GENETIC ANALYSIS OF HUMAN HEREDITARY NAIL
DYSPLASIA IN PAKISTANI FAMILIES
by
Anwar Kamal Khan
Department of Biotechnology & Genetic Engineering Kohat University of Science and Technology, Kohat-26000 Khyber Pakhtunkhwa, Pakistan 2019 GENETIC ANALYSIS OF HUMAN HEREDITARY NAIL DYSPLASIA IN PAKISTANI FAMILIES
Thesis submitted in partial fulfillment of the requirements for the degree of doctor of philosophy (PhD) in Biotechnology & Genetic Engineering
by
Anwar Kamal Khan
(Registration No. BT420142001)
Department of Biotechnology & Genetic Engineering Kohat University of Science and Technology, Kohat-26000 Khyber Pakhtunkhwa, Pakistan 2019 CERTIFICATION FROM THE SUPERVISORS
This thesis entitled “GENETIC ANALYSIS OF HUMAN HEREDITARY NAIL
DYSPLASIA IN PAKISTANI FAMILIES” submitted by ANWAR KAMAL KHAN to the Kohat University of Science & Technology, Kohat for the award of Doctor of
Philosophy in Biotechnology & Genetic Engineering presents bonafide research work carried out under our supervision. This work (fully or in part) has not been submitted to any other Institution for the award of any degree/ diploma/certificate.
Supervisor I: Dr. Saad Ullah Khan Assistant professor ______Department of Biotechnology & Genetic Engineering, Signature
Kohat University of Science and Technology, Kohat
Supervisor II: Dr. Noor Muhammad Associate professor ______Department of Biotechnology & Genetic Engineering, Signature
Kohat University of Science and Technology, Kohat
Contents
CONTENTS
Page No
ACKNOWLEDGEMENTS I
LIST OF FIGURES III
LIST OF TABLES XI
LIST OF ABBREVIATIONS XII
ABSTRACT XV
CHAPTER 1 1
1.1 INTRODUCTION & REVIEW OF LITERATURE 1
1.1.1 Nail Growth 3
1.1.2 Nail Development 3
1.1.3 Signaling Pathways Stimulating Nail Development 4
1.1.3.1 WNT Signaling 5
1.1.3.2 NOTCH Signaling 6
1.1.3.3 BMP Signaling 6
1.1.3.4 Keratin Regulators and Keratin Related Genes 7
1.1.3.5 Keratins 7
1.1.3.6 Enzymes Involved in Nail Morphogenesis 8
1.1.4 Isolated Hereditary Nail Disorders 9
1.1.4.1 Trachonychia (Nail Disorder, Nonsyndromic Congenital, 1) 9
Continued.....
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Contents
Continued from the previous page Page No
1.1.4.2 Nail Disorder, Nonsyndromic Congenital, 2 10
1.1.4.3 Nail Disorder, Nonsyndromic Congenital, 3 10
1.1.4.4 Nail Disorder, Nonsyndromic Congenital, 4 12
1.1.4.5 Nail Disorder, Nonsyndromic Congenital, 5 14
1.1.4.6 Nail disorder, nonsyndromic congenital, 6 14
1.1.4.7 Nail Disorder, Nonsyndromic Congenital, 7 15
1.1.4.8 Nail Disorder, Nonsyndromic Congenital, 8 15
1.1.4.9 Nail Disorder, Nonsyndromic Congenital, 9 16
1.1.4.10 Nail Disorder, Nonsyndromic Congenital, 10 17
1.1.5 Isolated Congenital Nail Clubbing (ICNC) 18
1.1.6 Ectodermal Dysplasia 20
1.1.7 Syndromic Nail Disorders 24
1.1.7.1 Primary Hypertrophic Osteoarthropathy 24
1.1.7.2 Witkop Syndrome 25
1.1.7.3 Nail Patella Syndrome 26
1.1.7.4 Nail Hypertrophy 27
1.1.8 Homozygosity and recent techniques of gene identification 28
1.1.9 Cousin Marriages in Pakistani Population 29
1.1.10 Hypothesis 30
1.1.11 Objectives 30
CHAPTER 2 31
2.1 MATERIALS AND METHODS 31 Continued.....
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Contents
Continued from the previous page
Page No
2.1.1 Study Approval 31
2.1.2 Clinical Examination and Collection of Blood Samples 31
2.1.3 DNA Extraction from Blood Samples 31
2.1.3.1 Genomic DNA Extraction using Organic Method (Phenol-Chloroform 32 Method)
2.1.3.2 Genomic DNA Extraction via Gentra puregene Kit Method 33
2.1.4 Quantification of Extracted DNA and Polymerase Chain Reaction 34
2.1.5 Linkage Studies 34
2.1.5.1 Exclusion Mapping 34
2.1.5.2 Human Genome Scan 35
2.1.5.3 Exome and Sanger Sequencing 36
2.1.6 Agarose Gel Electrophoresis 37
2.1.7 Polyacrylamide Gel Electrophoresis (PAGE) 37
2.1.8 Statistical Analysis 37
2.1.9 Candidate Gene Sequencing 38
Continued.....
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Contents
Continued from the previous page Page No
2.1.10 Prediction of Mutation Effect 39
2.1.11 Protein Structure Prediction 40
CHAPTER 3 49
3.1 HEREDITARY NAIL DISORDERS 49
3.1.1 Family A 50
3.1.1.1 Clinical Features 50
3.1.1.2 Demarcating Genes Through Homozygosity Mapping in Family A 51
3.1.1.3 Exome and Sanger Sequencing 52
3.1.2 Family B 53
3.1.2.1 Clinical Features 53
3.1.2.2 Sequencing PLCD1 Gene in family B 53
3.1.2.3 Protein Structure Prediction for PLCD1 54
3.1.3 Family C 54
3.1.3.1 Clinical Features 54
3.1.3.2 Sequencing PLCD1 gene 55
3.1.4 FAMILY D 55
3.1.4.1 Clinical Features 55
3.1.5 FAMILY E 56
3.1.5.1 Clinical Features 56
3.1.5.2 Sequencing FZD6 Gene in Family D and E 56 Continued.....
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Contents
Continued from the previous page Page No
3.1.5.3 Protein Modeling for Family E 57
3.1.6 Family F 57
3.1.6.1 Clinical Features 57
3.1.6.2 Mapping of Candidate Genes Involved in Family F 58
3.1.7 Discussion 58
CHAPTER 4 92
4.1 Ectodermal dysplasia 92
4.1.1 FAMILY G 92
4.1.1.1 Clinical Features 92
4.1.1.2 Genotyping and Sequencing 93
4.1.1.3 Protein Modeling 94
4.1.1.2 Discussion 94
CHAPTER 5 102
5.1 Primary Hypertrophic Osteoarthropathy 102
5.1.1 Family H 102
5.1.1.1 Clinical Features 102
5.1.1.2 Genotyping and Sequencing HPGD Gene 103
5.1.1.3 Protein Modeling 104
5.1.2 Discussion 104
Continued.....
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Contents
Continued from the previous page Page No
CONCLUSION AND RECOMMENDATIONS 115
CHAPTER 6 118
References 118
Appendices 150
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Acknowledgements
ACKNOWLEDGEMENTS
First and foremost, I would like to express my gratitude to ‘ALLAH’ Almighty who has been gracious and merciful and provided me with guidance and inspiration throughout my life. All regards, respects and blessings be upon the Holy Prophet
Hazrat Muhammad (Sallallahu aliahi wa sallam), whose blessings and teachings flourished my thoughts and thrived my ambitions.
I wish to express my greatest gratitude to everyone who has contributed to this thesis and helped me along the way. Especially, I would like to thank all the participated patients and their families, healthy controls, co-authors and collaborators for their active participation and scientific contributions. The credit also goes to the medical doctors for the clear diagnosis which is the key success in medical genetics.
I am deeply indebted and grateful to my supervisor Dr. Saad Ullah Khan and my co supervisor Dr. Noor Muhammad, Department of Biotechnology and Genetic
Engineering, Kohat University of Science & Technology, Kohat, for their support, guidance, patience and valuable feedback throughout my PhD studies. I wish to extend my gratitude to chairman Department of Biotechnology & Genetic Engineering Dr.
Muhammad Daud Khan for promoting research friendly environment for the students in the department.
I would like to acknowledge Dr. Sulman Basit and Dr. Khadim Shah specially, because without his help and cooperation in my work, though not possible, would be really difficult.
I appreciate my lab juniors Sher Alam Khan, Niamat Ullah Khan, Adil Rehman,
Mehran Khan, Nazif Khan, Haris Khan, Abdullah Khan, Gohar Khan, Usman Ullah
Khan and Hamid Nawaz Khan for the respect they gave me and for their support.
I
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Acknowledgements
I present heartiest thanks to my friends Asad Ullah, Pirzada Khan, Wajid Alim, Naqib
Ullah Khan, Dr. Wahid Ullah Khan, Dr. Zia-u-Rehman, Dr. Niamat Khan, Dr. Aziz
Uullah, Dr. Muhammad Jami and Muhammad Mudasir Aslam for their nice company and advice throughout my research work. The good time spent with them can never be erased from my memories.
I am extremely grateful to my parents for their endless support, love and care. The love and special concern of my brothers Mir Saad Ullah Khan, Asghar Ali Khan and Akhtar
Ali Khan will always be cherished.
Finally, I wish to thank the Higher Education Commission (HEC), Islamabad
Pakistan, for funding this project through research grants to my supervisor.
Anwar Kamal Khan
II
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
LIST OF FIGURES
Figure No. Title Page No.
Pedigree drawing for four generations family A inheriting 3.1 65 autosomal recessive congenital nail dysplasia (ARCND). Filled squires and circles denote affected subjects, while the empty squires and circles designate normal individuals. Squires and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers characterized with stars designate those siblings who donated blood samples for genetic study Phenotypes of the patients in family A. Patient V-1 showing severe 3.2 66 hyperkeratotic thick nail plate, nail bed and swelled fingers (a). Affected subject V-2 showing keratotic lesions of the, middle and ring fingers in the right hand and keratotic left fingernails and normal left thumb (b). Patient V-4 (c) showing onychodystrophy, hyperkeratotic with minor erythema and swelling. Thick dystrophic nails with hyperkeratotic nail bed in patient V-5 (d). Patient V-6 revealing destructed nail plate and nail bed (e)
3.3 Haplotype of family A transmitting congenital nail dysplasia in 67 recessive form. For each genotyped subject, haplotypes of microsatellite markers linked to chromosome 10q11.23-q22.1 are presented under each symbol. Alleles forming risk haplotypes are shown in black. Alleles that follow independent segregation are shown in white. The centromeric boundary of the disease interval is delimited by marker D10S1724 while the telomeric boundary is delimited by D10S1650. Genetic distances (centiMorgan) and markers are shown according to Rutgers physical map built 36.2
Continued.....
III
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
3.4 Ideogram demonstrating congenital nail dysplasia locus at 68 chromosome 10q11.23-q22.1. All linked markers and flanking markers (D10S1724 and D10S1650) are shown in 22.3 Mb linkage interval. Physical region is shown in accordance with sequence based physical map (build 36.2)
A short DNA sequence showing a missense variant (c.92G>T) in 3.5 69 SLC25A16 in family A. The upper row (a) denotes the DNA sequence of SLC25A16 gene in homozygous affected sibling, the central row (b) in carrier person and lower row (c) in homozygous normal person
Comparison of a short protein sequence of human SLC25A16 across 3.6 69 different species. The misssense variant (p.Arg31Leu) affecting the conserved arginine amino acid in human SLC25A16 is specified by an arrow Pedigree drawing for three generations family B, representing 3.7 73 segregation of autosomal dominant congenital leukonychia. Filled squires and circles denote affected subjects, while the empty squires and circles designate normal individuals. Squires and circles with cross lines denote deceased individuals. The numbers characterized with asterisks designate those persons who donated blood samples for this study Clinical characteristics of affected subjects in family B. True 3.8 74 leukonychia in affected subjects III-1 and III-3 (a, b). Incomplete leukonychia in affected subject III-2 (c) showing yellow color in the middle toe-nail
Continued.....
IV
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
A short DNA sequence showing a missense variant (c.625T>C) in 3.9 75 PLCD1 in family B. The upper row (a) denotes the DNA sequence of PLCD1 gene in normal individual while the lower row (b) denotes the DNA sequence of PLCD1 in the affected individual 3.10 Comparison of a limited protein sequence of human PLCD1 with 75 other orthologs. Cysteine (C) designates the conserved amino acid across different vertebrate groups 3.11 The predicted structure of wild-type PLCD1 protein (a). Zoom-up 76 view of interaction pattern of wild type (b) and mutant type protein (c) Pedigree drawing for family C segregating autosomal dominant 3.12 77 leukonychia. Filled symbols denote affected subjects while clear symbols designate normal persons. The numbers characterized with asterisks specify those siblings who donated blood samples for genetic analysis Clinical symptoms of the patients in family C. Affected individuals I- 3.13 77 1 (a), II-4 (b) showing leukonychia phenotype Pedigree drawing for family D, representing the segregation of 3.14 79 autosomal recessive isolated congenital nail dysplasia (ICND). Filled squires and circles denote affected subjects, while the empty squires and circles designate normal individuals. Squires and circles with cross lines denote deceased individuals. The numbers characterized with stars designate those siblings who donated blood samples for the present study Clinical characteristics of the affected persons in family D. Affected 3.15 80 individual IV-2 showing thick, hard, shiny and claw-shaped fingernails (a). Patient IV-2 showing hyponychia, onychauxis and onycholysis in toenails (b). Note thick, hard and hyperplastic fingers and toe nails in affected individual IV-3 (c, d). Continued.....
V
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
Pedigree drawing for four generations family E segregating 3.16 81 autosomal recessive congenital nail dysplasia (ARCND). Filled squires and circles denote affected subjects, while the empty squires and circles designate normal individuals. Squires and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers characterized with stars specify those persons who donated blood samples for this study Phenotypes of patients in family E. Affected individual IV-1 (a, b) 3.17 82 and IV-2 (c, d) showing onychauxis and onycholysis in the nails of fingers and toes Haplotype of family D segregating isolated congenital nail 3.18 83 dysplasia (ICND) in autosomal recessive manner. For each genotyped subject, haplotypes of the markers linked to chromosome 8q22.3 are presented under each squire and circle. Disease interval is bordered by marker D8S559 and D8S267, indicating that all affected persons are homozygous while the parents and only one sibling are heterozygous carriers Haplotype of family E transmitting isolated congenital nail 3.19 84 dysplasia (ICND) in autosomal recessive manner. For each genotyped subject, haplotypes of microsatellite markers linked to chromosome 8q22.3 are presented under each squire and circle. Disease interval is bordered by marker D8S559 and D8S267, indicating that the patients are homozygous while the mother and a brother is heterozygous carriers A short DNA sequence showing missense polymorphism (c.1750G>T) 3.20 85 in FZD6 gene in family D. The upper row (a) denote the DNA sequence of FZD6 gene in homozygous affected person, the central row (b) in heterozygous carrier and lower row (c) in the homozygous normal person. Continued..... VI
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
3.21 85 Comparison of a short amino acid sequence of human FZD6 across different groups. The nonsense variant (p.Glu584*) altering the conserved glutamic acid in human FZD6 is designated by arrow A short DNA sequence showing a missense polymorphism 3.22 86 (c.1266G>A) in FZD6 gene in family E. The upper row (a) denotes the DNA sequence of FZD6 gene in homozygous affected subject, the central row (b) in heterozygous carrier and lower row (c) in homozygous normal subject Comparison of a short protein sequence of human FZD6 across 3.23 86 different groups. The missense variant (p.Gly422Asp) altering the conserved glycine amino acid in human FZD6 is designated by arrow Location of residue Gly422 in the helix region (a). Hydrogen 3.24 87 bonding of Ser421 with Ile417 and Trp300. Local conformational change in the nearby residues interactions that results from the substitution of Glycine by Glutamic acid at position 422 (b, c). In case of Glu584* sequence variant, there occur the formation of truncated protein due to the premature stop codon and the loss subdomain is highlighted by magenta color (d) Pedigree drawing of Family F, transmitting autosomal recessive 3.25 89 congenital nail dysplasia. In pedigree clear squires and circles represent normal males and females while the black squares and circles designate affected male and female respectively. Squires and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers with stars indicate that these samples were available for clinical and genetic analysis Phenotypes of the patients in family F. Affected individuals IV-1, 3.26 90 IV-5 and V-2 showing deformed nail bed and onycholysis
Continued.....
VII
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
(a, b, c and d). The nails of the affected individuals are thick, hard, showing longitudinal over-curvature, ridging and loss of cuticle and curvature Genome-wide homozygosity. The image generated by 3.27 91 Homozygosity Mapper indicates the most promising regions of linkage on chromosome 1, 3, 5, 6 and 20 Pedigree of four generations family G segregating pure hair and nail 4.1 96 ectodermal dysplasia (PHNED) in autosomal recessive form. Filled squires and circles denote affected subjects, while the empty squires and circles designate normal individuals. Squires and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers characterized with stars designate those siblings who provided blood samples for this study Phenotypes of the patients in family G. Patient IV-1 showing 4.2 97 absence of scalp hair, eyebrows, eyelashes and rest of the body (a)., b and c). Dystrophic, irregular-shaped nails and distal onycholysis in affected member IV-1(b and c), IV-3 (d, e) and IV-4 (f and g) Haplotype of family G transmitting autosomal recessive PHNED). 4.3 98 For each genotyped sibling, haplotypes of microsatellite markers linked to chromosome 12q13.13 are presented under each squire and circle. boundaries of the disease interval are flanked by marker D12S96 and D12S298, indicating that all patients are homozygous, while the parents and unaffected siblings are carriers A short DNA sequence showing a missense variant (c.929A>C) in 4.4 99 HOXC13 in family G. The upper row (a) denotes the DNA sequence in homozygous affected person, the central row (b) in the carrier individual and lower row (c) in the homozygous normal person
Continued.....
VIII
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
Comparison of a short protein sequence of human HOXC13 with 4.5 other species. The missense mutation (p.Asn310Thr) substituting 99 the conserved asparagine amino acid is specified by an arrow Demonstration of predicted structure for homeobox domain of 4.6 100 human HOXC13 (a). Demonstration of wild and mutant HOXC13 interactions (b and c). Computed surface of the homeobox domain of the human HOXC13 (d). Computed surface of wild and mutant homeobox domain of HOXC13 (e and f) Pedigree of family H transmitting autosomal recessive primary 5.1 107 hypertrophic osteoarthropathy (PHO). Black symbols represent affected individuals. Squires and circles with stars designate individuals who donated blood samples for molecular study Radiograph of the affected sibling (II-4) of family H displaying 5.2 108 expansion of soft tissues round the tip of fingers, acro-osteolysis and sub-periostal new bone formation in the hands Clinical symptoms of the patients of family H. Patients II-1 and II- 5.3 109 4 displaying digital clubbing (a) and large ankles and arthropathy (b), respectively. Affected individual (V-1) showing dry, scaly and thickened skin (c). Affected individual (II-1) showing digital clubbing and pachydermia (d and e) Affected member (V-1) of family H showing the phenotype of 5.4 110 bulging eyes Genome-wide homozygosity. The screenshots indicate genome- 5.5 110 wide homozygosity scores created by HomozygosityMapper. The homozygosity scores are plotted in the form of bar chart. The red bars show the most promising genomic blocks lying at chromosome 4 containing the HPGD gene HPGD gene sequence analysis displaying homozygous affected 5.6 111 person (a), heterozygous carrier person (b), and homozygous normal person (c) Continued.....
IX
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Figures
Continued from the previous page
Comparison of a short protein sequence of human HPGD across 5.7 different vertebrate species. The misssense variant (p.S193P) 111 affecting the conserved serine amino acid in human HPGD is specified by an arrow Demonstration of crystal structure for human 15-PGDH protein (a). 5.8 112 Pattern of interaction of wild and mutant HPGD protein (b and c)
X
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Tables
LIST OF TABLES
Table No Title Page No
2.1 Microsatellite markers used to test linkage to genes/loci causing 41 isolated nail dysplasia
2.2 Microsatellite markers used to test linkage to genes/loci causing 43 ectodermal dysplasia
2.3 Microsatellite markers used to linkage to genes causing primary 44 hypertrophic osteoarthropathy 2.4 Primers sequences used for the amplification of PLCD1gene 45
2.5 Primers sequences used for the amplification of FZD6 gene 46
2.6 Primers sequences used for the amplification of HPGD gene 46
2.7 Primer sequences used for the amplification of SLC25A16 gene 47
2.8 Primers sequences used for the amplification of KRT74 gene 47
2.9 Primers sequences used for the amplification of KRT85 gene 48
2.10 Primers sequences used for the amplification of HOXC13 gene 48
3.1 Results of multiple and two point LOD score between ARCND and 70 chromosome 10 markers
3.2 List of homozygous pathogenic sequence variants identified in 72 exome sequence of affected member
3.3 List of mutations reported in PLCD1 gene so for 78
3.4 List of mutations reported in FZD6 gene so for 88
4.1 List of mutations reported in HOXC13 gene so for 101
5.1 Review of clinical characteristics of the affected members of 113 family M
5.2 List of mutations reported in HPGD gene so for 114
XI
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Abbreviations
LIST OF ABBREVIATIONS
APS Ammonium persulphate Aa Amino acids BMP Bone morphogenetic protein Bp Base pairs BWA Burrows-wheeler aligner BMP Bone morphogenetic protein CAP Keratin associated protein COL7A1 Collagen type VII alpha 1 CNV Copy number variants cM Centi Morgan DNA Deoxyribonucleic acid DAG Diacylglycerol EDA Ectodysplasin EDAR Ectodyplasin receptor EDARADD EDAR-associated death domain ED Ectodermal dysplasias EDTA Ethylene-diamine-tetra-acetic acid FLG Filaggrin FZD6 Frizzled class receptor 6 ExAC Exome aggregation consortium FMS Fragmentation solution FS Frame shift GATK Genome analysis toolkit HPGD Hydroxyprostaglandin HOXC13 Homeobox C-13 HED Hypohydrotic ectodermal dysplasia ICNC Isolated congenital nail clubbing IBD Identical by descent ICND Isolated congenital nail dysplasia Continued.....
XII
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Abbreviations
Continued from the previous page
Kb Kilobase KRT74 Keratin-74 LMX1 LIM homeobox transcription factor 1, alpha LEF Lymphoid enhancer factor LOD Logrithium of odds MIM Mendelian inheritance in man MSX2 Muscle segment homoebox drosophila homolog 2 MSXI Muscle segment homoebox drosophila homolog 1 Mm Millimolar mg Milligram ml Millilitre Mb Mega base pairs MA1 Multiple-sample amplification 2 mix MSM Multiple-sample amplification master mix MOE Molecular Operating Environment MAF Minor allele frequency NDNC Nail disorder nonsyndromic congenital NPS Nail–patella syndrome OMIM Online mendelian inheritance in man PHO Primary hypertrophic osteoarthropathy PLCD1 Phosphoinositide-specific phospholipase C delta 1 PHNED Pure hair and nail ectodermal dysplasia PC Pachyonychia congenital PMol Picomolar PCR Polymerase chain reaction PDB Protein data bank PTC Protein truncation RSPO R-spondin Continued.....
XIII
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
List of Abbreviations
Continued from the previous page
SNP Single nucleotide polymorphism SLC25A16 Solute Carrier Family 25 Member 16 TND Twenty nail dystrophy TCF T-cell factor TNS Tooth and nail syndrome Taq Thermus aquaticus TEM Two-color extension master mix TBE Tris Borate EDTA TEMED NNNN Tetramethylethylenediamine Tm Melting temperature WNT wingless type MMTV integration site family member
XIV
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Abstract
ABSTRACT
In human, genetic disorders of the nails are very rare and occur in both isolated and syndromic form. In syndromic forms, anomalies in other ectodermal appendages and/or skeletal deformities are associated with nail disorders. Over the past few years several, different types of human nail disorders have been characterized at clinical and molecular levels. In few cases of nail disorders, causative genes have been identified.
In the study presented in the dissertation, eight Pakistani families (A-H) representing isolated form of nail dysplasia (Families A-F) and syndromic nail disorders (Families
G and H) have been characterized both at clinical and molecular levels. Family A showed autosomal recessive isolated congenital fingernail dysplasia. Whole exome sequencing of the family revealed a novel variant c.92G>T (p.Arg31Leu;
MAF=0.0001; chr10:70,287,041) in the SLC25A16 (NM__152707.4) gene. Affected individuals in two families, B and C, showed typical phenotypes of hereditary leukonychia. Based on the phenotypes observed the PLCD1 gene was sequenced in all available individuals of both families. Analysis of sequencing data showed a recurrent heterozygous mutation c.625T>C (p.Cys209Arg; MAF=0.00009; chr3: 38,052,933) in family B. In family C analysis of sequencing data did not reveal any mutation in PLCD1
(NM_001130964.1) gene. To ascertain the causative gene, the DNA sample of an affected family member has been submitted for exome sequencing.
In two other families (D and E) of isolated nail dysplasia, linkage was established to mapped on chromosome 8q22.3. Subsequent sequencing of the FZD6 (NM_003506.4) gene revealed a homozygous non-sense variant c.1750G>T (p.E584X*; MAF=0.00001; chr8:104,342,091) in family D and a homozygous missense variant c.1266G>A ( p.Gly422Asp; MAF=0.00001; chr8:104,342,091) in family E. In family F the nails of
XV
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Abstract the affected individuals were thick and hard with deformed nail bed. After failing to establish linkage to the known genes in the family, DNA samples were used for SNP microarray genotyping. This identified four homozygous regions. To identify a causative gene in the linked regions, DNA sample of an affected individual has been submitted to exome sequencing.
In family G, affected individuals displayed typical phenotypes of pure hair and nail ectodermal dysplasia. All affected individuals of the family showed homozygosity with several markers related to HOXC13 (NM_017410.3) gene at chromosome 12p11.1- q21.1. Sequence analysis of HOXC13 revealed a novel homozygous missense mutation c.929A>C (p.Asn310Thr; chr12: 54,338,976).
Family H segregated autosomal recessive form of primary hypertrophic osteoarthropathy. Homozygosity mapping, based on whole genome SNP genotyping, lead to the identification of 7.05 Mb homozygous region at chromosome 4q34.1-q34.3.
The HPGD (NM_000860.6) gene, located in the homozygous region, was sequenced which detected a homozygous missense variant c.577T>C (p.S193P; chr4:
175,414,387) in all affected family members.
The study presented here involves the clinical and genetic analysis of eight families collected from different remote areas of Pakistan. Six of them were characterized by isolated congenital nail dysplasia while two others with syndromic nail disorders. In these families mutation analysis of SLC25A16, PLCD1, FZD6, HOXC13 and HPGD genes revealed some novel and recurrent mutations. In addition, failure to establish linkage to known genes in two families (C and F) directed the existence of undiscovered genes in the human genome triggering nail dysplasia phenotypes.
XVI
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Abstract
The data obtained from the present study contributed in publishing the following articles:
1. Khan, Anwar Kamal, Noor Muhammad, Sher Alam Khan, Waheed Ullah, Abdul
Nasir, Sibtain Afzal, Khushnooda Ramzan, Sulman Basit, and Saadullah Khan. “A
novel mutation in the HPGD gene causing primary hypertrophic osteoarthropathy
with digital clubbing in a Pakistani family.” Annals of human genetics 82, no. 3
(2018): 171-176.
2. Khan, Anwar Kamal, Noor Muhammad, Abdul Aziz, Sher Alam Khan, Khadim
Shah, Abdul Nasir, Muzammil Ahmad Khan, and Saadullah Khan. “A novel
mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair
and nail ectodermal dysplasia (ECTD9) in a Pakistani family.” BMC medical
genetics 18, no. 1 (2017): 42.
3. Khan, Anwar Kamal, S. A. Khan, Na Muhammad, Jamshaid Ahmad, Hamed
Nawaz, Abdul Nasir, Saira Farman, and Saadullah Khan. "Mutation in
Phospholipase C, δ1 (PLCD1) gene underlies hereditary leukonychia in a Pashtun
family and review of the literature." Balkan Journal of Medical Genetics 21, no. 1
(2018): 69-72.
4. Khan, S., M. Ansar, Khan, Anwar Kamal, K. Shah, N. Muhammad, S. Shahzad, D. A.
Nickerson et al. “A homozygous missense mutation in SLC25A16 is associated with
autosomal recessive isolated fingernail dysplasia in a Pakistani family.” British journal of
dermatology 178, no. 2 (2018): 556.
5. Khan, S., Khan, Anwar Kamal, Malaika, Nazif, M., Abbas, M., Khan, S. A., Khan,
B., Nasir, A., Jan, A., Muhammad, N., (2018). Association of sequence variants in
FZD6 encoding the Wnt receptor frizzled 6 with autosomal recessive Nail Dysplasia
(NDNC-10) in Pashtun families. J Pakistan Med Assoc 70, no.1 (2019):143-146. XVII
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
CHAPTER 1
1.1 INTRODUCTION & REVIEW OF LITERATURE
Nail is a unique skin outgrowth made up of a fully keratinized nail plate (Bergqvist et
al. 2017). Nails protect the soft tissues of the fingers and toes from injuries. It can be
used in the manipulation of fine items, an apparatus for scratching and grooming,
enhance the sensitivity of finger-tips and work like a natural weapon. In addition, well-
trimmed nails can increase the esthetic demand of the fingers and toes (Khan et al.
