in one hundred end-joining during immunoglobulin class switch recombina- eight infants. J Pediatr 1997; 130: 378–387. tion. J Exp Med 2008; 205: 3031–3040. 5 Geha RS, Notarangelo LD, Casanova JL, Chapel H, Conley 24 Schuetz C, Huck K, Gudowius S, Megahed M, Feyen O, ME, Fischer A et al. Primary immunodeficiency diseases: an Hubner B et al. An immunodeficiency disease with RAG update from the international union of immunological mutations and granulomas. N Engl J Med 2008; 358: 2030–2038. societies primary immunodeficiency diseases classification 25 de Jager M, Blokx W, Warris A, Bergers M, Link M, Weemaes committee. J Allergy Clin Immunol 2007; 120: 776–794. C et al. Immunohistochemical features of cutaneous granulo- 6 McBlane JF, van Gent DC, Ramsden DA, Romeo C, Cuomo mas in primary immunodeficiency disorders: a comparison CA, Gellert M et al. Cleavage at a V(D)J recombination signal with cutaneous sarcoidosis. J Cutan Pathol 2008; 35: 467–472.

Genes and Immunity Artemis splice defects cause atypical SCID H IJspeert et al 444 26 Rohr J, Pannicke U, Doring M, Schmitt-Graeff A, Wiech E, 42 Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack Busch A et al. Chronic inflammatory bowel disease as key MP, Wulffraat N, Leboulch P et al. LMO2-associated clonal T manifestation of atypical ARTEMIS deficiency. J Clin Immunol cell proliferation in two patients after gene therapy for SCID- 2010; 30: 314–320. X1. Science 2003; 302: 415–419. 27 van der Burg M, Verkaik NS, den Dekker AT, Barendregt BH, 43 Hu H, Gatti RA. New approaches to treatment of primary Pico-Knijnenburg I, Tezcan I et al. Defective Artemis nuclease immunodeficiencies: fixing mutations with chemicals. Curr is characterized by coding joints with microhomology in long Opin Allergy Clin Immunol 2008; 8: 540–546. palindromic-nucleotide stretches. Eur J Immunol 2007; 37: 44 van Deutekom JC, Janson AA, Ginjaar IB, Frankhuizen WS, 3522–3528. Aartsma-Rus A, Bremmer-Bout M et al. Local dystrophin 28 Jurka J, Milosavljevic A. Reconstruction and analysis of restoration with antisense oligonucleotide PRO051. N Engl J human Alu genes. J Mol Evol 1991; 32: 105–121. Med 2007; 357: 2677–2686. 29 Jung D, Giallourakis C, Mostoslavsky R, Alt FW. Mechanism 45 Noordzij JG, de Bruin-Versteeg S, Verkaik NS, Vossen JM, de and control of V(D)J recombination at the immunoglobulin Groot R, Bernatowska E et al. The immunophenotypic and heavy chain locus. Annu Rev Immunol 2006; 24: 541–570. immunogenotypic B-cell differentiation arrest in bone marrow 30 Pan Q, Petit-Frere C, Lahdesmaki A, Gregorek H, Chrzanows- of RAG-deficient SCID patients corresponds to residual ka KH, Hammarstrom L. Alternative end joining during recombination activities of mutated RAG proteins. Blood switch recombination in patients with ataxia-telangiectasia. 2002; 100: 2145–2152. Eur J Immunol 2002; 32: 1300–1308. 46 van der Velden VH, Hochhaus A, Cazzaniga G, Szczepanski T, 31 Lahdesmaki A, Taylor AM, Chrzanowska KH, Pan-Hammar- Gabert J, van Dongen JJ. Detection of minimal residual disease strom Q. Delineation of the role of the Mre11 complex in class in hematologic malignancies by real-time quantitative PCR: switch recombination. J Biol Chem 2004; 279: 16479–16487. principles, approaches, and laboratory aspects. Leukemia 2003; 32 Aartsma-Rus A, van Ommen GJ. Antisense-mediated exon 17: 1013–1034. skipping: a versatile tool with therapeutic and research 47 Lefranc