British Journal of Dermatology 2007 156, Pp793–801 793 794 MAL-PDT in AK and BCC, P

May 2007 - Vol. 156 Issue 5 Page.793-1114

Snippets

RESEARCH SNIPPETS pages xvi–xvi

Review article

Methyl aminolaevulinate–photodynamic therapy: a review of clinical trials in the treatment of actinic keratoses and nonmelanoma skin cancer

P. Lehmann pages 793–801

Meeting report

Updates from the British Association of Dermatologists 86th Annual Meeting, 4–7 July 2006, Manchester, U.K.

A. Birnie, S. Langan, J.S.C. English and D.J. Eedy pages 802–813

Original articles

Cutaneous biology

S-nitrosoglutathione-containing hydrogel increases dermal blood flow in streptozotocin-induced diabetic rats

A.B. Seabra, E. Pankotai, M. Fehér, Á. Somlai, L. Kiss, L. Bíró, C. Szabó, M. Kollai, M.G. de Oliveira and Z. Lacza pages 814–818 Stromal fibroblasts from basal cell carcinoma affect phenotype of normal keratinocytes

L. Lacina, K. Smetana Jr, B. Dvořánková, R. Pytlík, L. Kideryová, L. Kučerová, Z. Plzáková, J. Štork, H-J. Gabius and S. André pages 819–829

Inhibition of T helper 2 chemokine production by narrowband ultraviolet B in cultured keratinocytes

R. Hino, M. Kobayashi, T. Mori, H. Orimo, T. Shimauchi, K. Kabashima and Y. Tokura pages 830–837

Dimethylfumarate inhibits nuclear binding of nuclear factor κB but not of nuclear factor of activated T cells and CCAAT/enhancer binding protein β in activated human T cells

S. Gerdes, K. Shakery and U. Mrowietz pages 838–842

Effect of ultraviolet (UV) A, UVB or ionizing radiation on the cell cycle of human melanoma cells

M. Placzek, B. Przybilla, U. Kerkmann, S. Gaube and K.-P. Gilbertz pages 843–847

Original articles

Clinical and laboratory investigations

Novel function of DUSP14/MKP6 (dual specific phosphatase 14) as a nonspecific regulatory molecule for delayed-type hypersensitivity

Y. Nakano pages 848–860

Localized and generalized forms of blistering in junctional epidermolysis bullosa due to COL17A1 mutations in the Netherlands

A.M.G. Pasmooij, H.H. Pas, G.H.L. Jansen, H.H. Lemmink and M.F. Jonkman pages 861–870

Squamous cell carcinoma of the nail apparatus: clinicopathological study of 35 cases

S. Dalle, L. Depape, A. Phan, B. Balme, S. Ronger-Savle and L. Thomas pages 871–874

Aberrant human tissue kallikrein levels in the stratum corneum and serum of patients with psoriasis: dependence on phenotype, severity and therapy

N. Komatsu, K. Saijoh, C. Kuk, F. Shirasaki, K. Takehara and E.P. Diamandis pages 875–883

Establishment of a mouse skin model of the lichenification in human chronic eczematous dermatitis

Y. Matsunaga, Y. Ogura, R. Ehama, S. Amano, T. Nishiyama and H. Tagami pages 884–891

Assessment of nailfold capillaroscopy by × 30 digital epiluminescence (dermoscopy) in patients with Raynaud phenomenon

E. Beltrán, A. Toll,A. Pros, J. Carbonell and R.M. Pujol pages 892–898

Cytokine gene polymorphisms in Chinese patients with psoriasis

Y.T. Chang, C.T. Chou, C.W. Yu, M.W. Lin, Y.M. Shiao, C.C. Chen, C.H. Huang, D.D. Lee, H.N. Liu, W.J. Wang and S.F. Tsai pages 899–905

Original articles

Contact dermatitis and allergy

Olopatadine hydrochloride accelerates the recovery of skin barrier function in mice

T. Amano, T. Takeda, H. Yano and T. Tamura pages 906–912

Original articles

Epidemiology and health services research

Cost-effectiveness of tacrolimus ointment vs. standard treatment in patients with moderate and severe atopic dermatitis: a health-economic model simulation based on a patient survey and clinical trial data

J. Hjelmgren, Å. Svensson, E.T. Jörgensen, B. Lindemalm-Lundstam and G. Ragnarson Tennvall pages 913–921

Reliability of self-reported willingness-to-pay and annual income in patients treated for toenail onychomycosis

P.M.H. Cham, S.C. Chen, J.P. Grill, Y.C. Jonk and E.M. Warshaw pages 922–928

The family impact of skin diseases: the Greater Patient concept

M.K.A. Basra and A.Y. Finlay pages 929–937

Factors associated with a high tumour thickness in patients with melanoma

J. Baumert, G. Plewig, M. Volkenandt and M.-H. Schmid-Wendtner pages 938–944

The Dermatology Life Quality Index: assessing the efficacy of biological therapies for psoriasis

R.P. Katugampola, V.J. Lewis and A.Y. Finlay pages 945–950

Original articles

Photobiology

Significant downregulation of transforming growth factor-β signal transducers in human skin following ultraviolet-A1 irradiation

T. Gambichler, M. Skrygan, N.S. Tomi, S. Breuksch, P. Altmeyer and A. Kreuter pages 951–956

Protection from photodamage by topical application of caffeine after ultraviolet irradiation

S-W. Koo, S. Hirakawa, S. Fujii, M. Kawasumi and P. Nghiem pages 957–964

Original articles

Therapeutics

Oral liarozole vs. acitretin in the treatment of ichthyosis: a phase II/III multicentre, double-blind, randomized, active-controlled study

C.J. Verfaille, F.P. Vanhoutte, C. Blanchet-Bardon, M.A. van Steensel and P.M. Steijlen pages 965–973

Single application of a fluorescent test cream by healthy volunteers: assessment of treated and neglected body sites

E. Ulff, M. Maroti, Å. Kettis-Lindblad, K.I. Kjellgren, J. Ahlner, L. Ring and J. Serup pages 974–978

Low basal serum cortisol in patients with severe atopic dermatitis: potent topical corticosteroids wrongfully accused

I.M. Haeck, L. Timmer-de Mik, E.G.W.M. Lentjes, E. Buskens, D.J. Hijnen, C. Guikers, C.A.F.M. Bruijnzeel-Koomen and M.S. de Bruin-Weller pages 979–985

Treatment of axillary hyperhidrosis with botulinum toxin type A reconstituted in lidocaine or in normal saline: a randomized, side-by-side, double-blind study

J. Vadoud-Seyedi and T. Simonart pages 986–989

Rituximab in the adjuvant treatment of pemphigus vulgaris: a prospective open-label pilot study in five patients

M.S.Y. Goh, C. McCormack, H.V. Dinh, B. Welsh, P. Foley and H.M. Prince pages 990–996

Evaluation of efficacy and safety of rucinol serum in patients with melasma: a randomized controlled trial

A. Khemis, A. Kaiafa, C. Queille-Roussel,L. Duteil and J.P. Ortonne pages 997–1004

Is minocycline therapy in acne associated with antineutrophil cytoplasmic antibody positivity? A cross-sectional study

H. Marzo-Ortega, K. Baxter,R.M. Strauss,S. Drysdale, B. Griffiths, S.A. Misbah,A. Gough, W.J. Cunliffe and P. Emery pages 1005–1009

Two years of experience with etanercept in recalcitrant psoriasis

K. Ahmad and S. Rogers pages 1010–1014

Original articles

Concise communication

Keratitis–ichthyosis–deafness syndrome: disease expression and spectrum of connexin 26 (GJB2) mutations in 14 patients

J. Mazereeuw-Hautier, E. Bitoun, J. Chevrant-Breton, S.Y.K. Man, C. Bodemer, C. Prins, C. Antille, J.-H. Saurat, D. Atherton, J.I. Harper, D.P. Kelsell and A. Hovnanian pages 1015–1019

Topical pimecrolimus and tacrolimus transiently induce neuropeptide release and mast cell degranulation in murine skin

S. Ständer, H. Ständer, S. Seeliger,T.A. Luger and M. Steinhoff pages 1020–1026

Case reports

Ultrastructural features of ichthyosis hystrix strongly resembling Lambert type

W-H. Wang, L-F. Li, Q. Zhang, S-M. Yang, W. Jiang, Y-Y. Wang, P-C. Lei and X-R. Chen pages 1027–1031

Case report

Sclerodermatous graft-versus-host disease: clinical spectrum and therapeutic challenges

J.M.L. White, D. Creamer, A.W.P. du Vivier, A. Pagliuca, A.Y. Ho, S. Devereux, J.R. Salisbury and G.J. Mufti pages 1032–1038

Complete response of deep neutrophilic dermatosis associated with myelodysplastic syndrome to 5- azacytidine

K. Raj, A. Ho, J.D. Creamer,A.W.P. du Vivier,J.R. Salisbury and G.J. Mufti pages 1039–1041

Gene corner

A novel H1 domain mutation in the keratin 2 gene in a Japanese family with ichthyosis bullosa of Siemens

A. Nishizawa, Y. Toyomaki, A. Nakano, S. Takeuchi, Y. Matsuzaki, H. Takeda, T. Kaneko, Y. Mitsuhashiand H. Nakano pages 1042–1044 Correspondence

Audit of erythema in patients with psoriasis undergoing phototherapy with narrowband (TL-01) ultraviolet B: impact of the introduction of a comprehensive erythema-reporting protocol

R.J. Batchelor, R.F. Rose, A. Yung, B. Rathmell, D. Turner and V. Goulden pages 1045–1046

Oral adverse effects for escitalopram (Cipralex®)

D.J. Aframian pages 1046–1047

Unilateral cutaneous heterotopic meningeal nodules with neural, smooth muscle and connective tissue hamartomas: a field defect of cephalic neural crest-derived tissues

C.M. Hunzeker, D. Borys, M.A. Greco, S.J. Orlow and J.V. Schaffer pages 1047–1050

Ulcerated haemangioma of infancy: a retrospective review of 47 patients

H.T. Shin S.J. Orlow M.W. Chang pages 1050–1052

Fibrous hamartoma of infancy in a patient with Williams syndrome

T. Togo E. Araki M. Ota T. Manabe S. Suzuki A. Utani pages 1052–1055

Type II adult-onset pityriasis rubra pilaris successfully treated with intravenous immunoglobulin

A.C. Kerr and J. Ferguson pages 1055–1056

Angio-oedema induced by bicycling

B. Schubert C.S. Seitz C. Weigel E.B. Bröcker and A. Trautmann pages 1056–1058

High-dose intravenous immunoglobulin infusion as treatment for diffuse scleroderma

H. Ihn Y. Mimura N. Yazawa M. Jinnin Y. Asano K. Yamane and K. Tamaki pages 1058–1060

Development of a diagnostic role for a clinical nurse specialist

N.N. Goyal and G.B. Colver pages 1060–1061 Sclerodermoid graft-versus-host disease-like lesions occurring after drug-induced hypersensitivity syndrome

Y. Kano K. Sakuma and T. Shiohara pages 1061–1063

A case of hereditary angio-oedema type III presenting with C1-inhibitor cleavage and a missense mutation in the F12 gene

L. Bouillet D. Ponard H. Rousset S. Cichon and C. Drouet pages 1063–1065

Coexistence of sacral dimple, solitary collagenoma and mid-dorsal hypertrichosis in a child with occult spinal dysraphism

A. Senayli E. Sezer T. Sezer Y. Senayli D. Koseoglu N. Filiz and B. Sarikaya pages 1065–1066

Two patients with localized epidermolysis bullosa acquisita: diagnostic value of laser scanning confocal microscopy

K. Wozniak C. Kowalewski D. Rosinska-Borkowska and M. Ciupinska pages 1066–1068

An infant with extensive Mongolian spot, naevus flammeus and cutis marmorata telangiectatica congenita: a unique case of phakomatosis pigmentovascularis

B.P-H. Chang C-H. Hsu H-C. Chen and J-W. Hsieh pages 1068–1071

Nail bed lichen planus associated with onychopapilloma

B. Richert M. Iorizzo and A. Tosti, J. André pages 1071–1072

Schnitzler syndrome: a case report of successful treatment using the anti-CD20 monoclonal antibody rituximab

K.M. Ramadan H.A. Eswedi and M.R. El-Agnaf pages 1072–1074

Class I and class II major histocompatibility complex genes in Mexican patients with actinic prurigo

S. Zuloaga-Salcedo M. Castillo-Vazquez E. Vega-Memije O. Arellano-Campos J.M. Rodríguez-Pérez N. Pérez-Hernández L. Domínguez-Soto T. Hojyo-Tomoka G. Vargas- Alarcón and J. Granados pages 1074–1075

Anti-p200 pemphigoid in a 17-year-old girl successfully treated with systemic corticosteroid and dapsone

N. Yamane D. Sawamura W. Nishie M. Abe K. Kodama K. Adachi H. Nakamura N. Ishii T. Hashimoto and H. Shimizu pages 1075–1078

Multifocal distribution of cutaneous human papillomavirus types in hairs from different skin areas

A. Köhler T. Forschner T. Meyer C. Ulrich M. Gottschling E. Stockfleth and I. Nindl pages 1078–1080

Sunscreens and thyroid function in humans after short-term whole-body topical application: a single-blinded study

N.R. Janjua B. Kongshoj J.H. Petersen and H.C. Wulf pages 1080–1082

The diagnosis of a DRESS syndrome has been sufficiently established on the basis of typical clinical features and viral reactivations

T. Shiohara M. Iijima Z. Ikezawa K. Hashimoto pages 1083–1084

A case of herpes zoster in a child with congenital insensitivity to pain with anhidrosis

M. Ogata N. Misago Y. Suzuki N. Hirashima T. Inoue M. Yamasaki and Y. Narisawa pages 1084–1086

Life imitating art

F.J. Moloney and S. Rogers pages 1086–1086

An unusual terminal hair growth on the nose tip associated with gefitinib therapy

S.Y. Kim, H-J. Choi, H.J. Park, J.Y. Lee and B.K. Cho pages 1087–1088

Milia and cutaneous leishmaniasis

P. Del Giudice pages 1088–1088

Type 2 segmental Cowden disease vs. Proteus syndrome

R. Happle pages 1089–1090 Elevated triglyceride and cholesterol levels after intravenous antitumour necrosis factor-α therapy in a patient with psoriatic arthritis and psoriasis vulgaris

C. Antoniou, C. Dessinioti, A. Katsambasand A.J. Stratigos pages 1090–1091

News and Notices

News and Notices pages 1091–1092

Abstracts

British Society for Investigative Dermatology Annual Meeting pages 1093–1114

RESEARCH SNIPPETS DOI 10.1111/j.1365-2133.2007.07957.x

Inhibition of T helper 2 chemokine production by narrowband ultraviolet B in cultured keratinocytes Narrowband ultraviolet B (UVB) has recently been used for the treatment of various skin disorders. Hino et al. investigated its effects on production of cytokines and chemokines by keratinocytes. Human epidermal keratinocytes were irradiated with narrowband UVB or broadband UVB. The two UVB sources were compared on the basis of their minimal erythemal doses and therapeutically used doses. Characteristically, narrowband UVB reduced the production of Th2 chemokines without excess production of proinﬂammatory cytokines, suggesting its therapeutic effectiveness in Th2-mediated skin disorders as well as its relative safety in clinical usage. Hino R, Kobayashi M, Mori T et al. Inhibition of T helper 2 chemokine production by narrowband ultraviolet B in cultured keratinocytes. Br J Dermatol 2007; 156:830–7.

Squamous cell carcinoma of the nails Subungual squamous cell carcinoma (SCC) is rare. Its diagnosis is often missed or delayed because the clinical presentation is often atypical, and it can mimic other conditions such as verruca vulgaris, onychomycosis, trauma-induced nail dystrophy or exostosis. In this retrospective study Dalle et al. analysed 35 cases of nail SCC. A wide range of clinical features was encountered, including leuconychia, subungual hyperkeratosis, trachonychia, subungual tumoral syndrome, longitudinal erythronychia and melanonychia. In many cases the diagnosis was delayed, and most cases were invasive at the time of diagnosis. Most often the ﬁngernails were affected. On toenails, only the big toe was regularly affected. Wide surgical excision led to a lower risk of relapse. In cases of more limited surgical treatment (saving part of the affected nail), micrographic surgery should be considered for a better control of the margins. Dalle S, Depape L, Phan A et al. Squamous cell carcinoma of the nail apparatus: clinicopathological study of 35 cases. Br J Dermatol 2007; 156:871–4.

Topical corticosteroids wrongfully accused in atopic dermatitis Sound investigation to determine whether topical corticosteroids induce suppression of hypothalamic–pituitary–adrenal function is lacking. In this study, basal serum cortisol levels of patients with severe atopic dermatitis (AD) (inpatients at admission) were decreased compared with those in patients with mild AD (outpatients), while the use of topical corticosteroids during the previous 3 months did not differ between both groups. Furthermore, basal serum cortisol levels of the inpatient group increased during treatment with potent topical corticosteroids. This suggests that disease activity, rather than the use of topical corticosteroids, is responsible for low basal serum cortisol levels in patients with severe AD. Haeck IM, Timmer-de Mik L, Lentjes EGWM et al. Low basal serum cortisol in patients with severe atopic dermatitis: potent topical corticosteroids wrongfully accused. Br J Dermatol 2007; 156:979–85.

Two years of experience with etanercept in recalcitrant psoriasis Ahmad and Rogers reviewed the safety and efﬁcacy of etanercept in 49 patients with psoriasis recalcitrant to other systemic treatments over a 2-year period. Forty-four patients had chronic plaque psoriasis, two were suberythrodermic, one had palmoplantar pustular psoriasis and two had acrodermatitis continua. PASI 75 was achieved in 47% at week 24 and in 66% at week 48. Etanercept was stopped in 12 patients in whom clearance was achieved. Rebound did not occur. Four remained in remission (mean 13 weeks) while eight relapsed; etanercept was reintroduced in these patients with renewed efﬁcacy. Unmasking of latent tuberculosis in one patient underlines the need for rigorous tuberculosis screening. Ahmad K, Rogers S. Two years of experience with etanercept in recalcitrant psoriasis. Br J Dermatol 2007; 156:1010–14. REVIEW ARTICLE DOI 10.1111/j.1365-2133.2007.07833.x Methyl aminolaevulinate–photodynamic therapy: a review of clinical trials in the treatment of actinic keratoses and nonmelanoma skin cancer P. Lehmann Zentrum fu¨r Dermatologie, Allergologie und Umweltmedizin, Helios Klinikum Wuppertal, Klinikum der Universita¨t Witten-Herdecke, Heusnerstr. 40, D-42283 Wuppertal, Germany

Summary

Correspondence Methyl aminolaevulinate–photodynamic therapy (MAL-PDT) has advanced the Percy Lehmann. management of nonmelanoma skin cancer (NMSC), providing a treatment option E-mail: [email protected] for actinic keratosis (AK), basal cell carcinoma [both superficial (sBCC) and nodular (nBCC)] and Bowen’s disease, with good clinical outcomes, low recurrence Accepted for publication 11 December 2006 rates and enhanced cosmetic acceptability. Excellent results have been reported, with complete responses (CRs) in AK ranging from 69% to 93% at 3 months; Key words CRs in Bowen’s disease are 93% at 3 months and 68% at 24 months. In sBCC, actinic keratoses, basal cell carcinoma, Bowen’s CRs range from 85% to 93% at 3 months and are comparable with cryosurgery disease, methyl aminolaevulinate, photodynamic up to 60 months (75% vs. 74%). In nBCC, CRs range from 75–82% at 3 months therapy, review to 77% at 60 months. MAL-PDT specifically targets diseased cells, leaving healthy Conflicts of interest tissue unharmed. This noninvasive treatment option is associated with minimal None declared. risk of scarring. Moreover, systemic uptake of MAL is negligible and the local phototoxic reactions that often occur during treatment rapidly heal to produce excellent cosmetic results. The side-effects of therapy, which are predominantly local phototoxic effects (burning, stinging and prickling sensations), are of mild- to-moderate intensity, of short duration and easily managed. Overall, the efficacy and low risk of side-effects afforded by this therapy have resulted in high patient preference in clinical trials. The current evidence base for MAL-PDT in the treatment of AK and NMSC is reviewed in this article.

The treatment of basal cell carcinoma (BCC) should be based 60 months following treatment and patient acceptance of cos- on clinical type, tumour size and location. Other factors of metic outcomes. Other therapeutic modalities for the treat- importance when considering which treatment to use include: ment of skin tumours are reviewed elsewhere.1,2 restoring or maintaining normal skin appearance, duration of post-therapeutic downtime, treatment compliance and thera- Nonmelanoma skin cancer peutic risks related to comorbidities (e.g. peripheral vascular disease), concomitant medications (e.g. anticoagulants) and BCC is the most common malignant skin tumour in the white immune status (e.g. transplant recipients). Apart from surgical population and is classified together with squamous cell excision, several treatment options exist including cryotherapy, carcinoma (SCC) as nonmelanoma skin cancer (NMSC). In the curettage and electrocautery, cytotoxic agents, immune U.S.A., 0Æ9–1Æ2 million new cases of NMSC are diagnosed response modifiers, Mohs micrographically controlled surgery each year and of these 80% are BCC and 16% are SCC.3 The and radiotherapy. incidence of SCC is increasing across Europe, the U.S.A. Recently, there has been an increased use of photodynamic and the Southern hemisphere,4 and the incidence of BCC con- therapy (PDT) with topical, tumour-specific photosensitizers tinues to rise in Australia; it is estimated that NMSC affects for the treatment of skin tumours.1 One such agent, methyl at least 1–2% of the population annually.3,5 Exposure to ultra- aminolaevulinate (MAL), has been approved in Europe for the violet radiation is the most important risk factor and is treatment of superficial BCC (sBCC), nodular BCC (nBCC), related to sun-exposure habits. Light complexion, increasing actinic keratosis (AK) and Bowen’s disease. age, male gender, precancerous skin lesions, immuno- The evidence for the efficacy and safety of MAL-PDT is suppression, ionizing radiation and psoralen phototherapy are reviewed in this article, including recurrence data up to other host factors.6

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 793 794 MAL-PDT in AK and BCC, P. Lehmann

A number of forms of the disease can be differentiated based absorb energy from photons and transfer this energy to sur- on clinical appearance.7 BCC may be categorized into three rounding oxygen molecules. Toxic oxygen species such as major growth patterns: nodular, superficial and morphoei- singlet oxygen and free radicals are formed, which cause cell form.8 Superimposed on any of these growth patterns may be death in the target tissue.20 The light sources utilized for PDT ulceration or pigmentation. Metastasis is extremely rare,9 and are visible blue light (405 nm) matching the peak absorption the morbidity associated with BCC is related to local tissue spectrum of the photoactive porphyrins, or visible red light invasion and destruction, particularly on the head and neck. (570–670 nm), which corresponds to a smaller absorption sBCC involves little deep penetration and most commonly peak but allows for deeper tissue penetration.21–23 occurs on the trunk and limbs. Most sBCCs will progressively The original photosensitizers used in cutaneous malignancy enlarge over months to years and with time, may adopt nod- were haematoporphyrin derivatives and porfimer sodium ular or even sclerosing growth patterns. injected intravenously, but their use was limited by prolonged nBCCs are more often found on the head and neck in sub- generalized photosensitivity.20,24 jects who are, on average, somewhat older than those with Topical MAL-PDT has a high degree of selective accumula- sBCC. nBCCs will progressively enlarge, and have a tendency tion in neoplastic lesions.25 The relative depth of penetration to deep extension and ulceration. of porphyrin fluorescence (ratio of the depth of porphyrin In contrast, morphoeiform or ‘sclerotic’ BCCs have a sclero- fluorescence to the depth of the tumour) was studied by Peng sing growth pattern. They present with the appearance of et al.,26 and it was found to be 98% after the application of ) a pale scar, can be clinically difficult to detect or outline, 160 mg g 1 for 3 h in BCC lesions up to 2 mm in depth. extending laterally beyond the clinical margins, and tend to be No significant systemic uptake has been shown with MAL- deeply invasive, making surgical and nonsurgical treatments PDT and the side-effects of therapy are transient and easily less effective. managed.27

Actinic keratoses Clinical studies with methyl aminolaevulinate–photodynamic therapy AKs are potential precursors of SCC, with an incidence about 10-fold that of BCC.10 In Australia, it has been estimated that Dose-ranging studies 60% of people over the age of 40 years will have at least one AK lesion.11,12 AK affects the face, scalp, hands and forearms. Dose-ranging studies for MAL-PDT have established an opti- ) Although lesions can occur singly, they usually consist of mul- mum dose regimen of 160 mg g 1 for 3 h.26,28,29 These tiple growths. Both single and multiple growths are slow include one study of 112 patients with AK,28 another of 141 growing, small (< 1 cm in diameter), dry, rough yellow- patients with BCC (sBCC and nBCC)29 and one study of BCC ) brown lesions with well-defined scales that do not flake off. lesions up to 2 mm deep,26 where 16, 80 and 160 mg g 1 They may become thick and horny, and sometimes bleed. for 3–18 h were compared.26,28,29 The latter showed that the Pathological evidence suggests that AK should be regarded as highest ratio of porphyrin fluorescence depth to tumour depth ) very early SCC.13 The malignant potential of AK is supported was achieved with the 160 mg g 1 dose for 3 h.26 These by studies showing that AK has the same genetic markers and results have been confirmed in a recent study of 18 sBCC and mutations of tumour-suppressing p53 genes as SCC of the der- 32 AK lesions.30 mis.14 It is not known which AK will progress to SCC. How- ever, conversion rates of 0Æ25–20% have been reported3,5,15 Basal cell carcinoma and one study showed that 97% of SCCs were associated with AK.16 As 3–4% of SCCs metastasize,17 it has been suggested The use of MAL-PDT has been investigated in eight clinical that AK should be treated early to avoid future malignancy studies29,31–43 (Table 1). One of these studies was the previ- and the need for more extensive treatment.18 ously described dose-ranging study;29 three studies were noncomparative;31,32,34 and in four studies MAL-PDT 36,37 38 Bowen’s disease was compared with placebo-PDT, excision surgery and cryotherapy.42 Four studies included patients with either sBCC Bowen’s disease is a persistent form of intraepidermal (in situ) or nBCC, three assessed only patients with nBCC and one only SCC, which appears as an enlarging, well-demarcated, erythe- patients with sBCC. matous plaque with an irregular border, a crusted or scaling surface19 and potential for extending along the cutaneous Noncomparative studies appendages. It has a small potential for invasive malignancy. A retrospective, noncomparative study in 59 patients with a Photodynamic therapy total of 310 sBCC or nBCC lesions with complete response (CR) at initial treatment was conducted to investigate the PDT is the combination of light and light-sensitive agents (such long-term efficacy of MAL-PDT following successful treatment as porphyrins) in an oxygen-rich environment. Porphyrins can of at least one BCC lesion.31 A single treatment had previously

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 ora Compilation Journal 07TeAuthor The 2007

Table 1 Summary of reviewed studies on methyl aminolaevulinate acid–photodynamic therapy (MAL-PDT) in basal cell carcinoma (BCC)

Study design Number of patients enrolled Primary aims Key results European multicentre exploratory 141 Optimal application time CR for 3-h application was 96% in sBCC and 90% in nBCC 07BiihAscaino Dermatologists of Association British 2007 study. MAL-PDT application for 1, 3, 5 and 18 h29 European single centre retrospective 59 Long-term CR, recurrence and At a median of 35 months, the overall cure rate was 79%, with a sustained study31 cosmetic outcome in sBCC and response rate of 89% nBCC showing early CR 98% of CR lesions had an excellent/good cosmetic outcome sBCC CR ¼ 91%, recurrence rate ¼ 9% nBCC (thin) CR ¼ 93%, recurrence rate ¼ 7% nBCC (thick) CR ¼ 86%, recurrence rate ¼ 14% European multicentre study in 94: 45 sBCC and 45 nBCC CR, recurrence and cosmesis in MAL-PDT was effective in difﬁcult-to-treat lesions at 24 months with high-risk BCC lesions32 high-risk lesions unsuitable for overall CR of 77%, taking into account histological evaluation conventional treatment sBCC CR ¼ 85%, recurrence rate ¼ 22% nBCC CR ¼ 75%, recurrence rate ¼ 14% Overall recurrence rate ¼ 18% •

rts ora fDermatology of Journal British Australian multicentre study in 102: 92 sBCC and 36 nBCC CR rate in high-risk patients The efﬁcacy of MAL-PDT was dependent on tumour thickness and location high-risk patients33,34,43 with BCC Overall histologically conﬁrmed CR ¼ 89% at 3 months (sBCC 93% and nBCC 82%) Recurrence rate was 15% at 24 months and 20% at 48 months Most patients showed good to excellent cosmetic outcome with MAL-PDT High patient preference for MAL-PDT Randomized, double-blind, 66: 33 MAL-PDT and 33 Histological evaluation and cosmesis MAL-PDT superior to placebo-PDT (P <0Æ001) parallel-group, placebo-controlled placebo-PDT in nBCC 73% vs. 21% showed no signs of malignancy at histological evaluation 36 2007 study (MAL-PDT vs. placebo-PDT) Most patients showed good to excellent cosmetic outcome with MAL-PDT

156, Randomized, double-blind, 65: 33 MAL-PDT and 32 Histological evaluation, CR and At 6 months 78% vs. 33% showed no signs of malignancy at histological parallel-group, placebo-controlled placebo-PDT cosmesis in nBCC evaluation (MAL-PDT vs. placebo-PDT) Lehmann P. BCC, and AK in MAL-PDT pp793–801 study37 80% vs. 51% CR evaluation (MAL-PDT vs. placebo-PDT, P <0Æ001) There was an estimated potential for recurrence in 12Æ5% Most patients showed good to excellent cosmetic outcome with MAL-PDT European multicentre, open, 101: 52 MAL-PDT and CR, recurrence rate and cosmesis 3-month CR was similar for MAL-PDT and surgery (91% vs. 98%) randomized study35,38,39 49 surgery in primary nBCC 36-month CR was 79% for MAL-PDT and 96% for surgery 60-month CR was 77% for MAL-PDT and 96% for surgery 60-month recurrence rate was 14% vs. 4% for surgery Cosmetic outcome at 60 months for CR patients good or excellent in 87% for MAL-PDT vs. 53% in the surgery group 795 796 MAL-PDT in AK and BCC, P. Lehmann

been applied to the majority of lesions. An overall CR was sustained in 89% of lesions at a median follow-up of 35 months (range 24–48); in 98% of these lesions an excellent or good cosmetic outcome was maintained. The CR for patients with sBCC was 91%, with a recurrence rate of 9%. The CR for patients with thin nBCC was 93% (recurrence rate 7%) and for thick nBCC was 86% (recurrence rate 14%). Subsequently, an open noncomparative study was conducted to investigate efficacy and cosmetic outcome following MAL-PDT in 94 patients with a total of 123 difficult-to-treat sBCC or nBCC lesions.32 The criteria for difficult-to-treat lesions were recurrent and/or large lesions and/or lesions located in the mid-face region and/or in severe sun-damaged skin. Most of these patients (87%) had a solitary difficult-to- treat lesion, which was located on the face or scalp in 60% of cases. A single cycle of MAL-PDT involving two treatments was applied at a 1-week interval. If lesions did not have a CR at 3-month follow-up, treatment was repeated. The histologically confirmed lesion CR rate at 3 months after the last treatment was 77% overall (95% confidence interval 70–85%), 85% for sBCC and 75% for nBCC. At 24 months after treat-

vs. 16% after cryotherapy vs. 19% after cryotherapy vs. 20% after cryotherapy ment, the overall lesion recurrence rate was 18% (12 of 66), 3-month CR was similar48-month for CR MAL-PDT was and similar cryotherapy60-month (97% for CR vs. MAL-PDT was and 95%) similar cryotherapyAt for (76% 12 MAL-PDT vs. and months 75%) cryotherapy 8% (75% of vs. the 74%) lesions initiallyAt cleared 48 with months MAL-PDT 22% had of recurred, the lesions initiallyAt cleared 60 with months MAL-PDT 22% had of recurred, the lesions initiallySuperior cleared cosmetic with outcome MAL-PDT with had MAL-PDT recurred, (87% vs. 49%) with 22% for sBCC and 14% for nBCC. In addition, MAL-PDT was associated with a good or excellent cosmetic outcome in up to 94% of patients at 24 months. A multicentre study in Australia was conducted in 102 patients with 187 sBCC or nBCC lesions to examine the efﬁc- acy, safety and cosmetic outcomes of MAL-PDT therapy in .

1 33,34 ) patients with BCC at high risk of complications. Patients at high risk of surgical complications due to anticoagulant medication or bleeding disorders, or with cardiac risk factors, anaesthetic contraindications, poor surgical compliance and/or cosmesis in primary sBCC CR, recurrence rate and ‘difficult-to-treat’ lesions (i.e. large lesions or lesions in the mid-face region or on the ear) were included. Data evaluated were from 95 patients with a total of 148 lesions. Initial assessment was at 3 months post-treatment and lesions with non-CR were re-treated with a repeat cycle of MAL-PDT. MAL-PDT was shown to be highly effective in this patient group, with an overall histologically confirmed lesion CR rate of 89% (sBCC 93% and nBCC 82%). There was histologically confirmed recurrence in 15% of lesions within 24 months and 20% within 48 months.43 A total of 97% of patients rated cosmetic outcome as good to excellent at 3 months. Up to

double freeze-thaw cryotherapy 70% of these patients would usually need to undergo 118: 60 MAL-PDT and 58 reconstructive surgery following lesion removal, emphasizing the importance of this ﬁnding.44 The study also showed that most patients preferred MAL-PDT to previous treatments for BCC; MAL-PDT was rated better than surgery by 67% of 40–42 patients, and 53% of patients rated MAL-PDT better than cryotherapy.34 ) Comparative studies: nodular basal cell carcinoma Continued ( A randomized, double-blind, parallel-group, placebo-controlled 36 open randomized study study was undertaken with MAL-PDT for nBCC. Lesions in 66 Study designEuropean multicentre, Number of patients enrolled Primary aims Key results CR, complete response; sBCC, superﬁcial BCC; nBCC, nodular BCC. MAL was applied at 160 mg g

Table 1 patients (33 in each group) were treated with two sessions

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 MAL-PDT in AK and BCC, P. Lehmann 797

1 week apart with placebo-PDT or MAL-PDT using sion.35 The cosmetic outcome at 60 months for patients in CR ) ) 160 mg g 1 cream and 75 J cm 2 red light (570–670 nm) was rated by investigators as good or excellent in 87% for after surface debridement. Lesions with a partial response at MAL-PDT vs. 53% in the surgery group. 3 months were re-treated. Six months after the last PDT, the lesion sites, including 3-mm margin, were excised. Serial Comparative studies: superficial basal cell carcinoma sectioning of the tissue specimens was performed for histological evaluation. MAL-PDT was shown to be superior to placebo- An open-label randomized study involving 120 patients com- PDT (P <0Æ001). Seventy-three per cent of the lesions in the pared treatment of sBCC with MAL-PDT or cryotherapy.40 In MAL-PDT group and 21% in the placebo-PDT group showed total, 60 patients were treated with standard MAL-PDT and no signs of malignancy at histological evaluation. The cosmetic 58 treated with two freeze-thaw cycles of cryotherapy. In outcome in lesions with a CR was graded as good or excellent the MAL-PDT group, lesions with non-CR at 3 months in 95% of patients by the investigators and 100% by the (22%) were re-treated. Efficacy analysis was conducted on patients. In addition, the majority of patients who had pre- data from 115 patients, as well as recurrence rate, cosmetic viously undergone other treatment modalities expressed a pre- outcome and safety. Results indicated that lesion CR rates at ference for MAL-PDT. Adverse effects were predominantly local 3 months were similar with MAL-PDT and cryotherapy (97% phototoxic effects of mild-to-moderate intensity and of short vs. 95%, respectively). At 48 and 60 months the CR was duration. similar for MAL-PDT and cryotherapy (76% vs. 75% and In another study with a similar design, 45 BCC lesions in 75% vs. 74%, respectively). At 12 months 8% of the lesions 33 subjects received MAL-PDT while 41 BCC lesions in 32 initially cleared with MAL-PDT had recurred, vs. 16% after patients received placebo-PDT.37 Surface debridement and cryotherapy. At 48 months 22% of the lesions initially slight lesion debulking were performed prior to cream appli- cleared with MAL-PDT had recurred, vs. 19% after cryothera- cation for both treatment groups. At 6 months, histological py. There were no new recurrences after 48 months and the evaluation showed that 78% of patients in the MAL-PDT 60-month recurrence rate for MAL-PDT was 22% vs. 20% group and 33% in the placebo-PDT group had no signs of for cryotherapy.42 malignancy. Overall lesion CR was 80% for MAL-PDT vs. 51% Cosmetic outcome was again superior with MAL-PDT than for placebo-PDT (P <0Æ001). It was estimated that there with cryotherapy.40 An excellent or good outcome at could be a potential for recurrence in 12Æ5% of patients. 3 months was reported by 87% of MAL-PDT-treated patients Investigator-assessed cosmetic outcome was excellent or good compared with 49% of cryotherapy-treated patients. At in 93% of MAL-PDT sites vs. 90% for placebo-PDT sites. 12, 48 and 60 months superior cosmesis with MAL-PDT was Erythema, burning, stinging and pain were of mild-to-moder- maintained.42 ate intensity in both groups. The thickness of the skin lesion sometimes makes nBCC dif- Bowen’s disease ficult to treat and surgical excision is the conventional treatment. Although associated with excellent clinical outcomes, A recent comparative trial has evaluated MAL-PDT compared surgery can result in scarring and loss of healthy tissue. MAL- with placebo, cryotherapy and 5-fluorouracil (5-FU) in the PDT was compared with excision surgery in an open-label, treatment of Bowen’s disease.45 Patients with histologically randomized study involving 101 patients: 52 received MAL- confirmed, previously untreated Bowen’s disease lesions were ) PDT (two treatment sessions at a 1-week interval) and 49 treated with either one cycle of 160 mg g 1 MAL-PDT (96 underwent excision surgery.38 The majority of patients had patients, 124 lesions), placebo-PDT (17 patients, 24 lesions), one lesion, usually < 15 mm diameter, located on the face, a single freeze-thaw cycle (82 patients, 91 lesions) or 5-FU scalp or neck. Lesions with non-CR (22%) at 3 months in the applied once daily for 1 week then twice daily for 3 weeks MAL-PDT group were re-treated. All patients were included in (30 patients, 36 lesions). At 3 months 91% of MAL-PDT the intention-to-treat analysis; the per-protocol analysis patients had responded compared with 27% with placebo, included 97 patients (50 patients in the MAL-PDT group with 87% with cryotherapy and 81% with 5-FU. Lesion CR rates 53 lesions and 47 patients in the surgery group with 52 were 93% with MAL-PDT, 21% with placebo-PDT, 86% with lesions). MAL-PDT treatment of nBCC was shown to be non- cryotherapy and 83% with 5-FU. MAL-PDT demonstrated a inferior to simple excision surgery. At 3 months after the last superior cosmetic result to cryotherapy, as evaluated by both treatment 48 of 53 (91%) lesions treated with MAL-PDT and investigator and blinded assessor. At 24 months following 51 of 52 (98%) lesions in the surgery group had a CR.39 At final treatment lesion CR rates were 68% (76 of 111) for 36 months the CR was 79% for MAL-PDT and 96% for sur- MAL-PDT, 11% (two of 19) for placebo-PDT, 60% (68 of gery. Overall, cosmetic outcome was rated by investigators as 114) for cryotherapy and 59% (68 of 114) for 5-FU.46 The good or excellent in 84% for MAL-PDT vs. 36% in the surgery percentage CR with an excellent or good cosmetic outcome group. No new recurrences were observed 36 months after was 98% for MAL-PDT, 100% placebo-PDT, 70% cryotherapy MAL-PDT treatment. In the 60-month follow-up study the CR and 100% 5-FU. Adverse events were mainly local and tran- for MAL-PDT vs. surgery was 77% and 96%, respectively. The sient with mild-to-moderate intensity. No serious adverse 60-month recurrence rate was 14% vs. 4% for simple exci- events were reported with MAL-PDT and two serious treat-

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 798 MAL-PDT in AK and BCC, P. Lehmann ment-related adverse events were reported with cryotherapy lesions). Of note, the single session with MAL-PDT used in (lymphangitis and necrosis). this study resulted in a lesion CR rate at 3 months that was comparable with cryotherapy (69% vs. 75% with MAL-PDT and cryotherapy, respectively). Thin lesions located on the Actinic keratoses face or scalp had the highest CR rates (80% and 82% for Treatment of AK with MAL-PDT was investigated in six clin- MAL-PDT and cryotherapy, respectively). The cosmetic out- ical studies47–51 (Table 2). come was greater for MAL-PDT compared with cryotherapy (96% vs. 81%) and most patients stated a preference for MAL-PDT. Placebo-controlled studies An intraindividual right/left comparison in 119 patients of Efficacy, cosmetic outcome and patient satisfaction with MAL- one MAL-PDT session vs. a double freeze-thaw cycle of cryo- PDT were investigated in two placebo-controlled, multicentre therapy revealed the percentage of patients with CR at studies involving a total of 119 patients, of whom 62 were 6 months who had required re-treatment at 3 months to be treated with MAL-PDT.47 In the larger of these studies invol- 10% for MAL-PDT and 21% for cryotherapy.50 At 3 months ving 80 patients with thin to moderately thick AK lesions on lesion CR was seen in 83% of lesions treated with one MAL- the face and scalp, 42 patients (260 lesions) were treated with PDT session compared with 72% receiving double freeze-thaw standard MAL-PDT and 38 received placebo (242 lesions).47 A therapy. Cosmetic outcome at 6 months was assessed as excel- significantly higher lesion CR rate at 3 months was reported lent in 77% of MAL-PDT-treated patients compared with 50% in patients treated with MAL-PDT compared with placebo of those receiving cryotherapy. (89% vs. 38%, P <0Æ001). CR rates with MAL-PDT were Standard treatment with MAL-PDT (i.e. two treatments similar in mild and moderate AK lesions. Again, cosmetic out- 1 week apart) in 88 patients with 360 lesions has also been come with MAL-PDT was excellent or good in 97% of patients compared with a single freeze-thaw cycle of cryotherapy (89 assessed by the investigator and 91% as assessed by the patients with 421 lesions) or placebo-PDT (23 patients with patients themselves. Patient satisfaction was also high, with 74 lesions).51 At 3 months, overall lesion CR rates were signi- 73% of 32 patients who had previously undergone other treat- ficantly higher in patients treated with MAL-PDT than cryo- ment indicating a preference for MAL-PDT. therapy or placebo-PDT (91% vs. 68% and 30%, P <0Æ001). Particularly good results were obtained with thin lesions (96% vs. 63% with cryotherapy), especially on the face (95% vs. Regimen comparison 70% with cryotherapy). Cosmetic outcome was assessed by Superiority of two MAL-PDT sessions 1 week apart over one investigator as excellent in 83% of MAL-PDT-treated pati- treatment session for the treatment of AK was established in ents compared with 51% of those receiving cryotherapy an open-label, prospective study.48 Two hundred and eleven (P <0Æ001); respective patient assessments were 76% vs. 56% patients with 413 AK lesions of varying thickness from thin (P ¼ 0Æ013). to moderately thick were randomized to either single )1 160 mg g MAL-PDT (n ¼ 105) or two treatments 1 week Discussion apart (n ¼ 106). Lesion CR rates were similar for thin lesions (93% with single MAL-PDT, 89% with double treat- As a treatment modality, PDT has been of interest to clinicians ment), but were greater for thicker lesions following double since the beginning of the 20th century; however, it has only treatment (84% vs. 70% with single treatment). There was gained popularity in recent years. Use of porphyrin precursors no evidence of cumulative local phototoxicity following of low molecular weight allows selective penetration of abnor- repeated PDT; most local adverse events were of mild-to- mal epidermis overlying skin tumours. The ability to use top- moderate intensity and relatively short duration. The authors ical preparations has removed the problems of prolonged concluded that a single treatment can be effective in thin photosensitivity seen with earlier systemic preparations.1 The AK, but that repeated treatment is preferable for thicker current agents available include 5-aminolaevulinic acid (ALA) lesions. and MAL. Although no direct comparative clinical studies have been performed with these two agents, a comparative study of porphyrin metabolite formation at 1 and 6 h after application Active comparator studies of either ALA or MAL to human AK and normal skin was car- Three open-label, randomized controlled studies involving ried out.25 It was found that both reagents induced higher 521 patients compared MAL-PDT with cryotherapy; 309 porphyrin levels in AK than in normal skin. However, the patients received MAL-PDT.49–51 In total, 202 patients with ratio of porphyrins (AK/normal skin) was higher with MAL 732 multiple facial or scalp lesions of thin to thick depth were (8Æ7) than with ALA (5Æ1), indicating that MAL has higher included in one study.49 Patients were randomized to one of lesion selectivity. Additionally, penetration enhancers such as two treatments: either single application of MAL-PDT followed dimethylsulphoxide are required for ALA when treating nBCC by illumination (102 patients with 384 lesions) or a double lesions as ALA does not penetrate the full depth of the freeze-thaw cycle of cryotherapy (100 patients with 348 lesion.52

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 ora Compilation Journal 07TeAuthor The 2007 07BiihAscaino Dermatologists of Association British 2007

Table 2 Summary of reviewed studies on methyl aminolaevulinate–photodynamic therapy (MAL-PDT) in actinic keratosis (AK)

Number of Number treated Study design Comparator group patients enrolled with MAL-PDT Primary aims Key results U.S. multicentre randomized, Placebo 80 42 Efﬁcacy, cosmetic outcome High CR rate with MAL-PDT (89% vs. 38% with placebo, P <0Æ001) double-blind study47 and patient satisfaction Excellent or good cosmetic outcome in 97% (investigator assessed)/91% (patient assessed) of MAL-PDT-treated patients 73% of patients rated MAL-PDT more satisfactory than previous treatments Open-label, prospective Single MAL-PDT session 211 106 CR Efﬁcacy of MAL-PDT double application was similar to single application study. Two MAL-PDT (89% vs. 93%, respectively) for thin lesions but less for thick lesions sessions 1 week apart48 (84% vs. 70%)

• European multicentre open, Cryotherapy (double 202 102 CR, cosmetic outcome and CR for MAL-PDT was similar to cryotherapy (69% vs. 75%) following rts ora fDermatology of Journal British randomized study. freeze-thaw) patient satisfaction single application One MAL-PDT application49 Superior cosmetic outcome with MAL-PDT (96% vs. 81%) Most patients preferred MAL-PDT to previous treatments Multicentre, randomized, Cryotherapy (double 119 119 CR, cosmetic outcome CR for MAL-PDT and cryotherapy was 83% and 72%, respectively at intraindividual (right-left) freeze-thaw) and patient satisfaction 3 months and 86% and 83%, respectively at 6 months study. One MAL-PDT Percentage CR lesions at 6 months requiring re-treatment at 3 months application50 was 10% for MAL-PDT and 21% for cryotherapy Superior cosmetic outcome with MAL-PDT (77% vs. 50%) 2007 Randomized, reference- Cryotherapy (single 200 88 CR, cosmetic outcome CR at 3 months for MAL-PDT was superior to cryotherapy or placebo-PDT and placebo-controlled, freeze-thaw) or (91% vs. 68% and 30%, P <0Æ001) 156,

parallel-group placebo-PDT Superior cosmetic outcome for MAL-PDT vs. cryotherapy (83% vs. 51%, Lehmann P. BCC, and AK in MAL-PDT

pp793–801 multicentre study. P <0Æ001 investigator assessed/76% vs. 56%, P ¼ 0Æ013 patient assessed) Two MAL-PDT sessions 1 week apart51

) CR complete response. MAL was applied at 160 mg g 1 . 799 800 MAL-PDT in AK and BCC, P. Lehmann

The more tumour-selective MAL has led to extensive inves- 2 Wong CSM, Strange RC, Lear JT. Basal cell carcinoma. BMJ 2003; tigation of PDT as a more cosmetically acceptable alternative 327:794–8. to surgery in skin tumours. Although surgical excision can 3 Diepgen TL, Mahler V. The epidemiology of skin cancer. Br J Dermatol 2002; 146:1–6. provide 5-year cure rates of 95% or better when performed 4 Schmook T, Stockfleth E. Current treatment patterns in non- by an experienced physician, scarring is often not acceptable melanoma skin cancer across Europe. J Dermatol Treat 2003; 1 to the patient. Indeed a discrete-choice experiment conducted 14 (Suppl. 3):3–10. with members of the Australian general public has found that 5 Marks R. Epidemiology of nonmelanoma skin cancer and solar patients are willing to pay for the better cosmetic outcomes keratoses in Australia: a tale of self-immolation in Elysian fields. provided by MAL-PDT rather than receive simple excision for Australas J Dermatol 1997; 38:S26–9. BCC.53 When the differences in CR rates were considered, 6 Albert MR, Weinstock MA. Keratinocyte carcinoma. CA Cancer J Clin 2003; 53:292–302. their willingness to pay did not change significantly, indica- 7 Freedberg IM, Eisen AZ, Wolff K, Austen KF, Goldsmith LA, Katz ting that cosmetic outcome is an important consideration for SI, Fitzpatrick TB (editors). Fitzpatrick’s Dermatology in General Medicine, patients when deciding upon treatments. 5th edn. New York: McGraw-Hill, 1999. The principal adverse event associated with PDT is pain, 8 McCormack CJ, Kelly JW, Dorevitch AP. Differences in age and typically a burning, stinging and prickling sensation during body site distribution of the histological subtypes of basal cell car- illumination, which usually resolves quickly but can persist cinoma. A possible indicator of differing causes. Arch Dermatol 1997; for up to 24 h and rarely up to several days.54 A double- 133:593–6. 9 Lo JS, Snow SN, Reizner GT et al. Metastatic basal cell carcinoma: blind randomized study in tape-stripped normal forearm report of twelve cases with a review of the literature. J Am Acad Der- skin found MAL-PDT to be significantly less painful than matol 1991; 24:715–19. ALA-PDT, with pain scores of 4Æ2 vs. 2Æ7 during, 2Æ3 vs. 10 Harvey I, Frankel S, Marks R et al. Non-melanoma skin cancer and 1Æ5 immediately after and 0Æ4 vs. 0Æ2 at 24 h after treat- solar keratoses. I. Methods and descriptive results of the South ment, respectively.55 However, pain should be discussed Wales Skin Cancer Study. Br J Cancer 1996; 74:1302–7. with the patient before commencing treatment and pain 11 Drake LA, Ceilley RI, Cornelison RL et al. Guidelines of care for management strategies implemented as required.55 Often actinic keratoses. J Am Acad Dermatol 1995; 32:95–8. 12 Schwartz RA. The actinic keratosis. A perspective and update. cooling the site of illumination with cold air or water pro- Dermatol Surg 1997; 23:1009–19. vides sufficient pain relief in the majority of patients and 13 Czarnecki D, Meehan CJ, Bruce F, Culjak G. The majority of cuta- local anaesthetic can be reserved for those experiencing neous squamous cell carcinomas arise in actinic keratoses. J Cutan more severe pain. Med Surg 2002; 6:207–9. Various studies exist for MAL-PDT in the management of 14 Ortonne JP. From actinic keratoses to squamous cell carcinoma. Br NMSC, providing a treatment option for AK, BCC and Bowen’s J Dermatol 2002; 146 (Suppl. 61):20–3. disease. MAL-PDT offers the advantage of ambulatory, nonin- 15 Osborne JE. Skin cancer screening and surveillance. Br J Dermatol 2002; 146:745–54. vasive, standardized therapy applied under physician control, 16 Hurwitz RM, Monger LE. Solar keratosis: an evolving squa- with no compliance issues and side-effects limited to a few mous cell carcinoma. Benign or malignant? Dermatol Surg 1995; days. Excellent results have been reported, with recurrence 21:184. rates in sBCC comparable with cryosurgery, as demonstrated 17 Lober BA, Lober CW. Actinic keratosis is squamous cell carcinoma. recently in a long-term follow-up trial (60 months). MAL- South Med J 2000; 93:650–5. PDT has the potential of becoming a therapy with equal 18 Callen JP. Statement on actinic keratoses. J Am Acad Dermatol 2000; effectiveness to classical therapeutic modalities but without the 42:S25–8. 19 Burova EP. Bowen’s disease incorrectly diagnosed as psoriasis: a case report detail- complications of scar formation, requirement for grafts, need ing a modified diagnosis and successful treatment with photodynamic therapy using for repetitive treatments over longer time periods or pigmen- methyl aminolevulinate (MAL-PDT). Poster presented at 10th World Con- tary changes. MAL-PDT also offers an efficient way to treat gress on Cancers of the Skin, Vienna, 2005; P118. BCC or Bowen’s disease in patients with a high risk of surgical 20 Szeimies RM, Abels C, Fritsch C et al. Wavelength dependency of complications. photodynamic effects after sensitization with 5-aminolevulinic acid Currently, MAL-PDT is approved for use in AK and NMSC in vitro and in vivo. J Invest Dermatol 1995; 105:672–7. (sBCC, nBCC and BCC unsuitable for other available therapies 21 Brown SB. The role of light in the treatment of nonmelanoma skin cancer using methyl aminolevulinate. J Dermatol Treat 2003; 14 due to possible treatment-related morbidity and poor cosmetic (Suppl. 3):11–14. outcome) in 26 European countries, Australia and New Zea- 22 Lehmann P. Kutane Photosensibilisierung und Photoprotektion. In: land. It was recently approved for Bowen’s disease. This new Klinische Fluoreszenzdiagnostik und Photodynamische Therapie (Szeimies RM, indication is approved in 22 European Union/European Eco- Jocham D, Landthaler M, eds). Berlin: Blackwell Verlag, 2003; nomic Area countries. 372–82. 23 Morton CA, Brown SB, Collins S et al. Guidelines for topical photodynamic therapy: report of a workshop of the British References Photodermatology Group. Br J Dermatol 2002; 146:552–67. 24 Dougherty TJ, Cooper MT, Mang TS. Cutaneous phototoxic occur- 1 Szeimies RM, Morton CA, Sidoroff A, Braathen LR. Photodynamic rences in patients receiving Photofrin. Lasers Surg Med 1990; therapy for nonmelanoma skin cancer. Acta Derm Venereol (Stockh) 10:485–8. 2005; 85:483–90.

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 MAL-PDT in AK and BCC, P. Lehmann 801

25 Fritsch C, Homey B, Stahl W et al. Preferential relative porphyrin European Academy of Dermatology and Venereology, London, enrichment in solar keratoses upon topical application of delta- October 2005. aminolevulinic acid methylester. Photochem Photobiol 1998; 68:218– 40 Basset-Seguin N, Ibbotson S, Emtestam L et al. Photodynamic 21. therapy using Metvix is as efficacious as cryotherapy in BCC, 26 Peng Q, Soler AM, Warloe T et al. Selective distribution of porphy- with better cosmetic results. J Eur Acad Dermatol Venereol 2001; rins in skin thick basal cell carcinoma after topical application 15 (Suppl. 2):226 (Abstract). of methyl 5-aminolevulinate. J Photochem Photobiol B Biol 2001; 41 Basset-Seguin N, Ibbotson S, Emtestam L et al. MAL-PDT versus cryo- 62:140–5. therapy in primary sBCC: results of a 48 months follow-up. Poster presented 27 Sorensen R, Juzenas P, Iani V et al. Formation of protoporphyrin IX at the 10th World Congress on Cancers of the Skin, Vienna, May in mouse skin after topical application of 5-aminolevulinic acid 2005; P116. and its methyl ester. SPIE 1998; 3563:77–81. 42 Basset-Seguin N, Ibbotson S, Emtestam L et al. MAL-PDT versus cryo- 28 Braathen L, Paredes B, Fro¨lich K et al. A dose finding study of phototherapy for treatment of primary superficial basal cell carcinoma: dynamic therapy (PDT) with Metvix in actinic keratosis (AK). J Eur results of a five year prospective randomized trial. Poster presented Acad Dermatol Venereol 2000; 14 (Suppl. 1):38. at the 3rd Meeting of the European Association of Dermato-Oncol- 29 Basset-Seguin N, Bachmann I, Pavel S et al. A dose finding study ogy Rome, June 23–25, 2006. JID 2006; 126(Suppl. 2): 534. of photodynamic therapy (PDT) with Metvix in patients with 43 Vinciullo C. MAL-PDT in ‘difficult-to-treat’ basal cell carcinoma, an basal cell carcinoma (BCC). J Eur Acad Dermatol Venereol 2000; Australian study: 48 month follow-up data. Poster presented at the 14 (Suppl. 1):39. 3rd Meeting of the European Association of Dermato-Oncology 30 Angell-Petersen E, Sorensen R, Warloe T et al. Porphyrin forma- Rome, June 23–25, 2006. JID 2006; 126(Suppl. 2): 534. tion in actinic keratosis and basal cell carcinoma after topical 44 Swanson NA. Mohs surgery. Arch Dermatol 1983; 119:761–73. application of methyl 5-aminolevulinate. J Invest Dermatol 2006; 45 Morton CA. Topical photodynamic therapy for Bowen’s disease. 126:265–71. Australas J Dermatol 2005; 46:S1. 31 Soler AM, Warloe T, Berner A et al. A follow-up study of recur- 46 Morton CA, Horn M, Leman J et al. A randomised, placebo-controlled, Euro- rence and cosmesis in completely responding superficial and pean study comparing MAL-PDT with cryotherapy and 5-fluorouracil in subjects nodular basal cell carcinomas treated with methyl-5-aminolaevuli- with Bowen’s disease: results from a 24 months follow-up. Poster presented at nate-based photodynamic therapy alone and with prior curettage. the 10th World Congress on Cancers of the Skin, Vienna, May Br J Dermatol 2001; 145:467–71. 2005; P129. 32 Horn M, Wolf P, Wulf HC et al. Topical methyl aminolaevulinate 47 Pariser DM, Lowe NJ, Stewart DM et al. Photodynamic therapy with photodynamic therapy in patients with basal cell carcinoma prone topical methyl aminolevulinate (Metvix) is effective and safe in to complications and poor cosmetic outcome with conventional the treatment of actinic keratosis: results of a prospective random- therapy. Br J Dermatol 2003; 149:1242–9. ized trial. J Am Acad Dermatol 2003; 48:227–32. 33 Vinciullo C, Elliott T, Francis D et al. Photodynamic therapy with methyl 48 Tarstedt M, Rosdahl I, Berne B et al. A randomized multicenter aminolevulinate 160 mg/g cream in patients with basal cell carcinoma with a risk study to compare two treatment regimens of topical methyl ami- of complications and poor cosmetic outcome using conventional therapy. Poster nolevulinate (Metvix)-PDT in actinic keratosis of the face and presented at 9th World Congress of Cancers of the Skin, Seville, scalp. Acta Derm Venereol (Stockh) 2005; 85:424–8. May 2003. 49 Szeimies RM, Karrer S, Radakovic-Fijan S et al. Photodynamic ther- 34 Vinciullo C, Elliott T, Francis D et al. Photodynamic therapy with apy using topical methyl 5-aminolevulinate compared with cryo- topical methyl aminolaevulinate for ‘difficult-to-treat’ basal cell therapy for actinic keratosis: a prospective, randomized study. JAm carcinoma. Br J Dermatol 2005; 152:765–72. Acad Dermatol 2002; 47:258–62. 35 Rhodes LE, De Rie M, Enstro Y et al. A randomized European com- 50 Morton C, Campbell S, Gupta G et al. Intraindividual, right-left parison of MAL-PDT and excision surgery in nodular basal cell comparison of topical methyl aminolaevulinate–photodynamic carcinoma: Results from a 60 month follow-up study. Poster pre- therapy (MAL-PDT) and cryotherapy in subjects with actinic kera- sented at the 3rd Meeting of the European Association of Dermato- toses: a multicentre, randomized controlled study. Br J Dermatol Oncology Rome, June 23–25, 2006. JID 2006; 126(Suppl. 2): 2006; 155:1029–36. 534. 51 Freeman M, Vinciullo C, Francis D et al. A comparison of photo- 36 Foley P, Freeman M, Siller G et al. A phase III randomized study dynamic therapy using topical methyl aminolevulinate (Metvix) comparing photodynamic therapy (PDT) using Metvix or placebo with single cycle cryotherapy in patients with actinic keratosis: a cream in nodular basal cell carcinoma (BCC). Australas J Dermatol prospective, randomized study. J Dermatol Treat 2003; 14:99–106. 2003; 44:A5. 52 Warloe T, Peng Q, Heyerdahl H et al. Photodynamic therapy with 37 Tope WD, Menter A, El-Azhary RA et al. Comparison of topical methyl 5-aminolevulinic acid induced porphyrins and DMSO/EDTA for aminolevulinate photodynamic therapy versus placebo photodynamic therapy in nod- basal cell carcinoma. SPIE 1994; 2371:226–35. ular BCC. Poster presented at the 13th Congress of the European 53 Weston A, FitzGerald P. Discrete choice experiment to derive will- Academy of Dermatology and Venereology, Florence, November ingness to pay for methyl aminolevulinate photodynamic therapy 2004. versus simple excision surgery in basal cell carcinoma. Pharmacoeco- 38 Rhodes LE, de Rie M, Enstro¨mYet al. Photodynamic therapy using nomics 2004; 22:1195–208. topical methyl aminolevulinate vs surgery for nodular basal cell 54 Wennberg AM. Pain, pain relief and other practical issues in carcinoma: results of a multicentre randomised prospective trial. photodynamic therapy. Australas J Dermatol 2005; 46:S4–5. Arch Dermatol 2004; 140:17–23. 55 Wiegell SR, Stender IM, Na R, Wulf HC. Pain associated with 39 Rhodes LE, de Rie M, Enstro¨mYet al. A randomized European comparison photodynamic therapy using 5-aminolevulinic acid or 5-aminolev- of MAL-PDT and excision surgery in nodular basal cell carcinoma: results from a ulinic acid methylester on tape-stripped normal skin. Arch Dermatol 36 months follow-up. Poster presented at the 14th Congress of the 2003; 139:1173–7.

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp793–801 MEETING REPORT DOI 10.1111/j.1365-2133.2007.07761.x Updates from the British Association of Dermatologists 86th Annual Meeting, 4–7 July 2006, Manchester, U.K. A. Birnie, S. Langan, J.S.C. English and D.J. Eedy* Queen’s Medical Centre, Nottingham University Hospitals, Nottingham, U.K. *Craigavon Area Hospital Group, Portadown, N. Ireland, U.K.