2015).
Nail is a complete organ comprises four major components namely nail plate, nail
matrix, nail bed and nail folds (Haneke et al. 2006). The nail plate is curved both in
longitudinal and transverse direction. Individuals show variability in the size, shape,
thickness and curvature of nail plate. Nail plate is a flexible structure and its flexibility
fluctuates within and among individuals concerning with age, season, disease state and
site (finger/toe) (De Berker and Forslind, 2004; Baden, 1970). The proximal nail plate
is enclosed by cuticle. The proximal and lateral parts of the nail plate is detained in nail
fold (Haneke, 2015). The nail plate is composed of parallel filaments of keratin, which
confers it’s a mechanical stability. As compare to intact skin, the nail plate is 1000 times
more permeable to water. It can also be a site for the deposition of exogenous substances
like drug of abuse, medications and arsenic (De Berker, 2007). For fingernails the
thickness of the nail plate is 0.25-0.6 mm and that for toenails is 1.3 mm. Approximately
25 layers of dead keratinized cells constitute the nail plate. These dead keratinized cells
are strongly attached to one another with the help of desmosomes, intercellular
junctions and membrane-coating granules.
1
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
Three layers, the dorsal, intermediate and ventral layer constitute the nail plate. The
dorsal layer consists of cornified keratin, which is dense, hard and only a few cells thick
(approximately 200µ). The intermediate layer is the softest and thickest layer, highly
fibrous and constitutes approximately 75% of the plate’s thickness. The ventral layer is
composed of limited layers of cells and it attaches the nail plate to nail bed (Gupchup
and Zatz, 1999).
Nail matrix is the tissue that produces hard keratins and is divided into proximal and
distal parts. Distal matrix is located under lunula (Sellheyer and Nelson, 2012; Perrin,
Langbein, and Schweizer, 2004). The matrix contains highly proliferative epithelial
cells and approximately 80% of the nail plate is formed by the matrix (De berkkr, 1996).
The proximal part of the matrix is more proliferative than the distal part so that more
nail substance is produced in the proximal part and the nail plate achieves a normal
convex curvature from proximal to distal (Pessa et al. 1990). Histopathologically, the
nail matrix contains three zones namely a germinative zone, prekeratogenous zone and
keratogenous zone. The germinative comprises two or three basaloid germinative cells
layers. The prekeratogenous zone comprises polygonal-shaped cells having oval
elongated nuclei and pink cytoplasm. These cells are organized parallel to the growth
of nail plate. The keratogenous zone comprises cells having large, compressed,
eosinophilic cytoplasm and compact hyperchromatic nuclei (Perrin, 1997).
The nail bed is located below nail plate. It initiates from the distal matrix and continue
up to hyponychium (Zaiac and Weiss, 2001). The nail bed is composed of scarcely
proliferating and stratified cells. These cells lack mitosis and keratinized very slowly
and mostly during the extension of the nail bed (Dawber, de Berker, and Baran, 2001).
2
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
At the distal end of nail plate, hyponychium attaches the nail bed to the ventral
epidermis of the digits (Cai and Ma, 2011).
The proximal part of the nail fold is comparable to the flanking skin but is usually
devoid of sebaceous glands and dermatoglyphic markings. From the proximal nail fold,
the cuticle originates and reflects on to the proximal part of nail plate. It is composed
of stratum conium which protects nail from environmental assaults like irritants,
bacteria and fungi (Baran, 2003).
1.1.1 Nail Growth
In human, the length and growth rate of nails show variability among individuals and
correlated to the length of the outermost finger bones. The index finger nails grow faster
than the little finger; and the growth rate of finger nails is three times faster than toenails
(Ravosa and Dagosto, 2007). In human, an average growth rate of the finger nails is 3
mm per month while that of the toenails is 1mm per month. A normal finger nails
completely regrow in 3-6 months, whereas toenails regrow in 10-12 months (Gupchup
and Zatz, 1999). Actual growth rate of nail is also linked to gender, age, season and
hereditary factors. Usually the growth rate of the nail is faster in summer as compare to
other seasons (Hunter, Savin, and Dahl, 2002).
1.1.2 Nail Development
In human, nail development begins around the 9th week of pregnancy by the
compression of mesenchyme tissue in dorsal distal tip of the digits (Zaias, 1963).
Around the 10th week of gestation, the dorsal distal phalanx leads to the formation of
the embryonic nail field which is the first superficially observable nail structure of the
fetus. It is the site where the formation of nail occurs. The proximal nail field produces
the matrix primordium that grows both proximally and ventrally and finally develops
3
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
into the invagination of primary nail field. At around 14th week of developmental
period, the primary nail plate appears and the flanking nail folds become visible. At this
point, the matrix primordium starts differentiation and leads to the formation of nail
matrix. The matrix consists of proliferating keratinocytes. The keratinocytes located
dorsal to the matrix express epithelial keratins, undergo apoptosis and deposit cornified
structure on the nail plate (Cui et al. 2013). Primarily networks of keratins (K1, K5,
K14, K10) are expressed and lead to the formation of intermediate filaments. These
filaments form the epithelial cells cytoskeletons. Subsequently, cells nearby the matrix
shift to spinous layer and stop division. After migration to the spinous layer, the cells
secrete structural proteins and enzymes specific of the nail plate. These include two
types of keratins including Keratin 6A (K6A) and keratin 17 (K17) which are soft
keratins. Keratin 31 (K31), keratin 33 (K33), keratin 34 (K34), keratin 39 (K39), keratin
81 (K81), keratin 85 (K85) and keratin 86 (K86) are the hard keratins (Rice et al. 2010;
Barthélemy et al. 2012). Filaggrin (FLG) is a filament-associated protein which helps
in the aggregation of keratins and other proteins like loricin and involucrin. Prolin rich
proteins and transglutaminases are expressed, the latter cross link those proteins. At
about the 4th month of developmental period, the nail completely covers the nail unit,
and tandemly grow with digits. The formation of toenails initiates about 4 weeks after
the development of fingernails (Zaias, 1963).
1.1.3 Signaling Pathways Stimulating Nail Development
The molecular mechanisms involved in nail development are poorly understood.
Identification of mutations in genes involved in human nail dysplasias and mouse
model experiments have provided insights into nail development (Fleckman et al.
2013). Nails and limb bud development are strictly joined and depends upon a close
4
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
communication between ectodermal and mesodermal tissues through various signaling
pathways.
1.1.3.1 WNT Signaling Pathway
It is one of the major pathways activated during nail development. It has been extremely
conserved during the course of evolution and plays a pivotal role in nail morphogenesis
(Cadigan and Nusse, 1997). WNT/β-catenin pathway plays a major role in nail
differentiation. A recent experiment on conditional knockout mice confirmed that
catenin beta-1 plays an important role in nail differentiation (Takeo et al. 2013).
The dermal fibroblasts located under the digit tip epithelium secretes RSPO3 and
RSPO4, which binds to their corresponding receptors expressed by stem cells in the
nail matrix (Ishii et al. 2008; Blaydon et al. 2006). In human, RSPO4 mutation can
cause anonychia/hyponachia congenita (MIM 206800). It is an uncommon autosomal-
recessive genetic entity described by the absence or severe hypoplasia of all twenty
nails (Blaydon et al. 2006; Bergmann et al. 2006).
Knight and Hankenson. (2014) reported that R-spondin proteins are secreted by
different types of cells and contain two domains, a TSR1 domain and a modified
cysteine-rich domain. Additionally, R-spondins also possesses two furin repeats and
these proteins play roles in the positive regulation of canonical Wnt signaling. These
proteins reduce Wnt receptor turnover and thus increases the stability of beta-catenin
WNT7A stimulates the expression of LMX1 transcription factor in the dorsal
mesenchyme. LMX1 transcription factor plays a major role in the morphogenesis of
dorsal limb structures (Feenstra et al. 2012; Dai, Randy, and Ding, 2009). Lmx1b
knockout mice experiments revealed that lmx1b play a key role in nail morphogenesis.
5
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
In human, nail patella syndrome (MIM 161299) is triggered by pathogenic mutations
in lmx1b gene (Dai, Randy, and Ding 2009; Ghoumid et al. 2016).
Jumlongras et al. (2001) reported that MSX1 is a WNT related transcription factor that
plays a key role in the development of nails and teeth. In human, pathogenic mutations
in MSX1 causes Witkop syndrome (MIM 189500).
1.1.3.2 NOTCH Signaling
NOTCH signaling pathway stimulates the nail matrix stem cells and help in the
differentiation of keratinocytes by activating p21gene. It has been suggested that WNT
signaling pathway ultimately contribute to the long-term influence of NOTCH1
pathway on tissue homeostasis of the nail unit (Rangarajan et al. 2001; Lin and Raphael,
2003).
1.1.3.3 BMP Signaling
Msx2 and Foxn1 transcription factors are downstream of BMP signaling and upstream
of NOTCH1 during hair differentiation, roles of both factors were investigated in nail
homeostasis (Cai and Ma 2011; Cai et al. 2009). Several lines of evidence indicate that
both factors stimulate nail diff1erentiation and maintain nail bed homeostasis. In Msx2
mutant mice, the cells of keratogenous zone showed poor differentiation and produced
small amount of hard keratins (main constituents of the nail plate). This negligible
amount of hard keratin synthesis results in longer and brittle nails in Msx2 mutant mice
(Cai and Ma 2011; Satokata et al. 2000). It was also noticed that Foxn1 mutant mice
show broken nails (Mecklenburg et al. 2004). In accordance with this, fewer hard
keratin expression was found in the nails of Foxn1 mutants than those of Msx2 mutants.
Cai and Jing. (2011) conducted a study on the role of Msx2 and Foxn1 transcription
factors and it was concluded that both factors play important role in maintaining nail
6
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
bed homeostasis. Msx2 and Foxn1 double-mutants have the phenotype of nail bed
hyperplasia. Hence, it has been shown that both of these transcription factors limit
cycling cells to the basal layer. They also maintain homeostasis of nail unit.
1.1.3.4 Keratin Regulators and Keratin Related Genes
HOXC12 and HOXC13 both acts as transcription factors and are important for hair and
nail development (Shang, Pruett, and Awgulewitsch, 2002). Both genes belong to the
homoebox gene family and encodes evolutionary conserved transcription factors. These
transcription factors work as regulators of downstream genes engaged in cell division
and differentiation (Pick and Heffer, 2012). HOXC13 regulates the transcription of
several hair keratin and keratin associated protein (CAP) genes (Jave-Suarez et al. 2002;
Tkatchenko et al. 2001).
Bazi et al. (2009) conducted a study on the role of HOXC13 protein in hair and nail
development. From the study it was concluded that HOXC13 is also an important
regulator of several genes in hair follicle and nail unit such as Foxn 1, Foxq 1, Dsg4
and Crisp 1.
1.1.3.5 Keratins
Approximately 80% of the dry weight of the nail plate is composed of keratins. The
rage of structural and non-mechanical role of keratin proteins increasing constantly (Gu
and Pierre, 2007). In human, keratin 85 (K85) plays a fundamental role in hair and nail
keratinization (Perrin, Langbein, and Schweizer, 2004). Dysfunction of K85 results in
the disruption of keratin intermediate filament formation that leads to a typical
desmosomal assembly in hairs and nails (Shimomura et al. 2010). Hence, it is probable
that during hair and nail morphogenesis, absence of the protein will result in hair and
nail abnormalities (Schweizer et al. 2007). Other keratins like K81, K83 and K86 also
7
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
play a role in nail development (Gebhardt et al. 1999). Pure hair and nail ectodermal
dysplasia (PHNED) (MIM 602032) is a congenital disorder of both hairs and nails and
is caused by mutation in KRT85 or HOXC13 gene (Rasool et al. 2010; Farooq et al.
2013).
Raykova et al. (2014) reported that homozygous mutation in KRT74 causes PHNED.
The study confirmed that KRT74 highly expresses in nail matrix, nail bed and
hyponychium. From the study it was also concluded that KRT74 protein highly
expresses in human hair follicles.
1.1.3.6 Enzymes Involved in Nail Morphogenesis
Hydroxyprostaglandin (15-PGDH) is the key enzyme responsible for prostaglandin
metabolism. The enzyme resides in the cytosol and catalyzes the oxidation of the 15-
hydroxyl group on prostaglandin and related eicosanoids using NAD (+) as a coenzyme
(Ensor and Tai, 1996; ÄNggård, Larsson, and Samuelsson, 1971). Pathogenic
mutations in HPGD can cause primary hypertrophic osteoarthropathy (PHO) and
isolated congenital nail clubbing (ICNC) (Uppal et al. 2008; Tariq et al. 2009).
PLCD1 (Phosphoinositide-specific phospholipase C delta 1) is the key enzyme
involved in phospho-inositide metabolism and perform various physiological functions.
The highest expression of PLCD1 occurs in nail matrix and nail bed (Farooq et al.
2012). Mutations in PLCD1 gene cause leukonychia (MIM 151600) that segregates
both in autosomal dominant and recessive manner (Kiuru et al. 2011).
Nakamura et al. (2008) reported that PLCD1 serves downstream of FOXN1 and
controls the regulation of hard keratins expression required for nail differentiation. The
study also revealed that any disruption in the function of PLCD1 may cause a typical
keratinization of the nail plate due to unusual hard keratins expression.
8
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
1.1.4 Isolated Hereditary Nail Disorders
In human inherited nail disorders are rare and can occur as isolated disorder or in
syndromic ectodermal conditions where other ectodermal appendages are also
involved. Congenital nail disorders can also occur in association with skeletal
dysplasia. In literature non-syndromic congenital nail disorders are classified in
different types. The causal genes identified thus far are expressed in the nail bed and
play key roles in nail development and morphogenesis (Khan et al. 2015).
1.1.4.1 Trachonychia (Nail Disorder, Nonsyndromic Congenital, 1)
Trachyonychia (OMIM 161050) or twenty̒ nail dystrophy ̕ (TND) is a congenital nail
disorder described by thin, fragile nails with numerous longitudinal ridging (Jacobsen
and Tosti, 2016). In trachonychia many superficial pits are present on the nail plate and
nails show sand-paper like appearance. Nails can be affected in several ways and may
show thickening, thinning, koilonychias, pitting and loss of luster, or may be sparse
(Sehgal, 2007). On the basis of clinical appearance and severity, Baran in 1981,
categorized trachyonychia into two subtypes. Opaque trachyonychia which is more
severe and characterized by excessive rough nail plates. Shiny trachyonychia, the less
severe type and described by shiny, opalescent nail plate with many pits (Baran, 1981).
The disorder affects either one or all twenty nails and usually affect multiple nails
(Haber, Chairatchaneeboon, and Rubin, 2016). Trachyonychia affects individuals of all
ages and transmits in autosomal dominant pattern (Alkiewicz, 1950; Balc et al. 2002).
To date, three inherited cases and one sporadic case of trachyonychia have been studied.
The phenotypes of the reported families include thumb nail aplasia, thin and split nail
plates and discolored twenty nail dystrophy (Hazelrigg, Duncan, and Jarratt, 1977;
Karakayali et al. 1999). The gene/loci triggering this disorder is unknown so far.
9
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
1.1.4.2 Nail Disorder, Nonsyndromic Congenital, 2
Nail disorder, nonsyndromic congenital 2 (NDNC-2) also called koilonychia, is
characterized by spoon-shaped nails. It is an uncommon genetic condition represented
by unusually slim and curved nails with turned up ends. NDNC-2 is autosomal
dominant disorder (Hellier 1950; Bumpers, Darrel, and Bishop, 1980). The gene/loci
causing NDNC-2 is not known.
1.1.4.3 Nail Disorder, Nonsyndromic Congenital, 3
NDNC-3 or leuconychia (MIM 151600) is one of the most common types of nail
anomalies. The disorder characterizes by white nail plates of all twenty nails.
Leuconychia occur as an isolated disorder or exist secondarily with other systemic or
cutaneous deformities (Grossman and Scher, 1990). The disorder inherits in autosomal
dominant or recessive form (Kiuru et al. 2011). NDNC-3 has been categorized into
three major types; (i) true leukonychia with the involvement of the nail plate originating
in the nail matrix; (ii) apparent leukonychia, in which the nail matrix is normal, though
involving subungual tissues producing changes in the color of the overlying nail plate
(iii) pseudo-leukonychia in which the matrix has no role in the alteration of nail plate.
The nail plate is diseased because of external factors such as fungal infection of the nail. In
literature, true leukonychia has been further classified into total and partial leukonychia.
Partial leukonychia occurs as leuconychia punctata, leuconychia striata and
leukonychia distalis (Baran and Kechijian, 2001).
Hereditary leukonychia is caused by mutation in PLCD1 gene, mapped to chromosome
3p21.3-3p22 (OMIM 6022142). Several Pakistani families revealing leukonychia
phenotypes have been described. In the reported families the nails of the affected
members were chalky white (complete leukonychia) along with transparent and
10
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
yellowish tint in the distal portion of the nail plate (incomplete leukonychia) (Kiuru et
al. 2011; Mir et al. 2012).
In a study four Pakistani families with hereditary leukonychia were investigated at
clinical and molecular level. In the reported families the nails of the affected members
were chalky white (complete leukonychia). Using Affymetrix 10K chip linkage was
established to chromosome 3p21.3-p22 in all four families. The study results in the
identification of four novel pathological variants in PLCD1 gene in the affected
individuals of all four families. The data obtained from the study also revealed that
PLCD1 is located in the matrix of the human nails and mutations in PLCD1 gene results
in reduced PLCD1 enzymatic activity in vitro. From the study it was concluded that
pathogenic mutation in PLCD1 causes leukonychia and PLCD1 controls nail growth in
humans (Kiuru et al. 2011).
Until now, six mutations are known in PLCD1 gene, out of these, two mutations have
caused dominant leukonychia and four have caused recessive leukonychia (Farooq et
al. 2012; Kiuru et al. 2011). PLCD1 gene contains 15 exons and cover 22.17 kb
genomic DNA. The protein encoded by PLCD includes two isoforms of 777 and 756
amino acids, respectively. PLCD1 belongs to a large super family of mammalian
phosphoinositide-specific phospholipase C enzymes, which hydrolyses
phosphatidylinositol 4,5-biphosphate. The hydrolysis of phosphatidylinositol 4,5-
biphosphate results in the production of two second messengers including
diacylglycerol (DAG) and inisitol triphosphate (IP3). Disruption of phospholipase C δ1
gene causes considerable decrease in inositol monophosphate, a downstream metabolite
of IP3. Phospholipase C δ1is highly expressed in nail matrix, nail bed, hair matrix and
hair follicle (Kiuru et al. 2011; Barthélemy et al. 2012).
11
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
Phospholipase C delta1 function downstream of FOXN1 transcription factor and
controls the expression of hard keratin genes required for nail differentiation. In human
and mice loss-of-function mutations in forkhead box N1 causes imperfect
onycholemmal differentiation and onychodystrophy. Consequently, failure of PLC-
delta1 function may cause unusual keratinization of nails due to abnormal expression
of hard keratins triggering leukonychia phenotype (Nakamura et al. 2008; Auricchio et
al. 2005).
1.1.4.4 Nail Disorder, Nonsyndromic Congenital, 4
Congenital absence of finger-and toenails is called anonychia/hyponychia congenita
(OMIM 206800). In general, anonychia and its moderate phenotypic alternative
hyponychia arise as a characteristic of hereditary syndromes and may be linked with
major skeletal abnormalities. Renowned examples of syndromic anonychia are nail-
patella syndrome, different types of ectodermal dysplasias and brachydactyly type B
(MIM 113000). On the other hand, isolated, nonsyndromic anonychia is an unusual
genetic disorder that follows autosomal recessive fashion of inheritance and is caused
by mutation in RSPO4 gene (Cai and Ma, 2011; Bergman et al. 2006). The reported
nail phenotypes include lack of nail plate, nail matrix, hyponychia or remnants of
elementary nail plates (Blaydon et al. 2006).
In a study three families with anonychia phenotypes were sampled from different areas
of Pakistan and investigated for RSPO4 mutation. All the three families were
transmitting anonychia in autosomal recessive form and the affected individuals were
displaying anonychia phenotypes in the finger-and toenails. In all the three families
linkage was established to RSPO4 gene found on chromosome 20p13. Subsequent
sanger sequencing of RSPO4 gene in the three families result in the identification of
12
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
one novel homozygous missense variant and two recurrent homozygous missense
variants. This study increases the molecular repertoire triggering anonychia (Khan et
al. 2012).
The RSPO4 gene consists of five exons and covers about 44 kb genomic DNA. It
encodes a secreted protein composed of 234 amino acids (Kim et al. 2006). Until now,
19 mutations have been described in RSPO4 gene (Brüchle et al. 2008; Wasif and
Ahmad 2013; Khalil et al. 2017).
The R-spondin gene family encodes four secreted proteins (RSPO1-RSPO4) (Cruciat
and Niehrs 2013). The mammalian R-spondins possess 60% homology in pairwise
amino acids sequence and have analogous domain architecture (Kazanskaya et al.
2004). In addition to the TSR-1 domain, all four RSPO proteins possess an N-terminal
signal peptide, a carboxyl terminus and two furin repeats (Kim et al. 2008).
In brief, the R-spondin proteins regulate Wnt signaling pathway, resulting in an
expanded array of biological activities like cell division, differentiation, mature tissue
homeostasis, maintenance of stem cells and. The secreted R-spondin proteins interact
with the ligands of Wnt signaling, activates the canonical Wnt signaling pathway
stimulated by binding of the Wnt ligands to frizzeled receptors and LRP5 (low-density
lipoprotein receptor-related protein 5) or LRP6 (low-density lipoprotein receptor-
related protein 6) co-receptors (Kazanskaya et al. 2004). This process motivates the
deposition of β-catenin protein in the cell cytoplasm and its transportation to nucleus.
After entering the cell nucleus, β-catenin protein connects with TCF (T-cell factor)/LEF
(lymphoid enhancer factor) transcription factor complex that directs the target gene
motivation (Nam et al. 2006; Angers and Moon, 2009). Recently 3 leucine-rich G-
protein-coupled receptors (Lgr4, Lgr5 and Lgr6) are known that acts as a receptor of
13
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
RSPO proteins (De Lau et al. 2001). Lgr4, Lgr5 and LGR6 are considered to be
substantially linked to FZD/LRP complex. As a result, the RSPO constituent in Wnt
signaling is thought to be mediated by activated FZD-LRP5 or FZD-LRP6 co-receptors
(Wei et al. 2007).
Bergman et al. (2006) conducted an in vitro study to observe the expression of RSPO4
protein. From in vitro study it was concluded that RSPO4 expresses in mesenchymal
cells, responsible for the formation of nails. The protein works as agonist for Frizzled
receptors concerned with the stimulation of the WNT/β-catenin signaling necessary for
the morphogenesis of ectodermal appendages including nails.
1.1.4.5 Nail Disorder, Nonsyndromic Congenital, 5
Congenital distal onycholysis is an autosomal dominant nail abnormality described by
reduced growth rate of the nails, thick and hard nail plates (Bazex et al. 1990). Schuzle
in 1966 reported the first family harboring the phenotypes of hereditary onycholysis.
The clinical features of the affected individuals include scleronychia, lesions of the
finger-and toenails, reduced nail growth, palmoplantar hyperhydrosis and absence of
lunulae. Some affected individuals of the family were enormously sensitive to cold,
pressure and complained for hurting fissures on the soles. The gene/loci causing
hereditary distal onycholysis has not been reported yet.
1.1.4.6 Nail disorder, nonsyndromic congenital, 6
Congenital loss of the nails is an exceptional genetic condition occurs in two forms.
Some families show complete congenital loss of the nails (NDNC-4) while some
families display partial hereditary anonychia, in which the thumb nails and great toe
nails are rigorously affected while the lateral digits show less severe changes. This type
of nail disorder is grouped as NDNC-6 (OMIM 107000). In literature, several cases of
14
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
partial anonychia have been described in different ethnicities, revealing anonychia in
thumbs and toenails. The nails of the other digits show varying extents of severity
(Charteris, 1918; Ahlgren et al. 1988). The causative gene for nail disorder,
nonsyndromic congenital-6 is unknown so far.
1.1.4.7 Nail Disorder, Nonsyndromic Congenital, 7
The clinical phenotypes of NDNC-7 (OMIM 605779) include thin nail plate showing
longitudinal streaks, less developed lunulae, platonychia and overgrowth of the nail
plates over the lateral folds. NDNC-7 has autosomal dominant fashion of inheritance
(Hamm, Karl, and Bröcker, 2000).
Krebsová et al. (2000) studied a large German family with NDNC-7 phenotypes. The
nails of the affected subjects possess longitudinal streaks and the nail plate was thin
with free margins. In all affected members the finger- and toenails were equally affected
with some prominence in the thumb and great toenails. The nail matrix of the affected
members shows hyper-granulosis and the nail bed possess epithelial outgrowths. Hair,
teeth and other integumentary organs of the affected individuals were normal. The study
results in the identification of NDNC-7 locus on chromosome 17p13 but the causative
gene is still unknown.
1.1.4.8 Nail Disorder, Nonsyndromic Congenital, 8
Toe-nail dystrophy is also categorized as nail disorder, nonsyndromic congenital-8
(OMIM 607523) and is characterized by dystrophy of the toe nail. The disorder
segregates in autosomal dominant manner. Hammami-Hauasli studied a family having
the phenotype of toenail dystrophy with no skin lesions. Dideoxynucleotide sequencing
of COL7A1 (OMIM 697523) revealed p.Gly1519Asp and p.Gly2251Glu mutation in a
girl suffering from bullous dermolysis belonging to this family. The mother of the girl
15
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
had toe-nail dystrophy with normal integument and had the same missense mutation
(p.Gly2251Glu) (Hammami-Hauasli et al. 1998). In addition, Shimizu described the
case of 10-years-old Japanese girl illustrating remarkable epidermolysis bullosa
dystrophica. Sequencing analysis confirmed that the girl had compound heterozygous
mutations (p.Gly2316Arg; p.Gly2287Arg) in COL7A1 gene. The mother of the girl
showed mild toe-nail dystrophy with no skin abnormality, and was a heterozygous
carrier of p.Gly2287Arg transition. The same polymorphism was also found in
heterozygous state in her mother’s brother and grandmother (Shimizu, 1999).
In a study two Japanese families with dystrophic toe-nails have been investigated at
clinical and genetic level. In the reported families, the toe-nails of the affected persons
were embedded in nail bed. The free margins of the nail plates were thin and
malformed. In both families two missense mutations were identified by sequencing
COL7A1 gene (Sato-Matsumura et al. 2002). COL7A1 is mapped to chromosome
3p21.3, comprises 118 exons and encodes α chain of type VII collagen. The COL7A1
protein helps in the attachment of the fibril between the exterior epithelium and
underlying stroma.
1.1.4.9 Nail Disorder, Nonsyndromic Congenital, 9
NDNC-9 (nail disorder, nonsyndromic congenital-9; OMIM 614149) was first reported
by Rafiq et al. 2004 in a Pakistani family segregating in autosomal recessive manner.
At birth, all twenty nails of the affected persons remained normal but at the age of 7-8
years, onychodystrphy appears in the finger-and toenails. Initially, dystrophy occurs in
the margins of nail plates but with the passage of time expands to onychodermal band,
nails plate, cuticle, lanula and finally spreads to eponychium. Although
onychodystrophy initiates at the same time but the finger-and toenails are not equally
16
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
affected. Dystrophy of the toenails leads to anonychia while dystrophy of the
fingernails leads to onycholysis. NDNC-9 is genetically mapped to chromosome 17
(17q25.1-17q25.3). For this locus the causative gene is still to find.
1.1.4.10 Nail Disorder, Nonsyndromic Congenital, 10
This type of isolated nail dysplasia is described by onychauxis, hyponychia, and
onycholysis of all twenty nails and has been classified as nail disorder, nonsyndromic
congenital-10 (OMIM 614157).
Fröjmark et al. (2011) were the first who reported that NDNC-10 phenotypes are caused
by mutation in FZD6 gene. They studied two Pakistani consanguineous families
displaying NDNC-10 phenotypes. In both families, the nails of the affected siblings
remain shiny, hyperplastic and pigmented at birth. when ages of the affected persons
reach up to 10 years, their nails become claw-shape. In affected individuals the nail
growth was very slow and required infrequent trimming. SNP microarray and DNA
sequence analysis identified a homozygous nonsense and a missense mutation in the
human FZD6 gene. From the study it was concluded that pathological mutation in
FZD6 causes claw-shaped nails.
