Investigating the Neural Circuits That Control Cataplexy

Investigating the Neural Circuits that Control Cataplexy

by Zoltán Torontali A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Cell & Systems Biology University of Toronto

Investigating the Neural Circuits that Mediate Cataplexy

Zoltan Torontali Doctor of Philosophy Department of Cell & Systems Biology University of Toronto 2019 Abstract

In this thesis I explored a long-standing hypothesis that the paralysis occurring during REM sleep and cataplexy share a common neural mechanism. Cataplexy, a debilitating symptom of narcolepsy, is the abrupt onset of skeletal muscle paralysis during wakefulness. Under normal conditions, neurons of the sublaterodorsal tegmental region have been shown to be active during

REM sleep and either activate GABA/glycine neurons of the ventral medulla or inhibitory

interneurons in the spinal cord which in turn silences motoneurons and results in REM sleep

muscle paralysis. The mechanism mediating the paralysis of cataplexy has not been fully

characterized but is hypothesized to result from the abnormal activation of SLD neurons during

wakefulness. First, I investigated if activation of all cells in the SLD nucleus could trigger

cataplexy in wildtype (hypocretin-intact) mice and narcoleptic (hypocretin knockout) mice. Next,

I investigated if glutamatergic, VGLUT2-expressing, neurons of the SLD were the cellular

phenotype responsible for triggering cataplexy in wildtype and narcoleptic mice models. This final

investigation required the development of a new hypocretin knockout mouse line (hypocretin-/-,

VGLUT2-Cre mice). This new model is scientifically important as it provides an innovative toolkit for neuroscientists to examine the role of glutamatergic cell populations throughout the brain of mice with a narcolepsy phenotype. Several major conclusions can be drawn from my results:

1. Cataplexy and REM sleep share a common neural mechanism that generates muscle paralysis.

Activation of the SLD nucleus triggered cataplexy in wild type mice. This is a significant finding as it is the first time that cataplexy has been triggered in wildtype mice. Similarly, narcoleptic mice experienced an increase in the number of cataplexy episodes after activation of the SLD nucleus.

2. Activation of VGLUT2-SLD neurons in VGLUT2-Cre (hypocretin intact) mouse results in overall muscle weakness during wakefulness but does not trigger cataplexy episodes.

3. The VGLUT2-expressing SLD neurons are a component of the neural circuit that triggers cataplexy. Activation of the VGLUT2-SLD neurons in hypocretin knockout mice resulted in increased number of cataplexy attacks without altering the duration of the episode.

iii

Acknowledgments

First and foremost, I must thank my supervisor, Dr. John Peever, for his patient guidance

throughout my time in his laboratory. John not only established the foundation for my scientific

career, but has gone above and beyond in promoting and supporting it. I am forever grateful for

the skills, knowledge and experience I have gained under his mentorship.

A very special gratitude must be extended to Dr. Jimmy Fraigne. Jimmy has not only been

a mentor all these years but also a best friend. One could not find a more positive person who was

always able and willing to help focus my enormous energy and passion in the right direction. Our

friendship and memories will be cherished for the rest of my life. Every PhD student should be as

lucky as I was to have a friend and mentor like Jimmy.

I would also like to thank members of the Peever Lab (in alphabetical order) that made my time enjoyable. Thank you to Patti Brooks for the encouragement and 5pm reminders! Thank you

Sharshi Bulner for the comical conundrums he finds himself in as they always lightened the mood.

Christian Burgess’s sense of humor, advice and drive for scientific excellence was always (and continues to be) an inspiration for me. Negar Golmohammadi and Mohamad Hamieh’s lively and cheerful personalities were always the perfect remedy for my anxiety. A special mention must go out to Paul Sanghera, who was always a phone call away and a friend that could always find a different lens to look at any situation. I hope to continue our philosophical journeys. Dry humor

and encouragement was the specialty of Peter Schwarz-Lam. Your quick witted comments was always a treat! I would like to thank Han-hee Lee for the chats over coffee. Daniel Li was not only a fantastic lab-mate but also a fun room-mate. I would also like to single out Matthew Snow, who

is a fantastic friend! Our shenanigans were always the most fun and I am lucky to have such a talented proof-reader! Thank you Nicole Yee for the encouragement and support. I would like to

thank my extended family outside the lab but within the Sleep Field - you all know who you are and our memories will be cherished.

I must mention my greatest cheerleaders, Mom (Katica Torontali) and Dad (John

Torontali). You both encouraged me since I was young to pursue my curiosity and passion.

Constant moral and emotional support was provided from both of my parents and words cannot express how grateful I am to have the best parents in the world. This thesis would not have been possible without their love and support. I love them both very much! My dearest sister, Pearl, was also there for many late night calls and has taught me the art of being a good listener. Finally, I would like to thank Jessica Pressey for her love and support throughout this journey.

I would like to thank the members of my doctoral committee - Dr Kaori Takehara-

Nishiuchi, Dr. John Yeomans, Dr. Junchul Kim and Dr. Ritchie Brown. Their honest appraisal and discussion of my work has led to an elevated thesis and a very enjoyable thesis defence! I would also like to thank the University of Toronto, Ontario Graduate Scholarship, Canadian Institute of

Health and Research.

Finally, I would like to immortalize my kindred spirit, Oscar, by acknowledging him. He is the best dog a human could have and our long walks helped my brain disconnect from the lab.

Table of Contents Acknowledgments ...... iv

List of Tables ...... xii

List of Figures ...... xiii

Chapter 1: Introduction ...... 1

1.1 Narcolepsy ...... 1

1.1.1 Overview ...... 1

1.1.2 Diagnosis ...... 1

1.1.3 A brief history of the link between hypocretin and narcolepsy ...... 2

1.2 Cataplexy ...... 9

1.2.1 Overview ...... 9

1.2.2 Features of Cataplexy ...... 9

1.2.3 Status cataplecticus ...... 13

1.2.4 Treatment of Cataplexy ...... 13

1.3 Animal Models and Pathophysiology ...... 16

1.3.1 Canine Model of Cataplexy ...... 16

1.3.2 Mouse Models of Cataplexy ...... 17

1.4 Rapid Eye Movement Sleep ...... 21

1.4.1 Transections: Substantiating REM sleep as a state and the duality of sleep ...... 21

1.4.2 Neurotransmitters within the SLD pontine region regulating behavior ...... 24

1.5 REM sleep muscle paralysis ...... 28

1.5.1 Defining the location of the SLD ...... 34

1.6 REM sleep intrusion hypothesis ...... 35

1.6.1 The SLD nucleus and REM sleep intrusion hypothesis ...... 40

1.6.2 The neurobiology of cataplexy ...... 40

1.7 Chemogenetics: Investigating behavior by harnessing the control of neurons ...... 44

1.7.1 Overview ...... 44

1.7.2 Early approaches in neuronal control ...... 45

1.7.3 Designer G-coupled protein Receptors ...... 47

1.7.4 First Generation Receptors Activated Solely Activated by Synthetic Ligands (RASSLs) ...... 48

1.7.5 Second-generation Designer Receptors: Designer Receptors Exclusively Activated by Designer Drugs

(DREADDs) ...... 48

1.7.6 DREADD Expression Mechanisms ...... 51

1.8 Thesis Overview ...... 54

Chapter 2: Experimental Methods ...... 55

2.1 Animals ...... 55

2.2 Chemogenetics (Designer Receptors Exclusively Activated by Designer Drugs) ...... 56

2.3 Drug Preparation ...... 57

2.4 Viral Injection Surgery ...... 57

2.5 Electroencephalographic and Electromyographic Electrode Implantation Surgeries ...... 59

2.6 EEG and EMG Data Acquisition ...... 59

2.7 Data Analysis ...... 62

2.8 Histology, Immunohistochemistry and Fluorescence In Situ Hybridization ...... 63

2.9 Statistical Analyses ...... 66

Chapter 3: Activation of the SLD nucleus produces cataplexy in wildtype mice ...... 67

3.1 Overview ...... 67

3.2 Results ...... 68

3.2.1 hM3Dq receptors are expressed in and activate SLD cells ...... 68

vii

3.2.2 Activation of SLD neurons generates repeated episodes of motor paralysis ...... 69

3.2.3 The average duration of the behavioral arrests induced by SLD activation resemble cataplexy, not

REM sleep ...... 70

3.2.4 Behavioral arrests produced by SLD activation follow patterns of muscle activity which parallel

cataplexy ...... 72

3.2.5 The motor profile during SLD induced behavioral arrest resembles cataplexy not REM sleep...... 74

3.2.6 The cortical activity of the behavioral state produced by activation of SLD nucleus resembles

cataplexy...... 76

3.3 Discussion ...... 78

3.3.1 The sublaterodorsal nucleus triggers cataplexy ...... 78

3.3.2 Activation of the sublaterodorsal nucleus triggers cataplexy not REM sleep ...... 80

3.3.3 The role of the SLD nucleus in the neural circuit mediating cataplexy ...... 82

3.3.4 Technical considerations ...... 83

3.4 Conclusion...... 83

Chapter 4: Activation of the SLD nucleus regulates cataplexy in narcoleptic mice ...... 85

4.1 Overview ...... 85

4.2 Results ...... 86

4.2.1 Activation of SLD cells in narcoleptic mice promotes cataplexy ...... 86

4.2.2 Activation of SLD cells in narcoleptic mice does not promote sleep ...... 87

4.2.3 Inhibition of SLD cells in narcoleptic mice does not affect the expression of cataplexy...... 88

4.2.4 Inhibition of the SLD nucleus does not modulate sleep-wake architecture ...... 92

4.3 Discussion ...... 92

4.3.1 The SLD mediates cataplexy in narcoleptic mice ...... 96

4.3.2 Manipulation of the SLD exacerbates cataplexy but does not increase the amount of REM sleep ... 98

4.3.3 Technical Considerations ...... 100

viii

4.4 Conclusion...... 103

Chapter 5: Selective activation of VGLUT2-expresing SLD neurons decreases muscle tone during wakefulness in wild-type mice ...... 104

5.1 Overview ...... 104

5.2 Results ...... 104

5.2.1 Chemogenetic receptors were selectively expressed in VGLUT2-SLD cells ...... 104

5.2.2 Chemogenetic activation of VGLUT2-SLD resulted in decreased muscle activity during wakefulness.

105

5.2.3 Chemogenetic activation of VGLUT2- SLD neurons did not alter sleep-wake architecture ...... 108

5.3 Discussion ...... 114

5.3.1 Chemogenetic activation of VGLUT2-SLD neurons induces muscle weakness during wakefulness . 114

5.3.2 Chemogenetic activation of VGLUT2-SLD cells preferentially affected the masseter muscles ...... 117

5.3.3 Chemogenetic activation of all cell types in the SLD produced cataplexy whereas selective VGLUT2-

SLD neuron activation resulted in muscle weakness ...... 118

5.3.4 Chemogenetic activation of VGLUT2-SLD neurons did not trigger REM sleep ...... 119

5.4 Conclusion...... 121

Chapter 6: Selective manipulation of VGLUT2-expressing SLD neurons regulates cataplexy in narcoleptic mice...... 122

6.1 Overview ...... 122

6.2 Results ...... 123

6.2.1 Narcoleptic mice that express Cre in VGLUT2 neurons exhibit characteristic cataplexy ...... 123

6.2.2 Chemogenetic receptors are selectively expressed in VGLUT2-SLD cells of hypocretin−/−, VGLUT2-Cre

mice 125

6.2.3 Chemogenetic activation of VGLUT2-SLD neurons increases cataplexy ...... 129

6.2.4 Chemogenetic activation of VGLUT2-SLD neurons does not influence muscle tone of sleep-wake

states 133

6.2.5 Chemogenetic activation of VGLUT2-SLD neurons does not influence sleep-wake architecture .... 134

6.2.6 Reconciling the difference in behavior following VGLUT2-SLD activation in the wildtype and

narcoleptic animals ...... 136

6.2.7 Chemogenetic inhibition of VGLUT2-SLD neurons does not prevent cataplexy ...... 137

6.2.8 The characteristics of cataplexy remain unchanged following inhibition of VGLUT2-SLD cells ...... 142

6.3 Discussion ...... 147

6.3.1 Expanding the neuroscience toolkit for the study of sleep, wake and sleep disorders ...... 149

6.3.2 The VGLUT2-expressing neurons of the SLD nucleus trigger cataplexy in narcoleptic mice ...... 149

6.3.3 The VGLUT2-SLD neurons are a component of the neural pathway that promote cataplexy ...... 151

6.3.4 REM sleep was not triggered by activation of VGLUT2-SLD neurons ...... 155

6.3.5 Limitations ...... 158

6.4 Conclusion...... 161

Chapter 7: General Discussion ...... 162

7.1 Overview ...... 162

7.2 Cataplexy can be triggered through activation of the sublaterodorsal tegmental nucleus 163

7.3 The sublaterodorsal tegmentum nucleus mediates cataplexy in narcoleptic animals ...... 164

7.4 Activation of VGLUT2-expressing neurons of the SLD neurons triggers muscle weakness in

VGLUT2-Cre, hypocretin intact, mice ...... 165

7.5 The VGLUT2-expressing neurons of the sublaterodorsal tegmental nucleus mediate cataplexy in narcoleptic mice ...... 166

7.6 Cataplexy and rapid eye movement sleep share a common neural mechanism ...... 167

7.7 Manipulation of the SLD nucleus resulted in cataplexy not REM sleep ...... 169

7.8 The VGLUT2-SLD neurons mediate cataplexy in hypocretin knockout animals but not

hypocretin intact animals ...... 172

7.9 Activation of the VGLUT2-SLD neuron population alone is not enough to trigger cataplexy in

hypocretin intact mice ...... 174

7.10 Chemogenetics, CNO and controversy ...... 175

7.11 Updated neural circuit underlying the induction of cataplexy ...... 178

7.12 Limitations ...... 179

7.13 Future Directions ...... 181

7.14 Clinical implications of deciphering the sublaterodorsal tegmentum ...... 184

7.15 Final Summary ...... 187

References ...... 189

List of Tables

Table 1.1. Summary of mouse models used to investigate narcolepsy and cataplexy 22

Table 6.1. Behavioral state architecture in hypocretin−/− and hypocretin−/−, VGLUT2- 127 Cre mice

Table 6.2. Summary of the sleep-wake architecture, cataplexy and sleep attacks 140 following 3 hours recording in hM4Di-expressing and mCherry-expressing control hypocretin-/-, VGLUT2-Cre mice

Table 6.3. Summary of the sleep-wake architecture and sleep attacks following 3 hours 144 recording in hM4Di-expressing and mCherry-expressing control hypocretin-/-, VGLUT2-Cre mice

xii

List of Figures

Figure 1.1. Illustration by von Economo linking brain pathologies to disease. 4 Figure 1.2. Hypocretin knockout mice recapitulate narcoleptic symptoms 7 Figure 1.3. Narcoleptics have a significant loss of hypocretin cells. 8 Figure 1.4. An example of a narcoleptic patient experiencing a cataplexy attack. 14 Figure 1.5. An example of canine cataplexy 18 Figure 1.6. Displaying the transections made in cats that assisted in localizing the 25 brain area controlling REM sleep. Figure 1.7. The location of the SLD nucleus within the dorsolateral pons 36 Figure 1.8. Glutamate neurons of the sublaterodorsal tegmentum (SLD) are 37 responsible for generating REM sleep paralysis through downstream projections to the medulla Figure 1.9. Circuit schematic detailing the pathways that govern motor control 38 during REM sleep. Figure 1.10. Current hypothesized circuit mediating cataplexy. 46 Figure 1.11. Designer Receptors Exclusively Activated by Designer Drugs. 53

Figure 2.1. Chemogenetic investigation of the neural circuits mediating cataplexy. 58 Figure 2.2. Schematic representation of a surgically instrumented mouse. 60

Figure 3.1. HM3DGq-expressing neurons are located within the region of the SLD 71 and are activated by clozapine-n-oxide Figure 3.2. Activation of SLD produces a state of behavioral arrests. 73 Figure 3.3. SLD activation produces behavioral arrests that are similar in duration 75 of cataplexy. Figure 3.4. SLD activation triggers behavioral arrests where patterns of muscle 77 activity over time parallel cataplexy not REM sleep. Figure 3.5. Spectral analysis of cataplexy and SLD induced states are related 79

Figure 4.1. Location of hM3Dq-expressing neurons in the SLD nucleus. 89 Figure 4.2. Chemogenetic activation of the SLD neurons exacerbates cataplexy in 90 narcoleptic mice. Figure 4.3. Activation of the SLD nucleus abolishes NREM sleep and REM sleep. 91 Figure 4.4. Location of hM4Di-expressing neurons in the SLD nucleus 93 Figure 4.5. Inhibition of SLD neurons mitigates the expression of cataplexy episodes 94 in narcoleptic mice. Figure 4.6. Inhibition of SLD neurons had no significant impact on sleep and wake 95 architecture.

Figure 5.1 Chemogenetic hM3Dq receptors are expressed in VGLUT2-SLD 107 neurons. Figure 5.2 Chemogenetic activation of VGLUT2-SLD neurons produces muscle 110 weakness Figure 5.3 Chemogenetic activation of VGLUT2-SLD neurons does not affect 111 wakefulness.

xiii

Figure 5.4 The NREM sleep state was unaffected by chemogenetic activation of 112 VGLUT2-SLD neurons. Figure 5.5 Chemogenetic activation of VGLUT2-SLD neurons does not alter REM 113 sleep.

Figure 6.1. hypocretin−/− mice that express Cre in VGLUT2 neurons exhibit typical 126 cataplexy. Figure 6.2. Verification of chemogenetic receptor expression in VGLUT2-SLD 128 neurons and the location of hM3Dq-expressing VGLUT2-SLD neurons in the SLD nucleus. Figure 6.3. Chemogenetic activation of VGLUT2-SLD neurons in 131 hypocretin−/−,VGLUT2-Cre mice increase the number of cataplexy attacks Figure 6.4. Cataplexy triggered through CNO-induced activation of hM3Dq- 132 expressing VGLUT2-SLD cells was indistinguishable from cataplexy under saline control conditions Figure 6.5. Chemogenetic activation of VGLUT2-SLD neurons does not alter 135 muscle tone during sleep attacks, sleep or wake. Figure 6.6. Location of hM3Dq-expressing neurons across all studies in this thesis 138 Figure 6.7. Comparing the number of VGLUT2 hM3Dq-expressing SLD neurons in 139 wildtype and narcoleptic animals Figure 6.8. Chemogenetic inhibition of VGLUT2-SLD neurons in 143 hypocretin−/−,VGLUT2-Cre mice does not reduce cataplexy. Figure 6.9. Cataplexy occurring under CNO-induced inhibition of hM4Di- 146 expressing VGLUT2-SLD cells was indistinguishable from saline control conditions and viral vector control mice. Figure 6.10. Chemogenetic inhibition of VGLUT2-SLD neurons does not alter 148 muscle tone during sleep attacks, sleep or wake

Figure 7.1. Clozapine-n-oxide administration does not affect muscle tone during 177 wakefulness Figure 7.2. The future of understanding cataplexy and REM sleep will be found by deciphering of the microcircuitry of the SLD nucleus. 186

xiv

Chapter 1: Introduction 1.1 Narcolepsy

1.1.1 Overview

Narcolepsy is a chronic and debilitating sleep disorder that has been recognized since the

nineteenth century. The prevalence of narcolepsy is estimated at 0.02% of the population

worldwide and therefore, equates to 3 million people (Dauvilliers et al., 2007; Kornum et al.,

2017). Narcolepsy is characterized by excessive daytime sleepiness, disturbed nocturnal sleep,

hypnogogic hallucinations and sleep paralysis, whereby patients experience muscle paralysis

while falling asleep or upon waking up (Dauvilliers et al., 2007). Narcoleptic individuals also

experience inappropriate regulation of motor control, particularly in the form of cataplexy, the

abrupt onset of muscle paralysis during wakefulness (Dauvilliers et al., 2014). This is the most

debilitating symptom of narcolepsy as consciousness continues to be preserved during these

periods of paralysis (Wilson, 1928; Dauvilliers et al., 2003). Together, these symptoms are responsible for major reductions in quality of life by creating difficulties in school, work, social situations, and personal relationships (Daniels et al., 2001; Jennum et al., 2013).

1.1.2 Diagnosis

Hypocretin peptides are a fundamental biomarker of narcolepsy and function in the

regulation of behavioural state (Sakurai, 2007). Narcoleptic patients are born with these neurons

but over time neurodegeneration of hypocretin neurons leads to a reduction in hypocretin peptide

signaling (Thannickal et al., 2000). The loss of hypocretin neurons coincides with the appearance of narcolepsy symptoms (Savvidou et al., 2013; Pizza et al., 2014). A recent paradigm shift in

1 2

diagnosis has placed the focus onto identifying disease with molecular biomarkers to enhance the

stringent clinical checklist approach (McGorry, 2013). Therefore, the most recent edition of the

International Classification of Sleep Disorders classifies narcolepsy into one of two subtypes based

on the level of circulating hypocretin peptides in cerebrospinal fluid (Abad and Guilleminault,

2003). This is in contrast to a past method that was symptomatically based on the presence or

absence of cataplexy as in the former classification scheme (American Academy of Sleep, 2014).

Narcolepsy type 1 is now defined as low levels of hypocretin in the cerebrospinal fluid

regardless of the presence of cataplexy (American Academy of Sleep, 2014). Less emphasis has

been placed on cataplexy as a diagnostic criterion as recent literature indicates most narcoleptics

with low levels of hypocretin develop it anyway over time (Andlauer et al., 2012). Patients

expressing normal levels of hypocretin often do not present with cataplexy and are diagnosed with

narcolepsy type 2. The focus of this introduction will be on narcolepsy type 1 as this thesis sets

out to investigate the neural circuits that mediate cataplexy.

1.1.3 A brief history of the link between hypocretin and narcolepsy

Narcolepsy was recognized in the late 1800s by Westphal (1877) and Gelineau (1880) but its underlying pathophysiological mechanism was, at the time, a mystery. Between 1915-1919, the

Spanish flu pandemic resulted in the death of an estimated 50 million people (Taubenberger et al.,

2012). Individuals that survived this flu experienced multiple symptoms such as insomnia,

inversion of their sleep-wake cycle, psychiatric disorders, and Parkinson-like movement disorders

(Economo, 1930, 1931). The most bizarre of these symptoms was an extreme sleepiness, termed

encephalitis lethargica or “sleeping sickness” (Economo, 1931). Both Constantin von Economo

and Kinner Wilson identified an important correlation regarding individuals who survived this

syndrome and proceeded to develop narcolepsy (Wilson, 1928). By analyzing the brain tissue of

individuals with encephalitis lethargica von Economo, 1931 noted that sleepiness was correlated

with lesions in the posterior hypothalamic area, extending to the upper pons and third cranial nerve

and that lesions of the lateral hypothalamus produced narcolepsy (See Figure 1.1) (Economo,

1930, 1931).

Between the 1930s and 1970s, experiments involving stimulation of the hypothalamus in cats and rats demonstrated arousal-promoting responses, whereas hypothalamic lesions in monkeys produced hypersomnolence (Ranson, 1940; Nauta, 1946; Anand, 1955; Hess and Akert,

1955; Swett and Hobson, 1968). Subsequent experiments employing histological circuit tracing identified projections from the lateral hypothalamus region to pontine regions which were responsible for the arousal responses elicited by stimulation experiments (Saper et al., 2016).

The first animal model of narcolepsy was established in 1970s. A Stanford sleep researcher,

William Dement had exhibited a recorded video of narcolepsy and cataplexy in human patients at an educational conference (Mignot, 2014). A veterinarian in the audience volunteered that he had seen a similar condition in dogs (Mignot, 2014). Eventually, in 1975, three Doberman canines were donated and from them a line of dogs was bred that presented excessive sleepiness in addition to cataplexy (See Canine Models section).

The hypothalamus was evidently important for arousal states and loosely linked to narcolepsy but physiological underpinnings of these findings were still not well-understood

(Mignot, 2001). In the late 1990s scientists began investigating so-called “orphan receptors” – receptors without a known ligand – in the hypothalamus (Chemelli et al., 1999). Two peptides were discovered by two individual scientific teams and published within a short time of each other

(de Lecea et al., 1998; Chemelli et al., 1999).

Figure 1.1. Illustration by von Economo linking brain pathologies to disease. Von Economo advanced sleep medicine by his mapping of the brain regions implicated in sleep and wakefulness. After post-mortem brain analysis on patients that contracted viral encephalitis he correctly deduced that lesions at the junction of the midbrain and posterior hypothalamus (diagonal hatch marks above) led to hypersomnolence. He also marked with horizontal hatches lesions of the basal forebrain and regions of anterior hypothalamus that resulted in insomnia. Additionally, he identified lesions in the lateral hypothalamus which produced narcolepsy. Abbreviations: O, optic nerve; VE, third ventricle; Hy, hypothalamus; Th, thalamus; V4, fourth ventricle; Aq, cerebral aqueduct; N. oculomet, oculomotor nerve. Modified from Von Economo C. Sleep as a problem of localization. J Nerv Ment Dis 1930;71:249–259.

de Lecea and colleagues (1998) pursued the hypothalamic factors through a directional tag

PCR subtraction method. They identified 38 rat mRNAs that were selectively expressed within the

hypothalamic region (Gautvik et al., 1996). Of these 38 mRNAs, in situ hybridization revealed that one of the mRNAs, known as clone 35, had a bilateral and specific expression within the posterior hypothalamus (Gautvik et al., 1996). This mRNA also encoded two peptides which met the criteria for a neurotransmitter and had dense widespread projections to many well-established brain regions controlling sleep and wakefulness (e.g. basal forebrain, locus coeruleus, laterodorsal tegmental nucleus) (de Lecea et al., 1998). These peptides were named “hypocretins” to signify its location within the hypothalamus and specify it belonged to the incretin family (de Lecea et al.,

1998).

Yanagisawa’s team was interested in finding ligands involved in feeding regulation that would activate hypothalamic G-protein coupled receptors (GPCRs) lacking known ligands

(Chemelli et al., 1999). They did this by investigating GPCR-agonist activity in various fractions

of high resolution HPLC tissue extracts (Chemelli et al., 1999). This process led to the discovery

of several fractions that elicited increases in cytoplasmic calcium in cells expressing an orphan

GPCR. These fractions were then purified and subjected to structural analysis (i.e. Mass

spectrometry and Edman sequencing). This resulted in the identification of two peptides, orexin A

and orexin B (Sakurai et al., 1998). They were named orexin, the Greek word for “appetite”, most

likely because intracerebroventricular administration of these peptides resulted in increased

feeding behaviour (Sakurai et al., 1998). These two peptides were identical to the peptides de

Lecea et al., (1998) discovered. I have chosen to use the hypocretin, instead of orexin, as this

nomenclature is based on its location and family whereas orexin refers solely to appetite. As this

thesis will demonstrate, hypocretin peptides play more than just a role in feeding.

The following year, a mutant mouse lacking the hypocretin peptide (the orexin knockout

mouse) was generated to further understand the role of these peptides in behaviour (Chemelli et

al., 1999). Video recordings of the newly generated mouse model showed abrupt behavioural

arrests during locomotor activity (See Figure 1.2) (Chemelli et al., 1999). The behavioural arrests

demonstrated striking similarities to cataplexy seen in human narcoleptics. Upon further analysis

it was found that these mice recapitulated other features of human narcolepsy: inability to maintain

long periods of wakefulness, transitions to REM sleep from wakefulness, reduced latency to REM

sleep episodes, and overall increased REM sleep time during the darkphase (Chemelli et al., 1999).

Much progress was made in 1999 as not only was the first narcoleptic mouse model

published, but, the genetic component responsible for canine narcolepsy was established. Using

chromosomal analysis, it was found that the pathophysiological basis for canine narcolepsy was a

mutated and non-functional hypocretin-2 receptor (Lin et al., 1999).

While the mouse and canine models did provide similar symptoms to human narcolepsy and a genetic basis for the pathophysiology, human research demonstrated that twins do not always both express narcolepsy (Hublin et al., 1994). This suggested that the etiology of human narcolepsy was not exclusively genetic and therefore distinct from that seen in animal models (Siegel et al.,

2001). Siegel’s group surmised that human narcolepsy was related instead to neuronal function, specifically regarding the quantity of hypocretin-producing neurons or amount of hypocretin released. Antigen retrieval techniques using post-mortem brain tissue demonstrated a 93% decrease in hypocretin neurons within the brains (See Figure 1.3) and a reduced but detectable level of hypocretin in the

Figure 1.2. Hypocretin knockout mice recapitulate narcoleptic symptoms. Screenshots taken from video of hypocretin knockout mice. A. an arrow marks a mouse that is on his side and having a cataplectic attack while his littermates (marked 1, 2 and 3) are active as seen from the blurry image quality. B. denotes two animals having a cataplectic attack at the same time with an arrow and an asterisk. The animal denoted by the arrow is on its side and the asterisk is an animal that is in full prone position and collapsed in the middle of the cage. Both animals display stereotypical posture of a cataplexy attack. Modified from Chemelli et al., 1999

Figure 1.3. Narcoleptics have a significant loss of hypocretin cells. This figure demonstrates the distribution of hypocretin cells in the perifornical and dorsomedial hypothalamic regions of normal (left) and narcoleptic (right) humans. All cellular micrographs are taken from the denoted square in both A and B. Note the reduction in cells and axonal density seen in narcoleptic patients when compared to healthy individuals. Modified from Thannickal et al., 2000

CSF of narcoleptic patients compared to non-narcoleptics (Thannickal et al., 2000). Other studies demonstrated complete hypocretin cell loss and undetectable amounts of hypocretin in the CSF of human narcoleptics (Peyron et al., 2000). Regardless, together these studies provided clear evidence illustrating a link between reduced hypocretin signalling and the development of clinical narcolepsy.

1.2 Cataplexy

1.2.1 Overview

The work in this thesis probes the neuropathophysiology of cataplexy, the most distinctive

and enigmatic symptom of narcolepsy. Cataplexy is defined as an involuntary and abrupt bilateral

loss of skeletal muscle tone during wakefulness (Abad and Guilleminault, 2003). The level of

skeletal muscle tone can range from partial to complete loss (Abad and Guilleminault, 2003). The

loss of motor control can give the appearance of sleep, however, individuals remain conscious and

incapacitated throughout an episode of cataplexy (Burgess et al., 2013; Dauvilliers et al., 2014).

These attacks are often triggered by an emotional context but can also occur spontaneously

(Overeem et al., 2001; Overeem et al., 2011; Oishi et al., 2013; Snow et al., 2017). While excessive

daytime sleepiness is the first symptom to manifest in narcolepsy, cataplexy remains the clearest

behavioral biomarker of narcolepsy (Andlauer et al., 2012). Cataplexy can develop shortly after

birth, but in many cases the onset within a couple years after the onset of excessive daytime

sleepiness (Thorpy and Krieger, 2014).

1.2.2 Features of Cataplexy

1.2.2.1 Clinical Features

The diagnosis of cataplexy in a clinical setting can be challenging for a variety of reasons.

Patients are not able to summon an episode at will and spontaneous cataplexy seldom occurs in a

clinical setting (Overeem, 2011; Overeem et al., 2011). To that end, physicians can attempt to elicit

cataplexy through an emotional trigger such as surprise or humor (See Emotional Triggers Section)

(Overeem et al., 2011). There is variability amongst individuals with respect to the age of onset

(Dauvilliers et al., 2001; Dauvilliers et al., 2007). Differences can also be found among the muscles that are affected, the degree of muscle tone lost, cues that trigger episodes, and episode frequency.

1.2.2.2 Motor Features

During a cataplexy attack, the onset of muscle weakness or paralysis (atonia), primarily

targets skeletal muscles (See Figure 1.4) (Abad and Guilleminault, 2003). The muscle paralysis

occurs bilaterally, although in some cases it occurs more strongly on one side producing the

illusion of one-sided muscle loss (Guilleminault and Gelb, 1995; Abad and Guilleminault, 2003;

Dauvilliers et al., 2014). The extraocular and diaphragm muscles are unaffected, but shortness of

breath has been known to occur during the event and similar to the breathing pauses that happen

throughout REM sleep (Kryger et al., 2005). While any skeletal muscle can become paralyzed

during attack, the neck and facial muscles are most commonly affected (Dauvilliers et al., 2007;

Dauvilliers et al., 2014). This usually manifests in the jaw as tremors or drooping, as well as

dropping of the neck and head (Dauvilliers et al., 2014). The degree to which muscle tone is lost

can vary – 30% of patients suffer from partial attacks while 50% experience both partial and complete attacks (Sturzenegger and Bassetti, 2004; Overeem et al., 2011; Pizza et al., 2018).

Because of this, attacks can precipitate as full body (i.e. a sensation of the body sinking into itself

or total collapse) or more isolated expression as in dysarthria, grimacing, or a swift weakness in

the knees (Overeem et al., 2011). Generally, cataplexy attacks begin with a minor trembling felt

in either the knees or the wrist, known as asterixis, or twitches and jerks in the facial muscles

(Vetrugno et al., 2010; Dauvilliers et al., 2014; Pizza et al., 2018). These facial twitches are

11 actually the result of the rapid loss and return of tone in facial musculature, often due to the patient fighting the attack as can be seen in Dauvillers et al., (2014) supplementary video. The loss of motor control cataplexy patients experience can be dangerous depending on the situation. For example, Honda (1994) discusses a clinical case report in his book of a narcoleptic patient who had repeated attacks while taking baths and would unwillingly slip under the bath water.

1.2.2.3 Consciousness

While narcoleptics might collapse onto the floor during a cataplexy attack, consciousness is preserved throughout the attack (Wilson, 1928). Indeed, patients can recall what happened prior to, throughout and after the attack (Guilleminault and Gelb, 1995; Dauvilliers et al., 2007;

Overeem et al., 2011). This differentiates cataplexy from sleep attacks, which are the manifestation of the hypersomonlence exhibited in narcolepsy due to a narcoleptics over excessive urge to sleep

(Ohno and Sakurai, 2008). While consciousness remains intact, there are occasions where narcoleptics can have very vivid hallucinations during the cataplexy attack (known as hypnogogic hallucinations) (Guilleminault and Gelb, 1995). Since patients remain conscious, cataplexy is not sleep. However, transitions from cataplexy into REM sleep have been known to occur (Vetrugno et al., 2010).

1.2.2.4 Duration and frequency of cataplexy attacks

The number of attacks varies among narcoleptics and ranges from one attack per year to one per month to numerous episodes per day (Dauvilliers et al., 2007; Mattarozzi et al., 2008).

Low levels of hypocretin-1 in the cerebrospinal fluid are associated with cataplexy especially when levels reach less than 110pg/ml (Heier et al., 2007). However, the severity of cataplexy attacks, either in frequency or duration, have not been found to be correlated with cerebrospinal fluid

hypocretin levels (Baumann et al., 2006). Generally, cataplexy attacks with complete paralysis last

less than two minutes and partial attacks are typically less than 10 seconds but can range up to two

minutes in length (Overeem et al., 2011; Pizza et al., 2018). While narcoleptics report that as their

sleepiness increases so too does the likelihood of an attack, but research has not fully corroborated

this (Mattarozzi et al., 2008). Men have more cataplectic episodes than women, and while

cataplexy remains throughout life it decreases in frequency with age (Mattarozzi et al., 2008).

Some narcoleptics develop strategies to resist cataplexy such as flexing a muscle. However, some narcoleptics find that resisting lengthens the inevitable attack once it finally does transpire

(Overeem et al., 2011; Matos et al., 2016).

1.2.2.5 Emotion triggers cataplexy

A major observation that Gelineau found was that cataplexy was triggered by strong

emotional cues (Schenck et al., 2007). An example of this was where he describes one of his

patients having an episode of cataplexy at the zoo of the Jardin des Plantes in front of the monkey

cage (Schenck et al., 2007). Positively charged emotions such as elation, guffawing, witty

responses, and surprise are potent triggers of cataplexy (Krahn et al., 2005; Overeem et al., 2011;

Pizza et al., 2018). Since cataplexy is more associated with being triggered by positive emotions it is ironic that cataplexy is Latin for “struck down in fear”. It is rare for negative emotions such

as fear, stress, anger and frustration to produce cataplexy (Overeem et al., 2011). This is somewhat

unsurprising since laughter in healthy people can produce minor muscle weakness like the old

adage tells “weak with laughter” (Overeem et al., 2011). One rationalization regarding the

emotional prompt of cataplexy lies within the hypocretin system (Snow et al., 2017). Circuits

mediating emotional control can engage brainstem paralysis promoting circuits through indirect

sub-circuits (Dauvilliers et al., 2014). In healthy people, strong emotions activate the hypocretin

13 system to offset this emotion-induced muscle paralysis (Snow et al., 2017). Unfortunately, in the case of narcoleptics, the lack of hypocretin tips the balance in the neural circuitry engaging downstream paralysis mediating brainstem motor circuits and cataplexy occurs (See section The neurobiology of cataplexy) (Dauvilliers et al., 2014; Fraigne et al., 2015; Snow et al., 2017). While cataplexy has been reported to occur spontaneously, it is also possible that patients are simply unable to identify the emotional cue that triggered the episode (Dauvilliers et al., 2007; Mattarozzi et al., 2008).

1.2.3 Status cataplecticus

A rare form of cataplexy known as “status cataplecticus” has been documented in several cases, although the understanding of this uncommon phenomenon is limited (Wang and

Greenberg, 2013). Though formal diagnostic criteria are lacking for status cataplecticus at this time, it involves multiple cataplexy attacks in sequence or as a single, unusually long cataplexy episode (Dauvilliers et al., 2007). Honda & Juji (1988) stated that the emotional reaction to one cataplexy episode can induce another, giving rise to multiple tandem attacks. These attacks tend to be behaviourally similar to regular cataplexy attacks with head nodding, difficult talking, and lack of upright posture that often leads to full collapse (Simon et al., 2004; Calabro et al., 2007;

Chabas et al., 2007; Panda, 2014). Treatment for this condition is through the use of antidepressants, however, sudden and un-tapered withdrawal from anti-depressants has been known to prompt status cataplecticus in narcoleptic patients (Wang and Greenberg, 2013).

1.2.4 Treatment of Cataplexy

At this time, cataplexy cannot be cured, but it can be managed by several medications

(Klimova et al., 2016). The current best treatment strategy for cataplexy is sodium oxybate, a

Figure 1.4. An example of a narcoleptic patient experiencing a cataplexy attack. Screenshots from a video clip taken over a two-minute period accompanied by brain and muscle recordings. The patient suffers from a persistent loss of muscle tone that alternates with brief periods of muscle activity (EMG activity) which leads to a fluttering and jerking of body movement. These movements were voluntary and occurred due to the patient attempting to fight the abrupt muscle paralysis that ensued during the cataplexy attack. The patient remained conscious throughout the episode. Abbreviations: ECG, electrocardiogram; EMG, electromyogram; EOGD, right electrooculogram; EOGG, left electrooculogram. Modified from Dauvilliers, Siegel, Lopez, Torontali & Peever (2014)

gamma-hydroxybutyric acid B-subtype (GABAb) receptor agonist (Lammers et al., 1993; Mayer

et al., 2017; Steffen et al., 2017). It is taken in two separate doses at night-time and reduces the

number and severity of cataplexy episodes during the subsequent day. It is only approved for use

in adults but ongoing clinical trials are assessing its safety in children (Barker et al., 2017). R-

baclofen is another GABAB agonist and has shown to be effective in reducing cataplexy in mice –

even more so than sodium oxybate (Black et al., 2014; Black et al., 2017). However, further studies

need to assess its effectiveness in humans. Physicians often prescribe antidepressants off-label to

treat cataplexy (Mignot, 2014). The most common is venlafaxine, a noradrenaline-serotonin

reuptake inhibitor, which currently has no scientific studies on its efficacy with respect to cataplexy

(Kallweit and Bassetti, 2017). Tricyclic antidepressants such as clomipramine have been effective

in both humans and mice, as well as selective serotonergic reuptake inhibitors like fluoxetine and

citalopram (Schachter and Parkes, 1980). Thyrotropin-releasing hormone analogs have been

shown to reduce cataplexy in canine animals (Nishino et al., 1997). Pitolisant, a wake-promoting agent, and has shown some effectiveness in reducing cataplexy but further studies are needed to fully assess this drug (Calik, 2017).

Immunomodulators and immunosuppressors are an area of ongoing investigation due to

the hypothesis that narcolepsy-cataplexy may be an autoimmune disorder (Dauvilliers et al., 2009;

Knudsen et al., 2010). There was one case where improvements to narcoleptic symptoms and

cataplexy occurred following intravenous immunoglobulins, however most studies investigating

this strategy resulted in negative or temporary effects (Knudsen et al., 2010). Finally, some

promising research has recently been published in animal models using an adeno-associated virus to deliver the hypocretin gene into neurons and thereby rescue hypocretin expression in the lateral hypothalamus (Liu et al., 2011). This strategy was found to inhibit cataplexy onset in orexin/ataxin-3 mice (Liu et al., 2011). Furthermore, adding the prepro-hypocretin gene into the

16 dorsolateral pons in hypocretin knockout mice decreased cataplexy (Blanco-Centurion et al.,

2013). While gene therapy, cell transplants, and immune system modulation are promising area of treatments, further investigation is required before any of these can be translated into everyday clinical use (Arias-Carrion and Murillo-Rodriguez, 2014).

1.3 Animal Models and Pathophysiology

Sleep is a multifaceted process of which the physiology has not been fully characterized

(Brown et al., 2012). Disorders of sleep complicate the understanding of physiological processes even further. To aid in the understanding of these complicated physiological and neurophysiological processes animal models are used. Animal models allow the investigation and reverse engineering of the core physiology associated with sleep and its disorders (Burgess and

Peever, 2013). This in turn permits the identification of failures within the physiology and development of therapeutic approaches to correct those failures. This section will review animal models of narcolepsy with special attention paid to the mouse model used in this thesis.

1.3.1 Canine Model of Cataplexy

Cataplexy has been recognized in multiple narcoleptic canine breeds, but the Doberman pinschers and Labrador retrievers have been the main breeds used in canine narcolepsy research

(Mignot, 2014). Cataplexy in dogs can involve partial or full collapse and can be evoked through copulation, palatable food, or play with other dogs – similar to emotional cues that trigger cataplexy in humans (Nishino and Mignot, 1997). The episodes last from tens of seconds to 30 minutes (Mignot, 2014). Behaviourally the cataplexy is similar to human cataplexy as the animal presents with muscle paralysis (Figure 1.5), wake-like cortical activity, eyes that track objects, and often transition from cataplexy into REM sleep (Nishino et al., 1990; Nishino et al., 1991; Mignot et al., 1993; Siegel et al., 1999; Wu et al., 1999).

This model was essential to our understanding of narcolepsy as well as cataplexy. The

inheritance pattern of narcolepsy in canines suggested an autosomal recessive mode of

transmission in contrast to humans, in which no clear inheritance pattern has been identified (Lin

et al., 1999). While human narcolepsy was not autosomal recessive, it did lead Lin et al., (1999)

to further explore the genetic aspects of narcolepsy. This investigation revealed that the

hypocretin-2 receptor was non-functional due to a distinct exon splicing mutation (Lin et al., 1999).

1.3.2 Mouse Models of Cataplexy

Mouse models have also been instrumental in elucidating the fundamental mechanisms

mediating the symptoms of narcolepsy including cataplexy. While cataplexy has not been fully

characterized, the last 19 years of rodent research has helped refine our understanding of the

neurobiology and neural circuits mediating this disease (See Contemporary Model and

Hypothesized Circuits of Cataplexy). There are three categories of mouse models: ligand knockout

models, receptor knockout models, and neurodegenerative models (See Table 1.1).

After identification of the prepro-hypocretin (prepro-orexin) gene, a transgenic mouse model was generated to lack the pre-pro-hypocretin gene (Chemelli et al., 1999). To do this exon

1 of the prepro-hypocretin gene was replaced with a nuclear lacZ/neomycin resistance cassette

(Further details can be found in Chemelli et al., 1999) (Chemelli et al., 1999). Since the prepro- hypocretin gene is the precursor to both the hypocretin-1 and hypocretin-2 ligands, excising this gene completely prevents hypocretin neurotransmission in the model and effectively creates a hypocretin (orexin) knockout mouse (Chemelli et al., 1999). Chemelli et al., (1999) verified excision of the gene and disrupted hypocretin neurotransmission using in situ hybridization, immunohistochemistry and radioimmunoassay of homozygous mutant mice brains failed to detect either hypocretin-1 or hypocretin-2 peptides.

Figure 1.5. An example of canine cataplexy. Canine model of narcolepsy exhibits cataplexy due to a non-functional hypocretin-2 receptor. This figure demonstrates the stages of canine cataplexy in response to palatable food. It is similar to human cataplexy, beginning with rapid and sporadic breaks in muscle control that transition into a more extensive period of paralysis whereby the animal becomes immobile. Adapted from Nishino & Mignot, 1997.

This transgenic mouse model was found to recapitulate many other features of human

narcolepsy: inability to maintain long periods of wakefulness, transitions to REM sleep from

wakefulness, reduced latency to REM sleep episodes, and overall increased REM sleep time during

the dark phase (the period of time where mice are more active) (Chemelli et al., 1999; Mochizuki

et al., 2004; Oishi et al., 2013). Furthermore, these mice exhibited cataplexy (Mochizuki et al.,

2004). However, Chemelli et al., (1999) originally termed the cataplexy episodes “narcoleptic

episodes” or “behavioral arrests”. This was primarily because the original paper did not use

electromyography to measure muscle tone during the episode (Chemelli et al., 1999). However, follow-up studies demonstrated that these episodes were indeed cataplexy because they could be encouraged with an emotional stimulus (as seen in humans) like palatable food (hersey kisses)

(Oishi et al., 2013). Additionally, it was also demonstrated through electrophysiological measures that both theta dominated activity in the electroencephalogram and muscle paralysis occurred during the episode (Mochizuki et al., 2004; Burgess et al., 2010; Burgess and Peever, 2013).

Furthermore, animals tended to resume the behavior they were doing prior to the interruption of a cataplexy attack (Burgess et al., 2010). This led to the first established mouse model of cataplexy.

One advantage to this mouse model is the hypocretin cells remain intact (Chemelli et al., 1999).

This is important because it does not impair transmission of other neurotransmitters that are released from hypocretin cells (i.e. glutamate, dynorphins and neurotensis) (Chou et al., 2001;

Rosin et al., 2003; Furutani et al., 2013).

Hypocretin neurotransmission can be impaired by removing the in vivo expression of hypocretin receptors, the strategy employed in hypocretin receptor knockout models (Willie et al.,

2003). Mouse models have been generated that either lack just one of the two receptors

(hypocretin-2 deficient mice), or both receptors (hypocretin-1/hypocretin-2 or OX1R/OX2R

double knockout mice) (Willie et al., 2003; Soya et al., 2013). Hypocretin-1 knockouts are not

used frequently in literature, and it may be due to the fact that they do not exhibit cataplexy and

changes to their sleep and wake architecture is relatively underwhelming (Nishino and Sakurai,

2005). The hypocretin-2 receptor knockout animal has very limited presentation of cataplexy and

fewer impairments in overall sleep/wake architecture compared to the prepro-hypocretin model discussed earlier (Nishino and Sakurai, 2005). Willie et al., (2003) demonstrated that the double knockout mouse exhibits cataplexy and has sleep/wake impairments nearly identical to the prepro- hypocretin mouse.