Summary

Correspondence Here we provide a synopsis of the main clinical and research advances in clinical, J.S.C. English. epidemiological and biological dermatology that were presented at the meeting E-mail: [email protected] of the British Association of Dermatologists (BAD) held during 4–7 July 2006, in Manchester, U.K. Only the more important advances or summaries of findings Accepted for publication 3 January 2007 are mentioned. The meeting was held at the Manchester International Conference Centre (Fig. 1). The annual dinner was held at Manchester Town Hall, in the Key words Great Hall decorated with magnificent murals by Ford Madox Brown, with contact dermatitis, eczema, psoriasis, scientific Dr Susan Burge as host. meeting, skin cancer, update

Conﬂicts of interest D.J.E has received fees for speaking and chairing meetings from 3M Pharmaceuticals and is an advisor to Novartis (U.K.). A.B., S.L, J.S.C.E have no conﬂict of interest to declare.

the discovery of filaggrin (FLG) gene mutations in eczema.1,2 Briefly, the FLG gene product is a key component of the kera- tohyalin granules which are an important component of the skin barrier. It is estimated that up to 50% of children with eczema may carry one or two mutations in the FLG gene. Indi- viduals carrying one null allele for FLG make only 50% of the normal amount of FLG. Often these individuals have a mild form of ichthyosis vulgaris and are at risk for eczema. Individ- uals who have two null alleles make no FLG and have a more severe form of ichthyosis vulgaris and are at greater risk of eczema. The frequency of the null allele in the population is 10%; 63% of FLG null allele carriers will have eczema by 3 years of age. Ardern-Jones et al.3 examined the immunological basis for eczema and demonstrated that the staphylococcal superantigen, staphylococcal enterotoxin B (SEB), enhanced the aller- Fig 1. Manchester International Conference Centre. gen-specific immune response to the house dust mite allergen Der p1. They proposed that infection and allergens may act synergistically in eczema. Eczema

Aetiology Diagnosis

Professor Hovnanian introduced the topic using Netherton With relation to the diagnosis of eczema, research in South syndrome as a disease model for eczema. This was followed Africa demonstrated poor validity of the full questionnaire by a lecture by Dr Alan Irvine presenting the recent break- version of the U.K. diagnostic criteria in that setting.4 They through in our understanding of the basis of this disease with did show that visible ﬂexural eczema performed well as a

2007 The Authors 802 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al. 803 diagnostic tool. Looking at disease severity, an investigative identify a new role for NR4A receptors in the control of gene group in Hong Kong showed poor correlation between clin- expression during inflammation. Their results suggested that ical severity as assessed using the SCORing Atopic Dermatitis CRH, via CRH-R1a, mediated induction of NURR1 and that it (SCORAD) score and the Nottingham Eczema Severity Score may play a part in the pathogenesis of psoriasis and lend (NESS) and quality of life, assessed using the Chinese version further support for a role of the brain–skin axis in psoriatic of the Children’s Dermatology Life Quality Index (CDLQI).5 inflammation. Understandably it is always difficult to know why some patients respond well to methotrexate and others do not. Cam- Management palani et al.14 from St John’s Institute of Dermatology Research Looking at aspects of treatment, two groups from Newcastle Unit may have helped us to understand this. They looked at and Brighton examined the role of nurses in treating paediat- polymorphisms in folate, pyrimidine and purine metabolism ric eczema.6,7 The former group showed a reduction in and their relationship with methotrexate efficacy and toxicity admissions for eczema since the introduction of a nurse-led in patients with psoriasis. It has been shown in patients with follow-up service while the latter group showed a reduction rheumatoid arthritis that there are polymorphisms in the in primary care consultations for eczema after introduction of enzymes involved in folate, pyrimidine and purine metabolism a community based service. that influence the clinical response to methotrexate. They A group from Newcastle presented promising results from looked at this in patients with psoriasis and demonstrated an open-label study of methotrexate (doses 10–22Æ5mg potential evidence that specific polymorphisms of enzymes weekly) in 10 adults with moderate to severe atopic involved with folate, pyrimidine and purine have a significant eczema.8,9 They showed improvements in disease severity, effect on the clinical response to methotrexate and could poss- quality of life and affected body surface area and highlighted ibly be used as markers for predicting methotrexate efficacy the need for a randomized controlled trial to confirm and toxicity in patients with psoriasis. efficacy. The relationship between elevated antistreptolysin O (ASO) The Hong Kong group highlighted the problem of gluco- titres and flares of psoriasis has long been known, with the corticoid (GC) phobia in their patients, describing a prevalence classic streptococcal sore throat and guttate psoriasis develop- of 40% in mild and 60% in moderate and severe eczema.10 ing afterwards. However, Fairhurst and Goodfield from Leeds This problem was also a reason for the use of alternative medi- identified 10 patients with elevated ASO titres but no evidence cine (herbal and homeopathy) in 42% of children with of streptococcal infection who continued to have flares of eczema in a study from Dublin.11 The role of latex allergy was psoriasis despite antitumour necrosis factor (TNF)-a therapy.15 highlighted by a case series of seven children with severe They suggested that following anti-TNF-a therapy the ASO resistant eczema where latex allergy played a significant role.12 antibody begins to act as an autoantibody stimulating further Dr Rosemary Lever discussed the role of food allergies in psoriasis activity. eczema and key features to monitor for its detection; she also highlighted the need to work with dieticians and to monitor Clinical aspects of psoriasis height and weight with any dietary intervention. It is unusual to have to manage children with severe plaque pso- 16 Psoriasis riasis. Collin et al. from Birmingham presented 10 children with severe plaque psoriasis treated with methotrexate. The conclusions were that, as in adults, methotrexate treatment is Pathogenesis warranted for severe psoriasis and is safe when it is closely O’Kane et al.13 from Dublin presented a poster of their monitored. One of the patients who was an obese child research looking at altered expression of corticotrophin releas- developed fatty infiltration and methotrexate had to be stopped. ing hormone, corticotrophin releasing hormone receptor and It is unusual to measure the effectiveness of guidelines a nuclear receptor factor NURR1 in psoriasis. With increasing when disseminated to primary care. Professor Griffiths et al.17 applications of DNA technology such as polymerized chain from Manchester have looked in an objective manner at the reaction more detailed understanding of the pathogenesis of impact of psoriasis guidelines and appropriateness of referral psoriasis is being explored. They looked at the neuropeptide from primary to secondary care. They did this with a random- corticotrophin releasing hormone (CRH) and its receptor ized controlled trial at a cluster of health centres and derma- (CRH-R1a). They are found in the skin and mediate local tology departments in the Manchester area and found that inflammatory responses to noxious stimuli. The pro-inflamma- dissemination of guidelines on the management of psoriasis tory effects of peripheral CRH include activation of lym- did significantly enhance the appropriateness of the referral of phocytes and mast cells and modulation of angiogenesis, patients to secondary care. immunopathological features seen in psoriasis. It is known Hampton and Reynolds18 from Newcastle presented their that in psoriatic arthritis synovial CRH and CRH-R1a are up- experience of fumaric acid in 17 patients, nine of whom were regulated and that CRH signals through the orphan nucleo- continuing to take the treatment. The majority did respond receptor NURR1 (now NR4A2). There are reports that either well or partially. However, all patients experienced

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 804 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al. some side effects and they all developed a relative lympho- is that hydrophilic drugs are poorly absorbed when applied penia. Two patients experienced a severe lymphopenia, with topically because of the low partitioning through the lipid ) CD4 counts falling below 200 · 106 L 1, requiring cessation matrix and stratum corneum.27 They were able to demonstrate of therapy and co-trimoxazole prophylaxis until recovery. The that percutaneous absorption of a hydrophilic molecule can be conclusions were that significant lymphopenia can occur and significantly increased in the presence of eccrine sweating. that it is essential to ensure regular monitoring of the white This may well have implications for the future development cell count throughout treatment. of topically applied drugs. Adalimumab is a fully human monoclonal IgG1 antibody Dr Eedy28 from Craigavon Area Hospital Group Trust in against TNF-a in an international multicentre study supported Northern Ireland reminded us that Down syndrome patients by Abbot Laboratories (Abbot Park, Illinois, USA). They found have an increased sensitivity to methotrexate because of poly- that adalimumab is efficacious and safe in patients with chro- morphisms in MTHFE, the gene for methylenetetrahydrofolate nic plaque psoriasis who meet the BAD guidelines for biologi- reductase enzyme. This was noticed in Down syndrome cal therapies.19 patients undergoing treatment for various leukaemias where We are all troubled by the expense of the new biological an increased sensitivity to methotrexate is well recognized. therapies for psoriasis and Wyeth Pharmaceuticals (Taplow, Dr Eedy suggests that methotrexate is relatively contraindicated UK) presented data showing that etanercept is highly likely to in Down syndrome patients. be cost effective by U.K. standards when used in accordance Dr Goodfield’s team from Leeds have reported a good with BAD guidelines for the treatment of plaque psoriasis.20 response to efalizumab in four of five patients with discoid Professor Finlay and colleagues reviewed the dermatological lupus erythematosus (DLE); their conclusions were that life quality index (DLQI), assessing the efficacy of biological efalizumab may have good potential for the treatment of treatments in various studies.21,22 We all now have to use the patients with severe recalcitrant DLE.29 DLQI before we can start our patients on these drugs and so this Dr Green and colleagues from Ninewells Hospital, Dundee information is very pertinent. However, they were unable to presented data on an open pilot study of 0Æ1% tacrolimus in compare changes in DLQI scores between the various different the treatment of vulval lichen sclerosus; they reported a good biological agents as the raw data was not presented in the papers response to tacrolimus. However, 40% of patients developed they looked at. It is therefore essential when writing papers that notable short lasting adverse reactions but the majority of include DLQI scores and biological therapies that the raw data is patients were able to continue treatment.30 given. Professor Finlay and colleagues have also developed an Taghipour and James31 from Reading described their extension of DLQI for looking at the impact on the family.23 experience of low dose oral isotretinoin for the treatment of They named their index the Psoriasis Family Index. It is easy to acne vulgaris. They reviewed the safety data of 35 patients understand, administer and complete and it should help to from their pharmacy records who had received more than ) ) measure the secondary impact of psoriasis. 6 months low dose (0Æ04–0Æ3mgkg 1 day 1) oral isotretino- Katugampola et al.24 from Newport presented two patients in. Their conclusions were that long-term low dose isotretino- with severe pustular psoriasis who were found to be allergic in is a highly effective treatment for recalcitrant acne and it to various allergens; avoidance of these allergens led to an appeared to be free from significant side effects. improvement in the control of their pustular psoriasis. One patient was allergic to fragrance and was helped by avoidance Clinical of fragrance, and the other was allergic to medicament and clothing dye allergens and found that avoidance of these led Huq et al.32 from Bradford were able to demonstrate in vitro to significant improvement. It is always worth bearing in faster growing rates for dermal sheath fibroblasts than both mind in a patient with severe psoriasis, that an allergic contact interfollicular fibroblasts or follicular dermofibroblasts. The dermatitis can aggravate the situation. dermal sheath fibroblasts migrated more quickly, thus sup- Rutter et al.25 from Manchester presented the clinical and pho- porting clinical evidence of quicker wound healing rates in tobiological characteristics of patients with photosensitive psori- haired body sites. They recommended incorporating dermal asis; many of us see patients from time to time who have sheath fibroblasts into dermal skin substitute, which could photosensitive psoriasis. They looked at the results of mono- improve wound healing and reduce scarring. chromator light testing of these patients and were able to dem- Two posters concerned cutaneous ulceration from nicoran- onstrate provocation of abnormal responses to UV radiation. dil therapy. Dr Lyon and colleagues from York presented eight They found a pronounced female predominance and an cases of nicorandil-induced perianal and peristomal ulceration association with early-onset psoriasis and with a family history. and Yesudin and Field from Chester and Liverpool presented five cases of oral ulceration associated with nicorandil.33,34 It appears that oral, perianal and peristomal ulceration can occur Therapeutics on nicorandil treatment. We should be aware that any patients Professor Friedman and colleagues from Southampton studied with unexplained ulceration who are on nicorandil should cutaneous microdialysis of the eccrine sweat gland to see if it stop nicorandil and substitute an alternative anti-anginal medi- is a conduit for hydrophilic drug absorption.26 The rationale cation as this will usually induce healing.35

and laboratory based observational studies, which would sup- Miscellaneous port the fact that there is a decline in academic endeavour in Mak et al.36 from the dermatology department at Barts and the U.K. dermatology. London NHS Trust presented a poster on sebaceous gland Professors Griffiths and Kimber combined their teams to hyperplasia. They found this condition common in organ look at the effect of acute experimental stress on cutaneous transplant recipients and very difficult to treat.36 It is not neuroimmunology.42 They found that acute exposure to a exclusively associated with ciclosporin use. social aggressor appears to reduce epidermal Langerhans cell Hackett et al.37 from the Mater Misericordiae Hospital in frequency in human skin and trigger secretion of calcitonin Dublin presented a paper on the prognostic indicators in pyo- gene related peptide and perhaps other neuropeptides. They derma gangrenosum. This was a retrospective study which concluded that cutaneous neuroimmunology is influenced by reviewed patients diagnosed with pyoderma gangrenosum social stress and that this provides further evidence for the over a 20-year period. Their conclusions were that the male existence of a brain skin axis. sex, age at presentation < 60 years, ulcerative or bullous pyo- Have you on occasions wondered whether patients are tak- derma gangrenosum and haematological disease in the setting ing in the information that you are telling them and have of pyoderma gangrenosum were associated with a poor thought that maybe it would be worth setting them a little prognosis. test after the consultation? Dr Veysey et al.43 from Oxford and Professor Mortimer and colleagues from St Georges Hospi- Amersham did just this. They used a telephone questionnaire tal, London presented a study of 30 patients with cellulitis to audit to compare the patients’ recall of instructions about see what percentage had undetected lymphoedema.38 They using topical treatments with the regime recommended in the found that 47% of patients had signs of lymphoedema, inclu- clinical records. They found that the knowledge of topical ding indurated oedema, a positive Stemmer’s sign, increased treatments was very poor despite nearly half of the patients skin markings, papillomatosis and warty hyperkeratosis. They having received written instructions. However, they found that also found abnormal lymphatics in the contralateral limb not the majority of patients were satisfied with the amount of affected by lymphoedema, which suggested that lymphatic information that they were given. It may be that in the future impairment predated the cellulitis. The limitations of the study not only will doctors be assessed but maybe patients will be included the absence of a control group and the possibility assessed as well. that patients more likely to have lymphoedema self-select for Dr de Berker and colleagues from Bristol asked the question a scan, nevertheless the prevalence of lymphoedema is extre- what do patients value the most in the dermatology consulta- mely high in these patients and has implications for the man- tion.44 Their study was designed to quantify the preferences agement of those who have suffered from acute cellulitis. for different attributes of care within dermatology secondary Drs de Berker and Connolly from Bristol studied the inci- care services, including hospital and general practitioners with dence of skin conditions in the beard area in 200 men, and a special interest in dermatology. They found that the attribute their shaving habits, and made recommendations for a good of greatest importance to the patients was the expertise of the shave.39 They found that 98% of these men shave; only 2% doctor, whilst waiting time was of least importance. The grow a beard. A wide variety of shaving techniques were patients who responded were willing to wait at the most an used. The most frequently recommended tips for shaving additional 2Æ1 months to see a team led by an expert, or an included shaving after a shower or bath, with hot water, good additional 1Æ3 months to attend a consultation that was easy razor blades and advice to use plenty of lather and take one’s to get to. Their conclusions were that a reduction in waiting time. times was not the most important issue for patients, the thor- Drs Lanigan and Carter from Birmingham Skin Centre have oughness of the consultation provided and the expertise of the looked at the incidence of acneiform reactions from laser hair clinician were seen as higher priorities. removal and found that approximately 6Æ3% of patients developed acneiform lesions after laser therapy.40 It seems that Paediatric dermatology the Nd:YAG laser is more likely to cause these lesions than those treated with the alexandrite laser. The darker skinned Dr Jenny Powell discussed vulval lichen sclerosus in children individuals showed a higher incidence of acneiform lesions. and the difficulties with differentiating features from sexual They hypothesized that the Nd:YAG laser produces energy that abuse. She highlighted that ‘failure of treatment’ is usually penetrates deep into the skin causing thermal injury nearer the under-treatment and that even labial fusion can respond sebaceous glands and surrounding dermis. to potent topical corticosteroids. If the disease continues Dr Ilchyshyn and colleagues from Walsgrave Hospital, Cov- past puberty, the risks of squamous carcinoma must not be entry asked the question whether it is a myth or true that forgotten. there is a decline of dermatological research in the U.K.41 Dr Atherton highlighted key areas in the management of They found that despite a threefold increase in the number of congenital melanocytic naevi (CMN). A large CMN (> 20 cm) consultants and trainees in the U.K. in the last 35 years there will usually be at least 6 cm at birth. It has been shown that was not a corresponding increase in publications. There the presence of satellite lesions in a large lesion is associated appears to have been a reduction in the number of clinical with an increased risk of melanoma which may often be in

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 806 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al. the central nervous system.45 He highlighted the problems of circulating lymphocytes with skin homing potential. He des- pain, scarring and sepsis following early superficial removal cribed the murine local lymph node assay, which can be used with CO2 resurfacing laser or curettage. to identify the relative potency of allergens, and discussed the Tinea capitis is a common and increasing problem. Poor difference between respiratory sensitizers and cutaneous sensi- compliance with daily treatment regimens may contribute to tizers. Respiratory sensitization is mainly IgE mediated. He the high community carriage rates in endemic populations. described the TH1 response where there was a decrease in IgE A single-blinded randomized controlled trial in South African and a release of interferon (IFN)-c and IL-12. In the TH2 children compared three dose regimens of griseofulvin, once response there is an increase in IgE and a release of IL-4, )5, ) ) daily for 6 weeks (10 mg kg 1), two doses (50 mg kg 1) )10, )13 and )15. IL-10 downregulates TNF-a and hence ) 4 weeks apart and weekly doses (50 mg kg 1) for 6 weeks.46 delays Langerhans cell migration, which explains why it is dif- No difference was seen between groups in terms of mycologi- ficult to sensitize patients with severe atopic dermatitis to con- cal cure rates, maintenance of remission or side effect profile. tact sensitizers. This suggests that an intermittent dosing regimen could be used safely as a public health initiative. Cosmetic allergens A number of study groups presented data on preventative and therapeutic interventions in paediatric dermatology. The A British Contact Dermatitis Society multicentre study looked first of these was a case series looking at sun awareness in a at sensitivity to preservatives in the U.K. between the years transplant cohort (n ¼ 31).47 The key findings were that 2004 and 2005 and compared this with data collected 5-years while the majority of patients recalled receiving sun advice, previously.53,54 The main findings were a reduction in the rate half of them were not aware of the cancer risks and 16% did of positive tests for methyldibromoglutaronitrile from the pre- not use sun protective measures. A further postal survey viously reported rate. They also found that the site most com- looked at compliance with iron therapy in children with epi- monly affected by preservative allergy in both sexes was the dermolysis bullosa (EB) (n ¼ 84, response rate 39%).48 hand; formaldehyde was the commonest allergen found. Twenty-eight of the 33 responders had been prescribed iron, Dr Buckley55 from Swindon looked at fragrance ingredient of whom 23 took the medication as prescribed. Problems with labelling of cosmetic and toiletry products on sale in 2006. the medication were common (71%). The authors concluded The reason for this was that since 2005 in the EU countries that poor compliance was not the main reason for lack of products have to be labelled with 25 individual named fra- efficacy of this intervention in EB. grances if present in concentrations in < 10 parts per million Imiquimod 5% cream was proposed as a useful intervention for leave-on products and < 100 parts per million in rinse-off for infantile haemangiomas on the basis of a case series products. She found that limonene and linalool were the com- (n ¼ 5).49 The authors reported clinically useful responses in monest named fragrances. all of the patients, however in one infant treatment was dis- Connolly et al.56 presented another multicentre study look- continued because of the development of a severe local ing at cosmetics and fragrance allergy in the U.K. and the inflammatory reaction and fever. Some of the mechanisms by pooled data from all the departments that contributed confirms which topical imiquimod may act are through increased pro- that fragrance is the most frequently recorded contact allergen. duction of the anti-angiogenic cytokine interleukin (IL)-12 or White et al.57 from St John’s Institute of Dermatology through increased apoptosis through increased tissue levels of looked at the frequency of allergy to isoeugenol and found tissue inhibitor of metalloproteinase-1.50 that it has not been decreasing as previous reports had sugges- A number of presentations of case series reminded us of the ted. They suspected that the isoeugenol is being substituted spectrum of clinical features associated with the rare diseases, with isoeugenol-related compounds which may degrade to dermatitis artefacta (n ¼ 10) and mucous membrane pemphi- isoeugenol itself when used, or cause cross reactions on test- goid (n ¼ 9).51,52 These highlighted the need for vigilance ing. Unfortunately fragrance mix I does not always pick up and awareness of these unusual disorders. In the dermatitis people who are allergic to isoeugenol; further work with fra- artefacta study, children aged 9–17 years presented with hair grance allergen markers is needed. loss (n ¼ 2), bullae (n ¼ 2), petechiae (n ¼ 2), linear Birnie and English58 from Nottingham presented three cases atrophic scars (n ¼ 1), recurrent facial cellulitis (n ¼ 1) and of contact urticaria to cosmetic products. Contact urticaria is linear unilateral excoriated lesions (n ¼ 1). The varied presen- unusual from cosmetics but they had an individual who was tations increase the diagnostic difficulty. allergic to fragrance, another patient who was allergic to 2-phenoxyethanol and a trainee hairdresser who developed contact urticaria and asthma from paraphenylenediamine Contact dermatitis (PPD). The diagnosis of contact urticaria involves careful his- Professor Kimber gave the Prosser-White lecture at the British tory taking and prick testing. Contact Dermatitis Society meeting. In his talk he explained McFadden et al.59 looked at the incidence of prevalence of about the induction phase for allergic contact dermatitis which contact allergy to permanent hair dye in Thailand. Their study involves clonal expansion and cytokine production, especially showed a higher prevalence of hair dye allergy amongst the IL-1b, TNF-a, b-actin, and the elicitation phase involving normal population than was expected, with surprisingly

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al. 807 frequent new cases of sensitization in a 6-month period. Even is controversial because a genuine positive may be missed if at current legally permitted concentrations of PPD in the hair too low a concentration is used and a genuine positive reac- dyes a significant amount of sensitization was occurring. tion may be suppressed if the concentration is too high. In Recently German dermatologists recommended removing PPD Europe 0Æ1% in petrolatum is used, in the U.K. our advice from the European Standard Series, however, this study pro- would be to favour 1%. The results of the multicentre study vides further evidence that this recommendation is unwise.60 favoured the use of 1% tixocortol pivalate for patch testing. White et al.61 presented a paper in the registrars’ symposium However, if sensitivity to tixocortol pivalate is strongly suspec- on PPD on the role of Bandrowski’s base. They tried to deter- ted, and testing with 1% concentration is negative then a mine the allergenic component of PPD. Their conclusions patch test with 0Æ1% concentration is advised. were that allergic contact dermatitis from PPD may occur via a Dr Bourke and colleagues from Cork in Ireland looked at prohapten and that there was probably a spectrum of antigenic contact dermatitis from corticosteroid enemas in patients with determinants in vivo. They found that Bandrowski’s base was inflammatory bowel disease and found a prevalence of 10%.68 not an important hapten in vivo. They patch tested 29 patients and found three had positive relevant reactions. This may well have implications for the use of systemic as well as local corticosteroids in patients with Patch testing inflammatory bowel disease. It is always difficult to know how many patients should be Those of us who use Trimovate will be aware that sodium referred for patch testing. Bushan and Beck did look at this in metabisulphite is a constituent and also a reasonably frequent 1999.62 Gilmore et al.63 at Thameside General Hospital looked medicament allergen. However, Dr Beck and colleagues from at their referrals to a specialist unit because they did not Manchester have patch tested with sodium metabisulphite on undertake patch testing in their own department. They found their standard series for a number of years and have found that they were probably not referring enough patients as they that not only is it a medicament allergen found in Trimovate had a 76% positive rate where Bushan and Beck’s average rate and Timodine but also it is a quite frequent occupational sen- was 46% and Rietschel in the U.S.A. had a rate of between 30 sitizer found in 26% of their patients.69 The conclusions were and 65%.64 They asked their patients about their satisfaction that sensitization to metabisulphite can occur from parenteral with patch testing and found that in 58% the eczema solutions, and that occupational exposure from food handling improved or cleared as a result of the information gathered so may account for a high number of otherwise unexplained that patch testing was valued. They concluded that they were reactions, apart from medicament reactions to Trimovate and missing unsuspected allergic contact dermatitis because their Timodine. They proposed that sodium metabisulphite is worth referral rate was relatively low. including in the standard series. Professor Gawkrodger and Dr Paul from Sheffield had Rajpar et al.70 from the Birmingham Skin Centre presented a looked at late patch test reactions and tried to differentiate case of an 80-year-old lady with diabetes who had a severe between active sensitization and a delayed elicitation reac- adverse cutaneous reaction from insulin due to cresol sensitiv- tion.65 They defined a late reaction as one that occurred five ity. The clinical presentation was that of a drug-induced atyp- or more days after the patch tests were applied. Unfortunately ical erythema multiforme, vasculitis or immunobullous they were unable to determine from their retrospective study disorder. The histology showed a perivascular infiltrate of whether the late reactions they found in their patients were lymphocytes and eosinophils and several colloid bodies with due to active sensitization or delayed immune response. It is negative immunofluorescence. She did respond partially to nonetheless interesting that some late reactions were perhaps oral prednisolone at 30 mg daily with potent topical steroids not active sensitization. Allergens such as neomycin, sesquiter- but an exacerbation occurred after reducing the steroid dose. pine lactone mix, Compositae mix, tixocortol pivalate are known It was noted that the insulin contained m-cresol and so a para- to cause late reactions on patch testing. bens based insulin was substituted. There was significant improvement within 72 h and almost complete resolution of the cutaneous signs. Unfortunately she died before intradermal Medicament allergy testing to insulin could be performed with a patch test to the Dr Stone and colleagues from Newport presented a poster of m-cresol. She had been previously patch tested and was aller- flexural contact dermatitis from benzalkonium chloride.66 gic to chlorocresol. They described six cases of allergic reactions rather than irrit- Professor Gawkrodger’s team presented a poster showing ant reactions. Sometimes it is difficult to tell the difference in that the frequency of contact allergy from medicaments those patients who have been exposed to benzalkonium chlor- increased with age.71 The commonest allergens were fragrance ide in antiseptic bath emollients. The authors would encour- mix, lanolins, balsam of Peru, neomycin and gentamicin. age dermatologists to consider allergy to bath emollient additives in a differential diagnosis in patients presenting with Occupational contact dermatitis flexural eczema. Kalavala et al.67 presented a multi-centre study looking at Taghipour and Orton72 from Amersham analysed data from the right concentration for patch testing tixocortol pivalate. It patch testing to rubber chemicals over a 24-year period and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 808 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al. found that household gloves are probably the main source of GPs. Bassi et al.78 argued that SCCs should be excised away rubber glove allergy but that there was a high proportion of from the primary care setting by those with more experience nurses who are allergic to rubber gloves. The most common of treating such lesions. The data from their group, from a accelerators in gloves were thiurams followed by carbamates 6-month period in 2003, showed that of 360 tumours treated and mercaptobenzothiazole. They concluded that the incidence by primary excision 65 (18%) were incompletely excised of rubber allergy was high, stable and significant in an area [there were incomplete data on 21 (6%) of tumours]. General without heavy industry. practitioners excised 76 lesions with a 38% incomplete exci- Do alcohol hand cleansing products cause problems? Drs sion rate compared with 13% in hospital (P <0Æ001). It Statham and Jong from Swansea have undertaken a survey of should be stated however, that an incomplete excision rate of the British Contact Dermatitis Society members to answer this 13% is still rather high, and, in fact, consultants in the unit question.73 Their results showed that there seemed to be but a had an incomplete excision rate of 24%. This led to one com- minor problem from the widespread introduction of alcohol ment from the audience suggesting that many doctors in the hand rubs and hand cleansers, which is reassuring as the region may be excising tumours of a difficulty beyond their exposure to hand rubs has surely got to be greater than to own competence. liquid hand soaps. One reason for the high incomplete excision rates may be Langan and English74 from Nottingham reported the case of inaccurate diagnosis. Alrawi and de Berker79 highlighted how a dental technician who was allergic to propolis, which was this may be the case with regards to SCC of the nail unit – a widely found in the products that he was using to manufac- diagnosis which may certainly be delayed. They undertook a ture dental prostheses. This was an unknown source of this retrospective study of 20 patients seen over 8 years, which allergen and this presentation has brought it to our attention. suggested that there are three characteristic patterns of presen- They also reported that propolis, having been on the standard tation of SCC of the nail. These three categories were: (i) a series in a recent study showed quite a high frequency of pos- frank nodule or tumour (the most common); (ii) a mild– itive reactions and they suggested considering it as an addi- moderate warty periungual lesion with nail splitting and dis- tional allergen in the British Standard Series. comfort; and (iii) recurrent discharge from beneath the nail Professor Gawkrodger’s team from Sheffield have looked at with putative onychomycosis. Interestingly, in all cases < 50% the EPIDERM data for chromium and cobalt over an 11-year of the surface area of the distal phalanx was involved. period. Their findings support the traditional view that chro- Of course, surgery is not the only treatment modality mium-related dermatitis has its onset later in working life available for skin cancer. McKenna and McMillan80 presented a whereas the onset of cobalt-related dermatitis is usually poster documenting the treatment of a 72-year-old renal trans- earlier.75 plant patient with 12 nodular BCCs on the forehead and a further five on his lower face. He was successfully treated with topical imiquimod 5% once daily, 5 days a week, for 6 weeks. Skin cancer An alternative approach was presented by Madan et al.81 for the Skin cancer featured in a large cross section of the meeting, treatment of patients with multiple BCCs associated with perhaps reflecting the increasing involvement of dermatolo- Gorlin’s syndrome. They presented the results of a pilot study gists in its management and its growing incidence. Hoey using systemic photodynamic therapy (PDT) with porfimer et al.76 reported on the incidence of basal cell carcinoma sodium (Photofrin, Axcan Pharma Inc., Quebec, Canada), a (BCC) in Northern Ireland between 1993 and 2002 with data systemic photosensitizer, for treating seven patients with taken from the Northern Ireland Cancer Registry. The age multiple BCCs. In addition to this therapeutic option, they also adjusted incidence rates for males increased over this period presented a novel approach to monitoring treatment response from 88 to 104 per 100 000, but fell from 75 to 71 per using high-resolution 20 MHz ultrasound (US). They showed 100 000 for females. They also showed that, as with melan- a 74% reduction in the size of thick lesions treated with exter- oma, higher social class was a risk factor for developing BCC nal light and an 88% reduction in thick nodular lesions treated in males. There was no such trend in females. The male to with interstitial optical diffuser fibres in addition to external female incidence ratio was 1Æ3 : 1 during this period and light, measured by the high-resolution US. However, they did more BCCs were detected at a significantly younger age in not attempt to validate the US by taking biopsies from any of men than in women. Fraser et al.77 presented data from the the treated lesions. Treatment of BCCs with the more conven- Scottish perspective looking at the area surrounding Edinburgh tional methyl aminolaevulinate (MAL)–PDT was compared covering a population of 1Æ24 million during 2004. This with cryotherapy for the treatment of primary superficial BCC showed that squamous cell carcinoma (SCC) is much more a by an international group.82 Their poster detailed a 5-year problem in men (64% out of 572 patients) and one that still prospective randomized controlled trial which showed that predominantly affects the elderly; 35% of cases occurred in recurrence rates were similar at 5 years with both MAL–PDT those aged 71–80 and 32% in the 81–90 age group. It was (22%) and double freeze-thaw cryotherapy (20%), but with a also noted that dermatologists undertook the bulk of the better cosmetic outcome for the former. Interestingly, they workload, performing the initial treatment in 66% of the report that for the MAL-PDT all the recurrences occurred cases. Plastic surgeons dealt with 11% of cases as did the local within the first 2 years.

The therapeutic usefulness of imiquimod was increased by Jessner’s lymphocytic infiltrate is a difficult condition to findings in posters from Stavrakoglou et al.83 and Brown treat with few evidenced-based treatment options.91 Belgi and et al.84 Stavrakoglou et al.83 reported the successful treatment of Motley92 presented the successful treatment of Jessner’s using genital intraepithelial neoplasia with 5% cream. The endpoint with a pulsed dye laser. Their patient’s lesions resolved com- of treatment is suggested by reduction of the inflammatory pletely after three treatments with a 585 nm tuned dye laser response despite continued application. Both their patients over a period of 9 months, but after a remission of several required strong analgesia and encouragement to complete the months the lesions returned. He was treated again with a treatment. Brown et al.84 reported the successful treatment 595 nm pulsed dye laser which led to complete resolution of primary cutaneous follicle centre B-cell lymphoma using within a few weeks and he had no recurrence when seen topical 5% imiquimod with no signs of recurrence after 3 years later. 6 months follow up. If none of these treatment options Drs Bajaj and Langtry93 offered a surgical technique for the appeal, however, then one could always hope for spontaneous treatment of the difficult problem of acne keloidalis nuchae. resolution which is what happened to a Merkel cell carcinoma They presented two cases that were successfully treated, with presented as a clinico-pathological case report.85 good cosmesis, by excising down to and including the hair follicles and then leaving the wound to heal by secondary intention. The final presentation of the BSDS section preceded Surgery the talk by Dame Carol Black, the president of the Royal Col- The afternoon dedicated to the British Society for Dermato- lege of Physicians, London, who must have been amazed at logical Surgery (BSDS) was split into two sections of presen- what physicians in the guise of dermatologists get up to tations of papers followed by some ‘surgical pearls’. Muller as Langtry presented a description of interpolation flaps in et al.86 presented a new technique for measuring the margins skin cancer surgery.94 Those demonstrated included the of BCC using fibre-coupled fluorescence spectroscopy in paramedian forehead flap, cheek interpolation flap and inter- order to try to reduce the number of stages required when polation flaps to the ear. performing Mohs’ micrographic surgery (MMS). They compared the margins predicted by the new technique with Guest lectures those obtained following MMS in nine patients and found that in eight of them there was close correlation between Introducing our guest speaker, Dame Carol Black, President of the predicted and actual margins. The paper that won the the Royal College of Physicians since 2002, Dr Sue Burge prize for best presentation, presented by Birnie et al.,87 docu- explained that she had been Dame Carol’s SHO in Bristol many mented the number of blood splashes a dermatological sur- years ago and that Dame Carol’s enthusiasm for clinical medi- geon receives whilst operating. A postal questionnaire cine and research remain unchanged since those early days. In revealed that the majority of BSDS members thought that her lecture Dame Carol Black mentioned that her first involve- they received a blood splash to the face in 1% or fewer pro- ment with the Royal College of Physicians of London was cedures, but the study of 100 consecutive procedures docu- writing a three-page letter to complain how inactive the Royal mented at least one facial blood splash in 33% of operations. College was and explain how things could be done better. The The most significant contributory factor was use of the two-line reply from the then President suggested that she come bipolar electrocautery. and change things from the inside and she described the Chan et al.88 presented a new, more straightforward tech- various roles that she had played in the Royal College since nique for embedding the specimens taken from MMS which then until becoming President in 2003. In her lecture she requires less training of technical staff to achieve satisfactorily clearly painted the changing role of physicians in society with embedded Mohs’ blocks. Their technique involves placing the pressures from consumerism, technology and local pressures specimen deep surface down into a transparent plastic embed- from regulatory authorities, PMETB, NHS reforms and employ- ding mould. It can be viewed to ensure that it is correctly ori- ers. While our essential values must remain the same, she entated and then placed onto a precooled aluminium block explained how our role in society had significantly changed before it is submerged in liquid nitrogen. Having randomized from the traditional image. Dame Carol explained how she has 112 specimens they demonstrated that the new technique is tried over her 4 years as President to make the Royal College comparable to the traditional method. of Physicians (London) a more outward looking organization. Botulinum toxin A was twice featured as a treatment She described how central government would wish to see a option. Ah-Weng et al.89 showed good results in treating mul- generic voice representing the medical profession rather than tiple eccrine hidrocystomas, which became more prominent the present plethora of Royal Colleges. The larger of the 26 with excessive facial sweating. There was complete clearance specialist societies served by the Royal College now had a full of forehead sweating and cysts within a week of treatment. seat on the Council. A group of specialist society administrators There was some recurrence, however, at 12 months. Belgi and and managers have been set up to co-ordinate the concerns, Morris90 documented its use in treating amputation stump efforts and input from the 26 specialist societies. hyperhidrosis, which enabled the lady to return to wearing Dame Carol said that she had had a fairly steep learning her prosthesis and living a more active life. curve in dealing with central government. She explained that

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 810 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al.

‘banging on tables’ does not get heard but that what is over clinical diagnostic codes and may in certain instances required is continuous evidence-based information presented incur a higher tariff. However, if someone was to stay in in a persistent and nonconfrontational style, obviously lacking hospital longer than their ‘trim point’ and had a skin biopsy, in professional self-interest. She explained the importance of all of these factors needed to be considered as the biopsy patient groups in getting issues across to parliamentarians and might in that situation actually decrease the tariff. It was also that these tend to have much greater effect than even the noted that because skin obviously involves all parts of the voice of large representative organisations. She pointed out body, that a biopsy on the breast area or scrotum might many issues which threaten dermatology and her own special- attract a much higher tariff than would one on an eyelid. ity of rheumatology. These include a change in emphasis With a lot of these new discrepancies it is obviously import- towards primary care, alternative practitioners, difficulties in ant that lead clinicians get a firm hand on clinical coding as maintaining good core curricula and maintaining a strong aca- small differences in coding could have significant implica- demic basis. She asked if these new services will be compared tions for Trust income. with the existing services in terms of the quality of service There is also the factor of market forces. Cornwall is consid- delivery. Emergence of General Practitioners with Specialist ered to be the cheapest area in the country to provide services Interest is a good example of an expensive way of providing a whereas St Mary’s in London is the most expensive. In each service, and on recently pressing the Secretary of State, she case a tariff unit of 1 is applied but a London teaching hospi- had discovered that there were five independent sector treat- tal may get a considerable uplift from the Department of ment centres providing dermatology services in the United Health by virtue of its geographical location. Kingdom. She felt that there was need for much more trans- The talk by Sir Graham Catto from the General Medical parency and better data if there was to be an avoidance of Council was less intimidating than expected but was given conjecture and rumour. The new emphasis on Health for the before Sir Liam Donaldsons’s new recommendations for Nation seems to be on the preservation of health and empower- revalidation. Sir Graham explained that many of the problems ment of its citizens with acute hospitals becoming much that we face in medicine today have been caused by its leaner, fewer and perhaps bigger. various successes. There has been an increase in life expect- She raised serious concerns regarding the training of junior ancy, an increase in successful medical outcomes from inter- doctors with a ‘run through’ training programme designed to vention and these in turn have created an increase in the lead service commitments rather than provide an academic public interest in medicine. While many worry about our basis for broad general medical training and subsequent spe- perception by the public the reality is that, from surveys, the cialization. If the MRCP is to be mapped to the new curricu- patients’ trust in doctors remains very high, consistently in lum planned by Government, it may be that we will have excess of 90%. MRC(Dermatology), etc in the future. Many of the issues surrounding patient safety and safety She spoke of specialist knowledge-based assessments, which regarding medicines have indeed been raised by the medical were developed between the Royal College and the British profession itself, while we are facing increasing financial Association of Dermatology with not only an emphasis on the restrictions, cultural shifts and changes in the male/female medical aspect of dermatology but also surgery, paediatrics, ratio entering medical school. In general, industrial processes allergy, etc. She welcomed the role of the alliance between have become less dangerous with time while paradoxically, her own specialty of rheumatology and dermatology with the because of the increased complexity of intervention, medicine development of joint guidelines and audits from the Royal in many ways has become more dangerous and this, coupled College of Physicians with a much more overarching and with the increase in public awareness, public interest in medi- interactive role. cine and general exaggeration have brought increased scrutiny In a section on information technology in the NHS on our profession. As humans we also tend to focus on failure Dr George (London) took us through the ‘natural history’ of rather than on success and Sir Graham pointed out that, in coding. The hard work that had been carried out by mem- countries where resort has been had to criminal action against bers of the BAD over a few years previously has been over- doctors or other punitive measures, if anything, doctors have taken by SNOMED CT which is a largely American based tended to retreat from more intervention and be less transpar- system, but through the efforts of Dr Chalmers and ent, which cannot be in the interest of the government, public Dr McDonagh, input from British dermatology has been or doctors. achieved and this will be piloted at Hope Hospital, Salford. The quirks of coding were discussed in the OPCS4.3 version What’s new? which deals mainly with procedures and ICD10 which deals more with diagnostic codes. It was, however, pointed out Dr Celia Moss gave an update on cutaneous mosaicism and that tariffs set against these codes could be different for very the ongoing research in this field. Dr David de Berker fol- similar cases had the patient been coded as admitted as an lowed with an update on the world of nails. Dr Neil Walker emergency as opposed to an elective admission, the length highlighted the advances in laser technology including the of stay and whether a biopsy had taken place or not. By and concept of fractional photothermolysis, nonablative remodel- large surgical procedures to include a biopsy take precedence ling and a combined high-powered pulsed dye and Nd-YAG

laser; the latter may be useful for resistant capillary malforma- receptor and NURR1 in psoriasis. Brit J Dermatol 2006; 155 tions. (Suppl. 1):30 (Abstract). Dr Graham Ogg discussed the roles of antimicrobial pep- 14 Campalani E, Arenas M, Marinaki AM et al. Polymorphisms in folate, pyrimidine and purine metabolism have an impact on met- tides such as cathelicidins and b-defensins in eczema and their hotrexate efficacy and toxicity in psoriasis. Brit J Dermatol 2006; 155 potential role in future treatments. Dr Graham Colver provided (Suppl. 1):1 (Abstract). an entertaining and practical update on the medical treatment 15 Fairhurst DA, Goodfield MD. Elevated antistreptolysin O titres in of skin precancer and cancer, including interventions such psoriasis patients following tumour necrosis factor a inhibitor as radiotherapy, imiquimod, 5-fluorouracil, cryosurgery and therapy. Brit J Dermatol 2006; 155 (Suppl. 1):31–2 (Abstract). curettage and cautery. Dr Francisco Vega-Lopez discussed the 16 Collin B, Ogboli N, Moss C. Methotrexate therapy in 10 chil- varied clinical presentations and management of the different dren with severe plaque psoriasis. Brit J Dermatol 2006; 155 (Suppl. 1):33 (Abstract). forms of leishmaniasis. 17 Griffiths CEM, Taylor H, Collins SI et al. The impact of psoriasis Dr Andrew Finlay reminded us that doctors do not always guidelines on appropriateness of referral from primary to secon- know what the patient wants while Dr Paul Farrant and dary care: a randomized controlled trial. Brit J Dermatol 2006; 155 Dr Pamela Todd discussed what the trainees want from their (Suppl. 1):1–2 (Abstract). trainer and what makes a good trainee. Dr Chris Bunker fin- 18 Hampton PJ, Reynolds NJ. Fumaric acid esters for psoriasis: a ished the session with an excellent talk on modernising med- report of therapeutic experience and side effect profile in 17 ical careers (MMC), which is clearly an area about which we patients. Brit J Dermatol 2006; 155 (Suppl. 1):32 (Abstract). 19 Gordon KB, Langley RG, Leonardi C et al. Efficacy and safety of will all hear more in the near future. adalimumab treatment of chronic plaque psoriasis in patients who meet some criteria for biological interventions in accordance with References the British Association of Dermatologists guidelines. Brit J Dermatol 2006; 155 (Suppl. 1):32–3 (Abstract). 1 Palmer CN, Irvine AD, Terron-Kwiatowski A et al. Common loss- 20 Conway P, Reeves P, Lloyd A, Baxter G. Cost effectiveness of etan- of-function variants of the epidermal barrier protein filaggrin are a ercept in patients with plaque psoriasis meeting BAD criteria for major predisposing factor for atopic dermatitis. Nat Genet 2006; biological interventions. Brit J Dermatol 2006; 155 (Suppl. 1):33–4 38:441–46. (Abstract). 2 Irvine AD, O’Regan GM, Lewis-Jones MS et al. Mutations in the fil- 21 Katugampola R, Lewis VJ, Finlay AY. A review of the Dermatology aggrin gene cause ichthyosis vulgaris. Brit J Dermatol 2006; 155 Life Quality Index in assessing the efficacy of biological treatments (Suppl. 1):3 (Abstract). in psoriasis. Brit J Dermatol 2006; 155 (Suppl. 1):34 (Abstract). 3 Ardern-Jones MR, Black AP, Bateman EA, Ogg GS. Superantigen- 22 Katugampola R, Lewis VJ, Finlay AY. The Dermatology Life Quality allergy synergy: a novel mechanism of cutaneous atopic disease. Index: assessing the efficacy of biological treatments in psoriasis. Brit J Dermatol 2006; 155 (Suppl. 1):10 (Abstract). Brit J Dermatol 2007; (in press). 4 Chalmers DA, Todd G, Saxe N et al. Validation of the United King- 23 Eghlileb A, Davies EEG, Finlay AY. The secondary impact of psori- dom Working Party diagnostic criteria for atopic eczema in an asis on the family: the Psoriasis Family Index. Brit J Dermatol 2006; African setting. Brit J Dermatol 2006; 155 (Suppl. 1):5 (Abstract). 155 (Suppl. 1):31 (Abstract). 5 Hon KLE, Lam MCA, Kam WYC et al. CDLQI, SCORAD and NESS: 24 Katugampola RP, Hughes TM, Mills CM, Stone NM. Allergic con- are they correlated? Brit J Dermatol 2006; 155 (Suppl. 1):117–18 tact dermatitis complicating pustular psoriasis. Brit J Dermatol 2006; (Abstract). 155 (Suppl. 1):72 (Abstract). 6 Brown SJ, Leech SN, Eccleston FJ, Taylor AEM. Appointment of a 25 Rutter KG, Cotterill LF, Brownrigg NN et al. Clinical and photobio- paediatric eczema nurse reduces inpatient admissions for atopic logical characteristics of patients with photosensitive psoriasis. Brit J eczema. Brit J Dermatol 2006; 155 (Suppl. 1):106 (Abstract). Dermatol 2006; 155 (Suppl. 1):120 (Abstract). 7 Farrant PBJ, Benfield L, Price M. Eczema: education, education, 26 Morgan CJ, Clough GF, Botten JC, Friedmann PS. Cutaneous micro- education. Are community clinics beneficial in treating paediatric dialysis to investigate the eccrine sweat gland as a conduit eczema? Review of a nurse-led community paediatric eczema for hydrophilic drug absorption. Brit J Dermatol 2006; 155 clinic 2003–2005. Brit J Dermatol 2006; 155 (Suppl. 1):106–7 (Suppl. 1):11–2 (Abstract). (Abstract). 27 Morgan CJ, Renwick AG, Friedmann PS. The role of the stratum 8 Weatherhead S, Wahie S, Reynolds NJ, Meggitt SJ. Methotrexate corneum and dermal microvascular perfusion in penetration and for moderate-to-severe atopic eczema. Brit J Dermatol 2006; 155 tissue levels of water-soluble drugs investigated by microdialysis. (Suppl. 1):44 (Abstract). Br J Dermatol 2003; 148:434–43 (Abstract). 9 Weatherhead SC, Wahie S, Reynolds NJ, Meggitt SJ. Methotrexate for 28 Eedy DJ. Increased sensitivity to methotrexate in Down syndrome: moderate-to-severe atopic eczema. Brit J Dermatol 2007; 156:346–51. a clinically significant drug metabolism problem. Brit J Dermatol 10 Hon KLE, Lam MCA, Kam WYC et al. Fears about topical cortico- 2006; 155 (Suppl. 1):44–5 (Abstract). steroid use in children with eczema. Brit J Dermatol 2006; 155 29 Usmani N, Goodfield M. Efalizumab in the treatment of patients (Suppl. 1):117 (Abstract). with discoid lupus erythematosus. Brit J Dermatol 2006; 155 11 Hughes RM, Tobin SM, Kirby B. The use of alternative medicine in (Suppl. 1):2–3 (Abstract). paediatric patients with atopic dermatitis. Brit J Dermatol 2006; 155 30 Ezughah FI, Green CM. Pilot open label study of 0.1% tacrolimus (Suppl. 1):25–6 (Abstract). ointment in the treatment of vulval lichen sclerosus. Brit J Dermatol 12 Vatve M. Does latex allergy have a role in the severity of atopic 2006; 155 (Suppl. 1):8 (Abstract). dermatitis? Brit J Dermatol 2006; 155 (Suppl. 1):107 (Abstract). 31 Taghipour K, James M. Efficacy and safety of long-term, low-dose 13 O’Kane M, Kirby B, Fitzgerald O et al. Altered expression of isotretinoin for treatment of acne vulgaris. Brit J Dermatol 2006; 155 corticotrophin-releasing hormone, corticotrophin-releasing hormone (Suppl. 1):42–3 (Abstract).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 812 British Association of Dermatologists 86th Annual Meeting, A. Birnie et al.

32 Huq S, Adekunle S, Assad K et al. Variable migration potential of 52 Veysey EC, Dean D, Allen J et al. Mucous membrane pemphigoid in human skin fibroblasts sub-populations: implications for wound nine children: clinical features, treatment and immunopathology. healing. Brit J Dermatol 2006; 155 (Suppl. 1):6 (Abstract). Brit J Dermatol 2006; 155 (Suppl. 1):24 (Abstract). 33 Williams C, Tamuno P, Smith AG, Lyon CC. Perianal ulceration 53 Jong CT, Green CM, King CM et al. Preservative sensitivity in and other cutaneous ulcerations complicating nicorandil therapy. the United Kingdom (2004–2005). Brit J Dermatol 2006; 155 Brit J Dermatol 2006; 155 (Suppl. 1):29 (Abstract). (Suppl. 1):68 (Abstract). 34 Yesudin PD, Field A. Nicorandil induced oral ulceration: lessons 54 Britton JER, Wilkinson SM, English JSC et al. The British standard learnt from a case series. Brit J Dermatol 2006; 155 (Suppl. 1):29–30 series of contact dermatitis allergens: validation in clinical practice (Abstract). and value for clinical governance. Brit J Dermatol 2003; 148:259–64. 35 Ogden S, Mukasa Y, Lyon CC, Coulson IH. Nicorandil induced per- 55 Buckley DA. Fragrance ingredient labelling in products on sale in the istomal ulcers; is nicorandil also associated with the gastrointestinal U.K. in 2006. Brit J Dermatol 2006; 155 (Suppl. 1):68–9 (Abstract). fistula formation? Brit J Dermatol 2007 (in press). 56 Connolly M, Statham BN, Chowdhury MMU et al. Cosmetic 36 Mak R, Perrett C, Proby CM, Harwood CA. Sebaceous gland and fragrance allergy in the U.K. Brit J Dermatol 2006; 155 hyperplasia is common and therapeutically challenging in organ (Suppl. 1):69 (Abstract). transplant recipients. Brit J Dermatol 2006; 155 (Suppl. 1):36 57 White JML, White IR, Banerjee P et al. The frequency of allergic (Abstract). contact dermatitis to isoeugenol is not decreasing: a review of 37 Hackett BC, Collins S, Powell FC. Prognostic indicators in pyoder- 3636 patients tested from 2001 to 2005. Brit J Dermatol 2006; 155 ma gangrenosum: a study of 52 patients. Brit J Dermatol 2006; 155 (Suppl. 1):69–70 (Abstract). (Suppl. 1):3 (Abstract). 58 Birnie AJ, English JSC. Contact urticaria to cosmetics. Brit J Dermatol 38 Soo JK, Bicanic TA, Mortimer P. A study of the prevalence of 2006; 155 (Suppl. 1):70 (Abstract). lymphoedema in patients with cellulitis. Brit J Dermatol 2006; 155 59 McFadden JP, Jeffries D, Jowsey I et al. Incidence and prevalence of (Suppl. 1):10 (Abstract). contact allergy to the permanent hair dye agent para-phenylenedi- 39 Connolly M, de Berker DAR. A quick read on a good shave. Brit J amine: results of the AngloThailand study. Brit J Dermatol 2006; 155 Dermatol 2006; 155 (Suppl. 1):22 (Abstract). (Suppl. 1):6 (Abstract). 40 Carter JJ, Lanigan SW. Incidence of acneiform reactions to laser 60 Gawkrodger D, English JS. How safe is patch testing to PPD? Brit J hair removal. Brit J Dermatol 2006; 155 (Suppl. 1):54–5 (Abstract). Dermatol 2006; 154:1025–27 (Abstract). 41 Martin-Clavijo A, Roberts CML, Ilchyshyn A. Decline of dermato- 61 White JML, Basketter DA, Jowsey I et al. Paraphenylenediamine logical research in the U.K.: truth or myth? Brit J Dermatol 2006; allergy: the role of Bandrowski’s base. Brit J Dermatol 2006; 155 155 (Suppl. 1):5 (Abstract). (Suppl. 1):10–1 (Abstract). 42 Kleyn CE, Schneide L, Saraceno R et al. The effect of acute experi- 62 Bhushan M, Beck MH. An audit to identify the optimum referral mental stress on cutaneous neuroimmunology. Brit J Dermatol 2006; rate to a contact dermatitis investigation unit. Brit J Dermatol 1999; 155 (Suppl. 1):30–1 (Abstract). 141:570–72. 43 Veysey EC, Cooper S, Grabczynska S. Telephone questionnaire audit 63 Gilmore E, Bailey K, Bowcock S, Parry E. A prospective audit of comparing patients’ recall of instructions for using topical treat- referrals for patch testing from a district general hospital to a ments with the regime recommended in the clinical record. Brit J specialist contact dermatitis unit. Brit J Dermatol 2006; 155 Dermatol 2006; 155 (Suppl. 1):53–4 (Abstract). (Suppl. 1):70–1 (Abstract). 44 Coast J, Salisbury C, de Berker DAR et al. What do patients value 64 Rietschel RL. Is patch testing cost effective? J Am Acad Dermatol 1989; most in a dermatology consultation? Brit J Dermatol 2006; 155 21:885–87. (Suppl. 1):54 (Abstract). 65 Paul LEA, Gawkrodger DJ. Late patch test reactions: difficulties dif- 45 Hale EK, Stein J, Ben-Porat L et al. Association of melanoma and ferentiating active sensitization from delayed immune response. neurocutaneous melanocytosis with large congenital melanocytic Brit J Dermatol 2006; 155 (Suppl. 1):76–7 (Abstract). naevi: results from the NYU-LCMN registry. Brit J Dermatol 2005; 66 Hann S, Hughes TM, Stone NM. Flexural allergic contact dermatitis 152:512–17. to benzalkonium chloride. Brit J Dermatol 2006; 155 (Suppl. 1):27 46 Pather S. A prospective, randomized, single-blinded trial to deter- (Abstract). mine the efficacy of single and weekly dose regimens of oral gri- 67 Kalavala M, Statham B, Wilkinson M et al. Tixocortol pivalate: what seofulvin versus 6 weeks of daily dosing in the treatment of tinea is the right concentration? Brit J Dermatol 2006; 155 (Suppl. 1):71 capitis in children. Brit J Dermatol 2006; 155 (Suppl. 1):108–9 (Abstract). (Abstract). 68 Malik MM, Tobin AM, Kirby B et al. An assessment of the incidence 47 Thompson MA, Brown A, Hill VA et al. The effectiveness of sun of contact allergy to corticosteroid enemas in patients with inflam- awareness counselling in paediatric transplant patients. Brit J Derma- matory bowel disease. Brit J Dermatol 2006; 155 (Suppl. 1):71 tol 2006; 155 (Suppl. 1):107–8 (Abstract). (Abstract). 48 Kaur MR, Martinez A, Mellerio J, Moss C. National audit of com- 69 Madan V, Walker SL, Beck MH. Sodium metabisulphite allergy is pliance with iron therapy in children with epidermolysis bullosa. common, but is it relevant? Brit J Dermatol 2006; 155 Brit J Dermatol 2006; 155 (Suppl. 1):109–10 (Abstract). (Suppl. 1):71–2 (Abstract). 49 Barry RBM, Hughes BR, Cook LJ. Topical 5% imiquimod cream for 70 Rajpar SF, Foulds I, Abdullah A, Maheshwarim M. Severe adverse the treatment of infantile haemangioma. Brit J Dermatol 2006; 155 cutaneous reaction to insulin due to cresol sensitivity. Brit J Dermatol (Suppl. 1):7–8 (Abstract). 2006; 155 (Suppl. 1):73 (Abstract). 50 Sidbury R, Neuschler N, Neuschler E et al. Topically applied imiq- 71 Green CM, Holden CR, Gawkrodger DJ. The frequency of contact uimod inhibits vascular tumor growth in vivo. J Invest Dermatol 2003; allergens to medicaments increases with age. Brit J Dermatol 2006; 121:1205–9. 155 (Suppl. 1):77–8 (Abstract). 51 Hughes R, O’Callaghan C, Irvine AD, Kirby B. Dermatitis artefacta 72 Taghipour K, Orton D. Allergic contact dermatitis to rubber chemi- in paediatric patients: a series of ten cases. Brit J Dermatol 2006; 155 cals: incidence, pattern and spectrum of relevant reactions over the (Suppl. 1):22–3 (Abstract). last two decades. Brit J Dermatol 2006; 155 (Suppl. 1):74 (Abstract).

73 Jong CT, Statham BM. Do alcohol hand products cause hand prob- 83 Stavrakoglou A, Brown V, Williamson M, Coutts I. Two cases of long- lems? A survey of the British Contact Dermatitis Society members. standing genital intraepithelial neoplasia successfully treated with Brit J Dermatol 2006; 155 (Suppl. 1):74–5 (Abstract). 5% imiquimod cream. Brit J Dermatol 2006; 155 (Suppl. 1):55–6 74 Langan SM, English JS. Occupational contact dermatitis from prop- (Abstract). olis in a dental technician. Brit J Dermatol 2006; 155 (Suppl. 1):75 84 Brown VL, Stavrakoglou A, Coutts I. Primary cutaneous follicle (Abstract). centre B-cell lymphoma successfully treated with topical 5% 75 Athavale P, Shum KW, Carder M et al. Occupational dermatitis rela- imiquimod. Brit J Dermatol 2006; 155 (Suppl. 1):39 (Abstract). ted to chromium and cobalt: experience in the UK over an eleven 85 Birnie AJ, Leach IH, Perks AG. Spontaneous regression of primary year period (the EPIDERM and OPRA reporting schemes). Brit J Merkel cell carcinoma from the left elbow. Brit J Dermatol 2006; Dermatol 2006; 155 (Suppl. 1):75–6 (Abstract). 155 (Suppl. 1):14 (Abstract). 76 Hoey SEH, Catney D, Murray L et al. Trends in basal cell carci- 86 Muller FM, Fleming CJ, Lesar A et al. Fibre-coupled fluorescence noma registration in Northern Ireland over a 10-year period spectroscopy for prediction of lateral margins of basal cell cancers (1993–2002). Brit J Dermatol 2006; 155 (Suppl. 1):59–60 treated with Mohs’ surgery. Brit J Dermatol 2006; 155 (Suppl. 1):96 (Abstract). (Abstract). 77 Fraser S, Doherty VR, Butterworth M et al. The burden of squamous 87 Birnie AJ, Thomas K, Skelton L, Varma S. Blood splashes to the cancers: a cancer network audit. Brit J Dermatol 2006; 155 face during dermatological surgery. Brit J Dermatol 2006; 155 (Suppl. 1):93–4 (Abstract). (Suppl. 1):97–8 (Abstract). 78 Bassi N, Divekar P, Kersey P. Factors accounting for incomplete 88 Chan SK, Brooks C, Bright A et al. Plastic mould-based embedding excisions of primary cutaneous squamous cell carcinomas: a multi- technique in Mohs’ micrographic surgery. Brit J Dermatol 2006; 155 centre experience. Brit J Dermatol 2006; 155 (Suppl. 1):94–5 (Suppl. 1):101 (Abstract). (Abstract). 89 Ah-Weng A, Robson A, Kurwa HA. Multiple eccrine hydrocysto- 79 Alrawi M, De Berker D. Clinical characteristics of squamous cell car- mas treated by botulinum toxin A. Brit J Dermatol 2006; 155 cinoma of the nail unit. Brit J Dermatol 2006; 155 (Suppl. 1):12–3 (Suppl. 1):99 (Abstract). (Abstract). 90 Belgi AS, Morris AD. Treatment with botulinum toxin A for exces- 80 McKenna DJ, Macmillan C. Seventeen simultaneous basal cell carci- sive sweating of amputation stump. Brit J Dermatol 2006; 155 nomas presenting on the face in a chronically immunosuppressed (Suppl. 1):99–100 (Abstract). man: a difficult management problem treated successfully with 91 Birnie A, Sladden M. Critically appraised topic (CAT): how should topical imiquimod. Brit J Dermatol 2006; 155 (Suppl. 1):55 Jessner’s lymphocytic infiltrate of the skin be treated? J Am Acad (Abstract). Dermatol 2006; 54:3 (Abstract). 81 Madan V, Lear JT, Loncaster J et al. Systemic photodynamic therapy 92 Belgi AS, Motley RJ. Jessner’s lymphocytic infiltrate: successful with porfimer sodium in Gorlin’s syndrome: results of a pilot treatment with pulsed dye laser. Brit J Dermatol 2006; 155 study. Brit J Dermatol 2006; 155 (Suppl. 1):56 (Abstract). (Suppl. 1):100 (Abstract). 82 Nasset-Se´guin N, Ibbotson S, Emtestam L et al. Photodynamic ther- 93 Bajaj V, Langtry JAA. Surgical excision of acne keloidis nuchae apy using topical methyl aminolaevulinate versus cryotherapy for and secondary intention healing. Brit J Dermatol 2006; 155 treatment of primary superficial basal cell carcinomas: results of a (Suppl. 1):102 (Abstract). five-year prospective randomized trial. Brit J Dermatol 2006; 155 94 Langtry JAA. Interpolation flaps in skin cancer surgery. Brit J (Suppl. 1):57 (Abstract). Dermatol 2006; 155 (Suppl. 1):102 (Abstract).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp802–813 CUTANEOUS BIOLOGY DOI 10.1111/j.1365-2133.2006.07718.x S-nitrosoglutathione-containing hydrogel increases dermal blood ﬂow in streptozotocin-induced diabetic rats A.B. Seabra,* E. Pankotai,* M. Fehe´r,* A´. Somlai,* L. Kiss,* L. Bı´ro´,* C. Szabo´,* M. Kollai,* M.G. de Oliveira and Z. Lacza* *Department of Human Physiology and Clinical Experimental Research, Faculty of Medicine, Semmelweis University, Budapest, Hungary Chemistry Institute, State University of Campinas, UNICAMP, Campinas, SP, Brazil Biotech Hungary Research and Development LLC, Budapest, Hungary

Summary

Correspondence Background Endothelial dysfunction is characterized by decreased vasodilatory capa- Z. Lacza, H-1082 Budapest, U¨ll}oi u´t78⁄a, city of the arterioles mainly due to the reduced release of nitric oxide (NO). Hungary. E-mail: [email protected] Application of NO donors may prevent or even reverse the consequences of endothelial dysfunction, such as diabetic leg ulcers. Accepted for publication 15 October 2006 Objectives To investigate the vasodilatory capacity and the possible side-effects of topical application of an NO donor-containing hydrogel in diabetic rats. Key words Methods S-nitrosoglutathione (GSNO) was incorporated in Pluronic F127 hydro- dermal microcirculation, diabetes, hydrogel, gel and applied on the foot sole skin of healthy and streptozotocin-induced dia- laser-Doppler, nitric oxide, topical application betic rats. Blood flow was monitored using a laser-Doppler probe. Nitrotyrosine Conflicts of interest formation, a possible side-effect of GSNO action, was evaluated by Western blot- None declared. ting of skin protein extracts. Systemic circulatory side-effects were investigated by monitoring blood pressure and heart rate during the application. Results The hydrogel alone did not induce any changes in microvascular flow, while GSNO-containing hydrogel caused a twofold increase in perfusion. This effect was similar in diabetic and healthy animals. Topical GSNO application did not increase the nitrotyrosine content of skin proteins, nor did it have any effect on blood pressure or heart rate. Conclusions Dermal application of GSNO may be an effective treatment for promoting the local vasodilation in both healthy and diabetic states, without inducing protein nitration or alterations in blood pressure or heart rate.

Endothelial dysfunction plays an important role in the patho- centre of several pharmacological studies investigating the genesis of peripheral vascular diseases such as diabetic micro- importance of NO in living systems and it has already been circulatory disorders, Raynaud’s syndrome or chronic leg demonstrated that they are vasodilators and inhibitors of plate- ulcers.1–4 A main feature of endothelial dysfunction is that let aggregation.13–15 In such species, NO is covalently bound vasoconstrictors outweigh the effects of vasodilators in the to a sulphur atom in a C–S–NO moiety and can be released microcirculation. This vascular dysfunction leads to impaired through heterolytic or homolytic S–N bond cleavage, allow- autoregulation of blood flow and is suggested to be an early ing NO to be transferred to specific receptors such as iron- event in insulin resistance.5 In addition to impaired vaso- containing enzymes to which it can coordinate as a ligand dilation, the reduced level of nitric oxide (NO) also leads to (nitrosylation reactions) or thiol-containing proteins to which increased thrombocyte aggregation. Therefore, the delivery of it can be bound as a nitrosonium ion (NO+) in transnitrosa- exogenous NO may represent a promising therapeutic tool in tion reactions.12,16 GSNO can also decompose spontaneously the treatment of diabetic microangiopathy.6,7 Sodium nitro- through homolytic bond cleavage, with free NO release and prusside and organic nitrates have been shown to prevent the formation of oxidized glutathione.17 thrombosis development via the inhibition of platelet activa- Incorporation of GSNO in nontoxic polymers allows local tion.8,9 However, the prolonged administration of these com- delivery of NO to target areas such as the skin microcircula- pounds can lead to cyanide poisoning and nitrate tolerance, tion, where NO has a vasodilator effect.18 The incorporation limiting their usefulness in a clinical setting.10 of GSNO into a hydrogel composed of Pluronic F127 has S-nitrosothiols (RSNOs) such as S-nitrosoglutathione already been reported and its topical application on the skin (GSNO) have already been identified as endogenous NO carri- of healthy volunteers resulted in NO-dependent vasodila- ers and donors in mammals.11,12 RSNOs have been at the tion.18,19 Pluronic F127 is a well-studied biologically inert

2007 The Authors 814 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp814–818 Dermal application of GSNO-containing hydrogel, A.B. Seabra et al. 815 polymer which is used in formulations for controlled drug Experiments were carried out 3 weeks after the induction of release, for covering of burn wounds, in rectal, ophthalmic, diabetes. Control animals were treated with the vehicle of parenteral, nasal or subcutaneous administration.20 The use of streptozotocin (citrate buffer at pH 4Æ5). Animals were anaes- hydrogels as topical drug delivery systems may allow con- thetized by a mixture of halothane and N2O. Pluronic F127 ) trolled release of GSNO into the dermal microcirculation. hydrogel containing either 0Æ23 or 0Æ023 mol L 1 GSNO or However, it is unknown whether the effect of GSNO is locali- pure Pluronic hydrogel, as vehicle control, was applied to zed to the site of application or if it has systemic effects simi- the foot sole skin of the animals and blood flow was measured lar to those of transdermal nitroglycerin patches.21 Moreover, noninvasively by using continuous laser-Doppler assessment high nitrosothiol concentrations may alter the nitrotyrosine (Moor Instruments Ltd, Axminster, U.K.). Mean cutaneous pattern of the affected proteins, which can lead to unwanted blood flow was recorded at 5-min intervals for 30 min. side-effects. The aim of the present study was to investigate the local Evaluation of tyrosine nitration by Western blotting and systemic effects of a GSNO-containing hydrogel. We investigated whether GSNO is capable of improving micro- In order to evaluate if topically applied GSNO-containing circulatory blood flow in the skin of healthy and diabetic hydrogel could lead to nitration of protein tyrosine residues, rats without systemic effects on circulatory parameters. We skin biopsies were collected from the animals following also evaluated the nitration level of proteins at the site of 30 min of GSNO treatment. Proteins were extracted with cold ) ) application. NP-40 lysis buffer (135 mmol L 1 NaCl, 50 mmol L 1 Tris, 1% NP-40, pH 7Æ4) using a Biospec Tissue-TearorTM (Bio- Materials and methods spec, Bartlesville, OK, U.S.A.). Samples were then sonicated three times for 3 s each. Protein concentration was measured using BioRad DC Protein Assay Kit (BioRad, Hercules, CA, Preparation of S-nitrosoglutathione-containing hydrogels U.S.A.) and SpectraMax 340 spectrophotometer (Molecular Pluronic F127 [poly(ethylene oxide)99-poly(propylene Devices, Sunnyvale, CA, U.S.A.). Proteins were run on a oxide)65-poly(ethylene oxide)99, PEO99-PPO65-PEO99, MW NuPage 4–12% Bis-Tris Gel (Invitrogen, San Diego, CA, ~ 120 000; BASF, Florham Park, NJ, U.S.A.], glutathione U.S.A.) and blotted onto nitrocellulose membranes (LC2000; (g-Glu-Cys-Glu) (Sigma, St Louis, MO, U.S.A.) and sodium Invitrogen). The membrane was incubated overnight at 4 C nitrite (Sigma) were used as received. All the experiments with rabbit anti-nitrotyrosine primary antibody (1 : 1000; were carried out using analytical grade water from a Millipore Upstate Biotechnology, Lake Placid, NY, U.S.A.) in 1% nonfat Milli-Q gradient filtration system (Millipore, Billerica, MA, dried milk in 0Æ05% Tween-20–Tris-buffered saline. The U.S.A.). GSNO was synthesized as described previously.18 bands were visualized by chemiluminescence (ECL Western Reduced glutathione was reacted with equimolar sodium Blotting Analysis System; Amersham Biosciences, Amersham, nitrite in aqueous solution. The final solutions were stirred at U.K.). Positive control samples were obtained by mixing high 0 C for 20 min protected from light and used immediately concentrations of GSNO and isolated skin proteins allowing for the polymer preparation. GSNO-containing Pluronic nitration in vitro. F127 hydrogels were prepared by the cold method, as previously described.19 Solutions of Pluronic F127 in cold water Measurements of systemic circulatory parameters 1 : 1 (w/w) were allowed to attain dissolution equilibrium at 4 C overnight. Required volumes of previously synthesized In order to evaluate possible systemic circulatory side-effects ) GSNO solutions (0Æ75 and 0Æ075 mol L 1, respectively) were of topical GSNO application, heart rate, systolic and diastolic added to the Pluronic F127 aqueous solutions, under gentle blood pressure were monitored by canullating the femoral stirring in an ice bath for homogenization, and used immedi- artery and using a blood pressure transducer system in anaes- ately. This procedure leads to the preparation of 3Æ80 g of thetized rats. Animals were treated with GSNO-containing hydrogel containing 26Æ5% (w/w) of Pluronic F127 and hydrogels in a similar manner to that used during the blood ) 0Æ23 or 0Æ023 mol g 1 of GSNO. flow experiments (see above). Statistics were performed using repeated-measures ANOVA followed by Dunnett’s post hoc test: P <0Æ05 was considered significant. Blood flow measurements by laser-Doppler flowmetry

All procedures were approved by the local Animal Care and Results Use Committee. Adult male Wistar rats received a single dose ) of streptozotocin (70 mg kg 1 intravenously) and were given First we tested the local vasodilator effect of different doses of 5% glucose in the drinking water to induce a rapid onset of GSNO-containing hydrogels in healthy animals. As seen in diabetes mellitus. Blood glucose levels of the animals were Figure 1, neither the vehicle nor the low dose of GSNO measured 7 days after streptozotocin application: each animal increased local blood ﬂow, whereas the higher concentration ) had a blood glucose value higher than 25 mmol L 1. Polyuria of GSNO induced marked vasodilation after 10 min, which was also present and the animals stopped gaining weight. remained elevated for 30 min. This effect was similarly

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp814–818 816 Dermal application of GSNO-containing hydrogel, A.B. Seabra et al.

(a) Vehicle GSNO 23 mM GSNO 230 mM

(b) Healthy Diabetic

Fig 2. Nitrotyrosine formation in S-nitrosoglutathione (GSNO)-treated skin measured by Western blotting. No difference can be seen in the protein nitration pattern between vehicle- or GSNO-treated samples, whereas the positive control (NT+, in vitro nitrated skin proteins) contains numerous nitrotyrosine-positive bands.

(a)

Fig 1. Effect of S-nitrosoglutathione (GSNO)-containing hydrogel on skin microvascular blood flow. (a) The vasodilator responses are shown for two different GSNO concentrations in healthy animals. Æ Æ *P <005, **P <001 vs. the vehicle-treated value. (b) The Vehicle vasodilator capacity in response to topical GSNO application is GSNO retained in diabetic animals. present in diabetic animals (Fig. 1), indicating that GSNO can increase dermal blood flow even in severely diabetic states. (b) Next, we tested the possible side-effects of topical GSNO application. RSNOs can induce nitration of tyrosine residues, which alteration may inhibit specific proteins such as the electron transport chain complexes. Figure 2 shows that the application of GSNO, in a dose which elevated the local blood flow more than 100%, did not increase or otherwise change the nitration pattern of skin proteins. Another possible side-effect of GSNO application is that it Vehicle GSNO may be absorbed and elicit systemic circulatory effects. As seen in Figure 3, GSNO application on the sole of the animals did not change heart rate or blood pressure values during the course of application. Fig 3. Lack of systemic circulatory effects during the topical Discussion application of a S-nitrosoglutathione (GSNO)-containing hydrogel. (a) Treatment of the sole foot skin of the animals with GSNO does The main observation in the present study is that topical not elicit any decrease in mean arterial pressure. (b) The treatment GSNO application can induce pronounced local vasodilation in has no significant effect on heart rate.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp814–818 Dermal application of GSNO-containing hydrogel, A.B. Seabra et al. 817 the dermal microcirculation without affecting systemic circula- disease.21 The benefit of these dermal patches is sustained sys- tory parameters or causing nitrosative modifications in skin temic delivery of nitrovasodilators into the circulation, which proteins. The pronounced vasodilatory effect of GSNO is not leads to generalized vasodilation and a decrease in blood pres- affected by the diabetic state of the animals. sure. These drug formulations are designed in a way as to A number of diabetic complications, such as chronic ulcers minimize local effects and to maximize systemic delivery of or retinopathy, can be traced back to local microvascular dis- the compounds.32,33 In contrast, the treatment of diabetic orders.1,22 The main pathophysiological symptom of micro- microangiopathy requires exactly the opposite profile, namely vascular damage is decreased vasodilatory capacity, which maximal action at the site of administration without any sys- leads to decreased tissue perfusion even before any clinical temic alterations in the circulatory parameters. In order to test signs appear.23 The main contributing mechanism to impaired these possible side-effects in our animal model we monitored vasodilation is endothelial dysfunction and decreased NO blood pressure and heart rate during the application of the release.24 Thus, replacement of NO in a sufficiently high dose GSNO-containing hydrogel on the foot sole skin of the ani- for the induction of vasodilation can prevent secondary dam- mals. The same dose of GSNO which induced more than age in diabetic microvascular complications. Data from the 100% increase in microvascular flow did not have any effects present study indicate that GSNO-induced vasodilation is un- on the systemic circulatory parameters, indicating that NO affected by severe, insulin-dependent diabetes. It has already delivery through a hydrogel is strictly localized to the site of been demonstrated that topical GSNO application on healthy application. As after 30 min of application the increased blood human volunteers led to an increase in the local vasodilation, flow is still in an apparent plateau, in the treatment of diabetic as measured by laser-Doppler. This increase in local blood subjects, increased blood flow could be maintained for time flow was correlated to the increase in NO concentration detec- periods greater than 30 min. In addition, GSNO-containing ted in the dermis, as measured by skin microdialysis.18 The hydrogel can be reapplied several times during the day, if observed vasodilation is supposed to be a cGMP-dependent necessary. vasodilation, which is the result of guanylate cyclase activation We conclude that GSNO-containing hydrogel may be used by NO from GSNO. Therefore, GSNO-containing local treat- to increase the local vasodilation in the dermal microcircula- ments may have a good therapeutic value in the treatment of tion of diabetic animals. The combination of an NO donor diabetic microangiopathy. and a hydrogel may be used for site-specific delivery of NO, The NO-mediated post-translational modification of proteins which results in significant increase in microcirculatory blood may represent a mechanism of cellular signalling, which flow, without inducing protein nitration or alterations in includes binding to metal centres, nitrosation of thiols and blood pressure or heart rate. Therefore, GSNO-containing nitration of tyrosine residues.25 RSNOs such as GSNO also hydrogels may offer the prospect to be used in the therapy of have the capacity to induce transnitrosation reactions, which diabetic vasculopathy. result in the transfer of NO from an –SNO moiety to the sulphur atom of an –SH group of proteins, thus modifying their Acknowledgments activities.26 The expected final product after NO transfer to other substrates is glutathione. In addition to transnitrosation Supported by the Hungarian OTKA (D-45933, K-049621, reactions, in the presence of reactive oxygen species NO can AT-049488), ETT (248/2003, 249/2003), TET (A4/04, react with superoxide to form peroxynitrite, which can nitrate CHN37/04) and GVOP (TST-0002/2004, 5LET2005). A.B.S. protein tyrosine residues yielding nitrotyrosine. Nitrotyrosine held a graduate fellowship from Fundaçaõ de Amparo formation is widely used as a marker for nitrosative stress and a` Pesquisa do Estado de Saõ Paulo (FAPESP), project nitrated proteins often change their function.27–29 However, 01/7869–9. recent studies point out that nitration of tyrosine residues is a reversible regulatory process in a similar manner to phos- References phorylation.30,31 Therefore, it may be hypothesized that GSNO application induces protein modifications in addition to vaso- 1 Veves A, Akbari CM, Primavera J et al. Endothelial dysfunction and dilation.26 Data from the present study show that application the expression of endothelial nitric oxide synthetase in diabetic of a GSNO-containing hydrogel on the skin does not increase neuropathy, vascular disease, and foot ulceration. Diabetes 1998; 47:457–63. nitrotyrosine formation, neither does it change the nitration 2 Dinh T, Veves A. Microcirculation of the diabetic foot. Curr Pharm pattern of dermal proteins during the course of GSNO applica- Des 2005; 11:2301–9. ) tion. However, although both NO and ONOO are labile 3 Greenman RL, Panasyuk S, Wang X et al. Early changes in the skin compounds, nitrotyrosine is relatively stable so it may be pos- microcirculation and muscle metabolism of the diabetic foot. Lancet sible that it accumulates over time. Nonetheless, our data indi- 2005; 366:1711–17. cate that the GSNO dose used, which induces significant 4 Herrick AL. Pathogenesis of Raynaud’s phenomenon. Rheumatology vasodilation, is lower than that required for protein modifica- (Oxford) 2005; 44:587–96. 5 Meigs JB, O’Donnell CJ, Tofler GH et al. Hemostatic markers of tions in the same time frame. endothelial dysfunction and risk of incident type 2 diabetes: the Nitroglycerin patches are commonly used as systemic NO Framingham offspring study. Diabetes 2006; 55:530–7. donors in the treatment of heart failure and ischaemic heart

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp814–818 818 Dermal application of GSNO-containing hydrogel, A.B. Seabra et al.