Frizzled-6 gene involves 8 exons, covering 3.719 kb genomic DNA and encodes a
polypeptide chain of 760 amino acids and 80 kDa. The FZD6 protein is categorized into
the heptahelical group of frizzeled receptors. On the N-terminal, the protein has an
extracellular cysteine-rich domain that represent a signal peptide motif engaged in Wnt
interaction. The C-terminal domain of FZD6 protein contains the internal PDZ domain
binding motif essential for the selection of phosphoproteins disheveled 1-3 and some
additional signaling proteins. The internal PDZ domain binding motif is also required
17
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
for the transport of receptor for Wnt signaling pathway (Schulte and Bryja, 2007;
Schulte, 2010).
Rice et al. (2010) conducted a study on the transcriptional regulation of FZD6 protein.
From the study it was concluded that FZD6 protein is necessary for the transcriptional
regulation of 63 genes that play a pivotal role in ectodermal differentiation. These genes
include keratins, keratin-associate proteins, transglutaminases enzymes and their
substrates.
1.1.5 Isolated Congenital Nail Clubbing (ICNC)
Isolated congenital nail clubbing (OMIM 119900) is a rare genetic abnormality
described by magnified nail plate and terminal fragments of the digits. It is due to
connective tissues proliferation located between nail matrix and distal phalanx (Kathryn
and Farquhar, 2001). In digital clubbing, there is no normal angel between the nail and
the posterior nail fold. In this disorder, fingers and toes are variably affected but in most
of the cases thumbs are permanently involved (Samman and Fenton, 1995). The
disorder may appear in isolated form or linked with other systemic abnormalities like
primary hypertrophic osteoarthropathy. Familial nail clubbing was first reported by
Von Eiselsberg (Horsfall, 1936). In some cases, nail clubbing occurs in association with
other clinical disease and is thought to be a physical sign of that disease. Hyppocrates
was the first who described that nail clubbing is a sign of disease, therefore the
phenomenon of nail clubbing is also called Hyppocratic fingers (Marrie and Brown,
2007).
Marrie and Brown described that club-shape nails are related to pulmonary diseases
(lung abscess, cystic fibrosis, bronchogenic carcinoma, empyema, etc), cardiovascular
illnesses (atrial myxoma, cyanotic congenital heart disease, cardiac tumors, etc),
18
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
gastrointestinal infections (coeliac disease, inflammatory bowel disease, etc), and
metabolic defects (thyroid acropachy, Graves disease, severe secondary
hyperparathyroidism) (Tai et al. 2002). In club-shape nails, the nail matrix has elevated
distal part as compare to its proximal end. The nail plate is typical but its diameter and
dimensions are somewhat different as compare to normal nails. It may be due to unusual
function of the nail matrix in nail morphogenesis (Cai and Ma, 2011; Samman and
Fenton, 1995).
In a study Tariq et al. (2008) investigated a six generation Pakistani family segregating
isolated congenital nail clubbing (ICNC). In the family 11 affected individuals were
showing the phenotype of congenital nail clubbing without any additional skeletal,
systemic and ectodermal abnormality. The nails of the affected individuals were shiny,
thickened, hypoplastic, broad and convex in all directions. Genome wide homozygosity
mapping and subsequent sanger sequencing of ten candidate genes results in the
identification of a homozygous missense pathological variant in the human HPGD
gene. Hence it was concluded that HPGD is a candidate gene for ICNC and the enzyme
15-hydroxy prostaglandin dehydrogenase (15-PGDH) is involved in nail development.
The HPGD gene contains 7 exons and covers 31kb genomic DNA. The gene encodes
a long polypeptide chain which is composed of 266-amino acids. 15-hydroxy
prostaglandin dehydrogenase (15-PGDH) belongs to the family of short chain
nonmetalloenzyme dehydrogenases. The enzyme is dimeric and composed of two
identical subunits. The approximate molecular weight of the enzyme is 28.9 kDa and
catabolises hydroxyl fatty acids, lipoxin and prostaglandins (Tai et al. 2002).
19
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
1.1.6 Ectodermal Dysplasia
Ectodermal dysplasias (EDs) constitute a group of hereditary diseases charaterized by
congenital anomalies of one or more structures of ectodermal origin, notably skin, teeth,
hair, nail and sweat glands (Itin, 2009). EDs also cause changes in eccrine and apocrine
glands, anterior pituitary gland, lenses conjunctiva of eye, nipples and the ear. It also
causes defects in the central nervous system (CNS), pharyngeal and laryngeal mucosa,
the adrenal medulla, the oral, nasal and rectal mucosa and their associated glands
(Itthagarun and King, 1997). The prevalence of ED is approximately 7 births in 10,000
and the disorder follows all possible Mendelian patterns of inheritance (Lamartine et
al. 2003).
There are about 200 different types of ectodermal dysplasias. Until now 64 genes and
three loci (7q32-q34, 10q24.32-q25.1 and 18q22.1-q22.3) have been reported that
cause ectodermal dysplasia (Lamartine et al. 2003; Itin and Fistarol 2004; Visinoni et
al. 2009). Various classification approaches have been adopted for the classification
of ectodermal dysplasia. Initially EDs were classified on the basis of clinical findings
(Pinheiro and Freire-Maia, 1992) but later on this classification was revised by the
increasing knowledge regarding the casual pathogenesis and mutant genes. Currently,
ectodermal dysplasias are classified into four subclasses depend upon the defects
associated with cell-cell communication and signaling, adhesion, transcriptional
regulations, and development (Adaimy, 2007; Stevenson and Kerr, 1967). Hidrotic
(Cloustone’s syndrome) and non-hydrotic ectodermal dysplasia are the two main
subtypes of ectodermal dysplasia. The disorder transmits in autosomal dominant
manner and described by hair and nail dystrophy with scattered palmoplanter
keratoderma. Hypohydrotic ectodermal dysplasia (HED) is the most common form
20
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
of EDs that usually transmits in X-linked inheritance pattern, with a prevalence ratio
of 1 per 100,000 births. However, females show partial manifestations of X-linked
HED probably because of X-chromosome inactivation (Stevenson and Kerr, 1967;
Lexner et al. 2008). The clinical manifestations of HED includes scant hairs on the
scalp and body, partial or total hypodontia and conical teeth. The disorder is also
characterized by absence or reduced sweating and dry skin. The X-linked HED
(Christ-Siemens-Touraine syndrome) is caused by pathological alterations in
ectodysplasin-A gene (EDA1, OMIM 305100), mapped to chromosome Xq12-q13.1.
These mutations are evident in the development of ectoderm and its accessories like
hair, teeth, and sweat glands. Because the disorder segregates in X-liked recessive
pattern therefore the condition fully expresses in male individuals (Kere et al. 1996;
Huang et al. 2006). With lower frequency, the disorder also segregates in autosomal
dominant and recessive forms with mutations in EDAR-associated death domain
(EDARDD, MIM 606603) and ectodysplasin-A receptor (EDAR, MIM 604095)
respectively (Bal et al. 2007).
Hair-nail ectodermal dysplasia (OMIM 602032) is an infrequent genetic anomaly
described by hypotrichosis, nail dysplasia and partial or complete alopecia (Barbareschi
et al. 1997; Harrison and Sinclair, 2004). Abnormalities of hair vary from scant hair to
the entire absence of hair on the scalp. Eyebrows, eyelashes, axillary hair and pubic hair
may be sparse or entirely absent. The affected individuals show dystrophy of all twenty
nails with short, fragile and spoon-shape nails (Khan et al. 2017).
Pure hair and nail ectodermal dysplasia (PHNED) segregates both in autosomal
dominant and recessive mode of inheritance (Harrison and Sinclair, 2004; Calzavara-
Pinton et al. 1991). In literature five types of autosomal recessive PHNED have been
21
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
described. Hair and nail ectodermal dysplasia type 4 (ECTD4, MIM 602032) is
described by total alopecia and nail dysplasia. Individuals suffering from this type of
ectodermal dysplasia lack hairs on the scalp, face, chest, arms and legs. The affected
individuals have no eyebrows and eyelashes. They did not develop axillary and pubic
hairs and were of normal intelligence. Both finger and toe nails were abnormal and
sweating was normal. This type of ectodermal dysplasia occurs due to mutations in
KRTHB5 gene located on chromosome 12q13.13 (Naeem et al. 2006). Hair and nail
ectodermal dysplasia type5 (ECTD5, MIM 614927) is described by thin hairs on the
whole body. The affected individuals showed micronychia of the fingernails and
anonychia of the toenails since birth. All the patients showed no abnormality in teeth,
sweat glands and skeleton and all of them have normal intelligence. Other abnormalities
like palmoplantar keratoderma, oral leukokeratosis, ichthyosis and flexure
pigmentations were totally absent. The ECTD5 locus was mapped to chromosome
10q24.32-q25.1 (Rafiq et al. 2005) but the causal gene is unknown to date. Hair and
nail ectodermal dysplasia type 6 (ECTD6, MIM 614928) is described by total alopecia
and nail dysplasia. In all patients of ECTD6, hairs were absent from head and other
organs of the body since birth. At the age of 5 years, they developed thin, sparse and
curly hairs on the scalp. The abnormalities of nail include koilonychias of all twenty
nails. The nails of the affected individuals were thin and dystrophic. The patients were
not suffering from sweat glands abnormality and all of them were of normal
intelligence. The affected individuals did not show the phenotypes of palmoplantar
keratosis, ichthyosis, dental abnormalities, vision problems, oral leukokeratosis and
pigmentation. The ECTD6 locus was addressed to chromosome 17p12-q21.2 (Naeem
et al. 2006) but the candidate gene is yet to be studied. Hair and nail ectodermal
22
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
dysplasia type7 (ECTD7, MIM 614929) is described by sparse and delicate hair of the
scalp, eyebrows and eyelashes. In affected individuals, both the finger and toe nails
were spoon shaped. They showed dystrophic nails with micronychia and onycholysis.
All these symptoms were present by birth. The skin, sweat glands and dentition of all
affected individuals were normal. ECTD7 is triggered by mutations in KRT74 sited on
chromosome 12q13.13 (Raykova et al. 2014). Hair and nail ectodermal dysplasia type
9 (ECTD9, MIM 614931) is described by the absence of scalp hair, fine eyebrows,
eyelashes and sparse hairs on the remaining body. In ECTD9 hairs are thin, easily
breakable and axillary and pubic hairs are completely absent. In some cases, hairs of
the entire body were totally absent. The nails are irregular shaped with mild distal
oncholysis. The disease occurs due to mutations in HOXC13 gene situated on
chromosome 12q13.13 (Khan et al. 2017; Lin et al. 2012).
In a study two Pakistani consanguineous families with PHNED phenotypes were
investigated at clinical and genetic level. In both families there were some differences
in the clinical features of hairs and nails. In the affected members of family A, the scalp
hairs were sparse. Eyebrows and eyelashes were thin and hairs on the rest of the body
were also thin. In affected members the nails of both hands were irregular shaped with
distal onycholysis. In affected subjects of family B hairs were completely absent and
nails in the digits of hands were dystrophic. Sequence analysis of HOXC13 shown a
novel homozygous 4-bp duplication in family A and a novel homozygous nonsense
variant in family B. The study proved the important role played by HOXC13 in the
morphogenesis of human hair and nails (Ali et al. 2013).
23
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
1.1.7 Syndromic Nail Disorders
Predominantly nail disorders can arise as a part of syndromes containing abnormalities
in other body structures or related with inherited skeletal deformities (Sprecher, 2005).
1.1.7.1 Primary Hypertrophic Osteoarthropathy
Primary hypertrophic osteoarthropathy (PHO, OMIM 167100) is an infrequent genetic
condition segregating in autosomal dominant and recessive form (Touraine, 1935;
Oikarinen et al. 1994). Primary hypertrophic osteoarthropathy (PHO) is described by
nail clubbing, pachydermia, arthropathy, delayed closure of cranial sutures and
fontanels (Uppal et al. 2008; Chen et al. 2012; Naeem et al. 2006). Other symptoms of
this clinical entity include coarsening of facial features, hyperhydrosis, seborrhea, cutis
verticis gyrata, acne lesions, folliculitis, and blepharoptosis (Reginato, Schiapachasse,
and Guerrero, 1982; Bianchi et al. 1995; Bleyen et al. 2010; Alves et al. 2005). Some
patient’s complaint for corneal leukoma, contaract formation, presenile macular
dystrophy, and Bowman layer dystrophy (Kirkpatrick, McKee, and Spalton, 1991). In
some cases, arthritis of the knees and ankles have been reported (Grace, 1990). First
report of this genetic disease was given by Friedrich (1868) in two brothers suffering
from skeletal hyper-ostosis (Friedreich, 1868). Touraine, Solente and Golé in 1935
reported PHO as an independent disease (Touraine, 1935). Generally, the symptoms
initiate at puberty, slowly progress over 5-20 years and after that stand to stabalize. The
incidence rate is higher in men than in women (9:1) (Guerini et al. 2011). PHO is caused
by mutations in 15-hydroxy prostaglandin dehydrogenase (HPGD, MIM 601688)
situated on chromosome 4q34.1 and prostaglandin transporter encoding gene
(SLCO2A1, MIM, 601460) located on chromosome 3q22.1-q22.2 (Dias, 2014).
24
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
Bergman et al. (2011) studied three families showing the phenotypes of primary
hypertrophic osteoarthropathy. The clinical features of the patients in the three families
include digital clubbing, periostosis, acroosteolysis, hyperhidrosis, pachydermia and
delayed closure of cranial structures. Molecular analysis of the three families revealed
a recurrent truncating mutation, a novel heterozygous nonsense mutation and a
heterozygous missense mutation in the human HPGD gene. Hence it was concluded
that the truncation mutation is a recurrent one rather than an ancient founder mutation.
1.1.7.2 Witkop Syndrome
The Witkop syndrome also termed as “tooth and nail syndrome” (TNS, OMIM 189500)
was initially discovered by Witkop in 1965 (Hudson and Witkop, 1975). It is an
ectodermal dysplasia which affects two ectodermal appendages, namely nails and teeth.
Patients often have normal sweating and normal heat tolerance (Koutlas, 2014). The
syndrome segregates in autosomal dominant manner and the estimated incidence of the
syndrome is one or two in every 10000 born babies (Chitty, Dennis, and Baraitser,
1996; Witkop, 1990; Lidral and Reising, 2002; Memarpour and Shafiei, 2011).
In witkop syndrome the affected individuals show hypodontia, less often oligodontia
and, in some rare and severe cases anodontia. The maxillary incisors, second molars
and maxillary canine are the most frequently missing teeth in this disorder includes.
The premolar teeth often remain unaffected. Moreover, the teeth are widely spaced,
conical shape and have narrow crowns (Koutlas, 2014). The affected individuals have
spoon-shaped, slim, brittle nails and slow to growth. In general, fingernails are less
affected than toenails and in some patients the nail plates are totally absent at birth
(Hudson and Witkop, 1975; Edward and Cohen, 1999; Giansanti, Long, and Rankin,
1974).
25
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
In a study Jumlongras et al. (2001) analyzed a three generation family segregating
Witkop syndrome. The family consists 20 members of which 9 were affected. The
affected members of the family displayed oligodontia and nail dysplasia. In all affected
subjects the fifth toenail was absent and the nail plates were concave and hypoplastic.
In the family linkage was confirmed to MSX1 locus and sanger sequencing results in
the identification of a heterozygous stop mutation in the human MSX1 gene.
Additionally, histological examination of Msx1-knockout mice and expression of Msx1
in the developing nail beds shown that both tooth and nail development was disrupted
in these mice. Hence it was concluded that MSX1 mapped to chromosome 4p16.1 is the
causative gene of Witkop syndrome and MSX1 protein is critical for the development
of tooth and nail.
1.1.7.3 Nail Patella Syndrome
Nail–patella syndrome (NPS, OMIM 161200) is an infrequent pleiotropic, autosomal
dominant disease described by dysplasia of the nails, elbows, and knees. In nail-patella
syndrome, nail dysplasia is present in 95.1% of patients, patellar aplasia has been
detected in 92.7% of patients, and iliac horns have been reported in 70%-80% of
patients. Complaints of the ocular disorders are present in 7%, glaucoma in 10% and
nephropathy in 37.5% individuals with NPS. The most severe complications of this
disorder are nephropathy and glaucoma (Beals and Eckhardt, 1969; Bongers, Gubler,
and Knoers, 2002; Sweeney et al. 2003). The orthopaedic symptoms of nail-patella
syndrome can be categorized as mild (13%), moderate (53%) or severe (34%),
depending upon the number of anomalies occur, using the method of Farley (Farley,
1999; Bongers et al. 2005). Patients suffering from NPS often complaints for
patellofemoral pain. It is due to atypical structure of the patella which causes patellar
26
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
instability and osteoarthritis in early adulthood (Sweeney et al 2003; Guidera et al
.1991). The frequency of NPS has been estimated as1 per 50, 000 births, with de novo
mutations reporting for 12.5% cases of NPS (Chen et al. 1998; Lemley, 2009). The
responsible gene of nail patella syndrome has been reported as LIM homoebox
transcription factor 1beta (LMX1B, OMIM 602575), situated on 9q34.1 (Chen et al.
1998). LMBX1 acts as a transcription factor and plays a major role in limb development
(Bongers et al. 2005).
In a study eight families of Dutch origin with nail-patella syndrome were investigated
for the identification of mutations in LMX1B gene. The phenotypes of the patients
include nail dysplasia, elbow immobility and nephropathy. In the patients the patella
was totally absent or small. The abnormalities of eye include hyperpigmentation of iris,
cataract or glaucoma. Linkage analysis and sanger sequencing of LMX1B revealed one
novel and six recurrent mutations. Hence it was concluded that there is no correlation
between the phenotypes of NPS and specific mutations (Knoers et al. 2000).
1.1.7.4 Nail Hypertrophy
Majority of the hereditary nail abnormalities evident either with nail hypertrophy or
nail hypoplasia (Sprecher, 2005). Nail hypertrophy contains pachyonychia congenita
type1, type 2, type 3 and type 4 that are produced by pathological mutations in KRT16,
KRT17, KRT6A and KRT6B respectively (Khan et al. 2015). Pachyonychia congenita
(PC) is an infrequent hereditary condition which is illustrated by hypertrophic nails,
planter keratoderma, and painful palmoplantar blisters. Other clinical symptoms
include, cyst, hyperhidrosis, oral leukokeratosis, hyperkeratosis and natal teeth. PC
affects individuals from all ethnic groups and worldwide 500-1000 cases have been
reported (Eliason et al. 2012; Kaspar, 2005). It is an autosomal dominant
27
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
genodermatosis which corresponds to mutation in any of the five keratin genes
including KRT6A, KRT6B, KRT6C, KRT16 and KRT17 (Wilson et al. 2014).
Pachyonychia congenita has been divided into four subgroups, pachyonychia
congenital type1 (OMIM, 167200), type2 (OMIM, 167210), type3 (OMIM, 615726)
and type4 (OMIM, 615728) (Khan et al. 2015). Pachyonychia congenita type1
(Jadassohn-Levandowsky syndrome) is distinguished by thick nail plates with
yellowish discoloration. The disease is triggered by pathogenic alterations in K6a or
K16 that express in nail bed, nail fold, palmoplantar skin and oral mucosa (Shamsher
et al. 1995; Irvine and McLean, 1999). Pachyonychia congenital type2 is described by
hypertrophic nail dystrophy, multiple pilosebaceous cysts, and palmoplanter
hyperkeratosis. Natal teeth and hair disorders may exist in some affected individuals
(Cogulu et al. 2009). Type2 pachyonychia congenital is produced by mutations in
KRT17 or KRT6b that expresses in various epidermal appendages (Troyanovsky et al.
1989). Type-3 and type-4 pachyonychia congenita have minor variation like cornea
related leukokeratosis and mental retardation (Irvine and McLean, 1999).
1.1.8 Homozygosity Mapping and Recent Techniques of Gene Identification
Over the last few years, an unprecedented development has been occurred in the
clarification of genetic basis of various inherited diseases due to the introduction of
advance genomic technologies (Ott, 1991). Homozygosity mapping is a proficient
method of gene mapping applicable to uncommon disorders with recessive pattern of
inheritance in inbred populations. The method is advantageous because the inbred
affected individuals are expected to contain two recessive copies of the disease allele
from a common ancestor. As small chromosomal segments tend to be transferred
whole, affected individuals will also have identical-by-descent alleles at markers found
28
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
close to the disease locus and thus will be homozygous at these markers. The simple
concept of the method to locate genes causing unusual recessive disorders is thus to
search for regions of homozygosity that are shared by different affected individuals
(Genin and Alexander 2001).
SNP microarray chips are strategies permitting the immediate identification of the
genotypes of 104 to 2×106 SNPs (Bier et al. 2008). This technology has proven a best
method for linkage studies as it constructs a much denser linkage map as compare to
conventional STR marker based linkage analysis. Recent microarray technologies also
use nonpolymorphic DNA markers that reveals minor genomic alterations in terms of
kilobase pair range (Copy Number Variants (CNV) (Kuhlenbäumer and Appenzeller,
2011).
Exome sequencing is the method that captures, sequence and analyze all genes of a
genome in span of weeks. Using this technique many disease causing genes (MUC16,
HSD17B4, TMG6, MYH3 etc) have been identified in a short period of time. Through
this technique casual variants have been identified for a number of cases like sporadic
cases, several affected individuals in a family and in several unrelated cases (Sara et al.
2010; Hoischen et al. 2010). In addition, exome sequencing is used as a diagnostic tool
for the disorders described by major phenotypic and genetic heterogeneity (Sara et al.
2010). It is also applicable to study genetic disorders if only a single case is available
(Pierce et al. 2010).
1.1.9 Cousin Marriages in Pakistani Population
Cousin marriages are the most predominant mode of matrimonies demonstrating by
almost half of the world’s population (20-50% of marriages) (Bittles and Black, 2010).
Consanguinity has been practiced since long time but this practice is more prevalent in
29
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 1 Introduction & Review of Literature
Asian countries specially Pakistan (Jones and Gavin, 2010). It has been reported in
previous studies that in Pakistan 60% marriages were consanguineous out of which
80% were first cousins. Some studies emphasized a similar growing tendency of
consanguinity among married couples (Hussain, Rafat, and Bittles, 1998;
Akram, Arif and Fayyaz; Qidwai et al. 2003). Pakistan is the leading country with
around 70% of marriages being consanguineous (Pellissier, 2012). The high ratio of
consanguinity is the main cause for the incidence of recessive genetic disorders in
Pakistani population which is evident from the fact that nearly every year 700 newborns
face genetic disabilities caused by cousin marriages. Religious, cultural and tribal
diversities among diverse ethnic societies are the main causes for trending
consanguineous marriages in Pakistani population (Schulpen et al. 2006, Hamamy et
al. 2011). Pakistani population offer an unspoiled condition for disorders like nail
dysplasia with autosomal recessive pattern.
1.1.10 Hypothesis
It is hypothesized that genetic analysis of consanguineous families with hereditary nail
dysplasia may reveal some novel sequence variants in genes involved in nail
development.
1.1.11 Objectives
To evaluate patients of nail dysplasia at clinical level
To identify the inheritance pattern of nail dysplasia families
To identify pathogenic sequence variants in families with inherited nail dysplasia
To predict the effect of pathogenic mutation on the structure of protein through
bioinformatics analysis
30
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
CHAPTER 2
2.1 MATERIALS AND METHODS
2.1. Study Approval
Clinical and genetic study of eight Pakistani families displaying nail disorders have
been presented in the dissertation. Ethical approval of the study was given by
Institutional Review Board (IRB) of the Kohat University of Science and Technology,
Kohat Pakistan (Appendix.1). From participants of the study, informed written consents
were obtained for genetic analysis and presentation of photographs for publications
(Appendix. 2).
2.1.2 Clinical Examination and Collection of Blood Samples
Eight families (A-H) of nail disorders were localized in remote areas of Pakistan. The
families were visited at their local places to collect information regarding the family
history and clinical symptoms of the affected individuals. After taking detail interviews
from the elder men and women of the family, pedigree of each family was drawn using
Progeny software. In some cases, close neighbors of the families were also interviewed
to confirm the information provided. Two or three affected subjects of each pedigree
were clinically examined in regional government hospital and nail anomalies were
carefully examined by dermatologists (Appendix.3). From each participating individual
of the family 5-7 ml blood was taken, poured in 10 ml EDTA tubes (BD Vacutainer)
and subsequently preserved in refrigerator at 4°C.
2.1.3 DNA Extraction from Blood Samples
Blood samples were processed to isolate genomic DNA via manual organic method
(Sambrook, 2001) and/or commercially available kit (Gentra puregene genomic DNA
extraction kit, Qiagen Inc. Valenica, CA, USA) according manufacturer,s instructions.
31
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
2.1.3.1 Genomic DNA Extraction using Organic Method (Phenol-Chloroform Method)
Prior to DNA extraction, the stored blood samples were placed at room temperature for
1 hour. In a 1.5 ml microcentrifuge tube (Axygen, Union, USA) 750 µl blood was taken
from vacutainer and was mixed with equal volume of solution A (Appendix.4). The
tube was gently inverted 4-6 times and was incubated at room temperature for 10-15
minutes. The mixture was then centrifuged at 13,000 rpm for 1 minute. The aqueous
phase of the sample was discarded and the pellet was resuspended in with 400 µl of
solution A. The mixture was centrifuged for 1 minute at 13,000 rpm. Again the
supernatant was removed and the remaining nuclear pellet was re-suspended in 400 µl
of solution B (Appendix.4), 11 µl of proteinase K (Sigma-Aldrich, St. Louis, MO,
USA) and 12 µl of 20% SDS (BDH, Poole Dorset, UK). The solution was placed in
incubator at 37°C for 24 hours. After incubation, the sample was mixed with 500 µl of
a fresh mixture containing equal volume of solution C (Appendix.4) and solution D
(Appendix.4). The components of the solution were properly mixed and were then
centrifuged for 10 minutes at 13000 rpm. The aqueous layer of the solution was
carefully collected and shifted to a new eppendorf tube. The solution was then mixed
with 500 µl of solution D and centrifuge for 10 minutes at 13,000 rpm. The aqueous
layer was transferred to a new tube. In the next step, 55 µl of 3 M sodium acetate (pH
6) and 500 µl of ice cold Isopropanol (BDH, Poole Dorset, UK) was poured into the
sample. To precipitate DNA, the eddendorf tube was inverted 5-6 times and centrifuged
for 10 minutes at 13, 000 rpm. The supernatant layer of the solution was cautiously
removed and 200 µl ice cold 70% ethanol (BDH, Poole Dorset, UK) was added to the
tube. Again the solution was centrifuged for seven minutes at 13,000 rpm. After
centrifugation ethanol was carefully removed from the sample and the tube was then
32
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
kept in vaccum concentrater 5301 (Eppendorf, Hamburg, Germany) for 10 minutes at
45oC. After vaporization of the remaining ethanol, 200 µl TE (Tris-EDTA) buffer
(Sigma-aldrich, St. Louis, MO, USA) was added to the sample. For the complete
dissolution of DNA pellet in TE buffer, the tube was kept in incubator at 37oC
overnight. After incubation the DNA sample was stored at 4oC.
2.1.3.2 Genomic DNA Extraction via Gentra Puregene Kit
In an eppendorf tube (Axygen Inc., CA, USA) 300 µl human blood and 900 µl RBC
lysis solution was mixed. For thorough mixing, the tube was inverted for few seconds
and placed at room temperature for 1 minute. To obtain WBCs pellet, the mixture was
centrifuged at 13,000 rpm for 20 seconds. After centrifugation, supernatant of the
sample was carefully removed, leaving about 10 µl solution along with WBCs pellet.
For the dispersion of WBCs pellet in the solution, the tube was vigorously vortexed. In
the next step, 300 µl of lysis solution was poured into the tube and was vortexed again.
For protein precipitation, 100 µl protein precipitation solution was added to the sample
and the mixture was vortexed vigorously and centrifuged at 13,000 rpm for one minute.
The aqueous part of the solution was carefully collected to another eppendorf tube and
300 µl chilled Isopropanol was added. In order to precipitate DNA, the tube was gently
invert and centrifuged at 13,000 rpm for one minute. After centrifugation, the
supernatant of the sample was cautiously removed and the pellet was purified with 300
µl ice cold 70% ethanol. The pellet was then dried in vacuum concentrator at 30°C for
ten minutes. After vaporization of the remaining ethanol, the pellet was dissolved in
100 µl of DNA hydration solution. For the complete dissolution of DNA sample, the
tube was incubated at 65°C for 5 minutes and then the sample was stored at 4°C.
33
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
2.1. 4 Quantification of Extracted DNA and Polymerase Chain Reaction
The extracted genomic DNA was quantified with the help of Nanodrop-1000
spectrophotometer (Thermo Scientific, Wilmington, USA) at optimal density of 260
nm and was then diluted to 40 ng/µl. Polymerase chain reaction was carried out in 25
µl reaction mix containing 0.6 µl of primers of each forward and reverse primer, 0.4 µl
(one unit) of Taq DNA polymerase enzyme (MBI Fermantas, Life Sciences, York, UK),
0.5 µl of deoxy nucleoside triphosphate (dNTPs) mix, 2.3 µl of Mgcl2, 2.5 µl of 10X
KCl buffer, 1 µl of DNA sample and 17.7 µl PCR water. For thorough mixing, the tubes
were centrifuged for 5 seconds. The thermal cycling conditions include a single cycle
of denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for one min, primers
annealing at 55-62°C for one min and primer extension at 72°C for one min. A final
polymerization cycle was performed for 10 minutes at 72°C. The reaction was carried
out using thermocycler (AB Applied Biosystem).