As mentioned previously, human narcolepsy is thought to result from an autoimmune progressive degeneration of neurons (Thannickal et al., 2000). Attempts to replicate this pathological process have been made in three additional mice models. The first utilizes the prepro- hypocretin promoter for the expression of ataxin-3, which when expressed in neurons induces apoptosis (Yoshizawa et al., 2000; Hara et al., 2001). Postnatal mice have reduced numbers of hypocretin neurons compared to wildtypes and within 12 weeks have almost complete loss of hypocretin neurons. In another model, hypocretin-TTA;TetO DTA mouse, a Tet-off system is used to control expression of the diphtheria toxin (DTA) (Tabuchi et al., 2014). Mice are initially maintained on a diet containing the antibiotic doxycycline, but are eventually switched to a regular diet, enabling DTA to be expressed in hypocretin neurons. After 7 days, 80% of hypocretin neurons are rendered non-functional (Tabuchi et al., 2014). The third, most recent mouse model was developed to investigate the specific mechanisms by which the H1N1 infection may give rise to hypocretin cell loss in narcolepsy (Bernard-Valnet et al., 2016). In this mouse line, hypocretin neurons were genetically modified to express the H1N1 influenza virus hemagglutinin protein as a neo-self-antigen (Bernard-Valnet et al., 2016). This antigen could then be recognized by host cytotoxic T cells, which subsequently destroyed hypocretin neurons. When injections of cytotoxic

T cells were administered cataplexy and sleep attacks occurred within 8 weeks (Bernard-Valnet et al., 2016).

With the exception of the hypocretin-1 receptor mice knockouts, all the mouse models reviewed here express cataplexy in striking similarity to that seen in the human condition.

However, when choosing a model it is important to note that the TetOff mouse model requires less than 5 percent of orexin neurons to remain before cataplexy occurs and degenerative models require an amount of time before peak onset of cataplexy attacks occur (Tabuchi et al., 2014).

Cataplexy in each of the models are characterized by an abrupt loss in muscle tone that ranges from 10 seconds to 2 minutes in length, and are often preceded by a period of gait ataxia prior

(Scammell et al., 2009). Furthermore, just as positive emotions can trigger cataplexy in humans, rewarding behaviors (e.g. wheel running, grooming, group housing social interaction) and palatable foods (e.g. chocolate: Hershey kisses) also trigger episodes in mice (Espana et al., 2007;

Burgess et al., 2013).

1.4 Rapid Eye Movement Sleep

1.4.1 Transections: Substantiating REM sleep as a state and the duality of sleep

While Kleitman and his team started to unravel the presence of REM sleep in humans, a

French researcher, Michel Jouvet, was pursuing ground-breaking work that highlighted the brainstem’s role in arousal states using cats (Aserinksy and Kleitman, 1953). Jouvet and his team noticed recurring intervals of complete withdrawal of muscle activity during sleep (Jouvet and

Michel, 1959). These periods, which he termed paradoxical sleep due to the cortical activity resembling wake despite motor paralysis, were akin to what Dement and his team assessed as REM sleep in human participants (Jouvet and Michel, 1959). The early work of uncovering the brain regions responsible for

Table 1.1. Summary of mouse models used to investigate narcolepsy and cataplexy

Model Sleep Disrupted Cataplexy Cataplexy Onset Attacks Sleep/Wake Architecture

Prepro-hypocretin present 5 episodes / 3hr Early, < 3 weeks of knockout yes age Ligand Knockout

Hypocretin-1 present yes no no onset receptor knockout Hypocretin-2 present yes <5 episodes / 4 hr, early receptor knockout no EEG and EMG only video

Abrupt arrests data Receptor Knockout Receptor shown Hypocretin/ataxin- present yes Hypocretin loss 3 6.7 episodes / 12hr begins at 6 weeks ~2 episodes /3hr age

Hypocretin-tTA; present yes increases over time Delayed. Only after TetO DTA 5% hypocretin cells

Removal of dox food at remain 10 weeks†, and cataplexy at 11 weeks 56 episodes /12hr 14 episodes /3hr Degenerative

Orex-HA mice with present Not 2 episodes in 24 hours Hypocretin loss at 8 cytotoxic CD8 T discussed in weeks of age cells paper Can be increased with repeated cytotoxic CD8 T cells injection

†DOX food, which initiates the cell death, was removed at 10 weeks. Also, if animals were off dox from birth they had less severe cataplexy episodes than if having dox removed at 10weeks.

generating different behavioral states was done by isolating brain regions through either resection or transection (See Figure 1.6). These cuts sever the connections that would otherwise exist rostral

and caudally through the cut. In a series of papers using a combination of intact, decorticated,

ablated cerebellar, and transected cat preparations, Jouvet elucidated the sites responsible for generating paradoxical sleep (Jouvet, 1962, 1965; Sastre and Jouvet, 1979). Specifically, he found that paradoxical sleep would only occur if the brainstem was intact, as transections separating the brainstem from the forebrain left slow wave activity, but no recognizable REM sleep activity in forebrain recordings (Jouvet, 1962). Measured responses that occurred caudal to the transection

(midbrain and brainstem recordings) were cyclical episodes of muscle paralysis, constricted pupils and PGO waves (Jouvet, 1962, 1965). PGO waves are defined as the neural activity that can be recorded from the pons (where they originate) or in either the lateral geniculate nucleus or the

occipital cortex of the brain (where these waves propagate to) (Steriade et al., 1989; Marks et al.,

1999). These waves have been defined as one of the physiological correlates of REM sleep as they

are most obvious just prior to the REM sleep period and have been linked to dreaming (Steriade

et al., 1989; Marks et al., 1999).

Researchers continued to make transections in the caudal direction to ascertain whether a

specific REM sleep zone existed (Siegel et al., 1984). A transection caudal to the pons, separating

it and the entire rostral portion of the brain from the medulla, demonstrated no detectable REM

sleep in the medullary region (Siegel et al., 1984). Electrical and chemical stimulation targeted to

the medullary region resulted in muscle paralysis and therefore, it was a striking finding that

transections separating the pons from the medulla result in a lack of muscle paralysis (Lai and

Siegel, 1988). Thus, while the machinery for triggering muscle paralysis appeared to be in the

medulla, and periods of paralysis did not appear in cyclical periods when the medulla was isolated

from the pons (Siegel et al., 1984). However, recordings within this same preparation did show

REM sleep features in the pons and other areas rostral to the transection (Siegel et al., 1984). After isolating the pons with two transactions REM sleep characteristics were only present when recording from the pons (Siegel et al., 1984). While the pons itself does not generate all REM sleep phenomena, this isolated pons demonstrated that it was a critical area to the existence of the state since without it, REM sleep would not transpire (Matsuzaki, 1969).

1.4.2 Neurotransmitters within the SLD pontine region regulating behavior

Both transection and lesion experiments demonstrated that the pontine region is an integral

regulator of both the REM sleep state and paralysis of REM sleep (Hendricks et al., 1982; Shouse

and Siegel, 1992). Further evidence of the pons’ role in REM sleep came from pharmacological

studies. Some of the earliest studies were conducted by George et al., 1964, who demonstrated that injection of the cholinergic agonist carbachol into the cat pons could produce prolonged REM sleep-like states associated with muscle paralysis, rapid eye movements, and high-frequency low- amplitude cortical activity, which began within 5 minutes of carbachol administration. Studies over the next two decades continued to reveal that bilateral injection of cholinergic agonists into the dorsolateral pontine region could modulate REM sleep (George et al., 1964; Baghdoyan et al.,

1984b; Baghdoyan et al., 1984a; Gnadt and Pegram, 1986). While different studies use different nomenclature to describe the region being targeted, most involved regions that, when lesioned, suppressed REM sleep, and encompassed the area now known as the SLD nucleus (See Figure

1.7) (Valencia Garcia et al., 2017). The SLD nucleus is a functionally heterogeneous and complex region and therefore, administration of pharmacological agents lead to a variety of behavioral effects (Gnadt and Pegram, 1986; Vanni-Mercier et al., 1989; Lopez-Rodriguez et al., 1994;

Deurveilher et al., 1997; Boissard et al., 2002; Pollock and Mistlberger, 2003).

Figure 1.6. Displaying the transections made in cats that assisted in localizing the brain area controlling REM sleep. Transections A-F maintained REM sleep characteristics when recording from more caudal areas. Recordings rostral to these transections did not reveal REM sleep characteristics. REM sleep was eliminated from caudual recordings with transection G. The patterned area between F and G demonstrates where lesions in the cat pontine region eradicates REM sleep. Numbers +10 and -10 designate the planes of Horsley-Clarke Stereotaxic Apparatus. Cranial nerve nuclei are depicted by roman numerals. Abbreviations: trapezoid body, ct; red nucleus, nr; mammillary body, cm; interpeduncular nucleus, nip. Adapted from Jouvet 1962 and Jouvet 1979.

Microinjection of cholinergic agonists into the rodent pons can also induce REM sleep, but

with prolonged latency compared to the cat and with more modest increases in overall REM sleep

amount (George et al., 1964; Hobson et al., 1983; Gnadt and Pegram, 1986; Vanni-Mercier et al.,

1989; Bourgin et al., 1995; Garzon et al., 1998). Other experiments resulted in a mixed state consisting of a wakefulness-like EEG rhythm but REM sleep-like muscle paralysis was engaged

(Mitler and Dement, 1974; van Dongen, 1980; Baghdoyan et al., 1984b; Baghdoyan et al., 1984a;

Gnadt and Pegram, 1986; Mastrangelo et al., 1994; Deurveilher et al., 1997). Bossiard et al., (2002) demonstrated that cholinergic agonists into the SLD nucleus resulted in wakefulness and not REM sleep. Even more peculiar is that Deurveilher et al., (1997) showed that injections of carbachol into the rodent SLD nucleus most often produced prolonged wakefulness, no effect, or in rare occasions REM sleep.

Over the last two decades there has been a gradual paradigm shift from a cholinergic role to a GABA-glutamate role with respect to the induction of the REM sleep state. Cholinergic mechanisms were originally associated with the REM sleep state due to application of cholinergic agonists, either systemically or via microinjection into the pons, producing enhanced REM sleep durations (Kubin, 2001). While the literature agrees that cholinergic mechanisms participate in

REM sleep, the onset delay has cast doubt on its role for state induction (Van Dort et al., 2015).

Further doubt regarding the effectiveness of cholinergic mechanisms as inducers of the REM sleep

state was demonstrated by Grace et al., 2014 where antagonism of muscarinic acetylcholine receptors in the SLD nucleus produced no effect on the frequency of REM sleep muscle activity.

However, this blockade of cholinergic receptors did reduce the number of successful transitions into REM sleep (Grace et al., 2014). Taken together, this work suggested that cholinergic mechanisms are not responsible for the induction of REM sleep, rather, this mechanism serves a

modulatory role to support and promote the REM sleep state after induction has occurred (Grace

et al., 2014).

Evidence for the SLD nucleus’s sensitivity to glutamate comes from experiments where

REM sleep active neurons of the SLD increased their firing rate in response to the glutamate

agonist, kainic acid (Boissard et al., 2002). Iontophoretic application of this glutamatergic agonist also induced REM sleep-like state (Boissard et al., 2002). Iontophoretic application of a glutamate

antagonist, kynurenate, reversed this REM sleep-like state suggesting a glutamate mediated role

for REM sleep induction in the SLD (Onoe and Sakai, 1995). The origin of the glutamatergic input

onto the SLD neurons is currently not known but suspected to arise from non-GABAergic afferents

of the VLPAG and LPT (Boissard et al., 2003).

The SLD nucleus has also been shown to be sensitive to GABAergic input (Boissard et al.,

2003). Antagonism of GABAergic (biciculline, gabazine, antisense GAD) signalling within the

SLD induced REM sleep in both head-restrained and freely moving animals (Xi et al., 1999a;

Boissard et al., 2003; Pollock and Mistlberger, 2003). Neurons found to be active during REM

sleep also increased in response to iontophoresis of GABAergic antagonism (Boissard et al., 2003).

Wakefulness was produced in response to the presence of GABAergic agonists (muscimol or

baclofen) in the SLD nucleus (Xi et al., 1999b; Boissard et al., 2003; Sanford et al., 2003).

Investigations into understanding the origin of the inhibitory input onto the SLD nucleus used

retrograde tracing with cholera toxin B and demonstrated GABAergic innervation from the

ventrolateral periaqueduct grey, lateral pontine tegmentum and hypothalamic regions (See REM

sleep models) (Boissard et al., 2003). Taken together this suggested that REM sleep expression is

blocked by a GABAergic presence onto the SLD neurons functioning to suppress their neuronal

activity during wake and NREM sleep. Removal of this GABAergic tone allows activity of the

SLD neurons and the induction of REM sleep.

A consistent finding across studies and species is that the SLD promotes wakefulness,

REM sleep, or mixed states with features of both, but never NREM sleep (George et al., 1964;

Baghdoyan et al., 1984b; Gnadt and Pegram, 1986; Vanni-Mercier et al., 1989; Bourgin et al.,

1995; Kubin, 2001; Boissard et al., 2002; Torontali et al., 2014). While the transmitters involved, receptors or activation of cells may be different across species, the overall control center of this state remain universally within the sublaterodorsal tegmentum (Baghdoyan et al., 1984b; Gnadt and Pegram, 1986; Kimura et al., 2000; Lu et al., 2006). In some cases, dissociated states, such as wakefulness with REM sleep paralysis, were triggered (Mitler and Dement, 1974; Boissard et al.,

2003). These dissociated states suggest that the SLD nucleus is a major relay hub that can initiate multiple effectors of either wake or REM sleep states in addition to trigger the state as a whole.

Finally, while studies mostly describe the dissociated states produced after activation of the SLD nucleus as REM sleep-like states or wakefulness with motor paralysis it is important to note that these descriptions are the very definition of cataplexy (Scammell et al., 2009). Recently, due to

new toolkits available to neuroscience, studies are focused on teasing apart the cellular phenotypes

types responsible for particular behavioral states (Adamantidis et al., 2007; Carter et al., 2010;

Jego et al., 2013). Pharmacology discussed in this section did not allow for the targeting of selective cellular types and that is why current research and this thesis take advantage of chemogenetic and optogenetic toolkits to further decipher the cellular composition of this region

(See sections on REM sleep paralysis).

1.5 REM sleep muscle paralysis

A duality in the expression of motor activity exists during REM sleep: the stereotypical

tonic muscle paralysis punctuated by brief phasic events called twitches (Aserinsky and Kleitman,

1953; Mouret et al., 1967). Since the emphasis of this thesis is the paralysis of REM sleep and not

twitches, twitches will be explained in brief. REM sleep twitches are thought to be generated by

sporadic activation of motor neurons via glutamate release from the red nucleus, LDT, and PPT

(Gassel et al., 1966; Soja et al., 1995; Karlsson et al., 2005; Lim et al., 2007; Grace et al., 2012).

In fact, twitches progressively increase in activity throughout the REM sleep period with a limited amount in the first initial quarter of the period (Brooks and Peever, 2012; Brooks and Peever,

2016). Twitch activity is largely repressed by a surge of GABA and glycine onto the motor neurons, however, as the REM period progresses the release of GABA and glycine decreases and allows for excitatory input from the LDT,PPT and red nucleus to over-ride the active inhibition

(Brooks and Peever, 2016). Taken together, inhibitory transmission to the motor neuron dynamically forms the temporal pattern of muscle activity across a REM sleep episode (Brooks and Peever, 2016). This gradual decrease in inhibition increases twitch activity and suggests that regulatory loss of inhibitory drive could be at the root of REM sleep disorders (Brooks and Peever,

2012; Brooks and Peever, 2016).

The circuits mediating REM sleep paralysis are not yet fully characterized. As discussed previously, transections, lesions, cellular recordings, and pharmacological studies in both rats and cats demonstrated that the SLD nucleus in the pontine tegmentum is implicated in REM sleep motor control (Matsuzaki, 1969; Baghdoyan et al., 1984a; Boissard et al., 2002; Lu et al., 2006).

Indeed, further validation of the pons in REM sleep paralysis comes from multiple case reports of individuals suffering pathologies located in the pontine region (e.g. ischemic infarct, multiple sclerosis, cavernoma, encephalitis, lymphoma, neurinoma) (Culebras and Moore, 1989; Plazzi et al., 1996; Kimura et al., 2000; Zambelis et al., 2002; Provini et al., 2004; Gomez-Choco et al.,

2007; Mathis et al., 2007; Limousin et al., 2009; Xi and Luning, 2009; Jianhua et al., 2013). These pathologies produce an abnormal motor condition known as REM sleep behavior disorder, characterized by the presence of erratic gross motor behavior during REM sleep which can be so

dramatic that patients act out their dreams without waking up and may injure themselves or their

bed-partners (St Louis and Boeve, 2017). Thus, evidence strongly suggests that the pontine SLD nucleus lies at the core of the neural pathways that mediate REM sleep paralysis. However, we currently lack the knowledge of what mechanisms within the SLD engage the paralysis (Fraigne et al., 2015).

Careful dissection and deciphering of the cellular activity, cell types and efferent connections is vital in order to understand the role of the SLD nucleus in REM sleep paralysis.

The FOS protein is a biological marker of neural activity (Boissard et al., 2002). Researchers have used this protein and extracellular recordings to identify REM sleep active neurons within the SLD nucleus in animals following REM sleep rebound resulting from REM sleep deprivation (Sakai,

1986; Lu et al., 2006). Linking these techniques with staining for markers of specific cellular phenotypes, unveiled which types of neurons were active during REM sleep. In fact, this exact strategy demonstrated REM active neurons were not GABAergic or cholinergic (Verret et al.,

2005; Sapin et al., 2009). Rather, it was demonstrated that 85% of the neurons within the SLD that were active during REM sleep (based on FOS expression post REM sleep hypersomnia) expressed the glutamatergic marker, VGLUT2. Calcium imaging experiments support these findings and further confirm an active population of VGLUT2-expressing neurons in the SLD

nucleus during REM sleep (Cox et al., 2016). These data together implicated a role for glutamatergic neurons in REM sleep but failed to directly demonstrate their function.

Lu et al. (2006) functionally explored the role of SLD neurons in atonia by employing cell specific lesions with ibotenic acid into the SLD. Lesions of the SLD nucleus produced loss of

muscle paralysis in the majority of REM sleep episodes (Lu et al., 2006). During these REM sleep

episodes animals had jerking motions or lunging movements while remaining in the REM sleep

state (Lu et al., 2006). More recently, genetic inactivation of glutamate neurons in the SLD

demonstrated a loss of REM sleep paralysis (Valencia Garcia et al., 2017). Here, Valencia Garcia

et al., (2016) bilaterally targeted the SLD with an adeno-associated virus harboring short hairpin

RNAs against the SLC17a6 gene. This effectively and chronically prevented the glutamate

neurotransmission from occurring. Following this intervention, Valencia Garcia et al., (2016) reported “a tremendous increase of abnormal motor behaviors, a nearly total loss of muscle atonia

during paradoxical sleep” (Valencia Garcia et al., 2017). Taken together, there has been strong

evidence for the glutamatergic neurons in the control of REM sleep paralysis.

Most groups studying REM sleep paralysis are in agreement that the glutamatergic neurons

in the SLD function to control muscle paralysis, however, Luppi’s group (Lyon) and Lu and

Saper’s group (Boston) differ in the efferent connections the SLD neurons use to trigger paralysis

(Boissard et al., 2003; Lu et al., 2006). The GABA and glycine premotor neurons situated within

medial medulla has been largely implicated in generating muscle paralysis (Sakai, 1986; Holmes

and Jones, 1994; Vetrivelan et al., 2009). Injections of non-NMDA glutamate agonists into the

medullary region eradicated REM sleep paralysis, whereas increases in muscle tone were found

after cytotoxic lesioning of the medulla (Lai and Siegel, 1991; Holmes and Jones, 1994). Also, the

combination of extracellular recording and antidromic activation identified projections from REM

sleep active SLD neurons to the medulla (Kanamori et al., 1980). This connection has been

supported by the finding from Boissard et al., (2002), who used tracing techniques (anterograde:

phaseolus vulgaris leucoagglutinin or retrograde: cholera toxin B subunit) to show that SLD

neurons project onto GABA and glycinergic neurons of the medial medulla. They further

demonstrated a functional connection between these regions by demonstrating increased activity

in medial medulla neurons in response to pharmacological SLD activation (Boissard et al., 2002).

Finally, using short-hairpin RNAs against the vesicular transporter for GABA and glycine, VGAT,

local knock down of GABA/glycine transmission in the medial medulla was compromised and

resulted in loss of muscle paralysis during REM sleep (Valencia Garcia et al., 2018). This suggests

that the medial medulla is capable of inhibiting skeletal motor neurons with GABA/Glycine

neurotransmission. Elevated glutamate release was found in the medial medulla during REM sleep

which implicated a role for glutmate released from the SLD but no direct functional evidence had

demonstrated the two-part SLD nucleus to medial medulla circuit controls REM sleep paralysis

(Kodama et al., 1998).

Two schools of thought have emerged regarding the control of REM sleep paralysis due to

a lack of direct functional connections between the SLD and medial medulla. The Lu and Saper

group does not agree that the medulla is exerting the muscle paralysis through communication

with the glutamatergic SLD neurons (Lu et al., 2006). This stems from work by Sastre et al., (1981)

demonstrating large lesions encompassing the medulla failed to affect muscle paralysis of REM

sleep. Further support comes from the Saper groups investigations of the SLD nucleus projections.

Tracing studies demonstrated that the SLD nucleus projects to both the medial medulla and spinal cord (Lu et al., 2006; Weng et al., 2014). However, lesions of the medial medulla using cell- specific toxin orexin B-saporin failed to affect REM sleep paralysis (Lu et al., 2006). This led Lu et al. (2006) to speculate that it was the direct SLD-spinal projections that produced REM sleep paralysis. A few years later a follow-up study provided support for this hypothesis as the removal of GABA/Glycine transmission in the ventral horn of the spinal cord resulted in REM sleep without muscle paralysis (Krenzer et al., 2011). Furthermore, both optogenetic inhibition of

GABA neurons or removal of GABA neurons (using a transgenic mouse model) in the ventral medulla failed to produce REM sleep without atonia (Vetrivelan et al., 2009; Weber et al., 2015).

The ventromedial medulla is a large area, and it can be argued that the reason for the difference in results stems from targeting different populations of neurons. For example, the targeting of Weber et al., (2015) appears to be far more ventral and lateral compared to the more medial localization

of Valencia Garcia et al., (2016). Valencia Garcia et al. (2016) submit support of this conclusion

by pointing out that Weber et al. (2015) mention the transfected neurons projected to the LC, and

Luppi’s group has previously shown that the more ventrolateral regions project to the LC, whereas

the ventromedial portions they targeted project to the spinal motor neurons.

Due to a lack of functional evidence and debate amongst the sleep field, our laboratory

took a unique approach to investigate the descending pathway mediating REM sleep paralysis.

Unpublished findings by Fraigne and myself have demonstrated that optogenetic activation of

glutamatergic SLD neurons reduced overall motor activity during REM sleep bouts. Furthermore,

activation of glutamatergic SLD neurons induced cFos expression, a marker of neuronal activity,

in both the SLD nucleus and the medial medulla. An advantage to optogenetics is the ability to target specific pathways from the injection site (Parker et al., 2016). This is achieved by placing optic fibers in the target location (Parker et al., 2016). Since the opsins are expressed throughout the neuron, optogenetic activation of the terminals is a powerful method to tease apart the specific circuit connections between brain regions (Parker et al., 2016). Using this methodology, the SLD was transfected with an inhibitory opsin, ARCH. Selective stimulation of the SLD afferents terminating in the ventral medial medulla, which were expressing the inhibitory opsin, resulted in an overall increase in motor activity. Taken together, these results verified that muscle paralysis of REM sleep is engaged through the two-part SLD to ventral medial medulla brainstem circuit

(See Figure 1.8).

While the debate continues surrounding the descending pathways of SLD neurons as direct spinal projections to motor neurons or an intermediate projection to motor neurons through the medullary region, all researchers agree that the pathways terminate onto motor neurons (Lai and

Siegel, 1988; Boissard et al., 2003; Lu et al., 2006). Recordings of both trigeminal and lumbar motor neurons have been accomplished using chronic head-restrained cats, microiontophoresis

and intracellular recordings. Using these techniques, it was demonstrated that REM sleep causes

hyperpolarization of motor neurons through a glycinergic mechanism (Nakamura et al., 1978;

Morales and Chase, 1981; Soja et al., 1991; Morales et al., 2006). Microdialysis sampling at motor

neurons during carbachol-induced REM sleep showed both GABA and glycine were released onto

motor neurons (Lai et al., 2001; Morales et al., 2006). Understanding of motor neuron inhibition during REM sleep was further developed through elaborate experiments using reverse microdialysis and receptor pharmacology. Using this technique, inhibitory drive onto motor neurons during REM sleep was found to be mediated through a combination of GABAA, GABAB,

glycine and muscarinic receptors (Brooks and Peever, 2012; Grace et al., 2013). During REM

sleep, there is also disfacilitation of excitatory inputs to the motor neurons (Siegel and Rogawski,

1988). Specifically, noradrenergic and serotonergic input has been shown to play a tonic role in

muscle activity during wakefulness and NREM sleep, and reductions in this input occurs during

REM sleep (Lai et al., 2001).

Therefore, the current hypothesis of REM sleep paralysis involves activation of

glutamatergic SLD neurons which excites GABA/glycinergic cells in the medulla and direct

excitation of the spinal interneurons. This in conjunction with the decrease of excitatory input from

monoaminergic brain regions onto motor neurons (disfacilitation) during the REM sleep state

allows for the suppression of muscle tone during REM sleep (See Figure 1.9).

1.5.1 Defining the location of the SLD Previous studies have used different nomenclature when describing the REM sleep

modulating area in the dorsolateral pons, such as peri-LCα, subcoeruleus, pontine inhibitory area,

nucleus reticularis pontis oralis and sublaterodorsal tegmental nucleus. In this thesis, I use the term

sublaterodorsal tegmentum (SLD) and chose to use a conservative definition of the SLD nucleus

based on the location shown by Lu et al., 2006 and Boissard et al., 2002. Thus, I have defined the

SLD nucleus to be located ventral to the locus coeruleus, medial to the trigeminal motor nucleus

and extending from the emergence of the trigeminal motor nucleus (most rostral part of the SLD)

to the facial nerve (most caudal part of the SLD) (See Figure 1.7). This location encompasses the

region where lesion studies were found to have the greatest effect on sleep. Specifically, lesion

studies of this region disrupted REM sleep expression and REM sleep paralysis contained the majority of REM sleep active neurons in rodents, and where pharmacological modulation was found to modulate REM sleep expression in rodents (Peever et al., 2014).

1.6 REM sleep intrusion hypothesis

Narcoleptics repeatedly transition directly into REM sleep from wakefulness, which is rare

for healthy individuals (Oudiette et al., 2018). Narcoleptics suffering from a cataplexy attack have

been known to transition directly into REM sleep (Pillen et al., 2017). Additionally, medications

that alleviate cataplexy diminish the expression of REM sleep. The abrupt termination of these

medications can lead to REM sleep rebound and status cataplecticus, a prolonged single or series

of cataplexy attacks (Overeem et al., 2001; Broderick and Guilleminault, 2009; Ristanovic et al.,

2009). Narcoleptics also suffer from hypnagogic hallucinations (vivid dream-like hallucinations)

and sleep paralysis (abnormal paralysis of skeletal muscles) during transitions to and from sleep

(Dauvilliers et al., 2014). They are thought to stem from abnormal REM sleep control, representing

the vivid dreams and muscle paralysis normally associated with REM sleep features (Jalal and

Hinton, 2015). Pharmacological treatments effective against hypnagogic hallucinations and sleep

paralysis also reduce REM sleep (Vogel, 1975; Moller and Ostergaard, 2009; Abad and

Guilleminault, 2017). Shared physiological processes exist between both REM sleep and cataplexy

SLD

MO5 7n

Rostral Caudal

Figure 1.7. The location of the SLD nucleus within the dorsolateral pons. The shaded regions (red) represents the area of the SLD nucleus based on the experiments from Lu et al., 2006 and Boissard et al., 2002 . Note that these shaded regions are inclusive of REM sleep active neurons and represent the region where lesion and pharmacological studies produced the greatest manipulations in the expression of REM sleep and REM sleep motor control. Abbreviations: SLD, sublaterodorsal tegmentum; MO5, trigeminal motor nucleus; 7n, facial nerve.

Figure 1.8. Glutamate neurons of the sublaterodorsal tegmentum (SLD) are responsible for generating REM sleep paralysis through downstream projections to the medulla. A. Electrophysiological examples of REM sleep under control conditions and under optogenetic activation of glutamatergic SLD neurons. Note the decrease in overall muscle activity after activation of the SLD nucleus. Group data (mean+SEM) demonstrating that activation of SLD glutamate cells decreased motor activity during REM sleep. B. Activation of SLD glutamate cells expressing ChETA resulted in a strong expression of c-fos in the SLD nucleus and within its downstream target, the ventromedial Medulla, indicating a functional two part brainstem circuit. C. SLD neurons that expressed ARCH receptors had terminals in the ventromedial medulla. D. Selective inhibition of SLD terminals in the ventromedial medulla blocked glutamate release and increased motor activity to levels above REM sleep atonia seen during baseline condition. *p<0.05 **p<0.01 indicates significant difference compared to control. Unpublished findings by Fraigne, Torontali & Peever

SLD

Figure 1.9. Circuit schematic detailing the pathways that govern motor control during REM sleep. The paralysis of REM sleep is triggered when REM sleep active neurons of the SLD nucleus activate cells in the ventromedial medulla (VMM). The VMM neurons send inhibitory GABAergic/glycinergic projections to motor neurons. This inhibition from the VMM in combination with disfacilitation from monoaminergic (regions not shown) produces suppression in muscle tone limiting twitches and gross motor behaviors. The lower inset illustrates the brain (EEG) and muscle (EMG) activity during REM sleep in a healthy mouse (left) vs. a transgenic mouse model of RBD (right) Abbreviations: GABA, γ-aminobutyric acid; VMM, ventral medial medulla; SLD, sublaterodorsal tegmentum; vlPAG, ventrolateral periaqueductal gray; MNs, motoneurons; RN, red nucleus; EEG, electroencephalogram; EMG, electromyogram. Adapted from Fraigne, Torontali, Snow and Peever 2015 and from Brooks and Peever 2011.

as both states lack deep tendon and monosynaptic Hoffmann reflex (Guilleminault et al., 1974;

Dauvilliers et al., 2003; Overeem et al., 2004). Taken together, this evidence suggests that narcolepsy and cataplexy could be a disease of inappropriate REM sleep state control. Studies have

demonstrated certain brain regions during have similar levels activity during both cataplexy and

REM sleep which suggests that a common neural circuit may exist between the two phenomena.

In narcoleptic dogs, the LC cellular activity is maximal during wakefulness but it is heavily

attenuated in both REM sleep and cataplexy (Wu et al., 1999). The ventral medulla and the

amygdala are two regions which have demonstrated similar neural activity profiles during both

REM sleep and cataplexy See REM sleep muscle paralysis section (Siegel et al., 1991) (Hong et

al., 2006; Snow et al 2017).

As strong emotional cues are known to trigger cataplexy, it was hypothesized that the

amygdala is a key region in the control of cataplexy (Siegel et al., 1999; Snow et al., 2017).

Recordings in narcoleptic canines have demonstrated that the amygdala becomes active just prior

to cataplexy and single-photon emission computed tomography analysis demonstrates the

amygdala is active during both REM sleep and cataplexy (Gulyani et al., 2002; Hong et al., 2006).

An elegant set of experiments demonstrated that activation of GABAergic amygdala neurons

increased the amount of cataplexy whereas, inhibition reduced the amount of cataplexy episodes.

(Mahoney et al., 2017; Snow et al., 2017). Both publications hypothesize that GABAergic neurons

produce inhibition of brain regions serving to stabilize motor activity (i.e. locus coeruleus) as well

as inhibit key brain regions that suppress the activity of the SLD. From here, the hypothesis submits

that disinhibition of the SLD during wakefulness allows SLD cells to engage REM sleep atonia

pathway and trigger paralysis. Thus, there is a link between the structures that are involved with

REM sleep that may be functioning inappropriately to engage the state at the wrong time. This can

lead to the dissociated states whereby aspects of REM sleep superimpose onto wakefulness.

1.6.1 The SLD nucleus and REM sleep intrusion hypothesis

A cardinal feature of both REM sleep and cataplexy is muscle paralysis. A long-standing

hypothesis in the field advocates that cataplexy results from REM sleep paralysis seeping into

wakefulness by virtue of a possible shared circuitry between the two states. As described previously, REM sleep paralysis is generated by a two-component circuit in the brainstem

consisting of the SLD nucleus and the ventromedial medulla (Dauvilliers et al., 2014). Previous

research has demonstrated that manipulation of the SLD nucleus (See section REM sleep sections)

results in modulations of REM sleep paralysis (George et al., 1964; Hendricks et al., 1982; Lu et

al., 2006), and often produces dissociated states possessing some features of REM sleep. These

dissociated states, while sharing similarities to normal REM sleep, are better described as an

amalgamation between wakefulness and REM sleep paralysis, since the paralysis is being evoked

inappropriately during the wake state, which also describes cataplexy. The glutamatergic neurons

within the SLD nucleus have been implicated in the REM sleep paralysis circuit and, therefore,

the hypothesis of this thesis posits that cataplexy is triggered by these same glutamatergic neurons

that control REM sleep paralysis (Valencia Garcia et al., 2017).

1.6.2 The neurobiology of cataplexy

In the 1800s, Gelineau suspected sex and emotional situations lead to a decrease in

oxygenation of the pontine region and overall energy of the brain (Schenck et al., 2007). While

incorrect about the oxygenation, he was correct about the pontine region’s role in cataplexy. For

the next hundred years no major advances in the neurobiology of cataplexy occurred. However,

by the late 1950s, work by Michel Jouvet started the investigation of pontine monoaminergic and

cholinergic mechanisms of sleep and wakefulness (Jouvet and Michel, 1959; Jouvet, 1962, 1965;

Jouvet et al., 1965). This work was important to the pathophysiology of cataplexy because it began

the identification of brain structures and associated neurotransmitters important in the control

sleep, wake and motor control. More importantly, it spawned multiple follow up studies

investigating the role of the cholinergic mechanisms within the pontine region (George et al., 1964;

Karczmar et al., 1970; van Dongen, 1980). Many of these experiments resulted in cyclical or prolonged periods of motor inhibition leading most authors to conclude it was a REM sleep-like

state or periods of motor inhibition during wakefulness (Vanni-Mercier et al., 1989). However,

Mitler and Dement decided to re-evaluate the classification in the prior publications as they

thought the REM-like sleep periods were reminiscent of cataplexy (Mitler and Dement, 1974).

When cholinergic compounds were perfused into the SLD nucleus animals transitioned into an

immobile and flaccid state reminiscent of cataplexy (Mitler and Dement, 1974). After this initial

atonic episode, the animals would cycle between wakefulness and states of muscle loss. While this

behavior appeared similar to REM sleep, the authors note that the cat was indeed awake and

concluded that a descending motor inhibitory pathway involving the pontine reticular formation

resulted in cataplexy. Twenty years later, Micheal Chase's group published a paper using similar

methodology and stated that cataplexy results from an increase in the cholinergic activity in the

SLD while the animal is awake and thus, cataplexy is a consequence of dysfunctional REM sleep

motor circuits (Lopez-Rodriguez et al., 1994). These findings helped shape the basis for a model

suggesting that cataplexy and REM sleep may share a common mechanism.

The investigation of various monoamines added to the understanding of cataplexy.

Selective dopamine (D2) receptor agonists increased the episodes of cataplexy and D2-receptor

antagonists reduced cataplexy episodes (Nishino et al., 1991). Support for the noradrenergic

system stems from tricyclic antidepressants being an effective treatment in canine and human

narcolepsy (Babcock et al., 1976; Schmidt et al., 1977; Nishino et al., 1993). Furthermore, research

has demonstrated that selective activation of α1-receptors reduces cataplexy whereas antagonism

results in a reduction (Nishino et al., 1990; Renaud et al., 1991; Mignot et al., 1993). Cataplexy

has been demonstrated to occur following optogenetic stimulation of LC neurons (Carter et al.,

2010). However, it has been suggested that the stimulation parameters may have led to a

depolarization block which reduced noradrenergic input onto motor neurons (McGregor and

Siegel). This suggestion is compatible with previous findings where single unit recordings of the

LC that demonstrate its reduced activity during cataplexy (Wu et al., 1999). This reduction in LC activity and reduced noradrenergic release leads to disfacilitation of motor neurons and therefore, loss of muscle tone (Lai et al., 2001; McGregor and Siegel, 2010). This led to the incorporation of the locus coeruleus and noradrenergic mechanism into the model of cataplexy.

In contrast to the dopaminergic and noradrenergic mechanisms, for a few many years serotonin did not seem to be as pivotal in the control of cataplexy. First, unlike the experiments investigating the LC region, recordings of the dorsal raphe fail to show levels of suppression during cataplexy that match the suppression seen during REM sleep (Wu et al., 2004). Serotonergic agonists and antagonists seem to be relatively ineffective in treatment of cataplexy (Nishino et al.,

1995). This was mostly due to the fact that the anti-cataplectic effect of serotonin agonists were likely due to side-effects of manipulating the serotonin system rather than the agonist-receptor interaction (Nishino et al., 1995). However, recent work has refreshed the idea that cataplexy may be modulated by a serotonin mechanism (Hasegawa et al., 2013). Upon rescuing the hypocretin receptor expression at the dorsal raphe nucleus cataplexy episodes were reduced (Hasegawa et al.,

2013). More sophisticated methods using optogenetics have added insight to serotonin’s role on the manifestation of cataplexy as selective excitation of the dorsal raphe to amygdala neural circuit reduced the expression of cataplexy episodes (Hasegawa et al., 2017). Alternatively, inhibition of

this pathway increased the number of cataplexy episodes (Hasegawa et al., 2017). This work

suggests that cataplexy may be modulated by the serotoninergic interaction with emotion centers

(i.e. amygdala) (Hasegawa et al., 2017).

The hypocretin mouse model (for details refer back to sections 1.1.4 and 1.3.2) provided

a method to study how emotional stimuli triggers cataplexy. The first logical step was to investigate

brain areas involving emotion-processing and see their influence on cataplexy. Oishi et al., (2013)

demonstrated that palatable foods are pleasurable to mice and resulted in increased episodes of

cataplexy. Inactivation of the medial prefrontal cortex (mPFC), a region involved in emotion

processing, greatly reduced cataplexy induced through palatable foods (Oishi et al., 2013).

Furthermore, tracing studies demonstrated that the mPFC innervated both the amygdala and the

lateral hypothalamus (Oishi et al., 2013). Both of these regions had been previously implicated in

cataplexy due to evidence of neuronal degeneration and increased dopamine concentrations in

narcoleptic dogs (Miller et al., 1990; Siegel et al., 1999). Recently, the power of combining the

narcoleptic mouse model and novel genetic tools demonstrated a role for GABAergic amygdala neurons in cataplexy. Snow et al. (2017) found that activation of GABA cells in the amygdala

triggered a significant increase in cataplexy. These findings were further supported by Mahoney

et al, (2017) who found that inhibition of GABAergic amygdala neurons reduces the overall

amount of cataplexy episodes. These GABAergic amygdala cells have been hypothesized to

synapse onto the brain regions known as the LPT and VLPAG (Dauvilliers et al., 2014; Snow et

al., 2017). Lesions of the LPT and VLPAG led to the removal of REM sleep paralysis and created

a cataplexy-like state (Lu et al., 2006). These findings updated our understanding of the emotion

controlling circuits can trigger cataplexy.

This generated a new question: how does the activation of emotional circuits trigger

paralysis? The current hypothesis is that in the absence of hypocretin, cataplexy can manifest when

44 emotion circuits lead to the inhibition of brain regions functioning to suppress circuits that engage

REM sleep motor paralysis. (Snow et al., 2017).

The findings over the course of the last century have created a detailed map of the neural circuits responsible for the initiation of cataplexy. It is well accepted within the sleep field that cataplexy originates with the deterioration of hypocretin system. The hypocretin system serves many purposes, one of which is thought to counter balance emotional circuits that lead to the engagement of downstream circuits responsible for initiating paralysis during REM sleep

(Dauvilliers et al., 2014; Fraigne et al., 2015). (See Figure 1.10). When an emotional moment occurs, the medial prefrontal cortex becomes activated and triggers activation of both hypocretin neurons in the lateral hypothalamus and GABAergic neurons of the amygdala. These two regions project to the VLPAG, LPT and LC, with opposite effects. Under non-pathological circumstances the excitatory input from the hypocretin neurons is thought to dominate the inhibitory input from the amygdala, sustaining muscle tone and preventing cataplexy. However, in narcoleptics, the excitatory input is lost, permitting an overall inhibitory affect onto the VLPAG, LPT and LC, causing disfacilitation of motor neurons (via inhibition of the LC), and direct inhibition of motor neurons (via inhibition of the vlPAG/LPT and consequently disinhibition of the SLD). The SLD induces muscle paralysis via activation of the ventromedial medulla GABA/Glycine neurons which cause direct inhibition on the motor neurons. This collective recruitment of REM sleep brainstem circuits produces an overwhelming decrease in motor tone and leads to cataplexy.

1.7 Chemogenetics: Investigating behavior by harnessing the control of neurons

1.7.1 Overview

The Nobel Laureate, Francis Crick, observed that a major challenge for neuroscience was the inability to selectively control individual neurons without influencing the activity of other

neurons (Crick, 1979; Crick, 1999). Electrical stimulation and pharmacological approaches lacked the resolution required to properly scrutinize different populations of neurons (Rogan and Roth,

2011).While electrical stimulation produces rapid neuronal activation, it also spreads rapidly throughout the brain. Pharmacological approaches are sluggish in neuronal activation and lack precision of neuronal subtypes. Despite these disadvantages, these conventional neuroscience methods assisted and advanced the neuroscience of sleep. Crick suggested that the incorporation of novel technologies from molecular biology could eliminate some of these hurdles in neuroscience (Crick, 1979; Crick, 1999).

Chemogenetics, formerly known as pharmacogenetics, pharmacosynthetics and Designer

Receptors Exclusively Activated by Designer Drugs, is a technology developed by molecular biology to reversibly control neurons (Alexander et al., 2009). This thesis used chemogenetics to isolate, dissect, and understand the role of the SLD nucleus in the pathophysiology of cataplexy.

1.7.2 Early approaches in neuronal control

The initial experiment to attempt precise manipulation of neuronal modulation was

performed in vitro and used a caged molecule (Zemelman et al., 2003). A caged molecule is

photosensitive and biologically inert until photolysis rapidly converts it into a biologically active

molecule (Kao, 2006). Hippocampal neurons expressed the ligand-gated TRPV1 vanilloid receptor

and researchers caged a capsaicin derivative that upon photolysis became an active ligand for this

receptor (Zemelman et al., 2003). Application of light uncaged the ligand, enabling it to interact

with the TRPV1 receptor and rapidly leading to the generation of robust action potentials in

targeted neurons. Following this in vitro experiment, TRPV1 and other receptors were adopted for

in vivo use. The most notable of these applications was in a demonstration conducted by Lima &

Misenbock, 2005, who showed that this photoactivation strategy could produce flight in headless

Figure 1.10. Current hypothesized circuit mediating cataplexy. Cataplexy has long been hypothesized to be the result from inappropriate REM sleep paralysis seeping into wakefulness. Under non-pathological periods of REM sleep, glutamatergic SLD neurons activate the GABA/glycine ventromedial medulla neurons. These neurons have inhibitory projections to spinal motor neurons resulting in REM sleep paralysis. The two-part brainstem circuit that triggers this REM sleep paralysis, SLDàVMM, is inhibited during wakefulness by the VLPAG. This, in addition to excitatory drive onto motor neurons from noradrenergic and monoaminergic regions (not shown), allow for motor activity to occur. The VLPAG and LC are further supported by hypocretin input from the lateral hypothalamus to offset inhibitory input from the amygdala region – even when strong emotions drive amygdala activity. Narcolepsy is caused by the severe loss of hypocretin cells. Due to the loss of hypocretin input to maintain the excitation of the VLPAG and LC activity, the inhibitory amygdala projections dominates. This tip the balance in the favor of suppressing VLPAG and LC activity which removes the direct drive onto motor neurons and releases the inhibition on the SLD nucleus. The SLD nucleus is then active and activates the downstream motor paralysis circuit. This inappropriate activation of the motor paralysis circuit, and disfacilitation of motor neurons from the LC during wakefulness leads to an inappropriate loss of muscle control during wakefulness recognized as cataplexy. Abbreviations: CeA, central nucleus of the amygdala; LC, locus coeruleus; LH, lateral hypothalamus; MNs, motoneurons; SLD, Sublaterodorsal tegmentum; vlPAG, ventrolateral periaqueductal grey; VMM, ventral medial medulla. Modified from Fraigne, Torontali, Snow, and Peever, 2015

flies (Lima and Miesenbock, 2005). However, TRPV1 activation had a risk of excitotoxicity in vivo and so alternative approaches were sought out (Arenkiel et al., 2008).

Among the biggest drawbacks of lesions are their inherent irreversibility and the inability to

selectively target particular cell types. One of the first methods in reversible neuronal silencing

was through the use of a Drosphillia receptor, AlstR, which operates through the GIRK pathway

(Birgul et al., 1999; Lechner et al., 2002), reversible through saline washouts. It was used in several animal species to inhibit spontaneous neuronal activity (Tan et al., 2006) . Most notable was its use in targeting specific glutamatergic and somatostatin neurons in the PreBotzinger complex, effectively identifying this region’s cellular phenotype and overall role in respiratory control (Tan et al., 2008). Ivermectin-gated chloride channels could be expressed in particular cell types to reduce cellular activity (Lerchner et al., 2007; Oishi et al., 2013).

1.7.3 Designer G-coupled protein Receptors

G-protein coupled receptors (GPCRs) describe a super family of ligand-gated 7-pass-

transmembrane receptors (Nichols and Roth, 2009). These receptors are the most extensive and

ubiquitous family of membrane receptors, and are associated with countless physiological and

pathological processes (Nichols and Roth, 2009). Some of these processes include but are not

limited to cell proliferation, cell differentiation, modulation of neuronal activity, and cellular

communication. This superfamily of receptors can be activated by a large range of extracellular

ligands and upon activation initiate an array of intracellular signal cascades through various signal

transduction pathways (Gq, Gi and Gs) (Nichols and Roth, 2009). The re-engineering of these

receptors in such a way that only a synthetic and biologically inert molecule can engage its

cascades, instead of their native ligands, has provided neuroscience research with a powerful

toolkit, which allows for selective activation or inhibition of neurons through precise expression

systems and defined modulation of neuronal activity.