6 Durante W, Sen AK, Sunahara FA. Impairment of endothelium- F127 gel: potential uses for local and controlled nitric oxide dependent relaxation in aortae from spontaneously diabetic rats. release. Biomaterials 2003; 24:3543–53. Br J Pharmacol 1988; 94:463–8. 20 Kabanov AV, Batrakova EV, Alakhov VY. Pluronic block copolymers 7 Sigaudo-Roussel D, Demiot C, Fromy B et al. Early endothelial dys- as novel polymer therapeutics for drug and gene delivery. J Control function severely impairs skin blood flow response to local pres- Release 2002; 82:189–212. sure application in streptozotocin-induced diabetic mice. Diabetes 21 Todd PA, Goa KL, Langtry HD. Transdermal nitroglycerin (glyceryl 2004; 53:1564–9. trinitrate). A review of its pharmacology and therapeutic use. Drugs 8 Sogo N, Magid KS, Shaw CA et al. Inhibition of human platelet 1990; 40:880–902. aggregation by nitric oxide donor drugs: relative contribution of 22 Pacher P, Szabo C. Role of poly(ADP-ribose) polymerase-1 activa- cGMP-independent mechanisms. Biochem Biophys Res Commun 2000; tion in the pathogenesis of diabetic complications: endothelial dys- 279:412–19. function, as a common underlying theme. Antioxid Redox Signal 2005; 9 Vilahur G, Baldellou MI, Segales E et al. Inhibition of thrombosis 7:1568–80. by a novel platelet selective S-nitrosothiol compound without hemo- 23 Khan F, Elhadd TA, Greene SA et al. Impaired skin microvascular dynamic side effects. Cardiovasc Res 2004; 61:806–16. function in children, adolescents, and young adults with type 1 10 Johanning RJ, Zaske DE, Tschida SJ et al. A retrospective study of diabetes. Diabetes Care 2000; 23:215–20. sodium nitroprusside use and assessment of the potential risk of 24 Cohen RA. Role of nitric oxide in diabetic complications. Am J Ther cyanide poisoning. Pharmacotherapy 1995; 15:773–7. 2005; 12:499–502. 11 Hogg N. Biological chemistry and clinical potential of S-nitrosothiols. 25 Gow AJ, Farkouh CR, Munson DA et al. Biological significance of Free Radic Biol Med 2000; 28:1478–86. nitric oxide-mediated protein modifications. Am J Physiol Lung Cell 12 Zhang Y, Hogg N. S-nitrosothiols: cellular formation and transport. Mol Physiol 2004; 287:L262–8. Free Radic Biol Med 2005; 38:831–8. 26 Foster MW, Stamler JS. New insights into protein S-nitrosylation. 13 Ignarro LJ, Gruetter CA. Requirement of thiols for activation of Mitochondria as a model system. J Biol Chem 2004; 279:25891–7. coronary arterial guanylate cyclase by glyceryl trinitrate and 27 Szabo C, Salzman AL, Ischiropoulos H. Endotoxin triggers the sodium nitrite: possible involvement of S-nitrosothiols. Biochim expression of an inducible isoform of nitric oxide synthase and the Biophys Acta 1980; 631:221–31. formation of peroxynitrite in the rat aorta in vivo. FEBS Lett 1995; 14 Mellion BT, Ignarro LJ, Myers CB et al. Inhibition of human platelet 363:235–8. aggregation by S-nitrosothiols. Heme-dependent activation of sol- 28 Murray J, Taylor SW, Zhang B et al. Oxidative damage to mito- uble guanylate cyclase and stimulation of cyclic GMP accumulation. chondrial complex I due to peroxynitrite: identification of reactive Mol Pharmacol 1983; 23:653–64. tyrosines by mass spectrometry. J Biol Chem 2003; 278:37223–30. 15 Ricardo KF, Shishido SM, de Oliveira MG et al. Characterization 29 Chen YR, Chen CL, Chen W et al. Formation of protein tyrosine of the hypotensive effect of S-nitroso-N-acetylcysteine in normo- ortho-semiquinone radical and nitrotyrosine from cytochrome tensive and hypertensive conscious rats. Nitric Oxide 2002; 7:57– c-derived tyrosyl radical. J Biol Chem 2004; 279:18054–62. 66. 30 Lewis SJ, Graves JE, Bates JN et al. Peroxynitrite elicits dysfunction 16 Mateo AO, De Artinano MAA. Nitric oxide reactivity and mecha- of stereoselective S-nitrosocysteine recognition sites. J Cardiovasc nisms involved in its biological effects. Pharmacol Res 2000; 42: Pharmacol 2005; 46:637–45. 421–7. 31 Zhang H, Xu Y, Joseph J, Kalyanaraman B. Intramolecular electron 17 de Oliveira MG, Shishido SM, Seabra AB et al. Thermal stability of transfer between tyrosyl radical and cysteine residue inhibits tyro- primary S-nitrosothiols: roles of autocatalysis and structural effects sine nitration and induces thiyl radical formation in model pep- À on the rate of nitric oxide release. J Phys Chem 2002; 106: tides treated with myeloperoxidase, H2O2, and NO2 : EPR SPIN 88963–70. trapping studies. J Biol Chem 2005; 280:40684–98. 18 Seabra AB, Fitzpatrick A, Paul J et al. Topically applied S-nitroso- 32 Thadani U, Lipicky RJ. Ointments and transdermal nitroglycerin thiol-containing hydrogels as experimental and pharmacological patches for stable angina pectoris. Cardiovasc Drugs Ther 1994; 8: nitric oxide donors in human skin. Br J Dermatol 2004; 151: 625–33. 977–83. 33 Kanikkannan N, Kandimalla K, Lamba SS et al. Structure–activity 19 Shishido SM, Seabra AB, Loh W et al. Thermal and photochemical relationship of chemical penetration enhancers in transdermal drug nitric oxide release from S-nitrosothiols incorporated in Pluronic delivery. Curr Med Chem 2000; 7:593–608.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp814–818 CUTANEOUS BIOLOGY DOI 10.1111/j.1365-2133.2006.07728.x Stromal ﬁbroblasts from basal cell carcinoma affect phenotype of normal keratinocytes L. Lacina,* K. Smetana Jr,* B. Dvorˇa´nkova´,* R. Pytlı´k,§ L. Kideryova´,§ L. Kucˇerova´,– Z. Plza´kova´,* J. Sˇtork, H-J. Gabius** and S. Andre´** *Institute of Anatomy, Department of Dermatovenerology, §First Department of Internal Medicine, First Faculty of Medicine, Charles University, U nemocnice 2, 128 00 Prague 2, Prague, Czech Republic Centre of Cell Therapy and Tissue Repair, Second Faculty of Medicine, Charles University, Prague, Czech Republic –Department of Clinical Genetics, University Hospital Hradec Kra´love´, Hradec Kra´love´, Czech Republic **Institute of Physiological Chemistry, Faculty of Veterinary Medicine, Ludwig-Maximilians-University, Munich, Germany

Summary

Correspondence Background Epithelial–mesenchymal interactions are important not only to direct K. Smetana Jr. the course of prenatal development of skin and its appendages but also to influ- E-mail: [email protected] ence the behaviour of transformed epithelial cells. Objectives Evaluation of the role of stromal fibroblasts on the phenotype of epithe- Accepted for publication 6 October 2006 lial cells of basal cell carcinoma (BCC). Methods The phenotype of human BCC was compared with the in vitro model Key words where the growth and phenotypic pattern of normal human keratinocytes were basal cell carcinoma, epithelial–mesenchymal monitored in co-culture with fibroblasts prepared from stroma of BCC (BCCFs), interaction, galectin-1, keratin, keratinocyte with normal dermal fibroblasts or with two established fibroblast lines. We visu- Conflicts of interest alized the expression of a panel of keratins, three types of endogenous lectin None declared. [galectin (Gal)-1, Gal-3 and Gal-7], binding sites for Gal-1 and Gal-3, a proliferation marker Ki67, nucleolar protein nucleostemin (NuclS) and membrane protein Ber-EP4. A phenotype and karyotype of BCCFs were also monitored. BCCFs were also grafted to NOD/LtSz-Rag1null mice to evaluate their malignant potential. Results Prolonged cultivation of BCCFs has led to morphological changes, loss of contact inhibition, loss of fibroblast surface antigens and progressive aneuploidity. However, a fully malignant phenotype did not develop as these cells did not form tumours in immunodeficient mice. Co-culture of BCCFs with normal keratinocytes in vitro led to their phenotypical changes resembling those in BCC, namely, expression of keratin 19. These keratinocytes also strongly express nuclear binding sites for Gal-1 and NuclS. This phenotype was not observed when normal keratinocytes were cultured with nontumour-originated fibroblasts. Conclusions These observations indicate that BCCFs may differ from normal fibroblasts and may play a regulatory role in BCC biology.

Epithelial–mesenchymal interaction is important for the develop- but they can influence their phenotype, such as expression of ment of the skin and its appendages and even the postnatal body-site-specific keratins.7,8 function of the hair follicle is dependent on the interaction of Malignant epithelial tumours (carcinomas) are believed to the epidermal component of the hair follicle with the dermal be composed from the transformed epithelium and a non- papilla.1,2 The fundamental role of this interaction can be malignant mesenchymal component (tumour stroma). Interest demonstrated in vitro. Although cultivation systems where has been focused predominantly on the epithelial component keratinocytes can be cultured without feeder cells have been and the stroma was considered to be the supporting tissue developed,3–5 co-culture with fibroblasts as a feeder cell layer responsible for saturation of the epithelial component by nutri- brings the best results, including the normal differentiation tion via stromal vessels. However, the epithelial–mesenchy- pattern of cultured keratinocytes.6 Feeder layer fibroblasts are mal interaction was also discovered in carcinomas, where essential not only for the initial attachment of keratinocytes, tumour stromal cells can influence not only the growth of a

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 819 820 BCCFs affect phenotype of normal keratinocytes, L. Lacina et al. tumour but also its aggressiveness, including the metastasizing to the Declaration of Helsinki principles. Three samples of potential.9–11 normal human skin from the same source were used for This study focuses on the role of tumour stroma in the comparison. development of human basal cell carcinoma (BCC). To evaluate Tumour samples were embedded in Tissue-Tek (Sakkura, the potential role of BCC stromal cells for a tumour differenti- Zoeterwoude, the Netherlands), frozen in liquid nitrogen and ation pattern, we prepared BCC stromal fibroblasts (BCCFs). sectioned using Cryocut-E (Reichert-Jung, Vienna, Austria) to These cells were characterized by immunocytochemistry, flow 7-lm thick sections. cytometry and cytogenetic investigations and then co-cultured with normal human keratinocytes. The results were compared Cell cultivation with the same normal human keratinocytes co-cultured with mouse 3T3, human LEP (embryonic lung-derived fibroblasts) Normal DFs and keratinocytes were prepared from the residual cells and with freshly prepared human dermal fibroblasts skin of healthy patients (with their informed consent) who (DFs). The phenotype of cultured keratinocytes was compared underwent plastic surgery. The skin graft was treated over- with the phenotype of BCC epithelial cells. We have visualized night with 0Æ3% solution of trypsin at 4 C. The dermis and a panel of keratins using the LP34 (K1) antibody, keratin (K) epidermis were separated. Keratinocytes obtained from the 10, K14 and K19. While K10 is marker of suprabasal termin- epidermis were expanded following the modified Rheinwald– ally differentiated cells, K14 is expressed in basal cells of Green method.26 Keratinocytes from the first and second sub- epithelium only.12 K19 is also expressed prenatally in basal cultures were frozen in aliquots in 10% dimethyl sulphoxide keratinocytes; postnatally it disappears and K19-positive cells (Sigma, Prague, Czech Republic) and stored in liquid nitro- are present in the bulge region of the hair follicle where stem gen. Fibroblasts migrating from small pieces of dermis were cells are present.12,13 This keratin is also expressed in a section harvested and expanded in Dulbecco’s modified Eagle’s med- of BCC cells.14,15 Collagen type IV was detected to visualize ium with 10% fetal bovine serum (both, Biochrom, Berlin, integrity of the basement membrane surrounding the tumour Germany) at 37 C and 5% CO2. BCCFs were prepared and foci. Membrane protein Ber-EP4, which is extensively cultured by the modified method of Grando et al.27 We expressed in BCC epithelial cells,16 was also detected. employed cells from the 7th passage cultured for 60 days with The emerging role of endogenous lectins, especially galec- a normal appearance and cells from the 10th (83 days) and tins, for cell communication prompted us to add analysis of 15th (128 days) passages exhibiting lack of contact inhibition. key members of the family of adhesion/growth-regulatory LEP cells were obtained from SevaPharma (Prague, Czech lectins.17,18 Having prepared labelled tissue lectins, we were Republic) and cultured in a serum-free medium, EPL (Seva- able to assess the expression of binding sites for adhesion/ Pharma), in a closed system at 37 C. 3T3 cells were cultured growth-regulatory galectin-1 (Gal-1-BS) together with the in H-MEM (SevaPharma) with 10% bovine serum (ZVOS, 19,20 expression of galectin (Gal)-1. Of note, we demonstrated Hustopece, Czech Republic) at 37 C and 3Æ3% CO2. in our previous studies that Gal-1/Gal-1-BS are expressed in Before co-cultivation with keratinocyte proliferation activity, keratinocytes prepared from human and porcine hair follicles all types of fibroblasts were stopped by using a solution of ) also exhibiting K19.21,22 Gal-3/Gal-3-BS, the chimera-type Mitomycin C (Sigma) at a concentration of 25 lgmL 1 for member, and Gal-7 were also included in the study.19,23 3 h. Feeder cells were seeded on the cover glass at a density ) The last marker studied was the nucleolar protein nucleo- of 25 000 cells cm 2 and cultured for 24 h; the suspension of ) stemin (NuclS). NuclS is expressed in neuronal and haemato- keratinocytes (20 000 cells cm 2) was then added and the poietic stem cells and malignancies originating from these cells were cultivated in a keratinocyte medium26 at 37 C and 24 precursors. Although this nucleolar protein is probably not 3Æ3% CO2. an exclusive marker of epidermal stem cells, because it is also expressed in nucleoli of suprabasal keratinocytes, in vitro it is Fluorescence-activated cell sorting analysis of dermal expressed predominantly in nucleoli of keratinocytes prepared fibroblasts and basal cell carcinoma stromal fibroblasts from hair follicles cultured in the presence of feeder cells.25 Shortly passaged DFs and BCCFs, cultured for 60 (7th pass- Materials and methods age), 83 (10th passage) and 128 (15th passage) days, were harvested with trypsin–EDTA (ethylenediamine tetraacetic acid) solution. The effect of trypsin was neutralized by the Tissue processing addition of fetal calf serum. Cells were then re-suspended in a Samples of 30 BCCs were obtained from the Departments of fresh culture medium and analysed for the following markers: Dermatovenerology of the First and Second Faculties of Medi- CD29 (clone MAR4) and CD44 (clone G44-26) (both, Pharm- cine and from the Department of Otorhinolaryngology, Head ingen, Erembodegem, Belgium), CD45 (clone T29/33, Dako- and Neck Surgery of the First Faculty of Medicine (both facul- Cytomation, Glostrup, Denmark), CD90 (clone 5E10, ties of the Charles University, Prague, Czech Republic) with Pharmingen), CD105 (clone NS6, DakoCytomation), CD166 the consent of donors. The experiments were approved by the (clone 3A6, Pharmingen), HLA-A, B, C (clone W6/32) and local ethics committee and they were performed according HLA-DR, DP, DQ (clone CR3/43) (both, DakoCytomation).

Isotype immunoglobulins were used as negative controls in all but against antigens not present in studied cells or tissues. Spe- experiments. Measurements were performed using the FACS- cificity of galectin binding was tested by the omission of galec- Calibur (BD Biosciences Immunocytometry Systems, San tin (and using the second-step reagent only) or by use of Jose, CA, U.S.A.) and analysed on Summit V3.3. Build 1024 lactose as a competitive inhibitor. The nuclei of the majority of software (DakoCytomation, Fort Collins, CO, U.S.A.). specimens were counterstained with DAPI (Sigma-Aldrich), For DNA analysis, DNACon3 kit (Consul T.S., Orbassano, specifically recognizing DNA. The specimens were mounted to Italy, distributed by DakoCytomation) was used according to Vectashield (Vector Laboratories, Burlingame, CA, U.S.A.) and the manufacturer’s instructions. Healthy human blood mono- inspected and analysed using Eclipse 90i (Nikon, Prague, Czech nuclear cells were used as a standard for this type of analysis. Republic), a fluorescence microscope equipped with specific filter blocks, a high-resolution CCD camera (Cool-1300Q, Vosskhu¨ller, Osnabrick, Germany) and a computer-assisted Cytogenetic analysis image analyser (LUCIA 5Æ10) (Laboratory Imaging, Prague, BCCFs from the 7th and 15th passages were subcultured for Czech Republic). Calculations using Student’s nonpaired t-test 24 h, incubated with Demecolcemid (Sigma-Aldrich, Prague, led to the assessment of significance levels. Czech Republic) for 4 h, separated with trypsin–EDTA solution, treated with hypotonic KCl and fixed with acid ethanol. Basal cell carcinoma stromal fibroblasts xenografting to Metaphasic chromosomes were analysed after G-/R-banding immunodeficient mice using Ikaros, version 5 (MetaSystems, Altlussheim, Germany); 50 metaphases were analysed in all samples investigated. BCCF cells (3 · 106) from the 10th passage were injected subcutaneously or intraperitoneally into two 3-Gy-irradiated NOD/LtSz-Rag1null mice (Jackson Laboratories, Bar Har- Immunochemistry and lectin cytochemistry bor, ME, U.S.A.). After 6 weeks, apparently healthy and well- The sections or cells adhering to coverslips or collagen inserts prospering animals were sacrificed and autopsied. Organs were were washed in phosphate-buffered saline (PBS) and fixed embedded in TissueTek, frozen in liquid nitrogen and exam- briefly with 5% paraformaldehyde diluted in PBS (pH 7Æ3). The ined for the presence of metastases. antigens or binding partners for galectins were visualized as 28,29 described using a panel of monoclonal or polyclonal anti- Results bodies and biotinylated galectins as shown in Table 1. The galectin-related probes were subjected to specificity and activity Phenotype analysis of basal cell carcinoma in situ controls as described previously.19,30 The histochemical specificity was tested by replacement of a distinct antibody by The majority of the BCCs studied were of a nodular or micro- another polyclonal or monoclonal antibody of the same isotype nodular type (24 of 30). Samples obtained from six patients

Table 1 Probes used for immunocytochemic phenotypic characterization of basal cell carcinomas and cultured cells

Visualized epitope Type of probe Supplier Second-step reagent Supplier Panel of keratins (K1¼LP34) Mouse mAb DakoCytomationa (a) SwAM-FITC (a) AlSeVab Keratin 10 (b) Goat antimouse IgG-TRITC (b) Sigma-Aldrichc Ber-EP4 Ki67 Keratin 19 Vimentin Smooth muscle actin Keratin 14 Mouse mAb Sigma-Aldrichc (a) SwAM-FITC (a) AlSeVab Collagen IV (b) Goat antimouse IgG-TRITC (b) Sigma-Aldrichc Fibronectin Nucleostemin Goat pAb Neuromicsd Donkey antigoat-TRITC Jackson Laboratoriese Galectin-1 Rabbit pAb S.A. and H-J.G.f SwAR-FITC AlSeVab Galectin-3 Galectin-7 Galectin-1-binding sites Biotinylated lectin S.A. and H-J.G.f ExtrAvidin-TRITC Sigma-Aldrichc Galectin-3-binding sites

mAb, monoclonal antibody; pAb, polyclonal antibody; FITC, ﬂuorescein–isothiocyanate; SwAM-FITC, FITC-labelled swine antimouse antibody; SwAR-FITC, FITC-labelled swine antirabbit antibody; TRITC, tetramethylrhodamine isothiocyanate. aDakoCytomation, Brno, Czech Republic; bAlSeVa, Prague, Czech Republic; cSigma-Aldrich, Prague, Czech Republic; dNeuromics, Blooming- ton, MN, U.S.A.; eJackson Laboratories, West Grove, PA, U.S.A.; fantibodies prepared by co-authors of this paper: S. Andre´ and H-J. Gabius.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 822 BCCFs affect phenotype of normal keratinocytes, L. Lacina et al. were of the superﬁcial type. The positivity for the tissue effec- were detected in the cytoplasm of tumour cells of all studied tor Gal-1 showed clear differences. Whereas the normal epi- BCCs (Fig. 1d). In comparison with normal epidermis, practi- dermis and the majority of tumour epithelial cells (25 of 30) cally no signal for the expression of Gal-3/Gal-3-BS or for were Gal-1-free, all the studied tumour samples exhibited Gal-7 was observed (not shown). Smooth muscle actin was signs of increased expression of Gal-1 in tumour stroma com- detected in smooth muscle cells of the vessel wall in the pared with normal dermis (Fig. 1a). Binding sites for Gal-1 tumour area (Fig. 1b). Tumour keratinocytes from all studied

(a) (b)

(e) (f)

Fig 1. Detection of galectin (Gal)-1 (green signal; a), of keratin (K) 14 (red signal; a), of smooth muscle (SM) actin (red signal; b), of K19 (green signal; c), of Gal-1-binding sites (Gal-1-BS) (red signal; d), of Gal-3-BS (green signal; b), of collagen type (Col) IV (green signal; d), of Ber-EP4 (green signal; e), of Ki67 (green signal; f) and of nucleostemin (NuclS) (red signal; f) in basal cell carcinoma (BCC) (a–f). Discontinuity of Col IV containing basement membrane is marked by white arrows (d). Asterisk indicates the position of hair follicle negative for Ber-EP4 (e). Tumour tissue border is marked with dashed line (c, f). Nuclei were counterstained with DAPI (4,6-diamino-2-phenylindole) (a–c, e). Bar ¼ 100 lm.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 BCCFs affect phenotype of normal keratinocytes, L. Lacina et al. 823 samples exhibited keratins, especially K14 (Fig. 1a). This type monitored in 10 BCC samples and all exhibited a strong signal of intermediate filament was detected selectively in the basal for NuclS (Fig. 1f). Ki67 expression was not higher than in layer of a normal epithelium. K19, which was detected in 10% of tumour cells (Fig. 1f). three hair follicles of a normal epidermis, was observed in 70% (21 of 30) of BCC samples, where positive epithelial cells Flow cytometry, DNA analysis and cytogenetic analysis formed groups in the tumour, mainly on the periphery of cultured basal cell carcinoma stromal fibroblasts (Fig. 1c). No cells with K10 expression were observed in the BCCs studied. A basement membrane with collagen type IV In comparison with normal DFs, the cultured BCCFs exhibited fully surrounded the tumour tissue except for BCCs from five reduction of expression of all fibroblast markers during the patients where a discontinuity of signal was detected cultivation period. HLA-I expression was reduced as well, (Fig. 1d). Ber-EP4 was monitored in five samples only and all while panleucocytar antigen CD45 and HLA-II antigen were cells were highly positive for the expression of this marker negative in all fibroblast cultures, as expected. The phenotype (Fig. 1e). Interestingly, when normal upper parts of the hair from the 15th passage cells is shown and compared with the follicle were present in the same figure as an internal negative phenotype of normal fibroblasts and with negative isotypic control, they exhibited no signal. Proliferation marker Ki67 immunoglobulin control (Fig. 2a–h). was detected basally in normal epithelium and NuclS basally DNA analysis revealed progressive aneuploidization of and in the lower spinous layers. Both these markers were BCCFs during passaging. In the 7th passage, only 26% of

(a) (b) (c) (d) 596 485 485 485 Negative control Negative control Negative control Negative control Normal dermal fibroblasts Normal dermal fibroblasts Normal dermal fibroblasts Normal dermal fibroblasts 448 348 348 Basal cell carcinoma 348 Basal cell carcinoma Basal cell carcinoma Basal cell carcinoma stromal cells stromal cells stromal cells stromal cells 299 232 232 232

149 116 116 116

0 0 0 0 CD29 CD90 CD44 CD45 (e) (f) (g) (h)

476 394 529 465 Negative control Negative control Negative control Negative control Normal dermal fibroblasts Normal dermal fibroblasts Normal dermal fibroblasts Normal dermal fibroblasts 358 Basal cell carcinoma 295 Basal cell carcinoma 396 Basal cell carcinoma 348 Basal cell carcinoma stromal cells stromal cells stromal cells stromal cells

239 197 254 232

119 98 132 116

0 0 0 0

CD105 CD166 HLA-I HLA-II (i) (j)

120

100

80 1 2 3 4 5 mar 60

20 Number of cells (%) 0 6 789101112 BCCF LP-BCCF LP-BCCF I Cell type

13 14 15 16 17 18

19 20 21 22 X Y

Fig 2. Comparison of phenotype of normal dermal fibroblasts (DFs) (grey) and basal cell carcinoma stromal fibroblasts (BCCFs) (black) performed by fluorescence-activated cell sorting analysis (a–h). CD29 (a), CD44 (b), CD45 (c), CD90 (d), CD105 (e), CD166 (f), HLA-I (g) and HLA-II (h) were detected. Proportion of diploid (white column) and aneuploid (black column) cells in BCCFs cultured for 60 (BCCF), 83 (LP-BCCF), and 128 (LP-BCCF I) days, respectively, and karyotype of cultured BCCFs (i, j).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 824 BCCFs affect phenotype of normal keratinocytes, L. Lacina et al.

G0–G1 cells had a DNA index of 1Æ0, while 74% of cells were The morphology as well as the phenotype of cultured kera- near-triploid (DNA index 1Æ43). In the 10th passage, the tinocytes were significantly influenced by the feeder type number of diploid cells decreased to 16%, while in the 15th used, except for the expression of a panel of keratins visual- passage all cells were hypertriploid to near-tetraploid (DNA ized by the LP34¼CK1 antibody. Only peripheral keratinocytes index 1Æ73 and 1Æ93, respectively) (Fig. 2i,j). of colonies grown with an LEP or 3T3 feeder cells were positive for K14 (Fig. 5a,c,e). On the other hand, all keratinocytes co-cultured with BCCFs were strongly positive for this keratin Immunocytochemical analysis of cultured basal cell (Fig. 3f, 4e, 5b,c,f). K19 was observed only in keratinocytes carcinoma stromal fibroblasts co-cultured for 5 and more days with BCCFs (Fig. 4c). K19- The majority of short-term-cultured BCCFs expressed vimentin positive keratinocytes were observed also in co-culture with (Fig. 3a) as a typical marker of the mesenchymal cell. This long-term-passaged BCCFs not producing a Gal-1-rich extra- positivity was significantly reduced in the course of prolonged cellular matrix (Fig. 4d,e), even at the 11th day of cultivation passaging (Fig. 3b). Cultured BCCFs without (Fig. 3c) or with (Fig. 4e). co-cultured keratinocytes (Fig. 3e) produced an extensive To evaluate if the direct contact of keratinocytes with BCCFs extracellular matrix containing a large amount of endogenous is necessary for expression of this type of keratin, the insert lectin-Gal-1 that corresponded to high positivity for this lectin system separating both cell populations was used. K19 was in tumour stroma in situ (Fig. 1a). Long-term passaging of expressed in keratinocytes physically separated by an insert BCCFs was connected with minimization of Gal-1 production from direct contact with BCCFs but cultured in the same well in BCCFs cultured with as well as without keratinocytes and in the same media (Fig. 4h). Expression of this keratin by (Fig. 3d,f). Because numerous cells of the myofibroblast type keratinocytes separated by the insert from DFs was very low exhibiting smooth muscle actin are known to be frequent in or negative (Fig. 4g). Similar to K19, keratinocytes co- tumour stroma, the presence of smooth muscle actin cells was cultured with BCCFs also expressed Ber-EP14, in situ highly monitored in BCCFs, where only rare smooth muscle actin- expressed in cells of BCC (Fig. 4f). Ber-EP4 as a membrane containing cells were observed after short-term culture marker typical for BCC cells was not expressed by keratino- (Fig. 3c) and no cells in a prolonged culture (Fig. 3d). Inter- cytes separated from BCCFs using this insert system (Fig. 4i,j). estingly, long-term-cultured BCCFs, namely in the presence of K10 was very rarely observed in 7-day cultured cells without keratinocytes in culture, expressed Ber-EP4 (Fig. 3h), a mem- some relation to the type of feeder cells used. brane protein characteristic for epithelial cells. Binding of Gal-1 to the nuclei of cultured keratinocytes was significantly influenced by the type of feeder cells used (Fig. 4a,b,d), where the very high extent of nuclear Gal-1-BS Influence of basal cell carcinoma stromal fibroblasts on expression was detected when BCCFs were introduced into the phenotype of normal cultured epidermal keratinocytes system (Fig. 5b,d). When all types of feeder cells (3T3, LEP, DF, BCCF) were co- Expression of NuclS exhibited very similar trends (Fig. 5e–g). cultured with normal human keratinocytes, only BCCFs were Gal-1 and Gal-3/Gal-3-BS were not observed in cytoplasm or in able to form a Gal-1-rich extracellular matrix (Fig. 3e, 4c), the nuclei of keratinocytes cultured for 5 days. A weak signal contrary to other types of feeder cells where the amount of for Gal-7 was detected in the cytoplasm of cells at the beginning extracellular matrix containing Gal-1 was only negligible or of a multilayer growth, namely in the middle of colonies cul- absent (Fig. 4a,b). However, the ability of BCCFs to produce a tured with all types of feeder cells. Gal-1-rich extracellular matrix was inhibited in the course of Because of the extensive growth of 3T3, LEP and DF, these prolonged in vitro expansion (Fig. 3f, 4d,e). cells were pretreated with mitomycin to reduce their prolifer- When we monitored the phenotype of keratinocytes co- ation in co-culture with normal keratinocytes, as was described cultured with different feeder cells, the early cultured epidermal in Material and methods. To exclude the effect of this drug, cells (day 1) were very similar concerning their poor spreading, keratinocytes were co-cultured with BCCFs with or without expression of keratins and galectins and their binding sites. It mitomycin pretreatment. No differences in growth and pheno- should be mentioned here that keratinocytes cultured on all type characteristics of keratinocytes were found in either group types of feeder cells expressed K14, normally present in the where BCCF feeder cells were pretreated or nonpretreated. basal layer of interfollicular epidermis and K19 (Fig. 4a), which is postnatally expressed by cells of the bulge region of the outer Basal cell carcinoma stromal fibroblast grafting to mice root sheath of hair follicle, where stem cells are present. This result contrasted with the appearance of a 5-day-old culture that No tumours were observed at the transplantation site, in lym- was strongly influenced by the type of feeder cells used. While phatic tissue or in internal organs. keratinocytes formed large colonies with poorly visible cell borders (compact colonies) when 3T3, LEP and DF were employed Discussion as a feeder layer (Fig. 5a,e), the keratinocytes cultured in company with BCCFs formed small colonies with well-visible cell The main finding of this study is the observation that BCCFs borders (dispersed colonies) (Fig. 4f, 5b,e,f). were able to influence the growth and differentiation pattern

BCCF Vimentin LP-BCCF Vimentin

50 µm (a) (b)

BCCF Gal-1 SM-actin LP-BCCF Gal-1 SM-actin

50 µm (c) (d) BCCF+K/5 Gal-1 LP-BCCF+K/5 Gal-1 K14

(e) (f) BCCF+K/5 Ber-EP4 LP-BCCF+K/11 Ber-EP4

50 µm 50 µm (g) (h)

Fig 3. Detection of vimentin (green signal; a, b), of smooth muscle (SM) actin (red signal; c, d), of galectin (Gal)-1 (green signal; c–f), of keratin (K) 14 (red signal; f) and of Ber-EP4 (green signal; g, h) in basal cell carcinoma stromal ﬁbroblasts (BCCFs) cultured alone (a–d) or with keratinocytes (e–h). BCCFs passaged for 60 or 128 days (LP-BCCF) were used. Arrows indicate vimentin-negative BCCFs. Asterisks were placed in areas occupied with keratinocytes. Dashed-line circle surrounds group of Ber-EP4-positive BCCFs. Enlarged detail is in quadrangle. All nuclei were counterstained with 4,6-diamino-2-phenylindole (DAPI).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 826 BCCFs affect phenotype of normal keratinocytes, L. Lacina et al.

Lep+K/1 Gal-1 3T3+K/5 Gal-1 BCCF+K/5 Gal-1 K19 K19 K19

(a) 50 µm (b) (c)

D5 LP-BCCF+K/11 LP-BCCF/11 Ber-EP4 Gal-1 (d) K19

(e) (f)

DF- i+K/5 (Col) K19 BCCF- i+K/5 (Col) K19

(g) (h)

DF- i+K/5 (Col) Ber-EP4 BCCF- i+K/5 (Col) Ber-EP4

(i) (j)

Fig 4. Detection of galectin (Gal)-1 (green signal; a–f), of keratin (K) 19 (red signal; a–e) (green signal; g, h) and of Ber-EP4 (green signal; f, i, j) in keratinocytes cultured with LEP (embryonic lung-derived fibroblasts) cells for 1 day (a), in keratinocytes cultured with 3T3 (b), with basal cell carcinoma stromal fibroblasts (BCCFs) (c) and with 128-days passaged BCCFs (LP-BCCF, d) for 5 days. Insert system separated keratinocytes from dermal fibroblasts (DFs) (g and i) and from BCCFs (h and j). Representative K19-positive keratinocytes are marked by white arrows. Border of cultured keratinocytes is marked against feeder cells by dashed line (a–c). Nuclei are counterstained with 4,6-diamino-2-phenylindole (DAPI). Bar ¼ 50 lm. of normal keratinocytes. Normal keratinocytes co-cultured and DFs. K19 is postnatally expressed in a pool of epidermal with BCCFs express K19 after 5 days or more in culture, stem cells13 and in cells of BCC as was also shown in this which was not observed in the system employing 3T3, LEP study. These K19-positive cells prepared from hair follicle also

3T3+K/5 K14 Gal-1-BS BCCF+K/5

(a) 50 µm (b)

20 µm (e) (f)

(g)

Fig 5. Detection of keratin (K) 14 (green signal; a, b, e, f), of Gal-1-BS (binding sites for adhesion/growth-regulatory galectin-1) (red signal; a, b) and of nucleostemin (NuclS) (red signal; e, f) in keratinocytes co-cultured with 3T3 (a, e) or with basal cell carcinoma stromal fibroblasts (BCCFs) (b, f) for 5 days. The fluorescence profile for K14 (c) was measured in keratinocyte colonies cultured with 3T3 (blue curve) or with BCCFs (red curve) from the dot in the direction of the arrow. Expression of nuclear Gal-1-BS (d) and of NuclS (g) in keratinocytes was estimated also on the basis of the measurements of the fluorescence intensity. The dashed line represents the level of nonspecific background. Three asterisks indicates statistically significant differences at P £ 0Æ01. Nuclei were counterstained with 4,6-diamino-2-phenylindole (DAPI). Bar ¼ 50 lm.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 828 BCCFs affect phenotype of normal keratinocytes, L. Lacina et al. exhibit nuclear positivity for Gal-1 or Gal-1-BS15,22,31,32 and likely to provide valuable information with potential to we observed a high signal of Gal-1 binding to nuclei of kera- improve our understanding of stromal effects. tinocytes cultured in the presence of BCCFs. These keratino- In conclusion, fibroblasts with altered karyotype originating cytes also extensively expressed NuclS, which was also from BCC can influence the growth characteristics and pheno- detected in cells of BCC in situ. As reviewed by Tilli et al.,33 type of normal cultured keratinocytes towards a pattern similar BCC originates from epidermal stem cells located mainly in but not identical to malignant keratinocytes in situ. These the hair follicle by the alteration of Sonic hedgehog signalling. observations intimate an important role of tumour stroma for Therefore, the expression of K14 and K19 in cells of a sub- BCC biology with implications for developing new therapeutic stantial proportion of BCCs is not surprising.14,34 approaches for this type of skin cancer. However, it should be noted here that K19 was expressed in normal, originally negative keratinocytes co-cultured with Acknowledgments BCCFs. This observation indicates the possibility for cross-talk between stromal and malignant cells of BCC, where a regula- This study was supported by the Ministry of Youth and Sport tory role of stromal cells on BCC epithelial cell pattern is of the Czech Republic (projects MSM 0021620806 and likely. Because K19 was also expressed in keratinocytes separ- 1M0021620803), Grant Agency of the Czech Republic (pro- ated from physical contact with BCCFs or extracellular matrix ject 304/04/0171) and EC Marie Curie Research Training prepared with these cells, some factors produced by the culti- Network grant (contract MRTN-CT-2005-019561). The authors vation media can be responsible for the phenomenon are grateful to Eva Vancova´ and Vı´t Hajdućh for excellent tech- described. Several reports have demonstrated the direct role of nical assistance and Drs S. Namirha and B. Friday for inspiring tumour stromal cells on the biology of cancer cells including discussions. their aggressiveness and metastasation.9–11 BCCFs produce extensive amounts of extracellular matrix highly positive for References an endogenous lectin, namely Gal-1, in co-culture with keratinocytes. This protein is biologically active for tumour cells 1 Gilbert SF. Developmental Biology, 6th edn. Sunderland: Sinauer Associ- in an ambivalent manner, with pro- and antitumoral activities ates, 2000. depending on the context. For example, in patients with pros- 2 Paus R, Cotsarelis G. The biology of hair follicles. New Engl J Med 1999; 341:491–7. tate carcinoma, a high expression of Gal-1 in stroma predicts 27 3 Tsao MC, Walthall BJ, Ham RG. Clonal growth of normal human a poor prognosis and it is responsible for tissue invasion in epidermal keratinocytes in a defined medium. J Cell Physiol 1982; 35,36 glioblastoma. When Gal-1 is presented by an extracellular 110:219–29. matrix it efficiently triggers activated T-cell death via a 4 Daley JP, Hawley-Nelson P, Epstein DA. Growth of human epider- caspase-dependent mechanism.37,38 Moreover, Gal-1 is able to mal keratinocytes in keratinocyte serum-free medium. Focus 1990; downregulate proliferation and modulate tumour cell adhesion 12:68–71. and vascularization at the tumour site where its activity 5 Labsky J, Dvorankova B, Smetana K et al. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratino- depends on the interaction of galectin with integrins or gan- 19,39–42 cytes without feeder cells. Biomaterials 2003; 24:863–72. gliosides. In view of these data, the marked expression 6 Plza´k J, Holı´kova´ Z, Smetana K Jr et al. Differentiation-dependent of Gal-1 and its presentation in the extracellular matrix by glycosylation of cells in squamous epithelia detected by a mamma- fibroblasts originated from BCC can have a significant bio- lian lectin. Cells Tissues Organs 2002; 171:135–44. logical relevance. Because Gal-1-rich extracellular matrix pro- 7 Bordin S, Page RC, Narayan AS. Heterogeneity of normal human duction was reduced after prolonged passage of BCCFs, and diploid fibroblasts: isolation and characterization of one phenotype. keratinocytes were able to express both K19 and Ber-EP4, the Science 1984; 223:171–3. 8 Yamaguchi Y, Itami S, Tarutani M et al. Regulation of keratin 9 in non- influence of a BCC-derived feeder layer on the expression pro- palmoplantar keratinocytes by palmoplantar fibroblasts through epi- file of normal keratinocytes can be expected to be rather thelial–mesenchymal interactions. J Invest Dermatol 1999; 112:483–8. complex. Two hypotheses on the unexpected expression of 9 van Kempen LCL, Rhee J-S, Dehne K et al. Epithelial carcinogenesis: Ber-EP4 by BCCFs can be put forward, one considering the dynamic interplay between neoplastic cells and their microenviron- high degree of plasticity of fibroblastoid cells where even cells ment. Differentiation 2002; 70:610–23. with a phenotype compatible with neuroectodemal cells were 10 Kiaris H, Chatzistamou I, Kalofouitis C et al. Tumour–stroma inter- prepared from fibroblasts under in vitro conditions.43 The sec- actions in carcinogenesis: basic aspects and perspectives. Mol Cell Biochem 2004; 261:117–22. ond approach can be based on the observations of Petersen 11 Bhowmick NA, Moses HL. Tumor–stroma interactions. Curr Opin 44 et al., who observed the epithelial–mesenchymal transition of Genet Dev 2005; 15:97–101. breast cancer epithelial cells to nontumorigenic stromal ele- 12 Lane EB, McLean WHI. Keratins and skin disorders. J Pathol 2004; ments. BCCFs were also not able to form tumours in immuno- 204:355–66. deprived mice. 13 Michel M, To¨ro¨k N, Godbout MJ et al. Keratin 19 as a biochemical The abundant production of extracellular matrix akin to marker of skin stem cells in vivo and in vitro: keratin 19 expressing stroma of BCC is also encountered in dermatofibromas/sarco- cells are differentially localized in function of anatomic sites, and their number varies with donor age and culture stage. J Cell Sci mas where it is usually covered with normal epithelium.45,46 1996; 109 (pt 5):1017–28. A comparative analysis along the lines reported herein is thus

14 Habets JM, Tank B, Vuzevski VD et al. Absence of cytokeratin 8 and 30 Kopitz J, Andre´ S, von Reitzenstein C et al. Homodimeric galectin-7 inconsistent expression of cytokeratin 7 and 19 in human basal cell (p53-induced gene 1) is a negative regulator for human neuro- carcinoma. Anticancer Res 1988; 8:611–16. blastoma cells. Oncogene 2003; 22:6277–88. 15 Dvorańkova´ B, Smetana K Jr, Chovanec M et al. Transient expres- 31 Nagy N, Legendre H, Engels O et al. Refined prognostic evaluation sion of keratin K19 is induced in originally negative interfollicular in colon carcinoma using immunohistochemical galectin finger- epidermal cells by adhesion of suspended cells. Int J Mol Med 2005; printing. Cancer 2003; 97:1849–58. 16:525–31. 32 Smetana K Jr, Dvorańkova´ B, Chovance M et al. Nuclear presence of 16 Imayama S, Yashima Y, Higuchi R, Urabe H. A new concept of adhesion/growth-regulatory galectins in normal/malignant cells of basal cell epitheliomas based on the three-dimensional growth pat- squamous epithelial origin. Histochem Cell Biol 2006; 125:171–82. tern of the superficial multicentric type. Am J Pathol 1987; 33 Tilli CM, van Steensel MA, Krekels GA et al. Molecular aetiology 128:497–504. and pathogenesis of basal cell carcinoma. Br J Dermatol 2005; 17 Gabius HJ. Cell surface glycans: the why and how of their func- 152:1108–24. tionality as biochemical signals in lectin-mediated information 34 Crowson AN. Basal cell carcinoma: biology, morphology and clin- transfer. Crit Rev Immunol 2006; 26:43–79. ical implications. Mod Pathol 2006; 19:S127–47. 18 Villalobo A, Nogales-Gonza´lez A, Gabius HJ. A guide to signaling 35 van den Brule FA, Waltregny D, Castronova V. Increased expression pathways connecting protein–glycan interaction with the emerging of galectin-1 in carcinoma-associated stroma predicts poor out- versatile effector functionality of mammalian lectins. Trends Glycosci come in prostate carcinoma patients. J Pathol 2001; 193:80–7. Glycotechnol 2006; 18:1–37. 36 Rorive S, Belot N, Decaestecker C et al. Galectin-1 is highly 19 Andre´ S, Kojima S, Yamazaki N et al. Galectins-1 and -3 and their expressed in human gliomas with relevance for modulation of ligands in tumor biology. J Cancer Res Clin Oncol 1999; 125: invasion of tumor astrocytes into the brain parenchyma. GLIA 461–74. 2001; 33:241–55. 20 Andre´ S, Kaltner H, Furuike T et al. Persubstituted cyclodextrin- 37 He J, Baum LG. Presentation of galectin-1 by extracellular matrix based glycoclusters as inhibitors of protein–carbohydrate recogni- triggers T cell death. J Biol Chem 2004; 279:4705–12. tion using purified plant and mammalian lectins and wild-type and 38 Sturm A, Lensch M, Andre´ S et al. Human galectin-2: novel inducer lectin-gene-transfected tumor cells as targets. Bioconjug Chem 2004; of T cell apoptosis with distinct profile of caspase activation. 15:87–98. J Immunol 2004; 173:3825–37. 21 Purkra´bkova´ T, Smetana K Jr, Dvorańkova´ B et al. New aspects of 39 Clausse N, van den Brule FA, Waltregny D et al. Galectin-1 expres- galectin functionality in nuclei of cultured bone marrow stromal sion in prostate tumor-associated capillary endothelial cells is and epidermal cells: biotinylated galectins as tool to detect specific increased by prostate carcinoma cells and modulates heterotypic binding sites. Biol Cell 2003; 95:535–45. cell–cell adhesion. Angiogenesis 1999; 3:317–25. 22 Klı´ma J, Smetana K Jr, Motlı´kJet al. Comparative phenotypic char- 40 Siebert HC, Andre´ S, Lu SY et al. Unique conformer selection of

acterization of keratinocytes originating from hair follicles. J Mol human growth-regulatory lectin galectin-1 for ganglioside GM1 Histol 2005; 36:89–96. versus bacterial toxins. Biochemistry 2003; 42:14762–73. 23 Andre´ S, Kojima S, Gundel G et al. Branching mode in complex- 41 Andre´ S, Kaltner H, Lensch M et al. Determination of structural and type triantennary N-glycans as regulatory element of their ligand functional overlap/divergence of ﬁve proto-type galectins by analy-

properties. Biochim Biophys Acta 2006; 1760:768–82. sis of the growth–regulatory interaction with ganglioside GM1 24 Tsai RYL, McKay RDG. A nucleolar mechanism controlling cell in silico and in vitro on human neuroblastoma cells. Int J Cancer 2005; proliferation in stem cells and cancer cells. Genes Dev 2002; 114:46–57. 16:2991–3003. 42 Fischer C, Sanchez-Ruderisch H, Welzel M et al. Galectin-1 interacts 25 Lacina L, Smetana K Jr, Dvorańkova´ B et al. Immunocyto- and with the a5b1 fibronectin receptor to restrict carcinoma cell histochemical profiling of nucleostemin expression: marker of epi- growth via induction of p21 and p27. J Biol Chem 2005; dermal stem cells? J Dermatol Sci 2006; 44:73–80. 280:37266–77. 26 Matouskova´ E, Vesely P, Konigova´ R. Modified method of in vitro 43 Rieske P, Krynska B, Azizi SA. Human fibroblast-derived cell lines cultivation of human keratinocytes suitable for grafting. Folia Biol have characteristics of embryonic stem cells and cells of neuro- (Praha) 1989; 35:267–71. ectodermal origin. Differentiation 2005; 73:474–83. 27 Grando SA, Schofield O, Skubitz APN et al. Nodular basal cell carci- 44 Petersen OW, Nielsen HL, Gudjonsson T et al. Epithelial to mesen- noma in vivo vs in vitro. Arch Dermatol 1996; 132:1185–93. chymal transition in human breast cancer can provide a nonmalig- 28 Fronkova´ V, Holı´kova´ Z, Liu FT et al. Simultaneous detection nant stroma. Am J Pathol 2003; 162:391–402. of endogenous lectins and their binding capacity at the 45 D’Andrea F, Vozza A, Brongo S et al. Dermatofibrosarcoma protu- single cell-level—a technical note. Folia Biol (Praha) 1999; 45: berans: experience with 14 cases. J Eur Acad Dermatol Venereol 2001; 157–62. 15:427–9. 29 Plza´k J, Smetana K Jr, Hrdlickova´ E et al. Expression of galectin- 46 Sohn I-B, Hwang SM, Lee SH et al. Dermatofibroma with sclerotic 3-reactive ligands in squamous cancer and normal epithelial cells areas resembling a sclerotic fibroma of the skin. J Cutan Pathol 2002; as a marker of differentiation. Int J Oncol 2001; 19:59–64. 29:44–7.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp819–829 CUTANEOUS BIOLOGY DOI 10.1111/j.1365-2133.2007.07774.x Inhibition of T helper 2 chemokine production by narrowband ultraviolet B in cultured keratinocytes R. Hino, M. Kobayashi, T. Mori, H. Orimo, T. Shimauchi, K. Kabashima and Y. Tokura Department of Dermatology, University of Occupational and Environmental Health, Kitakyushu, Fukuoka 807-8555, Japan

Summary

Correspondence Background Narrowband ultraviolet B (NB-UVB) has recently been used for the Ryosuke Hino. treatment of various skin disorders. Its effects on the production of cytokines and E-mail: [email protected] chemokines by keratinocytes are unknown. Objectives To investigate the effect of NB-UVB on production of chemokines Accepted for publication 15 October 2006 and proinflammatory cytokines by keratinocytes in comparison with broadband (BB)-UVB. Key words Methods Normal human epidermal keratinocytes (or the human keratinocyte chemokine, cytokine, keratinocyte, ultraviolet B cell line HaCaT in some experiments) at semiconfluency were irradiated with ) ) NB-UVB at 10, 100, 500 or 1000 mJ cm 2 or BB-UVB at 10 or 100 mJ cm 2. Conflicts of interest The cultures were maintained in the presence or absence of interferon (IFN)-c at None declared. ) 200 U mL 1. The 72-h culture supernatants were analysed by enzyme-linked immunosorbent assay to quantify T helper (Th)1 chemokines (IFN-inducible protein 10 and monokine induced by IFN-c), Th2 chemokines [macrophage- derived chemokine (MDC) and thymus and activation-regulated chemokine (TARC)] and proinflammatory cytokines [interleukin (IL)-1a and tumour necrosis factor (TNF)-a]. The expression of mRNA for these molecules was simultaneously assessed by reverse transcriptase-polymerase chain reaction. The culture supernatants were also tested for their chemotactic activity for Th1 and Th2 cells. The two UVB sources were compared on the basis of their minimal erythemal doses and clinically used doses. Results Although both NB-UVB and BB-UVB increased the production of IL-1a and TNF-a, the augmentative effect of NB-UVB was less than that of BB-UVB. Both wavelength ranges of UVB enhanced or had no effect on Th1 chemokine production, but suppressed the production of Th2 chemokines MDC and TARC. This was confirmed by chemotactic assay, which showed decreased chemotactic activity for Th2 cells by the culture supernatants from NB-UVB-irradiated keratinocytes. Conclusions NB-UVB reduces the production of Th2 chemokines without excess production of proinflammatory cytokines, suggesting its therapeutic effectiveness on Th2-mediated skin disorders as well as its relative safety in clinical usage.

Ultraviolet B (UVB) radiation has been used for the treatment (BB)-UVB (290–320 nm) phototherapy for skin diseases such of various skin diseases. As compared with psoralen UVA as psoriasis, atopic dermatitis, vitiligo and others.2–7 Although (PUVA) photochemotherapy, UVB phototherapy has an a study in mice indicated that NB-UVB induced more skin advantage in daily clinical use because it is not necessary to cancers than BB-UVB therapy,8 we have found that NB-UVB administer psoralen. Parrish and Jaenicke1 reported that UVB yields less oxidative DNA damage than BB-UVB when com- of wavelength 313 nm is most effective for the treatment of pared at clinically used doses.9 In addition, the carcinogenic psoriasis. This finding provided the impetus for developing potential of NB-UVB is judged to be substantially lower than the Philips TL-01 fluorescent bulb, the narrowband (NB)-UVB that of PUVA therapy.10,11 radiation source, which produces a spectral emission at Keratinocytes are one of the major targets of UVB photo- 310–315 nm. NB-UVB phototherapy has thus significantly therapy. UVB irradiation induces not only the formation improved the therapeutic efficacy of conventional broadband of DNA damage such as cyclobutane pyrimidine dimers in

2007 The Authors 830 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp830–837 Inhibition of Th2 chemokine production by UVB, R. Hino et al. 831 keratinocytes but also the modulation of their immunological U.S.A.) supplemented with 10% heat-inactivated fetal calf ) ) functions. The production of cytokines and the expression of serum (FCS), 100 U mL 1 penicillin and 100 lgmL 1 strep- adhesion molecules are profoundly changed by UVB in kera- tomycin (all from Gibco-BRL Life Technologies Inc.). tinocytes.12–14 Although these alterations are concerned with the therapeutic effectiveness of UVB, the augmented produc- Ultraviolet B irradiation tion of proinflammatory cytokines, such as interleukin (IL)-1a and tumour necrosis factor (TNF)-a, may induce skin inflam- Semiconfluent keratinocytes at third passage were obtained in mation as an adverse effect. Therefore, it is of importance to six-well plates (Corning Glass Works, Corning, NY, U.S.A.) by compare the effect of NB-UVB with that of BB-UVB on the plating the same number of keratinocytes. They were washed production of proinflammatory cytokines. There have been twice with 2 mL of phosphate-buffered saline (PBS; pH 7Æ4) two reports regarding the modulatory effects of NB-UVB and left in 300 lL of PBS. Cells were immediately irradiated on cytokine production. In one study, whole-body NB-UVB with BB-UVB (FL-20 bulbs, emission range 280–340 nm, irradiation did not alter the levels of immunomodulatory 305 nm max.; Toshiba-Medical Systems Corp., Tokyo, Japan) cytokines in the serum of human volunteers.15 However, or NB-UVB (UV801 KL; Waldmann Medical Division, because cytokine modulation was assessed by serum concen- Villingen-Schwenningen, Germany; equipped with Philips tration in this study, detection of changes occurring in the TL-20W/01RS NB-UVB tubes; Philips, Eindhoven, The Nether- skin appears to be difficult. The other study demonstrated that lands). NB-UVB irradiation decreased the production of proinflamma- The minimal erythema dose (MED) of BB-UVB is 50– ) ) tory cytokines by stimulated T cells.16 No published study to 150 mJ cm 2, whereas that of NB-UVB is 500–1200 mJ cm 2. date has analysed the effect of NB-UVB on cytokine and The clinically used doses for patients with psoriasis vulgaris chemokine production by keratinocytes. or mycosis fungoides of BB-UVB and NB-UVB are 50– ) ) Recent accumulated findings have revealed that cell migra- 300 mJ cm 2 and 300–1500 mJ cm 2, respectively.3,4,21 Thus, tion driven by the interaction between chemokines and chemo- 8- to 10-fold higher doses of NB-UVB are clinically equivalent kine receptors is pivotal in the pathogenesis of various to BB-UVB.9 Therefore, to evaluate and compare the effects of inflammatory disorders.17 In the skin, external stimuli or NB-UVB and BB-UVB on keratinocytes, we chose the irradi- ) cytokines such as interferon (IFN)-c and TNF-a18 stimulate ation doses of 10 and 100 mJ cm 2 for BB-UVB, and 100 and ) keratinocytes to produce various chemokines, which initiate 1000 mJ cm 2 for NB-UVB. In some experiments, cells were migration of T cells and polymorphonuclear leucocytes. exposed to NB-UVB at varying doses of 10, 50, 100, 500 and ) Among chemokines, macrophage-derived chemokine (MDC/ 1000 mJ cm 2 to see its maximal effect. CCL22) and thymus and activation-regulated chemokine Immediately after UVB irradiation, PBS was replaced by ) (TARC/CCL17) are known as T helper (Th)2 chemokines that DMEM in the presence or absence of 200 U mL 1 of recom- bind to CC chemokine receptor 4 (CCR4) on Th2 cells, binant human IFN-c (Biogamma; Maruho Co., Osaka, Japan). whereas monokine induced by IFN-c (MIG/CXCL9) and IFN- inducible protein 10 (IP-10/CXCL10) are Th1 chemokines Quantification of cytokines and chemokines in culture with affinity for CXC chemokine receptor 3 (CXCR3) on Th1 supernatants cells.19 In this study, we compared NB-UVB and BB-UVB in their Three-day culture supernatants from NHEK and HaCaT cells modulatory effects on the production of proinflammatory were collected, stored at )70 C, and measured for IL-1a, TNF- cytokines and Th1 and Th2 chemokines. Results suggest that a, MDC, TARC, MIG and IP-10 by enzyme-linked immuno- both wavelength ranges of UVB similarly alter the production sorbent assay (Genzyme-Techne, Minneapolis, MN, U.S.A.) of these cytokines and chemokines, but the levels of modula- according to the manufacturer’s instructions. Optical density tion are different between them. Preferential downmodulation was measured with microplate reader Immuno-Mini NJ-2300 of Th2 chemokines by NB-UVB is especially interesting. (Nihon InterMed, Tokyo, Japan).

Materials and methods Reverse transcriptase-polymerase chain reaction of mRNA for cytokines and chemokines Cell culture NHEK and HaCaT cells treated or untreated with UVB were in- ) Normal human epidermal keratinocyte (NHEK) cells isolated cubated for 2 h in the presence or absence of 200 U mL 1 from neonatal foreskin were grown in the serum-free kera- IFN-c. Total RNA was isolated from cells using the SV Total tinocyte growth medium KGM-2 (Clonetics, San Diego, CA, RNA Isolation System (Promega, Madison, WI, U.S.A.). U.S.A.), and subcultured using trypsin–ethylenediamine tetra- Reverse transcriptase-polymerase chain reaction (RT-PCR) was acetic acid (Clonetics). Hydrocortisone was omitted 48 h performed using the SuperScript First-Strand Synthesis System before experiments. Cells of the human keratinocyte cell line (Invitrogen, San Diego, CA, U.S.A.) according to the manufac- HaCaT20 were grown in Dulbecco’s modified Eagle’s medium turer’s instructions. IL-1a, TNF-a, MDC, MIG and b-actin (DMEM; Gibco-BRL Life Technologies Inc., Gaithersburg, MD, were amplified for 35 cycles, which achieved linear amplifica-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp830–837 832 Inhibition of Th2 chemokine production by UVB, R. Hino et al. tion. The primers for human MDC have been described Statistical analysis previously.18 The other primers were as follows: IL-1a, 5¢-TTGAGTTTAAGCCAT-3¢ and 5¢-GCATCATCCTTTGATG- Student’s t-test was employed to determine the difference ACTT-3¢; TNF-a,5¢-CCTTGGTCTGGTAGGAGACG-3¢ and between means; P <0Æ05 was considered to be significant. 5¢-CAGAGGGAAGAGTTCCCCAG-3¢; MIG, 5¢-TTAAACAATTTG- CCCCAAGC-3¢ and 5¢-CTGTTGTGAGTGGGATGTGG-3¢; b-actin, Results 5¢-GGCACCACACCTTCTACAATGAG-3¢ and 5¢-CGTCATACTCC- TGCTTGCTGACT-3¢. PCR products were visualized on 1Æ5% Background study agarose gels containing ethidium bromide. It is well known that production of proinflammatory cytokines IL-1a and TNF-a by keratinocytes is enhanced by Preparation of T helper (Th)1 and Th2 cells BB-UVB.12–14 However, our preliminary study showed that Th1 and Th2 cells were established according to a previously the production of chemokines was differentially modulated reported method.22 Briefly, for Th1-polarized cells, peripheral by UVB, as MIG was enhanced, MDC and TARC were sup- blood mononuclear cells (PBMC) from a normal subject were pressed, and IP-10 was unchanged or slightly increased by stimulated with anti-CD3 (Pharmingen, San Diego, CA, U.S.A.) BB-UVB. To evaluate the effect of UVB on each chemokine and anti-CD28 (Immunotech SA, Marseille, France) monoclonal using the same experimental system, we therefore cultured antibodies (mAbs) in 24-well plates (Corning Glass Works) for UVB-irradiated NHEK cells in the presence (Figs 1–6) or ) 3 days in the presence of recombinant IL-12, IL-2 (R&D Sys- absence (Table 1) of 200 U mL 1 IFN-c in the experiments tems, Minneapolis, MN, U.S.A.) and anti-IL-4 mAb (Pharmin- described below. When UVB suppressed the production of a gen) in RPMI-1640 (Gibco-BRL Life Technologies Inc., Grand given chemokine, this IFN-c-augmented system was helpful Island, NY, U.S.A.) supplemented with 10% heat-inactivated to assess its suppressive effect clearly. Inversely, even when )1 )5 )1 FCS, 2 mmol L L-glutamine, 5 · 10 mol L 2-mercapto- UVB increased the production of a given chemokine, UVB ) ) ) ethanol, 10 5 mol L 1 sodium pyruvate, 25 mmol L 1 HEPES, enhancement was detected in the nonstimulated condition ) 1% nonessential amino acids, 100 U mL 1 penicillin and 100 and could also still be observed in the IFN-c-stimulated ) lgmL 1 streptomycin (all from Gibco-BRL Life Technologies condition. Inc.). The culture was maintained for 3 weeks with the same Cell viability, as assessed by trypan blue dye exclusion test, cytokines and mAbs. Half medium change was performed once was kept at 92–95% in NHEK cells treated with NB-UVB ) a week. For Th2-polarized cells, PBMC were stimulated with at 100 or 1000 mJ cm 2, or with BB-UVB at 10 or ) anti-CD3 and anti-CD28 mAbs and maintained in the presence 100 mJ cm 2. of IL-4 (R&D Systems), IL-2, anti-IFN-c mAb (BioSource Inter- national, Camarillo, CA, U.S.A.) and anti-IL-10 mAb (BioSource International).

Chemotaxis assay

PBMC were plated in Transwell inserts with a pore size of 5 lm and a diameter of 6Æ5 mm in 24-well plates (3421; Costar, Corning Life Sciences, Acton, MA, U.S.A.). PBMC (2 · 106) in 100 lL were added to the upper wells and 590 lL of culture supernatant was placed in the bottom wells, and plates were incubated for 3 h at 37 Cin5%CO2.To determine Th1 and Th2 subsets of migrating cells, cells that moved to the lower chamber were stained with mAbs directed against chemokine receptors: CXCR3 expressed on Th1 cells and CCR4 on Th2 cells. The cells were double stained with ﬂuorescein isothiocyanate (FITC)-labelled anti-CD4 mAb and phycoerythrin (PE)-labelled anti-CXCR3 or anti-CCR4 mAb Fig 1. Interleukin (IL)-1a production and expression by normal (BD Biosciences Pharmingen, San Diego, CA, U.S.A.) and ana- human epidermal keratinocyte (NHEK) cells irradiated with ultraviolet B (UVB). NHEK cells were irradiated with narrowband (NB)- or lysed on a FACSCalibur (BD Biosciences Pharmingen).18 Either broadband (BB)-UVB at the indicated dose and cultured in the FITC-labelled mouse IgG1 or PE-labelled mouse IgG1 was used ) presence or absence of interferon (IFN)-c at 200 U mL 1. The as an isotype-matched control. Duplicate wells were analysed concentration was measured by enzyme-linked immunosorbent assay for each condition. Data were expressed as % input, which in 3-day culture supernatants. The expression of mRNA was analysed indicates [(the number of migrating cells)/(the number of by reverse transcriptase-polymerase chain reaction. Data are expressed applied cells)] · 100. Th1 and Th2 cells were also used as as means ± SD of triplicate cultures. *P <0Æ05, between the means. migratory cells. **P <0Æ05, compared with no UV with IFN-c.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp830–837 Inhibition of Th2 chemokine production by UVB, R. Hino et al. 833

Fig 5. Macrophage-derived chemokine (MDC) production and Fig 2. Tumour necrosis factor (TNF)-a production and expression expression by normal human epidermal keratinocyte cells irradiated by normal human epidermal keratinocyte cells irradiated with with narrowband ultraviolet B (NB-UVB) or broadband (BB)-UVB. See narrowband ultraviolet B (NB-UVB) or broadband (BB)-UVB. See Fig. 1 legend for details. N.S., not signiﬁcant. **P <0Æ05, compared Fig. 1 legend for details. *P <0Æ01, between the means. **P <0Æ05, with no UV with interferon (IFN)-c. compared with no UV with interferon (IFN)-c.

Fig 6. Thymus and activation-regulated chemokine (TARC) production by HaCaT cells irradiated with narrowband ultraviolet B Fig 3. Interferon (IFN)-inducible protein 10 (IP-10) production (NB-UVB) or broadband (BB)-UVB. See Fig. 1 legend for details. N.S., by normal human epidermal keratinocyte cells irradiated with not significant. **P <0Æ05, compared with no UV with IFN-c. narrowband ultraviolet B (NB-UVB) or broadband (BB)-UVB. See Fig. 1 legend for details. N.S., not significant. Less augmentative effects of narrowband ultraviolet B (NB-UVB) than broadband (BB)-UVB on proinflammatory cytokine production

We first examined the effect of two sources of UVB on the production of proinflammatory cytokines. Both NB-UVB and BB-UVB significantly augmented the production of IL-1a in the presence (Fig. 1) or absence (Table 1) of IFN-c. The most ) augmentative dose of NB-UVB was 50–100 mJ cm 2 (data not shown). Considering that 8- to 10-fold higher doses of NB- UVB are equivalent to BB-UVB in the MED and in clinical use, the enhanced degree of IL-1a production by BB-UVB was higher than that by NB-UVB at both protein and mRNA levels. More pronouncedly, the production and expression of TNF-a was promoted by both NB-UVB and BB-UVB (Fig. 2, ) ) Table 1). As 1000 mJ cm 2 NB-UVB and 100 mJ cm 2 ) BB-UVB were more augmentative than 100 and 10 mJ cm 2, respectively, high doses of UVB were more effective for the Fig 4. Monokine induced by interferon (IFN)-c (MIG) production increment of TNF-a than of IL-1a. Likewise, TNF-a was pro- and expression by normal human epidermal keratinocyte cells irradiated with narrowband ultraviolet B (NB-UVB) or broadband duced more effectively by BB-UVB than by NB-UVB. Thus, (BB)-UVB. See Fig. 1 legend for details. *P <0Æ05, between the NB-UVB was less augmentative than BB-UVB in the produc- means. **P <0Æ05, compared with no UV with IFN-c. tion of proinflammatory cytokines.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp830–837 834 Inhibition of Th2 chemokine production by UVB, R. Hino et al.

Table 1 Percentage augmentation of cytokine and chemokine production by narrowband ultraviolet B (UVB) or broadband UVB in keratinocytes unstimulated with interferon-c

Control NB-UVBb NB-UVBb BB-UVBb BB-UVBb ) ) ) ) ) (pg mL 1)a 100 mJ cm 2 1000 mJ cm 2 10 mJ cm 2 100 mJ cm 2 IL-1a 144 49% )32% 90% 42% ) ) ) ) TNF-ac

NB-UVB, narrowband ultraviolet B; BB-UVB, broadband ultraviolet B; IL-1a, interleukin 1a; TNF-a, tumour necrosis factor-a; MIG, monokine induced by interferon (IFN)-c; IP-10, IFN-inducible protein 10; MDC, macrophage-derived chemokine; TARC, thymus and activation- regulated chemokine. Normal human epidermal keratinocyte cells (for IL-1a, TNF-a, MIG, IP-10 and MDC) and HaCaT cells (for TARC) ) ) were irradiated with NB-UVB at 100 or 1000 mJ cm 2, or with BB-UVB at 10 or 100 mJ cm 2, and cultured in triplicate for 3 days in the absence of IFN-c. The culture supernatants were analysed by enzyme-linked immunosorbent assay to quantify the indicated cytokines and ) chemokines. aThe control values represent the mean concentration (pg mL 1) of cytokines and chemokines in nonirradiated keratinocytes. bThe values in the irradiated groups are expressed as the mean percentage augmentation: [(irradiated group)control group)/control group] ) ·100. cAs the control level of TNF-a is under the level of detection, the absolute concentrations (pg mL 1) are shown.

ated using flow cytometry (Fig. 7). The chemotactic response Suppression of T helper 2 chemokine production by of both CXCR3+ Th1 and CCR4+ Th2 cells to the supernatant narrowband ultraviolet B (NB-UVB) and broadband was enhanced by IFN-c treatment of NHEK cells (Fig. 8). NB- (BB)-UVB ) UVB irradiation of NHEK cells at 100 mJ cm 2 before culture We explored the effects of UVB on keratinocyte production of with IFN-c profoundly suppressed the Th2 chemotactic activ- Th1 chemokines IP-10 and MIG, and Th2 chemokines MDC ity of supernatants, whereas the Th1 chemotactic activity was and TARC. Production of these chemokines was assessed in rather enhanced by this dose of NB-UVB. The higher dose ) NHEK cells; however, because NHEK cells are incapable of (1000 mJ cm 2) of NB-UVB suppressed production of both producing TARC in the known culture conditions,23 the pro- Th1 and Th2 chemokines. BB-UVB also suppressed Th2 chemo- duction of this chemokine was assessed in HaCaT cells. kines more markedly than Th1 chemokines, but its suppressive In the presence of IFN-c, IP-10 production was not signifi- ability for Th2 chemokines was slightly lower than that of cantly affected at any dose of either NB-UVB or BB-UVB NB-UVB. Virtually the same chemotactic activities of the sup- (Fig. 3), whereas its production was enhanced by both UVB ernatants were found in the migratory study using Th1- and sources in the absence of IFN-c (Table 1). MIG production Th2-polarized cells as responders (Fig. 9). These data confirm was increased by both NB-UVB and BB-UVB under IFN-c- that exposure of keratinocytes to NB-UVB suppresses their stimulated conditions (Fig. 4). production of Th2 chemokines. MDC production was suppressed by both NB-UVB and BB- UVB (Fig. 5, Table 1). At the lower doses, the two UVB sources Discussion produced comparable suppression. Similarly, in HaCaT cells, both UVB ranges at the lower doses profoundly suppressed Our study demonstrated that UVB differentially modulates the TARC production at comparable levels (Fig. 6). The higher dose production of each cytokine or chemokine by keratinocytes. of NB-UVB exerted a markedly stronger inhibitory effect. Similar to BB-UVB, which is well known to augment the pro- These results demonstrate that both NB-UVB and BB-UVB duction of IL-1a and TNF-a,12–14 NB-UVB also increased the downmodulate the production of Th2 chemokines but not proinflammatory cytokines but to lesser degrees. More inter- Th1 chemokines. The suppressive activity of NB-UVB was estingly, both UVB sources altered the production of chemo- rather stronger than BB-UVB. kines at the doses stimulatory for these proinflammatory cytokines. Whereas Th1 chemokines were augmented by UVB, MDC and TARC were depressed by ~60% at the doses tested, Chemotactic responses of T helper (Th)1 and Th2 cells suggesting that Th2 chemokines are preferentially down- to keratinocyte culture supernatants modulated by UVB as compared with Th1 chemokines and We examined the biological chemotactic activity of culture proinflammatory cytokines. This Th2 chemokine-dominant supernatants from NHEK cells irradiated with NB-UVB or suppression was confirmed by the chemotaxis assay, which BB-UVB. PBMC were incubated in the upper Transwell cham- showed that the culture supernatants from keratinocytes irradi- ber for 3 h, and the numbers of CXCR3 Th1 and CCR4 Th2 ated with UVB, in particular NB-UVB, had low chemotactic cells that migrated to keratinocyte supernatants were enumer- activity for Th2 cells.