MP. IMGT databases, web resources and tools applications. RNA 2007; 13: 1609–1624. for immunoglobulin and T cell receptor sequence analysis 33 Niehues T, Perez-Becker R, Schuetz C. More than just SCID– http://imgt.cines.fr Leukemia 2003; 17: 260–266. the phenotypic range of combined immunodeficiencies 48 Pan Q, Petit-Frere C, Dai S, Huang P, Morton HC, Brandtzaeg associated with mutations in the recombinase activating genes P, et al. Regulation of switching and production of IgA in (RAG) 1 and 2. Clin Immunol 2010; 135: 183–192. human B cells in donors with duplicated alpha1 genes. Eur J 34 Lev-Maor G, Sorek R, Shomron N, Ast G. The birth of an Immunol 2001; 31: 3622–3630. alternatively spliced exon: 30 splice-site selection in Alu exons. Science 2003; 300: 1288–1291. 49 Pan-Hammarstrom Q, Jones AM, Lahdesmaki A, Zhou W, 35 van Zelm MC, Geertsema C, Nieuwenhuis N, de Ridder D, Gatti RA, Hammarstrom L et al. Impact of DNA ligase IV Conley ME, Schiff C et al. Gross deletions involving IGHM, on nonhomologous end joining pathways during class BTK, or Artemis: a model for genomic lesions mediated by switch recombination in human cells. J Exp Med 2005; 201: transposable elements. Am J Hum Genet 2008; 82: 320–332. 189–194. 36 Grosso AR, Gomes AQ, Barbosa-Morais NL, Caldeira S, 50 Zuker M. Mfold web server for nucleic acid folding and Thorne NP, Grech G et al. Tissue-specific splicing factor gene hybridization prediction. Nucleic Acids Res 2003; 31: 3406–3415. expression signatures. Nucleic Acids Res 2008; 36: 4823–4832. 51 Aartsma-Rus A, van Vliet L, Hirschi M, Janson AA, 37 Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, Mayr C Heemskerk H, de Winter CL et al. Guidelines for antisense et al. Alternative isoform regulation in human tissue tran- oligonucleotide design and insight into splice-modulating scriptomes. Nature 2008; 456: 470–476. mechanisms. Mol Ther 2009; 17: 548–553. 38 Rivera-Munoz P, Soulas-Sprauel P, Le Guyader G, Abramows- 52 van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, ki V, Bruneau S, Fischer A et al. Reduced immunoglobulin Rossi V, Saglio G et al. Standardized RT-PCR analysis of class switch recombination in the absence of Artemis. Blood fusion gene transcripts from chromosome aberrations in acute 2009; 114: 3601–3609. leukemia for detection of minimal residual disease. Report 39 Notarangelo LD, Forino C, Mazzolari E. Stem cell transplanta- of the BIOMED-1 Concerted Action: investigation of minimal tion in primary immunodeficiencies. Curr Opin Allergy Clin residual disease in acute leukemia. Leukemia 1999; 13: Immunol 2006; 6: 443–448. 1901–1928. 40 Qasim W, Gaspar HB, Thrasher AJ. Progress and prospects: 53 Comans-Bitter WM, de Groot R, van den Beemd R, Neijens HJ, gene therapy for inherited immunodeficiencies. Gene Ther Hop WC, Groeneveld K et al. Immunophenotyping of blood 2009; 16: 1285–1291. lymphocytes in childhood. Reference values for lymphocyte 41 Neven B, Leroy S, Decaluwe H, Le Deist F, Picard C, Moshous subpopulations. J Pediatr 1997; 130: 388–393. D et al. Long-term outcome after hematopoietic stem cell 54 de Vries E, Kuijpers TW, van Tol MJD, van der Meer JWM, transplantation of a single-center cohort of 90 patients Weemaes CMR, van Dongen JJM. Diagnostiek bij vermoeden with severe combined immunodeficiency. Blood 2009; 113: van een afweerstoornis:inleiding. Ned Tijdschr Geneeskd 2000; 4114–4124. 144: 2192–2196.

Genes and Immunity