1.7.4 First Generation Receptors Activated Solely Activated by Synthetic Ligands (RASSLs)

The first attempt at creating selective activation of GPCRs was by Strader et al., 1991 when

they mutagenized the B2-adrenergic receptor. However, in in vivo settings, the receptors possessed

a low affinity for the selective ligands used, limiting their efficacy for neuroscience application

(Strader et al., 1991). Coward et al., 1998 attempted to build on this foundation by mutagenizing specific residues for native ligand binding on the human k-opioid receptor, leading to the creation

of Ro1 and Ro2, coupled to the Gi signal transduction pathway (Coward et al., 1998). Following

this, engineered receptors were created from serotonin receptors (5HT2A & 5HT4B) and histamine

H1 receptor, which utilized Gq and Gs pathways respectively. The problem with these initial receptors was twofold (Claeysen et al., 2003; Srinivasan et al., 2003; Bruysters et al., 2005;

Srinivasan et al., 2007). First, the ligands lacked the potency to efficiently activate the engineered receptor in vivo and this led to off-target effects. Second, in vivo application of RASSLs resulted in pathological conditions (Redfern et al., 1999; Redfern et al., 2000), arising from excessive activation of the transduction pathways. In the end, RASSLs were determined to lack the ability to effectively modulate neuronal activity in vivo without resulting in pathology. However, they ultimately found utility as tools for creating pathological models (e.g. hydrocephalus) that could then be studied for therapeutic solutions (Sweger et al., 2007).

1.7.5 Second-generation Designer Receptors: Designer Receptors Exclusively Activated by Designer Drugs (DREADDs)

The second generation of designer receptors focused on 2-way selectivity. In other words, the goal was to engineer a receptor that did not bind to endogenous ligands and create custom

ligands that only interact with the engineered receptor. The first attempt at this built on the Ro1

receptor and was known as the therapeutic receptor-effector complex (Small et al., 2001). Jacobson

et al., 2005 developed neoceptors, heavily modified adenosine receptors, which respond to

neoligands, customized nucleotides (Jacobson et al., 2001; Jacobson et al., 2005). While these

attempts rectified the lack of 2-way selectivity that the first generation failed to produce, these

designed receptors still functioned poorly in vivo.

To address this, Roth’s laboratory used a novel approach by generating receptors with

random mutagenesis via error-prone polymerase chain reaction (Nichols and Roth, 2009; Sternson

and Roth, 2014). Whereas previous efforts employed purposeful modification of receptors, Roth’s

laboratory chose a synthetic ligand, clozapine-N-oxide (CNO) and mutated the receptors until there was strong binding between both the receptor and the molecule (Rogan and Roth, 2011). CNO was bioavailable, penetrated the blood-brain barrier, and was a weak partial agonist to muscarinic receptors (Chang et al., 1998), and therefore muscarinic receptors were chosen as the target GPCR upon which mutagenesis was performed. Several DREADD receptors were generated and highly specific to CNO.

The first and most widely used excitatory DREADD, known as the hM3Dq receptor, was derived from the human muscarinic excitatory, hM3Dq, receptor (Alexander et al., 2009).

Neuronal excitation is produced via the Gq signal transduction pathway which leads to intracellular

inositol phosophate hydrolysis, calcium release and recruitment of ERK pathways. It has been

successfully used in multiple publications to examine behavior (Horton et al., 2017; Snow et al.,

2017). Multiple inhibitory DREADDs have been developed and include the hM2Di, hM4Di, and

kappa-opioid, KORD, receptors (Lee et al., 2014). The most commonly used inhibitory DREADD

has been hM4Di to inhibit neurons and examine behavior (Armbruster et al., 2007; Ferguson et

al., 2011; Ray et al., 2011; Kozorovitskiy et al., 2012; Carter et al., 2013; Boender et al., 2014;

Teissier et al., 2015). The newest receptor derived from κ-opioid receptor uses salvinorin B rather than CNO. Despite the difference in activating ligand, both hM4Di and KORD initiate neuronal silencing through hyperpolarization via Gβ/γ-mediated activation of G-protein inwardly rectifying potassium channels (GIRKs) and through reducing the presynaptic release of neurotransmitters

(e.g., synaptic silencing) (Armbruster et al., 2007; Stachniak et al., 2014; Vardy et al., 2015). This will be exciting in the future, since it is now possible to mix both excitatory hM3Dq and KORD receptors and activate them separately to have bidirectional neuronal control to investigate behavior.

DREADDs offer selective and reversible control of cell populations without creating pathologies or altering basal activity of expressing cells (Figure 1.11) (Rogan and Roth, 2011).

DREADDs also have potential medical application, as a large majority of medicines approved by the U.S. Food and Drug Administration and Health Canada act through the GPCR pathways

(Rogan and Roth, 2011). Thus, seizing and modulating the control of neurons that are pathologically out of sync with the network through the use of DREADDs and CNO could lead to an effective and targeted way of dealing with neurological disease and disorders in the future.

While originally CNO was thought to be a disadvantage due to its back metabolism to clozapine in humans, this is no longer the case. For example, compound 21 and perlapine have been found to activate DREADD receptors (Chen et al., 2015). Currently, perlapine has been shown to be potent for DREADD receptors and is a safe and approved medication for humans

(Chen et al., 2015).

This thesis argues that the SLD nucleus is inappropriately becoming active at an improper time to initiate REM sleep paralysis during wakefulness – cataplexy. Future methods may use an adenoassociated virus (gene therapy) harboring an inhibitory DREADD to the SLD neuronal population controlling REM sleep paralysis. Here, an application of perlapine or compound 21

would then trigger then inactivity of these neurons during wakefulness. The dose would be titrated

to only inhibit the neurons for the wakefulness periods, thereby, rendering an effective therapy

against cataplexy.

1.7.6 DREADD Expression Mechanisms

One of the advantages to the DREADDs system is that it allows for a more precise targeting of a

cellular population through a viral mediated gene transfer approach (Snow et al., 2017). In this

approach, the genes encoding the DREADDs are packaged into a viral vector (e.g. adeno-

associated virus, lentivirus) (Rogan and Roth, 2011). Viral mediated gene transfer is advantageous

as it has a quick turnaround compared to creating new mouse line expressing the DREADD, and

it also enhances the spatial specificity of an experiment by enabling targeting a specific brain

region (Nichols and Roth, 2009; Rogan and Roth, 2011). Furthermore, it allows for the use of

DREADD in rare mouse models or model organisms less capable of undergoing transgenic manipulations (Farrell and Roth, 2013). Some shortcomings of this approach are that the insertion of the cannula to deliver the virus can cause tissue damage, viral vectors are invasive, can sometimes induce immune responses depending on the viral vector used, and could have ectopic expression (Farrell and Roth, 2013). Furthermore, the exact expression across animals is not identical due to differential stereotaxic alignment, varying diffusion of viral particles after injection, and inconsistent viral infection across animals (Farrell and Roth, 2013).

Once a viral vector containing a DREADD has been prepared, it can be targeted to a specified brain region through stereotaxic microinjection (Snow et al., 2017). A conservative approach to broadly target a brain region can be through the use of a generic promoter. For example, Snow et al., (2017) used the human synapsin promoter to effectively target all cell types within the amygdala. However, further precision can be acquired using a more specific cellular

promoter or the Cre-Lox system, the latter of which is employed in the experiments described in

this thesis (See Chapters 5 and 6) (Boender et al., 2014; Snow et al., 2017). In the case of a Cre-

Lox system, the gene encoding the DREADD is packaged inverted and inactive into a double-

floxed inverse open reading frame (DIO) construct. The expression of Cre recombinase will cause

this gene to be re-inverted (serial recombination) into the active and functional orientation of the

transgene. This results in the expression of the transgene (Mallo, 2006). In order to utilize this

technique, one requires a transgenic mouse-line expressing Cre-recombinase in the cellular phenotype of interest (Roth, 2016). While the virus will infect all of the cells in the area, only the cells containing the Cre recombinase will be able to properly express the DREADD receptor

(Mallo, 2006). DREADDs are commonly associated with reporter genes, such as mCherry or GFP, to allow for confirmation of gene insertion and marks the location of DREADD-expressing cells

(Lee et al., 2014; Roth, 2016; Mahoney et al., 2017). Other methods have been constructed such as creating a new mouse line through genomic insertion of a transgene as well as the Tet-on/Tet-

off system which allows temporal control of when the DREADD expression can occur (Mayford

et al., 1996; Alexander et al., 2009). Essentially, this technique allows for an advantage over

classical techniques through its precise genetic targeting of neurons and reversible control over

these neurons. This was a revolution in the neuroscience toolkit.

Figure 1.11. Designer Receptors Exclusively Activated by Designer Drugs. A. As of 2018 there are six DREADD receptors available for neuronal modulation or G-protein coupled receptor cascade investigation. The most common excitatory DREADD is the hM3Dq receptor and the most common inhibitory receptor is the hM4Di receptor. Expression of these receptors into a neuronal populations of interest allows for neuronal modulation through a biologically inert ligand known as clozapine-n-oxide, CNO. Recently, perlapine and compound 21 have been shown to activate all of these receptors except for the KORD receptor. The KORD receptor is a recently developed DREADD and uses the Salvinorin B molecule to generate inhibition of the neurons. This will be a great addition to neuroscience toolkit as the excitatory hM3Dq receptor and KORD receptor can be used in tandem to generate bidirectional neuronal modulation. This technology has changed how researchers can investigate the brain and behavior with reversible and unprecedented levels of precision both spatially and temporarily. Modified from Roth 2017

1.8 Thesis Overview

To conclude, the mechanisms that control cataplexy have not been fully characterized.

While loss of hypocretin neurons has been demonstrated to lead to narcolepsy, how hypocretin

prevents the manifestation of cataplexy, the debilitating symptom of narcolepsy, remains a

mystery. Cataplexy is triggered by strong emotions and thought to be the manifestation of REM

sleep paralysis during wakefulness. A current but untested hypothesis is that the activation of the

emotional circuits in the absence of hypocretin engages circuits that control REM sleep paralysis

inappropriately during wakefulness.

These experiments examine if cataplexy and REM sleep paralysis share a common neural mechanism controlling muscle paralysis. Their goal is to identify the circuit responsible for the loss of muscle activity during cataplexy, and further elucidate the fundamental mechanisms mediating cataplexy. The significance of this work is in its functional identification of the neural circuits and cellular phenotypes mediating paralysis in the disease. In addition, a new mouse model for the study of glutamatergic cells in narcoleptic mice was generated. The results are medically relevant because they provide a therapeutic target for pharmacological management of cataplexy.

This work was done using a combination of freely behaving wild type mice with intact hypocretin systems and hypocretin knockout mice. In addition to behavioral studies, chemogenetics, electrophysiology, immunohistochemistry and in situ hybridization were used to identify the key neural circuit mediating cataplexy. Specific research objectives were to:

1. Determine if activation of the SLD nucleus can trigger cataplexy in wildtype mice (Chapter 3). 2. Characterize the role of the SLD nucleus in the regulation of cataplexy using hypocretin knockout mice (Chapter 4). 3. Determine if VGLUT2-expressing SLD neurons can trigger cataplexy in wildtype, hypocretin intact, mice (Chapter 5). 4. Characterize the role of the VGLUT2-expressing SLD neurons in the regulation of cataplexy using hypocretin knockout mice (Chapter 6).

Chapter 2: Experimental Methods 2.1 Animals

Three different lines of mice were used in this thesis. In order to assess the effect of

chemogenetic activation of all cell types in the SLD nucleus on behavior, male wild-type (i.e.,

C57BL/6; age: 15.6 ± 5 weeks; mass: 23.1g ± 2.7 g) and male hypocretin knockout (hypocretin-/-,

age: 7.0 ± 1.5 weeks; mass: 20.8g ± 2.2g) mouse lines were used. The hypocretin knockout mice

were originally acquired from Dr. Masashi Yanigasawa’s laboratory at the University of Texas

Southwestern Medical Center and then backcrossed several generations on our C57Black/6 mouse

line in our laboratory (Chemelli et al., 1999). Hypocretin knockout mice were genotyped using

PCR with genomic primers 5'-GACGACGGCCTCAGAC TTCTTGGG, 3'-

TCACCCCCTTGGGATAGCCCTTCC, and 5’-CCGCTATCAGGACATA GCGTTGGC (with forward primers being specific for either wildtype or KO mice and the reverse primer being common to both).

The third type of mouse was ordered from Jackson laboratory, VGLUT2-Cre (stock:

Slc17a6tm2(cre)Lowl/J, on C57BL/6 background; age: 11.4 ± 6.5 weeks; mass: 22.7 ± 3.2g) and the fourth line of mice was developed in our laboratory by crossing our narcoleptic mouse line

(hypocretin-/-) with the VGLUT2-CRE mice, generating a hypocretin-/-, VGLUT2-Cre (age: 5.5 ±

1.5 weeks; mass: 21 ± 3.1 g). The hypocretin-/-,VGLUT2-Cre mouse line was developed to allow the selective targeting of chemogenetic receptors to the glutamatergic, VGLUT2-expressing, neurons in the SLD nucleus.

55 56

2.2 Chemogenetics (Designer Receptors Exclusively Activated by Designer Drugs)

This thesis investigated cataplexy circuitry using chemogenetics, also known as, Designer

Receptors Exclusively Activated by Designer Drugs (DREADDs). This technique permits

reversible manipulation of activity in genetically defined neurons. DREADDs are mutated

muscarinic G protein-coupled receptors (i.e., hM3Dq, excitatory; hM4Di inhibitory). Expression

of these mutated muscarinic receptors were induced into SLD neurons using a stereotaxic viral

mediated delivery (Figure 2.1). The viral constructs, adenoassociated virus (AAV) harboring

hM3Dq or hM4Di transgenes, were obtained from University of North Carolina (Chapel Hill, NC)

and were packaged with serotype 8 (AAV8). Experiments which did not require cell specific

transfection used constructs with the DREADD expressed downstream of a neuron-specific-

promoter human synapsin (hSyn) and used either mCherry or GFP as a fluorescent reporter

(AAV8/hSyn-hM3Dq-mCherry, titer: 4.5 × 1012 particles/mL, Lot#: AV5359B) or (AAV8/hSyn-

HM4Di-mCherry, titer: 8.3 × 1012 particles/mL, Lot#: AV5360C). Control vectors lacked the

neuromodulating chemogenetic receptor of interest and only harbored the fluorescent protein (ie.

AAV8/hSyn-GFP, titer: 8.3 × 1012 particles/mL, Lot#: AV5075D). Double-floxed inverted

orientation (DIO) constructs were used in experiments requiring selective VGLUT2-expressing

SLD cell transduction. This restricted the expression of hM3Dq or hM4Di to cells that expressed

Cre recombinase (i.e., VGLUT2-SLD cells in VGLUT2-Cre mice, or hypocretin-/-,VGLUT2-Cre

mice). Cre-dependent constructs: AAV8/hSyn-DIO-HM3Dq-mCherry, 5.7 × 1012 particles/mL,

Lot#: AV4979F; AAV8/hSyn-DIO-HM4Di-mCherry, 7 × 1012 particles/mL, Lot#: AV4980D;

AAV8/hSyn-DIO-mCherry, 3.3 × 1012 particles/mL, Lot#: AV4981CD).

2.3 Drug Preparation

The hM3Dq and hM4Di receptors are activated by a biologically inert ligand clozapine-n-

oxide (CNO; generously donated by Bryan Roth) (Alexander et al., 2009). The CNO injection

solution was prepared by dissolving CNO powder into 0.05% dimethyl sulfoxide (DMSO, Sigma

Aldrich) followed by the slow addition of buffered sterile saline to make a solution concentration

of 0.5mg/ml CNO in buffered saline solution with 0.05% DMSO. Behavioral experiments then

used intraperitoneal (i.p.) injection of either 5mg/kg or 10mg/kg depending on the experimental

paradigm. Control injections consisted of buffered sterile saline solution with 0.05% DMSO.

2.4 Viral Injection Surgery

Isoflurane was used to induce (3.5%) and maintain (1.5-2.5%) mice throughout the surgery.

Mice were affixed into a stereotaxic frame (model 902; David Kopf Instruments). Using a 28-

guage cannula coupled to a digital microinjection syringe pump (Pump 11 Elite; Harvard

Apparatus) with p20 tubing, the infusion of adenoassociated virus (AAV8) harboring hM3Dq or

hM4Di transgenes (200-400nl at 0.05µl/min) bilaterally into the SLD nucleus (Stereotaxic

Coordinates: AP= -5.0mm, ML= ±0.9mm, DV= -4.25 mm from Bregma) of 5-8 week-old mice.

These coordinates target the defined area of the SLD nucleus and are based off of the studies examining the role of the SLD on REM sleep control by Lu et al., 2006 and Boissard et al., 2002.

Therefore, the defined location of the SLD is ventral to the locus coeruleus, medial to the trigeminal motor nucleus and extending from the emergence of the trigeminal motor nucleus to the facial nerve (See Figure 1.7). Postoperative care consisted of ketoprofen (5 mg/kg, s.c.) once per day for a minimum of two days after surgery and mice were allowed to recover from surgery for at least 14 days.

Figure 2.1. Chemogenetic investigation of the neural circuits mediating cataplexy. In order to reversibly control of all cell types of the SLD nucleus we injected 400nL of AAV8-hSyn-hM3D(Gq)-mCherry (excitation), AAV8-hSyn- hM4D(Gi)-mCherry (inhibition) or AAV8-hSyn-GFP (control) bilaterally into the SLD of either wildtype or narcoleptic mice (hypocretin-/-). To selectively target glutamatergic SLD neurons we used 400nL of AAV8/hSyn- DIO-hM3D(Gq)-mCherry (excitation), AAV8/hSyn-DIO-hM4D(Gi)-mCherry (inhibition), AAV8/hSyn-DIO- mCherry (control) viral constructs into VGLUT2-Cre mice or hypocretin-/-, VGLUT2-Cre mice. Sleep-wake behaviors were analyzed for 3 hours after administration of clozapine-N-oxide (CNO) via i.p. injection, (excitation, 5mg/kg; inhibition, 10mg/kg). To test functional connections, SLD expressing hM3Dq neurons were activated by CNO and brains were stained for cFos, a marker of neural activity. Immunohistochemistry was used to localize SLD terminals. Verification of selective delivery of chemogenetic receptors to VGLUT2-SLD neurons was performed using fluorescence in situ hybridization.

2.5 Electroencephalographic and Electromyographic Electrode Implantation Surgeries

After 14 days, mice underwent a second surgery for the implantation of a headplug that housed the electroencephalogram (EEG) and electromyogram (EMG) electrodes (Figure 2.2). The headplug and electrodes were constructed in-house. Headplugs were a microstrip connector (CLP-

105-02-L-D; Electrosonic) and electrodes were constructed in house from multi-stranded stainless- steel wire that was tied into a loop at one end with the insulation removed and the other end soldered to the microstrip connector (AS 632; Cooner Wire). For EEG recordings, the wire was looped around a stainless-steel screw (P0090CE125; J.I. Morris) which was implanted into the frontal and parietal bones (1 mm anterior and ± 1.5 mm lateral to bregma; 2 mm posterior and ±

2.75 mm lateral to bregma). The neck and facial muscles have been demonstrated to lose muscle tone in 94% of cataplexy episodes (Pizza et al., 2018). Therefore, in order to record muscle activity, two EMG loop electrodes were sutured into both the neck extensor muscles and the right masseter muscle. The headplug microstrip connector was affixed to the skull using a combination of Ketac- cem and C&B Metabond Cement System (K-dental). Postoperative care consisted of ketoprofen administration (5 mg/kg, s.c.) once a day for a minimum of two days. Mice were then housed individually to recover for at least 14 days before experiments began.

2.6 EEG and EMG Data Acquisition

After headplug implantation mice were transferred to plexi-glass recording chambers.

Running wheels (Bio-serv) were used in experiments involving narcoleptic mice, as previous research demonstrated it increased cataplexy (Espana et al., 2007). It has been demonstrated that mice need a week to become accustomed to running wheels, and thus, mice were left to habituate to wheels for a week.

Neck Mass

Tether

Headplug Neck EMG electrodes

EEG electrodes

Masseter EMG electrodes

Figure 2.2. Schematic representation of a surgically instrumented mouse. Mice were implanted with electroencephalographic (EEG) and electromyographic electrodes (EMG). The EEG electrodes are placed onto the skull in order to acquire cortical activity while the EMG electrodes are implanted into the masseter and neck muscle to monitor muscle activity throughout the recording period. All electrodes are attached to a headplug which is connected to a computer via tether cable. The muscle and brain activity allow for sleep, wake and cataplexy states to be determined. Adapted from Popesko et al., 1992

After 14 days from headplug implantation surgery, a custom lightweight recording data

cable (NMUF 8/30-4046SJ; Cooner Wire) was connected to the headplug micro-strip connector

and animals were habituated to both the newly attached tether (for a week) and i.p injections of buffered saline (B. Braun Medical Inc.) once a day for the 3 days prior to starting the first behavioral recording.

Cataplexy primarily occurs during the dark phase (Mochizuki et al., 2004) and therefore,

all chapters in this thesis consist of experiments in which recordings were performed during the

dark phase. Experiments involving chemogenetic activation of the SLD neurons consisted of a saline recording night and a 5mg/kg CNO recording night with a day of recovery in between each.

The treatment was randomly chosen. Inhibition of the SLD nucleus in narcoleptic mice took place over six recordings. Animals underwent i.p. injection of saline recordings in three of these recordings. The other three recordings consisted of i.p. administration of 10mg/kg CNO recordings. These were randomly selected and a recovery day between each treatment day. All experiment recordings consisted of EEG, EMG, and video recordings as to capture sleep-wake and cataplexy behaviors in real-time. EEG and EMG signals were passed through a Link 15 amplifier (Grass Inc.), which amplified signals by a factor of 500 to 5000. All signals were digitized at 1000 Hz (Spike2 Software, 1401 Interface, Cambridge Electronic Design Ltd.) and were digitally filtered (EEG, 0.1-100 Hz; EMG, 10-3000 Hz). All EMG signals were rectified.

Power spectrums were applied to recorded channels, and any channels that had 60Hz electrical noise detected, a 60Hz Notch filter was applied for that channel in control and treatment conditions. Video was captured on Microsoft live webcams and synchronized in Spike2 Software recordings.

2.7 Data Analysis

Analysis was performed on a 3-hour recording block that took place 30 minutes after injection of saline or CNO. Behavioral states were identified and scored to standard criteria based on previous publications (Burgess et al., 2010; Brooks and Peever, 2012; Burgess and Peever,

2013). In brief, behavioral states were scored based on 5-second epochs and each 5- second epoch script was analyzed for EEG, EMG custom-made scripts for Spike2 (sleepscore v1.01). Epochs that had a transitional period of two states was scored on the state occupying the largest majority

of the epoch (i.e. if a 5s epoch consisted of 4s wake and 1s NREM, it was scored as wake). Wake

was scored based on low amplitude high frequency EEG signals in conjunction with moderate to

high levels of EMG activity. NREM sleep was identified by high amplitude low frequency EEG

signals (slow waves) and minimal EMG activity. REM sleep was scored based on theta-rich EEG

activity with EMG presenting atonia and punctuated by periodic muscle twitches. Cataplexy was

scored per the consensus definition by Scammell et al., (2009) in conjunction with

electrophysiological signals as well as video recording. Sleep attacks had a strict criterion of a

gradual loss of neck muscle tone, EEG slow waves (0-4 Hz), and activity in the masseter EMG

(Burgess et al., 2010) which often resembles the activity seen during mice chewing and eating

behavior.

Behavioral states were quantified in terms percent time spent, average duration and number

of episodes within the 3 hour recording. The percent time was calculated through the summation

of total time spent in a state divided by the total length (3hr) of recording time. Duration was

calculated based on the number of episodes of state in a 3hr recording period divided by the time

spent in state. EMG activity was quantified via custom-made Spike2 script that looked at all scored

states in 5s epochs. Muscle tone during behavior states was then normalized to the average

integrated EMG activity of the EMG activity during NREM sleep during the saline treatment. EEG

analysis used an output from a Fast Fourier transformation and power spectra using Spike2

software that was then converted into relative power using Microsoft Excel by taking the total sum

of all frequency bands 1-20 Hz and dividing each power band by this total sum. In Chapter 3,

broad cellular activation of all cell types in the SLD nucleus triggered behavioral arrests that

needed careful analysis to determine if the state was REM sleep or cataplexy. Muscle analysis was

quantified in 10ms bins by a custom written script I programmed using Spike2. The output of this

script was entered into an excel macro developed in the laboratory to separate tonic and phasic

EMG activity (Brooks & Peever, 2011). In brief, previous literature has demonstrated the first 5s

of a REM sleep period lacks phasic activity, and therefore, the first 5s of a REM period was used

to calculate the 99th percentile of EMG activity (Brooks & Peever, 2011). This percentile was

assigned as the threshold for tonic EMG activity, and thus, any activity above this threshold

deemed phasic activity. The number of phasic events that occurred under cataplexy and REM sleep

were measured using a within animal strategy.

2.8 Histology, Immunohistochemistry and Fluorescence In Situ Hybridization

Mice were deeply anesthetized with a combination of Avertin (250mg/kg, I.P., Sigma

Aldrich) and isoflurane. After loss of righting reflexes and foot withdrawal reflex, mice were

transcardially perfused with ice cold 0.1M phosophate-buffered saline (PBS) for fifteen minutes

and ice cold 4% paraformaldehyde (PFA, Sigma Aldrich) for fifteen minutes. The brain was

extracted and immediately immersed in 4% PFA overnight, followed by 30% sucrose solution for

a minimum of 48hrs. Sucrose was used as a cryoprotection. Following sucrose immersion, the

brains were placed into cryomolds (Tiisue-Tek Standard Cryomold, Sakura Finetek USA Inc.) and coated with cryoprotectant compound (Tissue-Tek OCT compound, Electron Microscopy

Sciences). The brain molds were then placed onto an aluminum plate that lay onto dry ice within

64 a styrofoam box. After two hours, brains were removed, placed in ziplock bags and stored in a minus 20°C freezer until sectioning. Slices were sectioned at 40 µm using a cryostat (CM3050 S;

Leica) and wet mounted onto glass slides, coverslipped with Permafluor media. Expression of mCherry or GFP was visually confirmed with fluorescence microscopy. Only mice in which bilateral expression encompassed the SLD nucleus were used in analysis.

For c-Fos/mCherry immunohistochemistry, mice were injected with either saline or 5 mg/kg CNO injection at a period early in the lightphase (8:00am). This time was chosen as it is a period where REM sleep and wakefulness is less present, thereby reducing a celling effect of cellular activation as SLD activation is known to be involved in both REM sleep and wake

(McShane et al., 2012). After injection, animals were left for 135minutes before being sacrificed.

This time frame was chosen to allow peak hM3Dq receptor activation and c-FOS expression. After perfusion, cryoprotection, and sectioning of brain tissue, sections were washed in 0.1 M PBS, pH

7.4 (two changes), and then incubated in the primary antiserum for 72 hours at 4°C. For c-Fos, we used a rabbit polyclonal antiserum (1:5000, 26209, Immunostar) against residues 4–17 from human c-Fos. For mCherry, we used a polyclonal mouse antiserum (1:5000, T513, Signalway

Antibody). Sections were then washed in PBS and incubated in biotinylated secondary antiserum against rabbit (1:800, BA-1000, Vector Laboratories) for 1 hour, washed in PBS, and incubated in avidin-biotin-horseradish peroxidase conjugate (ABC solution, Vector Laboratories) for 1 hour.

Sections were then washed again and incubated in a 0.06% solution of 3,3-diaminobenzidine tetrahydrochloride containing nickel (DAB, purple/black staining; Vector Laboratories) plus

0.02% H2O2. Following DAB staining, sections were washed and then incubated in biotinylated secondary antiserum against mouse (1:800, BA-9200, Vector Laboratories) for 1 hour, washed in

PBS, and incubated in ABC solution for 1 hour. Sections were washed in PBS and incubated in

NovaRed (red staining, Vector Laboratories). Tissue was then mounted on glass slides and

coverslipped with Permount media. Expression was examined under light microscopy and the cells

were manually counted by taking 3 slices at (40x magnification) for each brain. I would like to thank Aren Thomasian for his technical assistance with this work.

Fluorescence in situ hybridization was used to confirm that DREADD receptors were selectively targeted to glutamate (VGLUT2-expressing) SLD cells. Brains were flash frozen in –

30°C isopentane and stored at –80°C. Sectioned at 16µm and mounted on glass slides, which were stored at –80°C. Sections containing the SLD nucleus were immersed in 4% PFA for 20 min, then incubated in 0.1 M PBS containing 0.3% H2O2 for 10 min at room temperature. Slices were

acetylated for 10 minutes using 0.1M TEA buffer containing 0.25% acetic anhydride, dehydrated

with ethanol, then transferred to a humid chamber saturated with formamide and incubated in a

hybridization buffer (40% formamide, 10 mM Tris-HCl, pH 8.0, 200µg/mL yeast tRNA, 10%

dextran sulfate, 1× Denhardt’s solution, 600mM NaCl, 1mM EDTA, pH 8.0) for 2 hours at 56°C.

Sections were next transferred to a hybridization buffer containing the antisense VGLUT2

riboprobe (1:1000, Generously donated by Dr. Patrick Fuller), incubated overnight at 56°C, and

washed with SSC buffers. Following this, sections were incubated in a blocking solution

containing 4% goat serum and 0.5% blocking reagent (Roche) for 1 hour at room temperature and

then incubated in a polyclonal mouse antibody to mCherry (1:1000, T513, Signalway Antibody)

for 36 hours at room temperature. Next, incubation in sheep anti-DIG-POD (1:500, 11207733910,

Roche) overnight at 4°C, then washed five times for 5-minute washes in 0.1 M PBS containing

0.1% Triton-X (PBS-T) and transferred to a solution containing the TSA Plus Fluorescein System

(1:100, NEL741E001KT, PerkinElmer) for 10 minutes. Incubation in Cy3-conjugated goat anti-

mouse antibodies (1:200, CLCC35010, Cedarlane) for 3 hours at room temperature followed by

incubation with 4’,6-diamidino-2-phenylindole (DAPI, 1:1000) for 5 minutes. After slices dried

overnight, they were coverslipped with Permafluor and examined with a confocal microscope. The

puncta was found to be brighter than background staining and distinguishable. The mCherry

staining demonstrated neuron morphology and VGLUT2 puncta that was aggregated within

demonstrated colocalization. While DAPI was not required to be colocalized, it did provide

verification puncta and mCherry expression as a neuron. Both, Mohamad Hamieh and Dorsa

Derakhshan provided technical assistance with the fluorescence in situ hybridization protocol.

In Chapter 6, the of VGLUT2-SLD neurons expressing hM3Dq receptors within the SLD

in wildtypes (Chapter 5) and narcoleptics (Chapter 6) was quantified. Fluorescent images of

mCherry, the hM3Dq reporter, in the SLD nucleus were acquired at 10x using upright fluorescent

microscopy and stitched together using Volocity software (Perkinelmer) for cell counting. The

total number of fluorescent neurons expressing HM3Dq were manually counted from the stitched

area within the SLD nucleus, defined in section 1.5.1 and Figure 1.7, using two separate brain

slices per brain.

2.9 Statistical Analyses

I performed between-group comparisons between using unpaired two-tailed t-tests and within-group comparisons using paired two-tailed t-tests. Any data not normally distributed, were

tested using Mann-Whitney U or Wilcoxon signed-rank test. EEG power spectra was compared

using 2-way repeated measures ANOVA within groups. All statistical analyses were performed

using GraphPad Prism 5 (La Jolla, CA) and significant differences were accepted at the 95% level

of confidence (α = 0.05). The data is presented as mean ± SEM within text and mean + SEM in figures.

Chapter 3: Activation of the SLD nucleus produces cataplexy in wildtype mice

3.1 Overview The sleep disorder narcolepsy is commonly known for its excessive daytime sleepiness

(Dauvilliers et al., 2007). Cataplexy, a debilitating symptom of narcolepsy, is the abrupt onset of muscle weakness or paralysis that occurs during wakefulness all while the individual remains awake (Guilleminault et al., 1974; Siegel, 1999). While hypocretin cell loss leads to narcolepsy and cataplexy, less is known about the neural circuit that triggers the debilitating muscle paralysis of cataplexy (Dauvilliers et al., 2014). This symptom has not been fully characterized, but an untested and long-standing hypothesis of the sleep field speculates that REM sleep paralysis inappropriately manifests during wake which gives rise to the phenomenon known as cataplexy

(Lopez-Rodriguez et al., 1994; Kryger et al., 2017).

While the circuit mediating the paralysis of cataplexy is unknown, the brainstem circuits controlling REM sleep paralysis have been identified. The paralysis of REM sleep is thought to be generated by the sublaterodorsal tegmental (SLD) region (George et al., 1964; Jouvet et al., 1965;

Garzon et al., 1998; Fraigne et al., 2015). Pharmacological stimulation of the SLD nucleus has been shown to produce muscle paralysis, whereas, muscle paralysis of REM sleep is lost after lesions of the SLD nucleus (George et al., 1964; Jouvet et al., 1965; Mouret et al., 1967; Sastre and Jouvet, 1979; Hendricks et al., 1982; Shouse and Siegel, 1992; Garzon et al., 1998; Lu et al.,

2006; Xi and Luning, 2009). Therefore, using behavioral, electrophysiological, immunohistochemical and chemogenetic methodologies (Refer to Chapter 2 for detailed

methods), I performed the first step in identifying whether the activation of SLD neurons underlies

cataplexy.

I discovered that chemogenetic activation of the SLD nucleus of wildtype mice which do

not normally display cataplexy, was sufficient to produce repeated behavioral arrests that

interrupted wakefulness. I compared these behavioral arrests to both cataplexy in a narcoleptic

mouse model and to the REM sleep state Behavioral arrests induced by chemogenetic activation

of the SLD nucleus were found to be more similar to the physiological variables defining cataplexy

than REM sleep. These findings indicate a role for the SLD nucleus in the triggering of muscle paralysis during cataplexy and provide evidence to the long-standing hypothesis that REM sleep and cataplexy share a common neural mechanism.

3.2 Results

3.2.1 hM3Dq receptors are expressed in and activate SLD cells

To understand the role of the SLD nucleus in behavior, a Cre-independent strategy was

used to activate all cells within the SLD nucleus. In order to demonstrate that any observed changes in cellular activation were not due to CNO administration per se, CNO was administered to a control group of mice (n=4) not expressing a chemogenetic, but instead a non-functional protein

(i.e., GFP). To verify that cellular activation was not induced by AAV-driven expression of hM3Dq receptors, a group of hM3Dq-expresing mice (n=4) received a saline injection instead of

CNO. Using cFOS, a marker of neuronal activity, cellular activation was quantified following

CNO-induced activation of hM3Dq-expressing SLD neurons in four mice and compared to both control groups. Cellular activation was increased in hM3Dq-expressing SLD neurons following

CNO administration (1-way ANOVA, F(2,9)=36.14 , p<0.0001, Figure 3.1B). More specifically,

CNO-induced activation of hM3Dq-expressing SLD receptors resulted in a 250% increase in cFos

expression as compared to saline (Tukey’s post hoc, p=0.0002, Figure 3.1C). This indicates that

the expression of hM3Dq receptor alone does not cause cellular activation, rather that hM3Dq-

expressing SLD neurons can be activated and induce cellular activity following administration of

CNO. Similarly, CNO-induced activation of hM3Dq-expressing SLD receptors resulted in a 492%

increase in cellular activation (i.e., cFos expression) compared to hM3Dq-null mice (i.e., no

chemogenetic receptor) that received CNO (Tukey’s post hoc, p=0.0001, Figure 3.1C). This finding indicated that CNO itself does not induce cellular activation in SLD neurons. Taken together, these results demonstrate that CNO activates hM3Dq receptors expressed in SLD neurons. Furthermore, this finding suggests that any changes to behavior following chemogenetic manipulation are due to changes in SLD neuron activity.

3.2.2 Activation of SLD neurons generates repeated episodes of motor paralysis

Broad activation of SLD neurons locked wild-type mice into an oscillation between

wakefulness and behavioral arrests, a state defined by the sudden onset of muscle paralysis during

wakefulness (Figure 3.2A). These behavioral arrests, which appeared repeatedly, caused animals

to collapse into a prone position and lose all gross motor movements. They were flanked

exclusively by wakefulness and the muscle paralysis was associated with a theta rich EEG (Figure

3.2B). I assessed the response to tactile stimulus by stroking the animal with a paintbrush during

either bona-fide REM sleep or the behavioral arrests triggered through SLD activation. Whereas

animals in REM sleep would be aroused by the tactile stimulus and resume waking behaviours,

animals experiencing behavioral arrests demonstrated no reaction whatsoever. This

unresponsiveness was more reminiscent of narcoleptic mice during their cataplexy attacks.

Expression of a control viral vector and administration of CNO in wild type mice did not produce

behavioral arrests (n=4).

One possibility was activation of the SLD neurons resulted in direct transitions into REM sleep; however, these attacks bore a stronger resemblance to cataplexy seen in narcoleptic mouse models. Therefore, I decided to closely examine the behavioral arrests produced under SLD activation through a detailed and systematic evaluation of their temporal distribution, muscle activity, and electroencephalographic activity, and compare these results to both REM sleep and to cataplexy. Wild-type mice do not exhibit behavioral arrests such as cataplexy. Therefore, I took advantage of a well-established model of narcolepsy, the hypocretin-/- mouse, which displays episodes of cataplexy. I chose the darkphase as it is during this period of time that narcoleptic mice predominantly experience cataplexy (Mochizuki et al., 2004).

3.2.3 The average duration of the behavioral arrests induced by SLD activation resemble cataplexy, not REM sleep

Next I assessed the duration of these events, and therefore, I compared the durations of the behavioral arrest produced by activation of the SLD nucleus in wildtype mice to either cataplexy episodes observed in the narcoleptic mice, or to the length of REM sleep measured under saline conditions in the same wild-type mice that expressed the hM3Dq receptors in SLD neurons (1- way ANOVA, F(2,25)=7.046, p=0.0037). I found the duration of the behavioral arrests resulting from CNO-induced activation of hM3Dq-expressing SLD neurons to be significantly shorter than the mean duration of REM sleep episodes (REM sleep vs behavioral arrest: Tukey’s post hoc, p=

0.0153, Figure 3.3). Similarly, REM sleep episodes were found to be significantly longer than the mean duration of cataplexy episodes in narcoleptic mice (REM sleep vs cataplexy: Tukey’s post hoc, p=0.0046, Figure 3.3). However, behavioral arrests arising from CNO-induced activation of

SLD neurons were equivalent in duration to cataplexy episodes (behavioral arrest vs cataplexy:

Tukey’s post hoc, p=0.9764, Figure 3.3), indicating that the behavioral arrests triggered by chemogenetic activation of the SLD nucleus resembled cataplexy more than REM sleep.

Figure 3.1. hM3Dq-expressing neurons are located within the region of the SLD and are activated by clozapine- n-oxide. A. Stereotaxic map and immunohistochemical example showing hM3Dq-expressing neurons in the SLD nucleus. Shaded regions represent the location and extent of the hM3Dq-expressing cells in 9 wild-type mice (red regions). Lower inset: Immunohistochemical example illustrating hM3Dq-expressing neurons (red) stained). B. Immunohistochemical staining for cells of the SLD expressing mCherry (red) and cFos (black). (Top left inset) Staining in the SLD nucleus. (Top right inset) Following an IP injection of CNO (5mg/kg ) mCherry+ SLD cells are cFos+. (Bottom left inset) Following an IP injection of saline, mCherry+ SLD cells do not express cFos. (Bottom right inset) SLD cells which were virally transfected with a fluorophore (i.e. GFP) but not a chemogenetic receptor are positive for the fluorophore but not cFos following an IP injection of CNO. C. Group data quantification of the percent of mCherry cells expressing cFos after administration of clozapine-N-oxide (CNO). Cells of the SLD that expressed the chemogenetic hM3Dq receptor had significantly more double-labeled cFos/mCherry cells than both the controls injected with saline alone and the controls where CNO was administered without the presence of the chemogenetic receptor (1-way ANOVA, p<0.001). n.s: non significant, p>0.05.

3.2.4 Behavioral arrests produced by SLD activation follow patterns of muscle activity which parallel cataplexy

After demonstrating that the duration of the behavioral arrests following CNO-induced

activation of hM3Dq-expressing SLD neurons were more akin to cataplexy than REM sleep, my

next objective was to compare the muscle tone between states. Muscle tone is a strong measure of

behavioral state and therefore, I measured the level of muscle tone in REM sleep, cataplexy and

the behavioral arrests induced by chemogenetic activation of the SLD nucleus. There were no significant differences in the amount of muscle tone when the behavioral arrests produced by SLD activation were compared to either REM sleep (unpaired t test, t(16)=1.182, p=0.2545, Figure

3.4C) or to the muscle paralysis of cataplexy (unpaired t test, t(16)=1.768, p=0.0962, Figure 3.4B).

It is well established that muscle tone prior to cataplexy is high, as cataplexy interrupts a period of

wakefulness, and muscle tone prior to REM sleep is low, since REM sleep always follows NREM

sleep (Brown et al., 2012). Therefore, I quantified the level of muscle tone prior to cataplexy, REM

sleep and behavioral arrests induced by activation of the SLD nucleus. I found that the amount of

muscle tone prior to cataplexy (x̅ = 0.42 ± 0.22 a.u. SEM, n=9) and SLD induced behavioral state

(x̅ = 0.44 ± 0.06 a.u. SEM, n=9) was not significantly different (unpaired t-test, t(16)=0.09292, p

= 0.9271, Figure 3.4B). Likewise, the amount of muscle tone following cataplexy (x̅ = 0.39 ± 0.23

a.u. SEM, n=9) and SLD induced behavioral state were both high and not significantly different

from one another (unpaired t-test, t(16)=0.1740, p=0.8641, Figure 3.4B). In contrast, the amount

of muscle tone preceding REM sleep (x̅ = 0.89 ± 0.02 a.u. SEM, n = 9, unpaired t test, t(16)=5.937,

p=0.0001, Figure 3C) was significantly different from the behavioral state induced by SLD

activation. This data suggests that the behavioral arrests produced by SLD activation follow

muscle tone similar to cataplexy whereby high levels of muscle tone occur before the state. This

is unlike REM sleep, as REM sleep shows low levels of muscle tone preceding the state. Thus,

Figure 3.2. Activation of the SLD nucleus produces a state of behavioral arrests. A. Hypnograms displaying behavioral states of wild-type mice during baseline conditions (saline) or after SLD activation (CNO). Note the behavioral arrests produced by CNO-induced activation of hM3Dq-expressing SLD neurons, a state not normally observed in wild-type mice. B. The behavioral arrests produced by SLD activation interrupted wakefulness and were characterized by theta rich electroencephalograph activity, muscle paralysis and devoid of phasic events as measured by masseter EMG, neck EMG and cortical EEG. Wakefulness always followed the behavioral arrest. During the behavioral arrest animals did not respond to tactile stimulation, much like cataplexy. C. Compared to saline (blue), CNO induced activation of the hM3Dq-expressing SLD neurons (red) produced no significant changes in the percent time spent in wakefulness (paired t test, t(7)=0.9068, p=0.3780). However, there was no expression of NREM sleep (paired t test, t(7)=7.116, p=0.0001) or REM sleep (paired t test, t(7)=4.809, p=0.0002) following CNO-induced activation of hM3Dq-expressing SLD neurons. CNO-induced activation of the hM3Dq-expressing SLD neurons did produce behavioral arrests, resembling cataplexy, that sporadically interrupted wakefulness and never present under saline conditions (paired t test, t(7)=4.467, p=0.0004). All values expressed as mean + SEM, * denotes significance and n.s. denotes not significantly different.

these findings further support the hypothesis that the SLD-induced state is more similar to cataplexy than to REM sleep.

3.2.5 The motor profile during SLD induced behavioral arrest resembles cataplexy not REM sleep.

After demonstrating that muscle activity before and after the SLD induced behavioral state

is more similar to cataplexy then REM sleep, my next objective was to examine the muscle activity

during the behavioral state induced by SLD activation and compare this to the muscle activity of

both REM sleep and cataplexy. Although both REM sleep and cataplexy share similar levels of

muscle paralysis, REM sleep can be differentiated by bursts of phasic events that intrude through

the muscle paralysis (Figure 3.4A). This phasic activity separates the electromyographic identity

of REM sleep from cataplexy. I therefore quantified the number of phasic events per second during

cataplexy, behavioral state induced by activation of the SLD nucleus and REM sleep. Indeed, both

cataplexy and the behavioral state resulting from CNO-induced activation of the hM3Dq-

expressing SLD neurons had significantly less phasic events than REM sleep (1-way ANOVA,

F=5.611, p=0.0152). Specifically, it was found that cataplexy (x̅ = 0.35 ± 0.06 events/s, n = 6)

and the behavioral states resulting from CNO-induced activation of hM3Dq-expressing SLD neurons (x̅ = 0.31 ± 0.13 events/s, n=6) had no significant difference in number of phasic events

(Tukey’s multiple comparisons test, p=0.9988, Figure 3.4D), indicating a similarity in the motor

profile between these two states. In contrast, the number of phasic events that occurred during

REM sleep (x̅ = 2.95 ± 1.1 events/s, n=6) was considerably greater than the behavioral states triggered by CNO-induced activation of hM3Dq-expressing SLD neurons (Tukey’s multiple comparisons test, p=0.0267, Figure 3.4D). Likewise, a greater number of phasic events occurred during REM sleep than cataplexy (Tukey’s multiple comparisons test, p=0.0292, Figure 3.4D).

Taken together, these results suggest that the motor profile during the behavioral arrests produced

Figure 3.3. SLD activation produced behavioral arrests that were similar in duration to cataplexy. A. The duration of behavioral arrests resulting from CNO-induced activation of SLD neurons was compared to the average durations of REM sleep and cataplexy (1-way ANOVA, F=7.046, p=0.0037). REM sleep was significantly longer in average length of the episode when compared to either cataplexy in narcoleptic mice (Tukey’s post hoc, p=0.0046) and the behavioral arrests resulting from the intervention (Tukey’s post hoc, p=0.0153). However, these behavioral arrests were not significantly different in length from cataplexy (Tukey’s post hoc, p=0.9764) indicating that the lengths of the behavioral arrests were more similar to cataplexy and unlike REM sleep. All values expressed as mean + SEM, * denotes significance and n.s. denotes not significantly different.

by SLD activation in wild-type mice has a motor profile more similar to cataplexy seen in

narcoleptic mice than to that seen in REM sleep.

3.2.6 The cortical activity of the behavioral state produced by activation of SLD nucleus resembles cataplexy.

In order to further elucidate the state produced by activation of the SLD nucleus, I next

examined cortical activity. With respect to cortical activity, cataplexy is defined as a state of highly

irregular but theta (4-8Hz) dominated electroencephalographic oscillations (Vassalli et al., 2013).

Therefore, I compared the cortical activity of the behavioral arrests resulting from CNO-induced

activation of the hM3dq-expressing SLD neurons to the cortical activity of both REM sleep and

cataplexy (Figure 3.5A-C). Spectral analysis via Fast Fourier transformation demonstrated no

significant differences in theta range (4-8 Hz) when comparing the behavioral arrests produced by

SLD activation to cataplexy in narcoleptic mice (2-way RM ANOVA, F= 31.39, Bonferroni's

multiple-comparisons post hoc test, p>0.05, Figure 3.5B). This finding indicates that the power

spectrum of cataplexy and the behavioral arrests produced by chemogenetic activation of the SLD

are similar in the theta band frequency – the signature frequency defining cataplexy. This is in contrast to the power spectrum profile of REM sleep, which was not similar to the behavioral state

induced by CNO-induced activation of the SLD nucleus. In fact, REM sleep exhibited significantly

less power in the slower theta bands, 4Hz and 5Hz, compared to the behavioral arrests produced

by SLD activation (4Hz, REM sleep vs Behavioral Arrests: 2-way RM ANOVA, F=26.95,

p<0.0001, Bonferonni post hoc, p=0.0219; 5Hz, REM sleep vs Behavioral Arrests: 2-way RM

ANOVA, F=26.95, p<0.0001, Bonferonni post hoc, p=0.0005, Figure 3.5C). Taken together, these

results suggest that the cortical activity of the behavioral arrest produced by SLD activation

resembles cataplexy and not REM sleep.