CXCR3+ Th1 cell chemotaxis 8

0 No addition IFN- IFN- NB-UVB NB-UVB BB-UVB BB-UVB gamma– gamma+ 100 1000 10 100

CCR4+ Th2 cell chemotaxis 20

10 Input (%) Input (%) 5

0 No addition IFN- IFN- NB-UVB NB-UVB BB-UVB BB-UVB gamma– gamma+ 100 1000 10 100

Fig 8. T-cell chemotactic activity of keratinocyte supernatants treated with narrowband ultraviolet B (NB-UVB) or broadband (BB)-UVB. Results are expressed as the percentage of input cells of each subtype migrating to the lower chamber of a Transwell ﬁlter containing culture supernatants from keratinocytes treated with or without ) ) interferon (IFN)-c (200 U mL 1), NB-UVB (100 or 1000 mJ cm 2), ) or BB-UVB (10 or 100 mJ cm 2) irradiation. Panels show migration of peripheral blood mononuclear cell subsets: CXC chemokine receptor 3 (CXCR3)+ T helper (Th)1 cells and CC chemokine receptor 4 (CCR4)+ Th2 cells. Diamonds and squares represent the numerical values of % input.

Th1 cell chemotaxis 8

Fig 7. Flow cytometric analysis of migrating T helper (Th)1 and Th2 Input (%) 2 cells. Peripheral blood mononuclear cells from a normal subject were 0 applied to the Transwell chamber. The migrating cells were subjected No IFN- IFN- NB-UVB NB-UVB BB-UVB BB-UVB to flow cytometric analysis. Th1 and Th2 cells were identified as addition gamma– gamma+ 100 1000 10 100 cells positive for CD4/CXC chemokine receptor 3 (CXCR3) and Th2 cell chemotaxis CD4/CC chemokine receptor 4 (CCR4), respectively. The panels 4 show representative data, which were obtained from HaCaT cell ) supernatants of 100 mJ cm 2 narrowband ultraviolet B for Th1 cells 3 and those of interferon-c treatment alone for Th2 cells. FITC, 2 fluorescein isothiocyanate; PE, phycoerythrin. Input (%) 1

0 In general, the production of the four chemokines tested No IFN- IFN- NB-UVB NB-UVB BB-UVB BB-UVB here can be stimulated with IFN-c, or more effectively with addition gamma– gamma+ 100 1000 10 100 the combination of IFN-c and TNF-a.18,23 Although we used Fig 9. T helper (Th)1- and Th2-cell chemotactic activity of IFN-c alone as a stimulant, TNF-a secreted from UVB-irradi- keratinocyte supernatants treated with narrowband ultraviolet B ated keratinocytes was considered to cooperate with IFN-c in (NB-UVB) or broadband (BB)-UVB. Th1- and Th2-polarized cells chemokine production. It seemed that UVB modulated the were cultured from peripheral blood mononuclear cells from a normal chemokine production as a combined result of its direct and subject with different combinations of cytokines and anticytokine indirect TNF-a-mediated effects. Additionally, it is possible monoclonal antibodies. Results are expressed as described in Fig. 8. that MIG was elevated by UVB as a consequence of the Panels show migration of Th1 cells and Th2 cells.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp830–837 836 Inhibition of Th2 chemokine production by UVB, R. Hino et al. increased production of TNF-a. Although TNF-a alone cannot 6 Scherschun L, Kim JJ, Lim HW. Narrow-band ultraviolet B is a use- stimulate NHEK cells to produce MIG, the combination of ful and well-tolerated treatment for vitiligo. J Am Acad Dermatol TNF-a with IFN-c dramatically enhances MIG production in 2001; 44:999–1003. 7 Bilsland D, George SA, Gibbs NK et al. A comparison of narrow keratinocytes and other epithelial cells.24,25 band phototherapy (TL-01) and photochemotherapy (PUVA) in NB-UVB and BB-UVB both alter the production of cytokines the management of polymorphic light eruption. Br J Dermatol 1993; and chemokines by keratinocytes, but the extents of their 129:708–12. modulation are different from each other. On the basis of the 8 Gibbs NK, Traynor NJ, MacKie RM et al. The phototumorigenic MED and clinically used doses, NB-UVB at an 8- to 10-fold potential of broad-band (270–350 nm) and narrow-band (311– higher dose than BB-UVB is biologically comparable with 313 nm) phototherapy source cannot be predicted by their edema- BB-UVB.9 When compared at these doses, NB-UVB was less togenic potential in hairless mouse skin. J Invest Dermatol 1995; 104:359–63. stimulatory than BB-UVB for the production of proinflamma- 9 Orimo H, Tokura Y, Hino R, Kasai H. Formation of 8-hydroxy-2¢- tory cytokines, whereas the ability of NB-UVB to downmodu- deoxyguanosine in the DNA of cultured human keratinocytes by late Th2 chemokine production was rather higher than that of clinically used doses of narrowband and broadband ultraviolet B BB-UVB. Clinically, IL-1a and TNF-a induce cutaneous inflam- and psoralen plus ultraviolet A. Cancer Sci 2006; 97:99–105. mation, such as erythema and swelling.26 Thus, using 10 British Photodermatology Group. An appraisal of narrowband NB-UVB might be safer than using BB-UVB because these (TL-01) UVB phototherapy. Br J Dermatol 1997; 137:327–30. adverse effects could be avoided, while still retaining the sup- 11 Young AR. Carcinogenicity of UVB phototherapy assessed. Lancet 1995; 345:1431–2. pressive effect on Th2 chemokines. 12 Kupper TS, Chua AO, Flood P et al. Interleukin-1 gene expression The UVB-induced suppression of Th2 chemokine produc- in cultured human keratinocytes is augmented by ultraviolet irradi- tion suggests that UVB exposure to the skin suppresses ation. J Clin Invest 1987; 80:430–6. infiltration of Th2 cells to the epidermis. Both BB-UVB and 13 Kondo S, Sauder DN, Kono T et al. Differential modulation of inter- NB-UVB are considered to be effective for the treatment of leukin-1a (IL-1a) and interleukin-1b (IL-1b) in human epidermal various Th2-mediated or Th2-infiltrating skin diseases, such keratinocytes by UVB. Exp Dermatol 1994; 3:29–39. as atopic dermatitis,26 subacute prurigo27 and eosinophilic 14 Schwarz A, Bhardwaj R, Aragane Y et al. Ultraviolet-B-induced apoptosis of keratinocytes: evidence for partial involvement of pustular folliculitis.28 However, the state of cultured mono- tumor necrosis factor-a in the formation of sunburn cells. J Invest layered keratinocytes is different from that of patients’ Dermatol 1995; 104:922–7. multilayered keratinocytes and, thus, the in vivo outcome 15 McLoone P, Man I, Yule S et al. Whole-body UVB (TL-01) or does not necessarily reflect the phenomenon observed in UVA-1 irradiation does not alter the levels of immunomodulatory this study. In addition, the effects of NB-UVB on constitu- cytokines in the serum of human volunteers. Photodermatol Photoimmu- ent cells of skin other than keratinocytes may participate in nol Photomed 2004; 20:76–80. the total therapeutic action. Although psoriasis is a disorder 16 Sigmundsdottir H, Johnston A, Gudjonsson JE, Valdimarsson H. Narrowband-UVB irradiation decreases the production of pro- mediated by Th1 cells,29 the effectiveness of UVB is widely 30 inflammatory cytokines by stimulated T cells. Arch Dermatol Res accepted. In this disease, the inhibitory effects of UVB on 2005; 297:39–42. keratinocyte proliferation, vascular proliferation and lympho- 17 Rossi D, Zlotnic A. The biology of chemokines and their receptors. cyte apoptosis may be involved in the underlying mecha- Annu Rev Immunol 2000; 18:217–42. nisms.31,32 Our study suggests that NB-UVB is more 18 Kobayashi M, Shimauchi T, Hino R, Tokura Y. Roxithromycin clinically beneficial than BB-UVB, even in Th2-mediated downmodulates Th2 chemokine production by keratinocytes and diseases. chemokine receptor expression on Th2 cells: its dual inhibitory effects on the ligands and the receptors. Cell Immunol 2004; 228:27–33. References 19 Sallusto F, Lenig D, Mackay CR, Lanzavecchia A. Flexible programs of chemokine receptor expression on human polarized T helper 1 1 Parrish JA, Jaenicke KF. Action spectrum for phototherapy of psor- and 2 lymphocytes. J Exp Med 1998; 187:875–83. iasis. J Invest Dermatol 1981; 76:359–62. 20 Boukamp P, Petrussevska RT, Breitkreutz D et al. Normal keratiniza- 2 Green C, Ferguson J, Lakshmipathi T, Johnson BE. 311 nm UVB tion in a spontaneously immortalized aneuploid human keratino- phototherapy – an effective treatment for psoriasis. Br J Dermatol cyte cell line. J Cell Biol 1988; 106:761–71. 1988; 119:691–6. 21 Gordon PM, Saunders PJ, Diffey BL, Farr PM. Phototesting prior to 3 Tanew A, Radakovic-Fijan S, Schemper M, Ho¨nigsmann H. narrowband (TL-01) ultraviolet B phototherapy. Br J Dermatol 1998; Narrowband UV-B phototherapy vs. photochemotherapy in the 139:811–14. treatment of chronic plaque-type psoriasis. Arch Dermatol 1999; 22 Cousins DJ, Lee TH, Staynov DZ. Cytokine coexpression during 135:519–24. human Th1/Th2 cell differentiation: direct evidence for coordina- 4 Gathers RC, Scherschun L, Malick F et al. Narrowband UVB photo- ted expression of Th2 cytokines. J Immunol 2002; 169:2498–506. therapy for early-stage mycosis fungoides. J Am Acad Dermatol 2002; 23 Tsuda T, Tohyama M, Yamasaki K et al. Lack of evidence for 47:191–7. TARC/CCL17 production by normal human keratinocytes in vitro. 5 Der-Petrossian M, Seeber A, Ho¨nigsmann H, Tanew A. Half- J Dermatol Sci 2003; 31:37–42. side comparison study on the efficacy of 8-methoxypsoralen bath- 24 Kraft M, Riedel S, Maaser C et al. IFN-c synergizes with TNF-a but PUVA versus narrow-band ultraviolet B phototherapy in patients not with viable H. pylori in up-regulating CXC chemokine secretion with severe chronic atopic dermatitis. Br J Dermatol 2000; 142: in gastric epithelial cells. Clin Exp Immunol 2001; 126:474–81. 39–43.

25 Granstein RD, Margolis R, Mizel SB, Sauder DN. In vivo inﬂamma- mRNA expression of interleukin 5 in peripheral blood mono- tory activity of epidermal cell-derived thymocyte activating factor nuclear cells. Br J Dermatol 1996; 134:766–72. and recombinant interleukin 1 in the mouse. J Clin Invest 1986; 29 Schlaak JF, Buslau M, Jochum W et al. T cells involved in psoriasis 77:1020–7. vulgaris belong to the Th1 subset. J Invest Dermatol 1994; 102:145–9. 26 Leung DY. Atopic dermatitis: the skin as a window into the patho- 30 Lebwohl M, Ali S. Treatment of psoriasis. Part 1. Topical therapy genesis of chronic allergic diseases. J Allergy Clin Immunol 1995; and phototherapy. J Am Acad Dermatol 2001; 45:487–98. 96:302–18. 31 Krueger JG, Wolfe JT, Nabeya RT et al. Successful ultraviolet B 27 Tokura Y, Yagi H, Hanaoka K et al. Subacute and chronic prurigo treatment of psoriasis is accompanied by a reversal of keratinocyte effectively treated with recombination interferon-c: implications pathology and by selective depletion of intraepidermal T cells. J Exp for participation of Th2 cells in the pathogenesis of prurigo. Acta Med 1995; 182:2057–68. Derm Venereol (Stockh) 1997; 77:231–4. 32 Ozawa M, Ferenczi K, Kikuchi T et al. 312-nanometer ultraviolet B 28 Fushimi M, Tokura Y, Sachi Y et al. Eosinophilic pustular folliculitis light (narrow-band UVB) induces apoptosis of T cells within psori- effectively treated with recombinant interferon-c: suppression of atic lesions. J Exp Med 1999; 189:711–18.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp830–837 CUTANEOUS BIOLOGY DOI 10.1111/j.1365-2133.2007.07779.x Dimethylfumarate inhibits nuclear binding of nuclear factor jB but not of nuclear factor of activated T cells and CCAAT/enhancer binding protein b in activated human T cells S. Gerdes, K. Shakery* and U. Mrowietz Psoriasis Center at the Department of Dermatology, University of Kiel, Schittenhelmstr. 7, 24105 Kiel, Germany *Department of Dermatology, Central Hospital, Sankt-Juergen-Str., Bremen, Germany

Summary

Correspondence Background Psoriasis is a chronic inflammatory skin disorder in which T-cell-medi- Sascha Gerdes. ated immune responses are thought to play a prominent role. Fumaric acid esters E-mail: [email protected] (FAEs) have proved to be an effective systemic treatment for psoriasis. The FAE dimethylfumarate (DMF) strongly suppresses chemokine production in human Accepted for publication 15 October 2006 keratinocytes and peripheral blood mononuclear cells. Additionally, it has been demonstrated that the nuclear translocation of the activated transcription factor Key words nuclear factor jB (NF-jB) is inhibited in human endothelial cells and fibroblasts fumarates, nuclear factor of activated T cells, activated with tumour necrosis factor-a. The NF-jB pathway plays a major role nuclear factor jB, psoriasis, T cells, treatment in regulating inflammatory cytokine production as well as in cell differentiation j Conflicts of interest and apoptosis. T-cell survival is also dependent on the activation of NF- B and it U.M. has acted as a paid consultant to has been demonstrated in vitro that DMF is an inducer of apoptosis in human Fumapharm AG and has received funding for T cells. The influence of FAEs on the expression of nuclear transcription factors research carried out in this work. in T cells has not yet been investigated. Objectives The effects of DMF and its main metabolite, methylhydrogenfumarate (MHF), were assessed on the nuclear binding of NF-jB, nuclear factor of activated T cells (NF-AT) and CCAAT/enhancer binding protein b (C/EBPb) in purified human T cells. Methods To examine the effect of DMF and MHF on the nuclear binding of NF-jB, NF-AT and C/EBPb in human T cells and fibroblasts, an enzyme-linked immunosorbent assay (ELISA) was used. The binding activity of these transcription factors was measured by its absorbance in an ELISA plate reader at 450 nm. Conspicuous results were confirmed by performing electrophoretic mobility shift assays. Results DMF inhibited nuclear binding of NF-jB1, but not of NF-AT or C/EBPb,in purified human T cells. No effect of MHF on any of these transcription factors could be seen. To verify our results, we used the same assay to show the inhibitory effect on the nuclear binding of NF-jB1 in human fibroblasts (as previously published). Conclusions The results of this study provide evidence for a specific effect of DMF on NF-jB. The data support previous results where NF-jB-dependent mediators and surface molecules were suppressed by DMF, but not those activated by other nuclear transcription factors.

Psoriasis is a chronic inﬂammatory skin disorder with an Fumaric acid esters (FAEs) have proved to be an effective sys- unknown pathogenesis. T cells and antigen-presenting cells temic treatment for patients with severe psoriasis. Fumaderm seem to be of major importance. Owing to the expression in (Fumedica GmbH, Herne, Germany), a mixture of dimethyl- skin lesions of interleukin (IL)-2 and interferon c, and a lack fumarate (DMF) and Zn, Ca and Mg salts of monoethylfuma- of IL-4, psoriasis is considered a type 1 cytokine-characterized rate, is the most used drug in the systemic treatment of disease.1 psoriasis in Germany since its registration in 1994.

2007 The Authors 838 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp838–842 Dimethylfumarate selectively inhibits NF-jB, S. Gerdes et al. 839

A main observation during treatment with FAEs is leuco- fusion Center, University Hospital Schleswig-Holstein, Campus cytopenia with a reduction of CD4+ and CD8+ T cells. This Kiel, Germany. Peripheral blood mononuclear cells (PBMC) decrease in peripheral T cells coincides with a reduction of were obtained by centrifugation of buffy coat cells over a lesional T cells2 and thus investigations have focused on apo- lymphocyte separation medium (PAA Laboratories). Isolation ptosis as an underlying mechanism. Indeed, DMF has been of T cells from PBMC was performed by depletion of non- shown to induce programmed cell death in the lymphohistio- T cells using a negative selection technique (MACS; Miltenyi cytic cell line U937, monocyte-derived dendritic cells and Biotech, Bergisch Gladbach, Germany). activated human T cells.3–5 T cells were incubated in six-well plates (Sarstedt) for 48 h The transcription factor nuclear factor jB (NF-jB) plays a using RPMI 1640 medium (Cell Concepts, Umkirch, Ger- ) pivotal role in the development and maintenance of T-cell- many) containing IL-2 (200 U mL 1) together with different mediated immune responses and in the regulation of proteins concentrations of DMF, MHF, ciclosporin or DMSO. T cells that inhibit apoptosis and promote cell survival.6 The NF-jB were used at a density of approximately 5 · 106 to 1 · 107 family comprises a variety of homo- and heterodimers cells per well. formed by the subunits of c-Rel, RelA (p65), RelB, NF-jB1 Further stimulation of T cells was performed using solid- (p50) and NF-jB2 (p52) that are inactivated by subunits of phase-bound OKT3 antibodies (Orthoclone-OKT3; Janssen- IjBs in the cytoplasm. The most common heterodimer is Cilag GmbH, Neuss, Germany). Tissue culture plates p50–RelA. were coated with OKT3 antibodies at a concentration of ) It has been shown in vitro that the prevention of nuclear trans- 10 lgmL 1 for 24 h. Afterwards, IL-2-prestimulated T cells location of NF-jB can induce apoptosis in T cells whereas other were seeded on the OKT3 plates and incubated for 2 h at nuclear transcription factors such as nuclear factor of activated 37 C.9 T cells (NF-AT) did not show this effect.6 For CCAAT/enhancer binding protein b (C/EBPb), a regulatory effect on the expres- Preparation of nuclear extracts sion of genes encoding a variety of inflammatory cytokines in cells of the myelomonocytic lineage has been described.7 Two hours after stimulation of T cells, or 24 h after stimula- DMF selectively inhibits the nuclear translocation of NF-jB1 tion of fibroblasts, nuclear extracts were prepared using a nuc- (p50) in normal human dermal fibroblasts whereas RelA lear extract kit (Active Motif, Rixensart, Belgium). Protein (p65) is not affected.8 The influence of FAEs on the expres- concentration of nuclear extracts was quantified using the BCA sion of nuclear transcription factors has not yet been investi- Protein Assay (Pierce Biotechnology, Rockford, IL, U.S.A.). gated in human T cells. Protein extracts were stored at )70 C until further use for In this study we assessed the effects of DMF and its main electrophoretic mobility shift assay (EMSA) and transcription metabolite methylhydrogenfumarate (MHF) on the nuclear factor assay (TransAMTM; Active Motif). binding of NF-jB, NF-AT and C/EBPb in purified human T cells. Electrophoretic mobility shift assay

Materials and methods Binding reactions were performed using 5 lg of nuclear protein. For NF-jB1, a 20-lL total reaction volume containing 2 lL of binding buffer (LightShift Chemiluminescent EMSA Incubation and stimulation of fibroblasts Kit; Pierce Biotechnology) and 1 lg of poly(dI-dC) was Normal human skin fibroblasts were cultured in Quantum used. For NF-AT, the 20-lL total reaction volume con- ) ) 333 (PAA Laboratories, Pasching, Austria) supplemented with tained 10 mmol L 1 Tris-HCl (pH 7Æ5), 0Æ05 mmol L 1 KCl, ) 10% fetal bovine serum (HyClone Laboratories, Logan, UT, 0Æ5 mmol L 1 ethylenediamine tetraacetic acid (EDTA), )1 )1 U.S.A.), 1 mmol L L-glutamine (Biochrom AG, Berlin, Ger- 0Æ5 mmol L dithiothreitol, 12% glycerol and 1 lgof ) many) and 100 lgmL 1 penicillin/streptomycin (Biochrom). poly(dI-dC). The reaction mixture was then incubated Fibroblasts were grown to 80–90% confluence in 75-cm2 tis- with biotin-labelled oligonucleotide for 30 min at room tem- sue culture flasks (Sarstedt, Nu¨mbrecht, Germany). The cells perature. The NF-jB1 consensus oligo, 5¢-AGTTGAGGGGACT- were then incubated for 1 h together with different concen- TTCCCAGG-3¢, and its complementary strand, as well as the ) trations of DMF (1, 10 and 20 lgmL 1), MHF (1, 10 and NF-AT consensus oligo, 5¢-CACGCCTTCTGTATGAAACAGTTT- ) 20 lgmL 1)or0Æ2% dimethylsulfoxide (DMSO; Sigma, Tauf- TTCCTCCG-3¢, and its complementary strand, were purchased kirchen, Germany), which was the solvent for DMF and MHF. from Sigma. Afterwards, samples were analysed by electro- Simultaneously, fibroblasts were stimulated with tumour phoresis in a 4% nondenaturing polyacrylamide gel for 3 h. ) necrosis factor-a at a concentration of 10 ng mL 1. The gel consisted of 2 mL 40% acrylamide (Sigma), 2 mL Tris-borate-EDTA 5· buffer, 1 mL glycine 50% (Sigma) and 15 mL distilled water. Proteins were transferred from the gel Isolation, incubation and stimulation of T cells to a nitrocellulose membrane (Biodyne B membrane; KPL, Purified human T cells were isolated from venous blood from Gaithersburg, MD, U.S.A.) using an electroblotting apparatus healthy donors using buffy coats provided by the Blood Trans- (Bio-Rad, Munich, Germany). The membrane was developed

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp838–842 840 Dimethylfumarate selectively inhibits NF-jB, S. Gerdes et al. with the LightShift Chemiluminescent EMSA Kit and visualized Statistical analyses under a charged couple device camera. Data were described as mean ± SD. Comparisons between samples and DMSO controls, as well as negative and positive Transcription factor assays controls, were performed as unpaired t-tests. For quantifying the amount of NF-jB1, C/EBPb and NF-AT in a highly sensitive enzyme-linked immunosorbent assay Results (ELISA), 10 lg of nuclear proteins was used in TransAM kits (TransAM for NF-jB1, C/EBPb and NF-AT; Active Motif). The Effect of fumarates on nuclear binding of nuclear factor transcription factor binding activity was measured by its jB1, nuclear factor of activated T cells and CCAAT/ absorbance in an ELISA plate reader at 450 nm. Each experi- enhancer binding protein b in activated human T cells ment was carried out with 4–11 sets of cells from different donors. According to the manufacturer’s instructions, for each Purified human T cells were incubated with different concen- experiment a nuclear extract from Jurkat cells was used as a trations of DMF and MHF, as well as with IL-2, before further positive control for the function of the assay, as well as a sam- stimulation with solid-phase-bound OKT3 antibodies, and ple without Jurkat nuclear extract in parallel conditions as a NF-jB1, NF-AT and C/EBPb were assessed as described. ) negative control. To assess the influence of DMF and MHF on MHF in all tested concentrations of 1, 10 and 20 lgmL 1 nuclear binding of NF-jB1, C/EBPb and NF-AT in cells inves- did not affect the nuclear concentration of NF-jB1 (Fig. 1a). tigated in our studies, binding activities were compared with For DMF, a significant inhibition of nuclear binding of ) the same cells incubated with DMSO (which was the solvent NF-jB1 was seen at a concentration of 20 lgmL 1, whereas for DMF and MHF) in parallel conditions. lower concentrations had no effect. Ciclosporin showed a

(a) (b)

Fig 1. Nuclear concentrations of (a) nuclear factor jB1 (NF-jB1), (b) nuclear factor of activated T cells (NF-AT) and (c) CCAAT/enhancer ) binding protein b (C/EBPb) in purified human T cells, and of (d) NF-jB1 in human dermal fibroblasts. T cells were incubated with 200 U mL 1 ) interleukin (IL)-2 plus dimethylfumarate (DMF) or methylhydrogenfumarate (MHF) at concentrations of 1, 10 and 20 lgmL 1, or plus 0Æ2% ) dimethylsulphoxide (DMSO), or plus 1 lmol L 1 ciclosporin for 48 h before further stimulation with solid-phase-bound OKT3 antibodies (a–c). ) Fibroblasts were incubated with DMF or MHF at concentrations of 1, 10 and 20 lgmL 1, or with 0Æ2% DMSO for 1 h. Fibroblasts were ) stimulated with tumour necrosis factor-a at a concentration of 10 ng mL 1 (d). NF-jB1, NF-AT and C/EBPb binding activity was measured using the TransAM assay. Results are shown as mean ± SD, using 4–11 samples from different donors. Unpaired t-tests: samples vs. DMSO; negative vs. positive control. *P <0Æ0001; **P <0Æ003; ***P <0Æ005; ****P <0Æ01. (a) Significant reduction of nuclear concentration of NF-jB1 due to ) DMF at a concentration of 20 lgmL 1 is shown. (b) No effect on the nuclear binding of NF-AT for either DMF or MHF in tested concentrations is seen, whereas ciclosporin as a control inhibits the nuclear binding of NF-AT significantly. (c) No effect on the nuclear binding of C/EBPb for either DMF or MHF in tested concentrations, or for ciclosporin, is seen. (d) Reduction of nuclear concentration of NF-jB1 due to DMF at a ) concentration of 20 lgmL 1 is shown.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp838–842 Dimethylfumarate selectively inhibits NF-jB, S. Gerdes et al. 841

) significant inhibition of NF-jB1 binding, whereas DMSO had of 20 lgmL 1. At this concentration, a positive shift of the no effect. transcription factor to its biotin-labelled consensus sequence Neither MHF nor DMF in all tested concentrations had any was seen. Figures 2c and d show EMSA analysis for NF-AT effect on nuclear binding of the transcription factors NF-AT performed with nuclear extracts from activated human T cells and C/EBPb (Fig. 1b,c). Although the activity measured in the incubated with DMF and MHF at concentrations of ) ELISAs for DMSO-only treated T cells is relatively low com- 20 lgmL 1. NF-AT showed positive shifts to the biotin- pared with the NF-jB1 assay, a significant ciclosporin-depend- labelled consensus sequences for samples from T cells incu- ent inhibition of NF-AT could be detected, as expected. DMSO bated with DMF and MHF, whereas strongly reduced had no effect. shifts were seen for samples from T cells incubated with To verify the ELISA results, we performed EMSA for NF- ciclosporin. jB1 and NF-AT. Figure 2a shows the results when nuclear extracts of activated human T cells incubated with DMF at a ) Effects of fumarates on nuclear binding of nuclear concentration of 20 lgmL 1 were analysed with EMSA for factor jB1 in human fibroblasts nuclear binding of NF-jB1. A strongly reduced shift of NF-jB1 to its biotin-labelled consensus sequence was seen for To verify our results generated from nuclear extracts from both DMF and ciclosporin. Figure 2b shows EMSA analysis for T cells incubated with different concentrations of DMF and samples from T cells incubated with MHF at a concentration MHF, we used the same ELISA to show a reduction of nuclear binding of NF-jB1 in human fibroblasts (as previously published).8 As shown in Figure 1d, MHF did not affect the nuclear con- (a) (b) centration of NF-jB1 in human fibroblasts when incubated with the compound at concentrations of 1, 10 and ) 20 lgmL 1. For DMF, an inhibition of NF-jB1 was seen at a ) concentration of 20 lgmL 1, whereas concentrations of 1 ) and 10 lgmL 1 showed no significant effect.

Discussion

A mixture of FAEs is the most frequently used drug for sys- (c) (d) temic treatment of psoriasis in Germany.10 Recent investigations of the antipsoriatic mechanism of FAEs focused on the potent immunomodulatory activity of the active compound DMF.10 It has been shown that the DMF metabolite MHF suppressed T helper (Th)1 and induced Th2 cytokines.11–13 Fur- thermore, a downregulation of GROa, IL-8, Mig, IP-10 and IP-9/I-TAC in human keratinocytes and PBMC by DMF has been described.14 In this study we provide evidence that DMF leads to a significant reduction of NF-jB1 in a concentration-dependent manner in stimulated human T cells. Further investigations should Fig 2. Electrophoretic mobility shift assay of nuclear factor jB1 focus on the actual transcriptional functionality of NF-jB (NF-jB1) and nuclear factor of activated T cells (NF-AT) in because ELISA and EMSA analyses reflect DNA-binding activity. purified human T cells. Nuclear extracts of purified human T cells Our data show that neither DMF nor MHF has any effect were prepared after incubation of cells with interleukin 2 plus on the nuclear binding of NF-AT and C/EBPb. However, to 0Æ2% dimethylsulphoxide (DMSO) (lane 1), or plus either understand fully the mechanism of DMF-induced antipsoriatic dimethylfumarate (DMF) (a and c) or methylhydrogenfumarate activity, future studies should use actual psoriatic T cells )1 (MHF) (b and d) at a concentration of 20 lgmL (lane 2), or plus because stimulated, purified human T cells might differ from )1 1 lmol L ciclosporin (lane 3), for 48 h before further stimulation activated, skin-homing T cells in psoriatic plaques. with solid-phase-bound OKT3 antibodies. Lanes 4–6 represent the In a pharmacokinetic study of FAEs it has been shown that nuclear extracts in parallel conditions plus competitive unlabelled DMF is almost completely hydrolysed to MHF at an alkaline oligonucleotides. Lane 7: negative control. (a) A reduced shift of pH as it occurs in the small intestine.15 The fact that only DMF NF-jB1 to its biotin-labelled consensus sequence is seen for DMF and ciclosporin which indicates a reduction of nuclear concentration of showed an effect in this study, and that the effectiveness of NF-jB1. (b) A positive shift of NF-jB1 is seen for MHF, which DMF has been shown in other studies, might suggest a differ- indicates no influence of the nuclear concentration of NF-jB1. (c and ent mode of action or metabolization of this ester. An intracel- d) A positive shift of NF-AT is seen for DMF (c) and for MHF (d), lular remethylation by O-methyltransferases of MHF to DMF whereas ciclosporin shows a reduced shift of NF-AT (c and d). may be possible. Data describing the therapeutic concentrations

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp838–842 842 Dimethylfumarate selectively inhibits NF-jB, S. Gerdes et al. of MHF in relation to the amount of DMF given are not 2 Krueger G, Ellis CN. Psoriasis—recent advances in understanding conclusive. To elucidate these findings, further pharmacokinet- its pathogenesis and treatment. J Am Acad Dermatol 2005; 53:S94– ic studies are necessary. 100. 3 Sebo¨k B, Mahrle G, Gollnick H, Bonnekoh B. Dimethylfumarat The pivotal role for NF-jB signalling in the type 1 T-cell- 16 ist unter den Fumaderm-Inhaltsstoffen der sta¨rkste Induktor dependent immune response and the reported suppression of von Apoptose-Pha¨nomenen in lympho-histiozyta¨ren U-937-Zellen. Th1 cytokines by DMF suggest that DMF acts by interfering Z Hautkr 2000; 75:347–51. with NF-jB. Experiments with normal human dermal fibro- 4 Zhu K, Mrowietz U. Inhibition of dendritic cell differentiation by blasts and human endothelial cells have shown an inhibition of fumaric acid esters. J Invest Dermatol 2001; 116:203–8. the NF-jB pathway by DMF.14,17,18 In human endothelial cells, 5 Treumer F, Zhu K, Glaser R et al. Dimethylfumarate is a potent nuclear entry of RelA, NF-jB1 and c-Rel was inhibited without inducer of apoptosis in human T cells. J Invest Dermatol 2003; 121:1383–8. affecting the nuclear transport mechanism of transcription 6 Kolenko V, Bloom T, Rayman P et al. Inhibition of NF-jB activity factors in general, as translocation of EGR-1, SP1 and AP-1 was in human T lymphocytes induces caspase-dependent apoptosis unaffected. The mechanism of action of DMF is thought to be without detectable activation of caspase-1 and -3. J Immunol 1999; 17 mediated at the level of nuclear entry of NF-jB. In a second 163:590–8. study with normal human dermal fibroblasts, a selective inhibi- 7 Poli V. The role of C/EBP isoforms in the control of inflammatory tion of nuclear translocation of NF-jB1 was found.8 and native immunity functions. J Biol Chem 1998; 273:29279– T-cell survival is dependent on the activation of the NF-jB 82. 8 Vandermeeren M, Janssens S, Wouters H et al. Dimethylfumarate is pathway.6,19 Inhibition of this pathway has led to the induc- an inhibitor of cytokine-induced nuclear translocation of NF-jB1, tion of apoptosis. Interestingly, it has been demonstrated that but not RelA in normal human dermal fibroblast cells. J Invest only DMF potently induced apoptosis and decreased expres- Dermatol 2001; 116:124–30. 5 sion of the antiapoptotic protein Bcl-2 in these cells. DMF 9 Uberti JP, Joshi I, Ueda M et al. Preclinical studies using immobil- has been demonstrated to induce apoptotic cell death in the ized OKT3 to activate human T cells for adoptive immunotherapy: lymphohistiocytic cell line U937 and in monocyte-derived optimal conditions for the proliferation and induction of non- dendritic cells.3,4 MHC-restricted cytotoxicity. Clin Immunol Immunopathol 1994; 70: 234–40. NF-AT is a transcription factor that binds to several sites 10 Mrowietz U, Asadullah K. Dimethylfumarate for psoriasis: more within the regulatory region of the gene encoding IL-2 and than a dietary curiosity. Trends Mol Med 2005; 11:43–8. other genes induced during an immune response. NF-AT is 11 Ockenfels HM, Schultewolter T, Ockenfels G et al. The antipsoriatic activated in the cytoplasm via dephosphorylation by the agent dimethylfumarate immunomodulates T-cell cytokine secre- enzyme calcineurin phosphatase, which is the main target of tion and inhibits cytokines of the psoriatic cytokine network. Br J ciclosporin, pimecrolimus and tacrolimus. Dermatol 1998; 139:390–5. C/EBPb belongs to a family of C/EBP transcription factors 12 Asadullah K, Schmid H, Friedrich M et al. Influence of mono- methylfumarate on monocytic cytokine formation—explanation for within the basic leucine zipper class of transcription factors. adverse and therapeutic effects in psoriasis? Arch Dermatol Res 1997; For C/EBPb, a more specific role in inflammation is suggest- 289:623–30. 7 ed. Interestingly, a link between C/EBPb and members of the 13 de Jong R, Bezemer AC, Zomerdijk TP et al. Selective stimulation of NF-jB family has been described. There is evidence for an T helper 2 cytokine responses by the anti-psoriasis agent mono- interaction in the pathways of two major mediators of inflam- methylfumarate. Eur J Immunol 1996; 26:2067–74. mation: IL-1 and IL-6.20 14 Stoof TJ, Flier J, Sampat S et al. The antipsoriatic drug dimethyl- The data obtained in this study substantiate previous find- fumarate strongly suppresses chemokine production in human keratinocytes and peripheral blood mononuclear cells. Br J Dermatol ings that DMF inhibits nuclear binding of NF-jB in various 2001; 144:1114–20. cells. This inhibition seems to be selective, as other transcrip- 15 Litjens NH, van Strijen E, van Gulpen C et al. In vitro pharmacokinet- tion factors such as NF-AT, C/EBP and AP-1 are not modulat- ics of anti-psoriatic fumaric acid esters. BMC Pharmacol 2004; 4: ed by DMF or MHF. This selectivity could be confirmed in 22. activated T cells. 16 Aronica MA, Mora AL, Mitchell DB et al. Preferential role for FAEs, namely DMF, are used for the treatment of psoriasis NF-jB/Rel signaling in the type 1 but not type 2 T cell-dependent and may be regarded as a new class of small-molecule NF-jB immune response in vivo. J Immunol 1999; 163:5116–24. 17 Loewe R, Holnthoner W, Groger M et al. Dimethylfumarate inhibits inhibitors for oral administration. TNF-induced nuclear entry of NF-jB/p65 in human endothelial cells. J Immunol 2002; 168:4781–7. Acknowledgments 18 Loewe R, Pillinger M, de Martin R et al. Dimethylfumarate inhibits tumor-necrosis-factor-induced CD62E expression in an NF-jB- This study was supported by an unrestricted educational grant dependent manner. J Invest Dermatol 2001; 117:1363–8. from Fumapharm AG, Lucerne, Switzerland. 19 Pagliari LJ, Perlman H, Liu H et al. Macrophages require constitutive NF-jB activation to maintain A1 expression and mitochondrial homeostasis. Mol Cell Biol 2000; 20:8855–65. References 20 Stein B, Cogswell PC, Baldwin AS Jr. Functional and physical associations between NF-jB and C/EBP family members: a Rel 1 Krueger JG, Bowcock A. Psoriasis pathophysiology: current con- domain-bZIP interaction. Mol Cell Biol 1993; 13:3964–74. cepts of pathogenesis. Ann Rheum Dis 2005; 64(Suppl. 2):ii30–6.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp838–842 CUTANEOUS BIOLOGY DOI 10.1111/j.1365-2133.2007.07795.x Effect of ultraviolet (UV) A, UVB or ionizing radiation on the cell cycle of human melanoma cells M. Placzek, B. Przybilla, U. Kerkmann, S. Gaube and K.-P. Gilbertz* Klinik und Poliklinik fu¨r Dermatologie und Allergologie, Ludwig-Maximilians-Universita¨t, 80337 Munich, Germany *Institut fu¨r Radiobiologie der Bundeswehr, Neuherbergstr. 11, 80937 Munich, Germany

Summary

Correspondence Background One important component of the cellular response to irradiation is the Klaus-Peter Gilbertz. activation of cell cycle checkpoints. It is known that both ultraviolet (UV) radi- E-mail: [email protected] ation and ionizing radiation (IR) can activate checkpoints at transitions from G1 to S phase, from G phase to mitosis and during DNA replication. Accepted for publication 2 16 November 2006 Objectives To evaluate the effects of irradiation with different wavelengths on cell cycle alterations. ) Key words Methods p53-deficient IPC-298 melanoma cells were irradiated with 10 J cm 2 ) cell cycle, ionizing radiation, melanoma, ultraviolet UVA, 40 mJ cm 2 UVB, or with 7Æ5 Gy IR. Cell cycle effects were then deter- radiation mined by DNA/5-bromodeoxyuridine dual-parameter flow cytometry. Conflicts of interest Results IPC-298 cells irradiated in G1 with UVA were not arrested at the G1/S tran- None declared. sition, but at the G2/M transition. Despite p53 deficiency, the cells showed a G1 arrest after UVB exposure. Furthermore, IR did not affect G1 or S phase, but induced G2 phase arrest. Hence, the effects of UVA, but not of UVB, on the cell cycle in p53-deficient melanoma cells are comparable with those of IR. Conclusions UVA and IR induce radical-mediated strand breaks and DNA lesions, and UVB essentially induces thymine dimers that lead to excision repair-related strand breaks. Different cell cycle effects may be a consequence of different types of DNA damage. The results showed that UVB-irradiated p53-deficient cells are

arrested in G1. Irradiation with the solar radiation component UVB can therefore result in a beneﬁcial retardation of tumour promotion in human skin carrying p53-mutated cell clones.

DNA damage evokes a wide range of acute cellular responses kinase and the kinases ATM (ataxia telangiectasia mutated) and that lead to the arrest of cell cycle progression, induction of ATR (ATM- and Rad3-related). The information is then trans- DNA repair, or apoptosis.1–3 Exposure to the environmental ferred by p53 and related proteins, chk1, chk2 to the cell carcinogens ultraviolet (UV) radiation and ionizing radiation cycle controlling machinery. (IR) induces different types of DNA damage in affected skin The varying effects of irradiation at different wavelengths are cells. Direct DNA damage such as thymine dimers is caused not completely understood, and published data are inconsistent. 11 mostly by absorbance of UVB, whereas indirect DNA damage UVA did not induce a G1 block in human fibroblasts, human such as 8-oxoguanine is mostly a consequence of UVA or transformed keratinocytes (HaCaT cells),12,13 mouse embryonal IR.4,5 Indirect DNA damage is caused by radiation-induced carcinoma cells,14 mouse fibroblasts and Chinese hamster fibro- free radicals, reactive oxygen species (ROS), lipoperoxides and blasts15 or human melanocytes,16 but reduced S phase progres- other reactive compounds.6,7 sion in human fibroblasts11 or mouse fibroblasts and Chinese 15 Both UV radiation and IR cause a decrease of proliferation hamster fibroblasts. AG2 arrest due to UVA irradiation was activity as a consequence of the activation of cell cycle check- observed in mouse fibroblasts and Chinese hamster fibro- points.8 Cell cycle progression is regulated by surveillance blasts,15 but not in HaCaT cells.12,13 UVB is known to induce a 12 16 mechanisms that activate checkpoints operating in G1 before G1 block in HaCaT cells, human melanocytes, Cloudman 8,9 17 18 entry into the S phase or in G2 before entry into mitosis. melanoma cells or rat keratinocytes, and to affect S phase 11,12,15–18 Many in vitro studies have demonstrated G1/S, G2/M and intra- progression. Induction of G2 arrest has been reported S phase cell cycle arrest as a response to DNA damage induced in human fibroblasts12 and HaCaT cells.19,20 However, a UVB- 3,8–10 11 by UV radiation or IR. DNA damage is detected by induced G2 arrest was not found in human fibroblasts or multiprotein complexes containing DNA-dependent protein mouse embryonal carcinoma cells.21 IR activates cell cycle

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp843–847 843 844 Radiation and cell cycle, M. Placzek et al.

checkpoints in G1 as well as in G2, but progression through S 3 mm Be. Dose rate was 1 Gy per min. To achieve clear cell phase is not affected, except at high doses.3,8–10 Cells with cycle effects the irradiation dose was set at 7Æ5 Gy. mutated or absent p53 are not able to activate the checkpoint at the G /S transition after exposure to IR.22 1 Cell proliferation Because the cellular response to different types of DNA damage is not yet sufficiently known, we investigated in vitro the cell An established method of evaluating cell cycle kinetics and cycle effects of UVA, UVB and IR on a human melanoma cell proliferation activity is the 5-bromodeoxyuridine (BrdU) line. The response of these cells to different types of radiation pulse-labelling technique of DNA-synthesizing cells.21,24,25 In may provide new insights into the biology of UV-induced dam- short, cells are incubated with the thymidine analogue BrdU age. As previously shown, there are no differences in the radi- which is then incorporated into newly synthesized DNA (S ation response to UVB of melanoma cells in comparison with phase) instead of thymidine. DNA with incorporated BrdU other cell types.17 To avoid interference by arresting the cells in can be detected by labelling with a specific antibody. By using the G1 phase, we used for our experiments a melanoma cell line dual-parameter flow cytometry it is possible to distinguish that has been shown to be p53 deficient. This improves the esti- cells irradiated in particular cell cycle phases especially in mation of cell cycle effects on S and G2 phases. asynchronously growing cell cultures. The BrdU/DNA double-labelling technique was used as 26 Materials and methods described previously. In order to avoid any radiosensitizing effects by BrdU during irradiation, cells were incubated at ) 37 C in the presence of 10 lmol L 1 BrdU (Serva, Heidel- Cell culture berg, Germany) for 10 min immediately after irradiation. IPC-298 melanoma cells (received from PD Dr V. Meineke, BrdU was then removed completely by repeated washings Institut fu¨r Radiobiologie der Bundeswehr, Munich) have been with BrdU-free culture medium. The cells were resuspended established from the primary tumour of a 64-year-old woman in culture medium and allowed to progress through the cell with cutaneous melanoma.23 Cells were grown as a monolayer cycle. At 0, 6, 12 and 24 h postirradiation (p.r.) cells were in RPMI 1640 medium (Gibco, Eggenstein, Germany) supple- fixed in 80% ethanol and stored at )20 C until preparation mented with 10% fetal calf serum (Boehringer Mannheim, for analysis. After treatment with ribonuclease 0Æ01% (ribo- Mannheim, Germany) and 1% antibiotic antimycotic solution nuclease A; Sigma, Deisenhofen, Germany) in phosphate-

(Gibco) under standard culture conditions (37 C, 5% CO2, buffered saline (PBS), the cells were incubated in 5% pepsin ) ) 95% humidity) in an incubator. Cells were passaged twice a (70 FIP-U g 1; Merck, Darmstadt, Germany) in 0Æ05 mol L 1 week. For experiments, cells were seeded at a density of HCl for 10 min at 37 C. DNA was denatured by incubation ) ) 1 · 105 mL 1 and irradiated 24 h later during exponential in 2 mol L 1 HCl [10 min, room temperature (RT)]. After growth. All experiments were performed in triplicate. three washes in PBS-albumin (1%), cell nuclei were incubated with anti-BrdU mouse IgG (Becton Dickinson, Heidelberg, Germany) diluted 1 : 10 in PBS-albumin (1%) for 30 min at Ultraviolet (UV) A and UVB irradiation RT, and subsequently with fluorescein isothiocyanate-conju- UVA irradiation was performed with UVASUN 5000 (Mutz- gated rabbit antimouse IgG (Dako, Hamburg, Germany) dilu- has, Munich, Germany) emitting in the range 320–460 nm ted 1 : 50 in PBS-albumin (1%) again for 30 min at RT (maximum at about 374 nm); UVA irradiance at a distance of (protected from light). DNA was counterstained by propidium ) ) 40 cm was 58 mW cm 2. UVB irradiation was carried out iodide (50 lgmL 1). DNA content and BrdU incorporation with TL 20 W/12 light bulbs (Philips, Hamburg, Germany) per cell were analysed by dual-parameter flow cytometry with the main emission between 275 and 365 nm (maxi- (FACScan; Becton Dickinson). mum at about 315 nm). After trials with different irradiation ) doses (data not shown) we chose 10 J cm 2 (UVA) and ) p53 determination 40 mJ cm 2 (UVB). These doses ensure clear cell cycle effects without reducing cellular viability. Quantification of p53 protein was carried out as described27 by using a mouse anti-p53 antibody (clone DO-1; BD Pharm- ingen, Heidelberg, Germany) and goat antimouse immuno- Dosimetry globulin (Santa Cruz, Heidelberg, Germany). For comparison, UVA or UVB intensities or doses were measured by an integ- p53-positive A549 lung carcinoma cells were used. rating instrument (Waldmann UV-Meter Type 585 100; Wald- mann, Schwenningen, Germany). Data analysis

The calculation of cell kinetic data from the dual-parameter Ionizing irradiation histograms was performed by the FACScan Research software Cells were irradiated with single doses of 240 kV IR (13 mA; as described previously.26 Altogether six regions of interest Isovolt 320/10; Seifert, Ahrensburg, Germany) ﬁltered with were deﬁned in the dual-parameter histograms. Three regions

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp843–847 Radiation and cell cycle, M. Placzek et al. 845 were deﬁned according to the DNA content of cells to identify Ultraviolet B effects cells in individual phases of the cell cycle (G1, S and G2 )2 phase). Each of these three regions was further divided into After exposure to 40 mJ cm UVB, cells irradiated in G1 two parts in order to separate cells that had incorporated BrdU were arrested in this phase (Fig. 2d). The progression into as from those that had not. With this method the percentage of well as through S phase was therefore delayed (Fig. 2e). As a cells in each cell cycle phase can be estimated separately for consequence, the transition of cells into G2, 12 h thereafter BrdU-labelled (S phase) and BrdU-unlabelled cells (G1 and (Fig. 2f), was also delayed. There was no detectable G2 arrest

G2). Analysing and observing each of these regions over sev- for cells irradiated either in G1 or in G2 phase (Fig. 2f). eral hours allows to distinguish and to survey the change in Like UVA-irradiated cells, cells irradiated in S phase with the proliferation activity in each cell cycle phase after irradi- UVB showed a delay in progression through this phase after ation. For data analysis the number of cells in G1, S or G2 at 12 h (Fig. 2b). Due to this slower progression through S the time of irradiation (t ¼ 0) was taken as 100%. With this phase, cells entered G2 phase with a delay and were then kind of analysis the changes in proliferation activity and the arrested in G2 phase (Fig. 2c). various numbers of cells in each cell cycle phase as a function of time can be distinguished for irradiated and nonirradiated Ionizing radiation effects cells.

Cells irradiated during G1 phase showed no arrest in this Results phase and no delay in transition into S phase. They essentially behaved like nonirradiated cells (Fig. 2d). At 24 h after irradiation the percentage of cells in G phase increased (Fig. 2f) p53 protein quantiﬁcation 2 compared with the nonirradiated controls due to an arrest in

Figure 1 shows a Western blot comparing p53 levels in cells G2 phase for cells irradiated in G1 phase. A consequence of 2 h after irradiation with 4 Gy, comparing IPC-298 and p53- the G2 arrest was the delayed entrance into the G1 phase of wild-type A549 lung carcinoma cells. A549 cells are chosen as the following cell cycle after 24 h (Fig. 2d). a p53-positive control. The p53 protein is not expressed in Irradiation during S phase of the cell cycle did not induce IPC-298 cells even after exposure to IR. any change in progression through this phase (Fig. 2b), but

the cells were arrested efﬁciently in G2 12 h later. This led to a delayed entrance into the subsequent G phase compared Ultraviolet A effects 1 with the nonirradiated controls (Fig. 2a). )2 Cells irradiated in G1 with 10 J cm UVA (BrdU-negative Cells irradiated during G2 phase were arrested in this phase, cells) were not arrested in G1. They behaved like nonirradi- which was detectable after 6 h and persisted at least until ated cells (Fig. 2d). The slightly slower progression of cells in 12 h p.r. (Fig. 2f).

G1 at 12 and 24 h p.r. is the consequence of the arrest in G2 seen in Figure 2f. At 24 h p.r. the number of UVA-irradiated Discussion cells in G2 is higher compared with nonirradiated cells

(Fig. 2f). This demonstrates that cells irradiated in G1 are In this study the response of IPC-298 melanoma cells to UVA, arrested in the subsequent G2 phase. UVB and IR was evaluated with respect to cell cycle kinetics.

Irradiation of cells during S phase slowed down their pro- It was found that cells irradiated in G1 phase with UVA were gression in this phase (Fig. 2b, 12 h p.r.) leading to a delay not arrested at the G1/S, but at the G2/M transition. Despite of progression into G2 (Fig. 2c). Cells are thereafter arrested p53 deﬁciency, the cells showed a G1 arrest after UVB expos- in G2 (Fig. 2c). These effects are responsible for the delayed ure. Furthermore, IR did not affect G1 or S phase, but induced entrance of cells into the next G1 phase (Fig. 2a). UVA irradi- G2 phase arrest as did UVA radiation. ation of G2 cells also induced an arrest in this phase (Fig. 2f). Our data, largely in concordance with these ﬁndings established in different cell lines, have been obtained with one cell line, so that differences in the cellular radiation response can- A549 IPC-298 not be attributed to possibly different cellular characteristics. IPC-298 cells irradiated in G1 phase with UVA did not show a

4 Gy 0 Gy 4 Gy 0 Gy M G1 block, but an effective G2 arrest. However, cells showed

aG1 block after UVB exposure despite p53 deﬁciency.

IR induced a G2 block but neither a G1 block nor S phase 60 kD retardation. p53 50 kD The cellular radiation response is controlled by mechanisms depending on a network of signal transduction pathways, consisting of DNA damage sensors, mediators, transducers and 28 Fig 1. p53 level in IPC-298 and A549 lung carcinoma cells, irradiated effectors. The DNA damage-sensing protein kinases ATM with 4 Gy or left unirradiated. M, marker proteins. and ATR are central components of this network, forwarding

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp843–847 846 Radiation and cell cycle, M. Placzek et al.

(a) 42 (b) 120 (c) 400 Control 36 UVA 100 350 UVB 30 300 IR 80 24 60 250

18 40 200

12 20 150

BrdU positive cells (%) 6 0 100

0 –20 50 0 5 10 15 20 25 0 6 12 18 24 0 5 10 15 20 25

(d) (e) (f) 250 160 800 140 200 120 600 100 150

80 400 100 60 40 200 50 BrdU negative cells (%) 20 0 0 0 0 6 12 18 24 0 6 12 18 24 0 6 12 18 24 Time (h)

Fig 2. Distribution of IPC-298 cells in the indicated cell cycle phases as a function of time after irradiation. (a,d) G1 phase; (b,e) S phase; (c,f) G2 phase. Cells were exposed to ultraviolet (UV) A, UVB or ionizing radiation (IR). Means ± SD are shown. BrdU, 5-bromodeoxyuridine. the DNA damage signal via mediators and transducers to the UVBUVA IR effectors of the affected cell. ATM and ATR are the origin of various downstream effects such as induction of cell cycle arrest.29 Helt et al.30 postulate that ATM and ATR exhibit selective substrate specificity in response to different genotoxic DNA damage sensors agents. It is therefore conceivable that different types of DNA damage generated by UVA, UVB or IR can induce different signal transduction pathways via ATM and/or ATR. The effects of UVA radiation and IR on the cell cycle were similar, but different from those of UVB radiation. This may p53X be explained by comparable UVA- or IR-induced indirect DNA damage due to free radicals, ROS, or other reaction products. UVB-induced effects can be pinned down to direct DNA damage such as thymine dimers, and ensuing excision repair-related strand breaks. Different types of DNA damage probably induce different repair mechanisms, which have already been shown for UVA and UVB irradiation.31 G1 arrest No G1 arrest UVA- and IR-induced damage activates the ATM DNA damage response pathway that is dependent on a functional p53.29 Fig 3. Schematic diagram of conceivable mechanisms that lead to Hence, p53-deficient IPC-298 cells are not able to activate the different cellular reactions after exposure to different types of G /S checkpoint after exposure to UVA or IR. On the other 1 irradiation. Ultraviolet (UV) A- and ionizing radiation (IR)-induced hand, UVB seems to activate the ATR pathway that does not DNA damage do not lead to a G1 arrest, due to a signal transduction require p53 to result in a G1 arrest. In p53-deficient IPC-298 pathway that is dependent on a functional p53. The DNA damage melanoma cells we found that UVA cell cycle effects are com- signal transduction after exposure to UVB is not dependent on p53. parable with IR effects (Fig. 3). Therefore we suppose that Therefore exposure to UVB, but not to UVA or IR, activates the G1/S UVA-induced damage does not activate the ATR pathway. checkpoint.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp843–847 Radiation and cell cycle, M. Placzek et al. 847

It is known that human skin of normal individuals fre- carcinoma cells after X-ray and UV-irradiation. J Radiat Res 2000; quently carries clones of p53-mutated keratinocytes.32 It can 41:227–41. be speculated that exposure of these p53-mutated cells to 15 Ba˚nrud H, Stokke T, Moan J, Berg K. S phase arrest and induction of multinucleated cells after exposure to ultraviolet radiation. UVB, also a component of solar radiation, can induce a G 1 Carcinogenesis 1995; 16:1087–94. arrest, by this providing time for induction of DNA damage 16 Abdel-Malek Z, Swope V, Smalara D et al. Analysis of the UV- repair processes. Thus, despite loss of p53 function, UVB induced melanogenesis and growth arrest of human melanocytes. might be able to retard tumour promotion. Further studies are Pigment Cell Res 1994; 7:326–32. necessary to evaluate the radiation response of other cell types, 17 Bolognia J, Sodi SA, Chakraborthy AK et al. Effects of ultraviolet especially nonmalignant cells, to different wavelengths. irradiation on the cell cycle. Pigment Cell Res 1994; 7:320–5. 18 Petrocelli T, Poon R, Drucker DJ et al. UVB radiation induces

p21Cip1/WAF1 and mediates G1 and S phase checkpoints. Oncogene Acknowledgments 1996; 12:1387–96. 19 Athar M, Kim AL, Ahmad N et al. Mechanism of ultraviolet The work of M.P., B.P., U.K. and S.G. was supported by Bay- B-induced cell cycle arrest in G2/M phase in immortalized skin erischer Forschungsverbund erho¨hte UV-Strahlung in Bayern – keratinocytes with defective p53. Biochem Biophys Res Commun 2000; Folgen und Maßnahmen. 277:107–11. 20 Herzinger T, Funk JO, Hilmer K et al. Ultraviolet B irradiation-

induced G2 cell cycle arrest in human keratinocytes by inhibitory References phosphorylation of the cdc2 cell cycle kinase. Oncogene 1995; 10:2151–6. 1 Pietenpol JA, Stewart ZA. Cell cycle checkpoint signalling: cell cycle 21 Dolbeare F, Gratzner HG, Pallavicini MG, Gray JW. Flow cytomet- arrest versus apoptosis. Toxicology 2002; 181–182:475–81. ric measurement of total DNA content and incorporated bromo- 2 Pawlik TM, Keyomarsi K. Role of cell cycle in mediating sensitivity deoxyuridine. Proc Natl Acad Sci USA 1983; 80:5573–7. to radiotherapy. Int J Radiat Oncol Biol Phys 2004; 59:928–42. 22 Fei P, El-Deiry WS. p53 and radiation responses. Oncogene 2003; 3 Wilson GD. Radiation and the cell cycle, revisited. Cancer Metastasis 22:5774–83. Rev 2004; 23:209–25. 23 Aubert C, Rouge F, Reillaudou M, Metge P. Establishment and 4 Ravanat JL, Douki T, Cadet J. Direct and indirect effects of UV characterization of human ocular melanoma cell lines. Int J Cancer radiation on DNA and its compounds. J Photochem Photobiol B 2001; 1993; 54:784–92. 63:88–102. 24 Gratzner HG, Leif RC. An immunofluorescence method for monit- 5 Cadet J, Sage E, Douki T. Ultraviolet radiation-mediated damage to oring DNA synthesis by flow cytometry. Cytometry 1981; 1:385–9. cellular DNA. Mutat Res 2005; 571:3–17. 25 Schutte B, Reynders MM, van Assche CL et al. An improved method 6 Halliwell B. Reactive oxygen species in living systems: source, bio- for the immunocytochemical detection of bromodeoxyuridine chemistry, and role in human disease. Am J Med 1991; 91 (Suppl. labeled nuclei using flow cytometry. Cytometry 1987; 8:372–6. 3C):S14–22. 26 Gilbertz K-P, van Beuningen D, Rhein AP. Early changes in cell 7 Saran M, Michel C, Bors W. Radical functions in vivo: a critical cycle kinetics after ionizing irradiation below 1 Gy. Int J Radiat Biol review of current concepts and hypotheses. Z Naturf 1998; 1998; 73:187–95. 53c:210–27. 27 Cordes N, Blaese MA, Meineke V, van Beuningen D. Ionizing radi- 8 Iliakis G, Wang Y, Guan J, Hang H. DNA damage checkpoint con- ation induces up-regulation of functional beta1-integrin in human trol in cells exposed to ionizing irradiation. Oncogene 2003; lung tumour cell lines in vitro. Int J Radiat Biol 2002; 78:347–57. 22:5834–47. 28 Sancar A, Lindsey-Boltz LA, U¨ nsal-Kaçmaz K, Linn S. Molecular 9 Morgan DO. Cyclin-dependent kinases: engines, clocks and micro- mechanisms of mammalian DNA repairs and the DNA damage processors. Annu Rev Cell Dev Biol 1997; 13:261–91. checkpoints. Annu Rev Biochem 2004; 73:39–85. 10 Lukas J, Lukas C, Bartek J. Mammalian cell cycle checkpoints: 29 Goodarzi AA, Block WD, Lees-Miller SP. The role of ATM and ATR signalling pathways and their organization in space and time. in DNA damage-induced cell cycle control. Prog Cell Cycle Res 2003; DNA Repair 2004; 3:997–1007. 5:393–411. 11 de Laat A, van Tilburg M, van der Leun JC et al. Cell cycle kinetics 30 Helt CE, Cliby WA, Keng PC et al. Ataxia telangiectasia mutated following UVA irradiation in comparison to UVB and UVC irradi- (ATM) and ATM and rad3-related protein exhibit selective target ation. Photochem Photobiol 1996; 63:492–7. specificities in reponse to different forms of DNA damage. J Biol 12 Weller EM, Hain J, Jung T et al. UV-B-induced cell cycle perturba- Chem 2005; 280:1186–92. tions, micronucleus induction, and modulation by caffeine in 31 Lehmann J, Pollet D, Peker S et al. Kinetics of DNA strand breaks human keratinocytes. Int J Radiat Biol 1996; 69:371–84. and protection by antioxidants in UVA- or UVB-irradiated HaCaT 13 Thorn T, Gniadecki R, Petersen AB et al. Differences in activation of keratinocytes using the single cell gel electrophoresis assay. Mutat G /M checkpoint in keratinocytes after genotoxic stress induced by 2 Res 1998; 407:97–108. hydrogen peroxide and ultraviolet A radiation. Free Radic Res 2001; 32 Jonason AS, Kunala S, Price GJ et al. Frequent clones of p53- 35:405–16. mutated keratinocytes in normal human skin. Proc Natl Acad Sci USA 14 Taga M, Shiraishi K, Shimura T et al. The effect of caffeine on p53- 1996; 93:14025–9. dependent radioresponses in undifferentiated mouse embryonal

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp843–847 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2006.07708.x Novel function of DUSP14/MKP6 (dual speciﬁc phosphatase 14) as a nonspeciﬁc regulatory molecule for delayed-type hypersensitivity Y. Nakano Division of Environmental Health, Osaka Prefectural Institute of Public Health, Higashinari, Osaka 537-0025, Japan

Summary

Correspondence Background Nonspeciﬁc unresponsive states of delayed-type hypersensitivity (DTH) Yumiko Nakano. to unrelated antigens are induced in mice by a single administration of hapten. In E-mail: [email protected] these studies, we found a unique regulatory mechanism of contact hypersensitivity (CHS) mediated by nonspeciﬁc suppressor factor (NSF) induced by the intravenous Accepted for publication 10 September 2006 injection of hapten-conjugated syngeneic spleen cells. NSF is a 45-kDa protein released from the macrophage-like suppressor cells and binds selectively to dendrit-

Key words ic cells (DCs). Moreover, NSF-treated DCs release a second 20-kDa NSF (NSFint). contact hypersensitivity, dendritic cells, dual Objectives To try and identify NSF and characterize its function. specific phosphatase 14, hapten-conjugated cells, Methods The suppressor activity was evaluated by inhibition of the passive transfer nonspecific suppressor factor of CHS by the effector cells sensitized with hapten and the antigen-presenting cell Conflicts of interest (APC) activity of hapten-primed draining lymph node cells (DLNCs) to induce None declared. CHS. NSF-containing supernatants obtained from the culture of spleen cells from mice that had been injected intravenously with oxazolone-conjugated syngeneic spleen cells 7 days before were prepared and purified with a Green A dye-affinity column, DEAE column and Sephacryl S-200 column. Then, samples of molecular mass of 45 kDa were separated by native-PAGE (polyacrylamide gel electrophoresis) and nonreducing sodium dodecyl sulphate (SDS)-PAGE. After confirming the suppressor activity of proteins of 45 kDa separated by native-PAGE, samples were separated by nonreducing SDS-PAGE, transferred onto polyvinylidene difluoride membranes and analysed using matrix-assisted laser desorption/ ionization time-of-flight (MALDI-TOF) mass spectrometry. Results Proteins of 45 kDa eluted from a Sephacryl S-200 column and the slice of native-PAGE gel exhibited the strong suppressor activity. Analyses using MALDI-TOF mass spectrometry and MASCOT algorithm of the protein bands around 45 kDa separated by nonreducing SDS-PAGE identified NSF as a 22Æ5-kDa protein, dual specific phosphatase 14/MAP-kinase phophatase-6 (DUSP14/ MKP6), which functions as a negative regulator of the MAP-kinase signalling. Western blot analyses revealed that recombinant DUSP14 (rDUSP14) exists as the mixture of 22Æ5-kDa monomer and 45-kDa dimer under nonreducing conditions, and monomers under reducing conditions. Treatment with rDUSP14 at 4 C for 2 h suppressed the ability of effector cells to transfer CHS dose dependently and the APC function of DLNCs to induce CHS. Epicutaneous application of rDUSP14 immediately after challenge inhibited the subsequent CHS expression. rDUSP14 was bound specifically by major histocompatibility complex class II (Ia)-positive spleen cells (presumably DCs). The suppressor activity of NSF was neutralized by anti-DUSP14 monoclonal antibody. Expression of DUSP14 mRNA in the spleen was upregulated parallel to the unresponsive state induced by hapten-conjugated

cells. NSF, NSFint and rDUSP14 exhibited the phosphatase activity towards p-nitrophenyl phosphate in vitro as alkaline phosphatase.

2007 The Author 848 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 DUSP14/MKP6 as a nonspeciﬁc regulatory molecule for DTH, Y. Nakano 849

Conclusions These studies indicate for the ﬁrst time that NSF is a dimer of DUSP14 secreted by macrophage-like suppressor cells by stimulation with hapten-conjugated cells and exerts a regulatory function on CHS through DCs as a secreted phosphatase.

Contact hypersensitivity (CHS) is mediated by hapten-specific T cally.12 These cells are indispensable for the suppression by NSF cells. During the induction phases, both CD4+ and CD8+ T-cell as intermediate cells because the deletion of these cells from precursors are activated in the draining lymph nodes by the the effector-cell population rendered the latter cells resistant to presentation of haptenated peptides from Langerhans cells, the the suppressor activity of NSF. Moreover, NSF-treated inter- antigen-presenting dendritic cells (DCs) of the skin. Generally, mediate cells release a second NSF (NSFint) after being cleaved CD8+ T cells function as the effector cells for CHS, while CD4+ in an energy- and lysosome-dependent manner during a 2-h T cells are endowed with downregulatory functions.1 Various culture at 37 C. Gel chromatography analysis revealed that regulatory cells and cytokines participate in the regulation of NSF is a 45-kDa protein, while NSFint is a 20-kDa protein. the CHS response. A subset of nickel-specific CD4+ T cells Production of NSF is RNA transcription-dependent, while pro- isolated from the peripheral blood of nickel-allergic patients duction of NSFint is energy- and lysosome-dependent, but does challenged with NiSO4 displays the cytokine profile [interleukin not require protein synthesis. These features suggest that NSFint (IL)-10, IL-5, interferon-c+/), IL-4+/)] of T regulatory cells is a degraded form of NSF released by the intermediate cells and can regulate the expression of CHS via release of IL-10.2 after having internalized and undergone some modification in T-cell receptor a/b+, CD4+CD8+ suppressor T cells that inhi- lysosomes.13 Thus, it is suggested that NSF is modulated by bit sensitization and elicitation of CHS are induced by the DCs and regulates the CHS response through DCs. epicutaneous application of a protein antigen.3 IL-4, a cytokine In the present study, I tried to identify NSF by proteome produced from T-helper 2 cells, is involved in the induction of analysis. Partially purified culture supernatants of spleen cells these suppressor T cells and their suppressive function is mainly in mice that had been injected with oxazolone (Ox)-conju- mediated by transforming growth factor (TGF)-b.4,5 IL-4 also gated syngeneic spleen cells 7 day before were separated by interferes with CHS at the induction phase.6 nonreducing sodium dodecyl sulphate-polyacrylamide gel Recently Nakano and Nakano have reported that the admin- electrophoresis (SDS-PAGE).14,15 A resulting 45-kDa protein istration of hapten via various routes such as painting and was analysed using matrix-assisted laser desorption/ionization intravenous injection induces a potent nonspecific unrespon- time-of-flight (MALDI-TOF) mass spectrometry. The obtained sive state of delayed-type hypersensitivity (DTH) involving mass fingerprint data sets were analysed using the MASCOT CHS to unrelated antigens and that this phenomenon (antigenic algorithm. As a result, dual specificity phosphatase 14/mitogen- competition) is mediated by suppressor cells.7–9 In these stud- activated protein kinase (MAPK) phosphatase-6 (DUSP14/ ies, we found a unique regulatory mechanism of CHS mediated MKP6) having molecular mass of 22Æ5 kDa was identified as a by nonspecific suppressor factor (NSF) induced by the injec- candidate corresponding to NSF. DUSP14 functions as a nega- tion of hapten-conjugated syngeneic spleen cells in mice.10–12 tive regulator of CD28 signalling and dephosphorylates various CHS to the hapten and nonspecific unresponsiveness to other MAPKs: extracellular signal-regulated kinase (ERK), c-jun 16 unrelated DTH, including CHS, are induced simultaneously by NH2-terminal kinase (JNK) and p38. The ability of NSF intravenous administration of hapten-conjugated cells. In the activity to suppress CHS expression is not contradictory to the induction of the nonspecific unresponsiveness, short-lived function of DUSP14/MKP6. Therefore, I examined whether T cells that are depleted by adult thymectomy and cyclo- recombinant DUSP14 (rDUSP14) has the same structure, func- phosphamide are indispensable.11 Macrophage-like nonspecific tions and properties as NSF, and whether anti-DUSP14 mono- suppressor cells are induced in the spleen 7 days after the clonal antibody (mAb) could neutralize the NSF activity. The injection of hapten-conjugated cells. The suppressor cells inhi- results show that NSF is a dimer of DUSP14 secreted by bit the passive transfer of CHS by effector T cells specific for macrophage-like suppressor cells after the injection of hapten- unrelated hapten, and release NSF during culture for 24 h at conjugated cells and exerts a regulatory function on CHS 37 C without any antigenic triggering.10 Suppressor activity through DCs as a secreted phosphatase. of NSF can be detected in two systems, i.e. treatment with NSF for 2 h at 4 C inhibits the passive transfer of CHS by the Materials and methods effector cells sensitized with hapten and the antigen-presenting cell (APC) activity of hapten-primed draining lymph node cells Animals (DLNCs) to induce CHS. The mechanism of the regulation of CHS by NSF is complex. BALB/c mice, 5–7 weeks old, were used in all studies. Animal The direct target of NSF is not T cells.11 NSF is bound by major care and experimental procedures were performed according histocompatibility complex (MHC) class II (Ia)- and 33D1 to the animal care guidelines of the Osaka Prefectural Institute (a DC marker)-positive cells located in the spleen and draining of Public Health. The animal room was maintained on a 12-h lymph nodes. NSF-treated spleen cells from normal mice light–dark cycle. Animals were given mouse chow and water acquire the ability to suppress the transfer of CHS nonspecifi- ad libitum.