2.1.5 Linkage Studies
2.1.5.1 Exclusion Mapping
Families displaying phenotypes of nail dysplasia were primarily evaluated for linkage
to the known gene/loci using microsatellite markers (Tables 2.1-2.3). For exclusion
mapping, genotyping was carried out via microsatellite markers (average
heterozygosity of >70%). The chromosomal position of the selected genes for linkage
study were obtained from National Centre for Biotechnology Information
(https://www.ncbi.nlm.nih.gov). After finding a positive linkage in the family, the
relevant gene was sequenced to ascertain a functional pathogical variant leading to a
particular disease phenotype.
34
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
For human genome scan, homozygosity mapping was followed. It was performed with
the help of short tandem repeat (STR) markers (Invitrogen, CA, USA). PCR amplified
products of the markers were resolved on 8% non-denaturing polyacrylamide gel. For
the determination of allele size of microsatellite markers, 10bp-50bp ladders (MBI,
Fermentas, Life Sciences, UK) were used.
2.1.5.2 Human Genome Scan
To identify the disease linked chromosomal region (s), genome-wide SNPs genotyping
was carried out using Infinium HumanOmni 2.5 M chip (Illumina Inc., San Diego,
USA) containing probes for more than 700000 loci. The steps of genotyping reaction
were carried out according to manufacturer’s guidelines. For dataset, each quality
control step was evaluated via PLINK program (Purcell et al. 2007). In the first step,
genomic DNA (60 ng/µl) was denatured and neutralized to prepare MSA1 plate for
DNA amplification. The plate was prepared by adding to each well Illumina provided
chemicals (20 µl of multiple-sample amplification 1 mix, 68 µl of multiple-sample
amplification 2 mix, 75 µl of multiple-sample amplification master mix and 4 µl of
0.1N NaOH). The denatured DNA samples were amplified by incubating the MSA1
plate in Illumina Hybridization Oven at 37°C overnight. For the fragmentation of
amplified DNA products, 50 µl of fragmentation solution was added to each well in
MSA1 plate. In the next step, the fragmented products were vortexed and centrifuged
and then the plate was placed on heat block for one hour at 37°C. In order to precipitate
the fragmented DNA, each well of MSA1 plate was added 100 µl of PM1 (solution
used for the preparation of BeadChips for hybridization) and 300 µl of 100% 2-
propanol. The plate was incubated at 4°C for half an hour followed by centrifugation at
3000 rpm for 20 minutes at 4°C. After centrifugation, each obtained DNA pellet was
35
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
soaked in 46 µl of RA1 solution (Resuspension, hybridization, and wash solution). The
plate was then kept in incubator for one hour at 48°C. After incubation, the samples
were smeared on BeadChips and were separated by an IntellyHib® seal. After
separation, the BeadChips were placed in Hyb Chamber and the Hyb Chamber was then
heated in hybridization oven for 20 hours at 48°C. To remove unhybridized DNA, the
beadchips were washed with BPI solution. The next step included single-base extension
BeadChips that was obtained by adding XC, XC2 (XStain BeadChip solution 1 and 2)
and TEM (Two-Color Extension Master Mix) solutions into the Flow-Through
Chambers. By the addition of these solutions (XC, XC2 and TEM) labelled nucleotides
were incorporated into the primers and the primers hybridized to DNA on the
BeadChips. Following neutralization with XC3 solution (XStain BeadChip solution 3),
the labelled extended primers were stained. Lastly, the BeadChips were rinsed with BPI
solution, coated with XC4 solution (XStain BeadChip solution 4) and dried with the
help of vacuum desiccator. Illumina iScan and iScan control software was used to scan
the BeadChips and to obtain images. Images gained from iScan control program were
transformed to SNP genotypes with the help of BRLMM algorithm. To identify loss of
heterozygosity, the SNP data was analyzed with Illumina Genome Studio software.
2.1.5.3 Exome and Sanger Sequencing
The DNA sample of an affected sibling was used for whole exome sequencing. Exome
capture was done in solution via Roche NimbleGen SeqCap EZ Human Exome Library
v 2.0. Paired-end sequencing (average read depth 50x) was performed with the help of
Illumina HiSeq 2000 sequencer and FASTQ files were aligned with Burrows-Wheeler
Aligner (BWA) (Li and Durbin, 2009). Genome Analysis Toolkit (GATK) was used
for the realignment of regions comprising indels, recalibration of base qualities, and
36
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
variant detection and calling (McKenna et al. 2010). Variant annotation was performed
with SeattleSeq137. In silico study of rare homozygous polymorphisms was carried out
by function change prediction using multiple bioinformatics tools, and nucleotide
conservation was evaluated with GERP++ and phyloP. In order to check co-segregation
of homozygous variant, Sanger sequencing was carried out. Primer sequences
(designed through Primer 3 software) for the amplification of various genes are enlisted
in table 2.4-2.10.
2.1.6 Agarose Gel Electrophoresis
Agarose gel electrophoresis is a sound procedure for resolving PCR amplified products.
2% agarose gel was used to analyze PCR products. After the completion of
electrophoresis, the DNA bands were envisioned with UV transilluminator (Biometra,
Göttingen, Germany) and results were noted via gel documentation system.
2.1.7 Polyacrylamide Gel Electrophoresis (PAGE)
The PCR amplified samples were run on 8% polyacrylamide gel (non-denaturing gel).
The gel was visualized with the help of UV trans-illuminator. Photograph of the gel
was captured via Digital camera DC 290 (Kodak, USA). The composition of solutions
used for the preparation of 8% polyacrylamide gel are shown in Appendix.5.
2.1.8 Statistical Analysis
The Rutgers combined linkage physical map of the human genome (Matise et al. 2007)
was used to determine genetic map distance for the genome scan and fine mapping
markers. Mendelian incompatibilities and genotyping errors were removed via
PEDCHECK, PEDSTATS and MERLIN (O'Connell and Weeks, 1998; Wigginton and
Abecasis, 2005; Abecasis, 2001). For the identification of recombination events,
haplotypes were built using SIMWALK2 (Sobel and Lange, 1996) and
37
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
HAPLOPAINTER (Thiele and Nürnberg, 2004). Linkage analysis (two-point and
multipoint) were executed by MLINK program of the FASTLINK computer package
(Cottingham, Idury, and Schäffer, 1993) and Allegro 2 respectively (Gudbjartsson et
al. 2005). Two-point LOD score was calculated by Superlink software
(http://bioinfo.cs.technion.ac.il/superlinkonline). Autosomal recessive pattern of
inheritance with 100% penetrance and disease allele frequency of 0.001 were supposed.
In linkage analysis (two point and multipoint), equal allele frequencies were assumed
as it was impossible to approximate allele frequencies from the founders, subsequently
the microsatellite markers were genotyped merely in the family under study.
2.1.9 Candidate Gene Sequencing
In the linkage intervals candidate gene selection was based upon the role of the gene in
causing disease symptoms, nature of the tissue in which the gene expresses,
involvement of the gene in main cellular pathway if reported and sub cellular
localization of the protein if reported. In order to identify potential sequence variants
six genes were sequenced in the present study. These include PLCD1 (MIM 6022142),
FZD6 (MIM 603409), HPGD (MIM 601688), SLC25A16 (MIM 139080) SLCO2A1
(MIM 601460), KRT74 (MIM 608248), KRT85 (MIM 602767) and HOXC13 (MIM
142976). To amplify exons of candidate genes, primers were designed with Primers3
program (0.4.0) (Rozen and Skaletsky, 2000). Primer specificity was checked with the
help of basic local alignment search tool (BLAST; http://www.ncbi.nlm.nih.gov/blast).
Primer sequences used for exons amplification, size of the amplified products and
annealing temperature (Tm) are planned in Table 2.4-2.10. All exons and exons-intron
junctions of candidate genes were amplified by PCR. The polymerization reaction was
done in 50 µl reaction volume consisting 2 1 µl (40 ng) of DNA sample, 0.5 µM of
38
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
each primer, 10 mM of dNTP mix, 1.0 unit of Taq DNA Polymerase enzyme, PCR
buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl) and 25 mM MgCl2. The same
thermocycling conditions were applied as stated in the previous section. The product
was separated on 2% agarose gel. The PCR amplified DNA was purified with Rapid
PCR Purification kit (Marligen Biosciences, Ijamville, MD, USA) and reanalyzed on
2% agarose gel. Purified PCR product was used for sequencing PCR. Thermal-cycling
condition include an initial denaturation at 95°C for 5 minutes, followed by 29 cycles
[Denaturation = 95°C for 12 seconds, annealing for 5 seconds at 50°C, extension for 4
minutes at 60°C]. One cycle of final polymerization was executed at 64°C for 15
minutes. The PCR amplified samples were purified using ethanol precipitation protocol
(POP6 Protocol). The purified samples were transferred to cycle sequencing using ABI
Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit v3.1(PE Applied
Biosystems, CA USA) on ABI 310 genetic analyzer (Applied Biosystems, Inc., Foster
City, CA, USA). To ascertain the causative mutations, sequencing data was compared
with sequences from NCBI database using BioEdit software (editor version 6.0.7).
After detecting a novel pathogenic variant in the gene of an affected individual, the
same gene was also sequenced in the remaining affected and normal subjects of the
pedigree. The novel identified variants were also screened in 100 ethically matched
control individuals.
2.1.10 Prediction of Mutation Effect
The probable influence of missense mutations on protein function was predicted by
Polyphen-2 software (http://genetics.bwh.harward.edu/pph/).The protein sequences of
the pathogenic sequence variant and the evolutionary conservation of amino acid was
deduced through ClustalW (www.ebi.ac.uk/clustalw/).
39
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
2.1.11 Protein Structure Prediction
The three-dimensional structures of human proteins were constructed using homology
modeling techniques. Proteins sequences were obtained from NCBI database
[http://www.ncbi.nlm.nih.gov/] and were imported against Protein Data Bank (PDB).
Using the PDB structures as a template, the homology models of the wild type proteins
were constructed. The mutant structures were then built by changing the particular
residue (Zhang, 2011). The models were constructed using Molecular Operating
Environment (MOE). A chain of independent protein models was constructed via
Boltzman weighted randomized technique joined with specified logic for the handling
of sequence insertions and deletions (Fechteler, Dengler, and Schomburg, 1995). From
these independent models, a model of best MOE packing score was chosen for
additional mutational investigation. The structure was visualized with the help of
PYMOL viewer (http://www.pymol.org).
40
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.1: Microsatellite markers used for linkage mapping in families with isolated nail dysplasia
No Phenotype Chromosome Gene Markers cM* Mb+ 1 Nail disorder non- 3p22.2 PLCD1 D3S1561 61.81 36.45 syndromic type 3 D3S2417 62.36 37.40 (Leukonychia) D3S3623 62.36 37.41 D3S1298 62.69 38.02 D3S3639 63.35 38.37 D3S1260 63.37 38.38 D3S3521 64.15 38.84 D3S3572 64.15 39.00 D3S3593 64.15 39.19 D3S3527 64.15 39.32 D3S3685 66.97 42.44 D3S3559 67.57 42.66 2 Nail disorder non- 20p13 RSPO4 D20S103 2.1 0.507 syndromic type 4 D20S105 2.82 0.600 (Anonychia) D20S117 2.82 0.603 D20S199 4.92 1.04 D20S906 6.02 1.45 3 Nail disorder non- 17p13 Unknown D17S849 0.63 0.379 syndromic type 7 candidate D17S926 0.63 0.577 gene D17S1840 1.35 0.907 D17S1529 2.81 0.996 D17S1528 6.63 1.97 4 Nail disorder non- 17q25.1- Unknown D17S1807 111.1 69.87 syndromic type 9 q25.3 candidate D17S1301 111.65 70.19 gene D17S1839 113.04 71.31 D17S801 114.23 72.01 D17S937 116.33 72.85 5 Nail disorder non- 8q22.3 FZD6 D8S1714 113.2 102.17 syndromic type 10 D8S545 115.75 103.51 D8S1049 115.75 103.63 D8S276 115.91 103.76 D8S1834 115.91 103.78 D8S385 117.06 104.42 D8S267 117.27 104.93 D8S1738 117.27 105.46 D8S1814 117.27 105.80
Continued....
41
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Continued from the previous page
6 Isolated congenital 10q21.3 SLC25A16 D10S1772 67.79 49.71 finger nail dysplasia D10S1766 68.72 50.41 D10S1724 69.18 50.62 D10S567 70.37 53.58 D10S546 72.5 55.76 D10S1643 72.22 54.94 D10S539 72.91 54.73 D10S1227 74.30 57.19 D10S1756 74.60 58.76 D10S549 76.28 60.49 D10S207 76.28 60.74 D10S2323 79.21 62.82 D10S609 79.73 63.43 D10S581 81.25 65.51 D10S1428 81.66 66.48 D10S1422 83.08 67.54 D10S522 84.09 68.53 D10S1670 84.09 68.54 D10S210 84.28 69.71 D10S2295 85.24 70.47 D10S1678 86.24 70.35 D10S1647 86.24 70.61 D10S451 87.89 71.30 D10S676 88.34 71.74 D10S1650 91.81 72.96 D10S1432 93.39 74.32
*genetic distance (cM=centi Morgan) and +physical distance (Mb=mega base pairs) are according to the second-generation combined linkage physical map of the human genome (Matise et al. 2007).
42
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.2: Microsatellite markers used for linkage mapping in families with ectodermal dysplasia
No Phenotype Chromosome Gene Markers cM* Mb+ 1 Ectodermal 17p12-q21.1 Keratin cluster D17S1824 51.32 23.68 dysplasia D17S1540 54.72 28.39 D17S1788 64.18 33.15 D17S1814 66.44 35.37 D17S800 67.26 36.30 D17S1860 69.99 39.72 2 Ectodermal 12p11.1- Keratin cluster D12S291 59.2 41.68 dysplasia q21.1 & HOXC cluster D12S85 61.69 45.62 D12S339 64.2 47.48 D12S297 67.04 50.89 D12S270 67.84 50.99 D12S96 68.15 51.40 D12S329 77.03 61.42 D12S1686 79.58 63.95 D12S270 67.84 50.99 D12S96 68.15 51.40 D12S1604 69.22 52.01 D12S325 69.56 52.48 D12S1724 70.52 53.15 D12S1632 72.58 54.70 D12S1298 74.31 57.64 D12S298 75.74 60.44 3 Hair and nail 10q24.32- Candidate gene D10S1710 121.35 102.76 ectodermal q25.1 unknown D10S1267 122.59 104.36 dysplasia D10S1264 123.83 106.77 D10S254 124.41 107.93 D10S1741 125.71 109.11
*genetic distance (centi Morgan) and +physical (mega base pairs) are according to the second-generation combined linkage physical map of the human genome (Matise et al. 2007).
43
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.3: Microsatellite markers used for linkage mapping in families with primary hypertrophic osteoarthropathy
No Phenotype Chromosome Gene Markers cM* Mb+ 1 Primary hypertrophic 4q34.1 HPGD D4S3326 170.54 168.62 osteoarthropathy or D4S2368 171.12 168.95 Isolated congenital D4S1597 172.31 170.07 nail clubbing D4S2373 174.15 171.77 D4S1545 174.7 172.53 D4S621 175.84 173.29 D4S2992 176.6 174.55 D4S2991 176.78 174.75 D4S2431 176.78 175.05 D4S2290 176.78 175.70 D4S1539 178.67 175.92 D4S3246 178.67 176.12 2 Primary hypertrophic 3q22.1- SLCO2A1 D3S3548 140.59 132.67 Osteoarthropathy 3q22.2 D3S1292 140.59 133.11 D3S1541 140.59 133.20 D3S2322 141.58 134.16 D3S1273 141.7 134.30 D3S1290 141.75 134.47 D3S3713 143.25 134.73 D3S3657 143.25 134.90 D3S1238 144.35 135.39 D3S3684 144.35 135.40 D3S3637 145.52 135.79
*genetic distance (cM=centi Morgan) and +physical distance (Mb=mega base pairs) are according to the second- generation combined linkage physical map of the human genome (Matise et al. 2007).
44
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.4: Primers sets used for the amplification of PLCD1gene
Exon Gene Primer Sequence 5’→ 3’ Product Tm(°C) (bp) 1A PLCD1-1F GCTGGAGGAATCTGGCTATT 578 58.5 PLCD1-1R CGGGCTAGATCTCGGACAA 60.4 1B PLCD1-1F GAGCAGAGGGTGTTGTGAGC 298 61.4 PLCD1-1R GTCCAATTAAAGGCTCCAAGG 60.4 2 PLCD1-2F AGCTGAGGATGAGGCTGGT 375 60.2 PLCD-2R TTTGATCCATGACTGACCTTTG 60.0 3 PLCD1-3F CCTCTCTACTGTGGCCTTGG 402 59.9 PLCD1-3R AGCTTCCATACCCAAGTTGC 59.2 4 PLCD1-4F GAGGCCACTGAAACATGGAT 423 59.9 PLCD1-4R GCCTCAATCTCCTCGTCCTC 61.2 5 PLCD1-5F AGGAGCTCAACATCCAGGTG 477 60.3 PLCD1-5R CTCCGGTTCCCTTCTTTCTG 61.1 6/7 PLCD1-6, 7F AGCTCTGGAAGACTGGCTCA 687 60.3 PLCD1-6, 7R TCCAGTGTGCAGTGGTTCTC 59.9 8/9 PLCD1-8, 9F TATGCCTTCAAGGTGGGAGT 582 59.6 PLCD1-8, 9R GCAGCCACAGAGAACTGAGA 59.2 10/11 PLCD1-10, 11F TGTCTGTCTCCCTCTGTCTCTC 589 58.6 PLCD1-10, 11R CCTCAGAGCTCCACTGCAT 59.1 12/13 PLCD1-12, 13F CTGCTAACTCACCATGTGACC 599 58.2 PLCD1-12, 13R GTCCCACCATGGGTTGAAA 61.1 14/15 PLCD1-14, 15F ACCAACAATGGTAGGTGCTG 586 58.5 PLCD1-14, 15R AATTTGGGGGCCTAGCTCT 60.0
F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
45
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.5: Primers sets used for the amplification of FZD6 gene
Exon Gene Primer Sequence 5’→3’ Product Size Tm (°C) (bp) 2 FZD6-2F GAGGATGCAAAGAGTGATTC 341 54.8 FZD6-2R CACAACTTGAAGAAATCGGC 58.4 3 FZD6-3F GGAGTTTGTTGGTGACTCTG 592 55.6 FZD6-3R CACAGCACTTAGCACCATAG 54.5 4A FZD6-4F TGCATTTTCATGTTCACCTG 682 58.1 FZD6-4R AAGTTCTAGCTTCTCATCTG 52.8 4B FZD6-4F GTGCAACTCTGTTCACATTC 481 54.0 FZD6-4R CAAAGTAGCGAGAAGCATC 54.9 4C FZD6-4F TGGTTCTTAGCTGCAGGAAG 454 58.3 FZD6-4R CTGTTCTTCTGACTCTGCTC 53.1 5 FZD6-5F AAATGTGTTGCACTTAGAGC 480 53.1 FZD6-5R GCAAAAATAAAGCACGTCTC 55.3 6 FZD6-6F TTGCCTTAATTTCTTGCCAG 744 58.0 FZD6-6R GCTTTCCAAATGTGTTATGC 55.8 7 FZD6-7F CTAGCAACAGAGTGAGACTC 616 49.8 FZD6-7R ATTCCTCTAACTCTGTCCTC 49.9 F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
Table 2.6: Primers sets used for the amplification of HPGD gene Exon Gene Primer Sequence 5’→ 3’ Product Size Tm (°C) (bp) 1 HPGD-1F CAAAGATCGCGAAGCTTG 471 58.2 HPGD-1R ACTTCTGAGGTGTGCTCAC 53.4 2 HPGD-2F GTGAGCACACCTCAGAAGTG 446 56.9 HPGD-2R GCTATTGGGCTGTCAGAAGG 59.8 3 HPGD-3F CCAAGCTGCCAGATTGATG 555 60.4 HPGD-3R GCCAATCCCTGAGTTAAGC 57.3 4 HPGD-4F GGCAAACCCAAAGAATCCAGG 570 64.9 HPGD-4R GGAGTCTCACCACAACCTTTG 59.6 5 HPGD-5F GGCTACTGAGTTTCACAAAGC 571 56.8 HPGD-5R GGCCTATTGCATCTTGCATTTC 62.9 6 HPGD-6F CATTGTTACATAGCTGGGAGG 439 57.3 HPGD-6R CTCCCAGAGAGTTTGCCAAAC 61.2 7 HPGD-7F CCTGCCAAAATGATGGAAGG 625 62.6 HPGD-7R TACAACCTAGCCTTTGGTCC 56.8 F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
46
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.7: Primer sets used for the amplification of SLC25A16 gene
Exon Gene Primer Sequence 5’→ 3’ Product Size Tm (°C) (bp) 1 SLC25A16-1F CCGTCCGGTGTTCTGTAAGT 480 60.03
SLC25A16-1R AGAAGTCTCTGCGGGTTGTG 60.44
F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
Table 2.8: Primers sets used for the amplification of KRT74 gene
Exon Gene Primer Sequence 5’→ 3’ Product Size Tm (°C) (bp) 1 KRT74-1F ATCAGCAGGGGAAAGGAGAT 720 60.0 KRT74-1R CCCTTGTCACCACTGGACTT 60.0 2 KRT74-2F AGGGCTACATCAGCAACCTG 540 60.2 KRT74-2R TGGCACAGAGATCAGGTGAG 59.9 3 KRT74-3F GCCATCTACTCTCCCTGCTG 299 59.9 KRT74-3R TGGAGGCCAGGACTATGACT 59.6 4 KRT74-4F CTTCAGGCCAAAGTGGACTC 360 59.8 KRT74-4R CACTTCCATGGTCTCCTGGT 59.9 5 KRT74-5F AAGACTGATGGGGCAGAAGA 420 59.8 KRT74-5R GATGCTGTCAAGGTCCAGGT 60.1 6 KRT74-6F GCAGGGGTGGCTTATTTACA 360 59.9 KRT74-6R CCCACCTGCTTCTTCACATT 60.1 7 KRT74-7F TAGAACCCAGGTTCCCCTTC 300 60.3 KRT74-7R CAGCTGTGTCCCTCAGTCAA 60.0 8 KRT74-8F AGACAATGCCCTGAAGGATG 600 60.0 KRT74-8R TCTCACACTTTCCCCTCCAC 60.0 9A KRT74-9F TGTCTGCATCGTGGTTTAGC 660 59.8 KRT74-9R CTCCTGCTCCTTCCCTCTTT 59.9 9B KRT74-9F GGCTGGTTTGTTCTGTGCTT 660 60.3 KRT74-9R CTGGCAGAGAATCCCCAATA 60.0 9C KRT74-9F GGGCTGTCAAAGTCACCATT 540 59.9 KRT74-9R GAAAAGCCAGCTCCACTCAC 60.0
F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
47
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 2 Materials & Methods
Table 2.9: Primers sets used for the amplification of KRT85 gene
Exon Gene Primer Sequence 5’→ 3’ Product Size Tm (°C) (bp) 1 KRT85-1F TCTTCAAGACTTCAGGGAGC 859 57.2 KRT785-1R TGGACCTCGTTAAATGCTGC 61.2 2 KRT85-2F CAGACACTCAGCTTTATGGC 460 56.1 KRT85-2R TGGATATCTGCTCTGGGTTC 57.7 ¾ KRT85-3, 4F CAGGAGTTGGGATGGTATTC 469 56.9 KRT85-3, 4R GCACATTGGCAAACATAGGC 61.4 5/6 KRT85-5, 6F TCTGGGAAGTGGACATTGTC 794 61.4 KRT85-5, 6R CAGTGACATGGTCTGATTGC 58.5 7 KRT85-7F AGGAGTACCAGGAGGTGATGAA 480 59.9 KRT85-7R ATTAGCCATGGCCAGAGTTG 60.1 8 KRT85-8F GACTCTGTACACAGGATGAC 206 49.8 KRT85-8R TGGGTTAGGCCAATGAGTTC 59.9 9 KRT85-9F ACAGGGCCTGCATTGTTGAC 429 63.4 KRT85-9R ATCCAGAAGATTCTGGAAGC 55.9
F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
Table 2.10: Primers sets used for the amplification of HOXC13 gene
Exon Gene Primer Sequence 5’→ 3’ Product Size Tm (°C) (bp) 1A HOXC13-1F ATGCGTAGAGGGAATGTAGG 455 56.8 HOXC13-1R CGGGATGTCCGTATAGACG 59.0 1B HOXC13-1F GAAGCACTAGGAGGAGGGGA 891 60.7 HOXC13-1R GCGCTCGGGTCCCTTCCTTA 62.9 2 HOXC13-2F GCCTCATCATAGTTGTGGTC 501 55.5 HOXC13-2R GTTCGGTTATGGTACAAAGC 54.8
F = forward primer, R = reverse primer, bp = base pair, Tm = melting temperature and °C = degree centigrade
48
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
CHAPTER 3
3.1 HEREDITARY NAIL DISORDERS
Nail is a specialized skin outgrowth, chemically similar to horn and hoof of other
vertebrates. It involves a keratinized nail plate and perform several important jobs
essential for the proficient use of the hands and feet (Baran et al. 2003). The nails of
hands and feet originate from the nail matrix while the nail bed adds limited number of
cells to the nail plate. The growth ratio of the finger-nails and toe-nails varies between
individuals. The normal growth rate of the fingernails is 0.1mm/day while that of the
toenails range from 0.03 to 0.05 mm/day. In human a normal fingernail completely
regrows in 3-6 month while the toenail requires 12-18 months to completely regrow
(Fleckman, Hager, and Dale, 1997).
In human inherited nail anomalies constitute a rare and diverse group of
genodermatosis. Congenital nail defects may arise as isolated disorder or in association.
In most of the cases nail disorders evident as nail hypertrophy or nail hypoplasia. In
literature isolated hereditary nail dysplasia (ICND) has been categorized into 10
different types (Khan et al. 2015).
This chapter of the thesis involves the clinical investigation and genetic analysis of six
families (A-F) with congenital nail dysplasia. Several remote areas of Pakistan were
visited for searching and collecting families. All affected subjects of each pedigree were
clinically inspected at local government hospitals. Venous blood samples were taken
from the patients and normal family members. DNA was extracted from the collected
blood samples. To identify the causative genes and sequence variants, different
techniques like microsatellite markers based and microarrays based genotyping, whole
exome sequencing and Sanger sequencing were employed.
49
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
3.1.1 Family A
3.1.1.1 Clinical Features
Family A, a five-generation consanguineous family was collected from rural area of
Sind province of Pakistan (Fig. 3.1). The family contains several affected siblings (V-
1, V-2, V-4, V-5, V-6) and segregates finger nail dysplasia in autosomal recessive
fashion. All affected males and females were clinically examined at local government
hospital in Sukkur district of Sindh. The patients ages range from 13-27 years at the
time of visit. All affected family members were suffering from severe
onychodystrophy. The digits of the affected individuals had bulbous look with minor
erythema. The proximal and lateral parts of the nail folds were swollen and nail bed
was hyperkeratotic. The nail plate of the digits was thick due to diffuse crumbling and
was completely destructed (Fig. 3.2). Toenails of all affected individuals were normal.
Any type of ectodermal defect including nail has not been revealed in the paternal and
maternal family history. The fingernails of the carrier subjects were normal and
indistinguishable from genotypically normal siblings. In all affected family members,
fungal infection of the nails was excluded by examination of a potassium hydroxide
preparation. In any of the affected individual, no chronic liver disease and
cardiovascular changes were observed. No additional abnormality of skin, teeth, hair
and sweat glands was evident in the affected subjects of the family.
For the identification of causative gene defect, venous blood samples were taken from
five affected (V-1, V-2, V-4, V-5, V-6) and four normal (III-1, IV-1, V-3, V-7)
individuals of the family.
50
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
3.1.1.2 Demarcating Genes through Homozygosity Mapping in Family A
On the basis of clinical manifestations of the patients, the family was primarily typed
for linkage to the formerly reported genes causing phenotypes similar to family A.
Linkage was investigated by microsatellite markers (Table 2.1-2.3) in the regions
encircling PLCD1 on chromosome 3p21.3-p22.2, RSPO4 on chromosome 20p13,
FZD6 on chromosome 8q22.3, HPGD on chromosome 4q32.3-q34.1, nail dysplasia
locus at 17q25.1-q25.3, hair and nail ectodermal dysplasia locus on chromosome
10q24.32-q25.1, locus at chromosome 12p11.1-q21.1 encircling type II keratins, ICND
locus on chromosome 17p13 and locus at 17p12-q21.1 encircling type I keratins.