A. Cataplexy SLD activation REM sleep

B. C. D. CataplexyCataplexy SubC activation SLDSubC activationactivation SLD activation REMREM sleep sleep *

n.s . n.s. n.s.

30s before During state 30s after 30s before During state 30s after sec / events phasic # state state Cataplexy SubCSLD REM state state Activationactivation sleep

Figure 3.4. SLD activation triggers behavioral arrests where patterns of muscle activity over time parallel cataplexy not REM sleep. A. Electromyographic traces showing the muscle activity that occurs before the state, during the state and after the state of cataplexy (in narcoleptic mice), behavioral arrests (produced by SLD activation in wildtype mice) and REM sleep (in wild-type mice). These examples demonstrate the level of muscle activity before, during and after a cataplexy attack resembles the activity before, during, and after a SLD induced behavioral arrest. Neither cataplexy nor the state produced by SLD activation exhibits a difference in the overall pattern of muscle activity over time, whereas REM sleep appears very different from these other two states. Note the lack of muscle activity prior to REM sleep and the phasic events that occur during REM sleep. B. I quantified the level of muscle activity before, during and after the state of cataplexy and behavioral arrests produced by SLD activation and found no significant differences at any of the time points. C. Comparisons between the behavioral arrests of SLD activation and REM sleep were significantly different in the amount of activity that occurs before the state. However, the level of muscle activity during and after are similar. Taken together, the resulting quantification regarding pattern of muscle activity over time suggests the behavioral arrests parallel cataplexy and not REM sleep. D. Group data demonstrating the number of phasic events during cataplexy and behavioral arrests (produced by SLD activation) are similar in quantity. This is in sharp contrast to the significant number of phasic events that occur during REM sleep when compared to SLD activation or cataplexy quantity. These data demonstrate the motor profile of the behavioral arrests emulate cataplexy more than the REM sleep state. All values are expressed as a (mean + SEM), * denotes significance and n.s. denotes not significantly different.

3.3 Discussion

The results of this chapter demonstrate that chemogenetic activation of the SLD nucleus

triggers a state that resembles cataplexy. I verified that the behavioral states produced by

chemogenetic activation were similar to the cataplexy naturally exhibited in the narcoleptic mouse model (hypocretin knockout mice) with stringent electrophysiological and behavioral measures. I found that these cataplexy attacks were remarkably similar in behavioral expression, duration,

motor activity and cortical activity. This is an important finding as wildtype are hypocretin-intact

and do not express cataplexy. Only narcoleptic, hypocretin-deficient, animals exhibit cataplexy.

Therefore, this is the first functional evidence that cataplexy can be triggered in a wild type mouse.

Furthermore, these attacks were not different in average duration when compared to cataplexy in

narcoleptic animals which suggests that the SLD nucleus triggers cataplexy but does not maintain

the state. Finally, this work provides evidence to the longstanding hypothesis that both REM sleep

and cataplexy share a common neural mechanism.

3.3.1 The sublaterodorsal nucleus triggers cataplexy

Cellular recordings of the SLD nucleus indicate that it is active during periods of REM

sleep paralysis (Cox et al., 2016). Electrical and pharmacological stimulation of the SLD nucleus

has been shown to produce periods of muscle paralysis (Jouvet, 1962; George et al., 1964). Lesions

of the SLD nucleus have shown a loss of muscle paralysis during REM sleep (Sastre and Jouvet,

1979). Furthermore, carbachol injections into the equivalent region of the SLD nucleus in the cat

resulted in cycling between wakefulness with normal motor behavior followed by cataplexy-like

episodes (Mitler and Dement, 1974). Also, lesions of brain regions that inhibit SLD activity (i.e.

lateral pontine tegmentum) resulted in cataplexy-like attacks (Lu et al., 2006). Taken together,

previous data indicated that the SLD nucleus functions to produce REM sleep paralysis.

Figure 3.5. Spectral analysis of cataplexy and SLD induced states are related. A. Upper: Electroencephalogram traces showing the theta dominated activity of three brain states: cataplexy, REM sleep and the behavioral arrests produced by SLD activation. B. Average spectral distribution of cataplexy (blue) vs behavioral arrests produced by SLD activation (red) are indistinguishable in the theta range. C. REM sleep has a decreased level of theta (relative power) compared to the behavioral states of SLD activation. This marked disparity in the theta range, along with the overall shape of REM sleep spectral profile differentiates it from behavioral arrests produced by SLD activation and cataplexy. Whereas, the overall shape of the spectral profile of cataplexy is similar to the behavioral arrests produced by SLD activation suggesting that the behavioral arrests are more akin to cataplexy and less like that of REM sleep.

What lacked in the experiments of previous literature was the direct activation of the SLD

neurons and an animal model where the comparison to bona-fide cataplexy could be accomplished.

Therefore, I tested the hypothesis by activating the SLD nucleus in hypocretin intact mice.

Activation of the SLD nucleus resulted in episodes of cataplexy, which I verified by comparing it

to bona-fide cataplexy in narcoleptic (hypocretin deficient) mice. Here, I found that chemogenetic activation of the SLD nucleus resulted in cyclical episodes of cataplexy that were characterized by paralysis and cortical theta activity similar to bone-fide cataplexy in narcoleptic mice. From our results, it appears that the SLD nucleus becomes inappropriately activated during wakefulness to initiate paralysis. The results within this chapter complement previous literature, as well as the long-standing hypothesis that REM sleep and cataplexy share a common neural mechanism.

3.3.2 Activation of the sublaterodorsal nucleus triggers cataplexy not REM sleep

Previous experiments in the SLD nucleus found that it not only functioned in the generation

of REM sleep paralysis, but also in the regulation of REM sleep itself (Mitler and Dement, 1974;

Bourgin et al., 1995). Since the SLD nucleus is thought to sit at the core of the neural network which generates the REM sleep state it raises the question: Why did activation of SLD neurons promote cataplexy rather than REM sleep? I hypothesize that the REM sleep network is intricately coordinated through multiple brain regions. Some of these brain regions which are wake promoting

(i.e. locus coeruleus, tuberomammilary nucleus, lateral hypothalamus) are required to be in an offline state, while other REM promoting regions (i.e. the pedunculopontine nuceli, laterodorsal tegmental nuclei and extended ventrolateral preoptic area) are required to be in an online state for the expression of REM sleep. Without this tightly regulated coordination the network would result in a blending of states – a dissociated state. I hypothesize that activation of the SLD nucleus produced the dissociated state of cataplexy because it triggered the muscle paralysis circuits, while

81 the rest of the wake promoting circuitry was left maintaining the wake state. Activation of the SLD muscle paralysis circuits destabilized motor control and resulted in cataplexy.

This hypothesis is consistent with Karczmar et al., (1970) who found that, under depletion of monoamines, carbachol activation of the SLD nucleus would produce REM sleep whereas, activation under normal conditions led to wakefulness. Thus, activation of the SLD nucleus while other monoaminergic systems are functioning creates a dissociated state of REM sleep paralysis during wake and hence, cataplexy manifests. In fact, stimulation of the SLD nucleus consistently resulted in muscle paralysis (George et al., 1964; Hobson et al., 1983; Baghdoyan et al., 1984b;

Baghdoyan et al., 1984a; Gnadt and Pegram, 1986; Garzon et al., 1998; Boissard et al., 2002).

Lopez et al. (1994) argued that atonia mechanisms may not be sensitive to the state and that the result of paralysis in their experiments was due exclusively to the activation of a paralysis system within the SLD nucleus. Lesion work found a SLD population functioning to initiate muscle paralysis of REM sleep. The results within this chapter demonstrate that activation of the

SLD neurons can produce paralysis regardless of state (Lu et al., 2006; Valencia Garcia et al.,

2017). Taken together, it is possible that while activation of the SLD nucleus was not able to shift the wake state to REM sleep, it was able to trigger the paralysis circuits and generate cataplexy. In this sense, my findings compliment the hypothesis put forth by Lopez et al., (1994) that cataplexy is the consequence of pathological increased SLD function during wakefulness.

The cellular composition of the SLD is not homogeneous (Lu et al., 2006; Brown et al.,

2008). Two photon calcium imaging has demonstrated that the SLD nucleus contains a population of neurons active during wakefulness and a separate population active during REM sleep (Cox et al., 2016). A limitation to chemogenetics is that it lacks the ability to produce state specific activation. In these chemogenetic experiments, activation is dependent on when the CNO reaches the chemogenetic receptors. This is an important consideration since work by Xi & Chase., 2010

demonstrated that the production of behavioral state after activation to the region encompassing

the SLD depends on the state the animal is in. More specifically, when they delivered hypocretin

into the SLD nucleus during wakefulness it promoted wakefulness, and when they provided

hypocretin during sleep it triggered the expression of REM sleep. Therefore, chemogenetic

activation of the SLD nucleus as a whole could be promoting wakefulness, and the atonia results

from driving the paralysis specific neuron pools. Future experiments could assess this by

identifying the separate neuronal pools and then using optogenetics to perform state specific

activation of the SLD nucleus. Nevertheless, this data suggests a role of the SLD in cataplexy and

is consistent with past literature implicating its role in the generation of muscle paralysis.

3.3.3 The role of the SLD nucleus in the neural circuit mediating cataplexy

Up until now the SLD nucleus was a hypothetical and untested component of the circuit mediating cataplexy. These results indicate that the SLD nucleus triggers cataplexy in mice and provides supportive evidence to the downstream pathways of the cataplexy circuit. Our laboratory has previously published that GABAergic cells from the amygdala are triggered during emotional stimuli and lead to the inhibition of downstream brainstem structures. Our last paper hypothesized that these brainstem regions (LPT, VLPAG, LC) jointly coordinate muscle paralysis by inhibiting the SLD and promoting motor activity under normal circumstances (Snow et al., 2017). However, in the case of the narcoleptic mice, hypocretin input to these regions is not present and destabilizes their control. It has been long expected these emotional circuits lead to the eventual release of inhibitory input onto the SLD nucleus. This release of inhibitory input would then allow the SLD neurons to become active during wakefulness and initiate cataplexy. Here, I add to this hypothesis by directly demonstrating that the SLD is capable of triggering the muscle paralysis of cataplexy.

I hypothesize the SLD becomes active inappropriately during wake and initiates muscle paralysis

through downstream projections to the ventromedial medulla. The neurons in the ventromedial

medulla become excited and release GABA/Glycine onto motor neurons resulting in cataplexy.

Taken together, the findings of this chapter demonstrate that the SLD is a downstream component

that functions to trigger muscle paralysis of the cataplexy circuit mediating REM sleep.

3.3.4 Technical considerations

Wildtype mice do not exhibit cataplexy naturally, rather, only hypocretin deficient mice

do. Therefore, while the results demonstrate that the SLD nucleus is sufficient in generating cataplexy, this experimental design cannot test the effects of inhibition of SLD neurons on cataplexy expression. This would require experiments where inhibition of SLD neurons was performed in narcoleptic mice, which do exhibit cataplexy since they lack hypocretin signaling.

Future experiments could take advantage of this mouse model as the effect of inhibiting the SLD nucleus on cataplexy can be determined.

These experiments were a “first pass” approach to assess the function of the SLD nucleus in cataplexy. The limitation to this set of experiments is that it does not assess what cellular phenotype is sufficient and necessary for cataplexy. However, this work implicates the SLD nucleus as neural substrate can induce cataplexy, and therefore, future experiments can be designed to decipher the cellular organization of this region. Evidence suggests that there are glutamatergic neurons in the SLD that function to control REM sleep paralysis (Lu et al., 2006; Clement et al.,

2011; Valencia Garcia et al., 2017). Therefore, future experiments (See Chapters 5 and 6) should focus on triggering those neurons and assessing their role in cataplexy.

3.4 Conclusion

The SLD nucleus has long been identified as a core generator of REM sleep muscle

paralysis (George et al., 1964). A longstanding hypothesis in sleep medicine posits that REM sleep

and cataplexy share similar circuitry (Hishikawa and Kaneko, 1965; Dauvilliers et al., 2014). Here,

I demonstrated that chemogenetic activation of neurons within the SLD nucleus triggers repeated episodes of cataplexy. This is significant because it is the first time cataplexy has been triggered in a wildtype mouse. I propose that the SLD nucleus is the trigger zone for muscle paralysis and that cataplexy is produced by the inappropriate activation of the SLD nucleus during wakefulness.

While these results demonstrate the sufficiency of SLD as the trigger for muscle paralysis, they cannot test the necessity of the region in cataplexy. This is due to the limitation that cataplexy is not present in wildtype animals naturally, and therefore future work can use a narcoleptic mouse model to activate and inhibit the SLD nucleus. This would further verify its role in cataplexy.

Understanding the cellular landscape of the SLD also represents a challenge in the understanding of how the SLD nucleus initiates its functional role in the REM sleep state and muscle paralysis.

Therefore, future experiments can begin to tease apart the neuronal pools composing the microcircuitry of the SLD nucleus to further understand the circuit mechanisms mediating cataplexy.

Chapter 4: Activation of the SLD nucleus regulates cataplexy in narcoleptic mice

4.1 Overview

Based on the findings in Chapter 3, where chemogenetic activation of the SLD nucleus

induced reoccurring episodes of cataplexy in wildtype animals, I hypothesized that chemogenetic

activation of the SLD nucleus would exacerbate cataplexy in narcoleptic mice (hypocretin-/-). It

has been well established that a hypocretin deficiency in humans, canines and mice results in

cataplexy (Nishino et al., 1991; Peyron et al., 2000; Thannickal et al., 2000; Burgess et al., 2013),

however, the mechanism and neural circuitry by which the loss of hypocretin leads to the

development of cataplexy is not well known. Wildtype animals have an intact hypocretin system

and do not display cataplexy, however narcoleptic animals lack hypocretin signaling and therefore,

naturally exhibit episodes of cataplexy (Chemelli et al., 1999). This is advantageous as the impact

of chemogenetic inhibition of the SLD nucleus can be assessed on cataplexy. Thus, I expected chemogenetic inhibition to reduce the overall amount of cataplexy experienced by narcoleptic animals.

Using similar methodology as Chapter 3 (i.e., behavioral analysis, electrophysiology, immunohistochemistry and chemogenetic techniques), I determined that activation of the SLD nucleus increased the number of cataplexy episodes in narcoleptic mice. While changes were seen in the total number of episodes, no effect was found on the duration of cataplexy episodes after chemogenetic activation of the SLD nucleus. This suggested that the SLD nucleus plays a role in

triggering but not maintaining the cataplexy state. Chemogenetic inhibition of the SLD nucleus was not found to significantly decrease the incidence of cataplexy exhibited by the narcoleptic

86 mice. Collectively, these results are significant as they test the functional role of the SLD nucleus on cataplexy in narcoleptic mice for the first time. Furthermore, these findings provide evidence supporting the longstanding hypothesis that a common neural mechanism mediates both the paralysis of cataplexy and the paralysis of REM sleep.

4.2 Results

4.2.1 Activation of SLD cells in narcoleptic mice promotes cataplexy

After demonstrating that activation of SLD neurons in wildtype mice produced cataplexy,

I investigated whether SLD activation promoted cataplexy in narcoleptic mice. To test this hypothesis I targeted the expression of the excitatory chemogenetic receptor hM3Dq, into all cells of the SLD nucleus of narcoleptic mice (Figure 4.1; for detailed methods refer to Chapter 2). To control for delivery of AAVs harboring the chemogenetic receptor and the effect of CNO administration alone, three mice received a viral construct containing the vector and reporter gene alone. Compared to saline, CNO-induced activation of hM3Dq-expressing SLD cells produced a

24-fold increase in the time spent in cataplexy (saline vs CNO: paired t test, t(7)=4.589, p=0.0025,

Figure 4.2C), suggesting that SLD cells function to modulate cataplexy. Not only did CNO- induced activation of SLD cells increase the total time in cataplexy, but the CNO injections significantly increased the total number of cataplexy episodes by 2100% (saline vs CNO: paired t test, t(7)=4.900, p=0.0018, Figure 4.2D). However, this intervention had no effect on the duration of the episodes, suggesting that SLD cells act to promote cataplexy events but not their duration

(Figure 4.2E). To demonstrate that neither CNO nor AAV-driven expression of hM3Dq were responsible for the observed changes in cataplexy, I drove expression of a functionless protein

(i.e., GFP) and gave mice the same dose of CNO as before (Figure 4.1 & Figure 4.2). Experiments expressing the vector alone and treated with either saline or CNO did not alter the number of

cataplexy episodes (saline vs CNO for # cat episodes: paired t test, t(2)=1.147, p=0.3699, Figure

4.2D) indicating that the increase in cataplexy resulted from CNO-induced activation of hM3Dq-

expressing neurons, and not due to CNO or the expression of a foreign protein alone. It should be

noted that cataplexy episodes produced by CNO-induced activation of hM3dq-expressing SLD

cells were behaviorally indistinguishable from cataplexy under saline conditions (Figure 4.2A &

4.2B).

4.2.2 Activation of SLD cells in narcoleptic mice does not promote sleep

For years the SLD has been proposed to regulate the neural circuitry responsible for the

control of REM sleep (Jouvet et al 1965; Boissard et al. 2002; Lu et al., 2006). Thus, sleep and

wake architecture act as functional readouts to investigate whether the manipulation of the SLD

may alter these parameters. Using the same hM3Dq-expresing narcoleptic mice (n=8) and control

group (n=3), which expressed a non-functional protein (i.e., GFP), sleep and wake architecture was examined. Compared to saline, CNO-induced activation of hM3Dq-expressing SLD neurons did not produce any significant changes in the number of wake bouts (saline vs cno: paired t test, t(7)=1.806, p=0.1139) and the length of the wake bouts remained the same (saline vs cno: paired

t test, t(7)=0.0594, p=0.9543). Consequently, compared to saline, overall time spent in wakefulness

was not significantly different following CNO-induced activation of hM3Dq-expressing SLD

neurons (saline vs cno: paired t test, t(7)=1.74, p=0.1255).

Compared to saline, a significant decrease was found in sleep states and sleep attacks (See

Figure 4.3). However, this was because there was no expression of NREM sleep, REM sleep or

sleep attacks. A decrease in REM sleep was contrary to my hypothesis based on previous literature

has implicated the SLD in the control of REM sleep expression. However, REM sleep, as well as

NREM sleep and sleep attacks, was likely reduced due to the considerable increase in the amount

of cataplexy that occurred following CNO-induced activation of hM3Dq-expressing SLD neurons.

To demonstrate that neither CNO nor delivery of AAVs harboring foreign proteins (i.e. hM3Dq) produced the effect on sleep-wake architecture, a control viral vector carrying a functionless protein was targeted to SLD neurons. Using similar dosing in mice with GFP- expressing SLD neurons, no significant impact on sleep-wake architecture was demonstrated

(Figure 4.3A-D). This indicated that neither CNO nor AAVs alone produce any reliable modulations in sleep-wake architecture. Rather, chemogenetic activation of SLD cells had specific impact on increasing the amount of cataplexy, which in turn produced less opportunity for sleep behaviors.

4.2.3 Inhibition of SLD cells in narcoleptic mice does not affect the expression of cataplexy

After demonstrating that activation of SLD cells in narcoleptic mice produced cataplexy,

my next objective was to investigate if inhibition of SLD neurons would reduce the amount of

cataplexy. Similar to the previous set of experiments, I targeted the inhibitory chemogenetic

receptor, hM4Di, into all cells of the SLD nucleus of 4 narcoleptic mice (Figure 4.4). I

hypothesized that inhibition of the SLD nucleus in narcoleptic mice would prevent cataplexy

attacks. However, inhibition did not significantly change the expression of cataplexy (Figure

4.5A). More specifically, when compared to saline, CNO-induced activation of hM4Di-expressing

SLD cells showed no change in the overall time spent in cataplexy (saline vs CNO: paired t test,

t(3)=1.901, p=0.1534, Figure 4.5B). Furthermore, compared to saline, no change in the number of

cataplexy episodes (saline vs CNO: paired t test, t(3)=2.724, p=0.0723, Figure 4.5C) or the length

of the cataplexy episodes occurred (paired t test, t(3)=0.8713, p=0.4477 Figure 4.5D), suggesting

that SLD cells may not be required for cataplexy to occur.

Figure 4.1. Location of hM3Dq-expressing neurons in the SLD nucleus. A. An adeno-associated virus (AAV) was used to selectively deliver the hM3Dq receptors or GFP fluorescent protein to neurons of the SLD nucleus in narcoleptic mice. Stereotaxic maps demonstrating the location of hM3Dq-expressing neurons in the SLD nucleus. Shaded regions represent the location and extent of the hM3Dq-expressing cells (red regions) and extent of control viral vector expression (green regions). B. Immunohistochemical example of the SLD neurons expressing the hM3Dq excitatory chemogenetic receptor and its fluorescent tag, mCherry.

Figure 4.2. Chemogenetic activation of the SLD neurons exacerbates cataplexy in narcoleptic mice. A. Hypnograms displaying the behavioral states of narcoleptic mice during control conditions (GFP-expressing SLD neurons) and after chemogenetic activation of SLD neurons (hM3Dq-expressing SLD neurons). Note the increase in cataplexy demonstrated by chemogenetic activation of the SLD nucleus. B. Electrophysiological examples of cataplexy under control conditions and after chemogenetic activation of SLD neurons. Both episodes of cataplexy are characterized by theta rich EEG, muscle paralysis devoid of phasic events show abrupt loss of motor activity. C. Compared to saline, CNO-induced activation of hM3Dq-expressing SLD neurons (labeled as “hM3Dq”) produced substantial increases in both the percent time spent in cataplexy and D. the number of episodes of cataplexy in a 3 hour recording. After SLD activation, the narcoleptic mice oscillated between wakefulness and cataplexy, similar to wild-type counterparts in Chapter 3. CNO administration in mice lacking the hM3Dq receptor (labeled as “GFP”) experienced the same level of cataplexy, both in total time spent and number of episodes, as saline controls. E. The average duration of cataplexy episodes did not change after CNO administration in neither hM3Dq-expressing nor GFP control mice. All values are expressed as MEAN+SEM, * denotes significance and n.s. denotes not significantly different.

Figure 4.3. Activation of the SLD nucleus abolishes NREM sleep and REM sleep. A. Chemogenetic activation of the hM3Dq-expressing SLD neurons (labeled “hM3Dq”, red bars) did not result in changes to the amount of time spent in wakefulness. Similarly, the control group of narcoleptic mice not expressing the hM3Dq receptor (labeled as “GFP”, grey bars) had no change in the amount of wakefulness following CNO administration (paired t test, t(2)=0.8375, p=0.4904). B. Following CNO administration, a significant decrease in the overall amount of NREM sleep occurred in hM3Dq-expressing narcoleptic mice (saline vs CNO: paired t test, t(7)=5.300, p=0.0011). Administration of CNO to mice lacking the hM3Dq receptor experienced the same level of NREM sleep as saline controls (saline vs CNO: paired t test, t(2)=0.7307, p=0.5410). C. Similar to NREM sleep, compared to saline, REM sleep was significantly decreased following CNO-induced activation of hM3Dq-expressing SLD cells (saline vs CNO: paired t test, t(7)=3.211, p=0.0148). The substantial increase in cataplexy that occurred following CNO-induced activation of hM3Dq-expressing neurons likely lead to this decrease in the amount of sleep. Control mice that did not express the hM3Dq-receptor had comparable amounts of REM sleep under both saline and CNO administration (saline vs CNO: paired t test, t(2)=3.319, p=0.0800). D. Significantly fewer sleep attacks occurred during CNO- induced activation of hM3Dq-expressing SLD neurons than during saline conditions (saline vs CNO: paired t test, t(7)=2.621, p=0.0343). This was in contrast to the control group of mice not expressing the hM3Dq receptor (saline vs CNO: paired t test, t(2)=1.246, p=0.3388). All group data is shown as MEAN+SEM, n.s. denotes not significant and * denotes p <0.05 when compared to saline.

4.2.4 Inhibition of the SLD nucleus does not modulate sleep-wake architecture

My next objective was to investigate if inhibition of SLD neurons would affect sleep-wake architecture. Based on previous literature, I had hypothesized that inhibition of the SLD nucleus would decrease the overall amount of REM sleep and reduce the overall amount of wakefulness.

However, no effect was seen on sleep-wake architecture. More specifically, compared to saline,

CNO-induced activation of hM4Di-expressing SLD neurons did not produce any significant changes to the overall amount of wakefulness (saline vs CNO: paired t test, t(3)=2.32, p=0.1030,

Figure 4.6A). When compared back to saline controls, the total amount of NREM sleep (saline vs

CNO: paired t test, t(3)=2.225, p=0.1125, Figure 4.6B) and REM sleep (saline vs CNO: paired t test, t(3)=0.09907, p=0.9273, Figure 4.6C) were unaffected following CNO-induced activation of the SLD nucleus. Finally, CNO-induced activation of hM4Di-expressing SLD neurons resulted in the same level of sleep attacks as saline conditions (saline vs CNO: paired t test, t(3)=1.415, p=0.2520, Figure 4.6D). Taken together, these results suggest that chemogenetic inhibition of the

SLD nucleus did not produce any changes to sleep-wake architecture.

4.3 Discussion

The results of this chapter demonstrate that activation of the SLD nucleus in narcoleptic animals increased the number of cataplexy episodes without altering the length of these episodes

(See Figure 4.2C-E). This suggests that the SLD nucleus plays a role in triggering, but not maintaining the state of cataplexy. These results are consistent with previous results in wild-type mice and demonstrate the capacity for the SLD nucleus to trigger cataplexy. Contrary to my hypothesis, inhibition of the SLD nucleus was not found to influence the number of episodes, duration or overall amount of cataplexy (See Figure 4.5B-D).

Figure 4.4. Location of hM4Di-expressing neurons in the SLD nucleus. A. An adeno-associated virus (AAV) was used to selectively deliver the hM4Di receptors or GFP fluorescent tags to the neurons of the SLD nucleus in narcoleptic mice. Stereotaxic maps demonstrating the location of hM4Di-expressing neurons and GFP-expressing neurons in the SLD nucleus. Shaded regions represent the location and extent of the hM4Di-expressing cells (blue regions) and extent of control viral vector expression (green regions). B. Immunohistochemical example of the SLD neurons expressing the hM4Di inhibitory chemogenetic receptor and its fluorescent tag, mCherry.

Figure 4.5. Chemogenetic inhibition of the SLD neurons does not reduce cataplexy in narcoleptic mice. A. Hypnograms displaying the behavioral states of narcoleptic mice after administration of CNO under both control conditions (GFP-expressing SLD neurons) and SLD inhibition (hM4Di-expressing SLD neurons). B. Compared to saline, CNO-induced inhibition of hM4Di-expressing SLD neurons (labeled as “hM4Di”) did not result in any significant changes in the percent time spent in cataplexy or the C. the number of episodes of cataplexy in a 3 hour recording compared to saline conditions. CNO administration in mice lacking the hM3Dq receptor (labeled as “GFP”) experienced the same level of cataplexy, both in total time spent and number of episodes, as saline controls. D. There was also no change to the average duration of cataplexy episodes following CNO administration in neither hM4Di- expressing nor GFP control mice. All values are expressed as MEAN+SEM, * denotes significance and n.s. denotes not significantly different.

Figure 4.6. Inhibition of the SLD nucleus does not alter sleep-wake architecture. A. Chemogenetic inhibition of the hM4Di-expressing SLD neurons (labeled “hM4Di”, blue bars) did not result in changes to the amount of time spent in wakefulness. Similarly, the control group of narcoleptic mice not expressing the hM4Di receptor (labeled as “GFP”, grey bars) had no change in the amount of wakefulness following CNO administration. B. No significant changes were found to the overall amount of NREM sleep following CNO administration in hM4Di-expressing narcoleptic mice. Administration of CNO to mice lacking the hM4Di receptor experienced similar amounts of NREM sleep as saline control conditions (saline vs CNO: paired t test, t(2)=0.7307, p=0.541). C. The total amount of REM sleep was also unchanged following CNO-induced inhibition of hM4Di-expressing SLD cells. Control mice that did not express the hM4Di-receptor had comparable amounts of REM sleep under both saline and CNO administration (saline vs CNO: paired t test, t(2)=3.319, p=0.0800). D. In comparison to saline, no change was observed in the total time spent in sleep attacks during CNO-induced inhibition of either hM4Di-expressing SLD neurons or control mice that did not express the hM4Di receptor (saline vs CNO: paired t test, t(2)=1.246, p=0.3388). All group data is shown as MEAN+SEM, n.s. denotes not significant and * denotes p <0.05 when compared to saline.

Collectively, the findings indicate that the SLD nucleus is a component of the circuit mediating cataplexy. These results suggest that both REM sleep and cataplexy share a common neural mechanism through which their paralysis is generated.

4.3.1 The SLD mediates cataplexy in narcoleptic mice

The role of the SLD nucleus in REM sleep paralysis has been known for half a century but

its role in cataplexy has not been characterized (Jouvet, 1962). A long-standing hypothesis in the

sleep field suggested that cataplexy results from REM sleep paralysis inappropriately manifesting

during wakefulness (Hishikawa and Kaneko, 1965; Lopez-Rodriguez et al., 1994; Dauvilliers et

al., 2014). I hypothesized that activation of the SLD would increase the number of cataplexy

episodes for two reasons. First, the narcoleptic mouse model lacks excitatory hypocretin signaling

to the structures which support motor activity and wakefulness. Furthermore, a lack of hypocretin in these mice also results in decreased excitation onto brain regions (i.e., VLPAG) that function to inhibit the SLD nucleus (Boissard et al., 2003; Burgess and Scammell, 2012; Snow et al., 2017).

This in turn could allow for the threshold of the SLD nucleus to be elevated and increases the probability of it becoming active. Second, in the previous work of Chapter 3, I demonstrated that chemogenetic activation of the SLD nucleus led to cataplexy in wild-type animals. Indeed, this chapter demonstrates that chemogenetic activation of the SLD in narcoleptic mice was found to promote the number of cataplexy episodes, but not duration. This data is in support of the hypothesis suggesting that if the SLD is active during wakefulness it can trigger the onset of paralysis (i.e. cataplexy). How does the SLD become active during wakefulness? Under normal circumstances the SLD is inhibited by brainstem regions, the VLPAG-LPT, during wakefulness

(Boissard et al., 2003; Lu et al., 2006). These brainstem regions receive excitatory input from the hypocretin neurons of the lateral hypothalamus (Peyron et al., 1998). However, in narcoleptics

there is a lack of hypocretin and therefore, a reduced excitatory drive from the hypocretin peptide

onto regions that inhibit the SLD nucleus (ie.VLPAG and LPT) (Burgess et al., 2013; Mahoney et

al., 2017; Snow et al., 2017). Furthermore, in narcoleptic knockouts the excitatory drive onto the

motor neurons is also reduced as hypocretin neurons project to areas that promote muscle activity

(i.e. LC) (Horvath et al., 1999). This disinhibition onto the SLD neurons may result in

depolarization of the membrane potential which would lead the membrane potential closer to the

threshold for action potential generation (Boissard et al., 2003; Lu et al., 2006). This would

increase the probability of SLD neurons becoming active during wake which would trigger

paralysis circuits and lead to the cataplexy state.

The results of this chapter investigate a limitation of Chapter 3, where experiments tested

the role of the SLD nucleus in wild-type mice. Wild-type mice are hypocretin intact, and therefore,

do not naturally exhibit cataplexy. Consequently, it was impossible to test if inhibition of the SLD

nucleus can reduce the number of cataplexy events as they do not occur in the wild-type animals.

However, narcoleptic mice (hypocretin knockout mice; hypocretin-/-) lack hypocretin signaling and therefore, exhibit episodes of cataplexy (Chemelli et al., 1999; Burgess and Peever, 2013).

Therefore, in this chapter, I tested the hypothesis if inhibition of the SLD could reduce the number of cataplexy events. Contrary to my hypothesis, inhibition of the SLD nucleus was not found to

influence the number of episodes, duration or overall amount of cataplexy (See Figure 4.5B-D).

Why did inhibition of the SLD cells not modulate cataplexy expression? Cataplexy can

result in less than 10-episodes over a three hour recording period. Moreover, it can reach levels as

low as 1 or zero episodes (Burgess et al., 2010; Burgess et al., 2013; Burgess and Peever, 2013;

Snow et al., 2017). This irregular nature of expression can make it difficult to study the role of the

SLD in loss of function experiments (Mochizuki et al., 2004). Therefore, it is possible that

reductions in cataplexy expression from inhibition of the SLD were masked by the low number of

episodes that occurred in the experiments. Finally, it is possible that several mechanisms are

involved in the generation of cataplexy (i.e. the LC) and these mechanisms also need to be

modulated in conjunction with inhibition of the SLD region to prevent cataplexy.

4.3.2 Manipulation of the SLD exacerbates cataplexy but does not increase the amount of REM sleep

While it is a significant finding that activation of the SLD nucleus promotes the number of

cataplexy episodes, it does raise the question as to why cataplexy is triggered, whereas, REM sleep

was not induced. There are several possible explanations for this. Since, only the activity of the

SLD nucleus was being influenced, the rest of the brain regions comprising the sleep-wake

network was still operating in wake mode (Brown et al., 2012). That is to say, wake promoting

regions such as the LC and TMN, were still driving wakefulness (Brown et al., 2012). Therefore,

activation of the SLD itself may have not been sufficient enough to produce a dynamic shift in the

network to induce the REM sleep state because other wake-promoting regions remained active and

support the state of wakefulness. Just as wakefulness is produced through a distributed network of

brain region, so too is REM sleep (Brown et al., 2012). Drucker-Colin & Pedraza (1983) showed

that REM sleep was not purely reliant on the SLD activation and suggested that REM sleep results

from the activation of multiple cell groups that organize together in a complicated system.

Therefore, generating the REM sleep state may require more than just the exclusive activation of

the SLD nucleus.

While the focus of many publications has been on the relationship of the SLD nucleus and

REM sleep it is worth noting that the SLD nucleus is heterogeneous in its composition (Lu et al.,

2006). Cells within the SLD nucleus are known to be active during wakefulness in addition to their activity during REM sleep (Cox et al., 2016). Thus, since all cells were targeted, it is possible that activation was not specific to REM generator neurons. Thus, activation of wake promoting SLD

neurons, as well as the neurons regulating REM sleep paralysis may have occurred. This

combination has the potential to trigger a dissociated state of cataplexy – wakefulness with paralysis. Lastly, a recent publication demonstrated that there are neurons within the SLD nucleus

which function to inhibit REM sleep (Hayashi et al., 2015). It is conceivable that a combination of

cells, which have discrete functions, were activated and lead to the promotion of wakefulness, the

suppression of the REM sleep state and the initiation of paralysis. The results of this chapter,

therefore, highlight the complexity of the SLD nucleus and advocate for future experiments to

tease apart its sub-circuits.

There is evidence to suggest that there are functionally discrete anatomical regions within

the SLD nucleus. Lesion experiments have demonstrated that the dorsal portion of the SLD nucleus

functions to control the expression of REM sleep, whereas, the support of muscle paralysis stems

from the ventral segment of the SLD nucleus. Since the anatomical organization of the SLD

nucleus may underline the behavioral outcome (i.e., muscle paralysis vs REM generation), the lack

of REM sleep expression may be explained by an insufficient activation of the dorsal SLD

neurons. This insufficient activation of the dorsal SLD neurons could have occurred by a lack of

viral transfection, hM3Dq receptor turnover or simply due to more neurons in the ventral SLD

nucleus expressing the chemogenetic receptor.

With respect to the inhibition experiments, one may ask why there was no reduction in

REM sleep. First, as mentioned in the previous paragraph, it is possible that an insufficient number

of dorsal SLD neurons were targeted and therefore, these dorsal cells which are involved with

REM sleep expression were not inhibited. Secondly, the experiments here were performed during

the dark phase, as this is the period of when mice experience cataplexy. While mice are polyphasic

sleepers, it is important to note that the dark phase is when mice are more active and have minimal

amounts of REM sleep (Mochizuki et al., 2004; McShane et al., 2012). Therefore, it is probable

100

that SLD inhibition failed to show any reduction in the amount of REM sleep due to a “floor

effect”. Using a different experimental paradigm, where experiments are performed during the

light phase, our laboratory is investigating the specific question pertaining to how the SLD nucleus

regulates REM sleep expression.

Finally, a limitation to the chemogenetic approach is that it is impossible to know what

behavioral state the animal will be in when the cells are activated or inhibited by CNO. Activation

of chemogenetic receptors (i.e., hM4Di or hM3Dq) is dependent on the binding of CNO, and while there is the general idea that the effect will occur within 15-45 minutes after an i.p. injection, it’s impossible to predict the state the animal will be in when that occurs (Alexander et al., 2009). This is important because Xi & Chase (2010) demonstrated activation of the SLD nucleus produced different results depending on the state of the animal. For instance, wakefulness was promoted if pharmacological stimulation of the SLD nucleus occurred during wakefulness, whereas, the same activation parameter during sleep shifted the behavioral state into REM sleep (Xi and Chase,

2010). Therefore, it is possible that the CNO was activating the SLD nucleus at a time that supported the encouragement of the wakefulness state.

4.3.3 Technical Considerations

These experiments used chemogenetics, and one limitation of this approach is the inability

to control stimulation parameters and timing. Once the CNO activates the receptors, their activity

is triggered for several hours and a current gap in the literature is how the SLD neurons respond

when activated or inhibited via chemogenetic receptors. It is known that cells expressing the

chemogenetic receptors have resting membrane potentials that are raised (hM3Dq) or lowered

(hM4Di) but what is unknown in what way the neurons behave in vivo (i.e. the pattern of neural

firing) (Anacker et al., 2018). For example, do the SLD neurons expressing the chemogenetic

101

receptors undergo bursting or is the activity of the neurons a constant set of action potentials.

Previous, literature has suggested that there is a bursting like activity of the excitatory chemogenetic receptor when tested in vitro (Alexander et al., 2009). This bursting may explain why activating SLD neurons did not result in prolonged episodes of cataplexy, known as status cataplecticus, and rather an oscillation between wake with proper motor control and cataplexy. It

is also impossible to know if all cells activated by chemogenetic receptors are firing in phase, or

if clusters of various cell populations are discharging out of phase with one another. The different

discharge patters may be what attributed to the constant ebb and flow between wakefulness and

wakefulness with paralysis (i.e. cataplexy) that resulted in the increased number of cataplexy rather

than modulations in the length of the episodes.

With respect to the chemogenetic inhibitory experiments, cataplexy was not abolished. It

is possible that not all neurons controlling muscle paralysis expressed the chemogenetic receptor

and therefore, initiation of cataplexy circuits was still able to overcome SLD inhibition and trigger

muscle paralysis during wakefulness. Additionally, there exists a general lack of understanding

within the field of how the chemogenetic inhibition operates in these SLD cells – i.e., are all cells

inhibited at the same time and is it constant inhibition or does a cycling of the inhibition occur. If

it is not constant inhibition, this may allow cataplexy to occur at periodic intervals when the

chemogenetic inhibition wanes.

Finally, there is a large amount of excitatory input into the SLD nucleus, which may

outweigh the reductions in resting membrane potential caused by the chemogenetic inhibitory

receptors. This excitatory input is thought to originate from cholinergic regions (i.e. LDT/PPT)

and glutamate from currently unknown regions (i.e. suspected LPT/VLPAG) (Boissard et al.,

2003). It is possible that the inhibitory chemogenetic receptor is not able to reduce the threshold

enough to overcome the excitatory input in the SLD nucleus. Future experiments could rectify this

102

situation through the use of optogenetics and the ArchT inhibitory photo-receptor. ArchT, is a

light-driven outward proton pump (Han et al., 2011). This receptor would be advantageous because

unlike the slower G-protein coupled receptor dependent on subcellular cascades, ArchT dynamics

operate on a proton pump (Han et al., 2011). It is, therefore, faster and more potent than the chemogenetic subcellular cascades since it produces complete silencing of the neurons (Han et al.,

2011). Furthermore, due to the temporal control of optogenetics, one could time the inhibition of

SLD neurons to the precise moment of a cataplexy episode. This method would be a convincing

demonstration for the role of these neurons in the paralysis of cataplexy (Han et al., 2011).

The results here demonstrate that cataplexy can be triggered by the activation of the SLD

nucleus. What unfolds from this finding is a more difficult question: where does the source of

input, that causes the SLD nucleus to become inappropriately activated and trigger cataplexy in narcoleptic mice, originate from? Unfortunately, the sources of input to the SLD nucleus are not well characterized (Boissard et al., 2003). For example, it is known that cholinergic input to the

SLD comes from the LDT and PPT but it was recently shown to be more involved in the process of encouraging the transition to REM sleep from NREM sleep and not a potent initiator of the state

(Grace et al., 2014; Torontali et al., 2014). It is more likely that a combination of disinhibition and maintained excitatory glutamatergic input to the SLD nucleus is responsible for activation of muscle paralysis, however, where this input originates from is largely uncharacterized and unknown (Boissard et al., 2003). While this input is unknown, it is currently suspected to derive from the neurons residing in the LDT/PPT, VLPAG, and potentially the LPT areas (Boissard et al., 2003). Understanding where the excitatory input to the SLD originates from and how these

regions pathologically trigger activity within the SLD nucleus during wakefulness would help clarify the cascade failure within the brain circuitry responsible for cataplexy.

103

4.4 Conclusion

Based on my findings, I propose that the SLD nucleus, which functions to elicit the muscle paralysis of REM sleep, becomes active inopportunely during wakefulness resulting in cataplexy.

The results in this chapter demonstrate that activation of the SLD nucleus promotes the number of cataplexy episodes, while inhibition of this region did not show any significant changes to the overall expression of cataplexy. It remains unknown why inhibition did not reduce cataplexy expression. Taken together, these results suggest that SLD neurons have the capacity to exacerbate cataplexy. This indicates that REM sleep and cataplexy share a common neural mechanism governing their paralysis. Future work is required to detail what cellular phenotype and mechanism within the SLD nucleus operates to generate the paralysis of cataplexy. Also, identifying where the excitatory input, which leads to the engagement of neuronal activity within the SLD nucleus during wakefulness, originates from would aid in the further understanding of this pathological state. Uncovering these variables will lead to a greater understanding of how other brain regions communicate with the SLD nucleus and how the circuitry within the SLD nucleus malfunction to result in the manifestation of cataplexy. This will help focus therapeutic strategies to better alleviate cataplexy episodes.

104

Chapter 5: Selective activation of VGLUT2-expresing SLD neurons decreases muscle tone during wakefulness in wild-type mice

5.1 Overview

In Chapter 3, I demonstrated that activation of SLD cells triggered cataplexy in wildtype.

In this chapter, I used a combination of behavioral, electrophysiological, immunohistochemical, in situ hybridization and chemogenetic methodologies to determine which cellular population within the SLD nucleus was responsible for this effect (Refer to Chapter 2 for detailed methods).

Since Valencia Garcia et al., (2017) demonstrated VGLUT2-expressing SLD cells control REM sleep paralysis, I targeted the excitatory chemogenetic receptor hM3Dq to the VGLUT2-SLD neurons in wildtype mice. Using this strategy I tested whether the activation of this cellular population could trigger cataplexy. First, I established that chemogenetic receptors could be selectively targeted to VGLUT2-expressing SLD neurons. Next, I demonstrate that chemogenetic activation of hM3Dq-expressing VGLUT2-SLD neurons did not induce cataplexy in wildtype mice, rather, a significant decrease in overall muscle activity was observed during wakefulness.

5.2 Results

5.2.1 Chemogenetic receptors were selectively expressed in VGLUT2-SLD cells

After demonstrating that broad activation of the SLD nucleus triggers cataplexy in wildtype and narcoleptic mice (Chapter 3 and 4), my next aim was to identify which cellular subtype within the SLD nucleus was responsible for this effect. Existing literature suggests that VGLUT2- expressing neurons in the SLD reside at the core of the brainstem circuit generating REM sleep

105

paralysis (Clement et al., 2011; Cox et al., 2016; Valencia Garcia et al., 2017). Since cataplexy is

thought to result from the manifestation of REM sleep paralysis, I investigated the role of

VGLUT2-SLD cells in triggering cataplexy (for detailed methods refer back to chapter 2). Before

I could use behavioral experiments to assess the role of VGLUT2-SLD neurons in mediating the expression of cataplexy, I had to verify that hM3Dq receptors could be selectively targeted to

VGLUT2-expressing SLD neurons. To do this, I used a combination of in situ hybridization against VGLUT2 mRNA and immunohistochemistry against chemogenetic receptors. The results confirm that the SLD is populated with VGLUT2-expressing neurons, but chemogenetic hM3Dq

receptors were found to be widely co-localized with these cells (Figure 5.1A). Using three

representative coronal slices (-5.29, -5.34, -5.40 mm; Anterior/Posterior relative to bregma) from

three animals, I demonstrated that the proportion of VGLUT2-positive cells which also expressed

mCherry was 97 ± 1% SEM but the average number of mCherry-positive cells that also expressed

VGLUT2 was 91 ± 5% SEM (See Figure 5.1B). This suggested that the following set of behavioral

experiments applying CNO-based manipulations would predominantly target VGLUT2-

expressing cells of the SLD nucleus.

5.2.2 Chemogenetic activation of VGLUT2-SLD resulted in decreased muscle activity during wakefulness.

It is important to recall that VGLUT2-Cre mice are phenotypically similar to wild-type

mice and therefore, do not normally express cataplexy because their hypocretin system is intact.

Nevertheless, broad chemogenetic activation of all SLD cell-types was found to trigger cataplexy

(See Chapter 3). After confirming selective targeting of chemogenetic hM3Dq receptors to

VGLUT2-SLD neurons (Figure 5.1A, B), I sought to determine if selective activation of VGLUT2-

SLD cells could produce cataplexy in wildtype mice. In eight VGLUT2-Cre mice, I successfully

targeted hM3Dq receptors to VGLUT2-SLD cells (Figure 5.1C). Remarkably, activation of these

106

neurons did not produce any gross behaviors resembling cataplexy (Figure 5.2C). Specifically, there were no electrophysiological or behavioral signs of sudden and complete loss of muscle tone during wakefulness (i.e. cataplexy).

The lack of cataplexy following CNO-induced activation of hM3Dq-expressing VGLUT2-

SLD neurons was unexpected because based on previous results, I hypothesized that VGLUT2- expresing SLD neurons were responsible for triggering muscle paralysis during cataplexy.

However, cataplexy attacks range from bilateral partial muscle weakness to complete muscle paralysis resulting in collapse (Dauvilliers et al., 2007; Overeem et al., 2011; Pillen et al., 2017).