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 850 DUSP14/MKP6 as a nonspeciﬁc regulatory molecule for DTH, Y. Nakano

23–27, 28–32 ( 45 kDa) and 33–36 were pooled, respect- Reagents and antibodies ively, concentrated by ultrafiltration (molecular mass limit 4-Ethoxymethylene-2-phenyloxazol-5-one (Ox; Sigma, St 10 kDa; Centricut Ultramini, Kurabo, Osaka, Japan) and Louis, MO, U.S.A.), 2,4,6-trinitrochlorobenzene (TNCB; dialysed against PBS. Tokyo Kasei, Tokyo, Japan), rDUSP14 (E. coli; GenWay Biotech Inc., San Diego, CA, U.S.A.), antimouse DUSP14 mAb Native and sodium dodecyl sulphate polyacrylamide (IgG2a,j; Abnoba, Taipei, Taiwan), antimouse Iad mAb gel electrophoresis (IgG2a,j; BD PharMingen, San Diego, CA, U.S.A.), mouse IgG2a,j (Abnoba), rabbit complement (Low-Tox-M rabbit Native-PAGE and SDS-PAGE were performed with 12Æ5% gels complement; Cederlane, Hornby, ON, Canada), alkaline phos- (PAG Mini DAIICHI; Daiichi Chemical, Tokyo, Japan) and pre- phatase (ALP) (Wako Pure Chemical, Osaka, Japan) and stained SDS-PAGE standards (Low range; Bio-Rad, Hercules, Tween 80 (Sigma) were all obtained from the indicated CA, U.S.A.) following the manufacturer’s instructions. For manufacturers. rDUSP14 was dialysed extensively against evaluating suppressor activity, a gel slice containing a phosphate-buffered saline (PBS) before use. 45-kDa protein was excised from native-PAGE and minced, and the proteins were eluted with PBS. Then, the solution was dialysed against PBS containing 5% fetal calf serum (Gibco, Preparation of Ox-conjugated spleen cells, and Grand Island, NY, U.S.A.). the production of nonspecific suppressor factor (NSF) and intermediate NSF Immunoblotting Ox in ethanol (1 mL of a 0Æ5% solution) was added to 40 mL of buffered disodiumethylenediaminetetraacetate dehydrate Western blotting was performed using SuperSignal West Femto (EDTA; Wako Pure Chemical), pH 8Æ4, with vigorous stirring. Maximum Sensitivity Substrate (Pierce, Rockford, IL, U.S.A.) The mixture was added immediately to 20 mL of a suspension following the manufacturer’s instructions. In brief, samples ) of spleen cells (2 · 107 mL 1) in Hank’s balanced saline solu- electrophoresed on SDS-PAGE were transferred to a polyvinylid- tion (HBSS; Nissui, Tokyo, Japan) and incubated at room ene difluoride (PVDF) membrane (DuPont-NEN, Boston, MA, temperature for 10 min without agitation. The resulting sus- U.S.A.). Then, the membrane was blocked by the blocking rea- pensions of Ox-conjugated spleen cells were then washed twice gent (Pierce), and the proteins were probed with antimouse in EDTA buffer, pH 7Æ4, and resuspended in HBSS. Mice were DUSP14 mAb. After being washed with PBS-Tween 20, blots injected intravenously with 3Æ7 · 106 Ox-conjugated spleen were incubated with a horseradish peroxidase-conjugated goat cells. For NSF preparation, spleen cells from these mice were antimouse IgG. After washing, bound antibodies were revealed ) harvested 7 days later and cultured for 24 h at 4 · 107 mL 1 by chemiluminescence reaction using luminocapture (ATTO, in RPMI 1640 medium (Nissui). For NSFint preparation, normal Tokyo, Japan). spleen cells were treated with NSF-containing supernatants at ) 2 · 107 mL 1 for 2 h at 4 C. After washing, these cells were ) Proteome analysis further cultured at 2 · 107 mL 1 for 2 h at 37 C. Then, the supernatants containing NSF and NSFint were separated by Samples electrophoresed on SDS-PAGE under nonreducing centrifugation at 10 000 g for 30 min. Samples were collected conditions were transferred to a PVDF membrane. The follow- and used immediately or, alternatively, frozen at )80 C after ing proteome analyses were performed by Protein Research adding 20% glycerin (Tokyo Kasei). Network (Yokohama, Japan). In brief, the PVDF membrane was stained with Colloidal Gold (Bio-Rad). The protein band was cut out, digested with Achromobacter protease I (lysyl Purification of nonspecific suppressor factor endopeptidase; Wako Pure Chemical) and subjected to NSF was purified from the pooled culture supernatants of MALDI-TOF mass spectrometric analysis (Boyager-DESTR, spleen cells from mice injected with Ox-conjugated syngeneic Applied Biosystems, Foster City, CA, U.S.A.). The obtained spleen cells 7 days before as described previously.14 Briefly, peptide mass fingerprint spectra were analysed using MASCOT ) samples were dialysed against 0Æ05 mol L 1 phosphate buffer database search software (http://www.matrixscience.com/, ) containing 0Æ15 mol L 1 NaCl, pH 8Æ0, and applied to a Green accessed 16 October 2006) in Shimaze Proteome Analysis A dye-affinity column (Matrix gel; Amicon, Beverly, MA, Center (Tsukuba, Japan). U.S.A.) at room temperature. After the column was washed thoroughly, proteins were eluted with the same buffer at Sensitization with hapten and elicitation of contact 4 C. Fractions containing proteins were pooled and dialysed ) hypersensitivity against 0Æ05 mol L 1 sodium phosphate buffer, pH 6Æ8. Then, the sample was applied to a DEAE column (Pharmacia, Mice were painted on the clipped abdomen with 50 lLof4% Uppsala, Sweden) and eluted with the same buffer containing TNCB in ethanol. Five days later, mice were challenged by ) 0Æ8 mol L 1 KCl. The eluate was equilibrated with PBS, and painting both sides of the right ear with 20 lL of 1% TNCB separated by a Sephacryl S-200 column (Pharmacia). Fractions in ethanol or olive oil. The ear thickness of each mouse was

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 DUSP14/MKP6 as a nonspecific regulatory molecule for DTH, Y. Nakano 851 measured using a dial thickness gauge (Ozaki Co., Tokyo, cDNA synthesis was performed with the SuperScript First- Japan) before and 24 h after challenge. Then, ear swelling was Strand Synthesis System for reverse transcriptase (RT)-PCR calculated as follows: ear thickness 24 h after challenge – ear (Invitrogen Life Technologies, San Diego, CA, U.S.A.) using thickness before challenge. total RNA, oligo (dT)12~18, and SuperScript II RT according to the manufacturer’s instructions. PCR was performed with LightCycler-DNA Master SYBR Green I as a ready-to-use reac- Assessment of the suppressor activity using contact tion mix (Roche) according to the manufacturer’s instructions. hypersensitivity transfer by effector cells and the This buffer contains nucleotides, Taq DNA polymerase, reac- antigen-presenting cell activity for inducing contact ) tion buffer, SYBR Green I dye and 10 mmol L 1 Mg2+. The hypersensitivity by draining lymph node cells amplification of target genes in stimulated cells was calculated In the assessment using the passive transfer system, mice were by first normalizing to the amplification of glyceraldehyde-3- painted on the clipped abdomen with 200 lL of 4% TNCB. phosphate dehydrogenase (GADPH), and then expressing the Four days later, these mice were sacrificed and lymphoid cells normalized values as fold increase over the value obtained from the inguinal and mesenteric lymph nodes and spleen with unstimulated control cells according to the manufactur- were pooled (eight mice), and single-cell suspensions were er’s protocols. The sense primer for GADPH was 5¢-AAA- ) prepared. Then, these lymphoid cells (2 · 107 mL 1) were TGGTGAAGGTCGGTGTG-3¢ and the antisense primer was treated with various samples for 2 h at 4 C. After washing, 5¢-TGAAGGGGTCGTTGATGG-3¢. The sense primer for 3 · 107 of these cells were injected intravenously into a nor- DUSP14 was 5¢-GTAACAAGCACCGCTCCCAAG-3¢ and the anti- mal recipient. Immediately, mice were challenged by painting sense primer was 5¢-CATGAAGATGCCAGTGGTCACA-3¢. The on both sides of the right ear with 20 lL of 1% TNCB in sense primer for IL-10 was 5¢-GGCGCTGTCATCGATTTCTC-3¢, olive oil. and the antisense primer was 5¢-TCATGGCCTTGTAGACA- In the assessment using the system of induction of CHS by CCTTG-3¢. The sense primer for TGF-b was 5¢-GTGTGGAG- DLNCs, auricular lymph node cells were obtained from eight CAACATGTGGAACTCTA-3¢, and the antisense primer was mice treated with 20 lL of 4% TNCB in ethanol on the ear 5¢-TTGGTTCAGCCACTGCCGTA-3¢. The determinants were ) 24 h previously. Then, these cells (1 · 107 mL 1) were treat- performed in triplicate. ed with various samples as above and injected subcutaneously into the hind footpad of a mouse. Five days later, mice were p-Nitrophenyl phosphate dephosphorylation assay challenged with TNCB as above. The in vitro phosphatase assay was performed based on the cleavage of p-nitrophenyl phosphate (pNPP) using a pNPP Treatment with antibody phosphatase assay kit (BioAssay Systems, Hayward, CA, ) ) Spleen cells at 2 · 107 mL 1 were treated with 2 lgmL 1 of U.S.A.) following the manufacturer’s instructions. In brief, anti-Iad mAb in RPMI 1640 medium (Nissui, Tokyo, Japan) for samples were diluted serially in PBS, and incubated in 200-lL 30 min at 4 C. After washing to remove unbound antibodies, reaction volumes containing pNPP and imidazole for 30 min these cells were incubated at 37 C for 30 min with 10 mL of at room temperature. Hydrolysis of pNPP was assessed by a 1 : 10 dilution of rabbit complement (Low-Tox-M rabbit measuring the absorbance at 405 nm. Triplicate assays were complement; Cederlane). Finally the cells were washed twice. performed for each sample.

RNA preparation Statistical analysis

RNA was isolated according to the manufacturer’s protocol. Results were expressed as means ± SE. Comparisons between Briefly, 50 lg of pooled spleens (five mice per group) were two groups were performed with a two-tailed Student’s t-test, suspended in 1 mL of Isogen (Nippongene, Toyama, Japan) and P <0Æ05 was considered significant. and homogenized using a Polytron homogenizer (Kinematika, Steinhofhalde, Switzerland). RNA was extracted with chloro- Results form, precipitated with isopropyl alcohol, washed once with 70% ethanol, air-dried and suspended in RNase-free water. Partial purification of nonspecific suppressor factor After DNaseI (Roche, Mannheim, Germany) treatment at and evaluation of its suppressor activity 37 C for 30 min, RNA was re-extracted. Recently Nakano et al. have established the purification procedure of NSF using various columns and found that the suppres- Semiquantitative reverse transcriptase-polymerase sor activity of NSF was recovered in the 45-kDa fraction of chain reaction the Sephacryl S-200 column.15 To prepare samples for prote- Relative levels of DUSP14, IL-10 and TGF-b mRNAs were ana- ome analysis, stock NSF was partially purified according to lysed using semiquantitative real-time polymerase chain reac- this method and its suppressor activity was confirmed. In tion (PCR) analysis using a LightCycler (Roche). First strand brief, 3-L aliquots of NSF-containing supernatants obtained

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 852 DUSP14/MKP6 as a nonspecific regulatory molecule for DTH, Y. Nakano from spleen cell cultures from mice that had been injected Proteome analysis of nonspecific suppressor factor intravenously with 1Æ85 · 107 Ox-conjugated syngeneic spleen cells 7 days previously were prepared and purified with Next, proteome analysis of NSF was performed using the a Green A dye-affinity column, DEAE column and Sephacryl 45-kDa fractions of the Sephacryl S-200 column. Proteins S-200 column (Fig. 1a). Fractions 23–27, 28–32 ( 45 kDa) of the fractions were separated by nonreducing SDS-PAGE, and 33–37 of the Sephacryl S-200 column were pooled, con- transferred onto a PVDF membrane, and visualized with centrated and dialysed against PBS, respectively. Then, the sup- colloidal gold. As a result, a single band was detected at pressor activity of each pooled sample was examined using 45 kDa (Fig. 2). In the preliminary study, the 45-kDa the CHS transfer system by effector cells and the APC activity proteins eluted from the slice of native-PAGE gel (unstained) for inducing CHS by DLNCs. In the CHS transfer system lym- with PBS completely suppressed the CHS transfer by effector ) phoid cells (2 · 107 mL 1) from mice applied with TNCB cells (data not shown). Then, the band was cut out, digested 4 days before were treated with the samples diluted with with protease, and analysed by MALDI-TOF mass spectrome- RPMI 1640 medium for 2 h at 4 C and transferred to normal try. As the obtained peptide mass fingerprint data sets involved mice, and their CHS responses were tested immediately. Alter- human keratin 1 [molecular weight (MW) ¼ 66 kDa] and ) natively, DLNCs (2 · 107 mL 1) from mice applied with human keratin type II (MW ¼ 65Æ9 kDa) possibly due to con- TNCB 1 day before were treated with the samples as above, tamination during the purification procedure, further analysis and transferred to normal mice and their CHS responses were was performed using the MASCOT algorithm after deleting the tested 4 days later. As a result, treatment with the mediums data of contaminated keratins. As a result, DUSP14/MKP6 containing the proteins from fractions 28–32 ( 45 kDa) (Locus, NM_019819; MW ¼ 22Æ5 kDa) was detected as the completely suppressed the CHS transfer by effector cells and most probable protein having top score (score ¼ 51) (Table 1) CHS induction by the APCs compared with the treatment with among 20 proteins calculated. Other proteins having lower the control medium (vehicle) (Fig. 1b and c, respectively). scores were hypothetical protein LOC66410 (MW ¼

(a) 0 V 67 kDa 45 kDa 25 kDa 13·7 kDa

0·60

0·50

0·40

280 280 0·30 OD 0·20

0·10

0 0 10 20 30 40 50 Fraction number

(b)Ear swelling (x10–3 cm) (c) Ear swelling (x10–3 cm) 0 1·0 2·0 3·0 4·0 5·0 6·0 7·0 8·0 TNCB-induced 0 1·0 2·0 3·0 4·0 5·0 6·0 7·0 8·0 TNCB-sensitized Treated antigen Treated effector cells with presenting cells with – – – –

+ Vehicle + Vehicle

+ Frac. 23–27 + Frac. 23–27 * ** + Frac. 28–32 + Frac. 28–32

+ Frac. 33–37 + Frac. 33–37

Fig 1. Partial puriﬁcation of nonspeciﬁc suppressor factor (NSF) and evaluation of its suppressor activity. (a) Protein content of each Sephacryl S-200 column fraction determined by the optical density (OD) at 280. (b) The effect of each sample on the transfer of contact hypersensitivity (CHS) by effector cells. (c) The effect of each sample fraction on the induction of CHS by antigen-presenting cells. The columns represent the mean ear swelling of six mice 24 h after challenge. The horizontal bars represent the SEM. For the positive control, medium plus phosphate- buffered saline at the same volume as samples was used. *P <0Æ05 and **P <0Æ01.

Sample Marker Marker (x40) (x120)

Myosin (205 kDa)

β Fig 2. Images of nonspeciﬁc suppressor factor -Galactosidase (116 kDa) (NSF) separated by sodium dodecyl sulphate- Phosphorylase b (97·4 kDa) polyacrylamide gel electrophoresis (SDS- Bovine serum albumin (66 kDa) PAGE) and visualized with colloidal-gold staining. The 45-kDa proteins prepared from the Sephacryl S-200 column as described Egg albumin (45 kDa) above were separated by SDS-PAGE, transferred onto a polyvinylidene diﬂuoride membrane, and visualized with colloidal gold. The lanes contain the NSF sample and molecular mass standards (SDS-6H; Sigma) Carbonic anhydrase (29 kDa) diluted ·40 and ·120 times, respectively. The arrow indicates the main protein in the NSF sample.

Table 1 Mascot search results of NSF analysisa

Observed Mr Delta Start–End Peptide 1753 1752 0Æ05 173–187 MVQTPYGIIPDVYEK 1769 1768 0Æ04 173–187 MVQTPYGIIPDVYEK + Oxidation (M) 1807 1806 )0Æ20 129–142 FHNLCLLEAYNWVK 2351 2350 )0Æ12 76–96 VOLADIPHAPIRLYEDYVADK 2832 2830 )0Æ17 103–128 KHGATLVHCSSGVSRSATLCIAYLMK + Oxidation (M)

NSF, nonspecific suppressor factor; Ox, oxazolone. aNSF was partially purified from the pooled culture supernatants of spleen cells from mice injected with Ox-conjugated spleen cells 7 days before as indicated in Materials and methods. The 45-kDa proteins obtained from a Sephacryl S-200 column were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis, transferred onto a polyvinylidene difluoride membrane and visualized with colloidal gold. A 45-kDa protein was cut out, digested with protease and analysed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. After deleting the data of contaminated human keratins, the MASCOT algorithm was performed. Five peptides matched to Mus musculus DUSP14 were listed.

47Æ5 kDa), helix–loop–helix protein Id2 (MW ¼ 26Æ5 kDa), also form dimers. In order to conﬁrm this possibility, Western T-box protein 18 (MW ¼ 66Æ1 kDa), apoptosis inhibitor 5 blotting was performed using rDUSP14 and anti-DUSP14 (MW ¼ 57Æ1 kDa) and ribosomal protein L29 (MW ¼ mAb. rDUSP14 was separated by SDS-PAGE under nonreduc- 17Æ1 kDa). Cytokines were not involved in the list. Consider- ing and reducing conditions, transferred to a PVDF membrane ing the molecular weight, it seemed likely that NSF is a dimer and revealed by Western blot with anti-DUSP14 mAb. As a of DUSP14, because 45-kDa NSF is degraded to 20-kDa result, bands with molecular weight of 22Æ5 kDa and

NSFint in the intermediate cells. DUSP14 functions as a nega- 45 kDa were detected under nonreducing conditions, and a tive-feedback regulator of CD28 costimulatory signalling, 22Æ5-kDa band was detected under reducing conditions which controls the activation of MAP kinases in T cells.16 The (Fig. 3). Thus, it was conﬁrmed that rDUSP14 also forms ability of NSF to suppress CHS expression by effector cells is dimers running at a molecular weight of 45 kDa. not contradictory to this known function of DUSP14/MKP6. Taken together, it is possible that DUSP14 might be a candi- Effect of DUSP14 on the ability of effector cells to date protein for NSF. transfer contact hypersensitivity and the antigen- presenting cell activity of hapten-primed draining lymph Immunoblotting node cells to induce contact hypersensitivity

If NSF is a dimer of NSFint that is held together by a covalent To conﬁrm that NSF is the same as DUSP14, it was investi- bond such as a disulﬁde bond, it is possible that DUSP14 may gated whether rDUSP14 has the same functions as NSF.

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 854 DUSP14/MKP6 as a nonspeciﬁc regulatory molecule for DTH, Y. Nakano

on the ear 24 h before were also treated with various concen- Nonreducing Reducing trations of rDUSP14 for 2 h at 4 C. After washing these cells were injected into the hind footpad of recipient mice. Five days later, the CHS response was tested by challenge on the 45 kDa ear with TNCB. The results demonstrated that rDUSP14 suppressed the APC function of DLNCs to induce CHS dose ) dependently, and completely blocked it at 5 lgmL 1 (Fig. 4b). Thus, it was shown that rDUSP14 has the same function as NSF.

22·5 kDa Effect of DUSP14 on contact hypersensitivity expression

rDUSP14 exhibited the potent suppressor activity for the effector cells and the APCs related to CHS. In the next experiments, Fig 3. Immunoblotting. rDUSP14 (0Æ17 lg per lane) was separated it was investigated whether in vivo application of rDUSP14 using 12Æ5% sodium dodecyl sulphate-polyacrylamide gel could affect CHS responses. Mice sensitized with TNCB or Ox electrophoresis under nonreducing and reducing conditions and 5 days previously were challenged with the corresponding immunoblotted with anti-DUSP14 mAb at a dilution of 1 : 10 000. antigen on the ear. Varying doses of rDUSP14 dialysed against Horseradish peroxidase-conjugated antimouse immunoglobulin was PBS and mixed with 0Æ2% Tween 80 were applied topically used at a dilution of 1 : 1000 as recommended by the manufacturer. on the elicitation sites immediately after challenge and the CHS responses at 24 h were measured. As a result, rDUSP14 ) Lymphoid cells (2 · 107 mL 1) obtained from mice sensitized suppressed CHS responses dose dependently in both systems with TNCB 4 days before were treated with various concentra- (Fig. 5a,b). Treatment with Tween 80 did not affect the mag- tions of rDUSP14 for 2 h at 4 C. After washing, these cells nitude of the CHS response. Mice sensitized with TNCB 5 days were injected intravenously into the recipient mice and the before were injected with varying doses of rDUSP14 intraperi- CHS response was tested immediately by challenge with toneally and challenged immediately with the same antigen, TNCB. As shown in Figure 4a, treatment with rDUSP14 sup- which also suppressed the CHS response signiﬁcantly pressed the ability of effector cells to transfer CHS dose (Fig. 5c). Thus, it was shown that rDUSP14 has the suppressor ) dependently, and completely blocked it at 5 lgmL 1. DLNCs activity for the CHS responses in nonspeciﬁc manners inde- ) (2 · 107 mL 1) from the mice treated topically with TNCB pendent of administration route.

(a) Ear swelling (x10–3 cm) TNCB-sensitized –1 0 1·0 2·0 3·0 4·0 5·0 6·0 7·0 8·0 9·0 10·0 effector cells rDUSP14 (µg mL )

– –

+ None Fig 4. Effect of rDUSP14 on the activity of + 0·05 * effector cells to transfer CHS and the APC + 0·5 activity of hapten-primed DLNCs to induce CHS. (a) Treatment with rDUSP14 suppressed + 5·0 the ability of effector cells to transfer CHS dose dependently, and completely blocked it )1 (b) at 5 lgmL . (b) Treatment with rDUSP14 –3 TNCB-induced Ear swelling (x10 cm) suppressed the APC function of DLNCs to antigen –1 0 2·0 4·0 6·0 8·0 10·0 12·0 induce CHS dose dependently, and completely presenting cells rDUSP14 (µg mL ) ) blocked it at 5 lgmL 1. The columns – – represent the mean ear swelling of six mice 24 h after challenge. The horizontal bars + None * represent the SEM. For the treatment of the + 0·05 positive control, phosphate-buffered saline at the same volume as samples was added to the + 0·5 * medium. *P <0Æ05 and **P <0Æ01. CHS, + 5·0 ** contact hypersensitivity; APC, antigen- presenting cell; DLNCs, draining lymph node cells; TNCB, 2,4,6-trinitrochlorobenzene.

–3 (a)Ear swelling (x10 cm) (b) Ear swelling (x10–3 cm) Sensiti- rDUSP14 Sensiti- rDUSP14 –1 0 2 4 6 8 10 12 14 16 18 20 –1 0 2 4 6 8 10 12 14 16 18 20 zation Tween 80 (µg mL ) zation Tween 80 (µg mL )

– – – – – –

TNCB – None Ox – None

TNCB + None Ox + None

TNCB + 0·32 Ox + 0·32

TNCB + 1·6 * Ox + 1·6 **

TNCB + 8·0 Ox + 8·0

Ear swelling (x10–3 cm) (c) rDUSP14 –1 0 5 10 15 20 25 30 35 40 Sensitizaion (µg mL )

– –

TNCB None

TNCB 0·4 * TNCB 2·0

TNCB 10·0

Fig 5. Effect of rDUSP14 administration in vivo on the CHS responses. (a) The suppressor activity of rDUSP14 applied on TNCB-challenge sites. (b) The suppressor activity of rDUSP14 applied on Ox-challenge sites. (c) The suppressor activity of rDUSP14 injected just before challenge with TNCB. The columns represent the mean ear swelling of six mice 24 h after challenge. The horizontal bars represent the SEM. *P <0Æ05 and **P <0Æ01. CHS, contact hypersensitivity; TNCB, 2,4,6-trinitrochlorobenzene; Ox, oxazolone.

anti-DUSP14 mAb but not the isotype control (IgG2a,j)in Affinity of rDUSP14 to the spleen cells both systems. NSF binds selectively to Iad-positive DCs involved in the spleen. To examine whether DUSP14 has the same property, ) Gene expression in the spleen of mice injected rDUSP14 (5 lgmL 1 in RPMI 1640 medium) was incubated ) with Ox-conjugated spleen cells with normal spleen cells (1Æ5 · 108 mL 1) or spleen cells ) depleted of Iad-positive cells (1Æ5 · 108 mL 1) prepared as The maximum nonspecific unresponsive state for DTH is described in Materials and methods. After removing the cells, attained in mice 7 days after the injection with Ox-conjugated the suppressor activity of each supernatant on the TNCB- spleen cells.11 In the next experiment, the time course of the primed APCs to induce CHS were examined as described mRNA expression of DUSP14 and other regulatory cytokines in above. The results showed that the suppressor activity of the spleen of mice injected with Ox-conjugated spleen cells was rDUSP14 was completely abolished by the absorption with examined using RT-PCR as described in Materials and methods. normal spleen cells, but not the spleen cells depleted of Iad- Total RNA was extracted from the spleen of mice 3–7 days after positive cells (Fig. 6a,b). These results indicated that rDUSP14 the injection of Ox-conjugated spleen cells and the mRNA has the same feature as NSF to bind selectively to Iad-positive expression was examined. As shown in Figure 8a, upregulation cells, presumably DCs. of DUSP14 mRNA appeared on the fourth day and reached the maximum on the seventh day after the injection of Ox-conjugated spleen cells. Changes in IL-10 mRNA expression were also Neutralization of nonspecific suppressor factor activity observed in parallel to DUSP14 mRNA expression (Fig. 8b), by anti-DUPS14 monoclonal antibody while TGF-b mRNA expression peaked at the fourth day after Next, experiments were performed to examine whether the the injection of Ox-conjugated spleen cells (Fig. 8c). suppressor activity of NSF was neutralized by anti-DUSP14 ) mAb. Anti-DUSP14 mAb (4 lgmL 1) was added to the Characterization of nonspecific suppressor factor (NSF) NSF-containing supernatant. Then, the suppressor activity of and intermediate NSF phosphatase activity in vitro the mixture on the ability of effector cells to transfer CHS and on the ability of APCs to induce CHS was exam- DUSP14 exhibits phosphatase activity against an artificial low- ined as described above. As shown in Figure 7, the sup- molecular-weight substrate, pNPP, which is a chromogenic pressor activity of NSF was reduced by the addition of substrate for most phosphatases, such as alkaline phosphatases

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 856 DUSP14/MKP6 as a nonspeciﬁc regulatory molecule for DTH, Y. Nakano

(a)

TNCB-sensitized Ear swelling (x10–3 cm) antigen 0 1·0 2·0 3·0 4·0 5·0 6·0 7·0 8·0 presenting cells rDUSP14 Absorption

– – –

+ – – * + + – * + + Spleen cells

(b) TNCB-sensitized Ear swelling (x10–3 cm) antigen presenting cells rDUSP14 Absorption 0 2 4 6 8 10 12 14 16 18 20

– – – Fig 6. Absorption of rDUSP14 by spleen cells. (a) The suppressor activity of the + – – medium absorbed with normal spleen cells. * (b) The suppressor activity of the medium + + – absorbed with the spleen cells depleted of * Iad-positive cells. The columns represent the + + Spleen cells mean ear swelling of six mice 24 h after depleted of Iad+ cells challenge. The horizontal bars represent the SEM. *P <0Æ05.

(a) Ear swelling (x10–3 cm) TNCB-sensitized 0 1·0 2·0 3·0 4·0 5·0 6·0 7·0 8·0 effector cells NSF Neutralization

– – –

+ – – * + + – *

+ + Isotype control

Fig 7. Neutralization of NSF activity by + + Anti-DUSP14 anti-DUPS14 mAb. (a) Anti-DUSP14 mAb ) (4 lgmL 1) was added to the NSF- (b) containing supernatant. (b) The suppressor TNCB-sensitized Ear swelling (x10–3 cm) activity of the mixture on the ability of antigen- 0 2 4 6 8 10 12 14 16 18 20 effector cells to transfer CHS and on the presenting cells NS Neutralization ability of antigen-presenting cells to induce CHS was examined as described in Materials – – – and methods. The suppressor activity of NSF was reduced by the addition of anti-DUSP14 + – – mAb but not the isotype control (IgG2a,j)in * both systems. The columns represent the + + – * mean ear swelling of six mice 24 h after challenge. The horizontal bars represent the + + Isotype control SEM. For the isotype controls, mouse IgG2a,j was mixed with NSF at the same + + Anti-DUSP14 concentration of the mAb. *P <0Æ05. NSF, nonspeciﬁc suppressor factor; CHS, contact hypersensitivity, mAb, monoclonal antibody.

(a) DUSP14 Cont. sup. of NSF 2·5 NSF 2·3 Cont. sup. of NSFint 2·0 NSF 0·50 int 1·8 rDUSP14 1·5 0·45 ALP 1·3 0·40 1·0 0·8 0·35 0·5

Relative expression ratio 0·30 0·3 405

0 A 0·25 3d 4d 7d Days after Ox-sc injection 0·20 (b) IL-10 0·15 20·0 18·0 0·10 16·0 0·05 14·0 12·0 0 10·0 0 1/9 1/3 1 Dilution 8·0 6·0 Fig 9. Evaluation of phosphatase activity in vitro. Undiluted and three-

Relative expression ratio 4·0 time diluted supernatants containing NSF and NSFint exhibited 2·0 signiﬁcantly higher absorbance compared with each control culture 0 supernatant. rDUSP14 and ALP also exhibited the phosphatase activity 3d 4d 7d dose dependently. Columns indicate mean absorbance at 405 nm. Days after Ox-sc injection Values represent the mean ± SEM of triplicate determinants. The (c) β vertical bars represent the SEM. Control supernatants of NSF and 2·5 TGF- NSF were prepared from the culture of normal spleen cells under 2·3 int the same conditions as NSF and NSFint preparation. NSF, nonspeciﬁc 2·0 suppressor factor; NSFint, second NSF released by NSF-treated 1·8 intermediate cells; ALP, alkaline phosphatase. 1·5 1·3 NSFint have phosphatase activity compared with DUSP14. The 1·0 NSF- and NSFint-containing supernatants and rDUSP14 ) 0·8 (0Æ33 lg lL 1) were serially diluted with RPMI 1640 medium 0·5

Relative expression ratio or PBS and transferred to 96-well plates. The reaction was ini- 0·3 tiated by adding pNPP substrate solution. After the incubation 0 for 30 min at room temperature, the reaction was stopped 3d 4d 7d and the absorbance at 405 nm was measured. The average Days after Ox-sc injection and SE of the triplicate assays were calculated and blank values ) were subtracted. ALP (0Æ05 lg lL 1) was used as positive Fig 8. Kinetics of gene expression in the spleen of mice injected control for the comparison of phosphatase activity. As shown with Ox-conjugated spleen cells. The gene expression of DUSP14 (a), in Figure 9, undiluted and three-time diluted supernatants IL-10 (b) and TGF-b (c) was estimated using reverse transcriptase- polymerase chain reaction as described in Materials and methods. containing NSF and NSFint exhibited signiﬁcantly higher (a) Upregulation of DUSP14 mRNA appeared on the fourth day absorbance compared with each control culture supernatant. and reached the maximum on the seventh day after the injection of rDUSP14 and ALP also exhibited the phosphatase activity dose Ox-conjugated spleen cells. (b) Changes in IL-10 mRNA expression dependently. These results indicated that NSF and NSFint have were observed in parallel to DUSP14 mRNA expression. (c) TGF-b phosphatase activity in vitro as rDUSP14. mRNA expression peaked at the fourth day after the injection of Ox-conjugated spleen cells. Columns indicate fold-changes of the products. The vertical bars represent the SEM (for triplicate experiments). Discussion Ox, oxazolone; IL, interleukin; TGF, transforming growth factor. To identify NSF, a protein with molecular weight of (ALPs) and serine/threonine phosphatases.16 pNPP is dissoci- 45 kDa was separated from the partially puriﬁed samples of ated into n-nitrophenol and phosphate by phosphatases. Next, NSF-containing supernatants by SDS-PAGE and analysed using experiments were performed to examine whether NSF and MALDI-TOF mass spectrometry. MASCOT analysis of the

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 858 DUSP14/MKP6 as a nonspecific regulatory molecule for DTH, Y. Nakano obtained mass fingerprint data sets suggested that NSF is has crucial roles in the APC activity of DCs required for CHS DUSP14/MKP6, having a molecular weight of 22Æ5 kDa. By response. It is reasonable that NSF (DUSP14) is also synthes- performing comparative studies with rDUSP14 it was demon- ized in macrophage-like cells as a result of the activation of strated that DUSP14 has the same regulatory functions and these signalling pathways by stimulation with hapten-conju- properties as NSF, i.e. DUSP14 suppressed the ability of the gated cells.10 However, it is surprising that NSF (DUSP14)- effector cells to transfer CHS and the APC activity of DLNCs to synthesizing cells exert regulatory activity to DCs via the induce CHS. rDUSP14 was bound by MHC class II (Ia)-posi- secretion of NSF, as it was reported that DUSPs/MKPs gener- tive cells (presumably DCs) in the spleen. The suppressor ally act within the cells.16 The application of p38 inhibitor activity of NSF was neutralized by anti-DUSP14 mAb. Upregu- SB202190 before challenge inhibits both ear swelling and the lation of DUSP14 mRNA was detected in the spleen cells with number of infiltrated cells in the expression site in CHS.25 An the kinetics corresponding to the kinetics of the induction inhibitor of p38 signalling suppresses the costimulatory mole- of the unresponsive state for DTH in mice injected with cule expression and IL-12 production of DCs.26 Preincubation 11 Ox-conjugated spleen cells. NSF and NSFint exhibited the of DCs with a p38 MAPK inhibitor blocked CCR7-dependent phosphatase activity as rDUSP14 to degrade pNPP in vitro. DC migration.27 It is possible that the changes of DCs such as

Thus, the present studies indicated that NSFint is DUSP14 and costimulatory molecule expression, cytokine production and NSF is a dimer of DUSP14, and clarified for the first time that migration after hapten stimulation might be regulated by NSF a dual-specificity phosphatase exhibits a regulatory function (DUSP14) as a result of MAPKs inactivation via dephosphory- for the CHS response through DCs. lation in an autocrine/paracrine fashion. Western blot analysis revealed that rDUSP14 exists as the Multiple epicutaneous application of ovalbumin induces mixture of the monomer and the dimer in nonreducing con- strong IgE synthesis in mice.28 This evidence suggests that ditions and a reducing environment disrupted its dimeric proteins having large molecular weight can penetrate the skin state, suggesting that cysteine bonds play a role in the dimer barrier. In the present study, topical application of rDUSP14 formation of rDUSP14. In recent studies, it was shown that immediately after challenge suppressed the expression of CHS NSF is active in both the monomeric and dimeric states, in to TNCB and Ox dose dependently. It is possible that NSF contrast to a homodimeric enzyme ALP that is active only in (DUSP14) also penetrates the skin barrier and suppresses the the dimeric state.14,17,18 These results suggest that the switch activity of APCs such as Langerhans cells in the skin by the between the dimer and the monomer contributes to a poten- dephosphorylation of MAPKs activated by hapten. Thus, NSF tial self-regulation mechanism in the function of NSF (DUSP14) may become a useful therapeutic agent, as topical (DUSP14), although the minute mechanism is not known. application can protect its degradation by the enzymes.29 MAPK cascades control gene expression patterns in response NSF is selectively bound by DCs, internalized and released to extracellular stimuli.19 MAPK/ERK kinases (MEKs) activate for the second time after being cleaved in an energy- and MAPKs by phosphorylating them. Activated MAPKs, in turn, lysosome-dependent manner, although the binding sites on phosphorylate target transcription factors, and are deactivated the cell are not known.10 It is possible that NSF (DUSP14) by DUSPs/MKPs by dephosphorylation.20 DUSP14/MPK6 is a might associate with the lipid rafts, dynamic membrane type I dual-specificity MKP containing only a DSP domain.21 microdomains enriched in sphingolipids and cholesterol upon DUSP14 regulates CD28 signalling by interacting with the activation.30 In the raft-dependent pathway, internalized cargo cytoplasmic tail protein of CD28. As such, DUSP14 binding to is carried to lysosome-like compartments.31 Some molecules CD28 could allow localization to recently activated MAP kinases are also released in the extracellular medium via their associ- at the plasma membrane and subsequent inactivation before ation with lipid raft domains of the exosomal membrane.32 MAPK nuclear translocation. In peripheral blood T cells, For example, ALP is internalized by raft-dependent endocyto- DUSP14 is strongly upregulated by CD28 costimulation with sis, and released spontaneously to the extracellular medium in CD3 mAb plus CD28 mAb and acts as a negative regulator of an energy-dependent manner.33,34 IL-2 production. It appears likely that CD28 costimulation Lipid rafts play a central role in regulating signalling and with antigens occurs in hapten-specific T cells in mice treated intracellular trafficking. MAPK signalling is also associated with with hapten-conjugated cells, because the injection of hapten- lipid rafts.30 The integrity of lipid rafts in DCs is important conjugated cells induces the hapten-specific CHS.11 Thus, it is for antigen presentation to T cells.35 It is possible that NSF possible that DUSP14/MKP6 may be upregulated in effector T (DUSP14) may enter the membrane rafts on the activated DCs cells by the injection of hapten-conjugated cells, although its and suppress their APC activity by dephosphorylating the acti- release from these cells has not been detected. vated MAPKs, although the binding site of NSF (DUSP14) in Studies on the intracellular signalling mechanisms involved DCs has not been clarified as T cells.16 in DCs reported that contact sensitizers activate protein tyro- Even though DCs are well known for their capacity to sine kinases as an early molecular event in these cells.22 Tyro- induce immune responses, recent studies show that DCs are sine phosphorylation by activated protein tyrosine kinases involved in the negative regulation of immune responses.25,36 initiates MAPK signalling resulting in the activation and trans- Modulation by IL-10 results in DCs that are no longer capable location of p38 MAPK and ERK1/2 MAPKs.23–25 Thus, the of presenting antigens to induce immunity, but induce activation of p38 and ERK1/2 MAPKs by contact sensitizers antigen-specific anergy in both CD4+ and CD8+ T cells.37

The treatment of bone marrow-derived DCs with IL-10 ren- their factors with hapten-conjugated lymphoid cells. Immunology dered them suppressor cells for DTH, and the systemic injec- 1985; 54:297–305. tion of IL-10-treated DC-derived exosomes suppresses the 11 Nakano Y, Nakano K. Different cellular requirements for inducing contact sensitivity and non-specific unresponsiveness with hapten- onset of murine collagen-induced arthritis, although the enti- 38 conjugated lymphoid cells. Immunology 1985; 54:307–16. ties involved in the exosomes have not been identified. In 12 Nakano Y. Non-specific regulatory mechanism of contact sensitiv- the present system, injection of hapten-conjugated cells indu- ity: the requirement of intermediate cells for non-specific suppres- ces strong IL-10 mRNA expression parallel to NSF (DUSP14) sor factor (NSF) activity. Immunology 1988; 64:261–6. mRNA expression. Short-lived T cells are required for the 13 Mego JL. Role of thiols, pH and cathepsin D in the lysosomal cata- induction of the nonspecific unresponsive state for DTH by bolism of serum albumin. Biochem J 1984; 218:775–83. the injection of hapten-conjugated cells.11 It is possible that 14 Nakano Y. Non-specific regulatory mechanism of contact sensitivity: non-specific suppressor factor (NSF)-treated intermediate cells pro- some suppressor T cells releasing IL-10 may participate in the duce a second non-specific suppressor factor (NSFint). Cell Immunol induction of macrophage-like suppressor cells by the injection 1992; 143:357–67. of hapten-conjugated cells. However, the direct suppression of 15 Nakano Y, Hori S, Ihara M. Non-specific regulatory mechanism of the CHS responses by epicutaneous application immediately contact sensitivity: non-specific suppressor factor suppresses the after challenge suggests that NSF (DUSP14) could directly antigen-presenting activity of dendritic cells to induce contact sen- regulate the function of DCs related to the CHS responses. sitivity. Cell Immunol 1994; 158:228–40. Taken together, this report is the first evidence that 16 Marti F, Krause A, Post NH et al. Negative-feedback regulation of CD28 costimulation by a novel mitogen-activated protein kinase DUSP14, a member of the MAPK phosphatase family, could phosphatase, MKP6. J Immunol 2001; 166:197–206. be the nonspecific factor suppressing DTH and a phosphatase 17 Safadi A, Livne E, Reznick AZ. Characterization of alkaline and acid secreted by splenocytes after intravenous injection of hapten- phosphatases from skeletal muscles of young and old rats. Arch conjugated syngeneic cells. Further investigations on the Gerontol Geriatr 1997; 24:183–96. molecular dynamics of NSF (DUSP14) and its effects on the 18 Walchli S, Espanel X, van Huijsduijnen RH. Sap-1/PTPRH activity inflammatory diseases involving DTH is required for under- is regulated by reversible dimerization. Biochem Biophys Res Commun standing its regulatory roles in the body. MAPK signalling 2005; 331:497–502. 19 Bardwell AJ, Abdollahi M, Bardwell L. Docking sites on mitogen- contributes to a broad spectrum of inflammatory conditions. It activated protein kinase (MAPK) kinases, MAPK phosphatases and is possible that NSF (DUSP14) may suppress various types of the Elk-1 transcription factor compete for MAPK binding and are inflammatory cells and become a useful therapeutic agent for crucial for enzymic activity. Biochem J 2003; 15:1077–85. inflammatory diseases. 20 Dumont FJ, Staruch MJ, Fischer P et al. Inhibition of T cell activation by pharmacologic disruption of the MEK1/ERK MAP kinase or calcineurin signaling pathways results in differential modulation of References cytokine production. J Immunol 1998; 160:2579–89. 1 Saint-Mezard P, Berard F, Dubois B et al. The role of CD4+ and 21 Farooq A, Zhou MM. Structure and regulation of MAPK phos- CD8+ T cells in contact hypersensitivity and allergic contact phatases. Cell Signal 2004; 16:769–79. dermatitis. Eur J Dermatol 2004; 14:131–8. 22 Becker D, Valk E, Zahn S et al. Coupling of contact sensitizers to 2 Girolomoni G, Gisondi P, Ottaviani C et al. Immunoregulation of thiol groups is a key event for the activation of monocytes allergic contact dermatitis. J Dermatol 2004; 31:264–70. and monocyte-derived dendritic cells. J Invest Dermatol 2003; 120: 3 Szczepanik M, Bryniarski K, Tutaj M et al. Epicutaneous immuni- 233–8. zation induces alphabeta T-cell receptor CD4 CD8 double-positive 23 Brand P, Plochmann S, Valk E et al. Activation and translocation of non-specific suppressor T cells that inhibit contact sensitivity via p38 mitogen-activated protein kinase after stimulation of mono- transforming growth factor-beta. Immunology 2005; 115:42–54. cytes with contact sensitizers. J Invest Dermatol 2002; 119:99–106. 4 Brooks B, Parry H, Lawry J et al. Evidence that interleukin-4 sup- 24 Matos TJ, Duarte CB, Goncalo M et al. DNFB activates MAPKs and pression of lymphokine-activated killer cell induction is mediated upregulates CD40 in skin-derived dendritic cells. J Dermatol Sci through monocytes. Immunology 1992; 75:343–8. 2005; 39:113–23. 5 Epstein SP, Baer RL, Thorbecke GJ et al. Immunosuppressive effects 25 Takanami-Ohnishi Y, Amano S, Kimura S et al. Essential role of of transforming growth factor beta: inhibition of the induction of p38 mitogen-activated protein kinase in contact hypersensitivity. Ia antigen on Langerhans cells by cytokines and of the contact J Biol Chem 2002; 277:37896–903. hypersensitivity response. J Invest Dermatol 1991; 96:832–7. 26 Yamauchi A, Dai SY, Nakagawa R et al. Galectin-9 induces matur- 6 Gautam SC, Chikkala NF, Hamilton TA. Anti-inflammatory action ation of human monocyte-derived dendritic cells. Nihon Rinsho Meneki of IL-4. Negative regulation of contact sensitivity to trinitrochloro- Gakkai Kaishi 2005; 28:381–8. benzene. J Immunol 1992; 148:1411–15. 27 Wilflingseder D, Mullauer B, Schramek H et al. HIV-1-induced 7 Nakano Y. Antigenic competition in the induction of contact sensi- migration of monocyte-derived dendritic cells is associated with tivity in mice. Immunology 1977; 33:167–78. differential activation of MAPK pathways. J Immunol 2004; 8 Nakano K, Nakano Y. Suppressor cells in antigenic competition in 173:7497–505. contact allergy in mice. Immunology 1978; 34:981–7. 28 Nelde A, Teufel M, Hahn C et al. The impact of the route and fre- 9 Nakano Y, Nakano K. Induction of contact sensitivity and antigenic quency of antigen exposure on the IgE response in allergy. Int Arch competition by the intravenous administration of contact sensitizers. Allergy Immunol 2001; 124:461–9. Immunology 1981; 42:111–18. 29 Cross SE, Roberts MS. Physical enhancement of transdermal drug 10 Nakano Y, Nakano K. Non-specific regulatory mechanism of con- application: is delivery technology keeping up with pharmaceutical tact sensitivity: induction of macrophage-like suppressor cells and development? Curr Drug Deliv 2004; 1:81–92.

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 860 DUSP14/MKP6 as a nonspeciﬁc regulatory molecule for DTH, Y. Nakano

30 Kahya N, Brown DA, Schwille P. Raft partitioning and dynamic activated B cells. Kinetics and membrane anchor. J Immunol 1991; behavior of human placental alkaline phosphatase in giant 147:3690–5. unilamellar vesicles. Biochemistry 2005; 44:7479–89. 35 Poloso NJ, Roche PA. Association of MHC class II-peptide complexes 31 Sarnataro D, Grimaldi C, Pisanti S et al. Plasma membrane and lyso- with plasma membrane lipid microdomains. Curr Opin Immunol 2004; somal localization of CB1 cannabinoid receptor are dependent on 16:103–7. lipid rafts and regulated by anandamide in human breast cancer 36 Mahnke K, Enk AH. Dendritic cells: key cells for the induction cells. FEBS Lett 2005; 579:6343–9. of regulatory T cells? Curr Top Microbiol Immunol 2005; 293:133– 32 de Gassart A, Geminard C, Fevrier B et al. Lipid raft-associated pro- 50. tein sorting in exosomes. Blood 2003; 102:4336–44. 37 Jonuleit H, Schmitt E, Steinbrink K et al. Dendritic cells as a tool to 33 van der Luit AH, Budde M, Ruurs P et al. Alkyl-lysophospholipid induce anergic and regulatory T cells. Trends Immunol 2001; 22:394– accumulates in lipid rafts and induces apoptosis via raft-dependent 400. endocytosis and inhibition of phosphatidylcholine synthesis. J Biol 38 Kim SH, Lechman ER, Bianco N et al. Exosomes derived from Chem 2002; 277:39541–7. IL-10-treated dendritic cells can suppress inﬂammation and 34 Feldbush TL, Lafrenz D. Alkaline phosphatase on activated B cells collagen-induced arthritis. J Immunol 2005; 174:6440–8. characterization of the expression of alkaline phosphatase on

2007 The Author Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp848–860 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2006.07730.x Localized and generalized forms of blistering in junctional epidermolysis bullosa due to COL17A1 mutations in the Netherlands A.M.G. Pasmooij, H.H. Pas, G.H.L. Jansen,* H.H. Lemmink* and M.F. Jonkman Centre for Blistering Diseases, Departments of Dermatology, and *Genetics, University Medical Centre Groningen, University of Groningen, Hanzeplein-1, NL-9700 RB Groningen, the Netherlands

Summary

Correspondence Background Mutations in the gene COL17A1 coding for type XVII collagen cause Marcel F. Jonkman. non-Herlitz junctional epidermolysis bullosa (nH-JEB). E-mail: [email protected] Objectives Here we give an overview of the genotype-phenotype correlation in 12 patients from the Netherlands with type XVII collagen-deficient nH-JEB. Accepted for publication 2 October 2006 Patient and methods Family and personal history and clinical presentation were recorded from each patient, and skin biopsies of intact and bullous skin were taken Key words for immunofluorescence and electron microscopy. The mutations were identified COL17A1, deletion, genodermatosis, by analysing the patient’s DNA isolated from peripheral blood cells. nH-JEB Results DNA analysis identified five novel deletions: 1284delA, 1365delC, Conflicts of interest 3236delT, 3600–3601delCT and 4425delT. Interestingly, we identified a new None declared. patient, homozygous for 4425delT, with an exceptionally mild blistering phenotype. All together, three patients had more localized blistering confined to hands, lower legs and face, absent or very mild nail dystrophy, normal primary hair and sparse secondary hair. Nine patients had generalized blistering, nail dystrophy, sparse primary and absent secondary hair. All 12 patients had amelogenesis imperfecta (enamel pitting). Immunofluorescence (IF) antigen mapping with monoclonal antibodies 1A8C and 1D1 that bind to type XVII collagen, but not to its 97-kDa fragment was completely negative in patients with generalized blistering, whereas reduced in patients with localized blistering. Conclusions Our data reveal that in patients with COL17A1 mutations a localized nH-JEB phenotype can be differentiated from a generalized nH-JEB phenotype by IF antigen mapping. The data are important for genetic counselling at early age when the clinical phenotype is not yet clear.

About ten different genes expressed in the epidermal basement bullosa (GABEB). Mutations in the genes encoding the lamina membrane zone (BMZ) have now been discovered in which lucida/densa protein laminin 5 (LM-332: LAMA3, LAMB3, mutations lead to the genetic blistering disease epidermolysis LAMC2), and the hemidesmosomal proteins type XVII collagen bullosa (EB). This diverse group of inherited disorders is char- (COL17A1) and integrin a6b4(ITGA6, ITGB4) are associated acterized by fragility of the skin and mucous membranes. with JEB. Depending on the type and location of mutations, Based on the level of epidermal-dermal separation, EB is tradi- different mutations in the same gene may result in completely tionally divided into three main categories: simplex, junctional different phenotypes. Patients with mutations in COL17A1 are and dystrophic.1 In EB simplex the cleavage is within the basal clinically characterized by life-long blistering of skin and keratinocytes of the epidermis, whereas in junctional EB [JEB mucous membranes, universal alopecia, nail dystrophy and (MIM 226650, 226700)] the cleavage takes place within the amelogenesis imperfecta (enamel pitting).2–5 The disorder may lamina lucida. Two subtypes of JEB have been elucidated, affect the lifespan by the development of squamous cell carci- the more severe Herlitz type which is frequently lethal during noma.6 Even more, recently a patient with the homozygous the ﬁrst 2 years of life, and the less severe non-Herlitz subset, mutation 4144del4 was reported with a more severe course of previously known as generalized atrophic benign epidermolysis his disease.7 Despite good medical care, the newborn died

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 861 862 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al. shortly after birth. In contrast, COL17A1 mutations may also Monoclonal antibodies specific for type XVII collagen were: result in a milder phenotype accompanied with more localized 1A8C (epitope residues 155–163 in exon 8–9) (gift from blistering and alopecia to a lesser extent.8–11 Dr K. Owaribe)23 for the endodomain on the full length The COL17A1 gene spans 52 kb of the genome on the long polypeptide; NCC-Lu-226 (gift from Dr S. Hirohashi, Tokyo, arm of chromosome 10 (10q24Æ3).12,13 It comprises 56 Japan)24 and 233 (epitope residues 1118–1143 in exon exons, ranging in size from 27 to 390 bp. Type XVII collagen 48–49) (gift from Dr K. Owaribe)23 for the ectodomain on is a 1497 amino acid transmembrane protein and has a type II the shed LABD97, LAD-1 and the full length polypeptide; and orientation in which the N-terminus is cytoplasmic and the 1D1 (epitope residues 1357–1387 in exon 52) (gift from carboxyl-terminal end spans the lamina lucida outside the cell. Dr K. Owaribe)23 for the ectodomain on the full length poly- With the 15 collagenous regions (COL1–COL15), present in peptide and LAD-1. LAD-1 was specifically stained with 123 the ectodomain, three type XVII collagen molecules can form (gift from Dr P. Marinkovich, Stanford, CA, U.S.A.), 97–1 a triple helix on the basis of the Gly-X-Y repeating and 97–2 (gifts from Dr J. Zone, Salt Lake City, UT, U.S.A.). sequences.14,15 Through interactions with the hemidesmosome In combination with these primary mouse monoclonal anti- proteins plectin, BP230 and integrin a6b4, this homotrimeric bodies we used Alexa488-conjugated goat anti-mouse IgG macromolecule connects the keratin intermediate filament net- (Molecular Probes, Eugene, OR, U.S.A.) as the secondary step. work with the basement membrane compartment of the basal For the rat antibody GoH3 a goat anti-rat IgG antibody keratinocyte.16,17 The type XVII collagen ectodomain is pro- (Southern Biotechnology Associates, Birmingham, AL, U.S.A.) teolytically shed from the cell surface within the membrane was used as the secondary step. proximal 16th noncollagenous A (NC16A) domain (residues 490–566) as a 120 kDa soluble trimer,18,19 designated linear Identification of the mutations IgA disease antigen 1 (LAD-1). Subsequently, this LAD-1 can be cleaved to a second soluble form of 97 kDa, representing Immunofluorescent staining was deficient for type XVII colla- the linear IgA bullous disease antigen of 97 kDa (LABD97).20 gen and normal for laminin-332 in the described patients. The full length polypeptide consists of codons 1–1497, These IF results point to mutations in the COL17A1 gene and whereas the 120 kDa soluble LAD-1 comprises residues 524– not to mutations in the LAMA3, LAMB3 and LAMC2 genes. 1497 and LABD97 residues 531–1209.20,21 Therefore we performed mutation analysis solely on the Most of the 61 COL17A1 mutations reported thus far are COL17A1 gene. Genomic DNA was extracted from peripheral nonsense mutations and insertions or deletions, leading to blood. The COL17A1 gene (GenBank accession numbers premature termination codons (PTCs) and causing a pheno- U76564–U76604) was amplified using COL17A1-specific type with generalized blistering. In this study we correlated primers as described by Gatalica et al.,13 and all exons were phenotype to genotype in Dutch EB patients with mutations in sequenced. For exon 46, we used instead the sense primer COL17A1, who were referred to the Centre for Blistering Dis- 5¢-GTGCTTCAGGTCACCTCCGT-3¢ and the antisense primer eases in Groningen. Besides the identification of five novel 5¢-ACGAGGAGATGAGGCTCTGG-3¢. Amplification conditions deletions, we detected a new patient with COL17A1 mutations were 5 min at 94 C, followed by 35 cycles at 94 C for resulting in a very mild form of the disease. Furthermore, we 45 s, 60 Cor55C for 45 s and 72 C for 45 s and a final could distinguish with immunofluorescence (IF) a phenotype extension at 72 C for 7 min. The COL17A1 mutations were with localized blistering (localized nH-JEB) from a phenotype numbered according to Giudice et al.12 with more severe, generalized blistering (generalized nH-JEB). RNA analysis Materials and methods To determine the effect of the 4425delT mutation on the mRNA, RNA was analysed from a nonlesional skin sample of Immunomorphological techniques the upper arm of patient EB 168–01. Four cryosections of Punch biopsies were taken from lesional and nonlesional skin, 10 lm thickness were cut and transferred with a sterile needle and prepared for immunofluorescence microscopy (IFM) and into lysis buffer (Stratagene Europe, Heidelberg, Germany). electron microscopy (EM) as previously described.22 Informed RNA was isolated according to the accompanied Absolutely consent was given for all biopsies. All monoclonal antibodies RNA Microprep Kit protocol (Stratagene Europe) and eluted have been described previously. Pankeratin stained with CK1 with 15 lL, instead of the 30 lL elution buffer advised, to (DAKO, Glostrup, Denmark), keratin 14 with LL001 (gift get a more concentrated sample of RNA. Afterwards cDNA ) from Dr B. Lane, Dundee, U.K.), plectin with HD121 (gift was synthesised. In short, to 11 lL RNA, 1 lL 10 mmol L 1 from Dr K. Owaribe, Nagoya, Japan), integrin a6 with dNTP mix and 1 lL random primers (Invitrogen, Breda, The GoH3, integrin b4 with 58XB4 (gifts from Dr A. Sonnen- Netherlands) were added. The mixture was incubated at 65 C berg, Amsterdam, the Netherlands), uncein with 19-DEJ-1 for 5 min and then transferred to ice. After cooling down the ) (gift from Dr J-D. Fine, Nashville, TX, U.S.A.), LM-332 with sample, 4 lL5· first strand buffer, 1 lL0Æ1 mol L 1 DTT, GB3 (gift from Dr G. Meneguzzi, Nice, France), and type VII 1 lL Superscript III reverse transcriptase and 1 lL RnaseOUT collagen with LH7:2 (gift from Dr I. Leigh, London, U.K.). (all Invitrogen) were added. Then, incubation was at 25 C

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al. 863 for 5 min, 50 C for 60 min and 70 C for 15 min. From this cDNA sample 10 lL was used in a PCR reaction with primers F4337 5¢-GCATCAGCAAGGTCTTCTCT-3¢ and R4598 5¢-CAC-

GGCTTGACAGCAATACT-3¢ in a final volume of 50 lL. For 27 27 36,37 27 25 37 26 the nested PCR, primers were also used that annealed to exon 53 and exon 56 for the forward and reverse respectively. Of y hair; 4, normal the PCR product of the first PCR, 1 lL was used for the second PCR with primers F4367 5¢-CGGACCTCATGGACTTCTTC- 3¢ and R4596 5¢-CGGCTTGACAGCAATACTTC-3¢ in a final volume of 50 lL. The amplification product was analysed by 4% agarose gel electrophoresis and sequenced. p.G1109fsX21 Consequences References Results T p.G746fsX52/p.R1226X T p.D534fsX18/p.R1226X Patients included from former studies T p.G746fsX52/p.R1226X This article fi fi fi

The diagnosis was established in each patient on the basis of clinical findings, IF antigen mapping and EM. The clinical COL17A1 allele 2 characteristics of seven patients, EB 011–01, EB 025–01, EB C c.3432delT In-frame skip/p.G1109fsX21 fi T c.4424–5insC p.R1226X /p.P1440fsX14 T c.3432delT p.Q751X (in-frame skip)/ fi 026–01, EB 035–02, EB 086–01, EB 093–01 and EB 098–01 fi (Table 1), have been previously described in several articles. Patient EB 035–01 displayed the same clinical and cellular COL17A1 allele 1 DNA phenotype as his affected brother EB 035–02. In addition EB 035–01 had pretibial ulcers because of recurrent blistering. Interestingly, due to the presence of in-frame exon skipping in patients EB 086–0125 and EB 098–0126 slightly smaller type Blister level XVII collagen was produced. In both patients the blistering Deceased. was less severe and more confined to hands, lower legs and face than is normally seen in patients with type XVII collagen deficiency. Primary hair on the scalp, face and body was normal, whereas secondary hair was not yet developed or was lacking in the axillae and pubis. Remarkably, two epitopes 233, NCC-Lu-226 1D1 1A8C and 1D1 were not completely absent in these patients: mutations from the Netherlands a epitope 1A8C is specific for the full length, whereas epitope

1D1 recognizes the full length and the 120 kDa LAD-1, but COL17A1 1A8C Staining not the 97 kDa fragment. Here, we identify four new patients b with type XVII collagen deﬁciency: EB 084–01, EB 117–01, EB 134–01 and EB 168–01. Alopecia a Patient EB 084–01 pos 3pos pos/neg pos/red 2 pos/neg Junctional pos/neg c.1706delA pos/red c.3781C pos/neg Junctional c.3781C A 7-year-old boy, patient EB 084–01, was the child of healthy Atrophic scarring nonconsanguineous parents and the ﬁrst case of EB in the

family. The parents showed normal toenails and teeth. Since 1, normal primary hair and sparse/absent secondary hair; 2, sparse primary hair and absent secondary hair; 3, absent primary hair and absent secondar b birth the patient had blisters after minor trauma. Generalized bullae and erosions mostly without milia were present. Some- revertant mosaic revertant mosaic Generalized pos 3 neg red neg Junctional c.2342delG c.2342delG p.G746fsX52/p.G746fsX52 times blisters occurred in the mouth as well. Eyelashes, eye- Generalized, brows and scalp hair were present, although the latter was reduced. Some ﬁngernails were dystrophic and two were absent. No abnormalities of the eyes and nose were observed. (myocard (liver (SCC)/F Severe generalized pos 3 neg neg neg Junctional c.3236delC c.3236delC p.P1044fsX21/p.P1044fsX21 This article EM as well as IFM revealed a junctional blister. Staining with infarct)/M carcinoma)/M monoclonal antibodies against type XVII collagen, LAD-1 and Current age/sex Blistering LABD97 was all completely negative (1A8C, 1D1, NCC- Lu-226, 123 and 97–2). This is remarkable, since in our Non-Herlitz junctional epidermolysis bullosa (nH-JEB) patients with

experience most 1A8C/1D1-negative patients with a general- neg, negative; red, reduced; pos, positive. EB 011–01 43 EB 035–02 46/M Generalized pos 3 neg red neg Junctional c.2342delG c.3781C primary hair and secondary hair not present yet; 5, sparse primary hair and secondary hair not present yet. Patient EB 025–01EB 026–01 54/F 46/FEB 035–01 47/MEB 084–01EB 086–01 Generalized 7/MEB 093–01 Generalized, 6/F 75 EB Generalized 098–01 pos 40/MEB 117–01 GeneralizedEB 134–01 43 pos Mild 3EB localized 168–01 3/M 38/Ma pos Mild localized 3 neg neg neg 5 Generalized 4 Mild localized neg red 1 neg neg neg red red neg neg 1 red 4 red neg Junctional red c.2342delG red neg neg Junctional red c.2342delG c.2342delG red red Junctional red Simplex c.1284delA c.3781C p.G746fsX52/p.G746fsX52 c.1877–2A Junctional c.3432delT neg red c.2356C Junctional Junctional p.Q393fsX9/p.G1109fsX21 c.1365delC c.4425delT This article c.3600–3601delCT c.4425delT p.T420fsX72/p.L1165fsX6 This article p.P1440fsX71/p.P1440fsX71 This article

ized blistering phenotype have residual binding of the 233 Table 1

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 864 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al. and NCC-Lu-226 antibodies. Subsequently, sequencing of completely absent (Fig. 2b). Staining of LM-332 and type VII COL17A1 revealed the compound heterozygous presence for a collagen was normal. Mutation detection analysis showed the novel paternal deletion in exon 15, 1284delA, and the known homozygosity of patient EB 117–01 for a novel deletion in Dutch mutation, 3432delT in exon 48 of the maternal allele exon 46, 3236delC, of COL17A1. The deletion leads to a in proband EB 084–01. The deletion of A at position 1284 frameshift, concluding with a PTC at amino acid position results in a novel sequence beginning at amino acid 394 and 1065. concluding in a PTC at position 402. Patient EB 134–01 Patient EB 117–01 This patient, a 3-year-old boy, was the first and only child of Patient EB 117–01 was a 43-year-old woman, who had devel- healthy nonconsanguineous parents. There was no family his- oped blisters after minor trauma since birth. She had had three tory of blistering diseases. Since birth, blisters and erosions brothers of whom two had a blistering disease and died during occurred after minor friction on the hands, feet, lower legs, the first year of their lives. Her consanguineous parents were buttocks and face. The finger nails were intact and the hair not affected. Physical examination showed erosive areas with was still normal. Enamel abnormalities of the teeth occurred blisters and erythema on the face, lower legs, knees, and the first at the age of 3 years. IF antigen mapping showed a junc- extensor surfaces of the elbows and lower arms (Fig. 1a–c). tional blister, with keratin exclusively in the blister roof (CK1) A few fingernails were absent (Fig. 1a), and the small toe- and LM-332 (GB3) and type VII collagen (LH7:2) in the blis- nails were either dystrophic or absent. Sometimes, blisters ter floor. Staining with monoclonal antibodies 1A8C and 1D1 occurred in the mouth. The patient had universal alopecia was negative in an intact skin sample from the upper leg. without scarring; vellus hair, eyelashes, eyebrows and second- Staining with monoclonal antibodies NCC-Lu-226 and 233, ary hair were all almost completely absent (Fig. 1c). The binding to all three forms of type XVII collagen i.e. 180-kDa, teeth, already small and brown at the age of 14, had been 120-kDa and 97-kDa, was strongly reduced (Fig. 2c). Normal extracted. In 2001 three squamous cell carcinomas (SCC) staining was observed for LM-332, type VII collagen, plectin developed on the right knee, an area which was prone to blis- (HD121) and integrin a6b4 (58XB4, GoH3). DNA analysis of ter formation (Fig. 1d). The lesions were excised, but one COL17A1 showed the compound heterozygosity in this year later a metastasis was detected in a lymph node on the patient’s DNA for a paternal mutation in exon 16, 1365delC, right upper leg. The patient refrained from further treatment and a maternal mutation, 3600–3601delCT in exon 49. The and died in June 2003. EM and IFM showed a lamina lucida deletion of the C at position 1365 leads to a frameshift begin- level of blister formation. Like patient EB 084–01, in a healthy ning at amino acid 420, and resulting in a missense stretch of skin sample all epitopes of type XVII collagen, LAD-1 and 71 residues and finally a PTC at position 492. Also, the 3600– LABD97 (1A8C, 1D1, 233, NCC-Lu-226, 123, 97–1) were 3601delCT concludes in a PTC, at position 1171.

(a) (c) (d)

(b)

Fig 1. Generalized non-Herlitz junctional epidermolysis bullosa (generalized nH-JEB) phenotype of patient EB 117–01. Generalized blistering on the right hand (a), chest (b), scalp and face (c) and legs (d). Three ﬁnger nails were absent on the right hand (a). Universal alopecia on the scalp and face (c). At the age of 41 years developed a squamous cell carcinoma on the right knee (d).

(a) (b)

Fig 2. Type XVII collagen is reduced in patient skin compared with control (a). Expression of the NCC-Lu-226 epitope is absent in the skin of patient EB 117–01 (b) and strongly reduced in the skin of patient EB 134–01, (c). In contrast, the skin of patient EB 168–01 with a phenotype with mild localized blistering shows only a slightly reduced staining of NCC-Lu-226 as does healthy nonlesional skin, (d).

also normal, although the diameter of the hemidesmosomes Patient EB 168–01 was slightly reduced (mean diameter 178 nm) (Fig. 4). IF Index patient EB 168–01, a 38-year-old man, born in a antigen mapping of healthy rubbed skin showed a split level remote village in the Kurdish area in Turkey, was the child of high in the lamina lucida. Healthy nonlesional skin showed healthy consanguineous parents. A 21-year-old cousin of his reduced expression and loss of lateral staining of the 1A8C and father’s family was affected, whereas his children were clinic- 1D1 epitopes of type XVII collagen. Staining of NCC-Lu- ally healthy. Blistering was very mild and localized, conﬁned 226 and 233 was only slightly reduced (Fig. 2d), both apical- to the hands, feet and face (Fig. 3a,b). It was even possible lateral and along the epidermal BMZ. Plectin (Mab HD121) for him to run for seven kilometres without developing blis- and integrin a6b4 (Mabs GoH3 and 58XB4) stained with nor- ters on the feet. The blisters healed with hyperpigmentation mal pattern and intensity as normal human control skin. Since without milia. The toenails were slightly dystrophic, and his the parents of patient EB 168–01 were second cousins, it was ﬁngernails showed subungual hyperkeratosis. Primary hair on not surprising that COL17A1 mutation analysis disclosed the the scalp, face and body was normal (Fig. 3c,d), whereas the same deletion of a T at position 4425 in exon 54 on both alle- secondary hair in the axillae and pubis was sparse. The les. This mutation results in a frameshift with the introduction mucous membranes were not involved. The dental enamel of a terminal missense stretch of 69 amino acids starting after was hypoplastic and showed pits (Fig. 3e). Ultrastructural glycine at position 1441. In the wild-type protein only 56 examination revealed a subepidermal blister in a skin speci- amino acids are present after glycine-1441. To exclude the men of the hand with the cleavage plane underneath the basal possibility of skipping of the 62 bp (63 in the wild type) cell layer, in accordance with a lucidolytic split. In another mutation-bearing exon 54, RNA was isolated from cryosections biopsy specimen of healthy skin of the upper arm all struc- of the nonlesional skin biopsy of the upper arm. cDNA was tures of the BMZ were normal. The number and structure of synthesised, followed by nested PCR with forward primers the hemidesmosomes including the sub-basal dense plate was located in exon 53 and reverse primers in exon 56. On agarose

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 866 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al.