Haplotypes analysis did not disclose any homozygous region; hence the family was
excluded from linkage to the tested known genes. Following exclusion, genome-wide
autozygosity mapping was carried out with 580 STR (short tandem repeat) markers
using DNA samples of a normal (V-7) and four affected (V-1, V-2, V-4, V-5)
individuals. The results of genome-wide autozygosity revealed homozygosity with five
markers (D5S2863, 5q35.2; D10S549, 10q21.1; D10S522, 10q21.3; D13S1493,
13q13.1-q13.2; D18S454, 18q12.3) in the affected siblings. When all family members
were genotyped with these microsatellite markers, only two markers (D10S549 and
D10S522) were co-segregated with nail dysplasia. Within this region further
genotyping was carried out using 24 extra microsatellite markers (D10S1724,
D10S1772, D10S546, D10S1766, D10S567, D10S1643, D10S1432, D10S539,
D10S1756, D10S1227, D10S207, D10S581, D10S2323, D10S609, D10S1428,
D10S1647, D10S1678, D10S676, D10S1670, D10S451, D10S1422, D10S210,
D10S2295, D10S1650). Out of twenty-six markers, twenty-three markers were
informative and selected for further molecular investigation.
51
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Genome scan and fine mapping markers genotypes in this region (10q21.1-10q21.3)
were analyzed with PedCheck and MERLIN, no genotyping error was revealed. Results
obtained from two-point and multipoint linkage analysis are shown in Table 3.1. The
highest two-point LOD score at θ = 0.00 was 3.14 at several markers (D10S451,
D10S567, D10S1643, D10S210, D10S609, D10S207, D10S1756, D10S1670). A
maximum multipoint LOD score of 4.09 was obtained at 4 markers (D10S207,
D10S210, D10S1670, D10S609) along the disease interval. To define critical
recombination events in the family, haplotypes were constructed using SIMWALK2
(Fig. 3.3). In all affected individuals a remarkable recombination event between
markers D10S676 (88.34 cM) and D10S1650 (91.81 cM) demarcate the telomeric
border of disease interval. The centromeric border of the disease interval corresponds
to a recombination event between markers D10S1724 (69.18 cM) and D10S567 (70.37
cM), which occurred in individual V-2. The disease interval bordered by markers
D10S1724 and D10S1650, contains 22.34 Mb physical distances and is 22.63 cM long
according to the Rutgers combined linkage physical map of the human genome (Fig.
3.4) (Matise et al. 2007).
3.1.1.3 Exome and Sanger Sequencing
The DNA sample of one patient (V-5) was used for exome sequencing. From the exome
data of individual V-5, nine homozygous exonic variants (Table 3.2) that were
pathogenic, and had minor allele frequency (MAF) <0.01 in South Asian alleles from
the Exome Aggregation Consortium (ExAC) database were identified. Of these, only
the variant c.92G>T (MAF=0.0001; chr10: 70,287,041) in SLC25A16 (NM__152707.4)
lies within the linkage interval. Analysis of the variant with PolyPhen-2, CADD, SIFT,
Mutationtaster2, and MutationAssessor predicted that the variant is deleterious. Sanger
52
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
sequencing validated co-segregation of the mutation (c.92G>T) with the disease
phenotype in the whole family (Fig. 3.5).
3.1.2 Family B
3.1.2.1 Clinical Features
A three-generation family inheriting autosomal dominant leukonychia was collected
from district Lakki Marwat, Khyber Pakhtunkhwa (KPK) province of Pakistan (Figure.
3.7). The family consists three affected males (I-1, III-1, III-2) and two affected females
(II-2, III-3). The affected member I-1 was deceased. All other affected persons of
family B were clinically inspected in a government hospital of Lakki Marwat. At the
time of blood collection ages of the available patients ranged 12-45 years. All affected
males and females showed typical phenotypes of hereditary leukonychia. These include
leukonychia of all twenty nails. The nail plate and lunula both were chalky white and
the phenotype was present since birth. In an affected male (III-2) the phenotype of
incomplete leukonychia was observed. In this affected individual a yellowish coloration
was found in the distal end of the middle toe nail (Fig. 3.8). The growth rate was normal
in all twenty nails. All affected members of the family had normal skin, hair, teeth and
sweat glands.
For DNA extraction and further molecular study, blood samples of two normal (II-1,
III-4) and four affected (II-2, III-1, III-2, III-3) of the family were taken.
3.1.2.2 Sequencing PLCD1 gene in Family B
It is already reported that mutation in PLCD1 gene, lying on chromosome 3p21.3-p22,
is responsible for causing leukonychia phenotype (Kiuru et al. 2011; Mir et al. 2012).
Consequently, all fifteen exons of PLCD1 (NM__001130964.1) gene were sequenced
using the DNA samples of all affected and normal individuals of family B. Sequencing
53
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
data revealed a heterozygous missense mutation (c.625T>C) (Fig. 3.9). The mutation
c.625T>C (MAF=0.00009; chr3: 38,052,933) results in the substitution of cysteine
amino acid to arginine amino acid at position 209 (p.Cys209Arg).
3.1.2.3 Protein Structure Prediction for PLCD1
The three-dimensional (3D) model of normal and mutant PLCD1 protein was predicted
using the phosphoinositide-specific phospholipase c-delta1 structure (PDB ID 1DJZ)
as a template. In order to develop mutant structure for Cys209Arg, the selected amino
acid was changed into a desired one and the structure was refined with the help of
energy minimization protocol. Comparative modeling was carried out using Molecular
Operating Environment (MOE vr 2009-10) and the structure was visualized with
PyMOL software (www.pymol.org).
3.1.3 Family C
3.1.3.1 Clinical Features
Family C (Figure. 3.12), a three-generation family inheriting in autosomal dominant
manner was recruited from district Dera Ismail Khan, Khyber Pakhtunkhwa (KPK),
Pakistan. The affected siblings of the family include six males (I-1, II-2, II-4, III-4, III-
6, III-7) and three females (III-2, III-3, III-9) and their ages ranged 26-67 years. All
affected subjects of the family showed complete leukonychia since birth. The affected
individuals had chalky white nail plate and lunula. The growth rate was normal in all
twenty nails (Fig. 3.13). The skin and other ectodermal appendages (hair, teeth, sweat
glands) of the affected individuals were normal.
For DNA extraction and further molecular analysis, peripheral blood samples of seven
affected (I-1, II-4, III-2, III-3, III-6, III-7, III-9) and two normal individuals (III-1, III-
8) were taken.
54
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
3.1.3. 2 Sequencing PLCD1 gene
In previous studies it has been reported that leukonychia phenotype is caused by
mutation in PLCD1 gene (Kiuru et al. 2011; Mir et al. 2012). Consequently, all fifteen
exons of PLCD1gene were sequenced using the DNA samples of all affected and
normal individuals of family C. Analysis of sequencing data did not reveal any mutation
in PLCD1 gene. To ascertain the causative gene, the DNA sample of an affected family
member has been submitted for exome sequencing.
3.1.4 Family D
3.1.4.1 Clinical Features
Family D (Fig. 3.14), a four-generation consanguineous Pashto speaking family was
resident of district Charsada, Khyber Pakhtunkhwa (KPK), Pakistan. The family was
segregating autosomal recessive nail dysplasia and all affected persons of the family
were born to their carrier parents. At the time of blood collection ages of the affected
persons were ranged from 10 to 41 years. The affected persons showed severe nail
dysplasia and displayed features of shiny, hyper-pigmented and hyperplastic nails since
birth. When ages of the affected individuals reached about 8 years, their nails become
claw-shaped. The patients were also suffering from onycholysis and hyponychia of both
fingernails and toenails (Fig. 3.15). The skin, hair, teeth and sweat glands of the affected
individuals were normal.
For the genetic analysis of family D, peripheral blood samples of three unaffected (III-
1, III-2, IV-7) and four affected (IV-1, IV-2, IV-3, IV-5) individuals were taken.
55
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
3.1.5 Family E
3.1.5.1 Clinical Features
Family E, a four-generation consanguineous Pashto speaking family resides in district
Peshawar, Khyber Pakhtunkhwa (KPK) province of Pakistan (Fig. 3.16). The family
was segregating isolated hereditary nail dysplasia in autosomal recessive form. All
affected siblings of the family E were born to normal first cousin parents. At the time
of blood collection ages of the affected persons were ranged from 11 to 26 years. The
affected subjects of the family showed thick, hard and shiny nails on both the hands
and feet. From birth the nails of the hands and feet were hyperplastic and
hyperpigmented. The nail growth rate was very slow and required rare trimming. When
ages of the affected members reached 10 years, their nail become claw-shaped. The
affected siblings also showed onycholysis and hyponychia of both fingers and toenails
(Fig. 3.17) however their skin, hair, teeth and sweat glands were normal.
To perform genetic analysis, venous blood samples of 2 affected (IV-1, IV-2)
and 3 normal (III-2, IV-3, IV-3) individuals were taken.
3.1.5.2 Sequencing FZD6 Gene in Families D and E
Formerly it has been described that mutations in FZD6 (NM__003506.4) gene are
responsible for causing claw-shaped nails (Fröjmark et al. 2011; Naz et al. 2012;
Kasparis et al. 2016; Raza et al. 2013; Mohammadi-asl et al. 2017). Therefore, in both
families linkage was tested using microsatellite markers (D8S1714, D8S545, D8S1049,
D8S276, D8S1834, D8S385, D8S267, D8S1738, D8S1814) linked to FZD6 gene
located on chromosome 8q22.3. Haplotype analysis of family D (Fig. 3.18) and E (Fig.
3.19) verified linkage to FZD6 gene positioned on chromosome 8q22.3. Hence, FZD6
gene in all affected and normal members was sequenced in both families. Sequence
56
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
analysis of family D identified a homozygous sequence variant c.1750G>T
(MAF=0.00001; chr8: 104,342,091) that converts glutamic acid into a stop codon
(p.Glu584*). This conversion (p.Glu584*) will result in truncated protein. In the carrier
individuals of family D, the recurrent mutation c.1750G>T was present in heterozygous
state (Fig. 3.20). In family E, analysis of sequencing data showed a recurrent mutation
c.1266G>A (MAF=0.00001; chr8: 104,342,091) that substitutes glycine with aspartic
acid at position 422 (p.Gly422Asp). In the carrier individuals of family E, the recurrent
G to A transition was present in heterozygous state (Fig. 3.22). To confirm that the
missense mutations detected in family D and E does not characterize nonpathogenic
polymorphisms in this population, a group of 100 control normal individuals of the
same ethnic background was screened but the mutations were not found outside the
family.
3.1.5.3 Protein Modeling for Family E
The three-dimensional structures of FZ-6 protein was predicted with the help of
Modeller 4 (Webb and Sali, 2017). For homology modeling of wild and mutant FZ-6
protein, X-ray crystal structure of the cysteine-rich domain of human Frizzled 4 (PDB
ID: 5BPB, sequence identity 39%) and human srGAP2 motif (PDB ID: 5I7D, sequence
identity 36%) were used as a scaffold (Chang et al. 2015; Sporny et al. 2017). The
models were visualized with the help of Pymol software (https://pymol.org/).
3.1.6 Family F
3.1.6.1 Clinical Features
Family F, a five generation consanguineous Pashto speaking family representing
segregation of autosomal recessive isolated congenital nail dysplasia (ICND), was
collected from Bannu district, Khyber Pakhtunkhwa (KPK), Pakistan (Fig. 3.25). The
57
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
family contains eight patients including five males (III-1, IV-1, IV-3, IV-6, V-1) and
three females (IV-5, V-2, V-3). The nails of the affected individuals are not equally
affected; in some affected individuals all twenty nails are affected, while in other
affected family members only the nails of the digits of hands or toe-nails are affected.
In affected individuals the nails are thick and hard with deformed nail bed. The nails of
the affected individuals possess ridging and longitudinal over-curvature. The nail plate
lacks cuticle and curvature and in some affected individuals, the nail plate was detached
from the nail bed (Fig. 3.26).
To perform molecular analysis, peripheral blood samples of eight affected (III-1, IV-1,
IV-3, IV-5, IV-6, V-1, V-2, V-3) and two normal (III-2, IV-2) family members were
collected.
3.1.6.2 Mapping of Candidate Genes Involved in Family F
On the basis of phenotypes observed, linkage in family F was investigated using STR
(short tandem repeat) microsatellite markers linked to the formerly described genes
(HPGD and FZD6) causing hereditary nail dysplasia. However, the above tested genes
were not link to family F. To find causative gene in the family, the DNA samples were
submitted to SNP microarray. SNP microarray (Affymetrix, Santa Clara, CA, USA)
results in the identification of four homozygous regions (Fig. 3.27). To identify a
causative gene in the linked regions, the DNA sample of an affected individual has been
submitted to exome sequencing.
3.1.7 Discussion
In this chapter of the dissertation, six families (A-F) displayed isolated congenital nail
dysplasia were investigated at clinical and genetic level. These families were collected
from different remote areas of the country. Family A is a Pashto speaking
58
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
consanguineous Pakistani family displaying autosomal recessive fingernail dysplasia.
Clinically all affected individuals possess severe onychodystrophy. In affected
individuals, the digits had bulbous look with minor erythema. The nail plate was thick
and the nail bed was hyperkeratotic. The toe nails were normal but the nail plate in the
digits was completely destroyed.
When known genes (PLCD1, RSPO4 and FZD6) were excluded, whole exome
sequencing was carried out. Whole exome sequencing results in the identification of
novel mutation c.92G>T (p.Arg31Leu; MAF=0.0001; chr10:70,287,041) in SLC25A16
gene. The mutated arginine (R) amino acid at position 31 is very conserved in selected
orthologs (Fig. 3.6).
The SLC25A16 (NM__152707.4) gene comprises nine coding exons and encodes a long
protein composed of 332 amino acids. The polypeptide chain encoded by SLC25A16
contains three tandemly repeated mitochondrial transporter domains. In a previous
study mutation (c.793C>T; p.Arg265Cys) in human SLC25A16 has been reported
where the mutation causes cerebral visual impairment (Bosch et al. 2016). In some
previous studies mutations in other transporter genes (SLCO2A1, SLC6A19, SLC2A10
and SLC17A5) have been associated with different types of genodermatoses (Shah et
al. 2016; Shah et al. 2016; Seow et al. 2004; Callewaert et al. 2008; Lines et al. 2013).
Solute carrier proteins constitute a large group that contains more than 300 membrane-
bound proteins. These proteins serve to transport different types of substrates across
biological membranes. They also perform a variety of physiological functions like
uptake and absorbance of nutrients, metabolites, drugs, and xenobiotic (Lin et al. 2015).
The SLC25 constitute the largest group of solute carrier proteins that comprises 53
members. They are frequently related with transport in mitochondria (mitochondrial
59
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
carrier family). Some members of SLC25 family are found in other cell organelles like
peroxisomes, chloroplasts and mitosomes (Palmieri, 2013). The SLC25A16 protein
resides in the interior mitochondrial membrane and facilitate the transport and
interchange of molecules between cytosol and mitochondrial matrix (Prohl, 2001).
The two families (B and C) were characterized both at molecular and clinical level. The
affected family members of family B and C displayed typical features of congenital
leukonychia. Affected persons of both families had chalky white nails displaying total
leukonychia. In an affected male (III-2) in family A, the phenotype of incomplete
leukonychia was observed. In this affected individual a yellowish coloration was found
in the middle toe nail. This feature was also detected in affected individuals of family
A with hereditary leukonychia as described earlier (Mir et al. 2012). PLCD1 gene
located on chromosome 3p21.3-p22 is the only known gene for leukonychia disorder,
therefore sequencing of this gene was planned in both families before embarking into
the whole exome sequencing. Subsequent sequencing of PLCD1 (NM__001130964.1)
gene in the affected and normal subjects of family B revealed a heterozygous
pathological variant c.625T>C; MAF=0.00009; chr3: 38,052,933) resulting in the
exchange of cysteine residue to arginine residue at position 209 (p.Cys209Arg). The
mutated cysteine (Cys) amino acid at position 209 is very preserved in other orthologs
(Fig. 3.10). In family C no mutation was detected in PLCD1 gene. In order to find out
a novel locus/gene, the DNA sample of an affected subject has been submitted to exome
sequencing.
Family B is the first family of Pashtun origin harboring autosomal dominant
leukonychia caused by PLCD1 mutation at position p.Cys209Arg (MAF=0.00009;
chr3: 38,052,933). In the present study and in a previous study (Mir et al. 2012; Kiuru
60
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
et al. 2011; Farooq et al. 2012) several patients with mutations in PLCD1 gene have been
studied. However, no difference was found in the severity of the nails whitening in
patients carrying various mutations, and no vibrant genotype-phenotype correlation was
found. This study strengthened the idea that pathogenic mutations in PLCD1 gene
causes leukonychia phenotype.
Until now, six mutations have been described in PLCD1 gene triggering leukonychia
phenotype. Of these two mutations (including mutation reported in this family) are
causing autosomal dominant leukonychia, while the other four mutations underlie the
autosomal recessive form of leukonychia (Table 3.3). It seems that missense mutations
cause autosomal dominant leukonychia while the protein truncation mutations cause
the recessive form of the disorder.
For the identification of structural role of the mutated positions, homology modeling
techniques were used. The intra-molecular interactions were analyzed and compared
wild type protein with mutant model (Fig. 3.11 a-c). In fact, Cys209 is not involved in
any interaction with adjoining amino acid residue, while in the mutant model, Arg209
forms hydrogen bonds with the adjoining Ile145, owing to the difference in bonding
may provide a local difference in the helix structure as seen from the figure (Fig. 3.11
b and c).
The PLCD1 gene consist of 15 exons and covers 22.17 kb genomic segment. It encodes
2 isoforms consisting 777 and 756 amino acids respectively. The PLCD1 protein
belongs to a large superfamily of PLC (phosphoinositide-specific phospholipase C)
proteins. It hydrolyses phosphatidylinositol 4,5-biphosphate (PIP2) into diacylglycerol
and inositol triphosphate. When PLCD1 gene disrupted, there occur significant
reduction in the production of inositol monophosphate which is a downstream
61
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
metabolite of inositol triphosphate. The highest expression of phospholipase C-δ1
occurs in nail matrix, nail bed, hair matrix and hair follicles (Kiuru et al. 2011; Rice et
al. 2010).
It has been proposed that phospholipase C-δ1 works downstream of FOXN1 and
controls the expression of hard keratin necessary for the differentiation of nails
(Nakamura et al. 2008). Loss of function mutation in FOXN1 results in defective
onycholemmal differentiation and causes onychodystrophy both in humans and mice
(Auricchio et al. 2005). Therefore, disruption in PLC- δ1 function may results in
atypical keratinization of nails due to irregular expression of hard keratins leading to
leukonychia phenotype.
Families D and E were the 4th and 5th family recruited for the present study. In both
families the affected individuals showed onycholysis, onychauxis (thick nails) and
hyponychia in the nails of fingers and toes. The affected family members of both the
families had claw-shaped nails since birth. Phenotypes observed in both families (D
and E) were parallel to those described in the previous studies (Naz et al. 2012; Raza
et al. 2013). Linkage in family D and E was established to FZD6 (NM__003506.4)
gene. Sanger sequencing of FZD6 gene revealed a formerly reported nonsense mutation
p.E584X* (MAF=0.00001; chr8:104,342,091) in family D. The mutated glutamic acid
at position 584 is very conserved in other vertebrate groups (Fig. 3.21). In family E
sequence analysis shown a previously reported missense mutation p.Gly422Asp
(MAF=0.00001; chr8:104,342,091) in FZD6 gene. The altered glycine at position 422
is very conserved in other vertebrates (Fig. 3.23).
The FZD6 gene consists of eight exons and covers 3.719 kb genomic segment. The
gene encodes a long polypeptide chain (80 kDa) composed of 706 amino acids. The
62
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
FZD6 receptor (Frizzled class receptor) is a member of heptahelical group of Frizzled
receptors. At the N-terminal, the FZD6 receptor has an extracellular domain (cysteine-
rich domain) that constitute the signal peptide sequence. The C-terminal of FZD6
receptor contains 7 transmembrane domains and an internal PDZ-binding domain.
These domains are required for the recruitment of phosphoproteins disheveled 1-3 and
other signaling proteins. They are also required for the trafficking of the receptor
(Pinson et al. 2000; Clevers, 2006).
Until now, eight mutations have been described in FZD6 (NM__003506.4) gene
triggering isolated nail dysplasia (Fröjmark et al. 2011; Naz et al. 2012; Kasparis et al.
2016; Raza et al. 2013; Mohammadi-asl et al. 2017; Wilson et al. 2013). Of these
mutations two are nonsense, two deletions and four are missense mutations (Table 3.4).
The widespread occurrence of the mutation (c.1750G>T; Glu584*) as reported in
previous studies (Fröjmark et al. 2011; Naz et al. 2012) points towards a founder effect
and implies that the variation is due to a single alteration event on an ancestral
chromosome 8. Residue Gly422 is located in the helix region which does not involve
any binding with nearby residues (Fig. 3.24a). Among the nearby residues, the Ser421
make two hydrogen bonding with Ile417 and Trp300 while other residues (Leu419,
Leu423 and Leu663) interactions are hydrophobic. When Glycine is substituted by
Aspartic acid at position 422, there occur local confirmation change in the nearby
residues interactions as shown by the difference in the distances in figure 3.24 (b, c). In
case of E584* sequence variant, there occur the formation of truncated protein due to
the premature stop codon and the loss subdomain is highlighted by magenta color (Fig.
3.24 d).
63
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Claw development in mice has been investigated showing a governing role for FZD6-
mediated Wnt signaling in the differentiation process of claw/nail formation (Cui et al.
2013). The results of the present study along with earlier identified mutations in FZD6
gene support the disease spectrum of Pakistani population with claw shaped nail
dysplasia mostly in families of Pashtun origin.
Family F, is a Pashto speaking consanguineous family collected from district Bannu.
The phenotypes of affected individuals vary. In some affected members all twenty nails
are affected while in others only hand nails or toe nails are affected. Affected family
members display variations in phenotypes including thickened, hard nails with
deformed nail bed. The nails of the affected individuals possess ridging and longitudinal
over-curvature. The family failed to show linkage to the already known genes like
HPGD and FZD6. After exclusion the DNA samples of the affected individuals were
submitted to SNP microarray. SNP microarray results in the identification of four
homozygous regions on chromosome 1, 3, 5 and 6 respectively. Currently the DNA
sample of an affected subject has been submitted for targeted whole exome sequencing.
64
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.1: Pedigree of family A with autosomal recessive congenital nail dysplasia (ARCND). Filled squares and circles denote affected subjects, while the empty squares and circles designate normal individuals. Squares and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers characterized with stars designate those siblings who donated blood samples for genetic study.
65
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.2: Phenotypes of the patients in family A. Patient V-1 presented with severe hyperkeratotic thick nail plate, nail bed and swelled fingers (a). Affected subject V-2 showing keratotic lesions of the middle and ring fingers in the right hand and keratotic left fingernails and normal left thumb (b). Patient V-4 (c) showing onychodystrophy, hyperkeratotic with minor erythema and swelling. Thick dystrophic nails with hyperkeratotic nail bed in patient V-5 (d). Patient V-6 revealing destructed nail plate and nail bed (e).
66
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.3: Haplotype of family A with congenital nail dysplasia in recessive form. For each genotyped subject, haplotypes of microsatellite markers linked to chromosome 10q11.23-q22.1 are presented under each symbol. Alleles forming risk haplotypes are shown in black. Alleles that follow independent segregation are shown in white. The centromeric boundary of the disease interval is delimited by marker D10S1724 while the telomeric boundary is delimited by D10S1650. Genetic distances (centiMorgan) and arrangement of microsatellite markers are shown according to Rutgers combined linkage physical map built 36.2 (Matise et al. 2007).
67
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.4: Ideogram demonstrating congenital nail dysplasia locus at chromosome 10q11.23-q22.1. All linked markers and flanking markers (D10S1724 and D10S1650) are shown in 22.3 Mb linkage interval. Physical region is shown in accordance with sequence based physical map (build 36.2).
68
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.5: Chromatogram of family A. (a) for missense variant (c.92G>T) in an affected individual, (b) for carrier individual and (c) for normal individual.
Fig. 3.6: Comparison of arginine position 31 in the SLC25A16 protein in different species highlighted by an arrow.
69
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
70
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
71
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
72
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.7: Pedigree drawing for three generations family B with autosomal dominant congenital leukonychia. Filled squares and circles denote affected subjects, while the empty squares and circles designate normal individuals. Squares and circles with cross lines denote deceased individuals. The numbers characterized with asterisks designate those persons who donated blood samples for this study.
73
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.8: Clinical characteristics of affected subjects in family B. True leukonychia in affected subjects III-1 and III-3 (a, b). Incomplete leukonychia in affected subject III-2 (c) showing yellow color in the middle toe-nail.
74
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.9: Chromatogram of family B. (a) for normal individual and (b) for missense variant (c.625T>C) in affected individual.
Fig. 3.10: Comparison of cysteine position 209 in PLCD1 protein in different vertebrate species highlighted by an arrow.
75
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.11: The predicted structure of wild-type PLCD1 protein (a). Zoom-up view of interaction pattern of wild type (b) and mutant type protein (c).
76
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.12: Pedigree of family C with autosomal dominant leukonychia. Filled symbols denote affected subjects while clear symbols designate normal persons. The numbers characterized with asterisks specify those siblings who donated blood samples for genetic analysis.
Fig. 3.13: Clinical symptoms of the patients in family C. Affected individuals I-1 (a), II-4 (b) with leukonychia phenotype.
77
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
78
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.14: Pedigree of family D with autosomal recessive isolated congenital nail dysplasia (ICND). Filled squares and circles denote affected subjects, while the empty squares and circles designate normal individuals. Squares and circles with cross lines denote deceased individuals. The numbers characterized with stars designate those siblings who donated blood samples for the present study.
79
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.15: Clinical characteristics of the affected persons in family D. Affected individual IV-2 with thick, hard, shiny and claw-shaped fingernails (a). Patient IV-2 displaying hyponychia, onychauxis and onycholysis in toenails (b). Note thick, hard and hyperplastic fingers and toe nails in affected individual IV-3 (c, d).
80
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.16: Pedigree drawing of four generations family E with autosomal recessive congenital nail dysplasia (ARCND). Filled squares and circles denote affected subjects, while the empty squares and circles designate normal individuals. Squares and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers characterized with stars specify those persons who donated blood samples for this study.
81
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.17: Phenotypes of patients in family E. Affected individual IV-1 (a, b) and IV-2 (c, d) with onychauxis and onycholysis in the nails of fingers and toes.
82
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.18: Haplotype of family D segregating isolated congenital nail dysplasia (ICND) in autosomal recessive manner. For each genotyped subject, haplotypes of the markers linked to chromosome 8q22.3 are presented under each square and circle. Disease interval is bordered by marker D8S559 and D8S267, indicating that all affected persons are homozygous while the parents and only one sibling are heterozygous carriers.
83
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.19: Haplotype of family E transmitting isolated congenital nail dysplasia (ICND) in autosomal recessive manner. For each genotyped subject, haplotypes of microsatellite markers linked to chromosome 8q22.3 are presented under each squire and circle. Disease interval is bordered by marker D8S559 and D8S267, indicating that the patients are homozygous while the mother and a brother is heterozygous carriers.
84
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.20: Chromatogram of family D. (a) for missense variant (c.1750G>T) in affected individual, (b) for heterozygous carrier and (c) for homozygous normal individual.
Fig. 3.21: Comparison of glutamic acid position 584 in FZD6 protein in different vertebrate species highlighted by an arrow.
85
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.22: A short DNA sequence presenting a missense polymorphism (c.1266G>A) in FZD6 gene in family E. The upper row (a) denotes the DNA sequence of FZD6 gene in homozygous affected subject, the central row (b) in heterozygous carrier and lower row (c) in homozygous normal subject.
Fig. 3.23: Comparison of glycine position 422 in FZD6 protein in different vertebrate species indicated by an arrow.
86
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.24: Location of residue Gly422 in the helix region (a). Hydrogen bonding of Ser421 with Ile417 and Trp300. Local conformational change in the nearby residues interactions that results from the substitution of Glycine by Aspartic acid at position 422 (b, c). In case of Glu584* sequence variant, there occur the formation of truncated protein due to the premature stop codon and the loss subdomain is highlighted by magenta color (d).
87
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
88
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.25: Pedigree of Family F, transmitting autosomal recessive congenital nail dysplasia. In pedigree clear squares and circles represent normal males and females while the black squares and circles designate affected male and female respectively. Squares and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers with stars indicate that these samples were available for clinical and genetic analysis.
89
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Fig. 3.26: Phenotypes of the patients in family F. Affected individuals IV-1, IV-5 and V-2 with deformed nail bed and onycholysis (a, b, c and d). Note, the nails of the affected individuals are thick, hard, showing longitudinal over-curvature, ridging and loss of cuticle and curvature.