To that end, I quantified the overall level of muscle activity of wakefulness under saline control conditions and contrasted it with the level of muscle activity after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons. While there was no significant difference, there was a general trend for reduced muscle tone in the neck muscle following CNO-induced activation of

VGLUT2-expressing neurons (Neck muscle tone; saline vs CNO, Wilcoxon signed-rank test, W=-

19, p=0.0625, Figure 5.2C). Compared to saline, the level of tone in the masseter muscle during wakefulness was significantly reduced following CNO-induced activation of hM3Dq-expressing

VGLUT2-SLD neurons (Masseter muscle tone; saline vs CNO, Wilcoxon signed-rank test, W=-

32, p=0.0234, Figure 5.2A,B). This suggested that engaging the VGLUT2-SLD neurons, known to be involved in the muscle paralysis of REM sleep, influenced overall levels of muscle tone during wakefulness. While this had no effect on purposeful mouse behavior, it is a biological marker demonstrating effective CNO-induced activation of VGLUT2-SLD neurons and supports previous findings that VGLUT2-SLD neurons function to suppress muscle activity.

107

Figure 5.1 Chemogenetic hM3Dq receptors are expressed in VGLUT2-SLD neurons. A. Confocal imaging demonstrating Top row: mCherry fluorescence (red), which encompassed the SLD where VGLUT2 cells predominate (green). Most cells expressing mCherry also expressed VGLUT2 (yellow; merge image). Bottom row: An example demonstrating co-expression of mCherry (red), VGLUT2 mRNA (green) and a nuclear marker (DAPI, blue) in a single SLD neuron B. Quantification (mean + SEM, n=3) of the number of VGLUT2-positive cells that also expressed mCherry (96.5% ± 1.3%) and number of mCherry-positive cells that also expressed VGLUT2 (91.1% ± 5.2%) C. Stereotaxic maps and a representative immunohistochemical example of the demonstrating location of hM3Dq receptors with mCherry fluorescent tag expressed in VGLUT2-expressing SLD neurons of 8 mice. Note that the expression was found to be encompassing the SLD nucleus.

108

Since chemogenetic activation operates on a time course of hours it was possible that active

inhibition also affected sleep states. Therefore, muscle activity in both the masseter and neck

muscles were measured during NREM sleep and REM sleep states. During NREM sleep neither

the neck nor the masseter muscles were found to be significantly altered after CNO-induced

activation of hM3Dq-expressing VGLUT2-SLD neurons (saline vs CNO: Neck muscle tone,

paired t test, t(3)=2.349, p=0.1004; Masseter muscle tone, paired t test, t(5)=1.178, p=0.2917,

Figure 5.4D). Similar to NREM sleep, muscle activity during REM sleep was unaffected by

chemogenetic activation of VGLUT2-SLD cells (saline vs CNO: Neck muscle tone, unpaired t test, t(7)=0.8358, p=0.4308; Masseter muscle tone; saline vs CNO, paired t test, t(4)=0.1627,

p=0.8811, Figure 5.5D). Thus, CNO-induced activation of hM3Dq-expressing VGLUT2-SLD

neurons only produced decreases in muscle tone during wakefulness and not sleep states. Since

both NREM sleep and REM sleep have reduced muscle tone compared to wakefulness, any

reductions in muscle tone that CNO-induced activation may have induced during NREM sleep and

REM may have been masked and unable to reach statistical significance due to a “floor effect”.

5.2.3 Chemogenetic activation of VGLUT2- SLD neurons did not alter sleep- wake architecture

In Chapter 3, activation of all SLD neurons impacted sleep and wake architecture.

Furthermore, two separate VGLUT2-expressing SLD neuron populations have been shown to exist in the SLD (Cox et al., 2016). One population was shown to be active during REM sleep, and the other during wakefulness. Together, this suggests a possible role for the VGLUT2-SLD neurons in sleep-wake control. Furthermore, while loss-of-function experiments had selectively implicated the VGLUT2-expressing SLD neurons in the control of REM sleep expression, no experiments to date had tested the outcome of activating VGLUT2-SLD neurons. Therefore, I investigated the

109

outcome of chemogenetic activation of VGLUT2-expressing SLD neurons on sleep and wake architecture (Figure 5.3A).

First, I examined wakefulness after CNO-induced activation of hM3Dq-expressing

VGLUT2-SLD neurons. There was no significant change in the percentage of time spent in wakefulness following chemogenetic activation of VGLUT2-expressing SLD neurons (saline vs

CNO: paired t test, t(7)=1.606, p=0.1523, Figure 5.3B). Compared to saline, no changes were

found in the number of wake bouts (saline vs CNO: paired t test, t(7)=0.6424, p=0.5411, Figure

5.3C) or the average length of wake bouts (saline vs CNO: paired t test, t(7)=2.036, p=0.0812,

Figure 5.3D) following CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons.

NREM sleep was unaffected by CNO-induced activation of hM3Dq-expressing VGLUT2-

SLD cells. More specifically, compared to saline no significant changes to the overall time spent

(saline vs CNO: paired t test, t(7)=1.511, p=0.1746, Figure 5.4A) duration (saline vs CNO:

unpaired t test, t(12)=0.3984, p=0.6973, Figure 5.4C) or number of episodes (saline vs CNO:

Wilcoxon matched-pairs signed rank test, W=-10, p=0.5469, Figure 5.4B) were seen following

CNO-induced activation of hM3Dq-expressing VGLUT2-expressing SLD neurons.

Contrary to my hypothesis and unlike chemogenetic activation of all neurons in the SLD of Chapters 3 and 4, CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons did not alter any REM sleep parameters. Compared to saline, the total time spent in REM sleep was not significantly different following CNO-induced activation of hM3Dq-expressing VGLUT2-

SLD neurons (saline vs CNO: Wilcoxon matched-pairs signed rank test, W=-14, p=0.3828, Figure

5.5A). Similarly, neither the average duration of REM sleep episodes (saline vs CNO: unpaired t test, t(14)=0.2589, p=0.7995, Figure 5.5C) nor the number of REM sleep episodes was found to be

110

Figure 5.2 Chemogenetic activation of VGLUT2-SLD neurons produces muscle weakness. A. Electromyographic traces during wakefulness demonstrating the amount of muscle activity under saline control conditions and after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons. Note the decrease in overall activity of the muscle. B. Group data (MEAN + SEM) showing CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons resulted in a decrease in overall muscle activity during wakefulness in the masseter. C. Group data (MEAN+ SEM) showing no changes in muscle activity were found in the neck following CNO-induced activation of the VGLUT2-SLD neurons. n.s. denotes not significant and * denotes p<0.05 when compared to saline.

111

Figure 5.3 Chemogenetic activation of VGLUT2-SLD neurons does not affect wakefulness. A. Two representative hypnograms demonstrating the overall distribution of sleep and wakes states after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons. B. Group data (MEAN+SEM) demonstrating no significant difference in the overall time spent in wakefulness after CNO-induced activation of hM3Dq-expressing VGLUT2- SLD neurons when compared to saline controls. C. No significant changes were found to the mean number of episodes (MEAN+SEM) and D. the average durations of wake bouts (MEAN+SD) after CNO-induced activation of hM3Dq- expressing VGLUT2-SLD neurons. n.s. denotes not significant and * denotes p<0.05 when compared to saline.

112

Figure 5.4 The NREM sleep state was unaffected by chemogenetic activation of VGLUT2-SLD neurons. There were no significant changes to the NREM sleep state with respect to total time spent in the state (A), mean number of NREM sleep episodes (B), nor the average duration of the NREM sleep episodes (C) when comparing CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells back to saline controls. There was no difference found in muscle activity of the masseter or the neck muscles (D) during NREM sleep when saline conditions were compared to CNO- induced activation of hM3Dq-expressing VGLUT2-SLD neurons. All group data is shown as MEAN+SEM, n.s. denotes not significant and * denotes p<0.05 when compared to saline.

113

Figure 5.5 Chemogenetic activation of VGLUT2-SLD neurons does not alter REM sleep. Total time spent in REM sleep (A), the mean number of REM sleep episodes (B), nor the average duration of the REM sleep episodes (C) were not found to be significantly different when comparing CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells back to saline controls. D. Furthermore, there was no difference found in overall muscle activity of the masseter or the neck during REM sleep when CNO-induced activation of SLD neurons was compared to saline controls. All group data is shown as MEAN+SEM, n.s. denotes not significant and * denotes p<0.05 when compared to saline.

114 significant (saline vs CNO: Wilcoxon matched-pairs signed rank test, W=-15, p=0.3281, Figure

5.5B). Taken together, the findings suggest that chemogenetic activation of the VGLUT2-SLD neurons did not induce significant changes to REM sleep expression.

5.3 Discussion

Here, I hypothesized that activation of VGLUT2-SLD neurons would trigger episodes of cataplexy. This hypothesis was based on a combination of my findings in Chapter 3, that demonstrated activation of all cell-types within the SLD nucleus triggered cataplexy and previous literature demonstrating a role for VGLUT2-expressing SLD neurons in the control of REM sleep paralysis. After confirming chemogenetic receptors could be selectively targeted to VGLUT2- expressing SLD neurons, I demonstrated that activation of VGLUT2-SLD neurons did not induce episodes of cataplexy in VGLUT2-Cre mice. However, it did result in a decrease in muscle tone during wakefulness (i.e. muscle weakness) similar to what is experienced by narcoleptic patients.

Chemogenetic activation of VGLUT2-SLD neurons did not result in any changes to the number of wake episodes or the length of these episodes. Finally, compared to saline controls, CNO- induced activation of hM3Dq-expressing VGLUT2-SLD neurons did not result in any alterations of total time spent, number of episodes, average duration or muscle tone during the NREM sleep and REM sleep states.

5.3.1 Chemogenetic activation of VGLUT2-SLD neurons induces muscle weakness during wakefulness

Previously, in Chapter 3, I demonstrated with wild-type mice that chemogenetic activation of all cell types in the SLD nucleus resulted in cataplexy (i.e. periods of complete paralysis).

Unpublished results from our laboratory, as well as, previous literature by Lu et al., (2006) and

Valencia Garcia et al., (2017) have demonstrated that VGLUT2-SLD neurons function in the

115

control of muscle paralysis during REM sleep and therefore, I hypothesized that chemogenetic

activation of this neuronal population would produce cataplexy. Contrary to my hypothesis, CNO-

induced activation of the VGLUT2-SLD neurons failed to induce complete paralysis (i.e.

cataplexy). However, during wakefulness an overall decrease in muscle tone occurred after CNO-

induced activation of hM3Dq-expressing VGLUT2-SLD neurons when compared to saline conditions.

The production of muscle weakness after CNO-induced VGLUT2-SLD activation is consistent with my hypothesis as narcoleptics do not only suffer from complete loss of motor control. In fact, the presentation of cataplexy varies widely from partial episodes affecting only the face and neck, to full paralysis of postural muscles that can lead to the patient collapsing (Pizza et al., 2018). Self-reported questioners reveal that 65% of narcoleptics experience muscle weakness at least once a day (Pizza et al., 2018). Facial flickering or jaw dropping due to the loss of muscle tone (i.e. muscle weakness) is the most visually discernable characteristic of both partial and complete cataplexy in humans (Anic-Labat et al., 1999). In fact, the facial muscles are involved in 94% of cataplexy attacks (Pizza et al., 2018). Furthermore, it was shown that out of all partial attacks observed only one did not have facial hypotonia (Pizza et al., 2018). Thus, the decrease in overall masseter muscle activity during wakefulness produced by CNO-induced activation of the SLD neurons was consistent with my hypothesis and suggests a role for the

VGLUT2-expressing SLD neurons in motor loss during partial cataplexy.

Recent experiments by Snow et al., (2017) demonstrated that chemogenetic stimulation of the amygdala increased the amount of cataplexy in narcoleptic, hypocretin deficient, animals.

However, the induction of cataplexy failed to occur in animals with hypocretin intact systems despite using the same chemogenetic approach (Snow et al., 2017). It was speculated that the difference between the animals was due to a functioning hypocretin system (Snow et al., 2017).

116

How would hypocretin serve to protect motor activity? Hypocretin is known to innervate many of the main monoaminergic brain regions (Peyron et al., 1998). These monoaminergic systems function in turn to maintain and support muscle activity during wakefulness (Siegel, 1999).

Furthermore, in addition to exciting monoaminergic brain regions, hypocretin may prevent paralysis by the direct excitation of both spinal and motor neurons (Peever et al., 2003; Yamuy et al., 2004). When cataplexy occurs in narcoleptic animals the monoaminergic regions abruptly stop providing excitatory input onto motor neurons (Wu et al., 1999). In contrast, these monoaminergic systems continue to provide excitatory input to motor neurons throughout wakefulness in hypocretin intact animals. This maintained excitatory input by the monoaminergic system and direct excitation of hypocretin at the level of the motor neurons may have offset the inhibitory input driven by chemogenetic activation of VGLUT2-SLD neurons. Hence, muscle weakness occurred instead of complete paralysis due to VGLUT2-Cre mice having intact hypocretin signaling. These findings are complimentary to both the conclusions and the hypothesis put forth by Snow et al., (2017) where it was suggested that hypocretin may serve as a protective mechanism preventing muscle paralysis to occur during wakefulness. Future experiments can test if VGLUT2-

SLD neurons are involved with triggering cataplexy in the absence of hypocretin using the same experimental methods and paradigm but in a hypocretin deficient narcoleptic knockout mouse (See

Chapter 6). Based on my findings and the results of Snow et al., (2017), I hypothesize that in the absence of hypocretin chemogenetic activation of VGLUT2-SLD neurons will lead to complete muscle paralysis (i.e. cataplexy). This would shed light on how cataplexy and muscle weakness can occur in narcoleptics but not non-narcoleptics with intact hypocretin systems. Thus, muscle weakness instead of full muscle paralysis may have occurred because hypocretin excitation of motor neurons serves to compensate for any inhibition of the motor neurons induced by VGLUT2-

SLD neurons.

117

5.3.2 Chemogenetic activation of VGLUT2-SLD cells preferentially affected the masseter muscles

I demonstrate that CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons

leads to significant decreases in masseter muscle activity but fails to do the same in the neck

muscle. Experiments have demonstrated that both of these muscles are often differentially

controlled (Anaclet et al., 2010). For example, lesions of a brainstem region known as the rPCRt modulated masseter activity but left the neck unaffected (Anaclet et al., 2010). The authors suspected that the difference in muscle regulation was due to the fact that the masseter is a cranial muscle and the neck is postural muscle (Anaclet et al., 2010). Furthermore, it has been suggested

that these two muscles may be innervated by different neural circuitry (Anaclet et al., 2010). While

it is known that monoaminergic systems do project directly to motor neurons, the amount of

excitation onto the motor neurons controlling these muscles is not known and may differ (Espana

and Scammell, 2011). Thus, the neck may receive a greater amount of excitatory input from monoaminergic systems (i.e. Locus Coeruleus) that offsets the paralysis inducing effects triggered

by CNO-induced VGLUT2-SLD activation.

In both partial and complete cataplexy attacks, slow motion recordings have demonstrated

that the hypotonia begins in the facial musculature and then cascades towards the trunk and limbs

(Pizza et al., 2018). This propagation of paralysis from the facial muscles to the neck muscles may be dependent on the number of VGLUT2-SLD cells being recruited. It is conceivable to assume

an insufficient amount of VGLUT2-SLD neurons were inhibited by the chemogenetic approach to

produce full and complete muscle paralysis or that other brain regions (i.e. the excitatory input of

the LC onto motor neurons) were able to compensate for the inhibition of the SLD region.

118

5.3.3 Chemogenetic activation of all cell types in the SLD produced cataplexy whereas selective VGLUT2-SLD neuron activation resulted in muscle weakness

Previously in Chapter 3, I demonstrated that activation of all cell types produced cataplexy

in wild-type, hypocretin intact mice. Here, using hypocretin intact mice, I demonstrate that only

partial muscle paralysis, not cataplexy, could be induced following activation of a subset of SLD

neurons – the VGLUT2-expressing population. It is possible that complete paralysis (i.e.

cataplexy) did not occur due to an insufficient amount of VGLUT2-expressing SLD cells being

chemogenetically activated.

An alternative explanation as to why cataplexy failed to occur following chemogenetic

activation of the VGLUT2-expressing SLD neurons, is that these neurons either play a minor role

or may not be involved in the generation of cataplexy. A current gap in the literature and a major

obstacle that has prevented the complete understanding of REM sleep and cataplexy circuitry is

the lack of genetic identification and categorization of cell phenotypes within the SLD nucleus.

However, previous work has demonstrated that the SLD nucleus contain both GABAergic neurons and VGLUT2-expressing neurons (Boissard et al., 2003; Cox et al., 2016). Thus, when activating all cells in the SLD, as done in Chapter 3, it is possible that multiple discrete cellular populations were being activated (i.e. GABA cells and glutamate cells). These results further add to the intricacy of the SLD nucleus and strongly encourages future work to chart the internal SLD nucleus sub-circuit as well as the SLD nucleus’s projections. It is possible that other neuron populations within the SLD play a more significant role in cataplexy than the VGLUT2-expressing SLD neurons. Future experiments could systematically continue to dissect the role of these other neuronal populations within the SLD nucleus to assess their role on the regulation of cataplexy.

Since the SLD nucleus has been shown to have GABAergic neurons within it, the next logical investigation would involve the examination GABAergic SLD neurons on the regulation of

119

cataplexy expression. Defining the cellular composition and the discrete functions of cellular

populations within the SLD would be invaluable in producing an accurate model of how paralysis

is generated during cataplexy. It may also help reveal novel and more effective therapeutic targets

for cataplexy management.

5.3.4 Chemogenetic activation of VGLUT2-SLD neurons did not trigger REM sleep

Chemogenetic activation of the VGLUT2-SLD neurons did not trigger REM sleep nor did

it alter any aspect of REM sleep expression (i.e., duration, muscle tone, etc). One possible

explanation for this is based on a limitation for the experimental methodology employed –

chemogenetics. The advantage to chemogenetics is that it allows for precise targeting of VGLUT2

neurons, however, the disadvantage is lack of temporal precision of activation. Once an i.p. injection of CNO is administered it is impossible to know what state the animal will be in once

CNO binds to the chemogenetic receptors. This is relevant as Xi & Chase (2010) demonstrated that activation of the SLD nucleus during wakefulness will prolong the wake state, whereas, activation of the SLD nucleus during NREM sleep will cause a transition into REM sleep. Thus, activation of the chemogenetic receptors within the SLD may have occurred during wakefulness and thus re-enforced wakefulness rather than the induction of REM sleep.

Multiple brain regions are known to be active during REM sleep and therefore, induction of the state may require a tightly orchestrated set of interactions across this network (Brown et al.,

2012). This is supported by findings from Karczmar et al., (1970) where it was demonstrated that

under depletion of monoamines, the wake promoting neurotransmitters from wake brain regions,

administration of cholinergic agonists can induce REM sleep. However, under conditions where

monoamines were not reduced, like during wakefulness, similar delivery of cholinergic agonists

resulted in promoting wakefulness. This highlights the functional role that the monoaminergic

120 system plays in regulating the outcome of behavioral states. Since the experiments were performed during the dark phase, a period dominated by wakefulness, it is possible that chemogenetic activation of the VGLUT2-SLD cells coincided when the monoaminergic systems were “online”.

Therefore, chemogenetic activation of the VGLUT2-SLD neurons may not have been able to induce REM sleep in the presence of functioning monoaminergic systems.

It is possible that the VGLUT2-SLD neuronal population does not function in the induction of the REM sleep state, rather, it just modulates a component of the sleep state. This is demonstrated by the fact that selective activation of VGLUT2-SLD cells was not able to dynamically shift the network from wakefulness into REM sleep state, but, chemogenetic activation of these VGLUT2-SLD neurons was able to trigger the reductions in masseter muscle activity. These findings are compatible with Lopez et al., (1994) where it was determined that the

REM sleep state itself may be sensitive to the overall state of the network, but circuitry mediating

REM sleep paralysis is able to be triggered and function independent of network state.

Finally, there is evidence of an anatomical segregation of function within the SLD nucleus.

Using lesions, Lu et al., (2006) demonstrated that the dorsal portion of the SLD nucleus functionally controls the manifestation of the REM sleep state, whereas, the ventral portions of the

SLD function to maintain muscle paralysis during REM sleep. Therefore, an insufficient number of dorsal SLD neurons may have been activated and thus, no significant changes were observed in the expression of REM sleep. Furthermore, within the SLD nucleus there is evidence of different cellular populations having discrete functions. Lu et al., (2006) demonstrated that GABAergic

SLD neurons are involved in the control of REM sleep expression, whereas, there has been some debate as to the functional role of the glutamatergic (VGLUT2-expressing) SLD neurons. Multiple publications have demonstrated that the VGLUT2-SLD neurons are active during the REM sleep state, however, a recent publication, using loss of function experiments, suggested that these

121 neurons are specifically involved with the control of muscle paralysis during REM sleep rather than generators of the REM sleep state (Clement et al., 2011; Cox et al., 2016; Valencia Garcia et al., 2018). Thus, it is possible that the reason REM sleep failed to be induced following chemogenetic activation of VGLUT2-SLD neurons is because the VGLUT2-SLD neurons are not involved in regulating the expression of the REM sleep state, rather, they function to engage and maintain the paralysis of REM sleep.

5.4 Conclusion

Selective chemogenetic activation of VGLUT2-SLD neurons resulted in a decrease in overall muscle activity during wakefulness. While complete paralysis (i.e. cataplexy) was not observed, this data suggests that the inappropriate activation of the VGLUT2-SLD cells during wakefulness can lead, at minimum, to muscle weakness. However, it remains unclear as to which cell-types within the SLD nucleus triggers complete cataplexy.

122

Chapter 6: Selective manipulation of VGLUT2-expressing SLD neurons regulates cataplexy in narcoleptic mice

6.1 Overview

The results of Chapter 3&4 demonstrate that activation of the SLD nucleus can exacerbate

cataplexy in narcoleptic mice and trigger cataplexy in wildtype mice. Based on previous literature

suggesting VGLUT2-SLD neurons are involved with REM sleep paralysis I hypothesized that the

VGLUT2-expressing SLD (VGLUT2-SLD) neurons are responsible for triggering cataplexy.

Although, VGLUT2-SLD neurons did not trigger complete paralysis in wildtype mice (See

Chapter 5), a recent study demonstrated that chemogenetic activation of the amygdala increased

cataplexy in narcoleptic animals but failed to do so in wildtype (hypocretin intact ) mice (Snow et

al., 2017). Therefore, I set out to determine if VGLUT2-SLD neurons have the capacity to

modulate the expression of cataplexy in narcoleptic mice.

Similar to Chapter 5, I used behavioral, electrophysiological, immunohistochemical, in situ

hybridization and chemogenetic methodology (Refer to Chapter 2 for detailed methods) to test the

behavioral outcome of selectively activating and inhibiting the VGLUT2-SLD neurons in

narcoleptic (hypocretin−/−) mice. Selective chemogenetic activation of the VGLUT2-SLD neurons

resulted in a significant increase in overall amount of cataplexy. I found an increased frequency

of cataplexy episodes in response to the activation of VGLUT2-SLD neurons with no change in

the average duration, which suggests that VGLUT2-SLD neurons have the capacity to trigger but

not maintain cataplexy. Chemogenetic inhibition of VGLUT2-SLD neurons was not found to

reduce the amount or the duration of cataplexy. Here, I show that in the absence of hypocretin

signaling, cataplexy can be trigged by chemogenetic activation of VGLUT2-SLD neurons,

123

suggesting that these neurons have the capacity to trigger cataplexy in narcoleptic mice and are a

component of the circuit mediating cataplexy.

6.2 Results

6.2.1 Narcoleptic mice that express Cre in VGLUT2 neurons exhibit characteristic cataplexy

In order to test the hypothesis that VGLUT2-SLD neurons trigger cataplexy in narcoleptic mice, a new narcoleptic mouse line was needed in order to selectively manipulate VGLUT2 neurons. Therefore, the narcoleptic (hypocretin−/−) mice were crossed with VGLUT2-Cre mice

(Chemelli et al., 1999; Vong et al., 2011). This cross produced the hypocretin−/−,VGLUT2-

Cre mice line which enabled the delivery of hM3Dq or hM4Di chemogenetic receptors to

VGLUT2-expressing neurons via Cre-dependent AAVs through stereotaxic mediated viral delivery to the SLD nucleus.

First, I confirmed that these mice behaved like the narcoleptic founder line. I compared the amounts of cataplexy, sleep attacks, NREM sleep, REM sleep and wakefulness between the hypocretin−/− (n=9) and hypocretin−/−,VGLUT2-Cre (n=6) mice. First, I demonstrate that sleep

and wake architecture remains similar between hypocretin−/− and hypocretin−/−,VGLUT2-Cre. In

particular, I demonstrate that hypocretin−/− and hypocretin−/−, VGLUT2-Cre mice spent similar

times in wakefulness, NREM sleep, and REM sleep (See Table 6.1). Also, the duration and number

of episodes for each behavioral state was not significantly different. The hypocretin−/−,VGLUT2-

Cre mice, much like their hypocretin−/− founder line, exhibited sleep attacks. The sleep attacks

were found to be characteristic in duration and number and showed the characteristic activity in

124

the masseter as defined in Burgess et al., (2010). Collectively, these results suggested that both

genotypes were indistinguishable from one another with respect to sleep and wake architecture.

Both genotypes show cataplexy that is behaviorally and electrophysiological identical. In

both the hypocretin−/− and hypocretin−/−, VGLUT2-Cre mice lines, cataplexy occurred during

wakefulness when mice were engaged in purposeful behaviors (i.e., wheel running, grooming,

eating). The episodes of cataplexy were abrupt, interrupted wake behaviors and were characterized by postural collapse where the mice remained immobile and had a loss of muscle tone in the EMG, and a theta-dominated EEG (See Figure 6.1A). Cataplexy episodes ended suddenly with a rapid resumption of EMG activity and animals returning to the behavior that occurred prior to the episode (See Figure 6.1A). Theta activity in the EEG power spectrum analysis (2-way ANOVA,

F=8.475e-007, p=0.9993, Figure 6.1G), as well as, both the masseter and neck EMG activity were quantified during the cataplexy attack and found to be similar between genotypes recording

(Masseter EMG: unpaired t test, t(13)=1.463, p=0.1671; Neck EMG: unpaired t test, t(13)=1.616,

p=0.1301, Figure 6.1E,F). There was no difference in the overall time spent in cataplexy between

the two groups of mice (unpaired t test, t(13)=1.023, p=0.3248, Fig 6.1B). Likewise, both mice

lines had the same number of episodes in the 3hr recording (unpaired t test, t(13)=0.1016, p=

0.9206, Fig 6.1C) and these episodes were not different in their average duration (unpaired t test,

t(13)=1.686, p=0. 1156, Fig 6.1D).

Taken together, this data demonstrates that the hypocretin−/−,VGLUT2-Cre mouse line

presents cataplexy which is behaviorally and electrophysiologically identical to the cataplexy in the founder hypocretin−/− mouse line. Furthermore, this work provides a genetic tool for

experiments requiring manipulation of VGLUT2-expressing neurons in narcoleptic animals.

125

6.2.2 Chemogenetic receptors are selectively expressed in VGLUT2-SLD cells of hypocretin−/−, VGLUT2-Cre mice

Before I could use behavioral experiments to assess the role of VGLUT2- SLD neurons in

mediating the expression of cataplexy in a narcoleptic model, I had to verify that chemogenetic

receptors (i.e., hM3Dq and hM4Di) could be selectively targeted to SLD neurons expressing

VGLUT2 in our newly developed hypocretin−/−,VGLUT2-Cre mice line. A combination of in situ hybridization against VGLUT2 mRNA and immunohistochemistry to identify chemogenetic receptors was used to determine if VGLUT2-expressing SLD neurons could be transduced by the viral vector. Using these techniques, I verified that the hypocretin-/-,VGLUT2-Cre mouse line

contained VGLUT2-expressing neurons within the SLD. Furthermore, it was found that an

extensive co-localization occurred between VGLUT2-expressing neurons and neurons expressing

the hM3Dq receptor within the SLD nucleus (See Figure 6.2A). Using three representative coronal

slices (-5.29, -5.34, -5.40 mm; Anterior/Posterior relative to bregma) from three animals, I

demonstrated that the proportion of VGLUT2-positive cells also expressing mCherry was 89% ±

6% SEM and the average number of mCherry-positive cells that also expressed VGLUT2 was

83% ± 14% SEM (See Figure 6.2B). This suggested that the following set of behavioral

experiments applying CNO-based manipulations would predominantly target VGLUT2-

expressing cells of the SLD.

126

Figure 6.1. Hypocretin−/− mice that express Cre in VGLUT2 neurons exhibit typical cataplexy. A. A representative example showing an episode of a cataplexy in hypocretin−/−,VGLUT2-Cre mice. Cataplexy is characterized by the abrupt loss of skeletal muscle tone during wakefulness with a theta dominated EEG signature B- E. There were no significant differences in the time spent in, number of episodes of, or average duration of cataplexy attacks in the first 3 h of behavioral recording of hypocretin−/−,VGLUT2-Cre mice compared with hypocretin−/− mice. This newly generated hypocretin−/−,VGLUT2-Cre mouse line exhibits cataplexy that is electrophysiologically indistinguishable from that seen in the founder hypocretin−/− mice as measured by masseter EMG activity E, neck EMG F., and EEG G. All data is expressed as MEAN+SEM, n.s denotes not significant

127

−/− −/− Table 6.1. Behavioral state architecture in hypocretin and hypocretin , VGLUT2-Cre mice

hypocretin−/− mice hypocretin−/−,VGLUT2-Cre mice p-value (n=9) (n=6)

Wake

Time spent in state (%) 81.35 ± 2.90 73.37 ± 7.59 0.2789 Number of Episodes 39.11 ± 5.47 46.17 ± 8.404 0.4731 Mean duration of episodes (s) 325 ± 108.73 244.05 ± 85.41 0.6014

NREM sleep Time spent in state (%) 13.94 ± 2.54 21.07 ± 6.37 0.2556 Number of Episodes 32.67 ± 5.90 40.00 ± 9.16 0.4917 Mean duration of episodes (s) 41.79 ± 5.94 52.53 ± 5.45 0.2318

REM sleep Time spent in state (%) 2.47 ± 0.69 3.92 ± 1.66 0.3757 Number of Episodes 4.11 ± 1.20 8.33 ± 2.60 0.1231 Mean duration of episodes (s) 60.85 ± 9.24 53.22 ± 13.37 0.6395

Sleep attacks Time spent in state (%) 0.87 ± 0.32 0.65 ± 0.24 0.6262 Number of Episodes 2.56 ± 0.85 1.83 ± 0.75 0.5577 Mean duration of episodes (s) 25.10 ± 6.02 43.75 ± 10.83 0.1553

128

Figure 6.2. Verification of chemogenetic receptor expression in VGLUT2-SLD neurons and the location of hM3Dq-expressing VGLUT2-SLD neurons in the SLD nucleus. A. Confocal fluorescent microscope images demonstrating chemogenetic receptor expression in a glutamatergic neuron (green, VGLUT2 mRNA; red, excitatory chemogenetic receptor with mCherry fluorescent tag; The merge is in yellow with blue representing DAPI staining). B. Quantification (MEAN+SEM) of VGLUT2-positive cells that also expressed mCherry (89% ± 6%) and number of mCherry-positive cells that also expressed VGLUT2 (83% ± 14%). C. Right: Stereotaxic maps demonstrating location of hM3Dq (excitatory chemogenetic receptor with mCherry fluorescent tag, red regions) and the control vector that contains mCherry but does not harbor a chemogenetic receptor, grey regions. Left: A representative immunohistochemical example demonstrating glutamatergic SLD neurons expressing the hM3Dq excitatory chemogenetic receptor and its fluorescent tag, mCherry

129

6.2.3 Chemogenetic activation of VGLUT2-SLD neurons increases cataplexy

After demonstrating that chemogenetic receptors could be targeted to the VGLUT2-

expressing SLD neurons, my next goal was to investigate if VGLUT2-SLD neurons are the neural

substrate responsible for triggering cataplexy in a narcoleptic mouse model. Similar to previous

experiments, I targeted the excitatory chemogenetic receptor, hM3Dq, into VGLUT2-expressing

SLD neurons of 6 hypocretin−/−,VGLUT2-Cre mice (Figure 6.2C). To control for the delivery of

AAVs and CNO administration, 5 hypocretin−/−,VGLUT2-Cre mice received an AAV viral

construct lacking the chemogenetic receptor (Figure 6.2C). Due to the results observed in Chapter

4, I hypothesized that activation of the VGLUT2-expressing SLD neurons would increase the

amount of cataplexy experienced by hypocretin−/−,VGLUT2-Cre mice. Compared to saline, CNO-

induced activation of hM3Dq-expressing SLD cells produced a 1415% increase in the number of

cataplexy episodes, from 3 ± 1 to 50 ± 24 episodes (saline vs CNO: paired t test, t(5)=2.04,

p=0.0484, Figure 6.3C), suggesting that VGLUT2-expressing SLD cells function to regulate

cataplexy. While CNO-induced activation of SLD neurons increased the number of episodes, the

total time spent in cataplexy did not reach statistical significance (saline vs CNO: paired t test,

t(5)=1.925, p=0.0561, Figure 6.3B). The duration of cataplexy episodes was unaffected by the

intervention (saline vs CNO: paired t test, t(5)=0.8404, p=0.2195, Figure 6.3D).

Next, I set out to establish that the effects observed following CNO-induced activation of the hM3Dq-expressing SLD neurons was not due to either CNO administration or the AAV-driven expression of a foreign receptor in the SLD nucleus (i.e., hM3Dq). To do this, control viral vectors harboring a functionless protein (i.e., mCherry) were delivered to the SLD nucleus in 5 hypocretin−/−,VGLUT2-Cre mice and the same dose of CNO was administered as for hM3Dq-

expressing animals. I found that the administration of CNO into mice with mCherry-expressing

130

VGLUT2-SLD neurons had no significant effect on the expression of cataplexy (i.e., amount, # of

episodes or average duration), demonstrating that neither CNO nor AAV-driven protein expression

in SLD neurons was responsible for the increase in the number of cataplexy episodes (saline vs

CNO: # of cataplexy episodes: paired t test, t(4)=0.3944, p=0.3567). These results indicate that the

increase in cataplexy episodes was due to CNO-induced activation of hM3Dq-expressing SLD

neurons and not an effect of CNO administration alone or delivery of AAVs.

A stringent comparison of electrophysiological measures was used to confirm that the

behavioral arrests produced under CNO-induced activation of hM3Dq-expressing VGLUT2-SLD

neurons was cataplexy. The CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells

produced episodes of cataplexy with levels of muscle tone indistinguishable from saline (saline vs

CNO: Masseter EMG, paired t test, t(5)=2.05, p=0.0956; Neck EMG, paired t test, t(5)=0.7581,

p=0.4826, Figure 6.4C). The specificity of the CNO effect was tested by observing its innocuous effect in the mice which received the control viral vector harboring the expression of a functionless protein (i.e., mCherry). Similar to hM3Dq expressing animals, CNO administration produced no observable effect on muscle tone when compared to saline conditions saline (saline vs CNO:

Masseter EMG, paired t test, t(3)=0.9593, p=0.4082; Neck EMG, paired t test, t(4)=0.08938,

p=0.9331, Figure 6.4C). Electroencephalographic activity under CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons (2-way repeated-measures ANOVA, F=3.081e-010,

p=0.9999, Figure 6.4B) was indistinguishable from cataplexy under saline control conditions.

Furthermore, control animals receiving the inert viral vector (i.e., mCherry) had no change in EEG

power spectrum after CNO administration (2-way ANOVA, F=0.0134, p=0.9080, Figure 6.4C).

Thus, taking together these results suggest that specific activation of VGLUT2-SLD neurons is

triggers cataplexy.

131

A. CNO, VGLUT2 -SLD Activation Saline WAKE NREM REM S.A. CAT WAKE NREM REM S.A. CAT

0 1.5 3 0 1.5 3 Time (h) Time (h)

B. C. D.

80 80 Saline Saline CNO * CNO

40 40

of duration Mean cataplexy episodes(s) # of cataplexy episodes 0 0 Time Spent in cataplexy (%) in cataplexy Spent Time mCherry hM3Dq mCherry hM3Dq

Figure 6.3. Chemogenetic activation of VGLUT2-SLD neurons in hypocretin−/−,VGLUT2-Cre mice increase the number of cataplexy attacks. A. Hypnograms displaying the behavioral states of hypocretin−/−,VGLUT2-Cre mice during saline control injection and after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells. Note: the increase in cataplexy following CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells. B. Activation of VGLUT2-expressing SLD neurons (labeled as “hM3Dq”) did not result in changes to the overall time spent in cataplexy during the 3hr recording. In control hypocretin-/-, VGLUT2-Cre mice not expressing the hM3Dq receptor (labeled as “mCherry”), CNO administration did not produce any changes to the total time spent in cataplexy (mCherry saline vs mCherry CNO: paired t test, t(4)=0.4045, p=0.3533). C. Following CNO administration, a substantial increase in the number of cataplexy episodes occurred in hM3Dq-expressing hypocretin-/-, VGLUT2-Cre mice. CNO administration in mice lacking the hM3Dq receptor experienced the same level of cataplexy as saline controls. D. The average duration of cataplexy episodes did not change after CNO administration in neither hM3Dq- expressing nor mCherry control mice (mCherry saline vs mCherry CNO: paired t test, t(4)=0.7167, p=0.2566). All values are expressed as MEAN+SEM, * denotes significance.

132

Figure 6.4. Cataplexy triggered through CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells was indistinguishable from cataplexy under saline control conditions. A. Electrophysiological examples of cataplexy under saline control conditions and under CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells. Both episodes of cataplexy are characterized by theta rich EEG, muscle paralysis devoid of phasic events, and abrupt loss of motor tone with similar durations. B. No significant differences were found in the EEG spectral distribution of cataplexy under CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells (red) vs saline control conditions (grey) or C. No significant differences were found in the overall amount of muscle tone of either neck (right) or masseter (left) muscles during cataplexy after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells (red bars) when compared to saline controls (grey bars). Compared to saline, neither CNO administration nor delivery of AAVs was not shown to influence overall muscle tone in control mice not expressing hM3Dq (labelled “mCherry”).

133

6.2.4 Chemogenetic activation of VGLUT2-SLD neurons does not influence muscle tone of sleep-wake states

In Chapter 5, CNO-induced activation of hM3Dq-expressing VGLUT2-SLD cells

produced an overall decrease in muscle tone during wakefulness, but not during sleep. I examined

the muscle tone during the different sleep and wake states in the same manner as Chapter 5.

Contrary to the findings of Chapter 5, I found that CNO-induced activation of hM3Dq-expressing

VGLUT2-SLD (n=6) did not result in changes to the overall amount of masseter or neck muscle tone in wake when compared to saline controls (saline vs CNO: Masseter EMG, paired t test, t(5)=1.701, p=0.1498; Neck EMG, paired t test, t(5)=1.308, p=0.2476, Figure 6.5A).

Similar to Chapter 5, muscle tone had no significant change during NREM sleep following

CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons when compared to saline

conditions (saline vs CNO: Masseter EMG, unpaired t test, t(8)=0.8102, p=0.4413; Neck EMG,

unpaired t test, t(11)=1.061, p=0.3115, Figure 6.5C).

Since these experiments were designed to test the role of the VGLUT2-SLD neurons on

cataplexy experiments were ran in the darkphase. However, the darkphase is predominantly

occupied by wakefulness and not sleep. To that end, we saw only two mice express REM sleep

after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons. However, in the

episodes that did occur, CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons produced no alteration in the overall amount of muscle tone during REM sleep (saline vs CNO:

Masseter EMG, unpaired t test, t(5)=0.2352, p=0.8234; Neck EMG, unpaired t test, t(5)=0.4076,

p=0.7004, Figure 6.5D).

Finally, muscle tone was measured during sleep attacks and not found to be significantly changed after CNO-induced activation of the hM3Dq-expressing VGLUT2-SLD cells when compared to saline controls (saline vs CNO: Masseter EMG, unpaired t test, t(8)=0.1054,

134

p=0.9187; Neck EMG, unpaired t test, t(7)=0.1214, p=0.9068, Figure 6.5B). To conclude, CNO- induced activation of hM3Dq-expressing VGLUT2-SLD cells did not result in any significant changes to motor tone of sleep-wake states.

6.2.5 Chemogenetic activation of VGLUT2-SLD neurons does not influence sleep-wake architecture

In Chapter 5, selective chemogenetic activation of VGLUT2-SLD neurons did not produce any changes in sleep-wake architecture of VGLUT2-Cre mice. The experiments in this current chapter use hypocretin−/−,VGLUT2-Cre mice which unlike VGLUT2-Cre mice of Chapter 5, have a hypocretin deficient system. This is an important distinction because hypocretin has been regarded as a regulator and coordinator of sleep-wake architecture (Li et al., 2014). Furthermore, previous literature has implicated the SLD nucleus in the control sleep-wake architecture (Fuller et al., 2007). Therefore, there was two goals for this section’s analysis. The first goal was to determine if chemogenetic activation of VGLUT2-SLD neurons may perturb sleep-wake architecture in absence of hypocretin. Secondly, I wanted to verify that chemogenetic activation of VGLUT2-expressing SLD neurons did not perturb the sleep-wake architecture in a way that could have influence the expression of cataplexy (i.e., decreased wakefulness may result in fewer opportunities for cataplexy to occur). Using the same hM3Dq-expressing hypocretin−/−,VGLUT2-

Cre mice (n=6) and mCherry viral controls hypocretin−/−,VGLUT2-Cre mice (n=5) as the previous section, sleep and wake architecture was examined.

Compared to saline, CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons did not produce any significant changes to the overall amount of wakefulness or NREM sleep (See Table 6.2). The number of episodes and durations of wakefulness, NREM, REM and sleep attacks were unaffected by CNO-induced activation of the hM3Dq-expressing VGLUT2-

135

Figure 6.5. Chemogenetic activation of VGLUT2-SLD neurons does not alter muscle tone during sleep attacks, sleep or wake. There was no difference found in muscle activity of the masseter (left graph) or the neck muscles (right graph) after CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons (A) during wakefulness, (B), sleep attacks, (C) NREM sleep, nor during (D) REM sleep compared with saline controls. All group data is shown as MEAN+SEM, n.s. denotes not significant

136

SLD neurons (See Table 6.2). Since these experiments were designed to test cataplexy, they were

performed during the darkphase – a period where limited expression of REM sleep occurs

(McShane et al., 2012). While there was a significant decrease in the amount of total time spent in

REM sleep following CNO-induced activation of SLD neurons, it should be noted that only two

mice in the hM3Dq-expressing group exhibited REM sleep. This makes it challenging to

statistically conclude that REM sleep was decreased. One other possible explanation, is that REM

sleep was reduced due to the substantial increase in the amount of cataplexy that occurred

following CNO-induced activation of hM3Dq-expressing VGLUT2-SLD neurons. While there was no significant differences found in the number of sleep attacks, it is difficult to draw conclusions as this behavioral state does not happen often within a 3 hour recording and only two episodes occurred under saline conditions.

To demonstrate that neither CNO nor delivery of AAVs harboring foreign proteins (i.e. hM3Dq) produced any effect on sleep-wake architecture, a control viral vector containing a functionless protein was targeted to VGLUT2-SLD neurons. Using similar dosing in mice with mCherry-expressing SLD neurons, I found no significant impact on sleep-wake architecture (See

Table 6.2). This indicated that CNO nor AAVs alone produce any modulations in sleep-wake architecture. Consequently, taken together this suggests that chemogenetic activation of VGLUT2-

SLD cells had specific impact on cataplexy and not broad influence on sleep-wake behavior.

6.2.6 Reconciling the difference in behavior following VGLUT2-SLD activation in the wildtype and narcoleptic animals

To reconcile why activation of VGLUT2-SLD neurons could induce cataplexy in the

narcoleptic animals, but not in wildtype animals (See Chapter 5), I referred back to the histology

data. After comparing the distribution of hM3Dq-expressing neurons across all studies (Chapters

3-6) no overall difference was apparent in the area of viral infection. This indicates that the lack

137

of cataplexy following VGLUT2-SLD activation was not due to a difference in the anatomical

distribution of chemogenetic expression (Figure 6.6). Furthermore, I examined the number of hM3Dq-expressing VGLUT2 SLD neurons within the SLD nucleus in both the wildtype animals and narcoleptic animals. Here, I show that both the narcoleptic and wildtype animals had a similar number of neurons transduced within the SLD region (unpaired t Test, t(9)=0.512, p=0.6210,

Figure 6.7). Therefore, the lack of cataplexy in wildtype animals was not due to a decreased

number of neurons expressing the hM3Dq receptors or a difference in the area of transduction.

6.2.7 Chemogenetic inhibition of VGLUT2-SLD neurons does not prevent cataplexy

For my final aim, I set out to determine if the induction of cataplexy required VGLUT2-

SLD neurons. This was investigated by assessing the amount of cataplexy over a three-hour

recording following chemogenetic inhibition of VGLUT2-SLD neurons (See Figure 6.6B).

Bilateral delivery of hM4Di receptors to VGLUT2-SLD neurons was confirmed in hypocretin-/-,

VGLUT2-Cre mice (n=5, See Figure 6.8A). Likewise, a control viral vector lacking the hM4Di

gene, was delivered bilaterally to a separate group of hypocretin-/-, VGLUT2-Cre mice (n=5) to control for both AAV viral delivery as well as any effects CNO may have alone on behavior.

Similar to the previous experiment, I targeted the inhibitory chemogenetic receptor, hM4Di, into VGLUT2-expressing SLD neurons (Figure 6.8A). Based on previous literature, I hypothesized that selective inhibition of the VGLUT2-expressing SLD neurons would reduce cataplexy expression. Compared to saline, CNO-induced inhibition of the hM4Di-expressing SLD neurons produced no significant changes in the total time spent in cataplexy (saline vs CNO: paired

138

Figure 6.6. Location of hM3Dq-expressing neurons across all studies in this thesis. Stereotaxic infusion site maps showing the location of hM3Dq-expressing neurons in the SLD region from all studies in this thesis. These maps incorporate Cre-independent and Cre-dependent viral vectors in both wildtype and narcoleptic mice (See Chapters 3- 6). These stereotaxic injection site maps demonstrate that distribution of viral transduction of hM3Dq receptors was similar across all four studies in this thesis.

139

200

100 cells in the SLD region SLD the in cells

Total # of hM3Dq expressing Total 0 VGLUT2-SLD VGLUT2-SLD Wildtype Narcoleptic

Figure 6.7. Comparing the number of VGLUT2 hM3Dq-expressing SLD neurons in wildtype and narcoleptic animals. No difference in the number of VGLUT2-expressing neurons in the SLD nucleus of the wildtype and narcoleptic animals. Quantification (mean + SD) of the number of hM3Dq-expressing VGLUT2-SLD neurons in wildtype and narcoleptic animals was performed.