(a) (c) (d)

(b) (e)

Fig 3. Localized non-Herlitz junctional epidermolysis bullosa (localized nH-JEB) phenotype of patient EB 168–01. (a) Right hand shows mild localized blistering. Also visible is the normal hair pattern on the arm (a), scalp and face (c), and chest (d). Toenails were slightly dystrophic (b). Teeth enamel showed dental pitting (e).

2AfiC and 3432delT, were already detected in 2000. The (a) (b) fathers of EB 084–01 and EB 086–01 did not show any clinical abnormalities of skin, teeth, nails and hair. Staining for the endodomain (1A8C) was reduced in basal and first suprabasal keratinocytes (Fig. 5a,b) in the biopsy of the father of patient EB 084–01 (carrier of 1284delA). The C-terminal part of the ectodomain of type XVII collagen (1D1) showed reduced staining apical-laterally of the basal cells (Fig. 5c,d). The IF staining of type XVII collagen in the normal skin of the father of patient EB 086–01, carrier of the splice-site mutation 1877–2AfiC,25 resembled the data of the father of patient EB Fig 4. Electron microscopy of healthy skin of patient EB 168–01 084–01. shows hemidesmosomes with normal attachment plaques and normal sub-basal dense plates (a). Compared with normal human control skin (b) obtained from the same skin site the diameter of Discussion hemidesmosomes is only slightly reduced. In this overview of all known 12 Dutch EB patients with type XVII collagen deficiency due to COL17A1 mutations we gel no smaller fragments than the expected 220 bp amplicon describe five new deletion mutations. The novel mutations were present. Sequencing of this amplicon showed the deletion found in this study are located in exons coding for the intra- of nucleotide 4425 in the mRNA. The function of the type cellular domain (1284delA in exon 15 and 1365delC in exon XVII collagen polypeptide produced was apparently slightly 16) and the ectodomain (3236delC in exon 46, 3600– impaired by the aberrance of the NC1 tail domain. 3601delCT in exon 49 and 4425delT in exon 54). These five new deletions in the COL17A1 gene bring the total number of described mutations to 66 (Fig. 6). The mutations 2342delG, Healthy fathers of patients EB 084–01 and EB 086–01 3432delT and 3781CfiT (R1226X) occur more frequently in In addition to the patients skin, biopsy specimens of the skin the Dutch population. All were present in three unrelated of the upper arm of two fathers were also investigated. The patients (Table 1). Microsatellite analysis has previously shown biopsy of the father of EB 084–01 was taken simultaneously a founder effect for 2342delG.27 Most likely the mutations with the biopsy of his son in 1999. The IF antigen mapping 3432delT and 3781CfiT also represent founder effects. Of all of the father of patient EB 086–01 was conducted in 2001, mutations reported thus far, a large percentage (68%) com- 3 years later than that of his daughter in 1999. In case of the prise nonsense mutations and deletions or insertions resulting father of EB 084–01 IF was performed before the mutations in PTCs. Furthermore, nine missense mutations are included were identified, in contrast to the IF of the father of EB 086– of which four are located in the largest collagenous domain, 01. In the DNA of EB 086–01 the COL17A1 mutations, 1877– COL15.28–30 The preservation of Gly in every third position of

(a) (b)

Fig 5. Reduced brightness and altered distribution of type XVII collagen in heterozygous carriers of a recessive COL17A1 mutation. The cytoplasmic staining of basal and ﬁrst suprabasal cells by monoclonal antibody 1A8C was reduced in the skin of father of patient EB 084–01 (a) compared with the control (b). Staining with monoclonal 1D1 speciﬁc for the extracellular tail of type XVII collagen was reduced apical-laterally of the basal cells (c) compared to normal control skin (d).

the amino acid sequence (Gly-X-Y)n is required for the forma- domain is not essential for trimer formation. In accordance, tion of the collagen triple helix structure. Destabilization of Areida et al.33 already showed that the formation of the triple this motif through a missense mutation leading to the replace- helix proceeds in an N- to C-terminal direction. Also import- ment of one Gly will affect the interaction between the ant in this mild phenotype is that despite the 4425delT muta- a-chains. If protein is formed with such a mutation a domin- tion wild-type LABD97 can be produced, and although its ant negative effect can be expected. Evidence for this is found precise function is unclear, it almost certainly is involved in in dental abnormalities such as amelogenesis imperfecta, epidermal-dermal adhesion. Similarly, in another patient with observed in carriers of missense mutations G609D, G612R a homozygous mutation in exon 54, 4410–4413dupCATT, and G627V.28,30 In our population, even though the fathers of reduced IF staining of type XVII collagen was also observed.34 patients EB 084–01 and EB 086–01 showed an aberrant In contrast to 4425delT, this mutation leads to a prematurely immunofluorescent pattern and amelogenesis imperfecta has terminated collagen XVII protein lacking the 43 most been described in carriers of R1226X31 and 823delA,32 no C-terminally located amino acids. dental abnormalities were detected after careful examination In the previously published Dutch patients, EB 086–01 and in any of the carriers of COL17A1 mutations seen among our EB 098–01, an aberrant type XVII collagen protein was also 12 cases. Dental defects however are obligate in type XVII col- formed. In patient EB 086–01 the 1877–2AfiC mutation lagen-deficient patients with a mild form of the disease resulted in aberrant splicing and consequently the production (Fig. 3e). of two in-frame transcripts.25 In case of the 2356CfiT Furthermore, we identified a third patient with a clinically (Q751X) transition in patient EB 098–01, type XVII collagen mild phenotype. Patient EB 168–01 was of Kurdish birth and was rescued by deleting the PTC-containing exon 30.26 homozygous for a novel deletion in exon 54, 4425delT, in Accordingly, in both cases a smaller type XVII collagen protein the first collagenous domain. This frameshift mutation changes with a deletion in the 15th collagenous domain could be the most C-terminal 56 amino acids present in the wild-type detected. protein into a missense stretch of 69 amino acids. The pheno- More patients with mild phenotypes have been reported. type was extremely mild indicating that the first collagenous For instance, Huber et al.11 described a proband heterozygous

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 868 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al.

Fig 6. Schematic representation of type XVII collagen and the COL17A1 gene with the identified mutations. The protein consists of three domains, an intracellular domain of 466 residues (green), a transmembrane domain of 23 amino acids (red) and an extracellular tail of 1008 residues with fifteen interrupted collagenous domains (blue) and sixteen noncollagenous domains (yellow). The COL17A1 gene encoding this protein, depicted above, contains 56 exons. All COL17A1 mutations found so far are indicated. The mutations in red are COL17A1 mutations that were identified in patients with EB in the Netherlands. The novel deletions are boxed. The epitopes of the different monoclonals are indicated with arrows.

for a large in-frame deletion in the intracellular domain of classical generalized form naming it localized non-Herlitz type XVII collagen extending from intron 2 to intron 15 junctional epidermolysis bullosa. (158del1172; I18del389) and a nonsense mutation in exon We could delimit this clinically milder, localized nH-JEB 51 (R1226X). The patient had predominant features of EBS. phenotype from the more severe generalized nH-JEB pheno- Another mild phenotype, found in six Italian families, due type by reduced expression of the 1A8C and 1D1 epitopes of to the in-frame deletion of a part of the protein was repor- type XVII collagen (Table 1). If type XVII collagen staining ted by Ruzzi et al.10 Blistering was strictly limited to trauma with 1A8C and 1D1 is reduced due to COL17A1 mutations sites and oral mucosal lesions were rare.9 The unusually mild then the patients will have normal primary hair and sparse phenotype was also deducible from the lack of alopecia in secondary hair, whereas the patients with lack of staining of two individuals. The nonsense mutation R795X in exon 33 the antibodies 1A8C and 1D1 due to COL17A1 mutations will caused skipping of the mutation-bearing exon, leading to a have sparse primary and absent secondary hair. Moreover, this slightly smaller type XVII collagen protein. The occurrence of study found altered IF antigen mapping in asymptomatic het- a missense mutation may also result in a mild localized phe- erozygous carriers of COL17A1 mutations. Specifically, the type notype, with predominantly acral blistering and normal hair, XVII collagen epitopes 1A8C and 1D1 were reduced in the as observed in a patient homozygous for the R1303Q muta- skin of the carriers. We suggest that this can be explained by tion.8 Moreover, a patient with mild mucosal lesions and different expression levels in the skin of respectively the full lack of hair involvement was reported by Guerriero et al.35 length type XVII collagen and its processed forms LAD-1 and Alopecia was completely absent and secondary hair was nor- LABD97. The first sign of reduced expression is decreased mal in this man. Seemingly, the degree of skin, mucous staining of the 1A8C epitope, which denotes loss of the full membranes and hair involvement can vary considerably length molecule. As the reduction becomes more severe the between patients with type XVII collagen deficiency. Consid- 1D1 epitope, synonymous with both the full-length molecule ering the difference in clinical severities, we would like to and the 120 kDa LAD-1, is also lost. Finally, the 233 epitope, suggest distinguishing this more localized form from the present on all three forms, disappears. Apparently LABD97,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al. 869 which is deposited in the lamina lucida, is present as the 7 Abu Sa’d J, Indelman M, Pfendner E et al. Molecular epidemiology major form. Interestingly, the staining of the lateral cell bor- of hereditary epidermolysis bullosa in a middle eastern population. ders is more influenced by the lower polypeptide production J Invest Dermatol 2006; 126:777–81. 8 Schumann H, Hammami-Hauasli N, Pulkkinen L et al. Three than the staining of the epidermal-dermal junction. Previously novel homozygous point mutations and a new polymorphism in Pasmooij et al. also reported reduced expression of the 1D1 the COL17A1 gene: relation to biological and clinical phenotypes 32 epitope in heterozygous carriers of the 823delA mutation. of junctional epidermolysis bullosa. Am J Hum Genet 1997; 60: In contrast to the heterozygous carriers described in this study, 1344–53. these individuals had dental abnormalities. As a side observa- 9 Mazzanti C, Gobello T, Posteraro P et al. 180-kDa bullous pemphi- tion this study also reveals that monoclonal antibodies 233 goid antigen defective generalized atrophic benign epidermolysis and NCC-Lu-226 do not cross-react with other polypeptides, bullosa: report of four cases with an unusually mild phenotype. Br J Dermatol 1998; 138:859–66. and that the residual staining of 233 and NCC-Lu-226 in 10 Ruzzi L, Pas H, Posteraro P et al. A homozygous nonsense mutation absence of staining with other monoclonals indeed reflects in type XVII collagen gene (COL17A1) uncovers an alternatively type XVII collagen protein product. spliced mRNA accounting for an unusually mild form of non- In summary, we investigated 12 patients from the Nether- Herlitz junctional epidermolysis bullosa. J Invest Dermatol 2001; lands with mutations in COL17A1. On basis of IFM with 116:182–7. monoclonals 1A8C and 1D1 directed against type XVII colla- 11 Huber M, Floeth M, Borradori L et al. Deletion of the cytoplasmatic gen, a localized EB phenotype could be distinguished from a domain of BP180/collagen XVII causes a phenotype with predominant features of epidermolysis bullosa simplex. J Invest Dermatol generalized EB phenotype, thereby making it possible to pre- 2002; 118:185–92. dict the clinical phenotype at early age. Our data underscores 12 Giudice GJ, Emery DJ, Diaz LA. Cloning and primary structural once more the prognostic importance of IF antigen mapping analysis of the bullous pemphigoid autoantigen BP180. J Invest in predicting the severity of the disease. Dermatol 1992; 99:243–50. 13 Gatalica B, Pulkkinen L, Li K et al. Cloning of the human type XVII collagen gene (COL17A1), and detection of novel mutations in gen- Acknowledgments eralized atrophic benign epidermolysis bullosa. Am J Hum Genet 1997; 60:352–65. The authors thank the families with EB for their participation. 14 Hirako Y, Usukura J, Nishizawa Y, Owaribe K. Demonstration of Technical assistance with IFM of Gonnie Meijer and Janny the molecular shape of BP180, a 180-kDa bullous pemphigoid Zuiderveen is gratefully acknowledged. We thank Dr Tesshi antigen and its potential for trimer formation. J Biol Chem 1996; Yamada and Professor Setsuo Hirohashi for the generous gift 271:13739–45. of the anti-type XVII collagen monoclonal antibody, NCC- 15 Pas HH, Kloosterhuis GJ, Nijenhuis M et al. Type XVII collagen Lu-226, and Professor Katushi Owaribe for the monoclonal (BP180) and LAD-1 are present as separate trimeric complexes. antibodies 1A8C, 1D1, and 233. [Additional information J Invest Dermatol 1999; 112:58–61. 16 Hopkinson SB, Baker SE, Jones JC. Molecular genetic studies of added after online publication 1st February 2007: Part of this human epidermal autoantigen (the 180 kD bullous pemphigoid work was supported by the European GENESKIN coordinated antigen/BP180): identification of functionally important seq- action (LSHM-CT-2005-512117).] uences within the BP180 molecule and evidence for an interaction between BP180 and alpha 6 integrin. J Cell Biol 1995; 130:117–25. References 17 Koster J, Geerts D, Favre B et al. Analysis of the interactions 1 Fine JD, Eady RA, Bauer EA et al. Revised classification system for between BP180, BP230, plectin and the integrin alpha6beta4 im- inherited epidermolysis bullosa: Report of the Second International portant for hemidesmosome assembly. J Cell Sci 2003; 116:387–99. Consensus Meeting on diagnosis and classification of epidermolysis 18 Pas HH, Kloosterhuis GJ, Heeres K et al. Bullous pemphigoid and bullosa. J Am Acad Dermatol 2000; 42:1051–66. linear IgA dermatosis sera recognize a similar 120-kDa keratinocyte 2 Hintner H, Wolff K. Generalized atrophic benign epidermolysis collagenous glycoprotein with antigenic cross-reactivity to BP180. bullosa. Arch Dermatol 1982; 118:375–84. J Invest Dermatol 1997; 108:423–9. 3 McGrath JA, Gatalica B, Christiano AM et al. Mutations in the 180- 19 Franzke CW, Tasanen K, Borradori L et al. Shedding of collagen kD bullous pemphigoid antigen (BPAG2), a hemidesmosomal XVII/BP180: structural motifs influence cleavage from cell surface. transmembrane collagen (COL17A1), in generalized atrophic benign J Biol Chem 2004; 279:24521–9. epidermolysis bullosa. Nat Genet 1995; 11:83–6. 20 Zone JJ, Taylor TB, Meyer LJ, Petersen MJ. The 97 kDa linear IgA 4 Jonkman MF, de Jong MCJM, Heeres K et al. Generalized atrophic bullous disease antigen is identical to a portion of the extracellular benign epidermolysis bullosa: either 180-kd bullous pemphigoid domain of the 180 kDa bullous pemphigoid antigen, BPAg2. J Invest antigen or laminin-5 deficiency. Arch Dermatol 1996; 132:145–50. Dermatol 1998; 110:207–10. 5 Pohla-Gubo G, Lazarova Z, Giudice GJ et al. Diminished expression 21 Hirako Y, Nishizawa Y, Sitaru C et al. The 97-kDa (LABD97) and of the extracellular domain of bullous pemphigoid antigen 2 120-kDa (LAD-1) fragments of bullous pemphigoid antigen 180/ (BPAG2) in the epidermal basement membrane of patients with type XVII collagen have different N-termini. J Invest Dermatol 2003; generalized atrophic benign epidermolysis bullosa. Exp Dermatol 121:1554–6. 1994; 199–206. 22 Jonkman MF, de Jong MCJM, Heeres K et al. 180-kD bullous pem- 6 Weber F, Bauer JW, Sepp N et al. Squamous cell carcinoma in junc- phigoid antigen (BP180) is deficient in generalized atrophic benign tional epidermolysis bullosa. Acta Derm Venereol 2001; 81:189–92. epidermolysis bullosa. J Clin Invest 1995; 95:1345–52.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 870 COL17A1 mutations in the Netherlands, A.M.G. Pasmooij et al.

23 Di Zenzo G, Grosso F, Terracina M et al. Characterization of the 30 Vaïsa¨nen L, Has C, Franzke C et al. Novel glycine substitutions in anti-BP180 autoantibody reactivity profile and epitope mapping in the largest collagenous domain Col15 decrease the thermal stability bullous pemphigoid patients. J Invest Dermatol 2004; 122:103–10. of collagen XVII. J Invest Dermatol 2005; 125:1112–8. 24 Yamada T, Endo R, Tsukagoshi K et al. Aberrant expression of 31 Floeth M, Bruckner-Tuderman L. Digenic junctional epidermolysis a hemidesmosomal protein, bullous pemphigoid antigen 2, in bullosa: mutations in COL17A1 and LAMB3 genes. Am J Hum Genet human squamous cell carcinoma. Lab Invest 1996; 75:589–600. 1999; 65:1530–7. 25 Pasmooij AMG, van der Steege G, Pas HH et al. Features of epi- 32 Pasmooij AMG, Jonkman MF, Pas HH et al. Dental abnormalities in dermolysis bullosa simplex due to mutations in the ectodomain of heterozygous carriers of the COL17A1:823delA mutation in a family type XVII collagen. Br J Dermatol 2004; 151:669–74. with non-Herlitz junctional EB. J Eur Acad Dermatol Venereol 2005; 19 26 Pasmooij AMG, van Zalen S, Nijenhuis AM et al. A very mild form (Suppl. 2):12. of non-Herlitz junctional epidermolysis bullosa: BP180 rescue by 33 Areida SK, Reinhardt DP, Muller PK et al. Properties of the collagen outsplicing of mutated exon 30 coding for the COL15 domain. type XVII ectodomain. Evidence for n- to c-terminal triple helix Exp Dermatol 2004; 13:125–8. folding. J Biol Chem 2001; 276:1594–601. 27 Scheffer H, Stulp RP, Verlind E et al. Implications of intragenic mar- 34 Franzke CW, Has C, Schulte C et al. The laminin 5-binding ker homozygosity and haplotype sharing in a rare autosomal reces- domain of BP180/collagen XVII is important for structural integ- sive disorder: the example of the collagen type XVII (COL17A1) rity and adhesive functions. J Invest Dermatol 2004; 123:A15 locus in generalized atrophic benign epidermolysis bullosa. Hum [Abstract]. Genet 1997; 100:230–5. 35 Guerriero C, De Simone C, Venier A et al. Non-Herlitz junctional 28 McGrath JA, Gatalica B, Li K et al. Compound heterozygosity for a epidermolysis bullosa without hair involvement associated with dominant glycine substitution and a recessive internal duplication BP180 deficiency. Dermatology 2001; 202:58–62. mutation in the type XVII collagen gene results in junctional epi- 36 Jonkman MF, Scheffer H, Stulp R et al. Revertant mosaicism in epidermolysis bullosa and abnormal dentition. Am J Pathol 1996; dermolysis bullosa caused by mitotic gene conversion. Cell 1997; 148:1787–96. 88:543–51. 29 Tasanen K, Floeth M, Schumann H et al. Hemizygosity for a glycine 37 Pasmooij AMG, Pas HH, Deviaene FC et al. Multiple correcting substitution in collagen XVII: unfolding and degradation of the COL17A1 mutations in patients with revertant mosaicism of epi- ectodomain. J Invest Dermatol 2000; 115:207–12. dermolysis bullosa. Am J Hum Genet 2005; 77:727–40.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp861–870 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2006.07744.x Squamous cell carcinoma of the nail apparatus: clinicopathological study of 35 cases S. Dalle,* L. Depape, A. Phan,* B. Balme,* S. Ronger-Savle* and L. Thomas* *Service de Dermatologie and Service d’Anatomie Pathologique, Hoˆpital de l’Hoˆtel-Dieu, 1 place de l’hoˆpital, 69288 Lyon cedex 02, France

Summary

Correspondence Background Subungual squamous cell carcinoma (SCC) is rare. Its diagnosis is often Ste´phane Dalle. missed or delayed because the clinical presentation is often atypical and can E-mail: [email protected] mimic other conditions such as verruca vulgaris, onychomycosis, trauma-induced nail dystrophy or exostosis. Accepted for publication 7 November 2006 Objectives To define the different clinical presentations and the main pathological features and to evaluate the most appropriate surgical management of subungual Key words SCC. nail, squamous cell carcinoma, subungual Methods A retrospective review of all the cases of subungual SCC seen in our institution over a 5-year period. Conflicts of interest Results Thirty-five cases were selected. The spectrum of the clinical features None declared. encountered was extremely large including leuconychia, subungual hyperkeratosis, trachonychia, subungual tumoral syndrome, longitudinal erythronychia and melanonychia. Most cases (31 of 35) were invasive. Relapse rate after surgical treatment was low after wide surgical excision (5%) of the nail apparatus or amputation of the digit. However, limited surgical excision led to more frequent relapses (56%). Conclusions Nail apparatus SCC is often misdiagnosed. Most cases are invasive at the time of diagnosis. Wide surgical excision bears a lower risk of relapse. Micro- graphic surgery should be considered for a better control in cases treated with limited surgical excision.

Squamous cell carcinoma (SCC) of the nail is uncommon. Its surgical excision (LSE) was proposed when the tumour diagnosis can be easily missed or delayed, because the clinical involved the lateral part of the nail plate and did not exceed presentation is often atypical and may mimic other conditions 50% of the surface of the nail apparatus. Wide surgical exci- such as verruca vulgaris, onychomycosis, trauma-induced nail sion (WSE) of the nail apparatus was performed in larger dystrophy or exostosis. Accurate diagnosis can only be made tumours and/or when the tumour was affecting the medial by performing an appropriate surgical biopsy. The treatment part of the nail. DA was indicated only in cases of bone inva- method depends on the extension of the tumour in or under- sion evidenced by X-ray and MRI or in cases with involved neath the nail bed. For this article we reviewed 35 cases of inferior margin at pathological examination of the WSE speci- SCC of the nail apparatus treated in our dermatosurgical unit. men. In cases of invasive carcinoma, the vertical extent of the tumour was measured from the basal layer to the deepest car- Materials and methods cinoma cell.

All patients treated in the dermatology unit of the Hoˆtel Dieu Results Hospital Lyons for SCC of the nail (in situ or invasive) from January 2000 to March 2005 were included in this study. Among the 47 cases initially selected, 12 were immediately Pathological samples were reviewed by two pathologists (L.D., excluded from the study because of lack of information con- B.B.). Surgical biopsies and further conservative surgical treat- cerning medical history or follow-up or in cases of equivocal ments were performed in our unit (L.T., S.D., S.R.-S.) How- histopathological diagnosis. Among the 35 selected patients, ever, digital amputation (DA), when indicated, was performed 25 were men (71%) and 10 women (29%). The median age in a distinct surgical oncology department. Radiography of the at the time of diagnosis was 56Æ9 years (58 for men, 54 for ﬁnger was systematically performed, and magnetic resonance women). The median delay to diagnosis was 24Æ5 months. imaging (MRI) was performed in doubtful cases. Limited Relevant clinical criteria were subungual hyperkeratosis,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp871–874 871 872 Squamous cell carcinoma of the nail apparatus, S. Dalle et al.

Nine patients were treated by LSE of the macroscopically involved part of the nail. Five patients in this group relapsed after a time period ranging from 6 to 36 months (mean 14Æ2). All of them were successfully treated by secondary WSE. Twenty patients were treated by total avulsion of the nail apparatus (WSE). One patient (5%) relapsed at the periphery of the cutaneous graft and was successfully treated by LSE of the recurrent tumour. Six patients were treated by partial DA; one patient had a recurrence on the stub and underwent a complete ﬁnger amputation. This treatment did not prevent further extension of the disease towards draining lymph nodes and he died from lung metastases.

Discussion

In our series, as in previous reports, subungual SCC is found most commonly after the fifth decade, and is twofold more frequent in men than in women.1 Delay between onset of symptoms and diagnosis ranged from 2 months to 7 years in our study. This delay is often so long because ungual SCC is a slowly growing tumour. The initial clinical presentation is often erroneously diagnosed as onychomycosis, subungual viral wart or another benign condition. Moreover, the nail plate dystrophy induced by the carcinomatous process often allows sec- Fig 1. Invasive squamous cell carcinoma of the left second fingernail: ondary dermatophytic colonization that may be evidenced by clinical view. mycological cultures that add to the confusion. Interestingly, some clinical atypia and unusual findings, not routinely subungual haemorrhage, ungual dystrophy, trachyonychia, observed in onychomycosis or viral warts, are usually found longitudinal melanonychia, erythronychia, leuconychia and and can raise the index of suspicion of the observer. We regu- subungual tumoral syndrome (Fig. 1). Pain was usually absent larly observed, as already described,2,3 subungual tumoral and was recorded in only three patients (Table 1). Subungual syndrome, longitudinal erythronychia, leuconychia and mel- SCC was suspected at first medical examination in only 29% anonychia and, in rare instances, pain. Nevertheless, the diag- of cases. Among the previously proposed erroneous diagnoses, nosis of nail SCC often remains difficult. Our position, as a onychomycosis and viral wart were the most frequent large referral centre for nail diseases, offers a large recruitment (Fig. 2). Most cases were unsuccessfully treated before correct of patients with resistant nail pathology, allowing us to propose diagnosis with topical and/or systemic antimycotics. When the correct diagnosis of ungual SCC also on the basis of previ- mycological cultures were made, they were found positive in ous clinical hypotheses that have been excluded by the ineffi- one third of cases. No history of trauma was recorded in our ciency of the treatment or by an unusual disease evolution. patients. Fingernails were involved in 28 of 35 (80%) cases, Subungual SCC is more frequently observed on the finger- and toenails in the other seven cases. No case of multidigital nails. This may be explained by a much higher exposure rate involvement was observed during our inclusion period. SCC to sunlight and a possible role of human papillomavirus was on the thumbnail in 14 of 28 (50%) cases on the fingers, (HPV) infection. HPV infection has been clearly associated and the big toenail was involved in all seven cases occurring with Bowen’s disease and SCC on the hands and fingernails4–7 on the feet (Fig. 3). as an important cocarcinogenic factor. The possibility of gen- Histopathological examination of the biopsy specimen ital–digital transmission has been suggested as a mechanism of showed in situ carcinoma in only four of 35 cases (11%); 31 of infection. Various studies suggest that mucosal HPV (HPV 35 cases (89%) were invasive (Fig. 4). The depth of invasion, types 16, 31, 54, 58, 61, 62 and 73) may play a role in the as defined by the distance from the basal layer to the deepest development of this neoplasm in nail apparatus tissues. In carcinoma cell, ranged from 0Æ3to2Æ6 mm (mean 1Æ1). contrast, HPV has never been found in association with SCC Patients could have undergone three different surgical pro- developing on toenails.8 cedures: (i) LSE to the involved nail plate, matrix and bed; Mohs micrographic surgery has been evaluated for sub- (ii) WSE of the whole nail apparatus including the nail plate, ungual Bowen’s disease and SCC.1,9–14 The nail is a challenging bed, matrix, the supramatricial skin, the two lateral peringual location for Mohs surgery because of its unique anatomical skin areas including the lateral folds and the underlying tissue and histological characteristics.15 This method is extremely above the distal phalanx followed by whole-thickness auto- time consuming for the pathologist and the dermatologist and graft; or (iii) amputation of the involved digit (DA). is poorly cost-efficient for a dermatosurgical unit because of

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp871–874 Squamous cell carcinoma of the nail apparatus, S. Dalle et al. 873

Table 1 Patient characteristics

Age Tumour Follow-up Patient (years)/sex Digit Clinical ﬁndings Surgery thickness (mm) Recurrence time (months) 1 53/M 3RH Subungual hyperkeratosis, leuconychia LSE 1Æ1 Yes: M6a 44 2 59/M 2RH Subungual hyperkeratosis, leuconychia WSE 0Æ7No25 3 50/M 1RF Longitudinal melanonychia, subungual LSE 0Æ6No10 tumour 4 64/M 1RH Subungual hyperkeratosis, trachyonychia WSE 1Æ3No12 5 64/F 1RH Median nail dystrophy of Heller, pain Amputation 0Æ4No65 6 74/M 2LH Subungual hyperkeratosis WSE 1Æ3No31 7 79/M 3LH Subungual tumour Amputation 1Æ6No12 8 56/F 1RH Subungual hyperkeratosis, erythronychia WSE IS No 29 9 85/M 2LH Subungual hyperkeratosis, onycholysis Amputation 2Æ0No46 10 67/F 3LH Subungual hyperkeratosis, leuconychia LSE 1Æ9No38 11 73/M 5LH Longitudinal melanonychia WSE 0Æ9No18 12 62/M 4RH Subungual tumour, subungual Amputation 1Æ0No12 haemorrhage 13 64/M 1LH Subungual hyperkeratosis, onycholysis LSE 1Æ2 Yes: M36a 18 14 35/F 1LF Median nail dystrophy of Heller, WSE 0Æ35 No 30 subungual haemorrhage 15 39/M 1LH Subungual tumour, subungual WSE 1Æ6 Yes: M36a 28 hyperkeratosis 16 49/M 1RH Erythronychia, trachyonychia WSE 0Æ6No90 17 50/F 4RH Subungual tumour, subungual WSE 1Æ1No24 hyperkeratosis, pain 18 76/M 1RH Leuconychia, periungual tumour WSE 1Æ4No36 19 49/M 1RF Subungual hyperkeratosis, onycholysis WSE 1Æ4No19 20 50/F 4RH Erythronychia, onycholysis WSE 2Æ6No24 21 39/F 2RH Longitudinal melanonychia LSE 0Æ5No36 22 58/M 1RH Subungual hyperkeratosis, leuconychia WSE IS No 19 23 53/M 2LH Subungual hyperkeratosis, onycholysis WSE 1Æ0No24 24 49/M 1LH Subungual tumour WSE 0Æ4No90 25 25/M 1RH Subungual hyperkeratosis, erythronychia LSE 0Æ3No36 26 59/M 2RH Subungual hyperkeratosis, leuconychia WSE 1Æ6No12 27 63/F 1RH Longitudinal melanonychia WSE 0Æ8No50 28 52/M 1LH Subungual hyperkeratosis, onycholysis LSE 1Æ2 Yes: M6a 64 29 56/F 1LF Longitudinal melanonychia, onycholysis Amputation 0Æ5No48 30 44/M 5LH Subungual hyperkeratosis, onycholysis LSE 1Æ4 Yes: M16a 18 31 66/F 1LF Subungual hyperkeratosis, onycholysis LSE 1Æ1 Yes: M7a 54 32 49/M 1RF Onycholysis, pain WSE 1Æ5No51 33 75/M 1RF Subungual hyperkeratosis, leuconychia WSE IS No 14 34 77/M 1LH Subungual hyperkeratosis Amputation IS Yes: M2b Died, M4 35 63/M 1LH Subungual tumour WSE 1Æ1No10

RH, right hand; RF, right foot; LH, left hand; LF, left foot; WSE, wide surgical excision; LSE, limited surgical excision; IS, in situ; M, month. aPatients 1, 13, 15, 28, 30 and 31: relapse locally on periexcisional nail fold; bpatient 34: relapse in the dorsum of the hand and axillary lymph node, and ﬁnally development of pulmonary metastases.

Initial clinical diagnosis the much longer use of the surgical rooms, equipment and staff. Moreover, the conservation of a small part of the nail 17% 14% Subungual verruca apparatus is often found to be of poor benefit (if not a cause Onychomycosis of discomfort) to the patient. For all these reasons we wanted Longitudinal melanonychia to evaluate an alternative therapeutic modality through our 26% (nevus, melanoma) practical experience. In cases of preoperative or postoperative 29% Subungual SCC evidence of bone infiltration by the nail SCC, DA is the refer- Others (exostsis, onychomatricoma..) 14% ence treatment and there is no indication for micrographic surgery. In our series this treatment was successfully applied in Fig 2. Preoperative diagnoses in our series of 35 cases. SCC, five of six cases. However, in more aggressive cases, metastatic squamous cell carcinoma. spread can be observed. In our view, complete avulsion of

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp871–874 874 Squamous cell carcinoma of the nail apparatus, S. Dalle et al.

In conclusion, nail SCC remains a very challenging clinical situation. Its diagnosis is often mistaken with onychomycosis, but a careful examination of nail changes might lead to the correct diagnosis. Mycological cultures are useless to rule out nail SCC, and only an adequate surgical biopsy should be regarded as a valuable diagnostic test. Finger amputation is rarely indicated but should be proposed in cases with underlying bone involvement. SCC involving the axial part of the nail apparatus and tumours involving > 50% of the nail surface should be treated by complete avulsion. In smaller tumours, especially in lateralized cases, conservative treatment with micrographic surgery should be considered. Measurement of the tumour thickness gives useful information and tumours thicker than 1 mm should be carefully followed. Careful pathological examination of the surgical margins is mandatory whatever the type of surgery performed. Following pathologically complete excision, the prognosis should be considered as favourable.

References Fig 3. Anatomical distribution of the nail squamous cell carcinoma in hands and feet (35 cases). 1 de Berker DA, Dahl MG, Malcolm AJ, Lawrence CM. Micrographic surgery for subungual squamous cell carcinoma. Br J Plast Surg 1996; 49:414–19. Nail plate Cuticle Eponychium 2 Baran R, Perrin C. Longitudinal erythronychia with distal subungual keratosis: onychopapilloma of the nail bed and Bowen’s disease. Br J Dermatol 2000; 143:132–5. 3 Baran R, Simon C. Longitudinal melanonychia: a symptom of Bowen’s disease. J Am Acad Dermatol 1988; 18:1359–60. 4 Sau P, McMarlin SL, Sperling LC, Katz R. Bowen’s disease of the Nail bed nail bed and periungual area. A clinicopathologic analysis of seven Nail matrix cases. Arch Dermatol 1994; 130:204–9. 5 Mitsuishi T, Sata T, Matsukura T et al. The presence of mucosal human papillomavirus in Bowen’s disease of the hands. Cancer 1997; 79:1911–17. 6 Guitart J, Bergfeld WF, Tuthill RJ et al. Squamous cell carcinoma of Subungual SCC the nail bed: a clinicopathological study of 12 cases. Br J Dermatol 1990; 123:215–22. 7 Alam M, Caldwell JB, Eliezri YD. Human papillomavirus-associated digital squamous cell carcinoma: literature review and report of 21 Fig 4. Histopathological examination of a subungual squamous cell new cases. J Am Acad Dermatol 2003; 48:385–93. carcinoma (SCC) involving the proximal nail fold (haematoxylin, 8 Nasca MR, Innocenzi D, Micali G. Subungual squamous cell carci- eosin and saffron; original magniﬁcation · 200; inset · 400). noma of the toe: report on three cases. Dermatol Surg 2004; 30:345– 8. the nail apparatus (WSE) is the best treatment for medial inva- 9 Ongenae K, van de Kerckhove M, Naeyaert JM. Bowen’s disease of sive nail apparatus SCC or in lateral cases involving > 50% of the nail. Dermatology 2002; 204:348–50. the nail apparatus surface. The relapse rate is low (5%) and 10 Peterson SR, Layton EG, Joseph AK. Squamous cell carcinoma of the postoperative tolerance of the scar by the patients is good. The nail unit with evidence of bony involvement: a multidisciplinary approach to resection and reconstruction. Dermatol Surg 2004; question of the use of Mohs micrograhic surgery should, how- 30:218–21. ever, be addressed in the case of limited lateral tumours. Our 11 Zaiac MN, Weiss E. Mohs micrographic surgery of the nail unit recurrence rate after LSE was high (56%) and we frequently and squamous cell carcinoma. Dermatol Surg 2001; 27:246–51. had to perform a WSE after local recurrence of the disease. 12 Goldminz D, Bennett RG. Mohs micrographic surgery of the nail In all our cases, when recurrence occurred after a delay ran- unit. J Dermatol Surg Oncol 1992; 18:721–6. ging from 6 to 36 months, the depth of the initial tumour 13 Goldberg DJ, Robins P. Subungual squamous cell carcinoma treated was > 1 mm (range 1Æ1–1Æ6). We believe that the depth of by Mohs surgery in a patient with sarcoidosis. J Dermatol Surg Oncol 1986; 12:972–4. invasion should be systematically recorded in cases of nail 14 Baran R, Dupre A, Sayag J et al. [Bowen disease of the nail apparatus SCC and that tumours thicker than 1 mm treated by apparatus. Report of 5 cases and review of the 20 cases in the LSE should be carefully followed up. We did not observe literature]. Ann Dermatol Venereol 1979; 106:227–33. either nodal or visceral metastatic spread of nail SCC treated 15 Fleckman P, Allan C. Surgical anatomy of the nail unit. Dermatol Surg by LSE or WSE even in cases with local recurrence. 2001; 27:257–60.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp871–874 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2006.07743.x Aberrant human tissue kallikrein levels in the stratum corneum and serum of patients with psoriasis: dependence on phenotype, severity and therapy N. Komatsu,* K. Saijoh,§ C. Kuk,* F. Shirasaki, K. Takehara and E.P. Diamandis* *Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, Ontario M5G 1X5, Canada Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario M5G 1L5, Canada Department of Dermatology and §Department of Hygiene, Graduate School of Medical Science, School of Medicine, Kanazawa University, Kanazawa, Japan

Summary

Correspondence Background Human tissue kallikreins (KLKs) are a family of 15 trypsin-like or Eleftherios P. Diamandis. chymotrypsin-like secreted serine proteases (KLK1–KLK15). Multiple KLKs have E-mail: [email protected] been quantitatively identified in normal stratum corneum (SC) and sweat as candidate desquamation-related proteases. Accepted for publication 7 November 2006 Objectives To quantify KLK5, KLK6, KLK7, KLK8, KLK10, KLK11, KLK13 and KLK14 in the SC and serum of patients with psoriasis, and their variation Key words between lesional and nonlesional areas and with phenotype, therapy and severity. diagnostic marker, human kallikreins, psoriasis, The overall SC serine protease activities were also measured. serine proteases, stratum corneum, therapy Methods Enzyme-linked immunosorbent assays and enzymatic assays were used. Conflicts of interest Results The lesional SC of psoriasis generally contained significantly higher levels None declared. of all KLKs. KLK6, KLK10 and KLK13 levels were significantly elevated even in the nonlesional SC. The overall trypsin-like, plasmin-like and furin-like activities were significantly elevated in the lesional SC. Plasmin-like activity was significantly elevated also in the nonlesional SC. The SC chymotrypsin-like activity was only slightly elevated in psoriasis. KLK7 serum levels did not differ between normal volunteers and patients with psoriasis. Serum KLK6, KLK8, KLK10 and KLK13 levels in patients with untreated psoriasis significantly correlated with Psoriasis Area and Severity Index score. Serum KLK5 and KLK11 levels decreased in patients with psoriasis after therapy, especially with etretinate. Patients with erythrodermic psoriasis exhibited significantly higher serum KLK levels than normal subjects or patients with psoriasis vulgaris or arthropathic psoriasis. Conclusions We found aberrant KLK levels in the SC and serum of patients with psoriasis and suggest that KLKs might be involved in the pathogenesis of this disease.

Psoriasis is a common, chronic inflammatory skin disease. Pso- serine proteases (KLK1–KLK15); KLK3, KLK7 and KLK9 are riasis was recognized as a disease of disordered keratinocyte chymotrypsin-like enzymes, whereas the other KLKs are proliferation and differentiation. Currently, psoriasis is consid- trypsin-like enzymes.3 So far, at least eight different KLKs ered a T cell-mediated inflammatory disease.1 In psoriatic have been quantitatively identified in the stratum corneum lesions, T-cell and dendritic cell activation leads to nuclear (SC) by enzyme-linked immunosorbent assay (ELISA).4,5 In factor-jB activation and release of cytokines, chemokines, normal skin, KLKs tend to be distributed in more highly proteases and other inflammatory mediators.2 Among these differentiated cells, i.e. the SC, stratum granulosum and skin well-defined molecules, which may be associated with the appendages.6,7 KLK5, KLK7 and KLK8 are secreted into pathogenesis of psoriasis, and may represent potential thera- the intercellular space via lamellar granules.8,9 KLK5 and peutic targets,2 the involvement of proteases in the pathogene- KLK7 degrade desmosomes and/or corneodesmosomes.10,11 sis of psoriasis has not as yet been clarified. According to recently accumulated evidence, KLKs are The human tissue kallikrein (KLK) gene family localizes as a believed to be cell differentiation and/or desquamation- cluster to chromosome 19q13.4 and encodes 15 secreted related serine proteases.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 875 876 Aberrant kallikrein levels in psoriasis, N. Komatsu et al.

It has been reported that KLK2, KLK4 and KLK15 activate performed using NichibanTM tape (organic solvent-stable tape pro-KLK3, KLK5 activates pro-KLK7 and pro-KLK14, and with organic solvent-soluble adhesive; Nichiban, Tokyo, pro-KLK5 is activated by autocatalysis or by KLK14, suggesting Japan). The SC samples were washed and purified using that KLKs may function as an enzymatic cascade pathway.12,13 toluene. After toluene treatment, the purified samples were Protease-activated receptors (PARs) are members of transmem- air-dried and weighed. The detailed procedure is described brane G-protein coupled receptors which are cleaved and acti- elsewhere.4 vated by serine proteases (e.g. trypsin and thrombin). The signals are transmitted to the nucleus to mediate cell prolifer- Sample preparation for serum analysis ation, differentiation, pain transmission and inflammatory responses.14 KLKs and PAR-2 are colocalized in normal Serum samples were obtained from 90 healthy volunteers skin7,15 and KLK5, KLK6 and KLK14 cleave PAR-2 at its activa- (a mixture of men and women, age range 21–50 years). tion site in vitro.16,17 Hence, the presence of a KLK–PAR signal- Serum samples from patients with psoriasis were obtained ling pathway in the skin is conceivable. These and other from 96 subjects (mean ± SD age 50 ± 16 years) who were data18,19 implicate KLKs in inflammatory reactions. diagnosed as having psoriasis vulgaris (n ¼ 76), arthropathic In psoriasis, (mRNAs)KLK6 and KLK9 are increased in the psoriasis (n ¼ 13) and erythrodermic psoriasis (n ¼ 7). The skin lesion.20 The localization of multiple (mRNAs)KLK and severity of skin lesions was evaluated using PASI for each KLKs was expanded in suprabasal layers of psoriatic lesions.7,21 patient. The patients were also subdivided by types of therapy, Psoriatic lesions possess higher levels of active KLK7 and are i.e. no therapy, ciclosporin, etretinate, PUVA, corticosteroid 21 characterized by elevation of chymotrypsin-like activity. topical agents, and vitamin D3 topical agents. When a patient These collective findings suggest an involvement of KLKs in received a combination of the therapies, the main therapy the pathogenesis of psoriasis, including aspects of keratinocyte was suggested following a priority rule: (i) oral therapies, proliferation/differentiation and inflammatory reactions. (ii) PUVA therapy, and (iii) therapy with any topical agent. Therefore, the present study aimed to quantitatively measure KLK5, KLK6, KLK7, KLK8, KLK10, KLK11, KLK13 and Immunofluorometric enzyme-linked immunosorbent KLK14 in both the SC and serum, as well as to assess the over- assays for human tissue kallikreins all serine protease activities in the SC of patients with psoriasis. The data from these patients were further compared with With the exception of Fuso-FB6MA53 anti-KLK11 antibody corresponding data obtained from normal subjects, or ana- (Ab), which was purchased (Fuso, Osaka, Japan), all other lysed based on the following factors: lesional skin, nonlesional monoclonal and polyclonal anti-KLK Abs were developed in skin, phenotype, therapy and severity. our laboratory.7 Each of the Abs displayed negligible cross- reactivity with other KLKs (data not shown). The detailed pro- Materials and methods cedure and conditions for sample preparation and each KLK ELISA assay are described elsewhere.4 Sample preparation for stratum corneum analysis Assay of serine protease enzymatic activities Informed consent was obtained from all participants and our in the stratum corneum study was conducted according to the Declaration of Helsinki. The medical ethical committee of the Graduate School of Med- The synthetic peptide substrates Boc-Phe-Ser-Arg-AMC (FSR), ical Science, School of Medicine, Kanazawa University Boc-Pro-Phe-Arg-AMC (PFR), Pyr-Arg-Thr-Lys-Arg-AMC approved all of the described studies. The SC samples from (R-KR) and Boc-Val-Leu-Lys-AMC (VLK) (Bachem, Torrance, normal subjects were the same as in our previous study,4 and CA, U.S.A.) for the trypsin-like activities were used at ) were obtained from the forearms of 96 normal volunteers [30 0Æ1 mmol L 1 final concentration. MeO-Suc-Arg-Pro-Tyr-pNA- (15 women and 15 men) in each of three age groups: 30–39, HCl (RPY) (Chromogenix, Milan, Italy) for the chymotrypsin- ) 40–49 and 50–59 years, respectively, and six (five women like activity was used at 0Æ4 mmol L 1 final concentration. and one man) with ages over 70 years]. The SC samples from The reaction mixtures for the SC samples consisted of 0Æ5mg patients with psoriasis were obtained from the forearms of dry weight of the SC, 10 lLofN,N-dimethylformamide, ) 16 patients (10 men and six women, mean ± SD age 240 lLof0Æ1% Triton X-100, 175 lLof0Æ2 mol L 1 Tris-HCl 53 ± 16 years) who had been diagnosed as having psoriasis buffer (pH 8Æ0) and 50 lL of substrates.4 They were incubated vulgaris, showing a Psoriasis Area and Severity Index (PASI) at 37 C with shaking for 2 or 4 h. Released 7-amino-4-methyl- score between 15 and 25, and treated with psoralen plus coumarin (AMC) was measured using a fluorescence spectro- ultraviolet A (PUVA) and topical agents. Six nonlesional and photometer (Wallac Victor 2 1420 Multilabel Counter; Perkin lesional SC samples were provided by the same patients. Elmer, Boston, MA, U.S.A.) and released para-nitroanilide The SC samples from patients with psoriasis were further (pNA) using the same instrument at 405 nm. Porcine trypsin subdivided: lesional skin (n ¼ 12), psoriatic plaques with type II (trypsin tablets; Sigma, St Louis, MO, U.S.A.; molecular moderate-strong infiltration; and nonlesional skin (n ¼ 10), weight 23Æ8 kDa) and plasmin (Sigma) were used as positive i.e. skin unaffected by psoriatic plaques. Tape stripping was controls. Each assay was performed in triplicate.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 Aberrant kallikrein levels in psoriasis, N. Komatsu et al. 877

nonlesional (n ¼ 10), indicating that the skin was not affected Statistical analysis by psoriatic plaques; and lesional (n ¼ 12), which included Bartlett’s test was performed first to determine the equality of chronic psoriatic plaques with infiltration. In our figures, dots variances among the specified groups. If significant differences connected with a line represent samples acquired from both were found with Bartlett’s test, then the Kruskal–Wallis test lesional and nonlesional areas in six patients. Paired compari- was performed. Reported P-values were adjusted by Dunn’s sons were performed for the six patients who provided both method to reflect multiple comparisons. When a significant the nonlesional and lesional SC samples. A significant differ- difference was not found with Bartlett’s test, both the Krus- ence (P <0Æ05) was observed for all studied KLKs, not only kal–Wallis test and one-way ANOVA were performed. When by paired t-test but also by Wilcoxon matched pairs test in comparing two groups, the Mann–Whitney test or the Wil- these patients. KLK levels in lesional skin were higher than in coxon matched pairs test was used. All statistical tests were nonlesional skin in all six patients (Fig. 1). performed using GraphPad Prism 4 version 4.02 software When differences among the groups of normal, nonlesional (GraphPad Software, Inc., San Diego, CA, U.S.A.). and lesional samples were examined, the use of Bartlett’s test rejected the equality of variances among these groups. Then, Results the Kruskal–Wallis test with the post hoc test (Dunn’s method) was performed to reflect multiple comparisons and showed significant differences (P <0Æ05 for each) (Fig. 1). These Kallikrein levels in the stratum corneum of normal significant differences are represented by * (lesional vs. non- subjects and patients with psoriasis (nonlesional and lesional and normal skin) and # (nonlesional vs. normal skin). lesional areas) In short, the differences between lesional vs. nonlesional and We used ELISAs developed in-house to quantify KLK5, KLK6, normal skin were significant for all KLKs tested. KLK7, KLK8, KLK10, KLK11, KLK13 and KLK14 in SC extracts The mean values of KLK5, KLK7, KLK8, KLK10, KLK11 and ) (ng mg 1 dry weight) (Fig. 1). The SC samples of the normal KLK14 in lesional vs. nonlesional SC were two- to five-fold subjects (n ¼ 96) were the same as in our previous study.4 higher (Fig. 1a–f), with the exception of one case in which ) The psoriasis SC samples were obtained from patients diag- the level of KLK5 was equivalent (c. 12 ng mg 1) between the nosed as having psoriasis vulgaris. These were subdivided as nonlesional and lesional SC (Fig. 1d). The mean values of

Fig 1. Differences in kallikrein (KLK) concentrations in the stratum corneum (SC) of normal subjects and patients with psoriasis. KLK levels in the ) SC are shown (ng mg 1 dry weight). As the median and mean of each group were almost identical in all KLKs, only the mean (horizontal bars) is shown. The connected dots indicate paired samples (from the same patients). Kruskal–Wallis test with the post hoc test (Dunn’s method) identiﬁed signiﬁcant differences (P <0Æ05 for each) as represented by: *, lesional vs. nonlesional and normal skin; #, nonlesional vs. normal skin.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 878 Aberrant kallikrein levels in psoriasis, N. Komatsu et al.

KLK6 and KLK13 in lesional SC were 20- to 30-fold higher cantly higher than that in normal and nonlesional skin ) (86 and 45 ng mg 1, respectively) compared with those (P <0Æ05 for each comparison) (Table 1). The trypsin-like ) in nonlesional SC (3Æ4 and 1Æ5ngmg 1, respectively) activity towards PFR substrate and the chymotrypsin-like activ- (Fig. 1g,h). In the nonlesional samples, the amounts of KLK7 ity towards RPY substrate were moderately elevated in the and KLK14 were within the normal range (Fig. 1a,f). KLK5, nonlesional and lesional samples but no statistically significant KLK8 and KLK11 also remained within the normal range in differences were noted (Table 1). The plasmin-like activity most nonlesional samples, with a few exceptions which dis- towards VLK substrate was significantly elevated in both non- ) played higher values than the normal subjects (Fig. 1b,c). The lesional and lesional samples (5Æ8 and 14Æ5 nmol mg 1, amounts of KLK6, KLK10 and KLK13 in the nonlesional skin respectively, P <0Æ05 for each) in comparison with normal ) ) (0Æ1–7Æ5ngmg 1) were significantly higher than in normal skin (1Æ7 nmol mg 1) (Table 1). The furin-like activity ) subjects (< 1Æ7ngmg 1, P <0Æ05 for each) (Fig. 1e,g,h). towards R-KR substrate in nonlesional samples (8Æ5 nmol ) ) mg 1) was higher than in normal skin (3Æ0 nmol mg 1) but was not significantly different (P >0Æ05). The activity in Stratum corneum serine protease enzymatic activities lesional SC was increased significantly, by approximately in normal subjects and patients with psoriasis ) eightfold (26Æ2 nmol mg 1), in comparison with normal skin The overall SC enzymatic activities were measured in SC sam- (P <0Æ05) (Table 1). ples from normal volunteers and patients with psoriasis (Table 1). In this study, ‘trypsin-like activities’ refer to the Kallikrein levels in serum of normal subjects and activities of enzymes towards Boc-Phe-Ser-Arg-AMC (FSR) and patients with psoriasis of various phenotypes Boc-Pro-Phe-Arg-AMC (PFR) fluorogenic substrates. ‘Chymo- trypsin-like activity’, ‘plasmin-like activity’ and ‘furin-like The concentrations of KLK5, KLK6, KLK7, KLK8, KLK10, ) activity’ refer to the activities of enzymes towards MeO-Suc- KLK11, KLK13 and KLK14 in serum (ng mL 1) were quanti- Arg-Pro-Tyr-pNA-HCl (RPY), Boc-Val-Leu-Lys-AMC (VLK) fied for normal and psoriasis subjects and the results were and Pyr-Arg-Thr-Lys-Arg-AMC (R-KR) substrates, respectively. analysed according to phenotypes, severity and therapies Due to the limited amount of SC from these individuals, the (Table 2, Figs 2, 3). As these KLKs have mainly either chymo- samples used for each substrate were randomly chosen from trypsin-like (KLK7) or trypsin-like activity (KLK5, KLK6, the subjects indicated in Fig. 1. The number of subjects KLK8, KLK10, KLK11, KLK13 and KLK14),3 they have also chosen was the same (n ¼ 12 for the normal; n ¼ 6 for the been grouped as ‘chymotrypsin-like KLK’ and ‘trypsin-like nonlesional and lesional samples), although the individuals KLKs’. In Table 2, the patients with psoriasis were subdivided were not always the same. When the SC samples were boiled into those with psoriasis vulgaris (n ¼ 59), arthropathic psori- for 5 min, the enzymatic activity was completely lost (data asis (n ¼ 12) and erythrodermic psoriasis (n ¼ 7). Data not shown). shown in Table 2 are from patients who have been treated The trypsin-like activity towards FSR substrate in the non- (the treatment modalities were not classified); patients without ) lesional samples (13Æ5 nmol mg 1 dry weight) did not differ therapy were excluded due to their small number (n ¼ 18). ) significantly from that in normal SC (12Æ1 nmol mg 1) but The levels of KLK5 and KLK11 were decreased in psoriasis ) the activity in lesional samples (62Æ2 nmol mg 1) was signifi- vulgaris and arthropathic psoriasis compared with normal

Table 1 Stratum corneum serine protease Psoriasis enzymatic activities (mean ± SD) in normal Substrate subjects and patients with psoriasis Released AMC or pNA Normal skin Nonlesional Lesional ) (nmol mg 1 dry weight) (n ¼ 12) skin (n ¼ 6) skin (n ¼ 6) Trypsin-like activity Phe-Ser-Arg-AMC 12Æ1±4Æ113Æ5±5Æ462Æ2±15Æ7* Pro-Phe-Arg-AMC 5Æ6±2Æ76Æ2±2Æ411Æ0±1Æ9 Chymotrypsin-like activity Arg-Pro-Tyr-pNA 11Æ1±5Æ315Æ3±7Æ715Æ8±6Æ7 Plasmin-like activity Val-Leu-Lys-AMC 1Æ7±1Æ05Æ8±2Æ4# 14Æ5±5Æ5** Furin-like activity Pyr-Arg-Thr-Lys-Arg-AMC 3Æ0±1Æ38Æ5±4Æ426Æ2±9Æ5*

The overall stratum corneum serine protease enzymatic activities represent released AMC ) or pNA from the synthetic substrates (nmol mg 1 dry weight). The amounts of released AMC or pNA were measured at 2 h or 4 h, respectively. The post hoc test (Dunn’s method) identiﬁed signiﬁcant differences (P <0Æ05 for each) for the following: *, lesional vs. nonlesional and normal skin; **, lesional vs. normal skin; #, nonlesional vs. normal skin. AMC, 7-amino-4-methylcoumarin; pNA, para-nitroanilide.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 Aberrant kallikrein levels in psoriasis, N. Komatsu et al. 879

Table 2 Kallikrein (KLK) concentrations in serum of normal subjects and patients with Psoriasis Arthropathic Erythrodermic psoriasis, measured by enzyme-linked KLK Normal vulgaris psoriasis psoriasis ) immunosorbent assay (ng mL 1) (n ¼ 90) (n ¼ 59) (n ¼ 12) (n ¼ 7) PASI 11Æ5±5Æ610Æ7±5Æ934Æ9±6Æ8#a Chymotrypsin-like KLK KLK7 5Æ1±2Æ14Æ6±2Æ65Æ6±2Æ17Æ1±2Æ6#b Trypsin-like KLKs KLK6 4Æ4±1Æ55Æ3±2Æ84Æ9±1Æ716Æ4±7Æ1#c KLK8 1Æ9±0Æ77 2Æ1±1Æ32Æ1±1Æ18Æ2±4Æ1#d KLK10 1Æ2±0Æ56 1Æ3±0Æ62 1Æ4±0Æ70 3Æ4±3Æ0#c KLK5 0Æ68 ± 0Æ15 0Æ51 ± 0Æ22* 0Æ55 ± 0Æ30* 0Æ90 ± 0Æ37#a KLK11 0Æ55 ± 0Æ16 0Æ28 ± 0Æ14* 0Æ26 ± 0Æ17* 0Æ61 ± 0Æ25#a KLK14 0Æ23 ± 0Æ095 0Æ31 ± 0Æ28 0Æ41 ± 0Æ37 0Æ49 ± 0Æ37#c KLK13 0Æ01 0Æ078 ± 0Æ051 0Æ11 ± 0Æ085 0Æ27 ± 0Æ21#b

The values for KLKs and Psoriasis Area and Severity Index (PASI) are given as mean ± SD. Data are shown for treated patients only. As KLK13 was not always detectable in normal ) subjects, KLK13 in normal subjects is shown as 0Æ01 ng mL 1 (the minimum detection value) and the data were excluded from the statistics. The post hoc test (Dunn’s method) identified significant differences (P <0Æ05 for each) as follows: *, the specified phenotype vs. normal; #a, erythrodermic psoriasis vs. psoriasis vulgaris and arthropathic psoriasis; #b, erythrodermic psoriasis vs. psoriasis vulgaris; #c, erythrodermic psoriasis vs. normal; #d, erythrodermic psoriasis vs. psoriasis vulgaris and normal. subjects (P <0Æ05 for each comparison) (Table 2). Otherwise, ()) group displayed a significantly higher concentration than no significant differences in KLK levels were detected between the normal group (P <0Æ05) (Fig. 2d). KLK10 levels in the normal subjects and those with psoriasis vulgaris and arthro- therapy ()) group correlated significantly with PASI (r ¼ pathic psoriasis. However, in erythrodermic psoriasis all KLKs 0Æ51, P <0Æ05), but this was not seen in the therapy (+) were elevated in comparison with all other groups (P <0Æ05 group (Fig. 2d). The distribution of KLK5 in the therapy (+) for each, see the details in Table 2). group was significantly lower compared with normal subjects As the group with erythrodermic psoriasis showed signifi- (P <0Æ05) (Fig. 2e). The distributions of KLK11 in the ther- cant differences, in comparison with normal subjects or other apy ()) and therapy (+) groups were significantly lower com- phenotypes of psoriasis, erythrodermic psoriasis was excluded pared with the normal group (P <0Æ05 for each) (Fig. 2f). from the following analysis. No significant correlation was detected between PASI and KLK5 or KLK11 levels in the therapy ()) and therapy (+) groups (Fig. 2e,f). KLK14 levels in several therapy (+) Kallikrein levels in the serum of patients with psoriasis patients were above the normal range (Fig. 2g). A significant with or without therapy correlation between KLK14 levels and PASI was not observed KLK concentrations in serum are reported in the groups of (Fig. 2g). The KLK13 distribution in the therapy ()) group normal subjects (n ¼ 90), patients with psoriasis without was significantly higher compared with that in the therapy therapy [therapy ()), n ¼ 18] and patients with psoriasis (+) group (Fig. 2h). In the therapy ()) group, there was a undergoing therapy [therapy (+), n ¼ 71] (Fig. 2). The psori- significant correlation between KLK13 levels and PASI (r ¼ asis group includes psoriasis vulgaris and arthropathic psori- 0Æ50, P <0Æ05) (Fig. 2h). asis, as no significant differences were detected between these groups (Table 2). The therapy (+) patients were under treat- Kallikrein levels in the serum of patients with psoriasis ment with any combination of oral and topical agents and/or among therapy groups PUVA. For KLK7, we found no significant differences among the KLK concentrations in serum were analysed according to the normal, therapy (+) or therapy ()) patients (Fig. 2a, left) and type of therapy of patients with psoriasis (Fig. 3). Patients no significant correlations between KLK7 and PASI (Fig. 2a, with psoriasis included those with psoriasis vulgaris and right). Similarly, the distributions of KLK6 and KLK8 did not arthropathic psoriasis. In total, we included 81 patients with differ significantly among the normal, therapy (+) or therapy psoriasis and 90 normal subjects. The patients with psoriasis ()) groups (Fig. 2b,c, left). The therapy ()) group demon- were subdivided according to the type of treatment: no strated a significant correlation between KLK6 or KLK8 levels therapy [therapy ()), n ¼ 18]; ciclosporin (n ¼ 7, treated and PASI (r ¼ 0Æ70 and r ¼ 0Æ61, respectively, P <0Æ05 for with ciclosporin plus any topical agents); etretinate (n ¼ 7, each comparison). The correlation was not apparent in the treated with etretinate plus any topical agents); steroid (n ¼ therapy (+) group (Fig. 2b,c, right). For KLK10, the therapy 34, corticosteroid topical agent only); vitamin D3 (n ¼ 8,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 880 Aberrant kallikrein levels in psoriasis, N. Komatsu et al.

Fig 2. Kallikrein (KLK) concentrations in serum of patients with psoriasis with or without therapy. Horizontal bars indicate means. Patients include those with psoriasis vulgaris and arthropathic psoriasis. The subjects were further subdivided into normal (closed triangles, n ¼ 90), therapy ()) (closed circles, n ¼ 18) and therapy (+) (open circles, n ¼ 71) (for more details see text). The left panels present the distribution of KLK values, which were analysed by Kruskal–Wallis test with the post hoc tests, Dunn’s multiple comparison test (a–g) or Mann–Whitney test (h). In the right panels, data from patients with psoriasis were also used for regression analysis between Psoriasis Area and Severity Index (PASI) and ) KLK levels. As KLK13 was not always detectable in normal subjects, KLK13 levels in normal subjects are shown as a dot at 0Æ01 ng mL 1 (the minimum detection value) and are excluded from the statistics (h). *, significant differences (P <0Æ05) between the specified groups by Dunn’s multiple comparison test; **, significant differences (P <0Æ05) between the specified groups by Mann–Whitney test; #, the slopes were significantly nonzero (P <0Æ05). The equations of the regression lines are: KLK6, y ¼ 0Æ29x +1Æ6; KLK8, y ¼ 0Æ21x +0Æ079; KLK10, y ¼ 0Æ073x +0Æ90; and KLK13, y ¼ 0Æ0052x +0Æ054.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 Aberrant kallikrein levels in psoriasis, N. Komatsu et al. 881

Fig 3. Differences of kallikrein (KLK) concentrations in serum of patients with psoriasis undergoing therapy. Serum concentrations of KLK5, ) KLK11 and KLK14 are shown (ng mL 1). The data for the remaining KLKs are not shown due to the absence of significant differences. Horizontal lines indicate means. Patients include those with psoriasis vulgaris and arthropathic psoriasis. The patients were subdivided by the type of treatment: no therapy [therapy ()), n ¼ 18], ciclosporin (n ¼ 7), etretinate (n ¼ 7), psoralen plus ultraviolet A (PUVA, n ¼ 7), steroid (n ¼ 34) and vitamin D3 (n ¼ 8) (for details see text). Kruskal–Wallis test with the post hoc test (Dunn’s method) identified significant differences (P <0Æ05 for each) as follows: #, normal vs. the specified group; *, etretinate vs. the specified group.

vitamin D3 topical agent only, or vitamin D3 plus corticoster- lished data). The elevation of furin-like (R-KR) activity, oid topical agents); PUVA (n ¼ 7, PUVA plus any topical observed in the SC of psoriasis, could efﬁciently process pro- agents). LEKTI, which is expressed in the skin lesions of psoriasis,31 to

The groups of etretinate, steroid and vitamin D3 displayed release increased amounts of LEKTI active inhibitory domains. significantly lower KLK5 distributions in comparison with the KLK7 is believed to represent the major player of the chymo- normal subjects (P <0Æ05 for each comparison) (Fig. 3a). trypsin-like activity in normal skin.4,32 KLK7 proform is con- Furthermore, KLK5 levels in the etretinate group were signifi- verted to the active form in the psoriatic scales, and the cantly lower than those in the therapy ()), ciclosporin and chymotrypsin-like activity correlates with the amount of active PUVA groups (P <0Æ05 for each) (Fig. 3a). In the therapy KLK.21 However, in our study, despite the significantly differ- ()), etretinate, steroid and PUVA groups, the levels of KLK11 ent amounts of immunoreactive KLK7 between the nonlesional were significantly lower compared with normal subjects and lesional SC of psoriasis (Fig. 1), the RPY activity was sim- (Fig. 3b). No significant differences were detected in KLK14 ilar between these groups (Table 1). It seems that there is a among all therapy groups (Fig. 3c). However, several psoriasis discrepancy between the previously published and our present subjects in the ciclosporin, steroid or vitamin D3 groups data. Considering the preference of LEKTI inhibition towards ) showed a high KLK14 level (> 0Æ5ngmL 1) (Fig. 3c). The RPY activity26,28 (also our unpublished data), the similar SC levels of KLK6, KLK7, KLK8, KLK10 and KLK13 did not differ RPY activity among normal skin and psoriasis nonlesional and significantly in the same analysis (data not shown). lesional skin could be explained by an efficient inhibitory function by LEKTI domains. Discussion According to their kinetic properties, KLK5, KLK6, KLK8, KLK13 and KLK14 strongly display trypsin-like (FSR) activ- The present study aimed to quantify the tissue KLKs KLK5, ity.33–37 The elevation of FSR activity in the SC of psoriasis KLK6, KLK7, KLK8, KLK10, KLK11, KLK13 and KLK14 in the lesions was more prominent (Table 1) compared with that of SC and serum, as well as the overall serine protease activities KLK7. Hence, FSR activity by trypsin-like KLKs might over- in the SC of patients with psoriasis. These data were compared come LEKTI inhibition. The enzymatic activities towards FSR with those from normal subjects or analysed based on various and PFR substrates are both classified as ‘trypsin-like’ activity. factors such as lesional SC, nonlesional SC, phenotype, therapy However, the magnitude of elevation in the lesional SC of and severity. psoriasis was dissimilar between the substrates, suggesting KLKs contribute to the overall SC trypsin-like (FSR) and involvement of enzymes with distinct specificities. chymotrypsin-like (RPY) activities, which are known as As LEKTI also possesses anti-plasmin function,25 we meas- desquamation-related SC protease activities.4,10,11,22 The pro- ured overall SC ‘plasmin-like (VLK) activity’ in the SC (Table 1). lympho-epithelial Kazal-type-related inhibitor (LEKTI) is However, the elevated VLK activity in the lesions of patients believed to be a negative regulator of desquamation-related suggests that LEKTI may not be an efficient inhibitor for the proteases including KLKs.23–28 The furin-like activity of SC can overall SC ‘plasmin-like activity’. In addition, the plasmin-like proteolytically process pro-LEKTI at (R-KRfl) to 15 individual activity was significantly elevated even in the nonlesional SC, in bioactive domains.25,29,30 addition to the lesional SC of psoriasis (Table 1), suggesting LEKTI possesses an efficient inhibitory function towards the that this activity could be involved in a preinflammatory and/or overall FSR and RPY activities in the SC26,28 (also our unpub- inflammatory reaction in the SC of psoriasis.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 882 Aberrant kallikrein levels in psoriasis, N. Komatsu et al.