90
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 3 Hereditary Nail Disorders
Figure. 3.27: Genome-wide homozygosity. The numbers on the X-axis represent chromosome numbers. The red bars on the Y-axis represent significance of the data (most promising homozygous regions on chromosome 1, 3, 5, 6 and 20).
91
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
CHAPTER 4
4.1 ECTODERMAL DYSPLASIA
Ectodermal dysplasias (EDs) constitute an uncommon group of hereditary disorders
described by congenital defects of one or more ectodermal structures notably the skin,
teeth, hair, nail and sweat glands (Itin, 2009). Ectodermal dysplasias also cause changes
in eccrine and apocrine glands, anterior pituitary gland, lenses conjunctiva of eye,
nipples and ear (Itthagarun and King, 1997).
Pure hair and nail ectodermal dysplasia (PHNED) is a congenital genetic disease
affecting both hair and nail and inherits both in autosomal dominant and recessive
manner (Khan et al. 2017; Calzavara-Pinton et al. 1991). The phenotypes of PHNED
includes sparse or complete hair loss and onychodystrophy. The abnormalities of hair
include mild hair loss to the entire absence of scalp hair. Hairs on other body parts may
be sparse or completely absent. The abnormalities of nail include twenty nail dystrophy
and nails may be irregular, fragile and spoon-shape (Barbareschi et al. 1997).
The study presented in this chapter of the dissertation involves the clinical investigation
and genetic analysis of family G harboring pure hair and nail ectodermal dysplasia
phenotypes.
4.1.1 Family G
4.1.1.1 Clinical Features
Family G (Fig. 4.1), a four generations consanguineous family transmitting autosomal
recessive pure hair and nail ectodermal dysplasia is living in district Bannu, Khyber
Pakhtunkhwa province, Pakistan. In the family two females (IV-3, IV-4) and a male
(IV-1) was affected with PHNED. The affected siblings were born to normal first
cousin parents. At the time of collecting blood specimens, ages of the patients ranged
92
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
25-37 years. All patients of the family displayed complete hair loss throughout the
body. The nails of the affected individuals were dystrophic and irregular shaped at the
distal part. They showed distal onycholysis of the digits on hands. The toe-nails were
also dystrophic in affected individuals (Fig. 4.2). The abnormalities of hair and nails
were present by birth. The remaining ectodermal appendages (teeth and sweat glands)
were unaffected. In affected individuals, no abnormality of skeleton was observed and
they were mentally sound.
For genetic analysis, peripheral blood specimens of six individuals including three
patients (IV-1, IV-3, IV-4) and three normal individuals (III-2, IV-2, IV-5) were
taken.
4.1.1.2 Genotyping and Sequencing
For the identification of candidate gene causing PHNED phenotypes in family G,
genotyping was performed via microsatellite markers mapped to the closest genomic
region containing HOXC and keratin clusters. All affected individuals of the family
demonstrate homozygosity with five microsatellite markers (D12S1604, D12S325,
D12S1724, D12S1632, D12S1298) linked to HOXC and Keratin genes sited on
chromosome 12p11.1-q21.1 (Fig. 4.3). Subsequently, three genes (KRT74, KRT85,
HOXC13) were sequenced in the normal and affected siblings of the family. Analysis
of sequence lead to the identification of a novel homozygous variant c.929A>C
(p.Asn310Thr; chr12:54,338,976) in HOXC13 (NM_017410.3) gene. The normal
individuals and mother were heterozygous for the p.Asn310Thr mutation (Fig. 4.4). To
verify that the mutation c.929A>C (chr12:54,338,976) does not indicate a non-
pathogenic variant in this population, a panel of 102 ethnically matched normal
individuals were also screened. However, the variant was not found in any individual
93
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
outside the family. The sequence of KRT74 and KRT85 was normal in affected
members of the family.
4.1.1.3 Protein Modeling
For human HOXC13 protein no crystal structure was available in Protein Data Bank
(PDP). The three dimensional structure of homeobox domain (241-322aa) of human
HOXC13 was constructed using homology modeling techniques. The protein sequence
of Homeobox domain was obtained from NCBI database and imported against Protein
Data Bank. Using PDB structures 2L7Z as a template, homology models of the wild
type proteins were constructed and then the mutant structure was constructed by
changing the selected residue (Zhang et al. 2011). The models were constructed using
Molecular Operating Environment (MOE). A chain of 10 independent model was
constructed via Boltzman weighted randomized procedure joined with specialized logic
for the handling of sequence insertions and deletions (Fechteler, Dengler, and
Schomburg, 1995). Of all models, the model with best MOE packing score was chosen
for further mutational study. The structure was visualized using PYMOL
(http://www.pymol.org) software.
4.1.2 Discussion
This part of the study described clinical and genetic investigations of family G
transmitting PHNED via autosomal recessive pattern. The phenotypes of all affected
individuals include complete hair loss and nail dysplasia. Clinical features of affected
individuals observed in the present family is mostly similar to those reported earlier in
ECTD9 families (Lin et al. 2012; Farooq et al. 2013; Ali et al. 2013). In the family
linkage was established to Keratin and HOXC clusters mapped to chromosome
12p11.1-q21.1. Sanger sequencing of HOXC13 gene revealed a novel pathogenic
94
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
mutation p.Asn310Thr (chr12:54,338,976) in all affected siblings. The mutated
asparagine amino acid at position 310 is extremely conserved in other vertebrate species
(Fig. 4.5). In the wild type HOXC13 protein, asparagine residue at position 310
(Asn310) forms hydrogen bond with adjoining isoleucine (Ile306) but in the mutant
HOXC13 threonine (Thr310) cannot form hydrogen bond with adjoining isoleucine
(Ile306) (Fig. 4.6a-c). Thus, the mutant HOXC13 protein is less stable due to its high
potential energy (−1504.414 kcal/mol) in comparison to the normal HOXC13
(−1505.945 kcal/mol). As a result of this loss of hydrogen bonding, variation in
potential energy, and different surface area can change the function of the protein (Fig.
4.6 d-f).
HOXC13 (NM_017410.3) gene belongs to homoebox gene family and consists of two
exons covering 2.423 kbs genomic region (Pick and Heffer, 2012). HOXC13 encodes a
long protein composed of 330 amino acids. The DNA binding domain of HOXC13 is
composed of 61 amino acids (amino acids 258-318) which is responsible for the
transcriptional regulation of several hair keratin genes. The domain is also responsible
for the transcriptional regulation of FOXN1 gene in hair follicles and nails.
Until now, two missense (Khan et al. 2017; Li et al. 2017), three nonsense (Lin et al.
2012; Ali et al. 2013; Pinson et al. 2000), one duplication (Ali et al. 2013) and two
deletion mutations (Farooq et al. 2013; Lin et al. 2012) have been reported in HOXC13
gene (Table. 4.1). This study further supports the idea that pathogenic mutations in
HOXC13 gene causes ectodermal dysplasia type 9 (ECTD9).
95
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
Fig. 4.1: Pedigree of four generations family G segregating pure hair and nail ectodermal dysplasia (PHNED) in autosomal recessive form. Filled squares and circles denote affected subjects, while the empty squares and circles designate normal individuals. Squares and circles with cross lines denote deceased individuals while double line connection between individuals denotes cousin marriage. The numbers characterized with stars designate those siblings who provided blood samples for this study.
96
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
Figure. 4.2: Phenotypes of the patients in family G. Patient IV-1 showing absence of scalp hair, eyebrows, eyelashes and rest of the body (a)., b and c). Dystrophic, irregular- shaped nails and distal onycholysis in affected member IV-1(b and c), IV-3 (d, e) and IV-4 (f and g).
97
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
Fig. 4.3: Haplotype of family G transmitting autosomal recessive PHNED. For each genotyped sibling, haplotypes of microsatellite markers linked to chromosome 12q13.13 are presented under each squire and circle. Boundaries of the disease interval are flanked by marker D12S96 and D12S298, indicating that all patients are homozygous, while the parents and unaffected siblings are carriers.
98
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
Fig. 4.4: Chromatogram of family G. (a) for missense variant (c.929A>C) in affected individual, (b) for carrier individual and (c) for homozygous normal individual.
Fig. 4.5: Comparison of asparagine position 310 in HOXC13 protein in different vertebrate species. The position of asparagine (Asn310) is indicated by an arrow.
99
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
Fig. 4.6: Demonstration of predicted structure for homeobox domain of human HOXC13 (a). Demonstration of wild and mutant HOXC13 interactions (b and c). Computed surface of the homeobox domain of the human HOXC13 (d). Computed surface of wild and mutant homeobox domain of HOXC13 (e and f).
100
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 4 Ectodermal Dysplasia
101
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
CHAPTER 5
5.1 PRIMARY HYPERTROPHIC OSTEOARTHROPATHY
Primary hypertrophic osteoarthropathy or pachyderoperiostosis (PHO; MIM 167100)
is an infrequent hereditary disorder. It is described by clubbed fingers and toes,
periostosis, acro-osteolysis and soft tissues hypertrophy. The soft tissues of the face and
scalp become hypertrophic that results in thickened skin on the face and scalp (Jajic,
Jajic, and Grazio, 2001). The first report of PHO was given by Friedrich in 1868 in two
brothers that suffers from skeletal hyperostosis (Friedreich, 1868). Pathogenic mutation
in either HPGD or SLCO2A1 can cause PHO. The disease happens in autosomal
dominant or recessive form (Niizeki et al. 2014).
This chapter of the dissertation involves the clinical investigation and genetic analysis
of family H harboring primary hypertrophic osteoarthropathy phenotypes.
5.1.1 Family H
5.1.1.1 Clinical Features
Family H, a five generation Pashtun family, transmitting autosomal recessive primary
hypertrophic osteoarthropathy belongs to Karak district of Khyber Pakhtunkhwa,
province, Pakistan (Fig. 5.1). The family contains four affected persons (II-1, II-4, V-1
and V-2) that were born to healthy parents. At the time of blood collection, the patients
ages ranged 6-55 years. All affected individuals exhibited arthropathy, digital clubbing,
seborrhea, eczema and hyperhidrosis. The two affected male siblings (II-1, II-4)
possessed the phenotype of pachydermia, while the skin of the two affected sisters was
normal. The ankles of the two affected males were large and swollen. A female patient
(V-1) have bulging eyes (Fig. 5.2-5.4 and Table 5.1). In all affected individual hair and
teeth were normal.
102
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
For the study presented here, peripheral blood samples of six family members including
four affected (II-1, II-4, V-1, and V-2) and two normal individuals (III-2, IV-1) were
collected.
5.1.1.2 Genotyping and Sequencing HPGD Gene
In order to find out the disease associated chromosomal region, homozygosity mapping
was executed using DNA samples of the patients and normal individuals.
Homozygosity mapping results in the identification of a 7.05 Mb homozygous block
sited on chromosome 4q34.1-q34.3 in all affected siblings of the family (Fig. 5.5). The
homozygous block is bordered by SNPs rs6851464 and rs13126556. On the basis of
SNP data, linkage to the previously reported locus [HPGD(4q33-q34)] was confirmed
by genotyping highly polymorphic microsatellite markers (D4S1545, D4S1539,
D4S621, D4S3246, D4S2991, D4S2992, D4S2290, D4S2431) in affected and normal
siblings of the family. Subsequent HPGD (NM_000860.6) sequencing revealed a
homozygous mutation c.577T>C (chr4: 175, 414, 387) in all affected members of the
family which results in the replacement of serine residue by proline amino acid
(p.Ser193Pro) of the HPGD protein. Carrier subjects of the pedigree were heterozygous
for the p.Ser193Pro mutation (Fig. 5.6). To exclude the chances that the variant
(c.577T>C) denotes a non-pathogenic polymorphism, a panel of one hundred ethically
matched normal individuals were tested and the variant was not found outside this
family.
The amino acid Serine at position 193 is placed in the alpha helix of the wild protein.
The hydroxyl oxygen side chain of the serine residues form hydrogen bond with the
adjacent Asn95 residue. When proline residue substitutes at position 193, it does not
form hydrogen bond with the adjoining Asn95. Structural analysis revealed that the
103
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
altered protein (Pro193) contains the nonpolar residue (helix breaker), that cannot
accommodate in the alpha helix of the human HPGD protein. As a result of this loss of
interactions and dissimilar chemical composition of amino acid residues, a minor local
disconcertion of the helix conformation was observed in the mutant HPGD protein (Fig.
5.8).
5.1.1.3 Protein Modeling
For the homology modeling of the human HPGD Protein, the X-ray structure of the
human 15-PGDH protein (PDB id :2GDZ) was obtained from Protein Data Bank.
Initially the structure was energy minimized with the help of Molecular Operating
Environment (MOE), (http://www.chemcomp.com/MOE_Molecular
Operating_Envornment.htm/). The mutant structure for Ser193Pro was constructed by
altering the particular amino acid into a desired one, and was then refined with the help
of the same energy minimization protocol that was used for the wild protein. The
refined structures were selected for studying the effect of Ser193Pro variant on the
structure of protein.
5.1.2 Discussion
This section of the thesis consists clinical and genetic analysis of family H showing
autosomal recessive primary hypertrophic osteoarthropathy (PHO) phenotypes.
Clinical manifestations of the patients were similar to as reported earlier in literature
like arthropathy, digital clubbing and hyperhidrosis. One affected female displayed the
trait of bulging eyes.
On the basis of SNP data, linkage was established to the formerly described locus
[HPGD 4q34.1-q34.3) in all affected persons of the pedigree. Consequently, the HPGD
gene sequencing revealed a single homozygous T to C transition (c.577T>C) in all
104
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
affected males and females. Due to this pathogenic change, a hydroxylic uncharged
polar serine amino acid was replaced by nonpolar proline residue at position 193
p.S193P (chr4: 175,414,387) in the human HPGD protein. The hydroxylic serine
residue at position 193 is conserved in other vertebrates (Fig. 5.7).
In our knowledge this is the first family of Pakistani origin showing the phenotypes of
pachydermoperiostosis caused by a pathological variant p.S193P (chr4: 175,414,387)
in HPGD gene. The variant was formerly reported in another Pakistani family showing
isolated congenital nail clubbing (ICNC) but in this family the phenotypes of
arthropathy, pachydermia, and hyperhidrosis were absent, contrasting with our findings
(Tariq et al. 2009). Pathogenic mutations in HPGD (NM_000860.6) can cause two
different genetic entities including PHO and ICNC. Unexpectedly, the variant identified
in the present study causes PHO and not ICNC as reported in the previous study (Balc
et al. 2002). The probable clarification is incomplete penetrance of the variant in the
family described earlier (Balc et al. 2002).
The HPGD gene comprises 7 exons and covers 31 kb genomic segment at chromosome
4q34.1. It encodes a helical polypeptide comprises 266 amino acids. The protein is a
component of the short-chain non-metallo enzyme family of dehydrogenases. The
human HPGD protein serves as a dimeric enzyme that catabolizes different substrates
including prostaglandins, hydroxyl fatty acids and lipoxins (Tai et al. 2002).
The missense mutation reported in the present study situated in the 11th helix of the 15-
PGDH protein. It has been reported earlier that serine at position 193 is a part of a
complex of hydrogen bonds and coats the hydrophobic reaction activity of HPGD
protein (Uppal et al. 2008). Normally, when proline residue enters within an 훼 helix, it
affects the constancy of the helix by creating a slight twist caused by the absence of a
105
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
hydrogen bond; subsequently, the mutation p.Ser193Pro interferes the configuration of
HPGD at position the helix number 11. Eventually, this will cause the loss of function
of the 15-PGDH enzyme.
Until now, six point mutations (Uppal et al. 2008; Tariq et al. 2009; Bergman et al.
2011; Yuan et al. 2015; Khan et al. 2018; Yüksel-Konuk), two deletions (Uppal et al.
2008; Erken et al. 2015; Tüysüz et al. 2014; Liu et al. 2017), two splicing mutations
(Sinibaldi et al. 2010; Diggle et al. 2010), and a single insertion deletion (indel) (Uppal
et al. 2008) have been reported in HPGD gene causing PHO in different ethnic groups
(Table. 5.2).
106
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Fig. 5.1: Pedigree of family H transmitting autosomal recessive primary hypertrophic osteoarthropathy (PHO). Black symbols represent affected individuals. Squares and circles with stars designate individuals who donated blood samples for molecular study.
107
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Fig. 5.2: Radiograph of the affected sibling (II-4) of family H displaying expansion of soft tissues round the tip of fingers, acro-osteolysis and sub-periostal new bone formation in the hands.
108
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Fig. 5.3: Clinical symptoms of the patients of family H. Patients II-1 and II-4 displaying digital clubbing (a) and large ankles and arthropathy (b), respectively. Affected individual (V-1) showing dry, scaly and thickened skin (c). Affected individual (II-1) showing digital clubbing and pachydermia (d and e).
109
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Fig. 5.4: Affected member (V-1) of family H showing the phenotype of bulging eyes.
Fig. 5.5: Genome-wide homozygosity. The screenshots indicate genome-wide homozygosity scores created by HomozygosityMapper. The numbers on the X-axis represent chromosome numbers. The red bars on the Y-axis represent significance of the data (most promising homozygous region on chromosome 4).
110
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Fig. 5.6: Chromatogram of family H. (a) for missense mutation (c.577T>C) in affected individual, (b) for heterozygous carrier individual and (c) for homozygous normal individual.
Fig. 5.7: Comparison of a short protein sequence of human HPGD across different vertebrate species. The missense variant (p.Ser193Pro) affecting the conserved serine amino acid in human HPGD is specified by an arrow.
111
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Fig. 5.8: Demonstration of crystal structure for human 15-PGDH protein (a). Pattern of interaction of wild and mutant HPGD protein (b and c).
112
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
Table. 5.1: Review of clinical characteristics of the affected members of family H
113
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 5 Primary Hypertrophic Osteoarthropathy
114
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Conclusion & Recommendations
CONCLUSION AND RECOMMENDATIONS
In Pakistan, Afghanistan and some countries of Middle East, cousin marriages have been a common and ancient practice. Although, the rate of cousin marriage has been reduced in urban areas but in rural areas it is still a favored practice. This high level of consanguinity favors increase coefficient of inbreeding, which in turn increases the possibility of occurrence of disease-causing allele in homozygous condition (Bittles and Black, 2010). In Pakistani population, high coefficient of inbreeding has resulted in communities displaying different uncommon genetic disorders. This high incidence of cousin marriage has proved homozygosity mapping as most prevailing means of gene discovery in the recent history of human genetics.
In human, genetic nail disorders constitute an uncommon and heterogeneous group of genodermatoses. In contrast to other skin appendages, knowledge about nail development is sparse. The reason for this may be the fact that nail developmental abnormalities are rare and hence less studied. In the study presented in this dissertation, eight families of nail disorders were obtained from diverse areas of Pakistan. Of the total families, family A-F were segregating isolated nail dysplasia while family G and
H were segregating syndromic nail disorders. Only family B was inherited in autosomal dominant pattern while all the remaining families were segregated in autosomal recessive mode of inheritance.
Family A, clinically manifesting isolated finger nail dysplasia was mapped to a novel locus on chromosome 10q21.3. Exome sequencing of the family revealed a novel pathological variant in SLC25A16 gene. Family B and C both were displaying leukonychia phenotype. As PLCD1 located on chromosome 3p22.2 is the only known causative gene for leukonychia phenotype, therefore the same gene was sequenced in
115
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Conclusion & Recommendations both families. In family B sequence analysis identified a recurrent missense mutation but in family C no mutation was found in PLCD1 gene. In order to identify a novel locus/gene in the family, the DNA samples has been submitted to whole exome sequencing.
In families D and E, the affected individuals had claw-shaped nails in fingers and toes.
Both families were mapped to FZD6 gene located on chromosome 8q22.3. Subsequent sequencing of FZD6 gene revealed two recurrent homozygous mutations. In family F, linkage was tested to the known genes causing hereditary nail dysplasia but the family was not linked to any known locus. To identify a novel chromosomal location/gene in family F, the DNA samples of affected individuals were submitted to SNP microarray genotyping. Whole-genome SNP array identified four homozygous regions on chromosome 1, 3, 5 and 6 respectively. For the identification of causative gene in the linked regions the DNA samples of the affected subjects of this pedigree has been submitted to targeted whole exome sequencing. Family G, clinically manifesting pure hair and nail ectodermal dysplasia phenotype was linked to HOXC13 gene on chromosome 12q13.13. Sequencing of HOXC13 gene leads the identification of a new homozygous missense variant in all available affected persons of the pedigree. Family
H was segregating primary hypertrophic osteoarthropathy and was linked to HPGD gene on chromosome 4q34.1. Subsequent Sanger sequencing of HPGD results in the identification of a novel pathological variant in all affected subjects of family G.
The aim of the thesis presented here is to ascertain genes causing nail disorders and to identify sequence variants in genes leading to phenotypic diversity. The knowledge gained from the work presented here, will help to study gene function and learn more about the molecular bases of inherited nail disorders. This study will contribute to
116
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Conclusion & Recommendations improve diagnostics, risk assessment and therapeutic strategies. The results of this work may also prove helpful for the genetic counseling of carrier families and will help the
Pakistani population to reduce the number of affected births with congenital nail dysplasia.
In Pakistani population the high rate of consanguinity (60-70%) is linked to many recessive genetic disorders. To reduce the rate of affected births genetic counselling and carrier screening of the families at risk should be conducted. Primary health care workers need to acquire the necessary skills in first level counselling to provide premarital counselling. Epidemiological surveys on the frequency of genetic disorders and their impact on human population should be conducted. In addition, medical and nursing curricula linked to the practice of human genetics should be updated.
117
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
CHAPTER 6
REFERENCES
Abecasis, Gonçalo R., Stacey S. Cherny, William O. Cookson, and Lon R. Cardon.
“Merlin-rapid analysis of dense genetic maps using sparse gene flow
trees.” Nature genetics 30, no. 1 (2001): 97-101.
Adaimy, Lynn, Eliane Chouery, Hala Mégarbané, Salman Mroueh, Valérie Delague,
Elsa Nicolas, Hanen Belguith, Philippe de Mazancourt, and André Mégarbané.
“Mutation in WNT10A is associated with an autosomal recessive ectodermal
dysplasia: the odonto-onycho-dermal dysplasia.” The American journal of human
genetics 81, no. 4 (2007): 821-828.
Ahlgren, S. A., T. Elmros, I. Mamoun, F. Miltellman, and S. said. “Congenital hip
dislocation and onychodystrophy in a family.” Saudi medical journal 9, no. 2
(1988): 165-168.
Akram, D. S., Fehmina Arif, and Jabeen Fayyaz. "How frequent are consanguineous
marriages." J Dow University Health Sci 2, no. 2 (2008): 76-9.
Ali, R. H., R. Habib, N. Ud‐Din, M. N. Khan, M. Ansar, and W. Ahmad. “Novel
mutations in the gene HOXC13 underlying pure hair and nail ectodermal dysplasia
in consanguineous families.” British journal of dermatology 169, no. 2 (2013):
478-480.
Alkiewicz, J. "Trachyonychie." Ann Dermatol Syphiligr 10 (1950): 136-140.
Alves, Ana Paula Ximenes, Joana Gurgel Holanda Filha, and Fabiane Trindade
Jerônimo. “Eyelid ptosis associated with pachydermoperiostosis: case
report.” Arquivos brasileiros de oftalmologia 68, no. 3 (2005): 401-404.
118
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Angers, Stephane, and Randall T. Moon. “Proximal events in Wnt signal
transduction.” Nature reviews molecular cell biology 10, no. 7 (2009): 468.
ÄNggård, Erik, Carin Larsson, and Bengt Samuelsson. “The distribution of 15‐
Hydroxy prostaglandin dehydrogenase and prostaglandin‐13‐reductase in tissues
of the swine.” Acta physiologicasScandinavica 81, no. 3 (1971): 396-404.
Auricchio, Luigi, Marsilio Adriani, Jorge Frank, Rosanna Busiello, Angela Christiano,
and Claudio Pignata. “Nail dystrophy associated with a heterozygous mutation of
the nude/SCID human FOXN1 (WHN) gene.” Archives of dermatology 141, no. 5
(2005): 647-648.
Baden, Howard P. “The physical properties of nail.” Journal of investigative
dermatology 55, no. 2 (1970): 115-122.
Bal, E., L. Baala, C. Cluzeau, F. El Kerch, K. Ouldim, S. Hadj‐Rabia, C. Bodemer et
al. “Autosomal dominant anhidrotic ectodermal dysplasias at the EDARADD
locus.” Human mutation 28, no. 7 (2007): 703-709.
Balc, Sevim, Güler Kanra, Ebru Aypar, and Yesim Aydn Son. “Twenty-nail dystrophy
in a mother and her 7-year-old daughter associated with balanced translocation 46,
XX, t (6q13; 10p13).” Clinical dysmorphology 11, no. 3 (2002): 171-173.
Baran, Robert, and Paul KECHIJIAN. “Understanding nail disorders.” European
journal of dermatology 11, no. 2 (2001): 159-62.
Baran, Robert, Ivan Bristow, Rodney PR Dawber, Ekart Haneke, and Antonella Tosti,
eds. A text atlas of nail disorders: techniques in investigation and diagnosis.
CRC Press, 2003.
Baran, Robert. “Twenty-nail dystrophy of alopecia areata.” Archives of
dermatology 117, no. 1 (1981): 1-1.
119
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Barbareschi, M., S. Cambiaghi, A. C. Crupi, and G. Tadini. “Family with “pure” hair‐
nail ectodermal dysplasia.” American journal of medical genetics 72, no. 1 (1997):
91-93.
Barthélemy, Nicolas R., Audrey Bednarczyk, Christine Schaeffer-Reiss, Dominique
Jullien, Alain Van Dorsselaer, and Nükhet Cavusoglu. “Proteomic tools for the
investigation of human hair structural proteins and evidence of weakness sites on
hair keratin coil segments.” Analytical biochemistry 421, no. 1 (2012): 43-55.
Bazex, J., R. Baran, F. Monbrun, N. GRIGORIEFF‐LARRUE, and M. C. Marguery.
“Hereditary distal onycholysis-a case report.” Clinical and experimental
dermatology 15, no. 2 (1990): 146-148.
Bazzi, Hisham, Shadmehr Demehri, Christopher S. Potter, Alison G. Barber, Alexander
Awgulewitsch, Raphael Kopan, and Angela M. Christiano. “Desmoglein 4 is
regulated by transcription factors implicated in hair shaft differentiation.”
Differentiation 78, no. 5 (2009): 292-300.
Beals, Rodney K., and Arthur L. Eckhardt. “Hereditary onycho-osteodysplasia (nail-
patella syndrome): a report of nine kindreds.” JBJS 51, no. 3 (1969): 505-516.
Bergmann, C., J. Senderek, D. Anhuf, C. T. Thiel, A. B. Ekici, P. Poblete-Gutierrez,
M. Van Steensel et al. “Mutations in the gene encoding the Wnt-signaling
component R-spondin 4 (RSPO4) cause autosomal recessive anonychia.” The
American journal of human genetics 79, no. 6 (2006): 1105-1109.
Bergmann, Carsten, Marion Wobser, Henner Morbach, Albrecht Falkenbach, Dietrich
Wittenhagen, Lisa Lassay, Hagen Ott, Klaus Zerres, Herman J. Girschick, and
Henning Hamm. “Primary hypertrophic osteoarthropathy with digital clubbing and
120
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
palmoplantar hyperhidrosis caused by 15‐PGHD/HPGD loss‐of‐function
mutations.” Experimental dermatology 20, no. 6 (2011): 531-533.
Bergqvist, C., P. Ramia, O. Abbas, and M. Kurban. “Genetics of syndromic and non‐
syndromic hereditary nail disorders.” Clinical genetics 91, no. 6 (2017): 813-823.
Bianchi, L., C. Lubrano, A. M. Carrozzo, S. Iraci, M. Tomassoli, G. Spera, and G. Nini.
“Pachydermoperiostosis: study of epidermal growth factor and steroid
receptors.” British journal of dermatology 132, no. 1 (1995): 128-133.
Bier, F. F., E. Ehrentreich-Förster, E. Reiss, J. Henkel, R. Strehlow, and D. Andresen.
“DNA microarrays.” Advances in biochemical engineering/biotechnology 109
(2008): 433-453.
Bittles, Alan H., and M. L. Black. “Consanguinity, human evolution, and complex
diseases.” Proceedings of the national academy of sciences 107, no. suppl 1
(2010): 1779-1786.
Blaydon, Diana C., Yoshiyuki Ishii, Edel A. O'Toole, Harriet C. Unsworth, Muy-Teck
Teh, Franz Rüschendorf, Claire Sinclair et al. “The gene encoding R-spondin 4
(RSPO4), a secreted protein implicated in Wnt signaling, is mutated in inherited
anonychia.” Nature genetics 38, no. 11 (2006): 1245.
Bleyen, Isabel, Valerie A. White, and Peter J. Dolman. “Floppy eyelid syndrome and
ptosis in a patient with pachydermoperiostosis.” Ophthalmic plastic &
reconstructive surgery 26, no. 4 (2010): 293-295.