140

Table 6.2. Summary of the sleep-wake architecture and sleep attacks following 3 hours recording in hM3Dq-expressing and mCherry-expressing control hypocretin-/-, VGLUT2-Cre mice

hM3Dq-VGLUT2-SLD mCherry-VGLUT2-SLD n=6 n=5 Saline CNO Descriptive Statistics Saline CNO Descriptive Statistics

Time spent 73 ± 8 70 ± 7 (t(5)=0.5669, p=0.5953) 83 ± 6 65 ± 5 (t(4)=1.892, p=0.1315) (%)

# of 46 ± 8 79 ± 18 (t(5)=2.229, p=0.0763) 40 ± 13 71 ± 14 (t(4)=1.348, p=0.2489) WAKE episodes

Durations 244 ± 85 131.9 ± 37 (t(5)=1.575, p=0.176) 1628 ± 1392 120 ± 29 (t(4)=1.068, p=0.3455) (s)

Time spent 21 ± 6 10 ± 5 (t(5)=2.554, p=0.051) 12 ±4 28 ± 5 (t(4)=1.887, p=0.1321) (%)

# of 40 ± 9 26 ± 14 (t(5)=1.497, p=0.1946) 33 ± 12 65 ± 34 (t(4)=1.402, p=0.2336) NREM episodes

Durations 54 ± 13 47 ± 5 (t(5)=0.2977, p=0.7779) 33 ± 12 65 ± 15 (t(4)=1.402, p=0.2336) (s)

Time spent 4 ± 2 2 ± 1 (t(5)=2.741, p=0.0407) 2 ± 1 5 ± 1 (t(4)=2.07, p=0.1072) (%)

REM # of 8 ± 3 4 ± 2 (t(5)=2.185, p=0.0806) 5 ± 2 12 ± 2 (t(4)=2.075, p=0.1066) episodes Durations 53 ± 13 47 ± 5 (t(5)=0.2694, p=0.7984) 44 ± 4 47 ± 2 (t(7)=0.9902, p=0.3551) (s)

Time spent 1 ± 0.2 1 ± 0.4 (t(5)=0.3845, p=0.7164) 0.2 ± 0.1 1 ± 1 (t(4)=0.7672, p=0.4858) (%)

SLEEP # of 2 ± 1 2 ± 1 (t(5)=0.1644, p=0.8759) 1 ± 0.2 1 ± 1 (t(4)=0.2343, p=0.8263) ATTACKS episodes

Durations 40 ± 9 66 ± 20 (t(3)=0.9724, p=0.4026) 33 ± 7 66 ± 26 (t(4)=1.764, p=0.1525) (s)

All values are expressed as MEAN ± SEM

141

t test, t(4)=0.2973, p=0.7810) , number of cataplexy episodes (saline vs CNO: paired t test,

t(4)=0.9300, p=0.4050), or changes in the duration of episodes (saline vs CNO: paired t test,

t(4)=1.84, p=0.1395). This suggested that CNO-induced inhibition of hM4Di-expressing

VGLUT2-SLD neurons did not significantly impact the expression of cataplexy.

A decreased opportunity for cataplexy could occur if an animal were to spend less time in

wakefulness, therefore, I analyzed if CNO-induced inhibition of VGLUT2-SLD neurons produced changes in sleep-wake architecture. Compared to saline, CNO-induced inhibition of hM4Di- expressing VGLUT2-SLD neurons produced no changes in the overall time spent, episodes or durations of any sleep-wake states (See Table 6.3). These findings demonstrate that chemogenetic inhibition of VGLUT2-expressing SLD neurons does not influence sleep-wake activity.

Furthermore, these results indicate that cataplexy expression was not modulated by changes in sleep-wake architecture following inhibition. Lastly, a control group of animals expressing a functionless protein (i.e. mCherry) demonstrated that CNO alone and the delivery of AAVs do not alter sleep-wake architecture (See Table 6.3). Collectively, these outcomes demonstrate that CNO or AAV delivery of proteins to the SLD nucleus did not affect sleep-wake architecture.

Finally, to demonstrate that CNO alone or delivery of AAVs were not responsible for influencing the amount of cataplexy, I drove the expression of a functionless protein (i.e., mCherry) and administered CNO. I found that administration of CNO into mice expressing mCherry in SLD neurons had no significant impact on the amount of cataplexy expression (See

Figure 6.8C-E). These findings indicate that neither the administration of CNO nor AAV-driven protein expression are responsible altering the amount of cataplexy expression.

Collectively, these results suggest that VGLUT2-SLD neurons may not be required for the induction of cataplexy as no significant reduction of cataplexy was found when these neurons were chemogenetically inhibited. Mice expressing hM4Di receptors had a limited amount of cataplexy

142 during the 3-hr recording periods (only 1 to 2 episodes) under saline condition (See Figure 6.8D).

This may have masked any reducing effect of the CNO-induced inhibition of hM4Di-expressing

VGLUT2-SLD neurons, and makes it difficult to draw any definitive conclusions. Finally, complete abolishment of cataplexy may require multiple mechanisms to be modulated in addition to just the inhibition of the VGLUT2-SLD neurons.

6.2.8 The characteristics of cataplexy remain unchanged following inhibition of VGLUT2-SLD cells

The second goal of the final aim was to determine if the muscle paralysis during cataplexy could be eliminated and motor activity restored following chemogenetic inhibition of the

VGLUT2-SLD neurons. Cataplexy attacks occurring under CNO-induced inhibition of hM4Di- expressing VGLUT2-SLD neurons were behaviorally similar to cataplexy attacks under saline, whereby animals abruptly collapsed during wakefulness and remained immobile throughout the attack without any gross motor activity. Quantitative analysis of the muscle tone during cataplexy demonstrated no statistical significance difference in the neck (saline vs CNO: Neck EMG, paired t test, t(4)=1.12, p=0.3252, Fig 6.9C) or the masseter muscle (saline vs CNO: Masseter EMG, paired t test, t(3)=0.1542, p=0.8872, Fig 6.9C) when compared to saline conditions. This finding, along with the immobility that continued throughout the attacks, suggests that chemogenetic inhibition of VGLUT2-SLD cells did not restore motor function during cataplexy. Next, I examined the cortical activity (EEG) of cataplexy episodes under saline control conditions and following CNO-induced inhibition of hM4Di-expressing VGLUT2-SLD neurons (Figure 6.9B).

Compared to saline, there was no significant difference found in cortical activity following chemogenetic inhibition of VGLUT2-SLD neurons (2-way repeated-measures ANOVA, F(1, 80) =

0.1089, p=0.7422, Figure 6.9E). Thus, taken together these results suggest that selective chemogenetic inhibition of the VGLUT2-SLD neurons failed to produce any statistically

143

Figure 6.8. Chemogenetic inhibition of VGLUT2-SLD neurons in hypocretin−/−,VGLUT2-Cre mice does not reduce cataplexy. A. Right: Stereotaxic maps demonstrating location of hM4Di (inhibitory chemogenetic receptor with mCherry fluorescent tag, green regions) Left: A representative immunohistochemical example demonstrating VGLUT2-SLD neurons expressing the hM4Di inhibitory chemogenetic receptor and its fluorescent tag, mCherry. B. Hypnograms displaying the behavioral states of hypocretin−/−,VGLUT2-Cre mice after CNO-induced activation of hM4Di-expressing VGLUT2-SLD cells and during the saline control condition. C. Compared to saline levels, chemogenetic inhibition of VGLUT2-SLD neurons (labeled as “hM4Di”) did not alter the total time spent in cataplexy. Similarly, in a control group of mice lacking the chemogenetic receptor (labeled as “mCherry”), the total time spent in cataplexy was not significantly different following CNO administration (saline vs CNO: paired t test, t(4)=0.2102, p=0.8438). Neither the number of cataplexy episodes (D) nor the average duration of cataplexy episodes (E) were changed during the 3hr recording period in hM4di-expressing animals or mCherry-expressing control animals (mCherry; saline vs CNO; # of episodes: paired t test, t(4)=0.2049, p=0.8476; mCherry saline vs mCherry CNO; durations: paired t test, t(4)=0.01748, p=0.9869). All values are expressed as MEAN+SEM, n.s. denotes not significant and * denotes significance.

144

Table 6.3. Summary of the sleep-wake architecture and sleep attacks following 3 hours recording in hM4Di-expressing and mCherry-expressing control hypocretin-/-, VGLUT2-Cre mice

hM4Di-VGLUT2-SLD mCherry-VGLUT2-SLD n=5 n=5 Saline CNO Descriptive Statistics Saline CNO Descriptive Statistics

Time spent 96 ± 2 98 ± 1 (t(4)=1.628, p=0.1789) 83 ± 6 82 ± 4 (t(4)=0.2637, p=0.805) (%)

# of 10 ± 5 5 ± 2 (t(4)=1.806, p=0.1453) 38 ± 17 36 ± 7 (t(3)=0.1081, p=0.9207) WAKE episodes

Durations 3530 4658 (t(4)=2.576, p=0.0616) 1628 752 (t(4)=0.6638, p=0.5431) (s) ± 1196 ± 1070 ± 751 ± 388

Time spent 3 ± 2 1 ± 1 (t(4)=1.959, p=0.1217) 12 ± 4 13 ± 3 (t(4)=0.8717, p=0.4326) (%)

# of 7 ± 4 2 ± 2 (t(4)=1.865, p=0.1356) 33 ± 12 35 ± 7 (t(4)=0.1138, p=0.9149) NREM episodes

Durations 20 ± 6 24 ± 10 (t(3)=1.003, p=0.3899) 39 ± 3 39 ± 3 (t(3)=0.2162, p=0.8427) (s)

Time spent 0.4 ± 0.3 0.1 ± 0.1 (t(4)=1.166, p=0.3085) 2 ± 0.7 3 ± 0.6 (t(4)=0.7122, p=0.5157) (%)

# of 1 ± 0.8 0.3 ± 0.2 (t(4)=1.344, p=0.2501) 5 ± 2 4 ± 2 (t(4)=0.5726, p=0.5976) REM episodes

Durations 29 ± 10 29 ± 10 (t(2)=0.1854, p=0.87) 44 ± 4 45 ± 4 (t(3)=0.3516, p=0.7484) (s)

Time spent 0.1 ± 0.1 0.2 ± 0.1 (t(4)=1.898, p=0.1305) 0.3 ± 0.1 0.3 ± 0.2 (t(4)=0, p=>0.9999) (%)

# of 0.3 ± 0.2 0.5 ± 0.3 (t(4)=0.7385, p=0.5012) 0.8 ± 0.3 0.3 ± 0.2 (t(4)=1.606, p=0.1836) SLEEP episodes ATTACKS

Durations 20 ± 2 21 ± 6 (t(4)=0.0749, p=0.9439) 33 ± 6 66 ± 26 (t(4)=1.764, p=0.1525) (s)

All values are expressed as MEAN ± SEM

145

significant changes to cortical activity or abolish the paralysis of cataplexy in episodes that

occurred.

6.2.8.1 Chemogenetic inhibition of VGLUT2-SLD neurons does not influence the muscle tone of sleep-wake states

In hypocretin-/-,VGLUT2-Cre mice (n=5), I examined if CNO-induced inhibition of hM4Di-expressing VGLUT2-SLD neurons would impact the muscle tone of wake, NREM sleep,

REM sleep or sleep attacks. Compared to saline, muscle tone during wakefulness in both the neck and masseter muscles remained unchanged after CNO-induced inhibition of hM4Di-expressing

SLD neurons (saline vs CNO: Neck EMG, paired t test, t(5)=0.7103, p=0.5167; saline vs CNO:

Masseter EMG, paired t test, t(4)=0.04016, p=0.9705, Fig 6.10A). No significant changes were observed in either the neck (saline vs CNO: Neck EMG, paired t test, t(3)=0.2686, p=0.8056, Fig

6.10C) or the masseter muscles (saline vs CNO: Masseter EMG, paired t test, t(2)=0.3718,

p=0.7457, Fig 6.10C) during NREM sleep following CNO-induced inhibition of hM4Di-

expressing SLD neurons when compared to saline. Inhibition of the SLD nucleus may have

resulted in reduced REM sleep expression as this region has been implicated in REM sleep control

(Lu et al., 2006). Furthermore, these experiments were designed to assess cataplexy which occurs

during the dark phase. Therefore, these experiments took place during the darkphase, where

animals predominantly spend their time awake and not asleep. Only two of the five animals had

REM sleep following CNO-induced inhibition of the hM4Di-expressing VGLUT2-SLD neurons,

and therefore, statistical analysis is not conclusive at a low n-value, however, no overt abnormal

gross

146

Figure 6.9. Cataplexy occurring under CNO-induced inhibition of hM4Di-expressing VGLUT2-SLD cells was indistinguishable from saline control conditions and viral vector control mice. A. An electrophysiological example of cataplexy under saline control conditions and after CNO-induced activation of hM4Di-expressing VGLUT2-SLD cells. Both episodes of cataplexy are characterized by theta rich EEG abrupt loss of motor activity with similar durations. B. Group data showing no significant differences in EEG spectral distribution when comparing saline control conditions (grey) to cataplexy following CNO-induced inhibition of hM4Di-expressing neurons (green) C. Group data demonstrating that when comparing back to saline conditions (white bar), CNO-induced inhibition of hM4Di-expressing VGLUT2-SLD cells (green bar) does not result in a significant difference in the neck muscle tone (left) nor masseter tone (right) activity during cataplexy. All data is expressed as MEAN+SEM, n.s. denotes not significant.

147

motor behavior ensued in the episodes that did occur (saline vs CNO: Neck EMG, unpaired t test,

t(3)=0.8181, p=0.3407; saline vs CNO: Masseter EMG, paired t test, t(3)=0.2017, p=0.8531, Fig

6.10D). Similarly, only two mice under saline conditions exhibited sleep attacks, and therefore,

statistical calculations are not conclusive, but, no striking differences were found in the episodes

that transpired under CNO-induced inhibition of VGLUT2-SLD neurons (saline vs CNO: Neck

EMG, unpaired t test, t(4)=0.9085, p=0.4150, Fig 6.10B; saline vs CNO: Masseter EMG, paired t

test, t(4)=0.9782, p=0.3834, Fig 6.10B).

Taken together, our results suggest that CNO-induced inhibition of hM4Di-expressing

VGLUT2-SLD cells does not significantly affect muscle activity during wakefulness or NREM sleep. No conclusive results can be determined regarding REM sleep and sleep attacks as there was limited expression of these phenomena. On-going investigations in our laboratory have been designed to study the specific role of the SLD on motor control and the control of REM sleep expression during the light phase – as this the time when these phenomena are more likely to occur.

6.3 Discussion

Selective chemogenetic activation of hM3Dq-expressing VGLUT2-SLD neurons in hypocretin-/-

,VGLUT2-cre, narcoleptic, mice increased cataplexy. These results demonstrate that the VGLUT2-

expressing neurons of the SLD nucleus play a role in triggering, but not maintaining, the state of

cataplexy. Collectively, the findings portray a deeper level of complexity in the neurobiology of

cataplexy by indicating that cataplexy is the participation of auxiliary circuits in conjunction with

the VGLUT2-SLD neurons. In conclusion, these results are in line with my hypothesis and

therefore, I propose that cataplexy can be triggered by the inappropriate activation of VGLUT2-

SLD neurons during wakefulness.

148

Figure 6.10. Chemogenetic inhibition of VGLUT2-SLD neurons does not alter muscle tone during sleep attacks, sleep or wake. There was no difference found in muscle activity of the masseter (right) or the neck muscles (left) after CNO-induced inhibition of hM4Di-expressing VGLUT2-SLD neurons (green bar) (A) during wakefulness, (B), sleep attacks, (C) NREM sleep, nor during (D) REM sleep when compared to saline controls (white bar). All group data is shown as MEAN+SEM, n.s. denotes not significant and * denotes p <0.05 when compared to saline.

149

6.3.1 Expanding the neuroscience toolkit for the study of sleep, wake and sleep disorders

In order to identify the role of VGLUT2-SLD neurons in controlling the expression of

cataplexy, our laboratory developed a new hypocretin knockout mouse line. To do this we crossed

the VGLUT2-Cre mouse line with our hypocretin knockout mice. Following creation of this mouse line, a comprehensive analysis demonstrated that hypocretin-/-,VGLUT2-Cre mice exhibited similar amounts of wakefulness, sleep and sleep attacks compared to hypocretin-/- founder mice.

Furthermore, not only did this model present with cataplexy, but the cataplexy was indistinguishable in the overall amount and identical in behavioral and electrophysiological characteristics. Developing this mouse line was required, as well as, made it possible to selectively manipulate VGLUT2-expressing neurons using chemogenetics. The experiments herein presented validate the genetic delivery from viral vectors to VGLUT2-expressing SLD neurons in hypocretin-/- mice. The scientific significance of this mouse model is that it provides an effective

toolkit for neuroscientists to identify and examine the role of glutamatergic cell populations

throughout the brain of a narcolepsy phenotype. This allows further dissection of how neural

networks couple arousal and motor control, as well as, understand how malfunctions in these

networks lead to narcolepsy and its symptomology. Additionally, this mouse model is

advantageous to the medical field as it provides a stepping stone to probing cell specific

therapeutics and paving the way to further understand narcolepsy.

6.3.2 The VGLUT2-expressing neurons of the SLD nucleus trigger cataplexy in narcoleptic mice

A hypothetical association between the paralysis of cataplexy and REM sleep has existed

for many decades but remained unclear (Burgess and Scammell, 2012; Dauvilliers et al., 2014). In

fact, this was an opportune time to study the mechanisms mediating the paralysis of cataplexy for

150

several reasons. Only until recently did the development of a narcolepsy-cataplexy mouse model

become available (Chemelli et al., 1999). Furthermore, the mouse model has lended itself to

advanced genetic toolkits. Indeed, I was able to investigate the mechanism responsible for the

paralysis of cataplexy using one of these novel toolkits, chemogenetics (Roth, 2016). In Chapters

3 and 4, I used a conservative approach by chemogenetically activating all cellular phenotypes to

assess the role of the SLD nucleus in generating the cataplexy state. The results provided strong

evidence for a role of the SLD nucleus in cataplexy. Since previous literature had demonstrated

that the specific VGLUT2-SLD neurons were involved in the control of REM sleep paralysis and

previous chapters implicated this region in paralysis control, I set out to functionally test the role

that VGLUT2-SLD neurons may have on cataplexy in narcoleptic mice (Clement et al., 2011;

Valencia Garcia et al., 2017). Here in this chapter, the results suggest that VGLUT2-SLD neurons function to initiate cataplexy, as a 1500% increase in cataplexy episodes occurred following CNO- induced activation of hM3Dq-expressing VGLUT2-SLD neurons. While increases in the overall amount of cataplexy occurred there was no modulation of the episode lengths. Since durations following chemogenetic activation of the VGLUT2-SLD neurons remained similar to control conditions, it is plausible that other neuronal circuits are involved in mediating the duration of cataplexy episodes. One possible candidate for mediating this phenomenon may be the ventromedial medulla. This region not only receives projections from SLD neurons but has been implicated in controlling the duration of REM sleep episodes (Boissard et al., 2002; Morales et al.,

2006). There appears to be a common circuit across REM sleep and cataplexy, since my thesis

(Chapters 3-6) indicates that the SLD nucleus is recruited in cataplexy and previous literature demonstrates that the SLD nucleus is a component in the circuits mediating REM sleep (Lu et al.,

2006; Valencia Garcia et al., 2017). Therefore, it is possible that the ventromedial medulla

151 mediates the duration of cataplexy as it has been demonstrated to augment the durations of REM sleep (Weber et al., 2015).

6.3.3 The VGLUT2-SLD neurons are a component of the neural pathway that promote cataplexy

It has been speculated but untested that cataplexy was triggered by the activation of a circuit linking the emotion processing structures to brainstem regions that are involved in the REM sleep paralysis (Overeem et al., 2011; Burgess et al., 2013). Since activation of VGLUT2-SLD neurons resulted in increased cataplexy, I hypothesize that the VGLUT2-SLD paralysis neurons, located within the brainstem, are the downstream effectors of emotion which promote the paralysis of cataplexy during wakefulness. This hypothesis is based on previous work demonstrating that the emotional circuits are central to the induction of cataplexy. Lesions of either the medial prefrontal cortex (mPFC) or the amygdala, which receives excitatory input from the mPFC, lead to a reduction in cataplexy expression (Burgess et al., 2013; Oishi et al., 2013). Recently findings have demonstrated that the GABAergic neurons of the amygdala are involved in the induction of cataplexy through their projections to the VLPAG-LPT region (Mahoney et al., 2017; Snow et al.,

2017). Currently, it has been demonstrated that the VLPAG-LPT and monoaminergic regions, which the amygdala has been shown to innervate, inhibits the SLD nucleus (Crochet and Sakai,

1999; Lu et al., 2006). This SLD nucleus is a key component in the control of REM sleep paralysis, but, during wakefulness the activity of the SLD nucleus is dampened by the inhibitory input it receives from the VLPAG-LPT regions (Boissard et al., 2003). Thus, based on my findings where chemogenetic activation of hM3Dq-expressing VGLUT2-SLD neurons triggered increased amounts of cataplexy, I hypothesize that cataplexy is triggered when positive emotions activate emotional circuits which in turn inhibit the VLPAG-LPT and LC brainstem regions that normally function to suppress VGLUT2-SLD neurons during wake (Crochet and Sakai, 1999; Lu et al.,

152

2006). This cascade of events leads to the loss of inhibitory input onto VGLUT2-SLD neurons which engages paralysis during wakefulness (i.e., cataplexy).

One principal distinction between the animals of Chapter 5 and Chapter 6 is hypocretin signaling. More specially, animals in Chapter 5 were hypocretin intact (VGLUT2-Cre) whereas here, in Chapter 6 animals were hypocretin deficient (i.e. hypocretin-/-,VGLUT2-Cre; narcoleptic).

Complete paralysis did not occur upon chemogenetic activation of VGLUT2-SLD neurons in

VGLUT2-Cre hypocretin intact animals. Rather, an overall decrease in muscle activity was

observed. This is in stark contrast to cataplexy induction following chemogenetic activation of

VGLUT2-SLD neurons in hypocretin deficient, hypocretin-/-,VGLUT2-Cre, mice. This difference is not due to the distribution or number of cells expressing the chemogenetic receptor (See Figure

6.6 & 6.7). The difference between behavioral outcome of both the wildtype and narcoleptic animals does parallel recent work where activation of VGAT-amygdala neurons increased cataplexy in narcoleptic animals but failed to do so in hypocretin intact mice (Snow et al., 2017).

Snow et al., (2017) hypothesized that the inhibitory input from the amygdala to VLPAG-LPT region is normally offset by excitatory input from the lateral hypothalamus hypocretin releasing neurons. This hypothesis compliments and clarifies the dichotomy between my findings. Despite chemogenetic activation of the hM3Dq-expressing VGLUT2-SLD neurons which are downstream of the emotional circuits, inhibition onto these neurons still takes place through the VLPAG-LPT to SLD connection, a circuit which is supported by excitation from functioning hypocretin projections in the VGLUT2-Cre mice, but not the hypocretin-/-,VGLUT2-Cre mice. Therefore, in

the VGLUT2-Cre mice, inhibition onto the VGLUT2-SLD neurons reduces the efficacy of the

chemogenetic stimulation thereby preventing episodes of full paralysis. Whereas, in hypocretin-/-

,VGLUT2-Cre animals, the absence of supportive excitatory hypocretin signaling onto the

VLPAG-LPT decreases inhibitory input onto VGLUT2-SLD neurons . This results in elevating

153

the potential for these VGLUT2-SLD neurons and, thereby, reducing any restriction for

chemogenetic activation to excite VGLUT2-SLD neurons during wakefulness. This engages

cataplexy in the hypocretin-/-,VGLUT2-Cre, narcoleptic animals.

The protective mechanism of the hypocretin system can be further expanded beyond its

influence onto VLPAG/LPT neurons. The hypocretin system has vast connections throughout the

brain, and therefore, is well situated in providing multilayered support of motor activity during

wakefulness (Peyron et al., 1998). For instance, hypocretin peptides promote motor activity by

directly innervating both cranial and spinal motor neurons (Siegel, 1999; Peever et al., 2003;

Yamuy et al., 2004). Furthermore, hypocretin peptides excite monoaminergic regions, like the locus coeruleus (Horvath et al., 1999). Monoaminergic systems have direct connections with motor neurons and provide support during wakefulness (Siegel, 1999; Wu et al., 1999; Wu et al., 2004;

Fenik et al., 2005; Chan et al., 2006; Kohlmeier et al., 2013). Taken together, hypocretin neurons

function to excite motor neurons which supports motor activity during wakefulness (Peyron et al.,

1998).

In addition to its direct innervations, hypocretin also functions as a modulator of neural

activity (Torterolo et al., 2013). The first way that hypocretin can modulate downstream neurons

is by a glutamate interneuron mediated positive feedback mechanism (Li et al., 2002). More

specifically, release of hypocretin within the lateral hypothalamus excites glutamatergic axon

terminals within the lateral hypothalamus (Li et al., 2002). This increases local glutamatergic drive

onto hypocretin neurons which is thought to further intensify hypocretin release onto efferent

connections (i.e. the LC) (Horvath et al., 1999; Li et al., 2002). Furthermore, hypocretins also

produce neuromodulatory effects at the target neurons through co-release of hypocretin and

glutamate neurons (Schone et al., 2014). It was demonstrated that the combined effect of glutamate

and hypocretin release onto TMN neurons resulted in a fast and sustained neural firing. However,

154

when blocking glutamate only the fast response occurred (Schone et al., 2014). When obstructing

hypocretin signaling the slow and long-lasting component of firing was lost (Schone et al., 2014).

In our hypocretin knockout mouse model, the hypocretin neurons remain intact, but lack

hypocretin. Thus, glutamate release onto either the monoaminergic centers or motor neurons may

still occur but not produce the same level of sustained neural firing. This may cause a decrease in

the direct support of motor neurons and a decrease in the activity of the monoaminergic system.

This decrease in motor neuron support coupled with active inhibition of motor neurons via

chemogenetic activation of VGLUT2-SLD neurons creates the ideal condition for cataplexy to

manifest.

Taken together, these results suggest that in hypocretin intact systems the motor activity is

supported by the active inhibition of SLD neurons, in addition to, direct excitation of motoneurons

and monoaminergic systems functioning to promote motor neuron excitability during wakefulness

(Wu et al., 1999; Wu et al., 2004; Yamuy et al., 2004; Lu et al., 2006; Valencia Garcia et al., 2017).

Consequently, bypassing emotional circuits and directly chemogenetically stimulating VGLUT2-

SLD neurons may not be enough to overcome the supportive effects of hypocretin on motor

control. However, in the absence of hypocretin signaling, emotional stimuli leads to the

disinhibition of VGLUT2-SLD neurons, a reduced excitation to motor neurons and the loss of

hypocretin-glutamate neuromodulatory role on hypocretin-receptor expressing neurons (Burgess and Scammell, 2012). This sets the system at a disadvantage for sustaining motor activity during wakefulness and leaves the circuits vulnerable to the initialization of motor paralysis via activation of VGLUT2-SLD neurons. These findings and hypothesis reconcile the differences found in

Chapter 5 and 6 by indicating that hypocretin serves as a vital protective mechanism in preventing paralysis from occurring during wakefulness. Furthermore, my findings also suggest that cataplexy results from the activation of VGLUT2-SLD neurons during wakefulness.

155

6.3.4 REM sleep was not triggered by activation of VGLUT2-SLD neurons

If the SLD nucleus has been implicated in the control of the REM sleep state then why did

the resulting effect of activating VGLUT2-SLD neurons have a concentrated effect on cataplexy

rather than REM sleep? A paper by Xi & Chase., (2010) demonstrated that wake or REM sleep

was produced depending on the state in which the stimulation occurred. For example, wakefulness

was prolonged if the SLD nucleus was stimulated during wake. However, if the stimulation occurred during NREM sleep, then REM sleep was triggered (Xi and Chase, 2010). Since chemogenetic activation of VGLUT2-SLD neurons relies on drug-receptor interaction kinetics, it is not possible to control the activation in a state-dependent manner (Farrell and Roth, 2013).

Therefore, chemogenetic activation of the VGLUT2-SLD neurons likely occurred while animals were awake which thereby encouraged the wake state to continue rather than inducing the REM sleep state. In addition to this explanation, a recent publication by Luppi’s team in Lyon has suggested that the VGLUT2-SLD neurons are not responsible for the executive control for the entrance of the REM sleep state, but rather serve only to specifically gate the paralysis of REM sleep (Valencia Garcia et al., 2017). Therefore, it is possible that chemogenetic activation of

VGLUT2-SLD neurons encouraged the wakefulness state or that the VGLUT2-SLD neurons

function to trigger REM sleep paralysis and not executive control of the state as a whole. If either

the latter or both cases are true, chemogenetic activation of VGLUT2-SLD neurons would

inevitably lead to an increase in cataplexy episodes.

It is clear that sleep-wake states are regulated by multiple distinct brain regions (Brown et

al., 2012). In general, different brain regions are determined to be regulatory for sleep or wake

depending on their levels of activity before and during the onset of a sleep state (Saper et al., 2010).

The collective network of wakefulness is understood to be composed of monoaminergic regions

such as the histaminergic neurons of the tuberomammillary region, noradrenergic neurons of the

156

locus coeruleus, serotonergic neurons of the dorsal raphe and dopaminergic neurons of the ventral

tegmental area (Saper et al., 2010; Brown et al., 2012). Additionally, the supramammillary region,

parabrachial nucleus, basal forebrain and laterodorsal tegmental and pedunculopontine nuclei all

function to support wakefulness (Anaclet et al., 2015; Qiu et al., 2016; Pedersen et al., 2017).

While the SLD nucleus is thought to be a core component of REM sleep induction, it has been

demonstrated that several regions participate in the control and maintenance of REM sleep (Brown

et al., 2012). For example, the GABA-ergic neurons of the ventromedial medulla, cholinergic neurons of the LDT/PPT, melanin-concentrating hormone neurons of the lateral hypothalamus and

galanin neurons of the dorsomedial hypothalamus function to support the REM sleep state (Van

Dort et al., 2015; Weber et al., 2015; Valencia Garcia et al., 2017; Chen et al., 2018; Valencia

Garcia et al., 2018). Therefore, it is speculated that wake and REM sleep states arise from the

dynamic interplay between their discrete and distributed brain regions (Peever and Fuller, 2017).

However, what is not known is how this network interplay produces or shifts the overall network

from one behavioral state to the other or if there is a minimal number of brain regions within the

unabridged network that work in concert together to generate the transition in the behavioral state.

It is possible that the activation of just one brain region in the network, the SLD nucleus in this

case, may not be enough to transition the state of wakefulness into REM sleep when multiple

wake-promoting brain regions are still fully active.

To further add to this complexity, these experiments stimulated a specific sub-population within the SLD nucleus. This is a critical detail as calcium imaging has demonstrated two separate populations of VGLUT2-expressing SLD neurons are active during different states (Cox et al.,

2016). One population has peak activity during wakefulness while the other peaks in activity during REM sleep (Cox et al., 2016). Despite the identification of these populations, a gap in the literature remains regarding their direct function and how this sub-circuitry is internally wired. The

157 significance of dissecting sub-circuit populations was highlighted by a recent publication (Chen et al., 2018). It was shown that two populations of neurons of the dorsomedial hypothalamus have distinctly antagonistic effects on REM sleep despite both populations being identified as galanin- expressing (Chen et al., 2018). It was revealed that these two populations had unique projections to two different regions of the brain (Chen et al., 2018). This divergence in efferent pathways resulted in the differential effects (Chen et al., 2018). With respect to my data, since both populations express VGLUT2, it is possible that transduction of the virus populated the wake active population in addition to the paralysis promoting population. Therefore, although the chemogenetic virus was selective to VGLUT2-expressing neurons, it is possible that within the

VGLUT2 region subpopulations exert functionally distinct effects and this may be a reason why wake dominated the 3-hr recording instead of elevated amounts of REM sleep after CNO-induced activation of the VGLUT2-SLD neurons.

The monoamines may play an important role in how the SLD nucleus may gate the REM sleep state (Miller et al., 1990). Classic literature investigating REM sleep mechanisms have demonstrated that physostigmine salicylate induces wakefulness in the presence of normal monoaminergic signaling (Karczmar et al., 1970). However, after depleting the monoamines with the chemical compound resperine, application of physostigmine induced REM sleep (Karczmar et al., 1970). Since animals were predominately awake during the recordings, it is likely that monoamine signaling was fully operational while chemogenetic activation of the VGLUT2-SLD neurons occurred and thus, this signaling may have prevented the state to shift from wake into

REM sleep.

158

6.3.5 Limitations

The main goal of these experiments was to assess how chemogenetic manipulation of the

VGLUT2-SLD neurons impact the expression of cataplexy. Cataplexy has been demonstrated to

predominantly happen during the darkphase (Mochizuki et al., 2004). Therefore, in order to assess

any possible reduction or elevation in cataplexy amounts, following chemogenetic manipulations, experiments were scheduled during the darkphase. While this experimental design is optimal for the assessment of cataplexy it comes at the price of evaluating REM sleep. More specifically, evaluating the effect of chemogenetic inhibition of hM4Di-expressing VGLUT2-SLD neurons on

REM sleep may be confounded due to the timing of these experiments within the light-dark cycle.

This is because REM sleep has its lowest level of expression during the onset of the darkphase – the time when these experiments took place (Mochizuki et al., 2004; McShane et al., 2012). Thus, any reductions that may have occurred following CNO-induced inhibition of hM4Di-expressing

VGLUT2-SLD neurons may have been masked by the low levels of REM sleep expression. Our laboratory has rectified this drawback by designing a separate set of experiments to which the focus is REM sleep. These experiments occur during the lightphase to maximize the expression of

REM sleep and to minimize any possible floor effect.

The results in this chapter show that CNO-induced inhibition of VGLUT2-SLD neurons does not decrease cataplexy from saline controls. This may suggest that these neurons are not essential in triggering cataplexy. However, cataplexy expression can result in less than 10 episodes in 3-hrs recording period and even reach levels of 1 to zero episodes (Burgess et al., 2010; Burgess et al., 2013; Burgess and Peever, 2013; Snow et al., 2017). The erratic nature of cataplexy expression can make it difficult to study the role of brains region by loss of function experiments

(Mochizuki et al., 2004). Specifically, when hypocretin deficient animals had expressed 1 to 2 episodes during saline recording. It might be possible that these neurons are necessary, but it

159

remains inconclusive from my own data due to the limited amount of cataplexy expression that

occurred in the saline control groups of the animals expressing hM4Di receptors in VGLUT2

neurons.

However, it is also possible that auxiliary circuits in addition to the VGLUT2-SLD neurons may regulate cataplexy. This is not unexpected as cataplexy has been speculated to be a combination of both active inhibition, through the SLD-VMM-motoneuron circuit, and disfacilitation, through the decreased release of monoaminergic signaling to the motoneurons

(Siegel, 1999; Dauvilliers et al., 2014; Fraigne et al., 2015) (See Chapter 1, Figure 1.10). Hence,

cataplexy may have occurred despite CNO-induced inhibition of hM4Di-expressing VGLUT2

SLD neurons because loss of excitatory drive to the motor neurons from the dorsal raphe, locus coeruleus and dopaminergic regions is still occurring during the cataplexy attack.

Finally, hM4Di neurons only reduce the resting membrane potential by approximately

5mV (Anacker et al., 2018). It is therefore possible that excitatory inputs were able to overcome this reduced resting membrane potential which would counteract the chemogenetic inhibition. It has been speculated that VGLUT2-SLD neurons are tonically excited by glutamate during all sleep and wake states (Luppi et al., 2013). A tonic glutamate drive onto the VGLUT2-SLD neurons may have counteracted the reduced resting membrane potential produced by the hM4Di-receptors. It is thought that the SLD nucleus receives glutamatergic input, however, where these glutamate innervations originate is not known (Boissard et al., 2003). Possible candidate regions that could provide excitatory input are the lateral hypothalamus, vlPAG-LPT, and the ventrolateral medulla as these regions are all known to project to the SLD and to contain glutamate neurons (Shammah-

Lagnado et al., 1987; Sapin et al., 2009; Hossaini et al., 2012; Weber et al., 2015). Finally, the

LDT and PPT contain glutamate and release acetylcholine onto the SLD nucleus (Wang and

Morales, 2009; Van Dort et al., 2015). Indeed, cholinergic modulations in the SLD nucleus can

160 stimulate local glutamate terminals to increase release, and thereby, potentially overcome the inhibition of hM4Di-expressing neurons in the SLD nucleus (Torontali et al., 2014; Weng et al.,

2014). Future experiments could use inhibitory opsins as they have been validated as neuronal silencers and more potent than hM4Di in reducing the resting membrane potential (Han et al.,

2011). Another advantage to optogenetic inhibition is its unprecedented temporal resolution which allows for state-specific inhibition (Han et al., 2011). In other words, one could inhibit the

VGLUT2-SLD neurons at the precise moment a cataplexy attack occurs providing convincing evidence of the role in which these neurons play.

Taken together, these results reconcile the findings of Chapter 5, where chemogenetic activation of VGLUT2-SLD neurons failed to trigger cataplexy, but instead induced muscle weakness during wakefulness in hypocretin intact VGLUT2-Cre mice. Here, stimulation of

VGLUT2-SLD neurons induced cataplexy in narcoleptic, hypocretin deficient, mice. This suggests that hypocretin is a mechanism which functions to prevent muscle paralysis during wakefulness by restricting activity of VGLUT2-SLD neurons from engaging muscle paralysis during wakefulness. In Chapter 3, chemogenetic activation targeted all cell types and the outcome was the induction of cataplexy, whereas, this current chapter (Chapter 6) and Chapter 5 demonstrates that selective activation of VGLUT2-expressing neurons triggers cataplexy only in narcoleptic mice. While the results demonstrate the importance of hypocretin in maintaining proper motor control during wakefulness, the fact remains that activation of all cell types in wildtype mice can trigger cataplexy despite the presence of hypocretin. This finding does not undermine the importance of hypocretin in maintaining appropriate motor control, but, it does suggest that other cell types play a role in the generation of cataplexy. Therefore, these findings indicate that in narcoleptic animals, VGLUT2-expressing SLD neurons have the capacity to trigger cataplexy, but other cell types within the SLD nucleus are involved in cataplexy regulation.

161

6.4 Conclusion

Selective activation of VGLUT2-SLD neurons increased the amount of cataplexy episodes in hypocretin-/-,VGLUT2-Cre narcoleptic mice. This is the first study to examine the specific role of the VGLUT2-SLD neuronal population in narcoleptic mice and the first to demonstrate that chemogenetic activation of these neurons triggers cataplexy. These results provide support to the hypothesis that cataplexy and REM sleep share similar paralysis circuitry. Furthermore, these results suggest that the VGLUT2-SLD neurons function to trigger, but not maintain cataplexy episodes. This study is important because it highlights a critical region and cell population that is sufficient for inducing cataplexy attacks in narcoleptics. This work is scientifically relevant because these data help further unravel the underlying fundamental mechanism mediating cataplexy which allows for a greater understanding of how arousal and motor activity are coupled during wakefulness and help advance future therapeutic treatments for narcolepsy and cataplexy.

162

Chapter 7: General Discussion 7.1 Overview

It has been well established that the loss of hypocretin neurons leads to narcolepsy and

cataplexy; however, the underlying fundamental mechanisms mediating this paralysis has not been

fully characterized. The goal of this thesis was two-fold. The first goal was to identify the neural structure triggering the paralysis of cataplexy– the abrupt onset of muscle paralysis during wakefulness (See Chapters 3,4). The second goal was to further dissect the specific cellular phenotype within the structure responsible for the induction of cataplexy (See Chapters 5,6). A group of cells in the SLD nucleus have been speculated to control REM sleep paralysis (Siegel,

1999; Dauvilliers et al., 2014). An untested hypothesis within the sleep field is that cataplexy

occurs when these neurons become active during wakefulness and trigger the onset of paralysis

(Hishikawa and Kaneko, 1965; Roth et al., 1969; Overeem et al., 2002). My thesis tested this

hypothesis in two major aims. First, I investigated if activation of all cells in the SLD nucleus

could trigger cataplexy in wild-type (hypocretin-intact) mice and narcoleptic (hypocretin

knockout) mice. Next, I investigated if glutamatergic, VGLUT2-expresing, neurons of the SLD

were the cellular phenotype responsible for triggering cataplexy in wild-type and narcoleptic mice

models.

Three major conclusions were revealed from my results. First, cataplexy can be induced

following the activation of the SLD nucleus. This finding in combination with previous literature,

showing that the SLD nucleus participates in the control of REM sleep paralysis, suggests that both cataplexy and REM sleep share a common neural mechanism mediating their characteristic paralysis. Second, I found that VGLUT2-expressing neurons in the SLD nucleus can trigger cataplexy in narcoleptic animals. Finally, I found that activation of the VGLUT2-SLD neurons

163

only evoked cataplexy in narcoleptic, hypocretin deficient, mice and not in hypocretin intact mice.

These findings show that in the absence of hypocretin, activation of VGLUT2-SLD neurons can

trigger cataplexy. One interpretation from this finding is that hypocretin acts as a mechanism to support muscle activity during wakefulness and prevents the inappropriate onset of paralysis.

Taken together, these results demonstrate that the VGLUT2-SLD neurons of the SLD nucleus are

a component of the neural circuit meditating the onset of cataplexy.

7.2 Cataplexy can be triggered through activation of the sublaterodorsal tegmental nucleus

In Chapter 3 of this thesis, I examined the role of the SLD nucleus in mediating the onset

of cataplexy. The SLD nucleus contains neurons that are mainly active during REM sleep (Clement

et al., 2011; Cox et al., 2016). Several decades of experiments have demonstrated that both

electrical and pharmacological stimulation triggers REM sleep muscle paralysis, whereas, lesions

of this region lead to the loss of REM sleep or elimination of REM sleep paralysis (George et al.,

1964; Mouret et al., 1967; van Dongen, 1980; Hendricks et al., 1982; Jones, 1991; Lu et al., 2006).

It has been thought that in narcoleptic patients, cataplexy results when the SLD nucleus becomes

active during wakefulness and initiates muscle paralysis (Hishikawa and Kaneko, 1965; Roth et

al., 1969; Overeem et al., 2002). In support of this past work and hypothesis, I demonstrated, for

the first time in mice, that chemogenetic activation of all cells in the SLD nucleus results in

episodes of motor paralysis during wakefulness. I compared these episodes induced by

chemogenetic activation of the SLD nucleus to cataplexy in a narcoleptic mouse model that

naturally recapitulates all symptoms of narcolepsy including cataplexy. In that comparison, I found

that the episodes induced by chemogenetic activation of SLD neurons were similar behaviorally

and electrophysiologically to cataplexy.

164

The results within Chapter 3 demonstrate that cataplexy can be triggered by activation of the SLD nucleus. This provides support to the longstanding hypothesis that cataplexy and REM sleep share a common mechanism in the control of REM sleep paralysis. Therefore, not only do these findings have scientific merit by demonstrating that the SLD nucleus is a component in the circuitry mediating cataplexy, but also medically relevant because this chapter shines new light on the role of the SLD nucleus in pathology.

7.3 The sublaterodorsal tegmentum nucleus mediates cataplexy in narcoleptic animals

The previous section confirmed the role of the SLD nucleus in the generation of cataplexy in wild-type animals. The next step was to assess if chemogenetic activation of the SLD nucleus could promote cataplexy in narcoleptic mice. The advantage to probing the SLD function in narcoleptic animals, was that the narcoleptic mice naturally present with cataplexy due to their hypocretin deficiency and lack of hypocretin signaling (Chemelli et al., 1999; Burgess and Peever,

2013). Therefore, the outcome of inhibiting the SLD nucleus on cataplexy can be investigated using the narcoleptic mouse model.

Similar to Chapter 3, activation of all neurons in the SLD nucleus triggered cataplexy in narcoleptic mice. Not only was cataplexy triggered, but it was significantly increased above control levels. This intervention altered the number of cataplexy amounts, but never altered the duration of the events. This suggested that the SLD nucleus functions to trigger cataplexy but not maintain the state of cataplexy. Collectively, this data suggested that the SLD nucleus functions to control the onset of cataplexy in narcoleptic mice and further provides evidence that the SLD nucleus is a component of the neural circuit mediating REM sleep paralysis.

165

7.4 Activation of VGLUT2-expressing neurons of the SLD neurons triggers muscle weakness in VGLUT2-Cre, hypocretin intact, mice

The previous two sections discuss that manipulation of the SLD nucleus could alter the amount of cataplexy in both wild-type and narcoleptic mice (See Chapters 3 and 4). This indicated that the SLD nucleus was a key component in the neural circuit mediating cataplexy. The next step was to identify the cellular phenotypes within the SLD nucleus that was responsible for modulating cataplexy expression. The SLD nucleus was demonstrated to contain glutamatergic, VGLUT2- expressing, neurons (Lu et al., 2006; Clement et al., 2011). These neurons were not only active during REM sleep, but also demonstrated to be required for REM sleep paralysis (Lu et al., 2006;

Clement et al., 2011; Valencia Garcia et al., 2017). The VGLUT2-SLD neurons were an ideal candidate for being involved in the triggering of cataplexy as both previous literature and my findings (See Chapter 3 and 4) demonstrated the SLD nucleus was a component of the circuit triggering REM sleep paralysis. Therefore, Chapter 5 of this thesis examined the influence of

VGLUT2-expressing SLD neurons on cataplexy induction. Chemogenetic activation of VGLUT2-

SLD neurons did not result in episodes of complete paralysis (i.e. cataplexy), however, it did result in an overall decrease in muscle activity during wakefulness. It is unclear as to why activation of

VGLUT2-SLD neurons did not result in cataplexy. However, these findings demonstrate that

VGLUT2-SLD neurons can facilitate an element of suppression in motor activity and, as will become clear in the following section, suggest that auxiliary circuits and cellular phenotypes are involved with the regulation of cataplexy.

166

7.5 The VGLUT2-expressing neurons of the sublaterodorsal tegmental nucleus mediate cataplexy in narcoleptic mice

In Chapter 5, it was demonstrated that the VGLUT2-SLD neurons could exert a partial, but significant, suppression of muscle activity in hypocretin intact mice. A recent publication from our laboratory demonstrated that interventions which induce cataplexy in narcoleptic, hypocretin deficient mice, failed to do so in hypocretin intact mice, see Chapter 6 Discussion (Snow et al.,

2017). Snow et al., (2017) hypothesized that hypocretin acted as a protective mechanism to support muscle paralysis in hypocretin intact animals. Since the VGLUT2-Cre mice of Chapter 5 were hypocretin intact, I hypothesized that hypocretin was preventing the induction of full paralysis and therefore, I investigated if the chemogenetic activation of the VGLUT2-SLD neurons would induce periods of full paralysis (i.e. cataplexy) in narcoleptic, hypocretin deficient, mice. Consistent with my hypothesis, an increase in the amount of cataplexy occurred following chemogenetic activation of VGLUT2-SLD neurons in hypocretin intact mice. Furthermore, these neurons were found to only modulate the number of episodes and not the duration, similar to Chapters 3 and 4. This suggested that the VGLUT2-neurons function in the triggering but not maintenance of the episodes. Also similar to Chapter 4, Chemogenetic inhibition did not show any significant decrease, but this may have been due to a limited amount of cataplexy occurred. There may be several systems at play in the triggering of cataplexy. For example, the LC is known to have excitatory projections to the motor neurons and facilitate muscle tone during waking. This excitatory input onto the motor neurons may have been able to compensate for the chemogenetic inhibition of the SLD neurons. Future studies could try and stimulate the activity of the LC while inhibiting the SLD to see if this could abolish cataplexy. Taken together, the findings in this chapter suggested that the circuit supporting motor control during wake is vulnerable to the VGLUT2-

SLD neurons triggering paralysis in narcoleptic, hypocretin deficient, mice. Furthermore, these

167

findings provide evidence that the VGLUT2-expressing SLD neurons are an element of the circuit

that mediates the onset of cataplexy.