The levels of chymotrypsin-like KLK (KLK7) in the serum can mediate neutrophil migration/accumulation in skin tissue did not differ significantly among normal subjects and patients and in psoriatic lesions.41–43 Human airway trypsin-like prote- with psoriasis without and with therapy. Our data suggest that ase, extensively expressed in the epidermis of psoriatic lesions, chymotrypsin-like KLK in serum and the overall SC chymo- released IL-8 via PAR-2 signalling.40 Similarly, KLKs could play trypsin-like activity are unlikely to be significantly affected in a role in IL-8 release and/or neutrophil migration via PARs. psoriasis. PS-519, a synthetic proteasome inhibitor affecting the chymo- In normal SC, KLK6, KLK10, KLK13 and KLK14 are found trypsin-like activity of the 20s proteasome with limited activity at relatively low levels.4 However, these KLKs are significantly for serine proteases, reduced superantigen-mediated T-cell acti- increased in the lesional SC of psoriasis (Fig. 1). KLK6, KLK10 vation.44 In addition, PS-519 proved to be therapeutically and KLK13 levels were significantly elevated even in the non- effective in a xenogenic psoriasis transplantation model;44 lesional SC (Fig. 1), suggesting that their expression could hence KLKs could also be associated with T-cell activation. affect the emergence of the psoriatic lesion, e.g. the Ko¨bner The KLK–kinin system is an endogenous metabolic cascade, phenomenon and/or preinflammatory and inflammatory reac- catalysing the release of vasoactive kinins (bradykinin-related tions in nonlesional skin. KLK6, KLK8, KLK10 and KLK13 lev- peptides).45 KLK1 cleaves low-molecular-weight kininogen to els in serum were significantly correlated with PASI in therapy produce kinin peptide, which binds to kinin receptors and ()), but not in therapy (+) patients (Fig. 2). Taken together triggers a wide spectrum of biological effects, involving apo- with the elevation of KLK6, KLK10 and KLK13 in the non- ptosis, inflammation, proliferation, angiogenesis and neuro- lesional SC, these data suggest that these KLKs could be thera- genesis in different animal models.46,47 It is possible that peutic targets for this disease. some other KLKs might be involved in the KLK–kinin system KLK5 and KLK11 levels were significantly lower in the as well. Further studies are necessary to elucidate the point. serum of therapy (+) patients (Fig. 2), suggesting that their In summary, we report for the first time the quantification expression could be suppressed by therapies. In particular, of multiple KLKs in the SC and serum of patients with psori- etretinate might selectively affect KLK5 and KLK11 levels in asis. Our data suggest that KLKs, along with other proteolytic serum (Fig. 3). enzymes, might be involved in the pathogenesis of psoriasis. The distributions of KLK14 and KLK7 levels in the SC of The finding of aberrant KLK levels might help in the under- psoriasis were similar; these KLKs in the nonlesional SC are standing of the mechanisms of abnormal keratinization and within the normal range, while in half of the subjects the systemic inflammatory reactions commonly seen in psoriasis. lesional SC showed higher KLK7 or KLK14 values than the nor- Moreover, KLK levels seem to be modified by some therapies, mal subjects (Fig. 1). KLK14 possesses both trypsin-like and and KLKs could be candidate therapeutic targets in psoriasis. chymotrypsin-like kinetic properties towards synthetic sub- 37 strates, whereas KLK14 tends to act as a chymotrypsin-like Acknowledgments enzyme towards physiological substrates.38,39 The tendency of KLK14 to behave as a chymotrypsin-like enzyme could explain We thank the patients and our volunteers for generously pro- the similarity with KLK7. As high levels of KLK14 in serum viding samples, and Y. Yamada, M. Matsubara, Y. Obata, were observed only in the therapy (+) group (Fig. 2), KLK14 K. Hama, M. Sidiropoulos, B. Tsai, C.K. Cho and T. Yukami expression in serum could be affected by therapies. for their technical help. The distribution of KLK levels in ciclosporin and therapy ) ( ) groups tended to be similar (data not shown for KLK6, References KLK7, KLK8, KLK10 and KLK13), implying that ciclosporin might not affect KLK expression. 1 Bowcock AM, Krueger JG. Getting under the skin: the immuno- In serum, no significant difference was found in KLK levels genetics of psoriasis. Nat Rev Immunol 2005; 5:699–711. between psoriasis vulgaris and arthropathic psoriasis (Table 2). 2 Gottlieb AB. Psoriasis: emerging therapeutic strategies. Nat Rev Drug Discov 2005; 4:19–34. Therefore, KLKs are unlikely to be distinguishing factors for 3 Yousef GM, Diamandis EP. The new human tissue kallikrein gene these phenotypes. The patients with erythrodermic psoriasis family: structure, function, and association to disease. Endocr Rev showed significant elevations of all KLKs in serum compared 2001; 22:184–204. with normal, psoriasis vulgaris or arthropathic psoriasis 4 Komatsu N, Saijoh K, Sidiropoulos M et al. Quantification of human (Table 2). The regulation of KLKs in erythrodermic psoriasis tissue kallikreins in the stratum corneum: dependence on age and may thus be different from the other psoriatic forms. gender. J Invest Dermatol 2005; 125:1182–92. KLKs and PAR-2 are colocalized not only in normal skin, but 5 Komatsu N, Tsai B, Sidiropoulos M et al. Quantification of eight tissue kallikreins in the stratum corneum and sweat. J Invest Dermatol also in psoriatic lesions, where their expression extends into the 7,15,40 2006; 126:925–9. suprabasal layers. Together with the high levels of KLKs 6 Ekholm IE, Brattsand M, Egelrud T. Stratum corneum tryptic in the lesional SC, the increased KLK levels could contribute to enzyme in normal epidermis: a missing link in the desquamation an accelerated cell proliferation and/or inflammatory responses process? J Invest Dermatol 2000; 114:56–63. via PARs. Neutrophil migration, e.g. Munro’s microabscess, 7 Komatsu N, Saijoh K, Toyama T et al. Multiple tissue kallikrein into the skin lesion is one of the most specific features of psori- mRNA and protein expression in normal skin and skin diseases. asis. Accumulating evidence indicates that interleukin (IL)-8 Br J Dermatol 2005; 153:274–81.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 Aberrant kallikrein levels in psoriasis, N. Komatsu et al. 883

8 Ishida-Yamamoto A, Simon M, Kishibe M et al. Epidermal lamellar 29 Seidah NG, Chretien M. Proprotein and prohormone convertases: a granules transport different cargoes as distinct aggregates. J Invest family of subtilases generating diverse bioactive polypeptides. Brain Dermatol 2004; 122:1137–44. Res 1999; 848:45–62. 9 Ishida-Yamamoto A, Deraison C, Bonnart C et al. LEKTI is localized 30 Komatsu N, Takata M, Otsuki N et al. Elevated stratum corneum in lamellar granules, separated from KLK5 and KLK7, and is secre- hydrolytic activity in Netherton syndrome suggests an inhibitory ted in the extracellular spaces of the superficial stratum granulo- regulation of desquamation by SPINK5-derived peptides. J Invest sum. J Invest Dermatol 2005; 124:360–6. Dermatol 2002; 118:436–43. 10 Simon M, Jonca N, Guerrin M et al. Refined characterization of cor- 31 Bitoun E, Micheloni A, Lamant L et al. LEKTI proteolytic processing neodesmosin proteolysis during terminal differentiation of human in human primary keratinocytes, tissue distribution, and defective epidermis and its relationship to desquamation. J Biol Chem 2001; expression in Netherton syndrome. Hum Mol Genet 2003; 12:2417– 276:20292–9. 30. 11 Caubet C, Jonca N, Brattsand M et al. Degradation of corneodesmo- 32 Franzke CW, Baici A, Bartels J et al. Antileukoprotease inhibits stra- some proteins by two serine proteases of the kallikrein family, tum corneum chymotryptic enzyme. Evidence for a regulative SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J Invest Dermatol 2004; function in desquamation. J Biol Chem 1996; 271:21886–90. 122:1235–44. 33 Michael IP, Sotiropoulou G, Pampalakis G et al. Biochemical and 12 Yousef GM, Diamandis EP. Human tissue kallikreins: a new enzy- enzymatic characterization of human kallikrein 5 (hK5), a novel matic cascade pathway? Biol Chem 2002; 383:1045–57. serine protease potentially involved in cancer progression. J Biol 13 Brattsand M, Stefansson K, Lundh C et al. A proteolytic cascade of Chem 2005; 280:14628–35. kallikreins in the stratum corneum. J Invest Dermatol 2005; 124:198– 34 Magklara A, Mellati AA, Wasney GA et al. Characterization of the 203. enzymatic activity of human kallikrein 6: autoactivation, substrate 14 Ossovskaya VS, Bunnett NW. Protease-activated receptors: contri- specificity, and regulation by inhibitors. Biochem Biophys Res Commun bution to physiology and disease. Physiol Rev 2004; 84:579–621. 2003; 307:948–55. 15 Steinhoff M, Corvera CU, Thoma MS et al. Proteinase-activated 35 Oka T, Hakoshima T, Itakura M et al. Role of loop structures of receptor-2 in human skin: tissue distribution and activation of ker- neuropsin in the activity of serine protease and regulated secretion. atinocytes by mast cell tryptase. Exp Dermatol 1999; 8:282–94. J Biol Chem 2002; 277:14724–30. 16 Oikonomopoulou K, Hansen KK, Saifeddine M et al. Proteinase- 36 Kapadia C, Yousef GM, Mellati AA et al. Complex formation mediated cell signalling: targeting proteinase-activated receptors between human kallikrein 13 and serum protease inhibitors. (PARs) by kallikreins and more. Biol Chem 2006; 387:677–85. Clin Chim Acta 2004; 339:157–67. 17 Oikonomopoulou K, Hansen KK, Saifeddine M et al. Kallikrein- 37 Felber LM, Borgono CA, Cloutier SM et al. Enzymatic profiling mediated cell signalling: targeting proteinase-activated receptors of human kallikrein 14 using phage-display substrate technology. (PARs). Biol Chem 2006; 387:817–24. Biol Chem 2005; 386:291–8. 18 Christophi GP, Isackson PJ, Blaber S et al. Distinct promoters regu- 38 Komatsu N, Saijoh K, Otsuki N et al. Proteolytic processing of late tissue-specific and differential expression of kallikrein 6 in CNS human growth hormone by multiple tissue kallikreins and regula- demyelinating disease. J Neurochem 2004; 9:1439–49. tion by the serine protease inhibitor Kazal-Type5 (SPINK5) protein. 19 Blaber SL, Ciric B, Christophi GP et al. Targeting kallikrein 6 proteo- Clin Chim Acta 2007; 377:228–36. lysis attenuates CNS inflammatory disease. FASEB J 2004; 18:920–2. 39 Borgono CA, Michael IP, Komatsu N et al. A potential role for mul- 20 Gan L, Lee I, Smith R et al. Sequencing and expression analysis of tiple tissue kallikrein serine proteases in epidermal desquamation. the serine protease gene cluster located in chromosome 19q13 J Biol Chem 2007; in press. region. Gene 2000; 257:119–30. 40 Iwakiri K, Ghazizadeh M, Jin E et al. Human airway trypsin-like 21 Ekholm E, Egelrud T. Stratum corneum chymotryptic enzyme in protease induces PAR-2-mediated IL-8 release in psoriasis vulgaris. psoriasis. Arch Dermatol Res 1999; 291:195–200. J Invest Dermatol 2002; 122:937–44. 22 Suzuki Y, Koyama J, Moro O et al. The role of two endogenous 41 Rampart M, van Damme J, Zonnekeyn L et al. Granulocyte chemo- proteases of the stratum corneum in degradation of desmoglein-1 tactic protein/interleukin-8 induces plasma leakage and neutrophil and their reduced activity in the skin of ichthyotic patients. Br J accumulation in rabbit skin. Am J Pathol 1989; 135:21–5. Dermatol 1996; 134:460–4. 42 Gillitzer R, Ritter U, Spandau U et al. Differential expression of GRO- 23 Magert HJ, Standker L, Kreutzmann P et al. LEKTI, a novel alpha and IL-8 mRNA in psoriasis: a model for neutrophil migration 15-domain type of human serine proteinase inhibitor. J Biol Chem and accumulation in vivo. J Invest Dermatol 1996; 107:778–82. 1999; 274:21499–502. 43 Biasi D, Carletto A, Caramaschi P et al. Neutrophil functions and IL- 24 Chavanas S, Bodemer C, Rochat A et al. Mutations in SPINK5, enco- 8 in psoriatic arthritis and in cutaneous psoriasis. Inflammation 1998; ding a serine protease inhibitor, cause Netherton syndrome. 22:533–43. Nat Genet 2000; 25:141–2. 44 Zollner TM, Podda M, Pien C et al. Proteasome inhibition reduces 25 Mitsudo K, Jayakumar A, Henderson Y et al. Inhibition of serine superantigen-mediated T cell activation and the severity of psoriasis proteinases plasmin, trypsin, subtilisin A, cathepsin G, and elastase in a SCID-hu model. J Clin Invest 2002; 109:671–9. by LEKTI: a kinetic analysis. Biochemistry 2003; 42:3874–81. 45 Moreau ME, Garbacki N, Molinaro G et al. The kallikrein–kinin 26 Descargues P, Deraison C, Bonnart C et al. Spink5-deficient mice system: current and future pharmacological targets. J Pharmacol Sci mimic Netherton syndrome through degradation of desmoglein 1 2005; 99:6–38. by epidermal protease hyperactivity. Nat Genet 2005; 37:56–65. 46 Chao J, Bledsoe G, Yin H et al. The tissue kallikrein–kinin system 27 Egelrud T, Brattsand M, Kreutzmann P et al. hK5 and hK7, two ser- protects against cardiovascular and renal diseases and ischemic ine proteinases abundant in human skin, are inhibited by LEKTI stroke independently of blood pressure reduction. Biol Chem 2006; domain 6. Br J Dermatol 2005; 153:1200–3. 387:665–75. 28 Schechter NM, Choi EJ, Wang ZM et al. Inhibition of human kallik- 47 Emanueli C, Minasi A, Zacheo A et al. Local delivery of human tis- reins 5 and 7 by the serine protease inhibitor lympho-epithelial sue kallikrein gene accelerates spontaneous angiogenesis in mouse Kazal-type inhibitor (LEKTI). Biol Chem 2005; 386:1173–84. model of hindlimb ischemia. Circulation 2001; 103:125–32.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp875–883 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2007.07770.x Establishment of a mouse skin model of the licheniﬁcation in human chronic eczematous dermatitis Y. Matsunaga,* Y. Ogura,* R. Ehama,* S. Amano,* T. Nishiyama* and H. Tagami *Skin Biology Research Laboratories, Shiseido Life Science Research Center, 2-12-1 Fukuura, Kanazawa-ku, Yokohama 236-8643, Japan Department of Matrix Biology, Tokyo University of Agriculture and Technology, 3-8-1 Saiwai-cho, Fuchu-city, Tokyo, Japan Department of Dermatology, Tohoku University School of Medicine, 1-1 Seiryo-cho, Sendai-city, Miyagi, Japan

Summary

Correspondence Background Repeated mechanical stresses, such as scratching and rubbing, on a Yukiko Matsunaga. lesional skin area induce a rough skin condition known as lichenification in E-mail: [email protected] patients with chronic eczematous dermatitis. For ethical reasons, the pathomechanisms involved are difficult to study, so an animal model is required. Accepted for publication 31 August 2006 Objectives To study the pathomechanisms of the unique rough skin changes seen in chronic eczematous dermatitis, we established a mouse skin model by repeat- Key words ed tape stripping to inflict stratum corneum (SC) barrier disruption. The skin barrier disruption, epidermal hyperplasia, characteristics of the model were investigated biologically, histologically and lichenification, wrinkle formation pharmacologically. Conflicts of interest Methods Tape stripping was done on mouse back skin three times a week for None declared. 4 weeks. The skin changes were studied by obtaining negative replicas, haematoxylin and eosin staining, immunostaining for CD31 and BrdU, and measuring epidermal and cutaneous thickness and skin capacitance. Activities of matrix metalloproteinase (MMP)-2, 9 and urokinase-type plasminogen activator (uPA) in the skin tissues were analysed by zymography. The effects of MMP inhibitor and glycine were assessed. Results The repeated tape stripping produced crusting and desquamation at 48 h, followed 1 week later by the formation of shallow furrows, which became much deeper after 4 weeks, appearing as fine and regular wrinkles. The resultant wrinkled skin resembled lichenified skin seen in patients with chronic eczematous dermatitis. Histopathologically, we found acanthosis, hypergranulosis and hyperkeratosis even at 48 h, and the skin was 2Æ5 times thicker than untreated control skin at 4 weeks. We observed angiogenesis in the upper dermis at 1 and 4 weeks. Skin capacitance, a parameter of SC hydration, displayed consistently low levels throughout the experimental period. Although the dermis was also thickened, the activity of MMP-9 was sharply increased only at 24 and 48 h after tape stripping, declining thereafter to the control level. Topical applications of CGS-27023A (CGS), an MMP inhibitor, failed to suppress this tape-stripping-induced wrinkle formation. In contrast, topical applications of a barrier recovery accelerator, glycine, effectively inhibited the wrinkle formation induced by repeated tape stripping. Conclusions The induction of fine and regular wrinkles by inflicting chronic SC barrier disruption in this model involves mainly epidermal changes, which is in sharp contrast to the mainly dermal changes induced by chronic ultraviolet B irradiation.

Persistent mechanical stresses, such as scratching, inflicted on human patients with chronic eczematous dermatitis, such as pruritic skin trigger the development of unique rough skin atopic dermatitis and lichen simplex chronicus. changes, known as lichenification. However, for ethical rea- The outermost layer of the skin, the stratum corneum sons it has been difficult to conduct systematic studies on the (SC), not only provides protection against a wide variety of pathomechanisms underlying this common skin problem in environmental stresses, such as chemical and physical stresses,

2007 The Shiseido 884 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp884–891 Chronic barrier disruption induces ﬁne wrinkles, Y. Matsunaga et al. 885

) ) including ultraviolet (UV) light, but also plays a crucial role when TEWL reached 7~10 mg cm 2 h 1, monitored with an in the prevention of water loss from the living cutaneous tis- electrolytic water analyser (Meeco, Warrington, PA, U.S.A). sues. The SC is easily damaged by mechanical stresses, such as This procedure was conducted three times per week for scratching, leading to an increase in transepidermal water loss 4 weeks. Clinical observation, biophysical measurements and (TEWL) and a decrease in SC hydration, together with desqua- histological study of the skin were carried out at 48 h and at mation that lasts for more than a week in humans.1 Such 1 and 4 weeks after the first tape stripping. cutaneous barrier disruption is experimentally inducible by various methods, including applications of detergents (e.g. Biophysical measurements of the skin sodium dodecyl sulfate, SDS), defatting with acetone and physical insults, such as tape stripping, which remove SC cell Negative replicas of the skin surface were taken by using a sili- layers. Acute disruption of the permeability barrier with tape con-based gum material, SILFLO (Flexico Developments, Pot- stripping has been reported to trigger a rapid homeostatic ters Bar, Herts, U.K.).4 The image of the negative replicas was response to restore normal barrier function,1,2 with subse- observed with a wrinkle analysis system (Hamano Engineering, quent induction of epidermal cytokine production, as well as Kawasaki, Japan). Skin capacitance, a parameter of SC hydra- epidermal proliferation.2 Recently, several chemicals, including tion, was evaluated with a Corneometer CM825 PC (Cour- glycine,3 have been reported not only to facilitate barrier age + Khazaka Electric, Koln, Germany). The values obtained recovery, but also to inhibit such epidermal hyperplasia. were determined as the average of five measured values at the In the present study, we investigated the skin changes that same skin region, and the ratio of those measured at the treated are produced by repeated barrier disruption with tape stripping skin vs. those at the control skin was calculated. Skin thickness in hairless mice. We found that the repeated barrier disruption was measured three times at the same site with a dial thickness increased skin thickness, and this resulted in the formation of gauge (Ozaki Mfg, Ozaki, Japan), and the ratio of that meas- fine and regular wrinkles resembling those of the lesional skin ured at the treated region vs. that of the control was calculated. found in patients with chronic eczematous dermatitis. Increased matrix metalloproteinase (MMP)-9 activity, which is Analysis of epidermal proliferative activity persistent in UVB-induced wrinkled skin, was found only in the early stage of the tape-stripping-induced skin changes, and The proliferative activity of the epidermis was evaluated with an application of a synthetic MMP inhibitor did not suppress tape- immunoperoxidase method employing monoclonal anti-BrdU stripping-induced wrinkle formation. In contrast, a barrier antibody (Oxford Biotechnology Ltd., Oxford, U.K).5 Briefly, recovery enhancer, glycine,3 effectively suppressed tape-strip- each mouse was injected intraperitoneally with BrdU (Sigma, ) ) ping-induced thickened skin. These findings suggest that the St Louis, MO, U.S.A.) 0Æ65 mmol L 1 kg 1 body weight 2 h fine and regular wrinkles induced by chronic barrier disruption before sacrifice for the immunohistological examination. in mice involve mainly epidermal changes, in contrast to the dermal changes involved in UVB-induced wrinkle formation. Histopathological studies

Materials and methods Skin samples were fixed with cold acetone, and embedded by the AMeX method.6 Briefly, the acetone-fixed skin was immersed in methyl benzoate and xylene and then embedded Animals in paraffin. Sections (3-lm) were stained with haematoxylin We used male albino hairless HOS: HR-1 mice purchased and eosin. Immunohistochemical staining was performed with from Hoshino Laboratory Animals Co., Ltd. (Saitama, Japan). the SAB (streptavidin–biotin) method as described7 using rat They were approximately 6 weeks old at the start of the antimouse CD31 antibody (Pharmingen, San Diego, CA, experiment and were fed water and a commercial diet U.S.A) or rat antibromodeoxyuridine (BrdU) monoclonal anti- (CRF-1, Oriental Yeast Co., Ltd., Tokyo, Japan) ad libitum. All body (Oxford Biotechnology) as a primary antibody. The the invasive experiments, including barrier disruption and skin sections were incubated with biotin-labelled antirat IgG biopsy, as well as the applications of the test samples, were (DakoCytomation, Glostrup, Denmark) and then with peroxi- carried out under nembutal anaesthesia. All procedures were dase-labelled streptavidin (Nichirei, Tokyo, Japan). Epidermal approved by the Animal Research Committee of the Shiseido thickness was measured by using image analysis software, Research Center in accordance with the National Research Win Roof (Mitani Corporation, Tokyo, Japan). Council Guide (1996). Detection of matrix metalloproteinase and urokinase-type Experimental procedures plasminogen activator in skin extract

Barrier disruption was achieved by repeated application and Skin samples were frozen in liquid nitrogen, and crushed in a removal (tape stripping) of cellophane tape (Nichiban, Hid- cryopress (Microtech Nichion, Chiba, Japan). Protein was aka, Japan) on the dorsal skin of the left side. The right side extracted into 100 lL of extraction buffer consisting of ) of the back served as a control. Tape stripping was terminated 0Æ05 mol L 1 Tris-HCl buffer (pH 7Æ4), 0Æ25% Triton X-100,

2007 Shiseido Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp884–891 886 Chronic barrier disruption induces ﬁne wrinkles, Y. Matsunaga et al.

)1 10 mmol L ethylenediamine tetraacetic acid and 1% protein- Results ase inhibitor cocktail (added to improve the extraction effi- ciency of MMP; from Sigma-Aldrich, Tokyo, Japan) from Repeated barrier disruption with tape stripping produced samples corresponding to 10 mg wet weight, by rotation for fine and regular wrinkles in hairless mouse skin 2 h at 4 C. The skin extract solution was centrifuged at 61 g at 4 C for 30 min, and the supernatant was used for gelatin Dorsal skin after repeated tape stripping (TS) developed fine or fibrin zymography. and regular wrinkles that were perpendicularly arranged to the Gelatin zymography was performed on the skin extracts by vertebral line at 4 weeks after the start of tape stripping using 7Æ5% SDS-polyacrylamide gel co-polymerized with 0Æ2% (Fig. 1a). Negative replicas of the skin were taken with SILFLO gelatin, as described previously.8 The activity of urokinase-type (Flexico Developments), which showed only a fine texture in plasminogen activator (uPA) of the epidermis was evaluated by the case of nontreated control mouse skin (Fig. 1b1). In con- using 7Æ5% SDS-PAGE (polyacrylamide gel electrophoresis) gel trast, the dorsal skin after tape stripping revealed an apparently containing plasminogen, fibrinogen and thrombin as described rough pattern of texture, even at 48 h after tape stripping previously.9,10 The activity of the plasminogen activation system (Fig. 1b2). Furrows that tended to be oriented in the same was detected as a transparent band on the blue background of direction began to be formed at 1 week (Fig. 1b3), becoming the Coomassie blue-stained gels in the 51-kDa region. The much deeper at 4 weeks after the start of tape stripping intensity of bands of stained gels was quantified by measuring (Fig. 1b4). the optical density with a CS analyser (Atto, Tokyo, Japan). Microscopic characteristics of skin after repeated barrier Topical treatment with various reagents disruption indicated the occurrence of epidermal proliferation and dermal angiogenesis N-Hydroxy-2(R)-[[(4-methoxyphenyl) sulfonyl](3-picolyl) amino]-3-methylbutanamide hydrochloride (CGS27023A; Histopathologically, the skin after repeated barrier disruption CGS) was synthesized at Shiseido Co. Ltd (Yokohama, Japan) displayed a thickened epidermis associated with hypergranu- according to the method described in the literature.11 Glycine losis and hyperkeratosis as early as 48 h after the first tape was purchased from Nacalai Tesque (Kyoto, Japan). CGS (1%) stripping (Fig. 2b), and this lasted throughout the experi- ) and glycine (1 mmol L 1) were each dissolved in 50% eth- mental period (Fig. 2d), while nontreated control skin anol, and 100-lL aliquots were applied to the dorsal skin on showed two~three layers of epidermal cells covered with the left side three times weekly for 4 weeks, just after tape- thin SC (Fig. 2a). stripping barrier disruption. At the end of the study, skin sam- Despite these epidermal changes, inflammatory cells were ples were obtained from both sides of the flank. They were rather sparse in the dermis in the skin after repeated barrier fixed, embedded and sectioned as described above, and disruption (Fig. 2b–d). However, the number and size of stained with haematoxylin and eosin. blood vessels visualized with anti-CD31 antibody were clearly increased in the upper dermis of the tape-stripping-treated skin at 1 and 4 weeks (Fig. 3c, d) compared with those of the Statistics untreated controls (Fig. 3a). The data are presented as the mean values ± SD. Statistical sig- Immunohistochemically, the number of BrdU-positive basal nificance was determined by analysis of variance (ANOVA) and cells per 100 lm of basement membrane in the epidermis P-values were calculated using Fisher’s protected least signifi- was greatly increased at 48 h after the first tape stripping, cant difference test. being statistically significantly higher even after 1 week

(a) (b) Fig 1. Wrinkle formation by repeated barrier disruption in mouse dorsal skin. Wrinkles induced after 4 weeks by repeated tape stripping (a). Negative replicas of the mouse TS dorsal skin. In nontreated control hairless mouse, the skin surface showed only ﬁne 1 2 NT texture (b1). Dorsal skin subjected to tape stripping revealed a rough pattern of texture at 48 h (b2) after the ﬁrst tape stripping. Furrows oriented in the same direction began to be formed at 1 week (b3), and became deeper at 4 weeks after the start of tape 3 4 stripping (b4). Arrowhead: wrinkle. Bars: 2 mm. TS, tape stripping; NT, nontreated.

(a) (b) dermis and subcutaneous tissue), measured as skin-fold thickness, was increased in the tape-stripping-treated back (Fig. 5b). The ratio of the tape stripping site to control site increased dramatically [48 h (+13%), 1 week (+20%) and 4 weeks (+29%)], indicating that dermal hyperplasia was also induced by the repeated barrier disruption, as the increase in epidermal thickness was much less than that of the total skin thickness. (c) (d) Skin capacitance measurements showed a significant reduction in the skin after repeated barrier disruption. The values obtained were consistently decreased in the tape stripping skin; as shown in Figure 6, they were reduced by 58% at 48 h, by 41% at 1 week and by 39% at 4 weeks after the start of tape stripping, compared with that of the nontreated control skin. TEWL values were significantly increased by 20–30-fold immediately after tape stripping at each time point. However, Fig 2. Chronic barrier-disruption-induced hyperkeratosis and at 4 weeks after the start of tape-stripping treatment, the epidermal hyperplasia. Normal skin (a) showed thin stratum corneum TEWL value measured at 48 h after the last tape-stripping ) ) and two~three layers of keratinocytes in the epidermis (haematoxylin treatment was 0Æ6±0Æ11 mg cm 2 h 1, which was still ) ) and eosin staining). At 48 h (b), 1 week (c) and 4 weeks (d) after the significantly higher than that of 0Æ3±0Æ05 mg cm 2 h 1 first tape stripping, the epidermal layer increased in thickness by up to observed in nontreated controls, as reported by Denda et al.12 two~three-fold, concomitantly with hyperkeratosis. Bars: 200 lm.

(a) (b) Urokinase-type plasminogen activator in the skin extract was elevated until 48 h after tape stripping

Elevation in uPA activity was observed at 24 and 48 h after tape stripping, but not at later time points. The uPA activity was increased 68% ± 26% at 24 h and 56% ± 8Æ8% at 48 h compared with that of the control skin, but after 1 week there was no signiﬁcant difference between the tape-stripped sites (c) (d) and control sites.

Matrix metalloproteinases contributed only weakly to the wrinkle formation induced by repeated barrier disruption

We next examined the role of MMPs in wrinkle formation in the skin after repeated barrier disruption, because MMPs were reported to play an important role in the wrinkle formation Fig 3. Increased number of blood vessels in barrier-disrupted mouse observed in chronically UVB-irradiated mice. Both MMP-9 skin. Blood vessels were stained immunohistochemically using anti- (gelatinase B) and MMP-2 (gelatinase A) are well known to CD31 antibody. The number of blood vessels was not changed at degrade the extracellular matrix of the dermis, including 48 h (b) after the first tape stripping compared with the control (a), certain types of collagen, laminin, elastin, fibronectin and but began to increase at 1 week (c), and continued to increase at 8,13 4 weeks (d). Arrow: blood vessels, Bars: 50 lm. proteoglycans. We analysed the MMP activities by gelatin zymography. Although pro-MMP-9 showed a marked rise at compared with the nontreated control skin (Fig. 4a2, b). Such 24 and 48 h after the first tape stripping, it subsequently a tendency for enhanced epidermal proliferation was still returned to the control level. The level of MMP-2 was apparent 4 weeks later, although it was no longer statistically unchanged throughout the experimental period (Fig. 7a). significant (Fig. 4a4, b). Topical applications of CGS conducted just after each tape stripping had no effect on the wrinkle formation compared with that of the vehicle-treated mice after 4 weeks (Fig. 7b). Biophysical measurements of skin after repeated barrier Measurements of epidermal thickness performed in haematox- disruption showed increased skin thickness and reduced ylin and eosin sections (not shown) showed a reduction in hydration of the stratum corneum epidermal hyperplasia only at 24 h. However, there was no The epidermal thickness was significantly increased compared clear difference between the CGS-treated and a vehicle-treated with that at the control site from 48 h through to the end of mouse at 4 weeks, and a similar increase in the epidermal the experiment (Fig. 5a). The total skin thickness (epidermis, thickness was noted in both (Fig. 7c).

2007 Shiseido Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp884–891 888 Chronic barrier disruption induces ﬁne wrinkles, Y. Matsunaga et al.

(a) (b)

m 5 µ ** TS 4 NT 1 2 3 *** 2

1 basement membrane

BrdU positive cells/100 0 48 h 1 week 4 weeks

3 4

Fig 4. BrdU-positive cells increased after barrier disruption. Immunohistochemical staining by anti-BrdU antibody showed few positive cells in nontreated (NT) control hairless mouse (a1). The number of BrdU-positive cells was signiﬁcantly increased at 48 h and 1 week after tape stripping (TS) (a2, 3), and had returned to the control level at 4 weeks (a4). Data in (b) are expressed as the means (n ¼ 3) ± SD, **P <0Æ01, ***P <0Æ001. Bars: 200 lm.

100 (a) 50 NT *** *** *** 40 TS 80

30 60

(µm) 20 40 10 TS (% of control)

0 20 48 h 1 week 4 weeks Before 48 h 1 week 4 weeks (b) 1·4 Fig 6. Changes of skin capacitance induced by chronic barrier disruption. Skin capacitance showed the lowest value (about 40% of 1·3 the control) at 48 h after tape stripping. It subsequently remained at about 60% of the control. TS, tape stripping. 1·2

1·1

Ratio of TS to NT vehicle in the barrier-disrupted mice revealed apparent hyperkeratosis, hypergranulosis and epidermal hyperplasia compared 1 Before48 h 1 week 4 weeks with the nontreated control mouse skin, whereas glycine treatment remarkably inhibited such epidermal hyperplasia, as Fig 5. Changes of epidermal and cutaneous thickness caused by shown in Figure 8b. chronic barrier disruption. comparison of epidermal thickness in Epidermal and dermal thickness measured in haematoxylin nontreated and tape-stripped skin. The epidermal thickness increased and eosin sections showed a signiﬁcant suppression of the two~three-fold from 48 h to 4 weeks in tape-stripped skin. tape-stripping-induced increases in both epidermal and dermal (b) Changes of dorsal skin thickness caused by repeated barrier thickness at glycine-treated sites compared with vehicle-treated disruption. The skin thickness of the tape-stripped side gradually sites (Fig. 8c). increased compared with that of the nontreated site. Data in (a) and (b) are expressed as the means (n ¼ 5) ± SD, ***P <0Æ001. NT, nontreated; TS, tape stripped. Discussion

In the present study, we found that repeated barrier disruption Topical glycine applications suppressed wrinkle of hairless mouse skin with tape stripping increased skin formation in the barrier-disrupted mice thickness and resulted in the formation of fine and regular The tape-stripping-induced wrinkle formation was markedly wrinkles simulating the lesional skin of lichenification noted inhibited by topical applications of glycine (Fig. 8a). This was in human patients with chronic eczematous dermatitis, such confirmed histopathologically; the dorsal skin treated with the as atopic dermatitis and lichen simplex chronicus.

(a) 24 h 48 h 1 week 2 weeks 4 weeks T N TNN TNTNN TTNN T T N T

Pro-MMP-9

Pro-MMP-2 Active-MMP-2 T: TS N: no treatment (control) (b) (c) CGS Vehicle 50 CGS 40 Veh

30 * (µm) 20

10 24 h 48 h 4 weeks

Fig 7. Cutaneous matrix metalloproteinase (MMP)-9 activity and the effects of MMP inhibitor in chronically barrier-disrupted mice. (a) MMP-9 and MMP-2 activities were analysed by gelatin zymography and compared between tape-stripped skins (T and/or TS) and nontreated control skins (N). Pro-MMP-9 rose markedly at 24 h and 48 h after the ﬁrst tape stripping, and subsequently returned to the control level. MMP-2 was not affected by the barrier disruption. (b) Visible changes in chronic barrier-disrupted mice after 4 weeks (negative replica). CGS-27023A (CGS) did not suppress the wrinkle formation induced by chronic barrier disruption. (c) Data of epidermal thickness as measured in haematoxylin and eosin sections (not shown). CGS suppressed epidermal hyperplasia only at 24 h after tape stripping. Data in (c) are expressed as means (n ¼ 5) ± SD, *P <0Æ05.

(a) (c) Glycine Vehicle NT 80 70 *** NT 60 Vehicle *** * Glycine Fig 8. Glycine-suppressed induction of 50 wrinkle formation in chronically barrier- 40 (µm) disrupted mice. (a) Skin negative replicas of 30 20 the dorsal skin after topical applications of (b) 10 0 glycine for 4 weeks. The wrinkle formation Epidermal thickness was strongly inhibited by glycine at 4 weeks. Vehicle-treated skin showed ﬁne wrinkles. 900 *** NT (b) Histological analysis revealed that the 800 Vehicle Glycine topical application of glycine signiﬁcantly 700 *** * Glycine Veh 600 suppressed epidermal hyperplasia at 4 weeks. 500

(µm) 400 (c) Comparison of epidermal and dermal 300 thickness among control (NT), glycine- 200 100 applied skin and vehicle-treated skin at 0 4 weeks. Data in (c) are expressed as means Dermal thickness NT (n ¼ 5) ± SD, *P <0Æ05. Bars: 200 lm.

Epidermal hyperplasia, reduced SC hydration and increased the mechanisms underlying the wrinkled skin induced by TEWL, in addition to infiltration of T cells and eosinophils, repeated mechanical stresses, such as scratching and rubbing, were induced in dorsal skin of mouse models with repeated as occurs in chronic eczematous dermatitis, the tape-stripping- topical application of an allergen, such as TNCB (2,4,6- induced model seems to be much simpler and more suitable trinitro-1-chlorobenzene) or ovalalbumin.14,15 Moreover, epi- than chemically induced models. dermal hyperplasia and dermal oedema, as well as increased Epidermal hyperplasia associated with hypergranulosis, as inflammatory cytokines, including interleukin-1a and tumour seen in the present model, is characteristic of chronic necrosis factor-a, are well known to be induced on dorsal superficial dermatitis, such as lichen simplex chroni- mouse skin by repeated topical treatment with TPA (phorbol cus.18 In contrast, parakeratosis with lack of the granular 12-myristate-13-acetate).16,17 Recently, we found that such layer is found in acute spongiotic dermatitis, such as occurs repeated TPA application on mouse dorsal skin also induced in psoriasis or when there is a defect in keratinocyte differen- the formation of wrinkles similar to those observed in mice tiation, as is found in porokeratosis and inflammatory linear after repeated barrier disruption (M. Shibata and S. Amano, verrucous epidermal naevus. Although parakeratosis may also unpublished data). Therefore, the skin changes are basically be observed in the early stage of barrier disruption after similar among these animal models. However, for analysis of tape stripping, hypergranulosis was predominantly observed

2007 Shiseido Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp884–891 890 Chronic barrier disruption induces fine wrinkles, Y. Matsunaga et al. throughout virtually the whole experimental period in the predominantly underlie the wrinkle formation in this barrier- present model. disrupted mouse model. In general, human skin wrinkles can be classified into three During studies to explore possible mechanisms contributing types, i.e. graphic, crinkled and linear wrinkles, based on their to the wrinkle formation coupled with epidermal and dermal appearance.19 Graphic wrinkles caused by photoageing appear hyperplasia, we found that an unsaturated fatty acid, oleic as deep wrinkles developing in sun-exposed skin, being char- acid, deepened the wrinkles associated with epidermal hyper- acterized by the presence of abundant dystrophic elastic mate- plasia (data not shown). Katsuta et al.26 found that unsaturated rials and an increase in glycosaminoglycans, together with fatty acids promoted calcium influx into keratinocytes, induc- damaged collagen fibres in the dermis.20,21 A photoageing ing abnormal differentiation of the epidermis. Furthermore, model in hairless mice exposed to low-dose UVB irradia- Denda et al.3 observed that the influx of calcium into keratino- tion has been established to characterize the mechanisms cytes through ionotropic receptors delayed barrier recovery, involved.22 whereas chloride ion influx accelerated barrier recovery after Recently, it was reported that matrix-degrading enzymes tape stripping. Glycine receptor was found to play an import- contribute to the changes of the extracellular matrix in sun- ant role in the inhibition of calcium influx, as an activator of exposed skin.23 We previously reported significant increases in the chloride channel.27 Importantly, the existence of glycine MMP-2 and MMP-9 activities in whole UVB-irradiated skin receptor subunit in the epidermis has been confirmed.3 Thus, throughout the experimental period, together with many dis- we studied the effect of topical applications of glycine on the ruptions of basement membrane structure. Moreover, repeated skin after tape stripping. We observed a prominent suppressive applications of CGS, an MMP inhibitor, not only successfully effect of glycine on the wrinkle formation after tape stripping, prevented UVB-induced damage to the basement membrane, which suggests that glycine binding to a glycine receptor in but also suppressed epidermal hyperplasia and dermal collagen the epidermis induces an influx of chloride ion into keratino- degradation.8 cytes, leading to normal proliferation. We speculate that influx Hence, in the present study, we also investigated the MMP of chloride ion via the glycine receptor may be the key to pre- activity in the barrier-disrupted mice. However, an increase of venting the wrinkle formation associated with epidermal MMP-9 activity was detected only in the early stage of the hyperplasia after repeated barrier disruption. experimental period, in contrast to the findings in UVB-irradi- In the present mouse model, it is of interest that, after tape ated mice. Furthermore, our electron microscopic study stripping, the duration of elevated TEWL, indicating SC barrier revealed no disruption of the basement membrane structure at abnormalities, was rather short, in contrast to the persistent 2 weeks after tape stripping (data not shown). Most of all, reduction in the hydration state of the skin surface. These topical applications of CGS had no suppressive effect on the findings indicate that the SC barrier function should be restored skin changes in these barrier-disrupted mice at 4 weeks com- quickly when it is impaired, especially in pathological skin, to pared with the control mouse skin, although there was some prevent dehydration and invasion of various injurious agents. effect in the initial 24 h. From these findings, it seems un- In daily life, reduced skin surface hydration is associated with likely that MMPs are major contributors to wrinkle formation fine scaling and superficial cracking, which is clinically in this chronic barrier-disruption model, which displays both observed as dry skin, and tends to induce involuntary scratching epidermal and dermal hyperplasia. due to a decreased cutaneous sensorial threshold for pruritus.21 Based on these data, it seems likely that the epidermal pro- Thus, it is important to use appropriate skin care, e.g. with liferation is essential for the induction of fine and regular moisturizing agents, to prevent exacerbation of clinically wrinkles. The plasminogen/plasmin system in the epidermis is invisible, underlying inflammation, which facilitates the entry thought to be a major protease system involved in the positive of various irritants and allergens from the environment.22 regulation of epidermal cell proliferation, because it is report- There are reports indicating that UVB irradiation is a major ed that basal keratinocytes consistently express uPA in the factor inducing vascular hyperpermeability and dilatation of hyperproliferative state of the epidermis.24 Katsuta et al.25 dermal blood vessels.23 In UVB-irradiated skin, upregulation found that uPA is activated in the SC after barrier disruption. of vascular endothelial cell growth factor, basic fibroblast Using anti-BrdU-immunostained sections of repeatedly bar- growth factor and other angiogenetic factors is thought to rier-disrupted skin, we confirmed that the basal keratinocytes play an important role in angiogenesis. In the present study, exhibited an increased proliferation rate at 48 h and 1 week we found that repeated barrier disruption by tape stripping after tape stripping. Therefore, we suspected that an increase also induced angiogenesis in the papillary dermis, resembling in uPA activity might be involved in the epidermal hyperplasia that found in photoaged skin. Therefore, it is important to observed in the repeatedly barrier-disrupted mice. However, investigate the expression of angiogenic factors and the influ- our data showed an increase in uPA activity only in the early ence of signal transduction pathways, especially those in the stage of the experiment, i.e. at 24 h and 48 h after tape strip- epidermis, associated with angiogenesis of the dermis in ping, and this was not maintained at 4 weeks. Taken together, barrier-disrupted mice. our present data suggest that, although the repeated barrier In the present study, we succeeded in establishing a new disruption increases uPA activity as well as MMP-9 in the early mouse wrinkle model via chronic barrier disruption of the SC, stages, mechanisms other than activation of MMP or uPA may and showed that the mechanism of wrinkle formation in this

2007 Shiseido Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp884–891 Chronic barrier disruption induces fine wrinkles, Y. Matsunaga et al. 891 model is distinct from that of wrinkles associated with photo- inhibitor that blocks cartilage degradation in rabbits. J Med Chem ageing. This barrier-disruption model should be useful for 1997; 40:2525–32. identifying topical agents that prevent wrinkle induction under 12 Denda M, Kitamura K, Elias PM et al. trans-4-(Aminomethyl)cyclo- hexane carboxylic acid (T-AMCHA), an anti-fibrinolytic agent, dry environmental conditions, as well as studying the mechan- accelerates barrier recovery and prevents the epidermal hyperplasia ism of lichenification in patients suffering from chronic ecze- induced by epidermal injury in hairless mice and humans. J Invest matous dermatitis, such as atopic dermatitis and lichen Dermatol 1997; 109:84–90. simplex chronicus. 13 Reynolds JJ. Collagenases and tissue inhibitors of metalloproteinases: a functional balance in tissue degradation. Oral Dis 1996; 2:70–6. 14 Matsumoto K, Mizukoshi K, Oyobikawa M et al. Establishment of Acknowledgment an atopic dermatitis-like skin model in a hairless mouse by repeated elicitation of contact hypersensitivity that enables to conduct We thank Dr Mitsuhiro Denda for his valuable technical advice functional analyses of the stratum corneum with various non- and helpful discussions. invasive biophysical instruments. Skin Res Technol 2004; 10:122–9. 15 Savinko T, Lauerma A, Lehtimaki S et al. Topical superantigen References exposure induces epidermal accumulation of CD8+ T cells, a mixed Th1/Th2-type dermatitis and vigorous production of IgE 1 Tagami H, Yoshikuni K. Interrelationship between water-barrier antibodies in the murine model of atopic dermatitis. J Immunol and reservoir functions of pathologic stratum corneum. Arch Dermatol 2005; 175:8320–6. 1985; 121:642–5. 16 Wilmer JL, Burleson FG, Kayama F et al. Cytokine induction in 2 Denda M, Wood LC, Emami S et al. The epidermal hyperplasia human epidermal keratinocytes exposed to contact irritants and its associated with repeated barrier disruption by acetone treatment relation to chemical-induced inflammation in mouse skin. J Invest or tape stripping cannot be attributed to increased water loss. Dermatol 1994; 102:915–22. Arch Dermatol Res 1996; 288:230–8. 17 Murakawa M, Yamaoka K, Tanaka Y et al. Involvement of tumor 3 Denda M, Fuziwara S, Inoue K. Influx of calcium and chloride ions necrosis factor (TNF)-alpha in phorbol ester 12-O-tetradecanoyl- into epidermal keratinocytes regulates exocytosis of epidermal phorbol-13-acetate (TPA)-induced skin edema in mice. Biochem lamellar bodies and skin permeability barrier homeostasis. J Invest Pharmacol 2006; 71:1331–6. Dermatol 2003; 121:362–7. 18 Weedon D. Skin Pathology. New York: Churchill Livingstone, 2002, 4 Kambayashi H, Odake Y, Takada K et al. Involvement of changes in 86. stratum corneum keratin in wrinkle formation by chronic ultra- 19 Kligman AM, Zheng P, Lavker RM. The anatomy and pathogenesis violet irradiation in hairless mice. Exp Dermatol 2003; 2:22–7. of wrinkles. Br J Dermatol 1985; 113:37–42. 5 Rahman SA, Tsuyama S. Immunohistochemical study of cell prolif- 20 Mitchell RE. Chronic solar dermatosis: a light and electron eration and differentiation in epidermis of mice after administra- microscopic study of the dermis. J Invest Dermatol 1967; 48:203–20. tion of cholera toxin. Arch Dermatol Res 1993; 285:27–31. 21 Uitto J, Fazio MJ, Olsen DR. Molecular mechanisms of cutaneous 6 Sato Y, Mukai K, Watanabe S et al. The AMeX method. A simplified aging. Age-associated connective tissue alterations in the dermis. technique of tissue processing and paraffin embedding with J Am Acad Dermatol 1989; 21:614–22. improved preservation of antigens for immunostaining. Am J Pathol 22 Kligman LH, Akin FJ, Kligman AM. Prevention of ultraviolet dam- 1986; 125:431–5. age to the dermis of hairless mice by sunscreens. J Invest Dermatol 7 Amano S, Ogura Y, Akutsu N et al. Protective effect of matrix met- 1982; 78:181–9. alloproteinase inhibitors against epidermal basement membrane 23 Kligman LH, Gebre M, Alper R et al. Collagen metabolism in ultra- damage: skin equivalents partially mimic photoageing process. Br J violet irradiated hairless mouse skin and its correlation to histo- Dermatol 2005; 153 (Suppl. 2):37–46. chemical observations. J Invest Dermatol 1989; 93:210–14. 8 Inomata S, Matsunaga Y, Amano S et al. Possible involvement of 24 Jensen PJ, Lavker RM. Modulation of the plasminogen activator cas- gelatinases in basement membrane damage and wrinkle formation cade during enhanced epidermal proliferation in vivo. Cell Growth in chronically ultraviolet B-exposed hairless mouse. J Invest Dermatol Differ 1996; 7:1793–804. 2003; 120:128–34. 25 Katsuta Y, Yoshida Y, Kawai E et al. Urokinase-type plasminogen 9 Herouy Y, Trefzer D, Hellstern MO et al. Plasminogen activation in activator is activated in stratum corneum after barrier disruption. venous leg ulcers. Br J Dermatol 2000; 143:930–6. J Dermatol Sci 2003; 32:55–7. 10 Kim S, Choi N, Lee W. Fibrin zymography: a direct analysis of 26 Katsuta Y, Iida T, Inomata S et al. Unsaturated fatty acids induce fibrinolytic enzymes on gels. Analytical Biochem 1998; 263: calcium influx into keratinocytes and cause abnormal differenti- 115–16. ation of epidermis. J Invest Dermatol 2005; 124:1008–13. 11 MacPherson LJ, Bayburt EK, Capparelli MP et al. Discovery of CGS 27 Shepherd GM. The synapse. In: Neurobiology (Shepherd GM, ed.). 27023A, a non-peptidic, potent, and orally active stromelysin New York: Oxford University Press, 1994; 102–31.

2007 Shiseido Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp884–891 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2007.07819.x Assessment of nailfold capillaroscopy by · 30 digital epiluminescence (dermoscopy) in patients with Raynaud phenomenon E. Beltra´n, A. Toll,* A. Pros, J. Carbonell and R.M. Pujol* Departments of Rheumatology and *Dermatology, Hospital del Mar, Passeig Maritim 25–29, 08003 Barcelona, Spain

Summary

Correspondence Background Dermoscopy is a useful tool for dermatologists to study melanocytic Agustı´ Toll. lesions. Its possible usefulness in the assessment of capillary nailfold morphologi- E-mail: [email protected] cal changes (capillaroscopy) has recently been advocated. Objectives To assess the practical utility of digital epiluminescence microscopy as a Accepted for publication 27 November 2006 capillaroscopic instrument in patients with Raynaud phenomenon (RP). To compare the sensitivity and specificity rates obtained by epiluminescence microscopy Key words with those previously reported with conventional capillaroscopic devices. capillaroscopy, dermoscopy, digital epiluminescence, Methods Fifty-six consecutive patients with primary RP (PRP; n ¼ 5) or secondary Raynaud phenomenon, scleroderma, systemic RP (SRP; n ¼ 51) (11 men and 45 women in total) were included in the study. sclerosis A control group of 10 healthy subjects was also evaluated. Twenty-six patients Conflicts of interest (46%) had systemic sclerosis (SS), 12 (21%) presystemic sclerosis (pre-SS), one The authors have no commercial interest in the (2%) dermatopolymyositis–SS, one (2%) mixed connective tissue disease, two company manufacturing the capillaroscopy device (4%) Sjo¨gren syndrome, two (4%) an overlap syndrome, one (2%) rheumatoid that is discussed in the article. arthritis and six (11%) other connective tissue diseases. Capillary nailfold changes were studied using a nonportable digital epiluminescence device (magnification · 30). Following a systematized protocol, capillary nailfold morphology, density and distribution were evaluated. Several capillaroscopic patterns were identified (normal, sclerodermic, nonspecific, nondiagnostic) as previously defined. A possible relationship between capillary nailfold changes and the intensity of RP or the presence of associated autoimmune diseases was assessed. Results The sclerodermic pattern showed a sensitivity of 76Æ9% and a specificity of 90Æ9% in SS. A typical capillaroscopic SS pattern was observed in 73% of cases of limited SS and in 82% of cases of diffuse SS. Patients with Sjo¨gren syndrome and dermatopolymyositis–SS showed a nonspecific capillaroscopic pattern. All patients with PRP presented a normal capillaroscopic pattern. A normal capillaroscopic pattern was also observed in 11 of 12 patients with pre-SS. In one of two patients presenting severe sclerodactyly and in all patients showing hand oedema (three of 56), capillaroscopic changes could not be evaluated. Avascular areas correlated significantly with severe RP (P <0Æ002), bone resorption (P <0Æ007) and diffuse SS (P <0Æ008). Conclusions Digital epiluminescence seems to be a useful and reliable technique in the evaluation of capillary nailfold morphological changes. This technical variation allows the identification of specific capillaroscopic patterns associated with connective tissue diseases. It also permits us to differentiate PRP from SRP. The results obtained with this technique are similar to those previously reported using standard capillaroscopy devices.

In vivo study of the nailfold vascular plexus by microscopy in diseases such as scleroderma, dermatomyositis and mixed con- patients with autoimmune connective tissue diseases has been nective tissue disease (MCTD) often show characteristic capil- performed for more than 25 years. Several connective tissue lary abnormalities. The most frequent changes in systemic

2007 The Authors 892 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp892–898 Capillaroscopy by epiluminescence in RP, E. Beltrań et al. 893 sclerosis (SS) are enlarged capillaries,1 haemorrhages2 and Patients avascular areas.3,4 Tortuosities, elongation and dilatation of capillaries may also be found in dermatomyositis,5 MCTD6 During a 6-month period (between October 2004 and March and systemic lupus erythematosus (SLE).7 2005), all consecutive patients who met the diagnostic criteria Capillaroscopy is a simple and useful technique that may of RP seen in the Departments of Rheumatology and Derma- allow us to differentiate Raynaud phenomenon (RP) into sec- tology in Hospital del Mar (Barcelona) were included in the ondary (SRP) and primary (PRP) types, giving reliable infor- study. A group of healthy subjects was also included in the mation regarding the severity of the disease.8,9 In RP study as a control group. associated with connective tissue diseases, it may also be a Following a systematized protocol, a panel of clinical useful tool in the follow-up assessment.10–12 parameters including the type of collagen disease, duration Several instruments have been used to identify and evaluate of disease and RP, and clinical features of RP (pain, dur- capillary nailfold morphological changes. The most common ation, frequency per day and presence of ischaemic trophic capillaroscopy device consists of an optical microscope with lesions, ulcer, gangrene or infection) was recorded. All an attached camera and a cold external light source. Magni- patients with a collagen disease fulfilled the American Col- fications of · 30–50 are usually sufficient to evaluate mor- lege of Rheumatology criteria for the classification of rheu- phological features of the capillary nailfold plexus.13 matic diseases. Videocapillaroscopy with · 100–200 magnification attached to The diagnosis of ‘presystemic sclerosis’ (pre-SS) was estab- a monitor with a specific program that allows storage and lished when a patient presented RP with specific SS autoanti- image processing gives detailed observations of individual bodies (such as anticentromere antibody or Scl 70) without capillaries.13 the presence of diagnostic cutaneous or systemic manifesta- The routine use of wide-field, in vivo nailfold capillaroscopy tions of SS.26 at the bedside has yet to become fully integrated into standard In total, 56 patients with RP and 10 healthy subjects were clinical rheumatological and dermatological practice. The evaluated. Of the 56 patients included in the study 45 were cumbersome equipment necessary for photographically docu- women (80%) and 11 were men with a mean age of menting nailfold capillary images (i.e. epiluminescent stereo- 59 years. The control group comprised seven women and microscope with attached camera) makes it difficult to three men with a mean age of 55 years. integrate this technique into routine clinical practice. The pos- Five patients (one man and four women) had PRP and 51 sible usefulness of hand-held ophthalmoscopes and dermato- (10 men and 41 women) had SRP. Associated disorders in scopes as capillaroscopic devices (with lower magnifying SRP included SS in 26 patients (46%): 11 of 56 had diffuse SS power) has recently been suggested.14–17 and 15 of 56 had limited SS. One of 56 had dermatopolymyositis–SS, 12 (21%) pre-SS, one (2%) MCTD, two (4%) Sjo¨gren Patients and methods syndrome, one (2%) rheumatoid arthritis (RA), two (4%) an overlap syndrome (RA and SLE) and six (11%) other connect- A prospective, observational study was designed. The main ive tissue diseases. RP was severe in eight patients (14%), all objective was to evaluate the clinical utility of a digital epilu- of them with diffuse SS. Hand oedema was observed in three minescence device as a capillaroscopy technique and to define patients with limited SS. the alterations in distribution, morphology and density of RP secondary to cervical ribs was ruled out by means of nailfold capillaries in patients with RP. A possible relationship chest X-ray in all patients. between capillary morphological changes and RP-associated diseases and clinical severity and/or associated underlying Methods radiological changes was also evaluated. Device Definitions Capillary nailfold changes were assessed by means of a non- RP was defined as episodic pallor or cyanosis (or both) of the portable digital epiluminescence dermatoscope (ED), Docu- distal portions of the digits after exposure to cold. Severe RP max (Derma Instruments, San Diego, CA, U.S.A.), routinely was defined as the presence of symptomatic digital ischaemia used to evaluate melanocytic cutaneous lesions (Fig. 1) and (persistent digital pain, cyanosis and coldness), with or with- different from standard · 10 dermatoscopes [Heine Dermato- out digital ulcers and gangrenous signs.8,9 scope (Heine Optotechnik, Herrsching, Germany) and Derm- PRP was defined by symmetrical attacks, absence of tissue Lite (3Gen, Dana Point, CA, U.S.A.)]. The ED achieves necrosis, ulceration or gangrene, absence of a secondary epiluminescence by cross-polarization, with real-time images cause (based on medical history, chest X-ray and physical shown on a computer screen. It allows · 30 magnification examination), and absence of antibodies and a normal eryth- images through a hand-held videomicroscope. It includes a rocyte sedimentation rate.18–21 The diagnosis of SRP was digital zoom, an optic fibre wire with cold light, and a pro- established when RP was associated with a connective tissue gram that allows information storage. Measurements were disease.22–25 undertaken on the third and fourth fingers of both hands from

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp892–898 894 Capillaroscopy by epiluminescence in RP, E. Beltra´n et al.

4. Nondiagnostic capillaroscopy: although a homogeneous vascularity could be observed, neither the distribution nor the morphology of capillary bundles could be evaluated.

Radiological parameters

All patients underwent hand X-ray explorations. Bone resorption, joint space narrowing and erosions were evaluated.

Statistical analysis

SPSS statistical software for Windows (SPSS, Chicago, IL, U.S.A.) was used for statistical analysis. The signiﬁcance of the differences between frequencies for patients and controls was determined by the v2 test.

Results

The results of the 56 capillaroscopies that were performed in patients with RP are illustrated in Table 1. No capillaroscopic changes were observed in healthy controls. Capillaroscopy was also normal in all patients with PRP, in 11 of 12 patients with pre-SS and in all patients from the control group (Fig. 2). None of the patients with diffuse SS had a normal capillaroscopic pattern. One patient with limited SS had a normal capillaroscopic pattern. Fig 1. A · 30 nonportable digital epiluminescence device The sclerodermic pattern showed a sensitivity of 76Æ9% and (Documax ; Derma Instruments, San Diego, CA, U.S.A.). a specificity of 90Æ9% in SS. The typical SS pattern was observed in 73% of patients with limited SS and in 82% of all patients and controls.27–31 The same investigators (E.B., patients with diffuse SS (Fig. 3a,b). Only one of 12 patients A.P.) performed all examinations. with pre-SS showed a scleroderma pattern. Capillaroscopy showed a nonspecific pathological pattern in patients with Sjo¨gren syndrome,35 RA36 and dermatopolymyo- Capillaroscopic parameters sitis–SS. Only one patient with diffuse SS (9%) showed a The following capillaroscopic parameters were evaluated: nail- nonspecific capillaroscopic pattern. The capillaroscopy was fold capillary density and distribution as well as morphological nondiagnostic (Fig. 4) in four patients. One of them had dif- changes (dilatation, megacapillaries, tortuosities and haemor- fuse SS and severe sclerodactyly; the three remaining patients, rhages). The classification of capillaroscopy findings was made all with limited SS, showed hand oedema. according to Maricq criteria.26,32–34 Diagnostic capillaroscopy Avascular areas correlated significantly with severe RP patterns were grouped into the following categories: (Fig. 5) (P <0Æ002), bone resorption (P <0Æ007) and diffuse 1. Normal capillaroscopy was defined as the presence of a SS (P <0Æ008). homogeneous capillary distribution in the nailfold plexus without capillary loss (normal medium density: linear 30 Radiological features capillaries per 5 mm) and no morphological alterations.22,27,28 2. Typical scleroderma capillaroscopy pattern as described by Bone resorption was observed in three of 56 patients, all of Maricq,26,32 with modifications according to Bergman et al.14 them with diffuse SS and severe RP. No other radiological According to this, the scleroderma capillaroscopic findings alterations were observed. were: enlarged capillaries, haemorrhages (more than two punctuate haemorrhages per finger or confluent areas of hae- Discussion morrhages), moderate or extensive capillary loss (avascular areas), and tortuous, crossed and arborized capillaries. A scle- RP is a common clinical feature characterized by digital roderma capillaroscopy pattern was defined as the presence of artery vasospasm, often caused by cold and emotional stress. two or more abnormalities described. PRP has a prevalence of 3–5% in the general population. 3. A nonspecific pattern is defined by the absence of a full The incidence in young women may be as high as 20–30% scleroderma capillaroscopy criteria according to Maricq’s cri- and is a frequent cause of dermatological and rheumatologi- teria modified by Bergman et al.14 cal consultation.21

Table 1 Capillaroscopic patterns observed in patients with primary and secondary Raynaud Patterns of capillaroscopy, n (%) phenomenon Diagnosis Normal SS pattern Nonspeciﬁc Nondiagnostic Total Limited SS 1 (7) 11 (73) – 3 (20) 15 (27) Diffuse SS – 9 (82) 1 (9) 1 (9) 11 (20) Pre-SS 11 (92) 1 (8) – – 12 (21) DM-SS – – 1 (100) – 1 (2) MCTD 1 (100) – – – 1 (2) RA – – 1 (100) – 1 (2) Sjo¨gren syndrome – – 2 (100) – 2 (4) Primary Raynaud 5 (100) – – – 5 (9) phenomenon Overlap (RA + SLE) 1 (50) 1 (50) 2 (4) Other 5 (83) 1 (17) 6 (11)

Total 24 22 6 4 56 (100)

SS, systemic sclerosis; Pre-SS, presystemic sclerosis; DM-SS, dermatopolymyositis–systemic sclerosis; MCTD, mixed connective tissue disease; RA, rheumatoid arthritis; SLE, systemic lupus erythematosus.

patient with PRP, an associated connective tissue disease must be suspected. Approximately 15–20% of patients with RP who have autoantibodies, abnormalities of nailfold capillaries, or both, and who do not initially meet the criteria for a well- defined connective tissue disease ultimately will develop such a disease within 2 years.40,41 Capillaroscopic alterations and the RP can precede, even by years, the development of an overt SS. In subjects with RP, one or more of the following capillaroscopic findings should alert the physician to the possibility of an associated connective tissue disease:40 enlarged capillaries (giant capillaries); architectural derangement of the microvascular network; tortuous and arborized capillaries; loss of capillaries and/or avascular areas; capillary haemorrhages. These features are found in > 95% of patients with SS.26,27,33,34 Capillary Fig 2. Normal capillaroscopy pattern with visible nailfold plexus and haemorrhages and enlarged capillaries are associated with early absence of capillary loss. vascular damage. A progression in microangiopathic damage has to be suspected when a disorganization in the capillary PRP is caused by a functional microangiopathic alteration distribution and large avascular areas are observed in the not associated with systemic disease.8,9 The suggested diagnos- nailfold.2–4 tic criteria for PRP include symmetrical attacks, the absence of The concept of ‘scleroderma pattern’ has been proposed to tissue necrosis, ulceration or gangrene, the absence of a sec- illustrate the sequential changes that are typical of the micro- ondary cause on the basis of a patient’s history and general vascular involvement in SS. This particular capillaroscopic physical examination, a negative test for antinuclear antibody pattern has a specificity of 95% in patients with SS.14,26,27,32–34 and a normal erythrocyte sedimentation rate. In contrast, It can be found in > 87% of patients with diffuse SS and 61% SRP is frequently associated with several connective tissue of patients with limited cutaneous SS.5 It is also observed in diseases,24,37 and may be suggested by an age at onset of 64% of patients with MCTD, in 27–83% of patients with > 30 years, and episodes that are intense, or are associated dermatomyositis and in only 2–4Æ8% of patients with SLE.14 with ischaemic skin lesions and the presence of specific auto- Conventional nailfold capillaroscopy usually requires special antibodies.8,13 SS, Sjo¨gren syndrome,35 SLE,7 antiphospholipid equipment that often makes it necessary to send the patient to syndrome,25 MCTD6 and dermatopolymyositis are the diseases a specialized centre. Recently, some authors have postulated that most frequently show RP. RP is the most frequent, early the use of simple devices such as ophthalmoscopes or dermat- and incapacitating clinical manifestation in patients with SS.24 oscopes in the study of nailfold vascular alterations.14–17,22,42 Nailfold capillaroscopy is a useful tool in distinguishing PRP The dermatoscope is an in vivo noninvasive technique fre- from SRP.27,37–39 The capillaroscopic pattern in PRP is invaria- quently used by dermatologists as a useful instrument to diag- bly normal.13 When capillaroscopic anomalies are found in a nose pigmented lesions.43 New applications of dermatoscopy,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp892–898 896 Capillaroscopy by epiluminescence in RP, E. Beltra´n et al.

(a)

(b) Fig 4. Nondiagnostic capillaroscopy. Neither the distribution or the morphology of capillary bundles is observed.

Fig 5. Capillaroscopy image with enlarged, tortuous and arborized capillaries with extensive capillary loss (conﬂuent avascular areas) in a patient with severe secondary Raynaud phenomenon.

replacing the conventional bulbs by 2Æ5-V kryptogen bulbs.16 Although this instrument showed similar results to those Fig 3. (a) Sclerodermic capillaroscopy pattern with enlarged, described with conventional capillary microscopy, it requires tortuous, crossed and arborized capillaries. (b) Sclerodermic special equipment. The attachment of a DermLite · 10 aug- capillaroscopy pattern with enlarged capillaries, haemorrhages and moderate capillary loss (avascular areas). mentation dermatoscope to a digital camera has been shown to be effective in registering the vascular changes of the nailfold in dermatomyositis.15 such as the visualization of parasites and vascular lesions, have Documax allows · 30 magnification images through a recently been advocated.17 The hand-held dermatoscope with hand-held videomicroscope. It is possible to obtain even · 10 magnification has been shown to be a simple, fast and higher magnification nailfold capillary images by using the accessible instrument in the study of nailfold vascular altera- digital zoom feature of the camera. Digital epiluminescence tions in autoimmune diseases.14–16 microscopy also allows easy image storage. The software High sensitivity and specificity rates have been obtained included in these devices, that are designed to detect changes with the Heine Delta dermatoscope (Heine Optotechnik) in in melanocytic lesions, also gives us the possibility of com- SS, dermatomyositis and MCTD, similar to those described paring two images that have been recorded on different with conventional capillaroscopy.14 Bauersachs and Lo¨bner days. Therefore, these tools may prove to be extremely use- described the use of a modified dermatoscope to study ful in future studies for making an easy developmental cor- patients with PR, adapting a · 12 augmentation lens and relation of the capillaroscopic findings. They can also aid in

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp892–898 Capillaroscopy by epiluminescence in RP, E. Beltrań et al. 897 monitoring the therapeutic response of connective tissue dis- using colour Doppler ultrasound. Rheumatology 2000; 39:1206– eases and RP.32 13. The benefits of · 30 over · 10 magnification digital epilu- 8 Anders HJ, Sigl T, Schattenkirchner M. Differentiation between primary and secondary Raynaud phenomenon. Ann Rheum Dis 2001; minescence devices have not been evaluated in previous stud- 60:407–9. ies. Capillaroscopic devices allowing · 30–50 magnification 9 Wigley FM. Clinical practice. Raynaud’s phenomenon. N Engl J Med images have been shown to be sufficient to evaluate morpho- 2002; 347:1001–8. 13 logical capillary features, whereas devices with lower resolu- 10 Silver RM, Maricq HR. Childhood dermatomyositis: serial micro- tion are not routinely used in rheumatological practice. vascular studies. Pediatrics 1989; 83:278–83. Almost half of the patients with RP who were included in 11 Maricq HR, Harper FE, Khan MM et al. Microvascular abnormalities the study had SS. We observed a sclerodermic pattern, using as possible predictors of disease subset in Raynaud’s phenomenon and early connective tissue disease. Clin Exp Rheumatol 1983; 1:195– the Maricq criteria, in 82% and 73% of patients with diffuse 205. and limited SS, respectively. We obtained a sensitivity of 12 Gerbracht DD, Steen VD, Ziegler GL et al. Evolution of primary 76Æ9% and a specificity of 90Æ9% in the whole group of Raynaud’s phenomenon to connective tissue disease. Arthritis Rheum patients with SS: these are comparable with those described 1985; 28:87–92. with other instruments. Those patients with limited SS who 13 Cutolo M, Grassi W, Cerinic MM. Raynaud’s phenomenon and the showed hand oedema had a nondiagnostic capillaroscopy. role of capillaroscopy. Arthritis Rheum 2003; 48:3023–30. Therefore, the lack of a typical sclerodermic capillaroscopic 14 Bergman R, Sharony L, Schapira D et al. The handheld dermatoscope as a nail-fold capillaroscopic instrument. Arch Dermatol 2003; pattern must be interpreted cautiously when hand oedema is 139:1027–30. present. 15 Sontheimer RD. A portable digital microphotography unit for rapid We have observed an association between severe RP and documentation of periungual nailfold capillary changes in autoim- avascular areas in capillaroscopy. This avascular pattern has mune connective tissue diseases. J Rheumatol 2004; 31:539–44. also been observed more frequently in patients with distal 16 Bauersachs RM, Lo¨bner F. The poor man’s capillary microscope. digital bone resorption and in patients with diffuse SS. This A novel technique for the assessment of capillary morphology. capillaroscopic feature thus correlates with a more aggressive Ann Rheum Dis 1997; 56:435–7. 17 Micali G, Lacarrubba F. Possible applications of videodermatoscopy form of RP, diffuse SS and radiological lesions. beyond pigmented lesions. Int J Dermatol 2003; 42:430–3. In conclusion, digital dermatoscope microscopy (· 30 mag- 18 Wigley FM, Flavahan NA. Raynaud’s phenomenon. Rheum Dis Clin nification) can be considered a useful tool in evaluating the North Am 1996; 22:765–81. morphology of periungual capillaries. Similar results to those 19 Block JA, Sequeira W. Raynaud’s phenomenon. Lancet 2001; described with other conventional devices can be obtained. 357:2042–8. This technique enables the detection of capillaroscopic changes 20 ter Borg EJ, Piersma-Wichers G, Smit AJ et al. Serial nailfold capil- in specific autoimmune diseases. It can also be useful in differ- lary microscopy in primary Raynaud’s phenomenon and scleroderma. Semin Arthritis Rheum 1994; 24:40–7. entiating PRP from SRP and in predicting severe clinical situa- 21 Riera G, Vilardell M, Vaque´ J et al. Prevalence of Raynaud’s phenom- tions associated with RP. These devices, routinely used by enon in a healthy Spanish population. J Rheumatol 1993; 20:66–9. dermatologists, may facilitate the noninvasive diagnosis and 22 Cutolo M, Pizzorni C, Sulli A. Nailfold video-capillaroscopy in follow-up of several autoimmune systemic diseases. systemic-sclerosis. Z Rheumatol 2004; 63:457–62. 23 Ranft J, Lammersen T, Heidrich H. In vivo capillary microscopy findings and ophthalmoscopy findings in scleroderma. Arthritis References Rheum 1987; 30:1173–5. 1 Grassi W, Medico PD, Izzo F, Cervini C. Microvascular involvement 24 Kahalen B, Cerinic MM. Raynaud’s phenomenon and scleroderma. in systemic sclerosis: capillaroscopic findings. Semin Arthritis Rheum Dysregulated neuroendothelial control of vascular tone. Arthritis 2001; 30:397–402. Rheum 1995; 38:1–4. 2 Sulli A, Burroni A, Tuccio M et al. La videocapillaroscopia periun- 25 LeRoy EC, Medsger TA. Raynaud’s phenomenon: a proposal for gueale nella sclerosis sistemica: parametri diagnostici e di follow- classification. Clin Exp Rheumatol 1992; 10:485–8. up della malattia e correlazione con il tipo di impegno cutańeo e 26 Carpentier PH, Maricq HR. Microvasculature in systemic sclerosis. con gli autoanticorpi specifici. Reumatismo 2004; 56:34–45. Rheum Dis Clin North Am 1990; 16:75–92. 3 Cutolo M, Pizzorni C, Tuccio M et al. Nailfold videocapillaroscopic 27 Kabasakal Y, Elvins DM, Ring EF, McHugh NJ. Quantitative nailfold patterns and serum autoantibodies in systemic sclerosis. Rheumatology capillaroscopy findings in a population with connective tissue disease 2004; 43:719–26. and in normal healthy controls. Ann Rheum Dis 1996; 55:507–12. 4 Cutolo M, Sulli A, Pizzorni C et al. Nailfold videocapillaroscopy 28 Anderson ME, Allen PD, Moore T et al. Computerized nailfold video assessment of microvascular damage in systemic sclerosis. J Rheumatol capillaroscopy – a new tool for assessment of Raynaud’s phenom- 2000; 27:155–60. enon. J Rheumatol 2005; 32:841–8. 5 Nagy Z, Czirjak L. Nailfold digital capillaroscopy in 447 patients 29 Bukhari M, Hollis S, Moore T et al. Quantitation of microcirculatory with connective tissue disease and Raynaud’s disease. J Eur Acad abnormalities in patients with primary Raynaud’s phenomenon Dermatol Venereol 2004; 18:62–8. and systemic sclerosis by video capillaroscopy. Rheumatology (Oxford) 6 Hoffman RW, Greidinger EL. Mixed connective tissue disease. 2000; 39:506–12. Curr Opin Rheumatol 2000; 12:386–90. 30 Pizzorni C, Sulli A, Craviotto C et al. Diagnostic perspectives in 7 Keberle M, Tony HP, Jahns R et al. Assessment of microvascular rheumatologic vasculitis: the role of video-capillaroscopy. Reuma- changes in Raynaud’s phenomenon and connective tissue disease tismo 2002; 54:99–104.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp892–898 898 Capillaroscopy by epiluminescence in RP, E. Beltra´n et al.