Bongers, Ernie M., Marie-Claire Gubler, and Nine V. Knoers. “Nail-patella syndrome.
Overview on clinical and molecular findings.” Pediatric nephrology 17, no. 9
(2002): 703-712.
121
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Bongers, Ernie MHF, Frans T. Huysmans, Elena Levtchenko, Jacky W. de Rooy, Johan
G. Blickman, Ronald JC Admiraal, Patrick LM Huygen et al. “Genotype–
phenotype studies in nail-patella syndrome show that LMX1B mutation location is
involved in the risk of developing nephropathy.” European journal of human
genetics 13, no. 8 (2005): 935.
Bosch, Daniëlle GM, F. Nienke Boonstra, Nicole de Leeuw, Rolph Pfundt, Willy M.
Nillesen, Joep de Ligt, Christian Gilissen et al. "Novel genetic causes for cerebral
visual impairment." European Journal of Human Genetics 24, no. 5 (2016): 660-
665.
Brüchle, Nadina Ortiz, Jorge Frank, Valeska Frank, Jan Senderek, Ahmet Akar, Erol
Koc, Dimitris Rigopoulos, Maurice Van Steensel, Klaus Zerres, and Carsten
Bergmann. “RSPO4 is the major gene in autosomal-recessive anonychia and
mutations cluster in the furin-like cysteine-rich domains of the Wnt signaling
ligand R-spondin 4.” Journal of investigative dermatology 128, no. 4 (2008): 791-
796.
Bumpers, Randy Darrel, and Marvin Edwin Bishop. “Familial koilonychia: a current
case history.” Archives of dermatology116, no. 7 (1980): 845-845.
Cadigan, Ken M., and Roel Nusse. “Wnt signaling: a common theme in animal
development.” Genes & development 11, no. 24 (1997): 3286-3305.
Cai, Jing, and Liang Ma. “Msx2 and Foxn1 regulate nail homeostasis.” genesis 49, no.
6 (2011): 449-459.
Cai, Jing, Jonghyeob Lee, Raphael Kopan, and Liang Ma. “Genetic interplays between
Msx2 and Foxn1 are required for Notch1 expression and hair shaft differentiation.”
Developmental biology 326, no. 2 (2009): 420-430.
122
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Callewaert, B. L., Andy Willaert, W. S. Kerstjens‐Frederikse, Julie De Backer,
Koenraad Devriendt, B. Albrecht, M. A. Ramos‐Arroyo et al. “Arterial tortuosity
syndrome: clinical and molecular findings in 12 newly identified
families.” Human mutation 29, no. 1 (2008): 150-158.
Calzavara-Pinton, P., A. Carlino, A. Benetti, and G. De Panfilis. “Pili torti and
onychodysplasia.” Dermatology 182, no. 3 (1991): 184-187.
Chang, Tao-Hsin, Fu-Lien Hsieh, Matthias Zebisch, Karl Harlos, Jonathan Elegheert,
and E. Yvonne Jones. “Structure and functional properties of Norrin mimic Wnt
for signalling with Frizzled4, Lrp5/6, and proteoglycan.” Elife 4 (2015): e06554.
Charteris, Frank. “Case of partial hereditary anonychia.” Glasgow medical journal 89,
no. 4 (1918): 207-209.
Chen, Haixu, Yi Lun, Dmitry Ovchinnikov, Hiroki Kokubo, Kerby C. Oberg, Carmen
V. Pepicelli, Lin Can, Brendan Lee, and Randy L. Johnson. “Limb and kidney
defects in Lmx1b mutant mice suggest an involvement of LMX1B in human nail
patella syndrome.” Nature genetics 19, no. 1 (1998): 51.
Chen, X., C. C. Zou, G. P. Dong, L. Liang, and Z. Y. Zhao. “Cranio-osteoarthropathy:
a rare variant of hypertrophic osteoarthropathy.” Irish journal of medical
science 181, no. 2 (2012): 257-261.
Chitty, L. S., N. Dennis, and M. Baraitser. “Hidrotic ectodermal dysplasia of hair, teeth,
and nails: case reports and review.” Journal of medical genetics 33, no. 8 (1996):
707-710.
Clevers, Hans. “Wnt/β-catenin signaling in development and disease.” Cell 127, no. 3
(2006): 469-480.
123
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Cogulu, Ozgur, Huseyin Onay, Ayca Aykut, Neil J. Wilson, Frances JD Smith, Tugrul
Dereli, and Ferda Ozkinay. “Pachyonychia congenita type 2, N92S mutation of
keratin 17 gene: clinical features, mutation analysis and pathological
view.” European journal of pediatrics 168, no. 10 (2009): 1269-1272.
Cottingham Jr, Robert W., Ramana M. Idury, and Alejandro A. Schäffer. “Faster
sequential genetic linkage computations.” American journal of human genetics 53,
no. 1 (1993): 252-263.
Cruciat, Cristina-Maria, and Christof Niehrs. “Secreted and transmembrane wnt
inhibitors and activators.” Cold Spring Harbor perspectives in biology 5, no. 3
(2013): a015081.
Cui, Chang-Yi, Joakim Klar, Patrik Georgii-Heming, Anne-Sophie Fröjmark, Shahid
M. Baig, David Schlessinger, and Niklas Dahl. “Frizzled6 deficiency disrupts the
differentiation process of nail development.” Journal of investigative
dermatology 133, no. 8 (2013): 1990-1997.
Dai, Jin‐Xia, Randy L. Johnson, and Yu‐Qiang Ding. “Manifold functions of the Nail‐
Patella syndrome gene Lmx1b in vertebrate development.” Development, growth
& differentiation 51, no. 3 (2009): 241-250.
Dawber, R. P. R., D. A. R. de Berker, and R. Baran. “CHAPTER Science of the nail
apparatus.” Baran and Dawber's Diseases of the Nails and their
Management (2001): 1.
De Berker, D. A. R., Josette André, and Robert Baran. “Nail biology and nail science.”
International journal of cosmetic science 29, no. 4 (2007): 241-275.
De Berker, D., and B. Forslind. “The structure and properties of nails and periungual
tissues.” Basic and clinical dermatology 26 (2004): 409-464.
124
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
DE BERKKR, D., B. Mawhinney, and L. Sviland. “Quantification of regional matrix
nail production.” British journal of dermatology 134, no. 6 (1996): 1083-1086.
De Lau, Wim, Nick Barker, Teck Y. Low, Bon-Kyoung Koo, Vivian SW Li, Hans
Teunissen, Pekka Kujala et al. “Lgr5 homologues associate with Wnt receptors
and mediate R-spondin signalling.” Nature 476, no. 7360 (2011): 293.
Dias, João AC Madruga, Rita S. Rosa, Inês Perpétuo, Ana M. Rodrigues, André Janeiro,
Maria M. Costa, Luís Gaião, José A. Pereira da Silva, João E. Fonseca, and Gabriel
Miltenberger-Miltenyi. “Pachydermoperiostosis in an African patient caused by a
Chinese/Japanese SLCO2A1 mutation-case report and review of literature.”
In seminars in arthritis and rheumatism, vol. 43, no. 4, pp. 566-569. WB Saunders,
2014.
Diggle, Christine P., Ian M. Carr, Emanuel Zitt, Katie Wusik, Robert J. Hopkin, Carlos
E. Prada, Olga Calabrese et al. “Common and recurrent HPGD mutations in
Caucasian individuals with primary hypertrophic
osteoarthropathy.” Rheumatology 49, no. 6 (2010): 1056-1062.
Edward Jr, J. Zabawski, and Jack B. Cohen. “Hereditary hypodontia and onychorrhexis
of the fingernails and toenail koilonychia: Witkop's tooth-and nail
syndrome.” Dermatology online journal 5, no. 1 (1999).
Eliason, Mark J., Sancy A. Leachman, Bing-jian Feng, Mary E. Schwartz, and C. David
Hansen. “A review of the clinical phenotype of 254 patients with genetically
confirmed pachyonychia congenita. Journal of the American academy of
dermatology 67, no. 4 (2012): 680-686.
125
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Ensor, Charles Mark, and Hsin-Hsiung Tai. “15-Hydroxyprostaglandin
dehydrogenase.” Journal of lipid mediators and cell signalling 12, no. 2-3 (1995):
313-319.
Erken, Eren, Çiğdem Köroğlu, Fatih Yıldız, Hüseyin TE Özer, Bozkurt Gülek, and
Aslıhan Tolun. “A novel recessive 15-hydroxyprostaglandin dehydrogenase
mutation in a family with primary hypertrophic osteoarthropathy.” Modern
rheumatology 25, no. 2 (2015): 315-321.
Farley, Frances A., Paul R. Lichter, Catherine A. Downs, Iain McIntosh, Douglas
Vollrath, and Julia E. Richards. “An orthopedic scoring system for Nail–Patella
syndrome and application to kindred with variable expressivity and
glaucoma.” Journal of pediatric orthopaedics 19, no. 5 (1999): 624.
Farooq, M., M. Kurban, O. Abbas, O. Obeidat, H. Fujikawa, A‐G. Kibbi, A. Fujimoto,
and Y. Shimomura. “A novel mutation in the PLCD1 gene, which leads to an
aberrant splicing event, underlies autosomal recessive leukonychia.” British
journal of dermatology 167, no. 4 (2012): 946-949.
Farooq, Muhammad, Mazen Kurban, Atsushi Fujimoto, Hiroki Fujikawa, Ossama
Abbas, Georges Nemer, Jessica Saliba et al. “A homozygous frameshift mutation
in the HOXC13 gene underlies pure hair and nail ectodermal dysplasia in a Syrian
family.” Human mutation 34, no. 4 (2013): 578-581.
Fechteler, Till, Uwe Dengler, and Dietmar Schomburg. “Prediction of protein three-
dimensional structures in insertion and deletion regions: a procedure for searching
data bases of representative protein fragments using geometric scoring
criteria.” Journal of molecular biology 253, no. 1 (1995): 114-131.
126
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Feenstra, Jennifer M., Kohei Kanaya, Charmaine U. Pira, Sarah E. Hoffman, Richard
J. Eppey, and Kerby C. Oberg. “Detection of genes regulated by Lmx1b during
limb dorsalization.” Development, growth & differentiation 54, no. 4 (2012): 451-
462.
Fleckman, Philip, Karin Jaeger, Kathleen A. Silva, and John P. Sundberg.
“Comparative anatomy of mouse and human nail units.” The anatomical
record 296, no. 3 (2013): 521-532.
Friedreich, N. “Hyperostose des gesammten skelettes.” Archiv für pathologische
Anatomie und Physiologie und für klinische Medicin 43, no. 1 (1868): 83-87.
Fröjmark, Anne-Sophie, Jens Schuster, Maria Sobol, Miriam Entesarian, Michaela BC
Kilander, Dana Gabrikova, Sadia Nawaz et al. “Mutations in Frizzled 6 cause
isolated autosomal-recessive nail dysplasia.” The American journal of human
genetics 88, no. 6 (2011): 852-860.
Gebhardt, M., T. Fischer, U. Claussen, U. Wollina, and P. Elsner. “Monilethrix-
improvement by hormonal influences?” Pediatric dermatology 16, no. 4 (1999):
297-300.
Génin, Emmanuelle, and Alexandre A. Todorov. "Homozygosity Mapping." e
LS (2001).
Ghoumid, Jamal, Florence Petit, Muriel Holder-Espinasse, Anne-Sophie Jourdain, José
Guerra, Anne Dieux-Coeslier, Martin Figeac, Nicole Porchet, Sylvie Manouvrier-
Hanu, and Fabienne Escande. “Nail–Patella Syndrome: clinical and molecular data
in 55 families raising the hypothesis of a genetic heterogeneity.” European journal
of human genetics 24, no. 1 (2016): 44.
127
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Giansanti, Joseph S., Stewart M. Long, and Joseph L. Rankin. “The “tooth and nail”
type of autosomal dominant ectodermal dysplasia.” Oral surgery, oral medicine,
oral pathology 37, no. 4 (1974): 576-582.
Grace, T. W. “A 38-year-old man with painful, dependent ankle edema and clubbing.
Hypertrophic osteoarthropathy syndrome.” Western journal of medicine 153, no.
5 (1990): 551.
Grossman, Melanie, and Richard K. Scher. “Leukonychia: review and
classification.” International journal of dermatology29, no. 8 (1990): 535-541.
Gu, Li-Hong, and Pierre A. Coulombe. “Keratin function in skin epithelia: a broadening
palette with surprising shades.” Current opinion in cell biology 19, no. 1 (2007):
13-23.
Gudbjartsson, Daniel F., Thorvaldur Thorvaldsson, Augustine Kong, Gunnar
Gunnarsson, and Anna Ingolfsdottir. "Allegro version 2." Nature genetics 37, no.
10 (2005): 1015.
Guerini, Marina Besen, Mariana Tremel Barbato, Naiana Bittencourt de Sá, Daniel
Holthausen Nunes, and Paulo Roberto Zeni. “Pachydermoperiostosis: the
complete form of the syndrome.” Anais brasileiros de dermatologia 86, no. 3
(2011): 582-584.
Guidera, Kenneth J., Yvonne Satterwhite, John A. Ogden, Linda Pugh, and Tim Ganey.
“Nail patella syndrome: a review of 44 orthopaedic patients.” Journal of pediatric
orthopedics 11, no. 6 (1991): 737-742.
Gupchup, Gouri V., and Joel L. Zatz. “Structural characteristics and permeability
properties of the human nail: A review.” Journal of cosmetic science 50, no. 6
(1999): 363-386.
128
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Haber, Jessica S., Manasmon Chairatchaneeboon, and Adam I. Rubin. “Trachyonychia:
review and update on clinical aspects, histology, and therapy.” Skin appendage
disorders 2, no. 3-4 (2016): 109-115.
Hamm, Henning, Susanne Karl, and Eva-bettina Bröcker. “Isolated congenital nail
dysplasia: a new autosomal dominant condition.” Archives of dermatology 136,
no. 10 (2000): 1239-1243.
Hammami-Hauasli, Nadja, Michael Raghunath, Leena Bruckner-Tuderman, and
Wolfgang Küster. “Transient bullous dermolysis of the newborn associated with
compound heterozygosity for recessive and dominant COL7A1
mutations.” Journal of investigative dermatology 111, no. 6 (1998): 1214-1219.
Hamamy, Hanan. "Consanguineous marriages." Journal of community genetics 3, no.
3 (2012): 185-192.
Haneke, Eckart. “Anatomy of the nail unit and the nail biopsy.” ,34, 2 34, no. (2015):
95-100.
Haneke, Eckart. “Surgical anatomy of the nail apparatus.” Dermatologic clinics 24,
no. 3 (2006): 291-296.
Harrison, Shannon, and Rodney Sinclair. “Hypotrichosis and nail dysplasia: a novel
hidrotic ectodermal dysplasia.” Australasian journal of dermatology 45, no. 2
(2004): 103-105.
Hazelrigg, Donald E., W. Christopher Duncan, and Michael Jarratt. “Twenty-nail
dystrophy of childhood.” Archives of dermatology 113, no. 1 (1977): 73-75.
Hellier, F. F. “Hereditary koilonychia.” British journal of dermatology 62, no. 5
(1950): 213-215.
129
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Hoischen, Alexander, Bregje WM van Bon, Christian Gilissen, Peer Arts, Bart van Lier,
Marloes Steehouwer, Petra de Vries et al. “De novo mutations of SETBP1 cause
Schinzel-Giedion syndrome.” Nature genetics 42, no. 6 (2010): 483-485.
Horsfall Jr, Frank L. “Congenital familial clubbing of the fingers and toes.” Canadian
medical association journal 34, no. 2 (1936): 145.
Huang, Changzheng, Qinbo Yang, Tie Ke, Haisheng Wang, Xu Wang, Jiqun Shen, Xin
Tu et al. “A novel de novo frame-shift mutation of the EDA gene in a Chinese Han
family with hypohidrotic ectodermal dysplasia.” Journal of human genetics 51,
no. 12 (2006): 1133-1137.
Hudson, Carolyn D., and Carl J. Witkop Jr. “Autosomal dominant hypodontia with nail
dysgenesis: Report of twenty-nine cases in six families.” Oral surgery, oral
medicine, oral pathology 39, no. 3 (1975): 409-423.
Hunter, John C., John Savin, and Mark Dahl. Clinical dermatology. Malden, Mass:
Blackwell Science, 2002.
Hussain, Rafat, and Alan H. Bittles. "The prevalence and demographic characteristics
of consanguineous marriages in Pakistan." Journal of biosocial science 30, no. 2
(1998): 261-275.
Irvine, A. D., and W. H. I. McLean. “Human keratin diseases: the increasing spectrum
of disease and subtlety of the phenotype–genotype correlation.” British journal of
dermatology 140, no. 5 (1999): 815-828.
Ishii, Yoshiyuki, Muhammad Wajid, Hisham Bazzi, Katherine A. Fantauzzo, Alison G.
Barber, Diana C. Blaydon, Ju-Suk Nam, Jeong K. Yoon, David Peter Kelsell, and
Angela M. Christiano. “Mutations in R-spondin 4 (RSPO4) underlie inherited
anonychia.” Journal of investigative dermatology 128, no. 4 (2008): 867-870.
130
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Itin, Peter H. “Rationale and background as basis for a new classification of the
ectodermal dysplasias.” American journal of medical genetics part A 149, no. 9
(2009): 1973-1976.
Itin, Peter H., and Susanna K. Fistarol. “Ectodermal dysplasias.” In American journal
of medical genetics part C: Seminars in medical genetics, vol. 131, no. 1, pp. 45-
51. Hoboken: Wiley Subscription Services, Inc., A Wiley Company, 2004.
Itthagarun, Anut, and Nigel M. King. “Ectodermal dysplasia: A review and case
report.” Quintessence international 28, no. 9 (1997).
Jacobsen, Audrey A., and Antonella Tosti. “Trachyonychia and twenty-nail dystrophy:
a comprehensive review and discussion of diagnostic accuracy.” Skin appendage
disorders 2, no. 1-2 (2016): 7-13.
Jajic, I., Z. Jajic, and Simeon Grazio. "Minor but important symptoms and signs in
primary hypertrophic osteoarthropathy." Clinical and experimental
rheumatology 19, no. 3 (2001): 357-358.
Jave-Suarez, Luis Felipe, Hermelita Winter, Lutz Langbein, Michael A. Rogers, and
Jürgen Schweizer. “HOXC13 is involved in the regulation of human hair keratin
gene expression.” Journal of biological chemistry 277, no. 5 (2002): 3718-3726.
Jones, Gavin W. "Changing Marriage Patterns in Asia." (2010).
Jumlongras, Dolrudee, Marianna Bei, Jean M. Stimson, Wen-Fang Wang, Steven R.
DePalma, Christine E. Seidman, Ute Felbor, Richard Maas, Jonathan G. Seidman,
and Bjorn R. Olsen. “A nonsense mutation in MSX1 causes Witkop syndrome.”
The American journal of human genetics 69, no. 1 (2001): 67-74.
131
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Karakayali, Güliz, Nurdan Lenk, Emel Güngör, Güneş Gür, and Nuran Alli. “Twenty‐
nail dystrophy in monozygotic twins.” Journal of the European academy of
dermatology and Venereology 12, no. 2 (1999): 192-193.
Kaspar, Roger L. “Challenges in developing therapies for rare diseases including
pachyonychia congenita.” In journal of investigative dermatology symposium
proceedings, vol. 10, no. 1, pp. 62-66. Elsevier, 2005.
Kasparis, C., D. Reid, N. J. Wilson, V. Okur, C. Cole, C. D. Hansen, K. Bosse, R. C.
Betz, M. Khan, and F. J. D. Smith. “Isolated recessive nail dysplasia caused by
FZD6 mutations: report of three families and review of the literature.” Clinical and
experimental dermatology 41, no. 8 (2016): 884-889.
Kazanskaya, Olga, Andrei Glinka, Ivan del Barco Barrantes, Peter Stannek, Christof
Niehrs, and Wei Wu. “R-Spondin2 is a secreted activator of Wnt/β-catenin
signaling and is required for Xenopus myogenesis.” Developmental cell 7, no. 4
(2004): 525-534.
Kere, Juha, Anand K. Srivastava, Outi Montonen, Jonathan Zonana, Nick Thomas,
Betsy Ferguson, Felix Munoz et al. “X–linked anhidrotic (hypohidrotic)
ectodermal dysplasia is caused by mutation in a novel transmembrane
protein.” Nature genetics 13, no. 4 (1996): 409.
Khalil, S., R. Hayashi, L. Daou, S. A. Staiteieh, O. Abbas, C. Bergqvist, G. Nemer, Y.
Shimomura, and M. Kurban. “A novel mutation in the RSPO4 gene in a patient
with autosomal recessive anonychia.” Clinical and experimental dermatology 42,
no. 3 (2017): 313-315.
Khan, Anwar Kamal, Noor Muhammad, Abdul Aziz, Sher Alam Khan, Khadim Shah,
Abdul Nasir, Muzammil Ahmad Khan, and Saadullah Khan. “A novel mutation in
132
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail
ectodermal dysplasia (ECTD9) in a Pakistani family.” BMC medical genetics 18,
no. 1 (2017): 42.
Khan, Anwar Kamal, Noor Muhammad, Sher Alam Khan, Waheed Ullah, Abdul Nasir,
Sibtain Afzal, Khushnooda Ramzan, Sulman Basit, and Saadullah Khan. "A novel
mutation in the HPGD gene causing primary hypertrophic osteoarthropathy with
digital clubbing in a Pakistani family.” Annals of human genetics 82, no. 3 (2018):
171-176.
Khan, S., S. Basit, R. Habib, A. Kamal, N. Muhammad, and W. Ahmad. “Genetics of
human isolated hereditary nail disorders.” British journal of dermatology 173,
no. 4 (2015): 922-929.
Khan, Tahir Naeem, Joakim Klar, Sadia Nawaz, Muhammad Jameel, Muhammad
Tariq, Naveed Altaf Malik, Shahid M. Baig, and Niklas Dahl. "Novel missense
mutation in the RSPO4 gene in congenital hyponychia and evidence for a
polymorphic initiation codon (p. M1I)." BMC medical genetics 13, no. 1 (2012):
120.
Kim, Kyung-Ah, Jingsong Zhao, Susan Andarmani, Makoto Kakitani, Takeshi Oshima,
Minke E. Binnerts, Arie Abo, Kazuma Tomizuka, and Walter D. Funk. “R-
Spondin proteins: a novel link to β-catenin activation.” Cell cycle 5, no. 1 (2006):
23-26.
Kim, Kyung-Ah, Marie Wagle, Karolyn Tran, Xiaoming Zhan, Melissa A. Dixon,
Shouchun Liu, Delphine Gros et al. “R-Spondin family members regulate the Wnt
pathway by a common mechanism.” Molecular biology of the cell 19, no. 6 (2008):
2588-2596.
133
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Kirkpatrick, J. N., P. H. McKee, and D. J. Spalton. “Ptosis caused by
pachydermoperiostosis.” British journal of ophthalmology 75, no. 7 (1991): 442-
446.
Kiuru, Maija, Mazen Kurban, Munenari Itoh, Lynn Petukhova, Yutaka Shimomura,
Muhammad Wajid, and Angela M. Christiano. “Hereditary leukonychia, or
porcelain nails, resulting from mutations in PLCD1.” The American journal of
human genetics 88, no. 6 (2011): 839-844.
Knight, M. Noelle, and Kurt D. Hankenson. “R-spondins: novel matricellular regulators
of the skeleton.” Matrix biology 37 (2014): 157-161.
Knoers, Nine VAM, Ernie MHF Bongers, Sylvia EC Van Beersum, Ed JP Lommen, H.
A. N. S. VAN BOKHOVEN, and Frans A. Hol. "Nail-patella syndrome:
identification of mutations in the LMX1B gene in Dutch families." Journal of the
American Society of Nephrology 11, no. 9 (2000): 1762-1766.
Koutlas, Ioannis G. “Syndromes affecting skin and mucosa.” Atlas oral Maxillofac
Surg Clin North Am 22, no. 2 (2014): 135-51.
Krebsová, Alice, Henning Hamm, Susanne Karl, André Reis, and Hans Christian
Hennies. “Assignment of the gene for a new hereditary nail disorder, isolated
congenital nail dysplasia, to chromosome 17p13.” Journal of investigative
dermatology 115, no. 4 (2000): 664-667.
Kuhlenbäumer, Gregor, Julia Hullmann, and Silke Appenzeller. “Novel genomic
techniques open new avenues in the analysis of monogenic disorders.” Human
mutation 32, no. 2 (2011): 144-151.
Lamartine, J. “Towards a new classification of ectodermal dysplasias.” Clinical and
experimental dermatology: Clinical dermatology 28, no. 4 (2003): 351-355.
134
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Lee, Sihoon, So Young Park, Hyun Jin Kwon, Chul-Ho Lee, Ok-Hwa Kim, and Yumie
Rhee. “Identification of the mutations in the prostaglandin transporter gene,
SLCO2A1 and clinical characterization in Korean patients with
pachydermoperiostosis.” Journal of Korean medical science 31, no. 5 (2016): 735-
742.
Lemley, Kevin V. “Kidney disease in nail–patella syndrome.” Pediatric nephrology 24,
no. 12 (2009): 2345-2354.
Lexner, Michala Oron, A. Bardow, I. Juncker, L. G. Jensen, L. Almer, S. Kreiborg, and
J. M. Hertz. “X‐linked hypohidrotic ectodermal dysplasia. Genetic and dental
findings in 67 Danish patients from 19 families.” Clinical genetics 74, no. 3
(2008): 252-259.
Li, Xiaoxiao, Meredith Lee Orseth, J. Michael Smith, Mary Abigail Brehm, Nnenna
Gebechi Agim, and Donald Alexander Glass. “A Novel Homozygous Missense
Mutation in HOXC 13 Leads to Autosomal Recessive Pure Hair and Nail
Ectodermal Dysplasia.” Pediatric dermatology 34, no. 2 (2017): 172-175.
Lidral, Andrew C., and B. C. Reising. “The role of MSX1 in human tooth
agenesis.” Journal of dental research 81, no. 4 (2002): 274-278.
Lin, Lawrence, Sook Wah Yee, Richard B. Kim, and Kathleen M. Giacomini. “SLC
transporters as therapeutic targets: emerging opportunities.” Nature reviews drug
discovery 14, no. 8 (2015): 543-560.
Lin, Meei-Hua, and Raphael Kopan. “Long-range, nonautonomous effects of activated
Notch1 on tissue homeostasis in the nail.” Developmental biology 263, no. 2
(2003): 343-359.
135
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Lin, Zhimiao, Quan Chen, Lei Shi, Mingyang Lee, Kathrin A. Giehl, Zhanli Tang,
Huijun Wang et al. “Loss of function mutations in HOXC13 cause pure hair and
nail ectodermal dysplasia.” The American journal of human genetics 91, no. 5
(2012): 906-911.
Lines, Matthew A., C. Anthony Rupar, Jack W. Rip, Berivan Baskin, Peter N. Ray,
Robert A. Hegele, David Grynspan, Jean Michaud, and Michael T. Geraghty.
“Infantile sialic acid storage disease: two unrelated inuit cases homozygous for a
common novel SLC17A5 mutation.” In JIMD Reports-Volume 12, pp. 79-84.
Springer, Cham, 2013.
Liu, X. G., J. Y. Li, Y. Bai, L. X. Zhang, X. Wu, Y. Y. Ma, L. J. Chai, and L. L. Zheng.
“Genetic analysis of a pedigree with primary hypertrophic
osteoarthropathy.” Zhonghua nei ke za zhi 56, no. 3 (2017): 194-198.
Loredo, Rebecca, Mini N. Pathria, David Salonen, and Donald Resnick. “Magnetic
resonance imaging in pachydermoperiostosis.” Clinical imaging 20, no. 3 (1996):
212-218.
Marrie, Thomas J., and Neil Brown. “Clubbing of the digits.” The American journal of
medicine 120, no. 11 (2007): 940-941.
Matise, Tara C., Fang Chen, Wenwei Chen, M. Francisco, Mark Hansen, Chunsheng
He, Fiona CL Hyland et al. “A second-generation combined linkage–physical map
of the human genome.” Genome research 17, no. 12 (2007): 1783-1786.
Mecklenburg, Lars, Ralf Paus, Zdenek Halata, Lesley S. Bechtold, Philip Fleckman,
and John P. Sundberg. “FOXN1 is critical for onycholemmal terminal
differentiation in nude (Foxn1nu) mice.” Journal of investigative
dermatology 123, no. 6 (2004): 1001-1011.
136
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Mehmood, S., S. I. Raza, H. Van Bokhoven, and W. Ahmad. “Autosomal recessive
transmission of a rare HOXC13 variant causes pure hair and nail ectodermal
dysplasia.” Clinical and experimental dermatology 42, no. 5 (2017): 585-589.