7.6 Cataplexy and rapid eye movement sleep share a common neural mechanism

Narcolepsy has been long considered a disease of REM sleep (Hishikawa and Kaneko,

1965; Roth et al., 1969; Overeem et al., 2002). This is partly due to dysfunctional REM sleep

regulation in narcoleptics which results in the appearance of REM sleep phenomena during

wakefulness (Dauvilliers et al., 2007). Narcoleptics suffer from sleep paralysis, a period of skeletal

muscle paralysis that occurs at the onset or termination of sleep (Dauvilliers et al., 2007; Overeem

et al., 2011). Additionally, a long standing hypothesis has been that cataplexy is the result of the

inappropriate manifestation of REM sleep paralysis during wakefulness (Hishikawa and Kaneko,

1965; Roth et al., 1969; Lopez-Rodriguez et al., 1994; Overeem et al., 2002). With respect to the

biological mechanism mediating cataplexy, this hypothesis assumes that the paralysis of both

cataplexy and REM sleep are caused by activation of similar neural circuits. The difference with

cataplexy, however, lies in the state-inappropriate activation of paralysis circuits during

wakefulness.

How is the paralysis of REM sleep generated? Lesion studies in the pioneering work of

REM sleep research identified the pons as a crucial site for REM sleep (Mouret et al., 1967).

Subsequent studies demonstrated that the electrical and pharmacological stimulation of the SLD

nucleus resulted in the production of muscle paralysis (George et al., 1964; Jouvet et al., 1965).

Further evidence came from experiments demonstrating that the muscle paralysis of REM sleep is

lost after lesions encompassed the SLD nucleus (Jouvet et al., 1965; Hendricks et al., 1982). More specifically, it was recently shown that the VGLUT2-expressing neurons of the SLD, which are

168

active during REM sleep, are required for the paralysis of REM sleep (Clement et al., 2011;

Valencia Garcia et al., 2017). These glutamatergic neurons are thought to activate GABA/glycine

neurons of the ventromedial medulla (Lai and Siegel, 1988; Boissard et al., 2003). These

ventromedial medulla neurons inhibit skeletal motor neurons which results in the decrease of

muscle activity and induction of REM sleep paralysis (Lai and Siegel, 1988). Alternatively, it has been speculated that eh SLD nucleus has direct spinal projections that lead to muscle paralysis (Lu et al., 2006). It is thought that the activity of the SLD neurons is suppressed during wakefulness by GABAergic projections of the VLPAG-LPT regions (Boissard et al., 2003; Lu et al., 2006).

Collectively, the results within this thesis suggest that cataplexy can be triggered by not

only the same brain structure, but also the same cellular mechanism that generates REM sleep

paralysis. When all cells of the SLD nucleus are activated in wild-type mice a behavioral arrest

resembling cataplexy is produced. Further support of the SLD nucleus involvement was through

chemogenetic activation of SLD neurons in narcoleptic mice which increased episodes of

cataplexy, similar to the findings in wild-type animals. The advantage of the narcoleptic animal

model was that they naturally exhibit cataplexy due to the absence of hypocretin signaling. Thus,

here I was able to investigate inhibition of this brain region on cataplexy. However, inhibition of

the SLD did not show any significant reduction in cataplexy episodes.

My thesis further examines the role of the SLD nucleus by specifically testing a cellular

population involved in the induction of cataplexy. Chemogenetic activation of the VGLUT2-

expressing neurons of the SLD was found to induce episodes of paralysis during wakefulness in

narcoleptic animals (i.e. cataplexy). These results, combined with the recent findings concerning

the role for the SLD in REM sleep circuitry, suggests that the paralysis of REM sleep and cataplexy are triggered by the same mechanism (Valencia Garcia et al., 2017). Based on my findings, I speculate that during wakefulness inhibition onto the VGLUT2-SLD neurons is reduced. This

169 disinhibition permits the state-inappropriate activation of VGLUT2-SLD neurons which allows the paralysis circuit to be engaged. In addition to demonstrating the role of the SLD nucleus in the circuit, these results also add another possible candidate region in the neural circuit mediating cataplexy. More specifically, this work implicates the ventromedial medulla as another brain region in cataplexy, since it is the subsequent brain region in the two-part brainstem circuit responsible for paralysis (Luppi et al., 2013). Future work could focus on identifying the role this region plays in meditating the paralysis and duration of cataplexy episodes.

7.7 Manipulation of the SLD nucleus resulted in cataplexy not REM sleep

Chemogenetic activation of the SLD nucleus resulted in triggering cataplexy but not enhancing the overall amount of REM sleep expression. This was somewhat unexpected as the

SLD has been demonstrated to induce REM sleep and REM sleep paralysis (Lu et al., 2006;

Valencia Garcia et al., 2017). One possible explanation as to why REM sleep was not produced following chemogenetic activation of the SLD nucleus, or VGLUT2-SLD neurons, was based on the timing of the intervention. It has been demonstrated that pharmacological excitation of the SLD neurons prolonged waking in animals that were already awake, whereas, if this same excitation occurred during NREM sleep then REM sleep would be produced (Xi and Chase, 2010). As chemogenetics relies on drug-receptor interaction kinetics, there is no precise temporal control of when chemogenetic receptors are activated and it is not possible to time the activation to a particular state (Roth, 2016). These experiments were performed in the darkphase and therefore, there is a greater chance that the animals were awake when the activation took place thereby encouraging the wake state over REM sleep (McShane et al., 2012).

170

It is generally well accepted that both wakefulness and REM sleep are regulated by multiple brain regions that organize together to form a distributed network (Brown et al., 2012). A gap in the literature remains about the minimum number of nodes required to shift from one network state to another. The tuberomammillary region, locus coeruleus, dorsal raphe, ventral tegmental area, supramammillary region, parabrachial nucleus, basal forebrain and laterodorsal tegmental all function to support wakefulness (Saper et al., 2010; Brown et al., 2012). While the core of the REM sleep network was identified to lie within the pontine region, it has been demonstrated that a distributed network of brain structures contributes to the control and maintenance of the REM sleep state (Brown et al., 2012). For example, the ventromedialmedulla, the lateral paragigantocellular nucleus, dorsal paragigantocellular reticular nucleus, ventralmedial medulla, dorsomedial and lateral hypothalamus, LDT/PPT and SLD nucleus all function to support the REM sleep state (Goutagny et al., 2008; Brown et al., 2012; Sirieix et al., 2012; Clement et al.,

2014; Chen et al., 2018). Here, chemogenetic activation of the SLD nucleus may not provide enough of a stimulus to encourage a transition to REM sleep while all other wake-promoting brain regions are fully functional. The induction of REM sleep state may require an intricate interplay of decreasing wake promoting regions in conjunction with the multiple REM sleep circuit nodes

(McCarley and Hobson, 1975).

The importance of the wake-promoting monoaminergic systems discussed above is further supported by experiments from Karczmar et al., (1970). This work demonstrated that cholinergic compounds can induce REM sleep following depletion of monoamines through systemic administration of respirine. However, under conditions where monoamines are not reduced, like during wakefulness, the same manipulation does not result in REM sleep, rather, wakefulness is promoted (Karczmar et al., 1970). In addition to this, Lopez et al., (1994) suggested that while the

REM sleep state itself may be sensitive to the overall state of the network, circuitry mediating

171

REM sleep paralysis appeared to function independent of network state as manipulation of SLD

nucleus could produce atonia regardless of behavioral state. Therefore, it is possible that while

activation of the SLD nucleus was not able to dynamically sway the network into a REM sleep

state, it was enough to trigger the paralysis circuitry. This further agrees with my original

hypothesis and the hypothesis put forth by Lopez et al., (1994) suggesting that cataplexy (i.e. state-

inappropriate muscle paralysis) is consequence of pathological regulation of SLD activity during

wakefulness.

Neurons in the SLD nucleus do not only function to control the REM sleep state. Calcium

imaging has demonstrated the existence of multiple cellular populations which are active during

various behavioral states (Cox et al., 2016). For example, one population of SLD neurons are active

during wakefulness and another population of neurons are active during REM sleep. Both

populations contained VGLUT2-expressing cells despite having a different state-dependent

activity. To further complicate matters, Hiyashi et al., (2015) demonstrated a VGLUT2-expressing

group of neurons in the SLD which function to inhibit REM sleep. While chemogenetic targeting

offers and unprecedented targeting system over classic neuroscience techniques, this targeting

cannot decipher between the discrete VGLUT2-expressng subpopulations based on their function.

To this end, transduction of the virus may have targeted REM sleep inhibiting, wake active and paralysis promoting neurons – a combination that would not encourage the expression of REM

sleep. Finally, it is possible that the neurons targeted simply functioned to promote paralysis and

not induce the state. Support for this hypothesis stems from experiments where glutamatergic

signaling within the SLD nucleus was disrupted (Valencia Garcia et al., 2017). This resulted in

REM sleep without motor paralysis but did not prevent the state from occurring (Valencia Garcia

et al., 2017). This suggests that these neurons may function in REM sleep regulation but not be

required to trigger the state (Valencia Garcia et al., 2017). Taken together, activation of the SLD

172 or selective VGLUT2-SLD neurons may have resulted in the expression of paralysis over the REM sleep state due to the heterogeneous group of neurons residing within the SLD nucleus and the overall state the animal was in during chemogenetic activation.

7.8 The VGLUT2-SLD neurons mediate cataplexy in hypocretin knockout animals but not hypocretin intact animals

A striking finding in this thesis was that chemogenetic activation of VGLUT2-SLD neurons increased episodes of cataplexy in hypocretin deficient, narcoleptic, mice whereas only muscle weakness occurred in hypocretin intact mice. These findings were similar to the recent work published by Snow et al., (2017) where activation of the amygdala triggered increased amounts of cataplexy in hypocretin deficient animals but failed to do so in hypocretin intact animals. There are several ways that the absence of hypocretin can expose the neural circuits to engaging state-inappropriate muscle paralysis. The first is through the suspected emotional brain regions (i.e. amygdala) to SLD nucleus circuit (Snow et al., 2017). Here, emotional stimuli excites the medial prefrontal cortex which has excitatory innervations onto GABAergic neurons of the amygdala (Oishi et al., 2013). These GABAergic neurons of the amygdala project to the VLPAG-

LPT brain regions (Snow et al., 2017). The VLPAG-LPT are thought to inhibit the paralysis promoting neurons of the SLD nucleus during wakefulness (Kaur et al., 2009; Sapin et al., 2009).

In narcoleptic mice, the absence of hypocretin results in a reduction of excitatory input to the

VLPAG-LPT brain regions (Peyron et al., 1998). Taken together, I suspect this reduces the inhibitory input onto the SLD nucleus (i.e. disinhibition) during wakefulness. Based on my results,

I propose that the increased activity of the VGLUT2-SLD neurons during wakefulness can trigger cataplexy through the induction of the REM sleep paralysis circuit. Why was muscle weakness produced in hypocretin intact mice and not cataplexy? Unlike the narcoleptic mice, the inhibitory input from the amygdala onto the VLPAG-LPT region is compensated by excitatory projections

173 from the hypocretin neurons (Peyron et al., 1998; Siegel, 1999). Even through the chemogenetic activation is downstream of these circuits, the inhibitory input from the VLPAG-LPT regions may be enough to overcome the effect of chemogenetic activation of the VGLUT2-SLD neurons, thus, resulting in a reduced overall amount of muscle activity in wakefulness but not complete paralysis.

Cataplexy is thought to be the result of disfacilitation of motor neurons from monoaminergic brain regions (i.e. LC, DR), as well as, the direct inhibition of motor neurons from the SLD to ventromedial medulla brainstem circuit (Siegel, 1999; Wu et al., 1999; Wu et al., 2004).

Hypocretin neurons in the lateral hypothalamus innervate the monoaminergic regions and have direct projections to motor neurons (Peyron et al., 1998; Horvath et al., 1999). This provides ongoing support to motor neurons during wakefulness and may counterbalance the paralysis initiated through chemogenetic activation of the SLD neurons (Burgess and Scammell, 2012;

Snow et al., 2017). Therefore, in hypocretin intact animals muscle weakness but not full paralysis.

Several possible reasons exist that leave the narcoleptic animals more susceptible to muscle paralysis. First, during a cataplexy attack the monoaminergic regions reduce firing and disfacilitation onto motor neurons leads to reduced muscle activity or paralysis (Wu et al., 1999;

Wu et al., 2004). If this occurs in combination with the chemogenetic activation of the SLD nucleus

(i.e. active inhibition) muscle paralysis during wake can occur. Second, the lack of hypocretin signaling in narcoleptic animals reduces overall excitatory input to monoaminergic regions, which results in less support to motor neurons (Siegel, 1999; Wu et al., 1999). Third, the motor neurons in narcoleptic animals lack the direct hypocretin excitation (Horvath et al., 1999). This collective lack of hypocretin support to motor neurons in addition to initiation of the SLD paralysis circuitry, by chemogenetic activation of VGLUT2-SLD neurons, favors the induction of muscle paralysis.

This supports the hypothesis that hypocretin serves as a protective mechanism to support muscle activity during wakefulness.

174

7.9 Activation of the VGLUT2-SLD neuron population alone is not enough to trigger cataplexy in hypocretin intact mice

Why does cataplexy occur following activation of all cells in the SLD nucleus but not after stimulating the VGLUT2-SLD cell population? I hypothesize that the discrepancy between these two results arises from the amount of discrete cellular populations activated. While the SLD nucleus has been poorly characterize, it is known that GABAergic and glutamatergic neurons are present in the SLD nucleus (Boissard et al., 2003; Brown et al., 2008; Cox et al., 2016). The

GABAergic neurons have been speculated to be active during REM sleep and function to inhibit the LC and DR regions (Brown et al., 2008). These monoaminergic brain regions provided excitatory input to motor neurons and have been shown to cease firing during cataplexy (Wu et al., 1999; Wu et al., 2004). Chemogenetic activation of all neurons in the SLD nucleus may have targeted both GABAergic and glutamatergic populations. Therefore, chemogenetic activation would have resulted in the inhibition of monoaminergic neurons, which would cause disfacilitation of motor neurons, and through the stimulation of glutamatergic (VGLUT2-expressing) neurons engage the circuits mediating muscle paralysis. In addition to these monoaminergic regions, the lateral pontine tegmentum also receives GABAergic projections from the GABA-SLD neurons

(Lu et al., 2006). Since it has been demonstrated that lesions to the lateral pontine tegmentum region produce cataplexy-like states, it is possible that inhibition from GABAergic SLD projections may have encouraged cataplexy to occur (Lu et al., 2006). Thus, activation of all cell types in the SLD nucleus may have led to a combination of disfacilitation of excitatory input onto motor neurons (via inhibition of monoaminergic regions by SLD GABAergic projections) and chemogenetic activation of glutamatergic SLD neurons involved in the paralysis circuitry of REM sleep. This combination sets the stage for a condition which favors the induction of cataplexy.

175

However, in the case of the selective activation of the VGLUT2-SLD population, no

GABAergic neurons were targeted or activated. Therefore, the disfacilitation did not occur because

GABAergic projections to monoaminergic systems were not engaged as they may have been in

the chemogenetic activation of all cell types. The onset of circuits mediating REM sleep muscle

paralysis during wakefulness, in absence of disfacilitation, was not sufficient enough to produce

cataplexy in the wild-type phenotype. Another possibility is that the VGLUT2-expressing neurons

play a minimal role in the production of cataplexy, however, it remains unclear as to exactly why

activation of VGLUT2-expressing SLD neurons did not result in cataplexy.

Another perplexing question that results from this thesis is why does activation of

VGLUT2-SLD neurons in narcoleptic animals trigger cataplexy (see Chapter 6)? One explanation

here is that hypocretin serves to support muscle paralysis during wakefulness by preventing the

VGLUT2-SLD neurons from becoming active outside of REM sleep state. These findings do not

undermine the possible influence of hypocretin on muscle paralysis, but suggest that other cell

types in the SLD nucleus may be more critical in the regulation of cataplexy. Collectively, this

thesis demonstrates that VGLUT2-SLD neurons have the capacity to trigger cataplexy in

narcoleptic animals and are therefore a component of the circuitry mediating cataplexy, but this

thesis also suggests that other cell types within the SLD nucleus are involved in cataplexy regulation.

7.10 Chemogenetics, CNO and controversy

Using a series of binding assays (competitive and saturated), autoradiography, PET

imaging co-registered with autoradiography Gomez et al., (2017) demonstrated that CNO does not

cross the blood brain barrier. Rather, it is metabolized into clozapine which was demonstrated to

cross the blood brain barrier and then bind to chemogenetic receptors. While the work by Gomez

176 et al., (201&) identifies the mechanism of action in how CNO leads to the activation of chemogenetic receptors it also reveals a significant limitation. Clozapine has a multi-receptor profile by which it binds to serotonin, dopamine, adrenergic, muscarinic and histamine receptors

(Selent et al., 2008). This could lead to potential off target and chemogenetic-independent effects.

However, Armbruster et al., (2007) demonstrates that clozapine has an affinity 100 times stronger than CNO for the chemogenetic receptors. Thus, it is far more likely to bind to the chemogenetic receptor than alternative receptors.

There are some isolated instances in humans where the administration of clozapine produces negative myoclonus and in the paper by Gomez, they suggest effects on locomotor activity three hours after administration (Butler 2009). Mahler & Gary Aston-Jones have reported that they do not see chemogenetic-independent behavioral effects at high doses of CNO directly delivered into the brain or via i.p. injection at doses up to 10mg/kg and for up to similar time frames in which Gomez reported. What the findings of Gomez et al., do suggest is that proper controls are required when using chemogenetic methodology. To rectify the CNO conversion to clozapine, proper controls must be used. In this case, experiments would have a separate group of animals that receive a control viral vector that harbors the fluorescent protein gene but lacks the chemogenetic receptor – as was performed in my thesis. In this group of a mice the outcome of

CNO alone at the doses used in the experiments can be quantified. In fact, our laboratory recently published a paper where i.p. injections were performed at a dose of 5mg/kg and no locomotor or myoclonus effects were observed. Finally, this thesis did these proper controls and did not show any effect of CNO at 5mg/kg nor at 10mg/kg within the 3 hour period. There was no sign of jerking or myoclonus or effects on sleep wake behavior in the control animals at either CNO dose administered via i.p. injection. When I quantified the overall level of muscle activity in control animals receiving CNO there was no significant effect on overall muscle activity (see Figure 7.1).

177

n.s. n.s. 10 5

8 4

6 3

4 2 EMG Neck EMG EMG Masster EMG 2 1

0 0 Saline 5mg/kg CNO 10mg/kg CNO Saline 5mg/kg CNO 10mg/kg CNO

Figure 7.1 Clozapine-n-oxide administration does not affect muscle tone during wakefulness. Quantification of the neck (p = 0.0059) and masseter (p = 0.0710) muscles demonstrate that 5mg/kg (light grey bars) and 10mg/kg (dark grey bars) does not significantly alter overall muscle tone during the 3 hour recording in control animals expressing the mCherry fluorescent but no chemogenetic receptor. This data indicates that CNO administration alone does not alter muscle tone. MEAN + SEM is shown and ANOVAs were used to calculate significance.

178

7.11 Updated neural circuit underlying the induction of cataplexy

The experiments in this thesis and recent publications allow us to update the hypothetical circuit model of cataplexy. Cataplexy is caused by the lack of hypocretin signaling and triggered by strong emotions (Wilson, 1933; Dauvilliers et al., 2007). Emotional stimuli results in the activation of the medial prefrontal cortex, which has excitatory projections that innervate and engage the amygdala (Oishi et al., 2013). The amygdala acts as a relay center between the emotional stimuli and the brainstem circuits responsible for muscle paralysis during cataplexy

(Snow et al., 2017). In healthy individuals, the hypocretin system offsets the inhibitory input of

GABAergic amygdala neurons onto the brainstem paralysis promoting circuits (Burgess and

Scammell, 2012). Without this hypocretin excitation the LC, LPT and VLPAG are all inhibited

(Burgess and Scammell, 2012). The VLPAG suppresses the activity of the SLD nucleus, specifically, the VGLUT2-expressing SLD neurons, during wakefulness whereas the LC functions to support motor activity by regulating muscle tone during wakefulness (Boissard et al., 2002).

Therefore, without hypocretin to counterbalance the GABAergic inhibition from the amygdala, motor activity is reduced from the LC all while the SLD neurons are no longer inhibited (Snow et al., 2017). The results of thesis demonstrate that the SLD nucleus, and the VGLUT2-expressing neurons of the SLD nucleus, have the capacity to trigger the onset of paralysis. This thesis shows that the SLD nucleus is a component of the brainstem region mediating cataplexy and adds to cataplexy’s hypothetical model. Future work will continue to dissect the internal circuits (ie., synaptic connections and discrete functions by distinct cell types) to further our understanding of what cellular mechanisms are involved in triggering cataplexy.

179

7.12 Limitations

This thesis did not investigate what other cellular phenotypes are within the SLD nucleus nor did it investigate the role of cellular phenotypes other than VGLUT2-expressing neurons in cataplexy. It was not possible to uncover and investigate the roles for each of these other cellular populations, but this opens up future avenues of exciting research.

A few methodological concerns exist with the chemogenetic approach. While using the chemogenetic toolkit provided an unprecedented level of cellular control, targeting, and reversibility, it does come with its disadvantages (Roth, 2016). One limitation to the chemogenetic technique is its temporal dynamic. While, it provides better spatial and genetic specificity

(VGLUT2-expressing neurons) compared to classic neuroscience techniques, it does lack the ability to trigger activation or inhibition of the cells at will (Roth, 2016). This lack of temporal control leaves researchers to assume that chemogenetic inhibition is engaged throughout experimental paradigm following CNO administration. In contrast, optogenetic inhibition allows for precise neuromodulation (Han et al., 2011). Therefore, optogenetic inhibition of VGLUT2-

SLD cells during cataplexy would be advantageous because it would allow for the direct correlation of cell function and behavioral outcome. Furthermore, a gap in the literature exists with how the SLD cells operate in vivo after being activated or inhibited by clozapine-n-oxide. It is not certain if these cells fire at a particular frequency, change frequencies, burst or a mix of these possibilities. While these limitations do exist, they do not dilute the significance of the findings of this thesis. Overall chemogenetic activation of all cell types in the SLD nucleus resulted in triggering cataplexy in both wildtype and narcoleptic mice. Furthermore, selective activation of

VGLUT2-SLD neurons increased the amount of cataplexy in narcoleptic mice. This implicates

VGLUT2-SLD neurons as controllers of the paralysis in cataplexy states.

180

Cataplexy was never fully abolished after chemogenetic inhibition of all SLD neurons. One explanation for this is that periods of time existed when not all cells were fully inhibited or the amount of excitatory input onto the SLD is greater than the reduction in resting membrane potential the hM4Di receptors induce. Future experiments can implement other techniques that have a greater and more potent cellular inhibition, like optogenetics and the ArchT receptor which has been demonstrated to silence neurons far more potently than chemogenetics (Han et al., 2011).

Alternatively, it is possible that the hM4Di receptors were successful in inhibiting the SLD neurons and thus, these results demonstrate SLD neurons have the capacity to encourage episodes of cataplexy but are not mandatory. Other circuits have been demonstrated to play a role in the facilitation of muscle activity (i.e. the LC). Therefore, it is possible that multiple mechanisms need to be modulated in conjunction with inhibition of the SLD region to abolish cataplexy.

To date, the cellular phenotypes as well as function of the specific neuronal populations and subpopulations within the SLD are not well characterized. In fact, glutamatergic neurons have been demonstrated to be both wake active and REM sleep active all while being intermingled throughout this region (Clement et al., 2011; Cox et al., 2016; Valencia Garcia et al., 2017). In these experiments, it is impossible to know if manipulation of cellular activity was restricted to cells that primarily function in REM sleep paralysis. Future studies will need to continue to dissect and identify different cellular markers to uncover discrete populations that have specific functions.

Regardless, this thesis demonstrates for the first time with the highest level of cellular specificity available, that, VGLUT2-SLD neurons play a role in the generation of cataplexy in narcoleptic mice. Continuing to dissect out the function of individual cellular populations within the SLD nucleus will be the key to finding cures for cataplexy as well as other disorders involving pathology of the SLD nucleus, like REM sleep behavior disorder.

181

This thesis investigated how the muscle paralysis of cataplexy is controlled by the SLD nucleus. This thesis used the neck and masseter muscles to measure muscle activity. It is not known how all muscles within the body behave during cataplexy. Thus, there is a limitation to having only used these two muscles and this limitation extends to most investigations of REM sleep paralysis and cataplexy research. Examination of different muscles could lead to a more comprehensive understanding of cataplexy and REM sleep motor control. For example, respiratory muscles fail to become paralyzed during both REM sleep and cataplexy – a quite advantageous feature for one’s existence (Fraigne and Orem, 2011). Indeed, during REM sleep the respiratory muscles receive excitatory input and do not become paralyzed (i.e. diaphragm), unlike non- respiratory muscles (i.e. neck) that are subject to the paralysis of REM sleep (Orem et al., 2000;

Bennett et al., 2004; Orem et al., 2005; Fraigne and Orem, 2011). The source of this excitatory input is unknown but understanding where this input arises and how this mechanism supports respiratory muscle activity may lead to a novel understanding of muscle control during REM sleep.

This understanding could be applied to skeletal muscles of interest and prevent muscle paralysis during wakefulness (Fraigne and Orem, 2011). Furthermore, understanding this excitatory input may have a broader clinical significance than just cataplexy as excitatory processes in REM sleep may be involved with other diseases such as infant death syndrome and chronic hypoventilation syndrome (Fraigne and Orem, 2011).

7.13 Future Directions

The previous section discusses how the sub-circuitry within the SLD, in addition to, its connections to monoaminergic and medullary regions could result in cataplexy after chemogenetic activation of the SLD nucleus or VGLUT2-SLD neurons. However, part of this discussion is

182 based on speculation and the piecing together of previous evidence. This incomplete picture eludes to the fact that the projections into and out of the SLD are not fully mapped nor are they functionally tested. There is a major fundamental gap in the literature regarding this topic. A more comprehensive mapping of the inputs and outputs offers a neural blueprint of the circuit governing cataplexy. This blueprint would allow for a more systematic understanding of what pathways are failing and how they are disrupted during cataplexy. While this thesis demonstrates that the SLD nucleus is a component within the circuit involved in triggering cataplexy it reveals a new biological question: what is the neural connection innervating the SLD nucleus that is sanctioning its inappropriate activation during wakefulness? Understanding not only where this input originates from but also which neurotransmitters that region is releasing to modulate the activity of neurons controlling REM sleep paralysis is useful in the clinical aspect of designing pharmacological aids against cataplexy. For example, this thesis demonstrates that one therapeutic approach could be to tailor drugs to reduce the activity of VGLUT2-SLD neurons during wakefulness as a therapeutic prevention. Additionally, once the unknown circuits responsible for the excitation of the SLD nucleus are revealed, they could be targeted and reduced in their activity to prevent cataplexy. Finally, uncovering these unknown circuits and understanding how they might lead to the excitation of the SLD nucleus during wake may provide new understanding to how cataplexy is triggered.

Connections departing the SLD nucleus are just as important as the connections into it. It is in general agreement muscle paralysis is mediated by projections from the SLD onto spinal interneurons, as well as, projections onto the ventromedial medulla (Lu et al., 2006; Valencia

Garcia et al., 2017). The SLD nucleus also has projections to multiple brain regions that function to support wakefulness and appropriate motor control (Brown et al., 2012). However, it is unknown if these circuits are altered in narcoleptic patients compared to healthy individuals.

183

Further study and teasing apart of these connections in both healthy individuals and narcoleptic patients (or mice) could lead to a more accurate understanding of the neural circuit mediating cataplexy and impairments in arousal that narcoleptics suffer from (Figure 7.1).

Although projections are important to unravel, it is also important to know what cell types these incoming connections synapse onto. Two main questions arise regarding the anatomical cellular arrangement of the SLD. First, it is unknown what cellular phenotypes exist in this region

–other than GABAergic and glutamatergic neurons. Understanding the different cellular composition of this region could help elucidate how the SLD nucleus carries out its functions.

Adding to this complexity, it appears there are discrete sub-populations of glutamatergic neurons each serving a separate function (Figure 7.1). For example, using calcium imaging, Cox et al.,

(2016) demonstrated that there are two separate populations of glutamatergic neurons active whereby one group is active during REM sleep and the other operating during wakefulness.

Scrutinizing these discrete cellular populations may be the key to understanding how the SLD exerts its functions to control behavioral states and muscle paralysis. Again, understanding these circuits will ultimately create more targeted therapeutic approaches to specific cell groups of interest and mitigate cataplexy and disease.

A recent publication demonstrates the power in deciphering the cellular composition of the

SLD nucleus. Hayashi et al., (2015) used a developmental cell fate mapping approach to pinpoint a single genetically marked neuronal population that function to inhibit REM sleep. This further demonstrates the complexity of the SLD nucleus, since most literature focuses on the glutamatergic neurons as functioning in REM sleep paralysis. This paper’s approach highlights the advantages to spanning the scale from brain region to further identifying cells based on their transcription factors. Gray., (2013) demonstrated that the medulla, a region functioning to control multiple behaviors, could be structurally defined based on fate-mapping strategies in multiple

184 transgenic mouse lines coupled with in situ hybridization and immunohistochemistry. Similarly, our understanding of how breathing is regulated by the brain has been greatly advanced through microcircuit dissection (Tan et al., 2008). What Feldman’s group and Grays group demonstrated is that while neural landmarks can generalize a specific area to behavior, the neuronal heterogeneity within these brain areas generates a challenge for understanding its function (Gray,

2013). Therefore, identification of a unique molecular marker or transcriptional linage can lead to definable subpopulations (Figure 7.1). These definable subpopulations can then be individually tested to understand their impact on behavior (i.e. REM sleep state induction) and discrete characteristic outcomes (i.e. paralysis or cortical activation). This allows for neural basis of behavior to be accurately teased apart – the primary goal of neuroscience. These techniques could be applied to the SLD nucleus, as well as, individual populations of neurons can then be chemogenetically activated to decipher their discrete roles in cataplexy, wakefulness and REM sleep.

7.14 Clinical implications of deciphering the sublaterodorsal tegmentum

Deciphering the organization of the neural circuitry within the SLD based on transcription factors is not only scientifically relevant for the mapping the neural circuit, but it is medically relevant as it would open the door for a novel and unprecedented therapeutic approach. The first step as stated earlier is to identify the neuronal groups based on transcription factors using a high- throughput bioinformatics approach then to clarify their role in cataplexy (Heiman et al., 2008;

Hupe et al., 2014). Traditionally, the pharmaceutical and medical community has used drugs to target cell surface receptors (Billiard, 2008; Broderick and Guilleminault, 2009). However, the recent literature and results of this thesis emphasizes that the neuronal pools are incredibly

185 complicated and intermingled – especially within the SLD nucleus (Lu et al., 2006; Grace et al.,

2014; Hayashi et al., 2015; Cox et al., 2016; Valencia Garcia et al., 2017). Therefore, transcription factors as drugs targets could provide novel therapeutic selectivity. There has been ongoing research with this approach in osteoporosis, immune modulation, cardiovascular disease and cancer (Butt and Karathanasis, 1995; Yeh et al., 2013). Tailoring drugs to specifically reduce the

186

Figure 7.2. The future of understanding cataplexy and REM sleep will be found by deciphering of the microcircuitry of the SLD nucleus. Since the 1950s the SLD nucleus has been demonstrated to be at the foundation of the neural circuit controlling REM sleep paralysis. However, our understanding of this simple behavior has remained an enigma. This thesis confirms a long-standing hypothesis of sleep medicine in that REM sleep and cataplexy share a common neural mechanism. Furthermore, this thesis suggests that the SLD nucleus is a complex region containing an elaborate microcircuitry consisting of multiple heterogeneous populations within close proximity that serve many discrete functions. Glutamatergic SLD neurons gate the timing of REM sleep, suppression of REM sleep and wakefulness. Future work should prioritize teasing apart these subpopulations of glutamatergic and GABAergic neurons to uncover functional roles and associations with disease states. To do that a combination of cell- type specific tracing of input-output organization, optogenetics/chemogenetics and transcription factor regional profiling through TRAP-seq will be required. Cell-type specific tracing could separate populations based on their connective pathways and functional consequences (i.e. SLDàVMM, muscle paralysis pathway vs SLDàMS, wake- promoting pathway). Finally, moving a layer deeper than cell specific tracing would be profiling cellular groups based on molecular markers. Transcription factors may allow for isolation of these neuronal populations without requiring cell specific tracing and manipulation. This advantage would allow for the investigation of cellular receptors as well as transcription based pharmaceutical drug methods for therapeutics against disease caused by REM sleep circuit malfunctions (i.e. cataplexy or REM sleep behavior disorder).

187 activity of the cells that trigger paralysis during wakefulness is one advantage to this approach.

Furthermore, narcoleptics may be treated through a translational approach whereby gene-therapy could express inhibitory chemogenetic receptors in the paralysis promoting neurons or brain regions that are projecting to these SLD neurons. A tablet of CNO could be given daily to modulate the activity of the neurons that generate muscle paralysis the day, thereby reducing the cataplexy symptom.

One could dream up a number of experiments using techniques to examine different brain regions and neurotransmitter systems. However, this thesis demonstrated a role of the SLD nucleus in triggering cataplexy. Continuing to reverse-engineer the sub-circuits within this region and their interconnections to other brainstem regions would be the most appropriate pragmatic direction in understanding its role in cataplexy. Part of the reason for this is because other brain regions that have shown to trigger or increase cataplexy are often associated with the emotional system and higher executive functions (Oishi et al., 2013). Translational approaches to modulate these regions in humans could have unwarranted side effects on an individual’s affect. Thus, targeting the SLD nucleus purely targets the motor aspect of the disease without disrupting emotional functions.

Further, understanding of the cell populations that are leading to this condition could also provide new therapeutic approaches both receptor directed or transcription factor directed.

7.15 Final Summary

This thesis demonstrates the role for the SLD nucleus in mediating cataplexy. Activation of the SLD nucleus resulted in the expression of cataplexy for the first time in an hypocretin-intact, healthy, mouse. The role of the SLD was then investigated in a narcoleptic mouse model. Here, activation of the SLD neurons promoted more cataplexy episodes. The advantage of a narcoleptic

188 mouse model is the natural expression of cataplexy, and therefore, loss-of-function experiments could assess the necessity of the SLD nucleus. However, inhibition of the SLD nucleus did not result in a decreased number of cataplexy episodes in narcoleptic mice. This thesis, then further went on to examine the cellular phenotype that is responsible for mediating cataplexy. Selective activation of glutamatergic, VGLUT2-expressing, neurons did not produce cataplexy in hypocretin intact mice, however, it did result in significant decreases in overall muscle activity during wakefulness. This thesis generated a new mouse line to investigate the role of the VGLUT2- expressing SLD neurons in narcoleptic mice. Selective activation of VGLUT2-expressing SLD neurons in narcoleptic animals increased the number of cataplexy episodes, whereas, inhibition experiments were unable to conclusively determine the requirement of these neurons in cataplexy episodes. Taken together, this data suggests that neurons within the SLD nucleus and specifically, the VGLUT2-expressing SLD neurons, have the capacity to trigger episodes of cataplexy. These findings, suggest that the SLD nucleus, and the VGLUT2-expressing SLD neurons, are a component of the neural circuit mediating cataplexy. These results herein are both scientifically and clinically significant because it tackled a fundamental and unanswered question in sleep medicine and biology regarding the role of the SLD nucleus in the regulation of cataplexy. This thesis is the validation of the sleep field’s long-standing hypothesis that a REM sleep mechanism underlies the paralysis of cataplexy.

189

References

Abad VC, Guilleminault C (2003) Diagnosis and treatment of sleep disorders: a brief review for clinicians. Dialogues in clinical neuroscience 5:371-388. Abad VC, Guilleminault C (2017) New developments in the management of narcolepsy. Nat Sci Sleep 9:39-57. Adamantidis AR, Zhang F, Aravanis AM, Deisseroth K, de Lecea L (2007) Neural substrates of awakening probed with optogenetic control of hypocretin neurons. Nature 450:420-424. Alexander GM, Rogan SC, Abbas AI, Armbruster BN, Pei Y, Allen JA, Nonneman RJ, Hartmann J, Moy SS, Nicolelis MA, McNamara JO, Roth BL (2009) Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors. Neuron 63:27- 39. Anacker C, Luna VM, Stevens GS, Millette A, Shores R, Jimenez JC, Chen B, Hen R (2018) Hippocampal neurogenesis confers stress resilience by inhibiting the ventral dentate gyrus. Nature 559:98-102. Anaclet C, Pedersen NP, Fuller PM, Lu J (2010) Brainstem circuitry regulating phasic activation of trigeminal motoneurons during REM sleep. PLoS One 5:e8788. Anaclet C, Pedersen NP, Ferrari LL, Venner A, Bass CE, Arrigoni E, Fuller PM (2015) Basal forebrain control of wakefulness and cortical rhythms. Nat Commun 6:8744. Anand BK (1955) Somnolence caused by destructive lesions in the hypothalamus in cat. Indian J Med Res 43:195-199. Andlauer O, Moore Ht, Hong SC, Dauvilliers Y, Kanbayashi T, Nishino S, Han F, Silber MH, Rico T, Einen M, Kornum BR, Jennum P, Knudsen S, Nevsimalova S, Poli F, Plazzi G, Mignot E (2012) Predictors of hypocretin (orexin) deficiency in narcolepsy without cataplexy. Sleep 35:1247-1255F. Anic-Labat S, Guilleminault C, Kraemer HC, Meehan J, Arrigoni J, Mignot E (1999) Validation of a cataplexy questionnaire in 983 sleep-disorders patients. Sleep 22:77-87. Arenkiel BR, Klein ME, Davison IG, Katz LC, Ehlers MD (2008) Genetic control of neuronal activity in mice conditionally expressing TRPV1. Nat Methods 5:299-302. Arias-Carrion O, Murillo-Rodriguez E (2014) Effects of hypocretin/orexin cell transplantation on narcoleptic-like sleep behavior in rats. PLoS One 9:e95342. Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL (2007) Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Proc Natl Acad Sci U S A 104:5163-5168. Aserinsky E, Kleitman N (1953) Regularly occurring periods of eye motility, and concomitant phenomena, during sleep. Science 118:273-274. Babcock DA, Narver EL, Dement WC, Mitler MM (1976) Effects of imipramine, chlorimipramine, and fluoxetine on cataplexy in dogs. Pharmacol Biochem Behav 5:599- 602. Baghdoyan HA, Rodrigo-Angulo ML, McCarley RW, Hobson JA (1984a) Site-specific enhancement and suppression of desynchronized sleep signs following cholinergic stimulation of three brainstem regions. Brain Res 306:39-52. Baghdoyan HA, Monaco AP, Rodrigo-Angulo ML, Assens F, McCarley RW, Hobson JA (1984b) Microinjection of neostigmine into the pontine reticular formation of cats enhances desynchronized sleep signs. J Pharmacol Exp Ther 231:173-180.

190

Barker EC, Puchowicz M, Letterio J, Higgins K, Sharkey KM (2017) GHB levels in breast milk of women with narcolepsy with cataplexy treated with sodium oxybate. Sleep Med 36:172- 177. Bennett JR, Dunroy HM, Corfield DR, Hart N, Simonds AK, Polkey MI, Morrell MJ (2004) Respiratory muscle activity during REM sleep in patients with diaphragm paralysis. Neurology 62:134-137. Bernard-Valnet R, Yshii L, Queriault C, Nguyen XH, Arthaud S, Rodrigues M, Canivet A, Morel AL, Matthys A, Bauer J, Pignolet B, Dauvilliers Y, Peyron C, Liblau RS (2016) CD8 T cell-mediated killing of orexinergic neurons induces a narcolepsy-like phenotype in mice. Proc Natl Acad Sci U S A 113:10956-10961. Billiard M (2008) Narcolepsy: current treatment options and future approaches. Neuropsychiatr Dis Treat 4:557-566. Birgul N, Weise C, Kreienkamp HJ, Richter D (1999) Reverse physiology in drosophila: identification of a novel allatostatin-like neuropeptide and its cognate receptor structurally related to the mammalian somatostatin/galanin/opioid receptor family. EMBO J 18:5892- 5900. Black SW, Yamanaka A, Kilduff TS (2017) Challenges in the development of therapeutics for narcolepsy. Prog Neurobiol 152:89-113. Black SW, Morairty SR, Chen TM, Leung AK, Wisor JP, Yamanaka A, Kilduff TS (2014) GABAB agonism promotes sleep and reduces cataplexy in murine narcolepsy. J Neurosci 34:6485-6494. Blanco-Centurion C, Liu M, Konadhode R, Pelluru D, Shiromani PJ (2013) Effects of orexin gene transfer in the dorsolateral pons in orexin knockout mice. Sleep 36:31-40. Boender AJ, de Jong JW, Boekhoudt L, Luijendijk MC, van der Plasse G, Adan RA (2014) Combined use of the canine adenovirus-2 and DREADD-technology to activate specific neural pathways in vivo. PLoS One 9:e95392. Boissard R, Fort P, Gervasoni D, Barbagli B, Luppi PH (2003) Localization of the GABAergic and non-GABAergic neurons projecting to the sublaterodorsal nucleus and potentially gating paradoxical sleep onset. Eur J Neurosci 18:1627-1639. Boissard R, Gervasoni D, Schmidt MH, Barbagli B, Fort P, Luppi PH (2002) The rat pontomedullary network responsible for paradoxical sleep onset and maintenance: a combined microinjection and functional neuroanatomical study. Eur J Neurosci 16:1959-1973. Bourgin P, Escourrou P, Gaultier C, Adrien J (1995) Induction of rapid eye movement sleep by carbachol infusion into the pontine reticular formation in the rat. Neuroreport 6:532-536. Broderick M, Guilleminault C (2009) Rebound cataplexy after withdrawal from antidepressants. Sleep Med 10:403-404. Brooks PL, Peever JH (2012) Identification of the transmitter and receptor mechanisms responsible for REM sleep paralysis. J Neurosci 32:9785-9795. Brooks PL, Peever J (2016) A Temporally Controlled Inhibitory Drive Coordinates Twitch Movements during REM Sleep. Current biology : CB 26:1177-1182. Brown RE, Basheer R, McKenna JT, Strecker RE, McCarley RW (2012) Control of sleep and wakefulness. Physiol Rev 92:1087-1187. Brown RE, McKenna JT, Winston S, Basheer R, Yanagawa Y, Thakkar MM, McCarley RW (2008) Characterization of GABAergic neurons in rapid-eye-movement sleep controlling regions of the brainstem reticular formation in GAD67-green fluorescent protein knock-in mice. Eur J Neurosci 27:352-363.

191

Bruysters M, Jongejan A, Akdemir A, Bakker RA, Leurs R (2005) A G(q/11)-coupled mutant histamine H(1) receptor F435A activated solely by synthetic ligands (RASSL). J Biol Chem 280:34741-34746. Burgess CR, Scammell TE (2012) Narcolepsy: neural mechanisms of sleepiness and cataplexy. J Neurosci 32:12305-12311. Burgess CR, Peever JH (2013) A noradrenergic mechanism functions to couple motor behavior with arousal state. Current biology : CB 23:1719-1725. Burgess CR, Tse G, Gillis L, Peever JH (2010) Dopaminergic regulation of sleep and cataplexy in a murine model of narcolepsy. Sleep 33:1295-1304. Burgess CR, Oishi Y, Mochizuki T, Peever JH, Scammell TE (2013) Amygdala lesions reduce cataplexy in orexin knock-out mice. J Neurosci 33:9734-9742. Butt TR, Karathanasis SK (1995) Transcription factors as drug targets: opportunities for therapeutic selectivity. Gene expression 4:319-336. Calabro RS, Savica R, Lagana A, Magaudda A, Imbesi D, Gallitto G, La Spina P, Musolino R (2007) Status cataplecticus misdiagnosed as recurrent syncope. Neurol Sci 28:336-338. Calik MW (2017) Update on the treatment of narcolepsy: clinical efficacy of pitolisant. Nat Sci Sleep 9:127-133. Carter ME, Soden ME, Zweifel LS, Palmiter RD (2013) Genetic identification of a neural circuit that suppresses appetite. Nature 503:111-114. Carter ME, Yizhar O, Chikahisa S, Nguyen H, Adamantidis A, Nishino S, Deisseroth K, de Lecea L (2010) Tuning arousal with optogenetic modulation of locus coeruleus neurons. Nat Neurosci 13:1526-1533. Chabas D, Habert MO, Maksud P, Tourbah A, Minz M, Willer JC, Arnulf I (2007) Functional imaging of cataplexy during status cataplecticus. Sleep 30:153-156. Chan E, Steenland HW, Liu H, Horner RL (2006) Endogenous excitatory drive modulating respiratory muscle activity across sleep-wake states. American journal of respiratory and critical care medicine 174:1264-1273. Chang WH, Lin SK, Lane HY, Wei FC, Hu WH, Lam YW, Jann MW (1998) Reversible metabolism of clozapine and clozapine N-oxide in schizophrenic patients. Prog Neuropsychopharmacol Biol Psychiatry 22:723-739. Chemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, Richardson JA, Williams SC, Xiong Y, Kisanuki Y, Fitch TE, Nakazato M, Hammer RE, Saper CB, Yanagisawa M (1999) Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell 98:437-451. Chen KS, Xu M, Zhang Z, Chang WC, Gaj T, Schaffer DV, Dan Y (2018) A Hypothalamic Switch for REM and Non-REM Sleep. Neuron 97:1168-1176 e1164. Chen X, Choo H, Huang XP, Yang X, Stone O, Roth BL, Jin J (2015) The first structure-activity relationship studies for designer receptors exclusively activated by designer drugs. ACS Chem Neurosci 6:476-484. Chou TC, Lee CE, Lu J, Elmquist JK, Hara J, Willie JT, Beuckmann CT, Chemelli RM, Sakurai T, Yanagisawa M, Saper CB, Scammell TE (2001) Orexin (hypocretin) neurons contain dynorphin. J Neurosci 21:RC168. Claeysen S, Joubert L, Sebben M, Bockaert J, Dumuis A (2003) A single mutation in the 5-HT4 receptor (5-HT4-R D100(3.32)A) generates a Gs-coupled receptor activated exclusively by synthetic ligands (RASSL). J Biol Chem 278:699-702.