Memarpour, Mahtab, and Fereshteh Shafiei. “Witkop tooth and nail syndrome: a report
of three cases in a family.” Pediatric dermatology 28, no. 3 (2011): 281-285.
Mir, H., S. Khan, M. S. Arif, G. Ali, A. Wali, M. Ansar, and W. Ahmad. “Mutations in
the gene phospholipase C, delta-1 (PLCD1) underlying hereditary
leukonychia.” European journal of dermatology: EJD 22, no. 6 (2012): 736-739.
Mohammadi-asl, Javad, Mohammad Reza Pourreza, Aliasgar Mohammadi, Ameneh
Eskandari, Sima Mozafar-Jalali, and Mohammad Amin Tabatabaiefar. “A novel
pathogenic variant in the FZD6 gene causes recessive nail dysplasia in large
Iranian kindred.” Journal of dermatological science 88, no. 1 (2017): 134-138.
Myers, Kathryn A., and Donald RE Farquhar. “Does this patient have
clubbing?” Jama 286, no. 3 (2001): 341-347.
Naeem, M., M. Jelani, K. Lee, G. Ali, M. S. Chishti, A. Wali, A. Gul et al. “Ectodermal
dysplasia of hair and nail type: mapping of a novel locus to chromosome 17p12–
q21.2.” British journal of dermatology 155, no. 6 (2006): 1184-1190.
Naeem, M., M. Wajid, K. Lee, S. M. Leal, and W. Ahmad. “A mutation in the hair
matrix and cuticle keratin KRTHB5 gene causes ectodermal dysplasia of hair and
nail type.” Journal of medical genetics 43, no. 3 (2006): 274-279.
Nakamura, Yoshikazu, Manabu Ichinohe, Masayuki Hirata, Hirokazu Matsuura,
Takashi Fujiwara, Takahiro Igarashi, Masamichi Nakahara et al. “Phospholipase
C-δ1 is an essential molecule downstream of Foxn1, the gene responsible for the
137
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
nude mutation, in normal hair development.” The FASEB journal 22, no. 3 (2008):
841-849.
Nam, Ju-Suk, Taryn J. Turcotte, Peter F. Smith, Sangdun Choi, and Jeong Kyo Yoon.
“Mouse cristin/R-spondin family proteins are novel ligands for the Frizzled 8 and
LRP6 receptors and activate β-catenin-dependent gene expression.” Journal of
biological chemistry 281, no. 19 (2006): 13247-13257.
Naz, G., S. M. Pasternack, C. Perrin, M. Mattheisen, M. Refke, S. Khan, A. Gul, M.
Simons, W. Ahmad, and R. C. Betz. “FZD6 encoding the Wnt receptor frizzled 6
is mutated in autosomal‐recessive nail dysplasia.” British journal of
dermatology 166, no. 5 (2012): 1088-1094.
Ng, Sarah B., Abigail W. Bigham, Kati J. Buckingham, Mark C. Hannibal, Margaret J.
McMillin, Heidi I. Gildersleeve, Anita E. Beck et al. “Exome sequencing identifies
MLL2 mutations as a cause of Kabuki syndrome." Nature genetics 42, no. 9
(2010): 790-793.
Niizeki, H., A. Shiohama, Takashi Sasaki, A. Seki, K. Kabashima, A. Otsuka, Kenjiro
Kosaki et al. “The complete type of pachydermoperiostosis: a novel nonsense
mutation p. E141* of the SLCO2A1 gene.” Journal of dermatological science 75,
no. 3 (2014): 193-195.
O'Connell, Jeffrey R., and Daniel E. Weeks. “PedCheck: a program for identification
of genotype incompatibilities in linkage analysis.” The American journal of human
genetics 63, no. 1 (1998): 259-266.
Ohkawara, Bisei, Andrei Glinka, and Christof Niehrs. “Rspo3 binds syndecan 4 and
induces Wnt/PCP signaling via clathrin-mediated endocytosis to promote
morphogenesis.” Developmental cell 20, no. 3 (2011): 303-314.
138
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Oikarinen, Aarne, Riitta Palatsi, Meeri Kylmäniemi, Jorma Keski-Oja, Juha Risteli, and
Matti Kallioinen. “Pachydermoperiostosis: analysis of the connective tissue
abnormality in one family.” Journal of the American academy of dermatology 31,
no. 6 (1994): 947-953.
Qidwai, Waris, Iqbal Azam Syed, and Faisal M. Khan. "Prevalence and perceptions
about consanguineous marriages among patients presenting to family physicians,
in 2001 at a Teaching Hospital in Karachi, Pakistan." Asia Pacific Family
Medicine 2, no. 1 (2003): 27-31.
Ott, J. “Analysis dfiuman genetic linkage, Baltimore: The.” Johns Hop (1991).
Palmieri, Ferdinando. “The mitochondrial transporter family SLC25: identification,
properties and physiopathology.” Molecular aspects of medicine 34, no. 2-3
(2013): 465-484.
Perrin, C. H., J. F. Michiels, A. Pisani, and J. P. Ortonne. “Anatomic distribution of
melanocytes in normal nail unit: an immunohistochemical investigation.” The
American journal of dermatopathology 19, no. 5 (1997): 462-467.
Perrin, C., L. Langbein, and J. Schweizer. “Expression of hair keratins in the adult
nail unit: an immunohistochemical analysis of the onychogenesis in the proximal
nail fold, matrix and nail bed.” British journal of dermatology 151, no. 2 (2004):
362-371.
Pessa, Joel E., Tsu-Min Tsai, Yanni Li, and Harold E. Kleinert. “The repair of nail
deformities with the nonvascularized nail bed graft: indications and results.” The
journal of hand surgery 15, no. 3 (1990): 466-470.
Pellissier H. Cousin Marriage - 70% in Pakistan - Should it be Prohibited? Institute for
Ethics and Emerging Technologies. 2012.
139
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Pick, Leslie, and Alison Heffer. “Hox gene evolution: multiple mechanisms
contributing to evolutionary novelties.” Annals of the New York academy of
sciences 1256, no. 1 (2012): 15-32.
Pierce, Sarah B., Tom Walsh, Karen M. Chisholm, Ming K. Lee, Anne M. Thornton,
Agata Fiumara, John M. Opitz, Ephrat Levy-Lahad, Rachel E. Klevit, and Mary-
Claire King. “Mutations in the DBP-deficiency protein HSD17B4 cause ovarian
dysgenesis, hearing loss, and ataxia of Perrault Syndrome.” The American journal
of human genetics 87, no. 2 (2010): 282-288.
Pinheiro, M., and N. Freire-Maia. “Ectodermal dysplasias--a general view.” Revista da
Associacao Medica Brasileira 38, no. 4 (1992): 221-224.
Pinson, Kathleen I., Jane Brennan, Susan Monkley, Brian J. Avery, and William C.
Skarnes. “An LDL-receptor-related protein mediates Wnt signalling in
mice.” Nature 407, no. 6803 (2000): 535.
Prohl, Corinna, Winfried Pelzer, Kerstin Diekert, Hanna Kmita, Tibor Bedekovics,
Gyula Kispal, and Roland Lill. “The yeast mitochondrial carrier Leu5p and its
human homologue Graves' disease protein are required for accumulation of
coenzyme A in the matrix.” Molecular and cellular biology 21, no. 4 (2001): 1089-
1097.
Purcell, Shaun, Benjamin Neale, Kathe Todd-Brown, Lori Thomas, Manuel AR
Ferreira, David Bender, Julian Maller et al. “PLINK: a tool set for whole-genome
association and population-based linkage analyses.” The American journal of
human genetics 81, no. 3 (2007): 559-575.
Rafiq, M. A., M. Ansar, T. Pham, M. Amin‐ud‐din, M. Anwar, S. Haque, M. H.
Chahrour, K. Yan, S. M. Leal, and W. Ahmad. “Localization of a novel locus for
140
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
hereditary nail dysplasia to chromosome 17q25. 1‐17q25. 3.” Clinical genetics 66,
no. 1 (2004): 73-78.
Rafiq, Muhammad Arshad, Mohammad Faiyaz-ul-Haque, Mohammad Amin ud Din,
Sajid Malik, Muhammad Sohail, Maqsood Anwar, Sayedul Haque, Andrew D.
Paterson, Lap-Chee Tsui, and Wasim Ahmad. “A novel locus of ectodermal
dysplasia maps to chromosome 10q24.32–q25.1.” Journal of investigative
dermatology 124, no. 2 (2005): 338-342.
Rangarajan, Annapoorni, Claudio Talora, Ryuhei Okuyama, Michael Nicolas, Cristina
Mammucari, Heysun Oh, Jon C. Aster et al. “Notch signaling is a direct
determinant of keratinocyte growth arrest and entry into differentiation.” The
EMBO journal 20, no. 13 (2001): 3427-3436.
Rasool, Mahmood, Sadia Nawaz, Aysha Azhar, Muhammad Wajid, Per Westermark,
Shahid M. Baig, Joakim Klar, and Niklas Dahl. “Autosomal recessive pure hair
and nail ectodermal dysplasia linked to chromosome 12p11. 1-q14.3 without
KRTHB5 gene mutation.” European Journal of dermatology 20, no. 4 (2010): 443-
446.
Ravosa, Matthew J., and Marian Dagosto, eds. Primate origins: adaptations and
evolution. Springer Science & Business Media, 2007.
Raykova, Doroteya, Joakim Klar, Aysha Azhar, Tahir Naeem Khan, Naveed Altaf
Malik, Muhammad Iqbal, Muhammad Tariq, Shahid Mahmood Baig, and Niklas
Dahl. “Autosomal recessive transmission of a rare KRT74 variant causes hair and
nail ectodermal dysplasia: allelism with dominant woolly
hair/hypotrichosis.” PLoS One 9, no. 4 (2014): e93607.
141
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Raza, S. I., N. Muhammad, S. Khan, and W. Ahmad. “A novel missense mutation in
the gene FZD6 underlies autosomal recessive nail dysplasia.” British journal of
dermatology 168, no. 2 (2013): 422-425.
Reginato, Antonio J., Virgilio Schiapachasse, and Rosario Guerrero. “Familial
idiopathic hypertrophic osteoarthropathy and cranial suture defects in
children.” Skeletal radiology 8, no. 2 (1982): 105-109.
Rice, Robert H., Yajuan Xia, Rudy J. Alvarado, and Brett S. Phinney. “Proteomic
analysis of human nail plate.” Journal of proteome research 9, no. 12 (2010):
6752-6758.
Rozen, Steve, and Helen Skaletsky. “Primer3 on the WWW for general users and for
biologist programmers.” In bioinformatics methods and protocols, pp. 365-386.
Humana Press, Totowa, NJ, 2000.
Sambrook, J. “Preparation and analysis of eukaryotic genome DNA.” Molecular
cloning: a laboratory manual 1 (2001): 6-1.
Samman, P. D., & Fenton, D. A. (1995). Samman's the Nails in Disease. Butterworth-
Heinemann Ltd.
Satokata, Ichiro, Liang Ma, Hayato Ohshima, Marianna Bei, Ian Woo, Kazumichi
Nishizawa, Takeyasu Maeda et al. “Msx2 deficiency in mice causes pleiotropic
defects in bone growth and ectodermal organ formation.” Nature genetics 24, no.
4 (2000): 391.
Sato-Matsumura, Kazuko C., Kana Yasukawa, Yuki Tomita, and Hiroshi Shimizu.
“Toenail dystrophy with COL7A1 glycine substitution mutations segregates as an
autosomal dominant trait in 2 families with dystrophic epidermolysis
bullosa.” Archives of dermatology 138, no. 2 (2002): 269-271.
142
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Schulte, Gunnar, and Vítězslav Bryja. “The Frizzled family of unconventional G-
protein-coupled receptors.” Trends in pharmacological sciences 28, no. 10 (2007):
518-525.
Schulte, Gunnar. “International union of basic and clinical pharmacology. LXXX. The
class Frizzled receptors.” Pharmacological reviews 62, no. 4 (2010): 632-667.
Schulze, H. D. “Hereditary partial onycholysis with scleronychia.” Dermatologische
wochenschrift 152, no. 30 (1966): 766-775.
Schulpen, Tom WJ, Joke CM Van Wieringen, Pien J. Van Brummen, Jantien M. Van
Riel, Frits A. Beemer, Paul Westers, and Jonne Huber. "Infant mortality,
ethnicity, and genetically determined disorders in The Netherlands." The
European Journal of Public Health 16, no. 3 (2005): 290-293.
Schweizer, Jürgen, Lutz Langbein, Michael A. Rogers, and Hermelita Winter. “Hair
follicle-specific keratins and their diseases.” Experimental cell research 313, no.
10 (2007): 2010-2020.
Sehgal, Virendra N. “Twenty nail dystrophy trachyonychia: an overview.” The journal
of dermatology 34, no. 6 (2007): 361-366.
Sellheyer, Klaus, and Paula Nelson. “The ventral proximal nail fold: stem cell niche
of the nail and equivalent to the follicular bulge-a study on developing human
skin.” Journal of cutaneous pathology 39, no. 9 (2012): 835-843.
Seow, Heng F., Stefan Bröer, Angelika Bröer, Charles G. Bailey, Simon J. Potter,
Juleen A. Cavanaugh, and John EJ Rasko. “Hartnup disorder is caused by
mutations in the gene encoding the neutral amino acid transporter
SLC6A19.” Nature genetics 36, no. 9 (2004): 1003.
143
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Shah, K., T. M. Ferrara, A. Jan, M. Umair, S. Khan, W. Ahmad, and R. A. Spritz.
"Homozygous SLCO 2A1 translation initiation codon mutation in a Pakistani
family with recessive isolated congenital nail clubbing." British Journal of
Dermatology 177, no. 2 (2017): 546-548.
Shah, Khadim, Raja Hussain Ali, Muhammad Ansar, Kwanghyuk Lee, Muhammad
Salman Chishti, Izoduwa Abbe, Biao Li et al. “Mitral regurgitation as a phenotypic
manifestation of nonphotosensitive trichothiodystrophy due to a splice variant in
MPLKIP.” BMC medical genetics 17, no. 1 (2016): 13.
Shamsher, M. K., H. A. Navsaria, H. P. Stevens, R. C. Ratnavel, P. E. Purkis, D. P.
Keisell, W. H. I. McLean et al. “Novel mutations in keratin 16 gene underlie focal
non-epidermolytic palmoplantar keratoderma (NEPPK) in two families.” Human
molecular genetics 4, no. 10 (1995): 1875-1881.
Shang, Lijuan, Nathanael D. Pruett, and Alexander Awgulewitsch. “Hoxc12 expression
pattern in developing and cycling murine hair follicles.” Mechanisms of
development 113, no. 2 (2002): 207-210.
Shimizu, Hiroshi. “Compound heterozygosity for silent and dominant glycine
substitution mutations in COL7A1 leads to a marked transient intracytoplasmic
retention of procollagen VII and a moderately severe dystrophic epidermolysis
bullosa phenotype.” Journal of investigative dermatology 113 (1999): 419-421.
Shimomura, Yutaka, Muhammad Wajid, Mazen Kurban, Nobuyuki Sato, and Angela
M. Christiano. “Mutations in the keratin 85 (KRT85/hHb5) gene underlie pure hair
and nail ectodermal dysplasia.” The journal of investigative dermatology 130, no.
3 (2010): 892-895.
144
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Sinibaldi, Lorenzo, Ghita Harifi, Irene Bottillo, Miriam Iannicelli, Selma El Hassani,
Francesco Brancati, and Bruno Dallapiccola. “A novel homozygous splice site
mutation in the HPGD gene causes mild primary hypertrophic
osteoarthropathy.” Clinical & experimental rheumatology 28, no. 2 (2010): 153.
Sobel, Eric, and Kenneth Lange. “Descent graphs in pedigree analysis: applications to
haplotyping, location scores, and marker-sharing statistics.” American journal of
human genetics 58, no. 6 (1996): 1323-1337.
Sporny, Michael, Julia Guez-Haddad, Annett Kreusch, Sivan Shakartzi, Avi
Neznansky, Alice Cross, Michail N. Isupov, Britta Qualmann, Michael M. Kessels,
and Yarden Opatowsky. “Structural history of human SRGAP2
proteins.” Molecular biology and evolution 34, no. 6 (2017): 1463-1478.
Sprecher, Eli. “Genetic hair and nail disorders.” Clinics in dermatology 23, no. 1
(2005): 47-55.
Stevenson, A. C., and C. B. Kerr. “On the distributions of frequencies of mutation to
genes determining harmful traits in man.” Mutation research/fundamental and
molecular mechanisms of mutagenesis 4, no. 3 (1967): 339-352.
Sweeney, E., A. Fryer, R. Mountford, A. Green, and I. McIntosh. “Nail patella
syndrome: a review of the phenotype aided by developmental biology.” Journal of
medical genetics 40, no. 3 (2003): 153-162.
Tai, Hsin-Hsiung, Charles Mark Ensor, Min Tong, Huiping Zhou, and Fengxiang Yan.
“Prostaglandin catabolizing enzymes.” Prostaglandins & other lipid mediators 68
(2002): 483-493.
145
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Takeo, Makoto, Wei Chin Chou, Qi Sun, Wendy Lee, Piul Rabbani, Cynthia Loomis,
M. Mark Taketo, and Mayumi Ito. “Wnt activation in nail epithelium couples nail
growth to digit regeneration.” Nature 499, no. 7457 (2013): 228.
Tariq, Muhammad, Zahid Azeem, Ghazanfar Ali, Muhammad Salman Chishti, and
Wasim Ahmad. “Mutation in the HPGD gene encoding NAD+ dependent 15-
hydroxyprostaglandin dehydrogenase underlies isolated congenital nail clubbing
(ICNC).” Journal of medical genetics 46, no. 1 (2009): 14-20.
Thiele, Holger, and Peter Nürnberg. “HaploPainter: a tool for drawing pedigrees with
complex haplotypes.” Bioinformatics 21, no. 8 (2004): 1730-1732.
Tkatchenko, Andrei V., Richard P. Visconti, Lijuan Shang, Thomas Papenbrock,
Nathanael D. Pruett, Tatsuya Ito, Makio Ogawa, and Alexander Awgulewitsch.
“Overexpression of Hoxc13 in differentiating keratinocytes results in
downregulation of a novel hair keratin gene cluster and alopecia.”
Development 128, no. 9 (2001): 1547-1558.
Touraine, Albert. “Un syndrome osteodermopathique: la pachydermie plicaturee avec
pachyperiostose des extremites.” Presse méd 43 (1935): 1820-1824.
Troyanovsky, S. M., V. I. Guelstein, T. A. Tchipysheva, V. A. Krutovskikh, and G. A.
Bannikov. “Patterns of expression of keratin 17 in human epithelia: dependency
on cell position.” Journal of cell science 93, no. 3 (1989): 419-426.
Tüysüz, Beyhan, Saliha Yılmaz, Özgür Kasapçopur, Tuğba Erener-Ercan, Emre
Ceyhun, Kaya Bilguvar, and Murat Günel. “Primary hypertrophic
osteoarthropathy caused by homozygous deletion in HPGD gene in a family:
changing clinical and radiological findings with long-term follow-
up.” Rheumatology international 34, no. 11 (2014): 1539-1544.
146
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Uppal, Sandeep, Christine P. Diggle, Ian M. Carr, Colin WG Fishwick, Mushtaq
Ahmed, Gamal H. Ibrahim, Philip S. Helliwell et al. “Mutations in 15-
hydroxyprostaglandin dehydrogenase cause primary hypertrophic
osteoarthropathy.” Nature genetics 40, no. 6 (2008): 789-793.
Visinoni, Atila F., Toni Lisboa‐Costa, Nina AB Pagnan, and Eleidi A. Chautard‐Freire‐
Maia. “Ectodermal dysplasias: clinical and molecular review.” American journal
of medical genetics part A 149, no. 9 (2009): 1980-2002.
Wasif, Naveed, and Wasim Ahmad. “A novel nonsense mutation in RSPO4 gene
underlies autosomal recessive congenital anonychia in a Pakistani
family.” Pediatric dermatology 30, no. 1 (2013): 139-141.
Webb, Benjamin, and Andrej Sali. “Protein structure modeling with MODELLER.”
In Functional Genomics, pp. 39-54. Humana Press, New York, NY, 2017.
Wei, Qiou, Chika Yokota, Mikhail V. Semenov, Brad Doble, Jim Woodgett, and Xi
He. “R-spondin1 is a high affinity ligand for LRP6 and induces LRP6
phosphorylation and β-catenin signaling.” Journal of biological chemistry 282, no.
21 (2007): 15903-15911.
Wigginton, Janis E., and Gonçalo R. Abecasis. “PEDSTATS: descriptive statistics,
graphics and quality assessment for gene mapping data.” Bioinformatics 21, no. 16
(2005): 3445-3447.
Wilson, N. J., E. A. O'toole, L. M. Milstone, C. D. Hansen, A. A. Shepherd, E. Al‐
Asadi, M. E. Schwartz, W. H. I. McLean, E. Sprecher, and F. J. D. Smith. “The
molecular genetic analysis of the expanding pachyonychia congenita case
collection.” British journal of dermatology 171, no. 2 (2014): 343-355.
147
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Wilson, Neil J., C. David Hansen, Dilek Azkur, Can N. Kocabas, Ayse Metin, Zeynep
Coskun, Mary E. Schwartz, Peter R. Hull, WH Irwin McLean, and Frances JD
Smith. “Recessive mutations in the gene encoding frizzled 6 cause twenty nail
dystrophy-expanding the differential diagnosis for pachyonychia
congenita.” Journal of dermatological science 70, no. 1 (2013): 58-60.
Witkop, C. J. “Hypodontia-nail dysgenesis.” Birth defects encyclopedia: the
comprehensive, systematic, illustrated reference source for the diagnosis,
delineation, etiology, biodynamics, occurrence, prevention, and treatment of
human anomalies of clinical relevance. Center for Birth Defects Information
Services, Dover, MA 920 (1990).
Yuan, Lu, Ling Chen, Ruo-xi Liao, Yuan-yuan Lin, Yan Jiang, Ou Wang, Mei Li et al.
“A common mutation and a novel mutation in the HPGD gene in nine patients with
primary hypertrophic osteoarthropathy.” Calcified tissue international 97, no. 4
(2015): 336-342.
Yüksel-Konuk, Berrin, Aslı Sırmacı, Gülen Ece Ayten, Mustafa Özdemir, İdil Aslan,
Ülkü Yılmaz-Turay, Yurdanur Erdoğan, and Mustafa Tekin. “Homozygous
mutations in the 15-hydroxyprostaglandin dehydrogenase gene in patients with
primary hypertrophic osteoarthropathy.” Rheumatology international 30, no. 1
(2009): 39-43.
Zaiac, Martin N., and Eduardo Weiss. “Mohs micrographic surgery of the nail unit and
squamous cell carcinoma.” Dermatologic surgery 27, no. 3 (2001): 246-251.
Zaias, Nardo. “Embryology of the human nail.” Archives of dermatology 87, no. 1
(1963): 37-53.
148
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Chapter 6 References
Zhang, Yonghong, Christine A. Larsen, H. Scott Stadler, and James B. Ames.
“Structural basis for sequence specific DNA binding and protein dimerization of
HOXA13.” PLoS One 6, no. 8 (2011): e23069.
Electronic Databases
• BIOEDIT sequence alignment editor version 6.0.7
(http://www.mbio.ncsu.edu/BioEdit/bioedit/.html/).
• Ensemble genome browser (http://www.ensemble.org/Homo-sapiens).
• Homozygosity Mapper (http://www.homozygositymapper .org).
• OMIM and PUBMED (https://www.ncbi.nlm.nih.gov/omim/pubmed).
• PolyPhen-2 (http://genetics.bwh.harward.edu/pph).
• SIFT(http://sift.jcvi.org/www/SIFT_seq_submit2.html).
• University of California Santa Cruiz (UCSC) Human Genome Browser
(http://genome.ucsc.edu/cgi-bin/hgGate way).
• HomoloGene:Discover homologs:
http://www.ncbi.nlm.nih.gov/sites/entrez ?db=homologene.
• http://bioinfo.cs.technion.ac.il/superlinkonline
• https://www.ebi.ac.uk/clustalw
• http://www.pymol.org
• http://www.chemcomp.com/MOE_Molecular Operating_Envornment.htm
149
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Appendices
APPENDICES
Appendix.1
150
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Appendices
Appendix. 2
KOHAT UNIVERSITY OF SCIENCE & TECHNOLOGY
Indus Highway, Kohat 26000, Khyber Pakhtunkhwa, Pakistan
Department of Biotechnology & Genetic Engineering
Research Consent Form
I would like to participate in this genetic study voluntarily because I am a member of a family affected with a developmental disorder. My blood and DNA may be used for this research study.
I understand that my images taken are required for publication in a journal as part of an article, which may be seen by the general public as well as medical professionals.
Date………………………
Name of the patient /participant……………………………………………
Gender of the patient /participant …………………….
Date of Birth………………….
Signature of Patient/Guardian/Parent…………………….
Signature of Investigator…………
Supervisor
Saad Ullah Khan, PhD.
Assistant Professor,
Department of Biotechnology and Genetic Engineering,
Kohat University of Science and Technology (KUST) Kohat,
KPK, Pakistan.
151
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Appendices
Appendix. 3
KOHAT UNIVERSITY OF SCIENCE & TECHNOLOGY
Indus Highway, Kohat 26000, Khyber Pakhtunkhwa, Pakistan
Department of Biotechnology & Genetic Engineering
Nail Disorder Proforma
Name of the patient /participant……………………………………………
Gender of the patient /participant …………………….
Date of Birth………………….
History
Is there any pain or other complication in the affected nails? In particular;
When the patient walks/wearing shoes/socks? Does he/she like to wear shoes larger than his/her normal size?
Are the nails grow in normal way?
Are the nails curved downward, upward or grow in a spiral form?
Are all the nails equally affected?
Is color of the nails normal (pink)?
Is there any fungal infection associated with nails?
Are there any Beau's lines, Mees lines or Muehrcke lines on the nails?
What age did the nail problems start?
Are the nail problems stable, or are they getting worse?
Is there any fluctuation and softening of the nail bed?
Is the angle between the nail bed and the proximal nail fold more than the normal 160°?
152
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Appendices
Is Schamroth sign formed by opposing nails of the two index fingers?
Is there seen accentuated convexity of the nail?
Is there any development of a shiny or glossy change in nail and adjacent skin with longitudinal striations? Is there any other disease associated with nail disorder such as, Suppurative intra-thoracic diseases, Intrathoracic neoplastic disease, Diffuse pulmonary diseases, Cardiovascular diseases, Gastrointestinal diseases, Endocrine disorders? Is the patient taking any drugs?
Facial photograph Please provide a facial photograph of all the patients, focusing on the chin, lips, nose, ears, hair and neck region. Photographs of nails on the fingers and toes
Please provide clear photographs of nails of all the digits.
Radiological Examination
Provide X-rays of the nail disorder associated organs. Please include details on
X-rays of the oral cavity if the teeth are absent/missing X-rays of the joints if there is joint problem X-rays of hands and feet Any other relevant findings
I______s/d______having no sound complaint to process my
donation for pure research purpose and for the welfare of human being
Patients signature/right hand thumb impression: ______
Signature researcher: ______Signature supervisor______
153
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Appendices
Appendix. 4
Composition of solutions (A-D) used in DNA extraction
Solution Composition Manufacturer
Solution A 0.32 M Sucrose (Sigma-Aldrich, St. Louis, MO, USA)
10 mM Tris (pH 7.5) (BDH, Poole Dorset, United Kingdom)
5 mM MgCl2 (Sigma-Aldrich, St. Louis, MO, USA)
1% v/v Triton X-100 (Sig ma - Aldrich, St. Louis, MO, USA)
Solution B 10 mM Tris (pH 7.5) (BDH, Poole Dorset, United Kingdom)
400 mM NaCl
2 mM EDTA (pH 8.0) (BDH, Poole Dorset, United Kingdom)
Solution C 400 µl Phenol (BDH, Poole Dorset, United Kingdom)
Solution D 24 volumes of Chloroform (BDH, Poole Dorset, United Kingdom)
1 volume of Isoamyl alcohol (BDH, Poole Dorset, United Kingdom)
154
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families
Appendices
Appendix. 5
Composition of solutions used for the preparation of 8% polyacrylamide gel.
Solution Composition Manufacturer
Loading dye 40 g Sucrose (Sigma-Aldrich, St. Louis, MO, (Bromophenol blue) USA)
0.25 g Bromophenol Blue (BDH, Poole Dorset, UK)
10 X TBE buffer 89.1 mM Tris (BDH, Poole Dorset, UK)
89.9 mM Borate (BDH, Poole Dorset, UK)
2.5 mM EDTA (Ph 8.3) (BDH, Poole Dorset, UK)
30% Acrylamide 29 g acrylamide (Merck, Hohenbrunn, Germany) solution 1 g N, N’ Methylene-bis- (Sigma-Aldrich, St. Lous, MO,
acrylamide USA)
155
Genetic Analysis of Human Hereditary Nail Dysplasia in Pakistani Families