192

Clement O, Sapin E, Berod A, Fort P, Luppi PH (2011) Evidence that neurons of the sublaterodorsal tegmental nucleus triggering paradoxical (REM) sleep are glutamatergic. Sleep 34:419-423. Clement O, Valencia Garcia S, Libourel PA, Arthaud S, Fort P, Luppi PH (2014) The inhibition of the dorsal paragigantocellular reticular nucleus induces waking and the activation of all adrenergic and noradrenergic neurons: a combined pharmacological and functional neuroanatomical study. PLoS One 9:e96851. Coward P, Wada HG, Falk MS, Chan SD, Meng F, Akil H, Conklin BR (1998) Controlling signaling with a specifically designed Gi-coupled receptor. Proc Natl Acad Sci U S A 95:352-357. Cox J, Pinto L, Dan Y (2016) Calcium imaging of sleep-wake related neuronal activity in the dorsal pons. Nat Commun 7:10763. Crick F (1999) The impact of molecular biology on neuroscience. Philos Trans R Soc Lond B Biol Sci 354:2021-2025. Crick FH (1979) Thinking about the brain. Sci Am 241:219-232. Crochet S, Sakai K (1999) Effects of microdialysis application of monoamines on the EEG and behavioural states in the cat mesopontine tegmentum. Eur J Neurosci 11:3738-3752. Culebras A, Moore JT (1989) Magnetic resonance findings in REM sleep behavior disorder. Neurology 39:1519-1523. Daniels E, King MA, Smith IE, Shneerson JM (2001) Health-related quality of life in narcolepsy. J Sleep Res 10:75-81. Dauvilliers Y, Billiard M, Montplaisir J (2003) Clinical aspects and pathophysiology of narcolepsy. Clin Neurophysiol 114:2000-2017. Dauvilliers Y, Arnulf I, Mignot E (2007) Narcolepsy with cataplexy. Lancet 369:499-511. Dauvilliers Y, Abril B, Mas E, Michel F, Tafti M (2009) Normalization of hypocretin-1 in narcolepsy after intravenous immunoglobulin treatment. Neurology 73:1333-1334. Dauvilliers Y, Siegel JM, Lopez R, Torontali ZA, Peever JH (2014) Cataplexy--clinical aspects, pathophysiology and management strategy. Nat Rev Neurol 10:386-395. Dauvilliers Y, Montplaisir J, Molinari N, Carlander B, Ondze B, Besset A, Billiard M (2001) Age at onset of narcolepsy in two large populations of patients in France and Quebec. Neurology 57:2029-2033. de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C, Battenberg EL, Gautvik VT, Bartlett FS, 2nd, Frankel WN, van den Pol AN, Bloom FE, Gautvik KM, Sutcliffe JG (1998) The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A 95:322-327. Deurveilher S, Hars B, Hennevin E (1997) Pontine microinjection of carbachol does not reliably enhance paradoxical sleep in rats. Sleep 20:593-607. Economo CV (1930) Sleep as a problem of localization. The Journal of Nervous and Mental Disease:249-259. Economo CV (1931) Encephalitis Lethargica. London: Oxford Medical Publications, Humphrey Milford, Oxford University Press. Espana RA, Scammell TE (2011) Sleep neurobiology from a clinical perspective. Sleep 34:845- 858. Espana RA, McCormack SL, Mochizuki T, Scammell TE (2007) Running promotes wakefulness and increases cataplexy in orexin knockout mice. Sleep 30:1417-1425. Farrell MS, Roth BL (2013) Pharmacosynthetics: Reimagining the pharmacogenetic approach. Brain Res 1511:6-20.

193

Fenik VB, Davies RO, Kubin L (2005) REM sleep-like atonia of hypoglossal (XII) motoneurons is caused by loss of noradrenergic and serotonergic inputs. American journal of respiratory and critical care medicine 172:1322-1330. Ferguson SM, Eskenazi D, Ishikawa M, Wanat MJ, Phillips PE, Dong Y, Roth BL, Neumaier JF (2011) Transient neuronal inhibition reveals opposing roles of indirect and direct pathways in sensitization. Nat Neurosci 14:22-24. Fraigne JJ, Orem JM (2011) Phasic motor activity of respiratory and non-respiratory muscles in REM sleep. Sleep 34:425-434. Fraigne JJ, Torontali ZA, Snow MB, Peever JH (2015) REM Sleep at its Core - Circuits, Neurotransmitters, and Pathophysiology. Front Neurol 6:123. Fuller PM, Saper CB, Lu J (2007) The pontine REM switch: past and present. J Physiol 584:735- 741. Furutani N, Hondo M, Kageyama H, Tsujino N, Mieda M, Yanagisawa M, Shioda S, Sakurai T (2013) Neurotensin co-expressed in orexin-producing neurons in the lateral hypothalamus plays an important role in regulation of sleep/wakefulness states. PLoS One 8:e62391. Garzon M, De Andres I, Reinoso-Suarez F (1998) Sleep patterns after carbachol delivery in the ventral oral pontine tegmentum of the cat. Neuroscience 83:1137-1144. Gassel MM, Marchiafava PL, Pompeiano O (1966) Rubrospinal influences during desynchronized sleep. Nature 209:1218-1220. Gautvik KM, de Lecea L, Gautvik VT, Danielson PE, Tranque P, Dopazo A, Bloom FE, Sutcliffe JG (1996) Overview of the most prevalent hypothalamus-specific mRNAs, as identified by directional tag PCR subtraction. Proc Natl Acad Sci U S A 93:8733-8738. George R, Haslett WL, Jenden DJ (1964) A Cholinergic Mechanism in the Brainstem Reticular Formation: Induction of Paradoxical Sleep. Int J Neuropharmacol 3:541-552. Gnadt JW, Pegram GV (1986) Cholinergic brainstem mechanisms of REM sleep in the rat. Brain Res 384:29-41. Gomez-Choco MJ, Iranzo A, Blanco Y, Graus F, Santamaria J, Saiz A (2007) Prevalence of restless legs syndrome and REM sleep behavior disorder in multiple sclerosis. Mult Scler 13:805-808. Goutagny R, Luppi PH, Salvert D, Lapray D, Gervasoni D, Fort P (2008) Role of the dorsal paragigantocellular reticular nucleus in paradoxical (rapid eye movement) sleep generation: a combined electrophysiological and anatomical study in the rat. Neuroscience 152:849-857. Grace KP, Liu H, Horner RL (2012) 5-HT1A receptor-responsive pedunculopontine tegmental neurons suppress REM sleep and respiratory motor activity. J Neurosci 32:1622-1633. Grace KP, Hughes SW, Horner RL (2013) Identification of the mechanism mediating genioglossus muscle suppression in REM sleep. American journal of respiratory and critical care medicine 187:311-319. Grace KP, Vanstone LE, Horner RL (2014) Endogenous cholinergic input to the pontine REM sleep generator is not required for REM sleep to occur. J Neurosci 34:14198-14209. Gray PA (2013) Transcription factors define the neuroanatomical organization of the medullary reticular formation. Frontiers in neuroanatomy 7:7. Guilleminault C, Gelb M (1995) Clinical aspects and features of cataplexy. Adv Neurol 67:65-77. Guilleminault C, Wilson RA, Dement WC (1974) A study on cataplexy. Archives of Neurology 31:255-261. Gulyani S, Wu MF, Nienhuis R, John J, Siegel JM (2002) Cataplexy-related neurons in the amygdala of the narcoleptic dog. Neuroscience 112:355-365.

194

Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES (2011) A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Front Syst Neurosci 5:18. Hara J, Beuckmann CT, Nambu T, Willie JT, Chemelli RM, Sinton CM, Sugiyama F, Yagami K, Goto K, Yanagisawa M, Sakurai T (2001) Genetic ablation of orexin neurons in mice results in narcolepsy, hypophagia, and obesity. Neuron 30:345-354. Hasegawa E, Yanagisawa M, Roth B, Sakurai T, Mieda M (2013) Restoration of orexin signaling in the dorsal raphe and locus coeruleus differntially ameliorate symptoms of narcoleptic mice. Sleep Medicine 14:e150. Hasegawa E, Maejima T, Yoshida T, Masseck OA, Herlitze S, Yoshioka M, Sakurai T, Mieda M (2017) Serotonin neurons in the dorsal raphe mediate the anticataplectic action of orexin neurons by reducing amygdala activity. Proc Natl Acad Sci U S A 114:E3526-E3535. Hayashi Y, Kashiwagi M, Yasuda K, Ando R, Kanuka M, Sakai K, Itohara S (2015) Cells of a common developmental origin regulate REM/non-REM sleep and wakefulness in mice. Science 350:957-961. Heiman M, Schaefer A, Gong S, Peterson JD, Day M, Ramsey KE, Suarez-Farinas M, Schwarz C, Stephan DA, Surmeier DJ, Greengard P, Heintz N (2008) A translational profiling approach for the molecular characterization of CNS cell types. Cell 135:738-748. Hendricks JC, Morrison AR, Mann GL (1982) Different behaviors during paradoxical sleep without atonia depend on pontine lesion site. Brain Res 239:81-105. Hess WR, Akert K (1955) Experimental data on role of hypothalamus in mechanism of emotional behavior. AMA Arch Neurol Psychiatry 73:127-129. Hishikawa Y, Kaneko Z (1965) Electroencephalographic Study on Narcolepsy. Electroencephalogr Clin Neurophysiol 18:249-259. Hobson JA, Goldberg M, Vivaldi E, Riew D (1983) Enhancement of desynchronized sleep signs after pontine microinjection of the muscarinic agonist bethanechol. Brain Res 275:127- 136. Holmes CJ, Jones BE (1994) Importance of cholinergic, GABAergic, serotonergic and other neurons in the medial medullary reticular formation for sleep-wake states studied by cytotoxic lesions in the cat. Neuroscience 62:1179-1200. Hong SB, Tae WS, Joo EY (2006) Cerebral perfusion changes during cataplexy in narcolepsy patients. Neurology 66:1747-1749. Horton GA, Fraigne JJ, Torontali ZA, Snow MB, Lapierre JL, Liu H, Montandon G, Peever JH, Horner RL (2017) Activation of the Hypoglossal to Tongue Musculature Motor Pathway by Remote Control. Sci Rep 7:45860. Horvath TL, Peyron C, Diano S, Ivanov A, Aston-Jones G, Kilduff TS, van Den Pol AN (1999) Hypocretin (orexin) activation and synaptic innervation of the locus coeruleus noradrenergic system. J Comp Neurol 415:145-159. Hossaini M, Goos JA, Kohli SK, Holstege JC (2012) Distribution of glycine/GABA neurons in the ventromedial medulla with descending spinal projections and evidence for an ascending glycine/GABA projection. PLoS One 7:e35293. Hublin C, Kaprio J, Partinen M, Koskenvuo M, Heikkila K, Koskimies S, Guilleminault C (1994) The prevalence of narcolepsy: an epidemiological study of the Finnish Twin Cohort. Ann Neurol 35:709-716.

195

Hupe M, Li MX, Gertow Gillner K, Adams RH, Stenman JM (2014) Evaluation of TRAP- sequencing technology with a versatile conditional mouse model. Nucleic Acids Res 42:e14. Jacobson KA, Ohno M, Duong HT, Kim SK, Tchilibon S, Cesnek M, Holy A, Gao ZG (2005) A neoceptor approach to unraveling microscopic interactions between the human A2A adenosine receptor and its agonists. Chem Biol 12:237-247. Jacobson KA, Gao ZG, Chen A, Barak D, Kim SA, Lee K, Link A, Rompaey PV, van Calenbergh S, Liang BT (2001) Neoceptor concept based on molecular complementarity in GPCRs: a mutant adenosine A(3) receptor with selectively enhanced affinity for amine-modified nucleosides. J Med Chem 44:4125-4136. Jalal B, Hinton DE (2015) Sleep Paralysis Among Egyptian College Students: Association With Anxiety Symptoms (PTSD, Trait Anxiety, Pathological Worry). J Nerv Ment Dis 203:871- 875. Jego S, Glasgow SD, Herrera CG, Ekstrand M, Reed SJ, Boyce R, Friedman J, Burdakov D, Adamantidis AR (2013) Optogenetic identification of a rapid eye movement sleep modulatory circuit in the hypothalamus. Nat Neurosci 16:1637-1643. Jennum P, Ibsen R, Knudsen S, Kjellberg J (2013) Comorbidity and mortality of narcolepsy: a controlled retro- and prospective national study. Sleep 36:835-840. Jianhua C, Xiuqin L, Quancai C, Heyang S, Yan H (2013) Rapid eye movement sleep behavior disorder in a patient with brainstem lymphoma. Intern Med 52:617-621. Jones BE (1991) Paradoxical sleep and its chemical/structural substrates in the brain. Neuroscience 40:637-656. Jouvet M (1962) [Research on the neural structures and responsible mechanisms in different phases of physiological sleep]. Arch Ital Biol 100:125-206. Jouvet M (1965) Paradoxical Sleep--a Study of Its Nature and Mechanisms. Prog Brain Res 18:20- 62. Jouvet M, Michel F (1959) [Electromyographic correlations of sleep in the chronic decorticate & mesencephalic cat]. C R Seances Soc Biol Fil 153:422-425. Jouvet M, Jeannerod M, Delorme F (1965) [Organization of the system responsible for phase activity during paradoxal sleep]. C R Seances Soc Biol Fil 159:1599-1604. Kallweit U, Bassetti CL (2017) Pharmacological management of narcolepsy with and without cataplexy. Expert Opin Pharmacother 18:809-817. Kanamori N, Sakai K, Jouvet M (1980) Neuronal activity specific to paradoxical sleep in the ventromedial medullary reticular formation of unresdrained cats. Brain Res 189:251-255. Kao JP (2006) Caged molecules: principles and practical considerations. Curr Protoc Neurosci Chapter 6:Unit 6 20. Karczmar AG, Longo VG, De Carolis AS (1970) A pharmacological model of paradoxical sleep: the role of cholinergic and monoamine systems. Physiol Behav 5:175-182. Karlsson KA, Gall AJ, Mohns EJ, Seelke AM, Blumberg MS (2005) The neural substrates of infant sleep in rats. PLoS biology 3:e143. Kaur S, Thankachan S, Begum S, Liu M, Blanco-Centurion C, Shiromani PJ (2009) Hypocretin-2 saporin lesions of the ventrolateral periaquaductal gray (vlPAG) increase REM sleep in hypocretin knockout mice. PLoS One 4:e6346. Kimura K, Tachibana N, Kohyama J, Otsuka Y, Fukazawa S, Waki R (2000) A discrete pontine ischemic lesion could cause REM sleep behavior disorder. Neurology 55:894-895. Klimova B, Maresova P, Novotny M, Kuca K (2016) A Global View on Narcolepsy - A Review Study. Mini Rev Med Chem.

196

Knudsen S, Mikkelsen JD, Bang B, Gammeltoft S, Jennum PJ (2010) Intravenous immunoglobulin treatment and screening for hypocretin neuron-specific autoantibodies in recent onset childhood narcolepsy with cataplexy. Neuropediatrics 41:217-222. Kodama T, Lai YY, Siegel JM (1998) Enhanced glutamate release during REM sleep in the rostromedial medulla as measured by in vivo microdialysis. Brain Res 780:178-181. Kohlmeier KA, Tyler CJ, Kalogiannis M, Ishibashi M, Kristensen MP, Gumenchuk I, Chemelli RM, Kisanuki YY, Yanagisawa M, Leonard CS (2013) Differential actions of orexin receptors in brainstem cholinergic and monoaminergic neurons revealed by receptor knockouts: implications for orexinergic signaling in arousal and narcolepsy. Frontiers in neuroscience 7:246. Kozorovitskiy Y, Saunders A, Johnson CA, Lowell BB, Sabatini BL (2012) Recurrent network activity drives striatal synaptogenesis. Nature 485:646-650. Krahn LE, Lymp JF, Moore WR, Slocumb N, Silber MH (2005) Characterizing the emotions that trigger cataplexy. J Neuropsychiatry Clin Neurosci 17:45-50. Krenzer M, Anaclet C, Vetrivelan R, Wang N, Vong L, Lowell BB, Fuller PM, Lu J (2011) Brainstem and spinal cord circuitry regulating REM sleep and muscle atonia. PLoS One 6:e24998. Kryger MH, Roth T, Dement WC (2005) Principles and practice of sleep medicine, 4th Edition. Philadelphia, PA: Elsevier/Saunders. Kryger MH, Roth T, Dement WC (2017) Principles and practice of sleep medicine, Sixth edition. Edition. Philadelphia, PA: Elsevier. Kubin L (2001) Carbachol models of REM sleep: recent developments and new directions. Arch Ital Biol 139:147-168. Lai YY, Siegel JM (1988) Medullary regions mediating atonia. J Neurosci 8:4790-4796. Lai YY, Siegel JM (1991) Pontomedullary glutamate receptors mediating locomotion and muscle tone suppression. J Neurosci 11:2931-2937. Lai YY, Kodama T, Siegel JM (2001) Changes in monoamine release in the ventral horn and hypoglossal nucleus linked to pontine inhibition of muscle tone: an in vivo microdialysis study. J Neurosci 21:7384-7391. Lammers GJ, Arends J, Declerck AC, Ferrari MD, Schouwink G, Troost J (1993) Gammahydroxybutyrate and narcolepsy: a double-blind placebo-controlled study. Sleep 16:216-220. Lechner HA, Lein ES, Callaway EM (2002) A genetic method for selective and quickly reversible silencing of Mammalian neurons. J Neurosci 22:5287-5290. Lee HM, Giguere PM, Roth BL (2014) DREADDs: novel tools for drug discovery and development. Drug discovery today 19:469-473. Lerchner W, Xiao C, Nashmi R, Slimko EM, van Trigt L, Lester HA, Anderson DJ (2007) Reversible silencing of neuronal excitability in behaving mice by a genetically targeted, ivermectin-gated Cl- channel. Neuron 54:35-49. Li J, Hu Z, de Lecea L (2014) The hypocretins/orexins: integrators of multiple physiological functions. Br J Pharmacol 171:332-350. Li Y, Gao XB, Sakurai T, van den Pol AN (2002) Hypocretin/Orexin excites hypocretin neurons via a local glutamate neuron-A potential mechanism for orchestrating the hypothalamic arousal system. Neuron 36:1169-1181. Lim AS, Lozano AM, Moro E, Hamani C, Hutchison WD, Dostrovsky JO, Lang AE, Wennberg RA, Murray BJ (2007) Characterization of REM-sleep associated ponto-geniculo-occipital waves in the human pons. Sleep 30:823-827.

197

Lima SQ, Miesenbock G (2005) Remote control of behavior through genetically targeted photostimulation of neurons. Cell 121:141-152. Limousin N, Dehais C, Gout O, Heran F, Oudiette D, Arnulf I (2009) A brainstem inflammatory lesion causing REM sleep behavior disorder and sleepwalking (parasomnia overlap disorder). Sleep Med 10:1059-1062. Lin L, Faraco J, Li R, Kadotani H, Rogers W, Lin X, Qiu X, de Jong PJ, Nishino S, Mignot E (1999) The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 98:365-376. Liu M, Blanco-Centurion C, Konadhode R, Begum S, Pelluru D, Gerashchenko D, Sakurai T, Yanagisawa M, van den Pol AN, Shiromani PJ (2011) Orexin gene transfer into zona incerta neurons suppresses muscle paralysis in narcoleptic mice. J Neurosci 31:6028-6040. Lopez-Rodriguez F, Kohlmeier K, Morales FR, Chase MH (1994) State dependency of the effects of microinjection of cholinergic drugs into the nucleus pontis oralis. Brain Res 649:271- 281. Lu J, Sherman D, Devor M, Saper CB (2006) A putative flip-flop switch for control of REM sleep. Nature 441:589-594. Luppi PH, Clement O, Valencia Garcia S, Brischoux F, Fort P (2013) New aspects in the pathophysiology of rapid eye movement sleep behavior disorder: the potential role of glutamate, gamma-aminobutyric acid, and glycine. Sleep Med 14:714-718. Mahoney CE, Agostinelli LJ, Brooks JN, Lowell BB, Scammell TE (2017) GABAergic Neurons of the Central Amygdala Promote Cataplexy. J Neurosci 37:3995-4006. Mallo M (2006) Controlled gene activation and inactivation in the mouse. Frontiers in bioscience : a journal and virtual library 11:313-327. Marks GA, Roffwarg HP, Shaffery JP (1999) Neuronal activity in the lateral geniculate nucleus associated with ponto-geniculo-occipital waves lacks lamina specificity. Brain Res 815:21- 28. Mastrangelo D, de Saint Hilaire-Kafi Z, Gaillard JM (1994) Effects of clonidine and alpha-methyl- p-tyrosine on the carbachol stimulation of paradoxical sleep. Pharmacol Biochem Behav 48:93-100. Mathis J, Hess CW, Bassetti C (2007) Isolated mediotegmental lesion causing narcolepsy and rapid eye movement sleep behaviour disorder: a case evidencing a common pathway in narcolepsy and rapid eye movement sleep behaviour disorder. J Neurol Neurosurg Psychiatry 78:427-429. Matos N, Gaig C, Santamaria J, Iranzo A (2016) Tricks to rapidly terminate episodes of cataplexy in narcolepsy. Sleep Med 20:129-130. Matsuzaki M (1969) Differential effects of sodium butyrate and physostigmine upon the activities of para-sleep in acute brain stem preparations. Brain Res 13:247-265. Mattarozzi K, Bellucci C, Campi C, Cipolli C, Ferri R, Franceschini C, Mazzetti M, Russo PM, Vandi S, Vignatelli L, Plazzi G (2008) Clinical, behavioural and polysomnographic correlates of cataplexy in patients with narcolepsy/cataplexy. Sleep Med 9:425-433. Mayer G, Rodenbeck A, Kesper K, International Xyrem Study G (2017) Sodium oxybate treatment in narcolepsy and its effect on muscle tone. Sleep Med 35:1-6. Mayford M, Bach ME, Huang YY, Wang L, Hawkins RD, Kandel ER (1996) Control of memory formation through regulated expression of a CaMKII transgene. Science 274:1678-1683. McCarley RW, Hobson JA (1975) Neuronal excitability modulation over the sleep cycle: a structural and mathematical model. Science 189:58-60.

198

McGorry PD (2013) Early clinical phenotypes, clinical staging, and strategic biomarker research: building blocks for personalized psychiatry. Biol Psychiatry 74:394-395. McGregor R, Siegel JM (2010) Illuminating the locus coeruleus: control of posture and arousal. Nat Neurosci 13:1448-1449. McShane BB, Galante RJ, Biber M, Jensen ST, Wyner AJ, Pack AI (2012) Assessing REM sleep in mice using video data. Sleep 35:433-442. Mignot E (2001) A hundred years of narcolepsy research. Arch Ital Biol 139:207-220. Mignot E, Renaud A, Nishino S, Arrigoni J, Guilleminault C, Dement WC (1993) Canine cataplexy is preferentially controlled by adrenergic mechanisms: evidence using monoamine selective uptake inhibitors and release enhancers. Psychopharmacology 113:76-82. Mignot EJ (2014) History of narcolepsy at Stanford University. Immunol Res 58:315-339. Miller JD, Faull KF, Bowersox SS, Dement WC (1990) CNS monoamines and their metabolites in canine narcolepsy: a replication study. Brain Res 509:169-171. Mitler MM, Dement W (1974) Cataplectic-like behavior in cats after micro-injections of carbachol in pontine reticular formation . Brain Research 68:335-343. Mochizuki T, Crocker A, McCormack S, Yanagisawa M, Sakurai T, Scammell TE (2004) Behavioral state instability in orexin knock-out mice. J Neurosci 24:6291-6300. Moller LR, Ostergaard JR (2009) Treatment with venlafaxine in six cases of children with narcolepsy and with cataplexy and hypnagogic hallucinations. J Child Adolesc Psychopharmacol 19:197-201. Morales F, Chase MH (1981) Postsynaptic control of lumbar motoneuron excitability during active sleep in the chronic cat. Brain Res 225:279-295. Morales FR, Sampogna S, Rampon C, Luppi PH, Chase MH (2006) Brainstem glycinergic neurons and their activation during active (rapid eye movement) sleep in the cat. Neuroscience 142:37-47. Mouret J, Delorme F, Jouvet M (1967) [Lesions of the pontine tegmentum and sleep in rats]. C R Seances Soc Biol Fil 161:1603-1606. Nakamura Y, Goldberg LJ, Chandler SH, Chase MH (1978) Intracellular analysis of trigeminal motoneuron activity during sleep in the cat. Science 199:204-207. Nauta WJ (1946) Hypothalamic regulation of sleep in rats; an experimental study. J Neurophysiol 9:285-316. Nichols CD, Roth BL (2009) Engineered G-protein Coupled Receptors are Powerful Tools to Investigate Biological Processes and Behaviors. Front Mol Neurosci 2:16. Nishino S, Mignot E (1997) Pharmacological aspects of human and canine narcolepsy. Prog Neurobiol 52:27-78. Nishino S, Sakurai T (2005) The Orexin/Hypocretin System, 1 Edition: Humana Press. Nishino S, Arrigoni J, Shelton J, Dement WC, Mignot E (1993) Desmethyl metabolites of serotonergic uptake inhibitors are more potent for suppressing canine cataplexy than their parent compounds. Sleep 16:706-712. Nishino S, Shelton J, Renaud A, Dement WC, Mignot E (1995) Effect of 5-HT1A receptor agonists and antagonists on canine cataplexy. J Pharmacol Exp Ther 272:1170-1175. Nishino S, Arrigoni J, Shelton J, Kanbayashi T, Dement WC, Mignot E (1997) Effects of thyrotropin-releasing hormone and its analogs on daytime sleepiness and cataplexy in canine narcolepsy. J Neurosci 17:6401-6408.

199

Nishino S, Haak L, Shepherd H, Guilleminault C, Sakai T, Dement WC, Mignot E (1990) Effects of central alpha-2 adrenergic compounds on canine narcolepsy, a disorder of rapid eye movement sleep. J Pharmacol Exp Ther 253:1145-1152. Nishino S, Arrigoni J, Valtier D, Miller JD, Guilleminault C, Dement WC, Mignot E (1991) Dopamine D2 mechanisms in canine narcolepsy. J Neurosci 11:2666-2671. Ohno K, Sakurai T (2008) Orexin neuronal circuitry: role in the regulation of sleep and wakefulness. Frontiers in neuroendocrinology 29:70-87. Oishi Y, Williams RH, Agostinelli L, Arrigoni E, Fuller PM, Mochizuki T, Saper CB, Scammell TE (2013) Role of the medial prefrontal cortex in cataplexy. J Neurosci 33:9743-9751. Onoe H, Sakai K (1995) Kainate receptors: a novel mechanism in paradoxical (REM) sleep generation. Neuroreport 6:353-356. Orem J, Lovering AT, Dunin-Barkowski W, Vidruk EH (2000) Endogenous excitatory drive to the respiratory system in rapid eye movement sleep in cats. J Physiol 527 Pt 2:365-376. Orem JM, Lovering AT, Vidruk EH (2005) Excitation of medullary respiratory neurons in REM sleep. Sleep 28:801-807. Oudiette D, Dodet P, Ledard N, Artru E, Rachidi I, Similowski T, Arnulf I (2018) Author Correction: REM sleep respiratory behaviours match mental content in narcoleptic lucid dreamers. Sci Rep 8:6128. Overeem (2011) The Clinical Features of Cataplexy. In: Narcolepsy. New York, NY: Springer. Overeem S, Lammers GJ, van Dijk JG (2002) Cataplexy: 'tonic immobility' rather than 'REM- sleep atonia'? Sleep Med 3:471-477. Overeem S, Mignot E, van Dijk JG, Lammers GJ (2001) Narcolepsy: clinical features, new pathophysiologic insights, and future perspectives. J Clin Neurophysiol 18:78-105. Overeem S, Reijntjes R, Huyser W, Lammers GJ, van Dijk JG (2004) Corticospinal excitability during laughter: implications for cataplexy and the comparison with REM sleep atonia. J Sleep Res 13:257-264. Overeem S, van Nues SJ, van der Zande WL, Donjacour CE, van Mierlo P, Lammers GJ (2011) The clinical features of cataplexy: a questionnaire study in narcolepsy patients with and without hypocretin-1 deficiency. Sleep Med 12:12-18. Panda S (2014) Status cataplecticus as initial presentation of late onset narcolepsy. J Clin Sleep Med 10:207-209. Parker K, Kim Y, Alberico S, Emmons E, S. Narayanan N (2016) Optogenetic approaches to evaluate striatal function in animal models of Parkinson disease. Pedersen NP, Ferrari L, Venner A, Wang JL, Abbott SBG, Vujovic N, Arrigoni E, Saper CB, Fuller PM (2017) Supramammillary glutamate neurons are a key node of the arousal system. Nat Commun 8:1405. Peever J, Fuller PM (2017) The Biology of REM Sleep. Current biology : CB 27:R1237-R1248. Peever JH, Lai YY, Siegel JM (2003) Excitatory effects of hypocretin-1 (orexin-A) in the trigeminal motor nucleus are reversed by NMDA antagonism. J Neurophysiol 89:2591- 2600. Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG, Kilduff TS (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18:9996-10015. Peyron C et al. (2000) A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat Med 6:991-997. Pillen S, Pizza F, Dhondt K, Scammell TE, Overeem S (2017) Cataplexy and Its Mimics: Clinical Recognition and Management. Curr Treat Options Neurol 19:23.

200

Pizza F, Vandi S, Liguori R, Parchi P, Avoni P, Mignot E, Plazzi G (2014) Primary progressive narcolepsy type 1: the other side of the coin. Neurology 83:2189-2190. Pizza F, Antelmi E, Vandi S, Meletti S, Erro R, Baumann CR, Bhatia KP, Dauvilliers Y, Edwards MJ, Iranzo A, Overeem S, Tinazzi M, Liguori R, Plazzi G (2018) The Distinguishing Motor Features of Cataplexy: A Study from Video Recorded Attacks. Sleep. Plazzi G, Montagna P, Provini F, Bizzi A, Cohen M, Lugaresi E (1996) Pontine lesions in idiopathic narcolepsy. Neurology 46:1250-1254. Pollock MS, Mistlberger RE (2003) Rapid eye movement sleep induction by microinjection of the GABA-A antagonist bicuculline into the dorsal subcoeruleus area of the rat. Brain Res 962:68-77. Provini F, Vetrugno R, Pastorelli F, Lombardi C, Plazzi G, Marliani AF, Lugaresi E, Montagna P (2004) Status dissociatus after surgery for tegmental ponto-mesencephalic cavernoma: a state-dependent disorder of motor control during sleep. Mov Disord 19:719-723. Qiu MH, Chen MC, Fuller PM, Lu J (2016) Stimulation of the Pontine Parabrachial Nucleus Promotes Wakefulness via Extra-thalamic Forebrain Circuit Nodes. Current biology : CB 26:2301-2312. Ranson SW (1940) The Functional and Clinical Signficance of the Hypothalamus. Quarterly Bulletin of Northwestern University Medical School 14:1899-1912. Ray RS, Corcoran AE, Brust RD, Kim JC, Richerson GB, Nattie E, Dymecki SM (2011) Impaired respiratory and body temperature control upon acute serotonergic neuron inhibition. Science 333:637-642. Redfern CH, Coward P, Degtyarev MY, Lee EK, Kwa AT, Hennighausen L, Bujard H, Fishman GI, Conklin BR (1999) Conditional expression and signaling of a specifically designed Gi- coupled receptor in transgenic mice. Nat Biotechnol 17:165-169. Redfern CH, Degtyarev MY, Kwa AT, Salomonis N, Cotte N, Nanevicz T, Fidelman N, Desai K, Vranizan K, Lee EK, Coward P, Shah N, Warrington JA, Fishman GI, Bernstein D, Baker AJ, Conklin BR (2000) Conditional expression of a Gi-coupled receptor causes ventricular conduction delay and a lethal cardiomyopathy. Proc Natl Acad Sci U S A 97:4826-4831. Renaud A, Nishino S, Dement WC, Guilleminault C, Mignot E (1991) Effects of SDZ NVI-085, a putative subtype-selective alpha 1-agonist, on canine cataplexy, a disorder of rapid eye movement sleep. European journal of pharmacology 205:11-16. Ristanovic RK, Liang H, Hornfeldt CS, Lai C (2009) Exacerbation of cataplexy following gradual withdrawal of antidepressants: manifestation of probable protracted rebound cataplexy. Sleep Med 10:416-421. Rogan SC, Roth BL (2011) Remote control of neuronal signaling. Pharmacological reviews 63:291-315. Rosin DL, Weston MC, Sevigny CP, Stornetta RL, Guyenet PG (2003) Hypothalamic orexin (hypocretin) neurons express vesicular glutamate transporters VGLUT1 or VGLUT2. J Comp Neurol 465:593-603. Roth B, Bruhova S, Lehovsky M (1969) REM sleep and NREM sleep in narcolepsy and hypersomnia. Electroencephalogr Clin Neurophysiol 26:176-182. Roth BL (2016) DREADDs for Neuroscientists. Neuron 89:683-694. Sakai K (1986) Central mechanisms of paradoxical sleep. Brain Dev 8:402-407. Sakurai T (2007) The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nat Rev Neurosci 8:171-181. Sakurai T et al. (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92:573-585.

201

Sanford LD, Tang X, Xiao J, Ross RJ, Morrison AR (2003) GABAergic regulation of REM sleep in reticularis pontis oralis and caudalis in rats. J Neurophysiol 90:938-945. Saper CB, Loewy AD, Swanson LW (2016) Commentary on: Saper CB, Loewy AD, Swanson LW, Cowan WM. (1976) Direct hypothalamo-autonomic connections. Brain Research 117:305-312. Brain Res 1645:12-14. Saper CB, Fuller PM, Pedersen NP, Lu J, Scammell TE (2010) Sleep state switching. Neuron 68:1023-1042. Sapin E, Lapray D, Berod A, Goutagny R, Leger L, Ravassard P, Clement O, Hanriot L, Fort P, Luppi PH (2009) Localization of the brainstem GABAergic neurons controlling paradoxical (REM) sleep. PLoS One 4:e4272. Sastre JP, Jouvet M (1979) [Oneiric behavior in cats]. Physiol Behav 22:979-989. Savvidou A, Knudsen S, Olsson-Engman M, Gammeltoft S, Jennum P, Palm L (2013) Hypocretin deficiency develops during onset of human narcolepsy with cataplexy. Sleep 36:147-148. Scammell TE, Willie JT, Guilleminault C, Siegel JM, International Working Group on Rodent Models of N (2009) A consensus definition of cataplexy in mouse models of narcolepsy. Sleep 32:111-116. Schachter M, Parkes JD (1980) Fluvoxamine and clomipramine in the treatment of cataplexy. J Neurol Neurosurg Psychiatry 43:171-174. Schenck CH, Bassetti CL, Arnulf I, Mignot E (2007) English translations of the first clinical reports on narcolepsy and cataplexy by Westphal and Gelineau in the late 19th century, with commentary. J Clin Sleep Med 3:301-311. Schmidt HS, Clark RW, Hyman PR (1977) Protriptyline: an effective agent in the treatment of the narcolepsy-cataplexy syndrome and hypersomnia. The American journal of psychiatry 134:183-185. Schone C, Apergis-Schoute J, Sakurai T, Adamantidis A, Burdakov D (2014) Coreleased orexin and glutamate evoke nonredundant spike outputs and computations in histamine neurons. Cell Rep 7:697-704. Shammah-Lagnado SJ, Negrao N, Silva BA, Ricardo JA (1987) Afferent connections of the nuclei reticularis pontis oralis and caudalis: a horseradish peroxidase study in the rat. Neuroscience 20:961-989. Shouse MN, Siegel JM (1992) Pontine regulation of REM sleep components in cats: integrity of the pedunculopontine tegmentum (PPT) is important for phasic events but unnecessary for atonia during REM sleep. Brain Res 571:50-63. Siegel JM (1999) Narcolepsy: a key role for hypocretins (orexins). Cell 98:409-412. Siegel JM, Rogawski MA (1988) A function for REM sleep: regulation of noradrenergic receptor sensitivity. Brain Res 472:213-233. Siegel JM, Nienhuis R, Tomaszewski KS (1984) REM sleep signs rostral to chronic transections at the pontomedullary junction. Neurosci Lett 45:241-246. Siegel JM, Moore R, Thannickal T, Nienhuis R (2001) A brief history of hypocretin/orexin and narcolepsy. Neuropsychopharmacology 25:S14-20. Siegel JM, Nienhuis R, Gulyani S, Ouyang S, Wu MF, Mignot E, Switzer RC, McMurry G, Cornford M (1999) Neuronal degeneration in canine narcolepsy. J Neurosci 19:248-257. Simon DK, Nishino S, Scammell TE (2004) Mistaken diagnosis of psychogenic gait disorder in a man with status cataplecticus ("limp man syndrome"). Mov Disord 19:838-840. Sirieix C, Gervasoni D, Luppi PH, Leger L (2012) Role of the lateral paragigantocellular nucleus in the network of paradoxical (REM) sleep: an electrophysiological and anatomical study in the rat. PLoS One 7:e28724.

202

Small KM, Brown KM, Forbes SL, Liggett SB (2001) Modification of the beta 2-adrenergic receptor to engineer a receptor-effector complex for gene therapy. J Biol Chem 276:31596- 31601. Snow MB, Fraigne JJ, Thibault-Messier G, Chuen VL, Thomasian A, Horner RL, Peever J (2017) GABA Cells in the Central Nucleus of the Amygdala Promote Cataplexy. J Neurosci 37:4007-4022. Soja PJ, Lopez-Rodriguez F, Morales FR, Chase MH (1991) The postsynaptic inhibitory control of lumbar motoneurons during the atonia of active sleep: effect of strychnine on motoneuron properties. J Neurosci 11:2804-2811. Soja PJ, Lopez-Rodriguez F, Morales FR, Chase MH (1995) Effects of excitatory amino acid antagonists on the phasic depolarizing events that occur in lumbar motoneurons during REM periods of active sleep. J Neurosci 15:4068-4076. Soya S, Shoji H, Hasegawa E, Hondo M, Miyakawa T, Yanagisawa M, Mieda M, Sakurai T (2013) Orexin receptor-1 in the locus coeruleus plays an important role in cue-dependent fear memory consolidation. J Neurosci 33:14549-14557. Srinivasan S, Vaisse C, Conklin BR (2003) Engineering the melanocortin-4 receptor to control G(s) signaling in vivo. Ann N Y Acad Sci 994:225-232. Srinivasan S, Santiago P, Lubrano C, Vaisse C, Conklin BR (2007) Engineering the melanocortin- 4 receptor to control constitutive and ligand-mediated G(S) signaling in vivo. PLoS One 2:e668. St Louis EK, Boeve BF (2017) REM Sleep Behavior Disorder: Diagnosis, Clinical Implications, and Future Directions. Mayo Clin Proc 92:1723-1736. Stachniak TJ, Ghosh A, Sternson SM (2014) Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus-->midbrain pathway for feeding behavior. Neuron 82:797-808. Steffen AD, Lai C, Weaver TE (2017) Criteria for gauging response to sodium oxybate for narcolepsy. J Sleep Res. Steriade M, Pare D, Bouhassira D, Deschenes M, Oakson G (1989) Phasic activation of lateral geniculate and perigeniculate thalamic neurons during sleep with ponto-geniculo-occipital waves. J Neurosci 9:2215-2229. Sternson SM, Roth BL (2014) Chemogenetic tools to interrogate brain functions. Annual review of neuroscience 37:387-407. Strader CD, Gaffney T, Sugg EE, Candelore MR, Keys R, Patchett AA, Dixon RA (1991) Allele- specific activation of genetically engineered receptors. J Biol Chem 266:5-8. Sturzenegger C, Bassetti CL (2004) The clinical spectrum of narcolepsy with cataplexy: a reappraisal. J Sleep Res 13:395-406. Sweger EJ, Casper KB, Scearce-Levie K, Conklin BR, McCarthy KD (2007) Development of hydrocephalus in mice expressing the G(i)-coupled GPCR Ro1 RASSL receptor in astrocytes. J Neurosci 27:2309-2317. Swett CP, Hobson JA (1968) The effects of posterior hypothalamic lesions on behavioral and electrographic manifestations of sleep and waking in cats. Arch Ital Biol 106:283-293. Tabuchi S, Tsunematsu T, Black SW, Tominaga M, Maruyama M, Takagi K, Minokoshi Y, Sakurai T, Kilduff TS, Yamanaka A (2014) Conditional ablation of orexin/hypocretin neurons: a new mouse model for the study of narcolepsy and orexin system function. J Neurosci 34:6495-6509. Tan EM, Yamaguchi Y, Horwitz GD, Gosgnach S, Lein ES, Goulding M, Albright TD, Callaway EM (2006) Selective and quickly reversible inactivation of mammalian neurons in vivo using the Drosophila allatostatin receptor. Neuron 51:157-170.

203

Tan W, Janczewski WA, Yang P, Shao XM, Callaway EM, Feldman JL (2008) Silencing preBotzinger complex somatostatin-expressing neurons induces persistent apnea in awake rat. Nat Neurosci 11:538-540. Taubenberger JK, Baltimore D, Doherty PC, Markel H, Morens DM, Webster RG, Wilson IA (2012) Reconstruction of the 1918 influenza virus: unexpected rewards from the past. MBio 3. Teissier A, Chemiakine A, Inbar B, Bagchi S, Ray RS, Palmiter RD, Dymecki SM, Moore H, Ansorge MS (2015) Activity of Raphe Serotonergic Neurons Controls Emotional Behaviors. Cell Rep 13:1965-1976. Thannickal TC, Moore RY, Nienhuis R, Ramanathan L, Gulyani S, Aldrich M, Cornford M, Siegel JM (2000) Reduced number of hypocretin neurons in human narcolepsy. Neuron 27:469- 474. Thorpy MJ, Krieger AC (2014) Delayed diagnosis of narcolepsy: characterization and impact. Sleep Med 15:502-507. Torontali ZA, Grace KP, Horner RL, Peever JH (2014) Cholinergic involvement in control of REM sleep paralysis. J Physiol 592:1425-1426. Torterolo P, Sampogna S, Chase MH (2013) Hypocretinergic and non-hypocretinergic projections from the hypothalamus to the REM sleep executive area of the pons. Brain Res 1491:68- 77. Valencia Garcia S, Libourel PA, Lazarus M, Grassi D, Luppi PH, Fort P (2017) Genetic inactivation of glutamate neurons in the rat sublaterodorsal tegmental nucleus recapitulates REM sleep behaviour disorder. Brain 140:414-428. Valencia Garcia S, Brischoux F, Clement O, Libourel PA, Arthaud S, Lazarus M, Luppi PH, Fort P (2018) Ventromedial medulla inhibitory neuron inactivation induces REM sleep without atonia and REM sleep behavior disorder. Nat Commun 9:504. van Dongen PAM (1980) Locus ceruleus region: Effects on behavior of cholinergic, noradrenergic, and opiate drugs injected intracerebrally into freely moving cats. Experimental Neurology 67. Van Dort CJ, Zachs DP, Kenny JD, Zheng S, Goldblum RR, Gelwan NA, Ramos DM, Nolan MA, Wang K, Weng FJ, Lin Y, Wilson MA, Brown EN (2015) Optogenetic activation of cholinergic neurons in the PPT or LDT induces REM sleep. Proc Natl Acad Sci U S A 112:584-589. Vanni-Mercier G, Sakai K, Lin JS, Jouvet M (1989) Mapping of cholinoceptive brainstem structures responsible for the generation of paradoxical sleep in the cat. Arch Ital Biol 127:133-164. Vardy E et al. (2015) A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron 86:936-946. Verret L, Leger L, Fort P, Luppi PH (2005) Cholinergic and noncholinergic brainstem neurons expressing Fos after paradoxical (REM) sleep deprivation and recovery. Eur J Neurosci 21:2488-2504. Vetrivelan R, Fuller PM, Tong Q, Lu J (2009) Medullary circuitry regulating rapid eye movement sleep and motor atonia. J Neurosci 29:9361-9369. Vetrugno R, D'Angelo R, Moghadam KK, Vandi S, Franceschini C, Mignot E, Montagna P, Plazzi G (2010) Behavioural and neurophysiological correlates of human cataplexy: a video- polygraphic study. Clin Neurophysiol 121:153-162. Vogel GW (1975) A review of REM sleep deprivation. Arch Gen Psychiatry 32:749-761.

204

Vong L, Ye C, Yang Z, Choi B, Chua S, Jr., Lowell BB (2011) Leptin action on GABAergic neurons prevents obesity and reduces inhibitory tone to POMC neurons. Neuron 71:142- 154. Wang HL, Morales M (2009) Pedunculopontine and laterodorsal tegmental nuclei contain distinct populations of cholinergic, glutamatergic and GABAergic neurons in the rat. Eur J Neurosci 29:340-358. Wang J, Greenberg H (2013) Status cataplecticus precipitated by abrupt withdrawal of venlafaxine. J Clin Sleep Med 9:715-716. Weber F, Chung S, Beier KT, Xu M, Luo L, Dan Y (2015) Control of REM sleep by ventral medulla GABAergic neurons. Nature 526:435-438. Weng FJ, Williams RH, Hawryluk JM, Lu J, Scammell TE, Saper CB, Arrigoni E (2014) Carbachol excites sublaterodorsal nucleus neurons projecting to the spinal cord. J Physiol 592:1601-1617. Willie JT, Chemelli RM, Sinton CM, Tokita S, Williams SC, Kisanuki YY, Marcus JN, Lee C, Elmquist JK, Kohlmeier KA, Leonard CS, Richardson JA, Hammer RE, Yanagisawa M (2003) Distinct narcolepsy syndromes in Orexin receptor-2 and Orexin null mice: molecular genetic dissection of Non-REM and REM sleep regulatory processes. Neuron 38:715-730. Wilson SA (1933) Cataplexy. The Journal of neurology and psychopathology 14:45-51. Wilson SAK (1928) The narcolepsies. Brain 51:63-109. Wu MF, Gulyani SA, Yau E, Mignot E, Phan B, Siegel JM (1999) Locus coeruleus neurons: cessation of activity during cataplexy. Neuroscience 91:1389-1399. Wu MF, John J, Boehmer LN, Yau D, Nguyen GB, Siegel JM (2004) Activity of dorsal raphe cells across the sleep-waking cycle and during cataplexy in narcoleptic dogs. J Physiol 554:202- 215. Xi M, Chase MH (2010) The injection of hypocretin-1 into the nucleus pontis oralis induces either active sleep or wakefulness depending on the behavioral state when it is administered. Sleep 33:1236-1243. Xi MC, Morales FR, Chase MH (1999a) Evidence that wakefulness and REM sleep are controlled by a GABAergic pontine mechanism. J Neurophysiol 82:2015-2019. Xi MC, Morales FR, Chase MH (1999b) A GABAergic pontine reticular system is involved in the control of wakefulness and sleep. Sleep research online : SRO 2:43-48. Xi Z, Luning W (2009) REM sleep behavior disorder in a patient with pontine stroke. Sleep Med 10:143-146. Yamuy J, Fung SJ, Xi M, Chase MH (2004) Hypocretinergic control of spinal cord motoneurons. J Neurosci 24:5336-5345. Yeh JE, Toniolo PA, Frank DA (2013) Targeting transcription factors: promising new strategies for cancer therapy. Current opinion in oncology 25:652-658. Yoshizawa T, Yamagishi Y, Koseki N, Goto J, Yoshida H, Shibasaki F, Shoji S, Kanazawa I (2000) Cell cycle arrest enhances the in vitro cellular toxicity of the truncated Machado- Joseph disease gene product with an expanded polyglutamine stretch. Hum Mol Genet 9:69-78. Zambelis T, Paparrigopoulos T, Soldatos CR (2002) REM sleep behaviour disorder associated with a neurinoma of the left pontocerebellar angle. J Neurol Neurosurg Psychiatry 72:821- 822.

205

Zemelman BV, Nesnas N, Lee GA, Miesenbock G (2003) Photochemical gating of heterologous ion channels: remote control over genetically designated populations of neurons. Proc Natl Acad Sci U S A 100:1352-1357.