31 Cutolo M, Pizzorni C, Sulli A. Capillaroscopy. Best Pract Res Clin Rheu- 38 Mannatimo E, Pacualini L, Fedeli F et al. Nailfold capillaroscopy in matol 2005; 19:437–52. the screening and diagnosis of Raynaud’s phenomenon. Angiology 32 Maricq HR, LeRoy EC, D’Angelo WA et al. Diagnostic potential of 1994; 45:37–42. in vivo capillary microscopy in scleroderma and related disorders. 39 Lee P, Sarkocy J, Bookman AA et al. Digital blood flow and nailfold Arthritis Rheum 1980; 23:183–9. capillary microscopy in Raynaud’s phenomenon. J Rheumatol 1986; 33 Maricq HR. Widefield capillary microscopy. Technique and rating 13:564–9. scale for abnormalities seen in scleroderma and related disorders. 40 Zufferey P, Depairon M, Chamot AM, Monti M. Prognostic signifi- Arthritis Rheum 1981; 24:1159–65. cance of nailfold capillary microscopy in patients with Raynaud’s 34 Maricq HR, Le Roy C. Patterns of finger capillary abnormalities in phenomenon and scleroderma-pattern abnormalities. A six-year connective tissue disease by microscopy. Arthritis Rheum 1973; follow-up study. Clin Rheumatol 1992; 11:536–41. 16:619–28. 41 Kallemberg CGM, Wouda AA, Hoet MH. Development of connect- 35 Garcia-Carrasco M, Siso´ A, Ramos-Casalas M et al. Raynaud’s phe- ive tissue disease in patients presenting with Raynaud’s phenom- nomenon in primary Sjo¨gren syndrome. Prevalence and clinical enon, a 6-year follow-up with emphasis on the predictive value of characteristics in a series of 320 patients. J Rheumatol 2002; 29:726– antinuclear antibodies as detected by immunoblotting. Ann Rheum 30. Dis 1988; 47:634–41. 36 Saraux A, Allain J, Guedes C et al. Raynaud’s phenomenon in 42 Minkin W, Rabhan NB. Office nailfold capillary microscopy using rheumatoid arthritis. Br J Rheumatol 1996; 35:752–4. the ophthalmoscope. J Am Acad Dermatol 1982; 7:190–3. 37 Houtman PM, Callemberg CGM, Fidler V, Wouda AA. Diagnostic 43 Stolz W, Riemann A, Cognetta AB et al. ABCD rule of dermato- significance of nailfold capillary patterns in patients with Raynaud’s scopy: a new practical method for early recognition of malignant phenomenon. J Rheumatol 1986; 13:556–63. melanoma. Eur J Dermatol 1994; 4:521–7.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp892–898 CLINICAL AND LABORATORY INVESTIGATIONS DOI 10.1111/j.1365-2133.2007.07820.x Cytokine gene polymorphisms in Chinese patients with psoriasis Y.T. Chang,* C.T. Chou, C.W. Yu, M.W. Lin,§– Y.M. Shiao,** C.C. Chen,* C.H. Huang,* D.D. Lee,* H.N. Liu,*, W.J. Wang* and S.F. Tsai** *Department of Dermatology, §Institute of Public Health and **Faculty of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei, Taiwan Department of Dermatology, Division of Allergy-Immunology-Rheumatology and –Department of Medical Research and Education, Taipei Veterans General Hospital, No. 201, Sec. 2, Shih-Pai Road, Taipei 11217, Taiwan Department of Dermatology, National Defence Medical Centre, Taipei, Taiwan Division of Molecular and Genomic Medicine, National Health Research Institutes, Taipei, Taiwan

Summary

Correspondence Background Previous studies have shown that cytokine gene polymorphisms may Yun-Ting Chang. confer susceptibility to psoriasis. E-mail: [email protected] Objectives To determine whether genetic polymorphisms of the cytokine genes might inﬂuence the development of psoriasis in Chinese patients in Taiwan. Accepted for publication 9 December 2006 Methods DNA samples were obtained from 170 patients with psoriasis vulgaris (PV), 102 patients with psoriatic arthritis (PsA) and 210 control subjects. Using Key words direct sequencing and microsatellite genotyping, we examined 28 polymor- Chinese, HLA-Cw*0602, interleukin-12B, phisms in 11 cytokine genes including the interleukin (IL)-1a, IL-1b, IL-1 recep- psoriasis vulgaris, psoriatic arthritis tor antagonist, IL-4, IL-8, IL-10, IL-12B, IL-13, tumour necrosis factor (TNF)-a, b c Conﬂicts of interest TNF- and interferon- genes. Genotypes of HLA-Cw*0602, killer cell immuno- None declared. globulin-like receptor (KIR) genes and major histocompatibility complex class I chain-related gene A (MICA) were also determined in patients with PsA. Results The patients with PV were more likely to carry the +4496G allele of the

IL-12B gene (59Æ4% vs. 49Æ3%, P ¼ 0Æ0067, Pc ¼ 0Æ033). However, no signiﬁ- cantly different allelic and genotypic distributions of the other analysed genes including IL-1b, TNF-a, TNF-b, KIR genes and MICA were found between the PV/PsA patients and controls. Moreover, no association was observed with disease onset, gender, peripheral arthritis or joint erosion. With regards to HLA- Cw*0602, its allele frequency was signiﬁcantly increased in patients with early- ) onset PV (25Æ3% vs. 4Æ8%, P <10 7), but not in patients with PsA. Conclusions The IL-12B gene polymorphism conferred a risk for PV in our Chinese population, although the effect was more minor than that of HLA-Cw*0602. Cw*0602, KIR2DS1/S2 and MICA-A9 were unlikely to be risk alleles in our patients with PsA. The other analysed genetic polymorphisms of cytokine genes do not appear to be associated with susceptibility to PV and PsA in Chinese patients in Taiwan.

Psoriasis is a common chronic inﬂammatory disorder of the regulation of psoriasis.3,4 In addition, high levels of interleu- skin and joints with a prevalence of psoriasis vulgaris (PV) kin (IL)-1, IL-8, IL-10, IL-12, tumour necrosis factor (TNF)-a ranging between 1–2% in Caucasians to 0Æ3% in the Mongol- and interferon (IFN)-c have been detected in skin lesions, oid population.1 About 15% of patients with PV develop pso- synovial ﬂuid and sera of patients with psoriasis.5–9 riatic arthritis (PsA).2 Although the pathogenesis of PV and Cytokine gene polymorphisms may affect constitutive and PsA remains obscure, activated CD4+ and CD8+ T lympho- inducible cytokine production and contribute to susceptibility cytes, neutrophils and natural killer/natural killer-T (NK/ to PV and PsA. Recent studies showed that carriers of TNF-a – NKT) cells are found in the psoriatic lesions. The activation of 238A were associated with increased production of TNF-a T helper (Th) 1 cells appears to be central to the immune dys- in response to lipopolysaccharide (LPS) in vitro, and with

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp899–905 899 900 Cytokine gene polymorphisms in Chinese patients with psoriasis, Y.T. Chang et al. early-onset male psoriasis patients and peripheral polyarthri- ding in Taiwan and genetically unrelated to each other. The tis.10–12 Carriers of IL-1b –511C were associated with in- control group comprised 210 healthy individuals including creased production of IL-1 receptor antagonist (IL-1RN) in voluntary blood donors, hospital staff and medical students. response to LPS in vitro, and with late-onset psoriasis.13 The The control subjects were selected to maximize matching for TNF-a –308A and TNF-b +252A polymorphisms were signifi- age, sex and geographical origin. Informed consent was cantly associated with age at onset of psoriasis and presence of obtained from each participant, under protocols approved by joint erosions in PsA.14 Although no association was observed the research ethics board of the hospital. between the IL-12B promoter genotypes and the LPS-stimulated production of IL-12p70 or IL-12p40 in Caucasian patients Genotyping with psoriasis, the IL-12B +12542A (previously named as +1188A), a single nucleotide polymorphism (SNP) in the Genomic DNA was extracted from 5 mL whole blood using a 3¢-untranslated region, conferred a risk for PV in a Japanese DNA isolation kit (Gentra Systems, Minneapolis, MN, U.S.A.). population.15,16 Other studies also showed that polymor- Genotyping of SNPs of cytokine genes (IL-1a, IL-1b, IL-4, phisms in the genes encoding for IL-1a, IL-1RN and IL-10 IL-8, IL-10, IL-12B, IL-13, TNF-a and TNF-b) of the study contributed to susceptibility to psoriasis.17–19 Although cyto- subjects was performed by direct sequencing (Table 1). kine gene polymorphisms have been studied extensively in Firstly, the DNA sequence of the cytokine genes was amplified other populations with psoriasis, the report about cytokine by polymerase chain reaction (PCR). The amplified PCR prod- gene polymorphisms in Chinese patients with PV and PsA is ucts were then subjected to sequencing using fluorescent-dye- quite limited.20 terminator cycle chemistry (ABI Prism; PE Biosystems, It has been suggested that psoriasis is a multifactorial dis- Foster City, CA, U.S.A.) in a 10-lL reaction. Sequences were ease and that environmental factors may trigger psoriasis in obtained from both ends using the same primers used in the genetically susceptible individuals. At the PSORS1 locus on PCR reaction. The products of sequencing reactions were run chromosome 6p21Æ3, the HLA-Cw*0602 allele is the strongest on a DNA analyser (3730XL; ABI/Hitachi, Tokyo, Japan). susceptibility allele for PV in various populations.21 Our previ- The SNPs of cytokine genes that we have selected in the ous studies have also confirmed HLA-Cw*0602 as a major present study have been well studied before and most of them risk allele in Chinese patients with PV.22 Aside from HLA-C, are either tag SNPs or genotyped SNPs in the Chinese popula- NK/NKT cells may interact with HLA-C and also play a role in tion in HAPMAP. They fall into a linkage disequilibrium block the pathogenesis of psoriasis.23 The major histocompatibility that spans the entire gene and tag the majority of haplotypes complex class I chain-related gene A (MICA) and killer cell found in the relevant linkage disequilibrium blocks as seen in immunoglobulin-like receptor (KIR) gene are involved in HAPMAP. NK/NKT cell functions; moreover, the MICA-A9 allele and Genotyping for KIR2DS1, KIR2DS2, KIR2DL1 and KIR2DL2 KIR2DS1/S2 have been found to confer susceptibility to was performed by PCR with sequence-specific primers with an PV/PsA in both Caucasian and Japanese populations.24–28 internal positive control included in each PCR reaction.32 Gen- However, our recent studies showed that the frequencies of otyping for HLA-Cw*0602 was also carried out using HLA MICA-A9 and KIR2DS1/S2 were similar between Chinese Typing Kits (Lifecodes; Stamford, CT, U.S.A.) and was con- patients with PV and control subjects.29,30 Until now, geno- firmed by a sequence-based typing method.22 typing of HLA-Cw*0602, MICA and KIR2DS1/S2 has never The fragments of the IL-1RN gene containing variable num- been conducted in Chinese patients with PsA. bers of a tandem repeat of 86 bp were amplified by PCR and In order to investigate whether cytokine gene polymor- the PCR products were subsequently fractionated on a 1Æ5% phisms play a role in the pathogenesis of psoriasis, we per- agarose gel stained with ethidium bromide. The alleles were formed a case–control association study by genotyping the detected according to their size relative to a DNA size marker: polymorphisms of cytokine genes (IL-1a, IL-1b, IL-1RN, IL-4, 4R (four repeats), 412 bp; 2R (two repeats), 240 bp. IL-8, IL-10, IL-12B, IL-13, TNF-a, TNF-b and IFN-c genes) in The short tandem repeats of the IFN-c and MICA genes a Chinese population. HLA-Cw*0602, MICA and KIR2DS1/S2 were determined by the fluorescence-labelling technique. The were also genotyped in patients with PsA. forward primer was fluorescently labelled (with FAM) and the amplified PCR products were mixed with formamide contain- Materials and methods ing a stop buffer, denatured for 5 min at 95 C, and run on POP7 gel in a DNA analyser (3700; ABI/Hitachi). Fragment sizes were determined using Genescan (version 3.1) and Cases and controls Genotyper (version 2.5) software. In total, 272 subjects with psoriasis (170 patients with PV and 102 patients with PsA) were recruited from patients attending Statistical analysis the Taipei Veterans General Hospital. All patients were assessed by a rheumatologist and a dermatologist. Patients were classi- The differences of the allele frequencies between the case and fied as having PsA according to the criteria of Moll and control subjects were assessed using the v2 test or Fisher’s Wright.31 All patients with psoriasis were Han Chinese, resi- exact test. Odds ratios, 95% confidence intervals and signifi-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp899–905 Cytokine gene polymorphisms in Chinese patients with psoriasis, Y.T. Chang et al. 901

Table 1 Methods and primers used in genotyping of cytokine genes, major histocompatibility complex class I chain-related gene A (MICA) and killer cell immunoglobulin-like receptor (KIR) genes

Gene polymorphism Analysis Primers IL-1a ()889C/T) Sequencing Forward: GGCTTAAACTCCAACTGGGA Reverse: CCAAGGTGTGTCTTCTGTAG IL-1b ()511C/T), ()31T/C) Sequencing Forward: CTCAGAGGCTCCTGCAATTG Reverse: AGATAAGCAGTATCCATTCCC IL-1RN: 2nd intron 86-bp repeat PCRa Forward: CTCAGCAACACTCCTAT Reverse: TCCTGGTCTGCAGGTAA IL-4 ()590T/C), (+33T/C) Sequencing Forward: ACTAGGCCTCACCTGATACG Reverse: CACTTGTGTCCGTGGACAAAG IL-8 ()251T/A) Sequencing Forward: CTGCTCTTATGCCTCCACTGGAAT Reverse: AAGCTTGTGTGCTCTGCTGTCTCT IL-10 ()1082A/G), ()819T/C), ()592A/C) Sequencing Forward: ATCCAAGACAACACTACTAA Reverse: TAAATATCCTCAAAGTTCC IL-12B (+4237G/A), (+4383AAT), (+4496A/G), Sequencing Forward: ACCATCTGGAGAGCTTAAGAACC (+4510A/G) Reverse: TGCCTTACATTTGACTGAGGATT IL-12B (+12542C/A)b Sequencing Forward: TGATCCAGGATGAAAATTTGG Reverse: GGCAACTTGAGAGCTGGAAA IL-13 (+4464G/A) Sequencing Forward: TGGCGTTCTACTCACGTGCT Reverse: CAGCACAGGCTGAGGTCTAA TNF-a ()1031T/C), ()863C/A), ()857C/T) Sequencing Forward: TGGACTCACCAGGTGAGGCC Reverse: TCACTCCCTGGGGCCCTCTA TNF-a ()308G/A), ()238G/A) Sequencing Forward: CAAACACAGGCCTCAGGACTC Reverse: AGGGAGCGTCTGCTGGCTG TNF-b (+10G/A), (+80C/A), (+252A/G), Sequencing Forward: GCAGTATCTTCTAAGCCCTG (+368G/C), (+495T/C), (+723A/C) Reverse: ATGCTTGGGTTCCTGAGGCA IFN-c: VNTR at 1st intron Microsatellite genotyping Forward: AGACATTCACAATTGATTTTATTCTTAC Reverse: CCTTCCTGTAGGGTATTATTATACG MICA: VNTR at transmembrane region Microsatellite genotyping Forward: CCTTTTTTTCAGGGAAAGTGC Reverse: CCTTACCATCTCCAGAAACTGC KIR2DS1 SS-PCR Forward: TCTCCATCAGTCGCATGA Reverse: AGGGCCCAGAGGAAAGTT KIR2DS2 SS-PCR Forward: TGCACAGAGAGGGGAAGTA Reverse: CACGCTCTCTCCTGCCAA KIR2DL1 SS-PCR Forward: CCATCAGTCGCATGACG Reverse: CCACTCGTATGGAGAGTCAT KIR2DL2 SS-PCR Forward: ACTTCCTTCTGCACAGAGAA Reverse: GCCCTGCAGAGAACCTACA

IL, interleukin; TNF, tumour necrosis factor; IFN, interferon; VNTR, variable number of tandem repeat; PCR, polymerase chain reaction; SS-PCR, sequence-speciﬁc polymerase chain reaction. aThe PCR products were fractionated on agarose gel and the alleles were detected according to their size relative to a DNA size marker. bThis SNP was named as (+1188C/A) in a previous study by Tsunemi et al.16 cance values were calculated using Epi Info 2000 (CDC, of 45Æ6 years (range 19–79). Eighty-three patients with PV Atlanta, GA, U.S.A.). Bonferroni correction for multiple testing (49%) and 75 with PsA (74%) had onset of psoriasis before was applied where indicated. Hardy–Weinberg equilibrium the age of 40 years (early-onset psoriasis) and 87 patients was tested using v2 test. The Genecounting program (version with PV (51%) had onset at age 40 years or older (late-onset 1.3) was used for estimating the frequencies of haplotypes of psoriasis). Sixteen (6%) of these 272 patients with psoriasis different SNPs and calculating linkage disequilibrium between reported a family history of psoriasis. Among patients with SNPs.33 PsA, 14 (14%) had spondylitis, 59 (58%) had peripheral arthritis (nonspinal disease) and 29 (28%) had both spondylitis Results and peripheral arthritis. Joint erosion was detected in 36 (35%) patients with PsA. Characteristics of patients Frequencies of cytokine gene polymorphisms The 170 patients with PV included 123 males and 47 females with a mean age of 52Æ1 years (range 7–84). The 102 patients The allele frequencies of the investigated cytokine gene poly- with PsA included 53 men and 49 women with a mean age morphisms are shown in Table 2. The genotype frequencies

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp899–905 902 Cytokine gene polymorphisms in Chinese patients with psoriasis, Y.T. Chang et al.

Table 2 Cytokine genes and major histocompatibility complex class I chain-related gene A (MICA) polymorphisms in patients with psoriasis and control subjects

Polymorphism SNP PV patients (n ¼ 340)% PsA patients (n ¼ 204)% Control subjects (n ¼ 420)% IL-1a ()889T) rs1800587 27 (7Æ9) 24 (11Æ8) 32 (7Æ6) IL-1b ()511T) rs16944 166 (48Æ8) 95 (46Æ6) 192 (45Æ7) IL-1b ()31C) rs1143627 166 (48Æ8) 95 (46Æ6) 192 (45Æ7) IL-1RN: 2R (240 bp) 19 (5Æ6) 10 (4Æ9) 31 (7Æ4) IL-4 ()590C) rs2243250 63 (18Æ5) 32 (15Æ7) 92 (21Æ9) IL-4 (+33C) rs2070874 63 (18Æ5) 33 (16Æ2) 92 (21Æ9) IL-8 ()251A) rs4073 159 (46Æ8) 80 (39Æ2) 167 (39Æ8) IL-10 ()1082G) rs1800896 19 (5Æ6) 10 (4Æ9) 31 (7Æ4) IL-10 ()819C) rs1800871 112 (32Æ9) 61 (33Æ2) 134 (31Æ9) IL-10 ()592C) rs1800872 112 (32Æ9) 61 (33Æ2) 134 (31Æ9) IL-12B (+4237A) rs2569254 65 (19Æ1) 29 (14Æ2) 61 (14Æ5) IL-12B (+4383AAT) rs10631390 127 (37Æ4)a 84 (41Æ2) 191 (45Æ5) IL-12B (+4496G) rs2569253 202 (59Æ4)b 110 (53Æ9) 207 (49Æ3) IL-12B (+4510G) rs17875308 212 (62Æ4)c 120 (58Æ8) 230 (54Æ8) IL-12B(+12542A) rs17875322 214 (62Æ9)d 122 (59Æ8) 232 (55Æ2) IL-13 (+4464A) rs20541 125 (36Æ8) 54 (26Æ5) 136 (32Æ4) TNF-a ()1031C) rs1799964 57 (16Æ8) 39 (19Æ1) 84 (20) TNF-a ()863A) rs1800630 43 (12Æ6) 31 (15Æ2) 72 (17Æ1) TNF-a ()857T) rs1799724 36 (10Æ6) 32 (15Æ7) 43 (10Æ2) TNF-a ()308A) rs1800629 20 (5Æ9) 7 (3Æ4)e 40 (9Æ5) TNF-a ()238A) rs361525 15 (4Æ4) 7 (3Æ4) 8 (1Æ9) TNF-b (+10A) rs1800683 150 (44Æ1) 100 (49) 214 (51) TNF-b (+80A) rs2239704 123 (36Æ2) 64 (31Æ4) 124 (29Æ5) TNF-b (+252G) rs909253 148 (43Æ5) 100 (49) 214 (51) TNF-b (+368C) rs746868 121 (35Æ6) 61 (29Æ9) 123 (29Æ3) TNF-b (+495C) rs2857713 63 (18Æ5) 39 (19Æ1) 82 (19Æ5) TNF-b (+723C) rs1041981 192 (56Æ5)f 103 (50Æ5) 205 (48Æ8) IFN-c: 11R (122 bp) 38 (11Æ2) 28 (13Æ7) 73 (17Æ4) IFN-c: 12R (124 bp) 141 (41Æ5) 71 (34Æ8) 151 (36) IFN-c: 13R (126 bp) 0 (0) 7 (3Æ4) 7 (1Æ7) IFN-c: 14R (128 bp) 136 (40) 86 (42Æ2) 162 (38Æ6) IFN-c: 15R (130 bp) 16 (4Æ7) 3 (1Æ5) 8 (1Æ9) IFN-c: 16R (132 bp) 1 (0Æ3) 1 (0Æ5) 2 (0Æ5) IFN-c: 17R (134 bp) 8 (2Æ4) 8 (3Æ9) 17 (4) MICA: A4 (179 bp) 43 (12Æ6) 34 (16Æ7) 60 (14Æ3) MICA: A5 (182 bp) 137 (40Æ3) 78 (38Æ2) 143 (34) MICA: A5.1 (183 bp) 75 (22Æ1) 59 (28Æ9) 99 (23Æ6) MICA: A6 (185 bp) 22 (6Æ5) 5 (2Æ5) 44 (10Æ5) MICA: A9 (194 bp) 63 (18Æ5) 28 (13Æ7) 74 (17Æ6)

Signiﬁcant results are shown in bold face. Below, odds ratio (OR) is given with 95% conﬁdence interval in parentheses; Pc is P-value corrected for multiple testing. SNP, single nucleotide polymorphism; PV, psoriasis vulgaris; PsA, psoriatic arthritis; IL, interleukin; TNF, a b tumour necrosis factor; IFN, interferon. OR ¼ 0Æ71 (0Æ53–0Æ97), P ¼ 0Æ03, Pc >0Æ5; OR ¼ 1Æ51 (1Æ12–2Æ03), P ¼ 0Æ0067, Pc ¼ 0Æ033; c d e OR ¼ 1Æ37 (1Æ01–1Æ85), P ¼ 0Æ042, Pc >0Æ5; OR ¼ 1Æ38 (1Æ02–1Æ86), P ¼ 0Æ038, Pc >0Æ5; OR ¼ 0Æ34 (0Æ14–0Æ8), P ¼ 0Æ01, Pc >0Æ5; f OR ¼ 1Æ36 (1Æ01–1Æ83), P ¼ 0Æ042, Pc >0Æ5.

of all polymorphisms in the patients with psoriasis and in group (59Æ4% vs. 49Æ3%, P ¼ 0Æ0067, Pc ¼ 0Æ033). Although the control subjects were in Hardy–Weinberg equilibrium the patients with PV were also more likely to carry the IL-12B (P >0Æ05). There was complete or near complete linkage dis- +4510G and +12542A and TNF-b +723C alleles, the signi- equilibrium between the )511T and )31C alleles of the IL-1b ficance disappeared after correction for multiple testing gene, between the )590C and +33C alleles of the IL-4 gene, (Pc >0Æ05). No statistically significant associations of the between the )819C and )592C alleles of the IL-10 gene, other analysed cytokine gene polymorphisms could be found between the +4510G and +12542A alleles of the IL-12B between the patients with PV and controls. gene, and between the +10A and +252G alleles of the TNF-b In patients with PsA, no significantly different allelic, geno- gene. typic and haplotypic distributions of the analysed MICA and In patients with PV, the IL-12B +4496G allele was signifi- cytokine gene polymorphisms including TNF-a, TNF-b and cantly more frequent in the patient group than in the control IL-1a genes could be found between the patient group and

Table 3 Allele frequencies of HLA-Cw*0602 in patients and controls remains controversial. Evidence from several studies has suggested that the association of HLA-Cw*0602 with PsA is less HLA-Cw*0602 strong than that with PV.10,28 In our series, only about 6% of Group frequency (%) these 272 patients with psoriasis reported a family history of Patients with PsA 15/204 (7Æ4) psoriasis; the HLA-Cw*0602 was a strong susceptibility allele Patients with early-onset PsA 12/150 (8Æ0) in Chinese patients with early-onset PV, but not in patients a Patients with PV 59/340 (17Æ4) with PsA. b Patients with early-onset PV 42/166 (25Æ3) As the pathogenesis of PV cannot be explained solely by the Control subjects 20/420 (4Æ8) physiological function of HLA-C, the TNF-a, TNF-b and MICA aOdds ratio (95% confidence interval) ¼ 4Æ2(2Æ41–7Æ39), genes, near the HLA-C locus and KIR genes have been pro- ) P <10 7; bodds ratio (95% confidence interval) ¼ 6Æ77 (3Æ71– posed as the psoriasis susceptibility genes by association stud- ) 12Æ46), P <10 7. ies. TNF-a is considered to be a key proinflammatory cytokine in psoriasis and TNF-a –238A and –308A alleles were associated with age at onset of psoriasis.10–13,35 As the allele frequencies of TNF-a –238A and –308A were low in Japanese Table 4 Comparison of the IL-12B +4496G allele frequency between patients, it was reported that SNPs at –1031, –863 and –857 patients and controls according to their HLA-Cw*0602 status of the TNF-a gene were more commonly found in Japanese individuals, could lead to differences in the promoter activity Allele frequency of IL-12B +4496G HLA-Cw*0602 and conferred risk of rheumatoid arthritis in Japanese sub- status Patients (%) Controls (%) P-value jects.36 Therefore, we chose to study all these five SNPs of the Negative 135/232 (58Æ2) 184/379 (48Æ5) 0Æ026 TNF-a gene in the present study. As regards the TNF-b gene, Positive 67/108 (62) 23/41 (56Æ1) 0Æ64 the +252A polymorphism was associated with the presence and progression of joint erosions in PsA.14 MICA, located at 47 kb centromeric to HLA-B, is involved in NK/NKT cell functions. KIRs on the cell surface of NK/NKT cells may the control group. Moreover, no association was observed recognize HLA-C and are encoded by the KIR gene family clus- with disease onset, gender, the pattern of arthritis (peripheral tered on chromosome 19q13.4. Recently, the MICA-A9 allele or central arthritis) or the presence of joint erosion (data not and KIR2DS1/S2 have been found to confer susceptibility to shown). Regarding KIR genes, the genotype frequencies of PV/PsA in both Caucasian and Japanese populations.24–28 activating KIRs (KIR2DS1 and KIR2DS2) and inhibitory KIRs However, none of the previously reported TNF-a, TNF-b, (KIR2DL1 and KIR2DL2) were similar between the patients MICA or KIR associations with psoriasis was confirmed in the with PsA and the controls (data not shown). Therefore, present study. KIR2DS1, a major susceptibility gene for PsA found in the Previous studies have detected high levels of IL-1, IL-8, Caucasian and Japanese populations, was not a risk gene in IL-10, IL-12, TNF-a and IFN-c in skin lesions, synovial fluid the Chinese population. In fact, the KIR2DS1 frequency in our and sera of patients with psoriasis,5–9 and the polymorphisms patients was even lower than that in controls. of cytokine genes have been reported to influence disease sus- With regards to HLA-Cw*0602, its allele frequency was sig- ceptibility in patients with psoriasis. In the present study, nificantly different between the patients with PV and the con- however, no significantly different allelic, genotypic and haplo- trol subjects (Table 3) and the association was even stronger typic distributions of the analysed cytokine gene polymor- in patients with early-onset PV (25Æ3% vs. 4Æ8%, odds phisms could be found between the patients with PsA and the ) ratio ¼ 6Æ77, P <10 7). In contrast, the HLA-Cw*0602 was control group. Moreover, no association was observed with not a susceptibility allele in patients with PsA, even in those disease onset, gender, the pattern of arthritis or the presence with early-onset PsA. If we analysed the IL-12B +4496G of joint erosion. genotype data based on the presence or absence of HLA- Patients with PV were more likely to carry the IL-12B Cw*0602, the association with IL-12B +4496G was still found +4496G allele. IL-12, the primary inducer of the development in HLA-Cw*0602 ()) subjects but not in HLA-Cw*0602 (+) of Th1 cells, is considered to be an important immunomodu- subjects (Table 4). latory cytokine in psoriasis.37 The IL-12B gene is located on chromosome 5q31–33 and encodes the p40 subunit of IL-12. Discussion IL-12B and p19 may form IL-23 which can enhance the secretion of IFN-c. A recent study has shown significantly increased It has been suggested that psoriasis has a strong genetic back- levels of IL-23 and IL-12B, but not IL-12A, in psoriatic ground and that a positive family history is found in about lesions.38 Furthermore, patients with PV showed improvement one-third of patients with psoriasis.34 The HLA-Cw*0602 of the skin lesions after receiving anti-IL-12p40 antibody.39 allele at the PSORS1 locus is the allele conferring the most sus- A previous study showed that the IL-12B +4237A allele, ceptibility for PV in various populations. However, whether an intronic SNP, was strongly associated with asthma.40 the HLA-Cw*0602 confers similar susceptibility to PsA Because IL-12B +4496G is also an intronic SNP and we did

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp899–905 904 Cytokine gene polymorphisms in Chinese patients with psoriasis, Y.T. Chang et al. not measure the IL-12B levels in skin lesions, synovial fluid 9 Kane D, Gogarty M, O’Leary J et al. Reduction of synovial sublining and sera in our study subjects simultaneously, we cannot layer inflammation and proinflammatory cytokine expression in explore the relationship between the IL-12B genotype data psoriatic arthritis treated with methotrexate. Arthritis Rheum 2004; 50:3286–95. and the IL-12B tissue levels. Our results also cannot exclude 10 Ho¨hler T, Kruger A, Schneider PM et al. A TNF-alpha promoter the possibility that another gene closely linked to IL-12B, such polymorphism is associated with juvenile onset psoriasis and psori- as UBLCP1 (ubiquitin-like domain containing CTD phosphatase atic arthritis. J Invest Dermatol 1997; 109:562–5. 1), might actually determine the disease susceptibility; thus 11 Kaluza W, Reuss E, Grossmann S et al. Different transcriptional the observed IL-12B gene association could be due to linkage activity and in vitro TNF-alpha production in psoriasis patients car- disequilibrium. rying the TNF-alpha 238A promoter polymorphism. J Invest Dermatol In the present study, there is over 97% power to detect an 2000; 14:1180–3. 12 Al-Heresh AM, Proctor J, Jones SM et al. Tumour necrosis factor- increase from 4Æ8% to 17Æ4% in the frequency of Cw*0602 at alpha polymorphism and the HLA-Cw*0602 allele in psoriatic the 5% level of significance. However, for IL-12B +4496G arthritis. Rheumatology 2002; 41:525–30. there is 48% power to detect an increase from 49Æ3% to 13 Reich K, Mossner R, Konig IR et al. Promoter polymorphisms of 59Æ4% in the frequency. Because the case number in our series the genes encoding tumor necrosis factor-alpha and interleukin- is limited, it is likely that the power may not be enough to 1beta are associated with different subtypes of psoriasis character- detect genetic loci with a small effect on psoriasis. ized by early and late disease onset. J Invest Dermatol 2002; In conclusion, our results indicate that the IL-12B gene 118:155–63. 14 Balding J, Kane D, Livingstone W et al. Cytokine gene polymor- polymorphism conferred a risk of PV in our Chinese popula- phisms: association with psoriatic arthritis susceptibility and sever- tion, although the effect was more minor than that of ity. Arthritis Rheum 2003; 48:1408–13. HLA-Cw*0602. Cw*0602, KIR2DS1/S2 and MICA-A9 were 15 Litjens NH, van der Plas MJ, Ravensbergen B et al. Psoriasis is not unlikely to be risk alleles in our patients with PsA. The other associated with IL-12p70/IL-12p40 production and IL12B promo- analysed genetic polymorphisms of cytokine genes do not ter polymorphism. J Invest Dermatol 2004; 122:923–6. appear to be associated with susceptibility to PV and PsA in 16 Tsunemi Y, Saeki H, Nakamura K et al. Interleukin-12 p40 gene Chinese patients in Taiwan. Further studies are required to (IL12B)3¢-untranslated region polymorphism is associated with susceptibility to atopic dermatitis and psoriasis vulgaris. J Dermatol investigate the complex role of cytokine and cytokine gene Sci 2002; 30:161–6. polymorphisms in the pathogenesis of psoriasis. 17 Ravindran JS, Owen P, Lagan A et al. Interleukin 1alpha, interleukin 1beta and interleukin 1 receptor gene polymorphisms in psoriatic Acknowledgments arthritis. Rheumatology 2004; 43:22–6. 18 Tarlow JK, Cork MJ, Clay FE et al. Association between interleukin-1 The authors thank C.R. Wang and J.J. Shiue for their technical receptor antagonist (IL-1ra) gene polymorphism and early and late- assistance. This study was supported by a grant from Ministry onset psoriasis. Br J Dermatol 1997; 136:147–8. 19 Kingo K, Koks S, Silm H, Vasar E. IL-10 promoter polymorphisms of Education, Aim for the Top University Plan and a grant influence disease severity and course in psoriasis. Genes Immun 2003; from Taipei Veterans General Hospital (VGH 94–260), Execu- 4:455–7. tive Yuan, Taiwan. 20 Long F, Sun C, Deng D et al. TNF-238A is associated with juvenile onset psoriasis in patients of Han population in Southwest China. J Dermatol Sci 2004; 36:109–11. References 21 Mallon E, Newson R, Bunker CB. HLA-Cw6 and the genetic predis- 1 Yip SY. The prevalence of psoriasis in the Mongoloid race. JAm position to psoriasis: a meta-analysis of published serologic studies. Acad Dermatol 1984; 10:965–8. J Invest Dermatol 1999; 113:693–5. 2 Stern RS. Psoriasis. Lancet 1997; 350:349–53. 22 Chang YT, Shiao YM, Chin PJ et al. Genetic polymorphisms of the 3 Szegedi A, Aleksza M, Gonda A et al. Elevated rate of T helper1 HCR gene and a genomic segment in close proximity to HLA-C (T(H)1) lymphocytes and serum IFN-gamma levels in psoriatic are associated with psoriasis patients in Taiwan. Br J Dermatol 2004; patients. Immunol Lett 2003; 86:277–80. 150:1104–11. 4 Lew W, Lee E, Krueger JG. Psoriasis genomics: analysis of proinflam- 23 Nickoloff BJ, Bonish B, Huang BB, Porcelli SA. Characterization of matory (type 1) gene expression in large plaque (Western) and small a T cell line bearing natural killer receptors and capable of creating plaque (Asian) psoriasis vulgaris. Br J Dermatol 2004; 150:668–76. psoriasis in a SCID mouse model system. J Dermatol Sci 2000; 5 Ritchlin C, Haas-Smith SA, Hicks D et al. Patterns of cytokine pro- 24:212–25. duction in psoriatic synovium. J Rheumatol 1998; 25:1544–52. 24 Gonzalez S, Martinez-Borra J, Torre-Alonso JC et al. The MICA-A9 6 Ettehadi P, Greaves MW, Wallach D et al. Elevated tumour necrosis triplet repeat polymorphism in the transmembrane region confers factor-alpha (TNF-alpha) biological activity in psoriatic skin additional susceptibility to the development of psoriatic arthritis lesions. Clin Exp Immunol 1994; 96:146–51. and is independent of the association of Cw*0602 in psoriasis. 7 Elkayam O, Yaron I, Shirazi I et al. Serum levels of IL-10, IL-6, Arthritis Rheum 1999; 42:1010–16. IL-1ra, and sIL-2R in patients with psoriatic arthritis. Rheumatol Int 25 Nelson GW, Martin MP, Gladman D et al. Cutting edge: heterozy- 2000; 19:101–5. gote advantage in autoimmune disease: hierarchy of protection/ 8 Arican O, Aral M, Sasmaz S, Ciragil P. Serum levels of TNF-alpha, susceptibility conferred by HLA and killer Ig-like receptor combi- IFN-gamma, IL-6, IL-8, IL-12, IL-17, and IL-18 in patients with nations in psoriatic arthritis. J Immunol 2004; 173:4273–6. active psoriasis and correlation with disease severity. Mediators 26 Suzuki Y, Hamamoto Y, Ogasawara Y et al. Genetic polymorphisms Inflamm 2005; 2005:273–9. of killer cell immunoglobulin-like receptors are associated with

susceptibility to psoriasis vulgaris. J Invest Dermatol 2004; 122:1133– 33 Zhao JH. 2LD, GENECOUNTING and HAP: computer programs for 6. linkage disequilibrium analysis. Bioinformatics 2004; 20:1325–6. 27 Luszczek W, Manczak M, Cislo M et al. Gene for the activating nat- 34 Farber EM, Bright RD, Nall ML. Psoriasis. A questionnaire survey ural killer cell receptor, KIR2DS1, is associated with susceptibility to of 2,144 patients. Arch Dermatol 1968; 98:248–59. psoriasis vulgaris. Hum Immunol 2004; 65:758–66. 35 Veale DJ, Ritchlin C, FitzGerald O. Immunopathology of psoriasis 28 Williams F, Meenagh A, Sleator C et al. Activating killer cell immuno- and psoriatic arthritis. Ann Rheum Dis 2005; 64:ii26–9. globulin-like receptor gene KIR2DS1 is associated with psoriatic 36 Seki N, Kamizono S, Yamada A et al. Polymorphisms in the arthritis. Hum Immunol 2005; 66:836–41. 5¢-ﬂanking region of tumor necrosis factor-alpha gene in patients 29 Chang YT, Tsai SF, Lee DD et al. A study of candidate genes for with rheumatoid arthritis. Tissue Antigens 1999; 54:194–7. psoriasis near HLA-C in Chinese patients with psoriasis. Br J Dermatol 37 Shaker OG, Moustafa W, Essmat S et al. The role of interleukin-12 2003; 148:418–23. in the pathogenesis of psoriasis. Clin Biochem 2006; 39:119–25. 30 Chang YT, Chou CT, Shiao YM et al. The KIR genes do not confer 38 Lee E, Trepicchio WL, Oestreicher JL et al. Increased expression of susceptibility to psoriasis vulgaris independently in Chinese. J Invest interleukin 23 p19 and p40 in lesional skin of patients with psori- Dermatol 2006; 126:2335–8. asis vulgaris. J Exp Med 2004; 199:125–30. 31 Moll JM, Wright V. Psoriatic arthritis. Semin Arthritis Rheum 1973; 39 Kauffman CL, Aria N, Toichi E et al. A phase I study evaluating the 3:55–78. safety, pharmacokinetics, and clinical response of a human IL-12 32 Gomez-Lozano N, Vilches C. Genotyping of human killer-cell p40 antibody in subjects with plaque psoriasis. J Invest Dermatol immunoglobulin-like receptor genes by polymerase chain reaction 2004; 123:1037–44. with sequence-speciﬁc primers: an update. Tissue Antigens 2002; 40 Randolph AG, Lange C, Silverman EK et al. The IL12B gene is asso- 59:184–93. ciated with asthma. Am J Hum Genet 2004; 75:709–15.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp899–905 CONTACT DERMATITIS AND ALLERGY DOI 10.1111/j.1365-2133.2007.07796.x Olopatadine hydrochloride accelerates the recovery of skin barrier function in mice T. Amano, T. Takeda, H. Yano and T. Tamura Pharmaceutical Research Center, Kyowa Hakko Kogyo Co., Ltd, 1188 Shimotogari, Nagaizumi-cho, Sunto-gun, Shizuoka 411–8731, Japan

Summary

Correspondence Background The skin barrier function in patients with atopic dermatitis is disrupted Toru Amano. and prolonged topical steroid therapy produces epidermal barrier disturbance. E-mail: [email protected] Olopatadine hydrochloride (olopatadine; Allelock; Kyowa Hakko Kogyo Co., Ltd, Shizuoka, Japan) is an antiallergic drug with histamine H receptor antagon- Accepted for publication 1 16 November 2006 istic action. This drug alleviates skin inflammation and decreases the number of scratching episodes in a murine model of chronic contact dermatitis. Key words Objectives To investigate the effects of olopatadine and a steroid on the recovery of antihistamine, atopic dermatitis, olopatadine skin barrier function after barrier disruption in mice. hydrochloride, skin barrier, topical steroid Methods The skin barrier of the ears of mice was disrupted by tape stripping. The Conflicts of interest recovery of skin barrier function was monitored by measurement of transepider- The authors are employed by Kyowa Hakko Kogyo mal water loss (TEWL) after barrier disruption. Epidermal hyperplasia was Co., Ltd (Shizuoka, Japan), the manufacturer of induced by repeated tape stripping for 7 days. Olopatadine was administered Allelock (olopatadine). orally once daily from 3 days before the first barrier disruption. Betamethasone 17-valerate (betamethasone) was applied topically once daily from 3 days before barrier disruption. Results Tape stripping led to a significant increase in TEWL. TEWL decreased with time after tape stripping and the skin barrier function recovered by over 60% within 9 h after tape stripping. The recovery of skin barrier in olopatadine- treated mice was significantly accelerated, compared with that in vehicle-treated mice. In contrast, the skin barrier recovery in mice treated with topical betamethasone was significantly delayed, compared with that in vehicle-treated mice. Combined treatment with olopatadine and betamethasone ameliorated the delay in barrier recovery induced by topical treatment with betamethasone. In addition, olopatadine significantly prevented the increase in epidermal thickness induced by prolonged barrier disruption. Conclusions These results suggest that systemic administration of olopatadine accelerates the recovery of skin barrier function and ameliorates the adverse effects of topical steroids on skin barrier recovery.

Atopic dermatitis (AD), allergic contact dermatitis and psori- Topical steroids and emollients have been widely prescribed asis vulgaris are the most common skin diseases. AD is a for the lesions in various inflammatory skin disorders inclu- chronically relapsing inflammatory skin disease characterized ding AD and contact dermatitis.4 However, prolonged topical by episodes of intense pruritus, multiple lesions with ery- treatment with steroids results in well-recognized skin abnor- thema, excoriation, erosions, lichenification, papules, dry skin malities such as skin atrophy and epidermal barrier distur- and susceptibility to cutaneous infection. In the skin of bance.5 For example, prolonged steroid therapy produces patients with AD, skin barrier function is disrupted, with epidermal thinning and increases basal TEWL, indicating a increase in transepidermal water loss (TEWL) and decrease in defect in skin barrier function.6,7 These adverse effects of ster- skin hydration.1 The relationship of an increase of TEWL to oids are generally attributed to their negative effects on the severity of AD symptoms has been reported.2 Patients with keratinocyte proliferation and epidermal lipid synthesis.6 A AD often complain of intense itching. Scratching with finger- more recent study has shown that, in the normal skin of nails causes physical damage to the skin and aggravates skin humans and mice, even short-term treatment with a potent lesions.3 steroid could produce deterioration in barrier homeostasis,

2007 The Authors 906 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp906–912 Olopatadine-accelerated skin barrier repair, T. Amano et al. 907 characterized by delayed barrier recovery and abnormal stra- water. Betamethasone was dissolved in propylene glycol/ tum corneum integrity.8 ethanol (7 : 3).

Histamine H1 receptor antagonists have long been prescribed for patients with AD as an adjunct to therapy with Recovery of skin barrier function topical agents, in the belief that they reduce pruritus by blocking the action of histamine in the skin. Histamine is also Skin barrier function was evaluated by measurement of TEWL considered to contribute to the maintenance of skin barrier using a VapoMeter (Delfin, Kuopio, Finland). In mice anaes- ) function in the epidermis. In an experimental model of skin thetized with pentobarbital 50 mg kg 1, the ventral surface of barrier disruption, topical application of histamine delayed the right ear was treated by tape stripping with cellophane barrier recovery and topical application of the histamine tape (Scotch; Sumitomo 3M, Tokyo, Japan) until TEWL )2 )1 H1 receptor antagonist diphenhydramine accelerated barrier reached 40–50 g m h . TEWL was measured just before, recovery.9 However, it has not been shown whether adminis- immediately after and at 1, 3, 6 and 9 h after tape stripping. tration of histamine H1 receptor antagonists under commonly The percentage of barrier recovery was calculated using employed conditions (i.e. systemic oral administration) accel- the following formula: (TEWL immediately after tape strip- erates skin barrier recovery. ping ) TEWL at indicated time point)/(TEWL immediately Olopatadine hydrochloride (olopatadine; Allelock; Kyowa after tape stripping ) TEWL before tape stripping) · 100%. Hakko Kogyo Co., Ltd, Shizuoka, Japan) is an antiallergic The areas under the curves (AUCs) for the skin barrier recov- agent with histamine H1 receptor-antagonistic action. Olopata- ery rates were calculated using the trapezoid method. Distilled ) dine is indicated for the signs and symptoms of allergic rhini- water, olopatadine at 1, 3 and 10 mg kg 1 daily and chlor- ) tis, chronic urticaria, eczema/dermatitis, prurigo, pruritus, pheniramine 10 mg kg 1 daily were administered orally to psoriasis vulgaris and erythema multiforme. We have reported mice once daily from 3 days before tape stripping. To exam- that olopatadine attenuates (i) the elevation of cytokines ine the effects of olopatadine on the delay in the barrier such as interleukin (IL)-4 and interferon-c in the lesion and recovery in betamethasone-treated mice, distilled water or olo- ) (ii) increases in the number of scratching episodes in a mouse patadine 10 mg kg 1 daily was administered orally to mice in model of chronic contact dermatitis induced by repeated chal- combination with topical application of either vehicle or lenge of hapten.10,11 We have also demonstrated that olo- 0Æ12% w/v betamethasone (0Æ012 mg per ear daily) once patadine suppresses the rebound phenomenon after the daily from 3 days before tape stripping. Distilled water, olo- discontinuation of topical steroid therapy in mice with chronic patadine and chlorpheniramine were administered orally at a contact dermatitis.12 The aims of this study were, firstly, to volume of 1 mL per 100 g of body weight. Vehicle and beta- investigate whether systemic administration of olopatadine methasone were applied at a volume of 10 lL per ear. accelerates the recovery of skin barrier function disrupted by tape stripping in mice and, secondly, to examine the effect of Quantification of histamine release from the skin olopatadine on the delay in skin barrier recovery in mice treated with topical steroid. Skin biopsies (circles of 8 mm diameter) were taken from the ear treated with or without tape stripping and incubated in Materials and methods phosphate-buffered saline at room temperature for 30 min. Histamine in the supernatant was quantified with a Histamine EIA kit (MBL, Nagano, Japan), according to the manufacturer’s Animals instructions. Six-week-old male ICR mice were purchased from CLEA Japan (Tokyo, Japan). The animals were kept in a specific pathogen- Epidermal hyperplasia induced by prolonged barrier free animal facility maintained at a temperature of 19–25 C, disruption humidity of 30–70%, and a 12-h day/night cycle, and were given access to food and water ad libitum. The experiments The ventral surface of the right ear of mice was treated were conducted in accordance with the Guiding Principles for with repeated tape stripping until TEWL reached over ) ) the Care and Use of Laboratory Animals and approved by the 50 g m 2 h 1. This procedure was carried out twice daily for Committee for Animal Experiments of Kyowa Hakko Kogyo 7 days. Distilled water and olopatadine at doses of 3 and ) Co., Ltd (Shizuoka, Japan). 10 mg kg 1 daily were administered orally once daily from 3 days before the first barrier disruption. Twenty-four hours after the final barrier disruption, mice were killed and the right Materials ear was removed. Punch biopsy specimens of the ear (circles Olopatadine was synthesized at Yokkaichi Plant, Kyowa Yuka of 8 mm diameter) were weighed, fixed with 10% v/v neutral Co., Ltd (Mie, Japan). Betamethasone 17-valerate (betametha- buffered formalin and embedded in paraffin wax. Tissue sec- sone) and chlorpheniramine maleate (chlorpheniramine) were tions were stained with haematoxylin and eosin for light purchased from Sigma Chemical Co. (St Louis, MO, U.S.A.). microscopic observation. Three sections were taken from each Olopatadine and chlorpheniramine were dissolved in distilled ear specimen. On each section, 10 points were selected at

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp906–912 908 Olopatadine-accelerated skin barrier repair, T. Amano et al. random and the thickness of the epidermis was measured with released from the skin with or without tape stripping. Tape a digital high deﬁnition microscope (VH-7000C; Keyence, stripping signiﬁcantly increased the secretion of histamine Osaka, Japan). The mean epidermal thickness was calculated. from the skin tissues within 30 min (Fig. 2).

Statistical analysis (a) Data are presented as mean ± SEM. The Aspin-Welch test or 50 DW Student’s t-test following the F-test was used for analysis of Olo 1 mg kg–1 differences between two groups. Multiple comparisons among 40 treatment groups were made by one-way analysis of variance, Olo 3 mg kg–1 followed by the Dunnett test. P <0Æ05 was considered statisti- ) Olo 10 mg kg–1 –1

h 30 cally signiﬁcant. All statistical calculations were performed ∗ with the Statistical Analysis System (SAS release 8.2; SAS Insti- –2 ∗∗∗ tute, Cary, NC, U.S.A.). 20 ∗∗ ∗ TEWL (g m Results 10

Olopatadine accelerates skin barrier recovery 0 Mean ± SEM TEWL values of the ear of mice treated with dis- 0369 ) tilled water, and olopatadine at doses of 1, 3 and 10 mg kg 1 Time after tape stripping (h) daily were 7Æ9±0Æ6, 7Æ5±0Æ4, 8Æ2±0Æ5 and 7Æ6± ) ) (b) 0Æ4gm 2 h 1, respectively, indicating that treatment with 80 olopatadine for 3 days did not affect basal TEWL. In addition, ∗ TEWL immediately after tape stripping in olopatadine-treated ∗∗ mice was also comparable with that in distilled water-treated 60 ∗∗∗ mice (Fig. 1a). TEWL decreased with time after tape stripping and skin barrier function recovered by over 60% at 9 h after ∗ tape stripping in distilled water-treated mice (Table 1). In mice 40 )1 treated with olopatadine at 3 and 10 mg kg daily, the recov- DW ery of skin barrier function was signiﬁcantly accelerated at 1 h Recovery (%) Olo 1 mg kg–1 and at 1, 3 and 6 h after tape stripping, respectively, compared 20 Olo 3 mg kg–1 with that in distilled water-treated mice (Fig. 1b). The AUC Olo 10 mg kg–1 for skin barrier recovery rates showed that olopatadine accelerated skin barrier recovery in a dose-dependent manner 0 (Fig. 1c). In contrast, the classical histamine H1 receptor antag- ) 0369 onist chlorpheniramine at 10 mg kg 1 daily did not have sig- Time after tape stripping (h) niﬁcant effects on the AUC (Fig. 1c). (c) 600 Histamine release from the skin immediately after ∗∗∗ barrier disruption ∗ To ascertain the contribution of endogenous histamine to the skin barrier recovery, we evaluated the amount of histamine 500

Fig 1. The effect of olopatadine (Olo) on the recovery of skin barrier AUC function after tape stripping. Distilled water (DW) and Olo at doses ) 400 of 1, 3 and 10 mg kg 1 daily (a–c) and chlorpheniramine (Chl) at ) 10 mg kg 1 daily (c) were administered orally from 3 days before barrier disruption. Transepidermal water loss (TEWL) was measured before, immediately after and at 1, 3, 6 and 9 h after tape stripping (a). Skin barrier recovery rate (b) and the area under the curve (AUC) 300 for the skin barrier recovery rate (c) were determined as described in DW 1 3 10 10 Materials and methods. Results are expressed as mean ± SEM (n ¼ 8). Olo Chl *P <0Æ05, **P <0Æ01, ***P <0Æ001 as compared with the DW (mg kg–1) (mg kg–1) group by Dunnett test.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp906–912 Olopatadine-accelerated skin barrier repair, T. Amano et al. 909

Table 1 The effect of olopatadine on skin barrier recovery after tape stripping Skin barrier recovery (%)

1h 3h 6h 9h Distilled water 32Æ8±2Æ347Æ7±3Æ458Æ5±1Æ465Æ7±1Æ8 ) Olopatadine 1 mg kg 1 37Æ3±3Æ452Æ0±2Æ557Æ5±2Æ065Æ0±2Æ0 ) Olopatadine 3 mg kg 1 46Æ2±4Æ2* 56Æ9±2Æ662Æ2±2Æ371Æ3±3Æ0 ) Olopatadine 10 mg kg 1 52Æ3±2Æ3*** 62Æ3±1Æ9** 67Æ6±2Æ6* 72Æ5±2Æ1 ) Chlorpheniramine 10 mg kg 1 44Æ0±2Æ5## 56Æ3±3Æ661Æ3±2Æ767Æ3±1Æ9

Data are presented as mean ± SEM (n ¼ 8). *P <0Æ05, **P <0Æ01, ***P <0Æ001 as compared with the distilled water group by Dunnett test. ##P <0Æ01 as compared with the distilled water group by Student’s t-test.

nation with topical application of betamethasone at clinically 1000 ∗∗ relevant concentration (0Æ12% w/v). Mean ± SEM TEWL values of the ear of mice treated with vehicle and betamethasone ) ) 800 were 7Æ9±0Æ5 and 7Æ7±0Æ6gm 2 h 1, respectively, indica- )

–1 ting that topical treatment with betamethasone for 3 days did not affect basal TEWL. As shown in Fig. 3 and Table 2, the 600 recovery of skin barrier function in mice treated with topical betamethasone for 3 days was signiﬁcantly delayed, compared 400 with that in vehicle-treated mice. The barrier recovery in mice treated with a combination of olopatadine and betamethasone Histamine (nmol L was signiﬁcantly accelerated, compared with that in mice trea- 200 ted with betamethasone alone (Fig. 3b).

0 Normal Tape stripping Olopatadine suppresses epidermal hyperplasia induced by barrier disruption

Fig 2. The release of histamine from the skin treated with tape Finally, we examined the effect of olopatadine on epidermal stripping. The amount of histamine in the supernatant of the skin hyperplasia induced by prolonged barrier disruption. As organ culture with or without tape stripping (Normal) was shown in Figure 4, the thickness of the epidermis in mice determined. Results are expressed as mean ± SEM (n ¼ 5). treated with prolonged tape stripping for 7 days was increased **P <0Æ01 as compared with the normal group by Student’s t-test. 2Æ6-fold, compared with that in untreated mice. Olopatadine ) at 10 mg kg 1 daily signiﬁcantly suppressed the increase in epidermal thickness by 40Æ5% (Fig. 4). Olopatadine ameliorates the delay in barrier recovery caused by topical betamethasone Discussion To evaluate the effects of olopatadine on the delay in barrier recovery in mice treated with topical steroids, olopatadine Systemic administration of the histamine H1 receptor antagon- ) 10 mg kg 1 daily was administered orally to mice in combi- ist olopatadine accelerated skin barrier recovery after barrier

Table 2 The effects of olopatadine and betamethasone on skin barrier recovery Skin barrier recovery (%)

1h 3h 6h 9h Vehicle/distilled water 37Æ0±1Æ352Æ1±2Æ158Æ9±2Æ364Æ5±2Æ6 Vehicle/olopatadine 48Æ2±3Æ0## 59Æ7±2Æ2* 64Æ3±2Æ567Æ7±2Æ4 Betamethasone/distilled water 24Æ8±2Æ4*** 36Æ2±3Æ2*** 45Æ8±2Æ7** 51Æ3±3Æ9* Betamethasone/olopatadine 33Æ4±2Æ0$ 44Æ3±2Æ6* 53Æ3±2Æ658Æ2±4Æ5

Data are presented as mean ± SEM (n ¼ 8). *P <0Æ05, **P <0Æ01, ***P <0Æ001 as compared with the vehicle/distilled water group by Student’s t-test. ##P <0Æ01 as compared with the vehicle/distilled water group by Aspin–Welch test. $P <0Æ05 as compared with the betamethasone/distilled water group by Student’s t-test.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp906–912 910 Olopatadine-accelerated skin barrier repair, T. Amano et al.

study has been shown significantly to suppress histamine- (a) 13 80 induced formation of paw oedema in mice, it remains unclear whether systemic administration of this drug achieves ∗ sufficient drug concentration to antagonize histamine response 60 in the epidermis. Alternatively, olopatadine appears to exert ## additional biological effects besides its histamine H1 receptor ∗ antagonistic activity on skin barrier recovery. Further studies ∗ ∗∗ 40 are required to elucidate whether histamine H1 receptor antagonists other than olopatadine can accelerate the barrier recov- $ ∗∗ ∗ Veh/DW Recovery (%) ery by systemic administration. Veh/Olo 20 ∗∗ ∗ The facilitatory effects of olopatadine on skin barrier recov- Beta/DW ery were detected at early time points after barrier disruption Beta/Olo by tape stripping. One of the earliest and crucial stages of the 0 skin barrier recovery is the exocytosis of lipid-containing 0 3 6 9 Time after tape stripping (h) granules, called lamellar bodies. The lipids secreted into the intercellular domain of the stratum corneum form a water- (b) 600 impermeable membrane within 1 h after damage of the barrier function.14 Previous studies showed that disruption of the skin barrier caused an immediate loss of the calcium gradient ∗ in the epidermis and that calcium ion influx into keratinocytes 500 reduced the secretion of lamellar bodies resulting in the delay in skin barrier recovery.15–17 In this study, we demonstrated that histamine was released from the skin organ culture imme- $ AUC diately after barrier disruption by tape stripping. Histamine 400 caused an elevation of intracellular calcium in keratinocytes 18 ∗∗ ∗ via histamine H1 receptor. Topical application of exogenous histamine caused a delay in the skin barrier recovery.9 These results suggest that histamine participates in the regulation of 300 the secretion of lamellar bodies in an early stage of skin bar- Veh/ Veh/ Beta/ Beta/ rier recovery. The facilitatory effects of histamine H1 receptor DW Olo DW Olo antagonists on the barrier recovery might be due to the acceleration of lamellar body secretion in the epidermis. Fig 3. The effect of olopatadine (Olo) on the delay in skin barrier Skin atrophy and epidermal barrier disturbance are well- recovery after tape stripping in mice treated with betamethasone ) recognized adverse effects of prolonged topical steroid (Beta). Distilled water (DW) or Olo 10 mg kg 1 daily was therapy.5 Even short-term treatment with the potent steroid administered orally to mice in combination with either topical clobetasol at clinically relevant concentration (0Æ05% w/v) application of vehicle (Veh/DW or Veh/Olo) or 0Æ12% w/v Beta (Beta/DW or Beta/Olo) from 3 days before barrier disruption. could produce deterioration in barrier function in the skin of 8 Transepidermal water loss was measured just before and at 0, 1, 3, 6 humans and mice. In the skin of mice treated with clobeta- and 9 h after tape stripping. Skin barrier recovery rate (a) and the sol, both the density of lamellar bodies and the amount of area under the curve (AUC) for the skin barrier recovery rate (b) secreted lamellar bodies at the interface between the stratum were determined as described in Materials and methods. Results corneum and the stratum granulosum were markedly are expressed as mean ± SEM (n ¼ 8). *P <0Æ05, **P <0Æ01, reduced. Here we showed that topical treatment with beta- ***P <0Æ001 as compared with the Veh/DW group by Student’s methasone, a less potent steroid than clobetasol, could also t-test. ##P <0Æ01 as compared with the Veh/DW group by Aspin– produce a significant delay in the barrier recovery. Combined Welch test. $P <0Æ05 as compared with the Beta/DW group by treatment with olopatadine + betamethasone ameliorated the Student’s t-test. delay in barrier recovery by betamethasone at 1 h but not at later time points after barrier disruption. Olopatadine might accelerate the secretion of lamellar bodies as described above disruption. This result was consistent with the previous report but did not affect the reduction in lipid synthesis caused by 12 that topical application of the classical histamine H1 receptor topical steroids. Tamura et al. reported that olopatadine sup- antagonist diphenhydramine accelerated the barrier recovery,9 pressed the rebound phenomenon following discontinuation suggesting that histamine and histamine H1 receptor may con- of topical treatment with a steroid, possibly resulting from tribute to the recovery of skin barrier function. In contrast, its effects in diminishing the elevated cytokines in the le- systemic administration of the classical histamine H1 receptor sional skin. Thus, olopatadine is expected to be a therapeutic antagonist chlorpheniramine had less effect on skin barrier agent that reduces the adverse effects of therapy with topical recovery. Although chlorpheniramine at the dose used in this steroids.

(a) (b)

(c) (d) Fig 4. The effect of olopatadine (Olo) on epidermal hyperplasia induced by prolonged barrier disruption. Tape stripping was carried out twice a day for 7 days. Distilled water ) (DW) and Olo at doses of 3 and 10 mg kg 1 daily were administered orally from 3 days before the first barrier disruption. As an untreated control, mice were administered DW without tape stripping (Sham). Twenty- four hours after the final tape stripping, ear specimens were fixed and stained with (e) 50 haematoxylin and eosin. (a) Sham, (b) DW, )1 (c) Olo at 3 mg kg daily, (d) Olo at mm) 40

) –3 10 mg kg 1 daily. Scale bar ¼ 50 lm. The ∗∗∗ 30 thickness of the epidermis was measured as described in Materials and methods (e). 20 ### Results are expressed as mean ± SEM (n ¼ 7–8). ***P <0Æ001 as compared with the 10 DW group by Dunnett test. ###P <0Æ001 as Epidermal thickness (10 0 compared with the DW group by Student’s Sham DW 3 10 –1 t-test. Olo (mg kg )

Olopatadine prevented the epidermal hyperplasia induced keratinocytes induced by histamine could stimulate the prolif- by prolonged barrier disruption. Although the magnitude of eration of keratinocytes resulting in epidermal hyperplasia. epidermal hyperplasia was directly correlated with both the Olopatadine might not only accelerate barrier recovery but degree and the duration of barrier disruption, occlusion with also provide other potential beneﬁts after epidermal injury, a water-impermeable membrane did not prevent the epider- resulting from its inhibitory effects on the production of mal hyperplasia, indicating that the epidermal hyperplasia did cytokines by keratinocytes. not appear to be directly related to an increase in TEWL in Scratching with ﬁngernails causes physical damage to the this model.19 Olopatadine might suppress epidermal hyper- skin, resulting in an increase of TEWL, and aggravates skin plasia by a mechanism independent of its facilitatory effect on lesions in patients with AD.25 So, suppression of scratching skin barrier recovery. The mechanisms by which prolonged behaviour results in a reduction of TEWL. Several reports barrier disruption induces the epidermal hyperplasia have implicated skin dryness itself and/or skin barrier disruption in remained unclear. Barrier disruption by tape stripping leads to dry skin-associated pruritus.26,27 However, in this study, tape an increase in the production of epidermal cytokines, such stripping treatment did not cause scratching behaviour in mice as tumour necrosis factor-a, granulocyte/macrophage colony- as reported previously.28 Therefore, the facilitatory effect of stimulating factor (GM-CSF), IL-8, IL-1a, IL-1b and IL-6.20,21 olopatadine on skin barrier recovery was not due to suppres- Among these cytokines, GM-CSF, IL-6 and IL-8 have been sion of scratching behaviour. Thus, olopatadine might not shown to stimulate keratinocyte proliferation.22–24 Keratino- only suppress scratching behaviour but also might accelerate cytes, which comprise 95% of the cells in the epidermis, are skin barrier recovery after physical barrier disruption by one of the important sources of cytokines in the skin. Hista- scratching behaviour in patients with AD. mine has been shown to induce production of GM-CSF, IL-6 In conclusion, olopatadine was demonstrated to be an anti- and IL-8 in human keratinocytes.18 Olopatadine inhibited allergic drug accelerating skin barrier recovery and to amelior- production of these cytokines induced by histamine in kera- ate the adverse effects of topical steroids on the skin barrier tinocytes.18 Thus, increased production of cytokines in recovery.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp906–912 912 Olopatadine-accelerated skin barrier repair, T. Amano et al.

References 14 Elias PM, Feingold KR. Coordinate regulation of epidermal differentiation and barrier homeostasis. Skin Pharmacol Appl Skin Physiol 1 Jensen JM, Folster-Holst R, Baranowsky A et al. Impaired sphin- 2001; 14:28–34. gomyelinase activity and epidermal differentiation in atopic derma- 15 Menon GK, Price LF, Bommannan B et al. Selective obliteration of titis. J Invest Dermatol 2004; 122:1423–31. the epidermal calcium gradient leads to enhanced lamellar body 2 Kim DW, Park JY, Na GY et al. Correlation of clinical features and secretion. J Invest Dermatol 1994; 102:789–95. skin barrier function in adolescent and adult patients with atopic 16 Lee SH, Elias PM, Proksch E et al. Calcium and potassium are dermatitis. Int J Dermatol 2006; 45:698–701. important regulators of barrier homeostasis in murine epidermis. 3 Kimura T, Miyazawa H. The ‘butterfly’ sign in patients with J Clin Invest 1992; 89:530–8. atopic dermatitis: evidence for the role of scratching in the develop- 17 Denda M, Fuziwara S, Inoue K. Influx of calcium and chloride ions ment of skin manifestations. J Am Acad Dermatol 1989; 21:579– into epidermal keratinocytes regulates exocytosis of epidermal 80. lamellar bodies and skin permeability barrier homeostasis. J Invest 4 Wahlgren CF. Itch and atopic dermatitis: an overview. J Dermatol Dermatol 2003; 121:362–7. 1999; 26:770–9. 18 Matsubara M, Tamura T, Ohmori K et al. Histamine H1 receptor 5 Ulrich RH, Thomas R, Robert A et al. Adverse effects of topical antagonist blocks histamine-induced proinflammatory cytokine glucocorticosteroids. J Am Acad Dermatol 2006; 54:1–15. production through inhibition of Ca2+-dependent protein kinase C, 6 Woodbury R, Kligman AM. The hairless mouse model for assaying Raf/MEK/ERK and IKK/I kappa B/NF-kappa B signal cascades. the atrophogenicity of topical corticosteroids. Acta Derm Venereol Biochem Pharmacol 2005; 69:433–49. (Stockh) 1992; 72:403–6. 19 Denda M, Wood LC, Emami S et al. The epidermal hyperplasia 7 Sheu HM, Lee JY, Chai CY et al. Depletion of stratum corneum associated with repeated barrier disruption by acetone treatment intercellular lipid lamellae and barrier function abnormalities or tape stripping cannot be attributed to increased water loss. Arch after long-term topical corticosteroids. Br J Dermatol 1997; Dermatol Res 1996; 288:230–8. 136:884–90. 20 Wood LC, Jackson SM, Elias PM et al. Cutaneous barrier perturba- 8 Kao JS, Fluhr JW, Man MQ et al. Short-term glucocorticoid treat- tion stimulates cytokine production in the epidermis of mice. J Clin ment compromises both permeability barrier homeostasis and stra- Invest 1992; 90:482–7. tum corneum integrity: inhibition of epidermal lipid synthesis 21 Wang XP, Schunck M, Kallen KJ et al. The interleukin-6 cytokine accounts for functional abnormalities. J Invest Dermatol 2003; system regulates epidermal permeability barrier homeostasis. J Invest 120:456–64. Dermatol 2004; 123:124–31. 9 Ashida Y, Denda M, Hirao T. Histamine H1 and H2 receptor 22 Kawada A, Hiruma M, Noguchi H et al. Granulocyte and macro- antagonists accelerate skin barrier repair and prevent epidermal phage colony-stimulating factors stimulate proliferation of human hyperplasia induced by barrier disruption in a dry environment. keratinocytes. Arch Dermatol Res 1997; 289:600–2. J Invest Dermatol 2001; 116:261–5. 23 Grossman RM, Krueger J, Yourish D et al. Interleukin 6 is expressed 10 Tamura T, Matsubara M, Takada C et al. Effects of olopatadine in high levels in psoriatic skin and stimulates proliferation of cul- hydrochloride, an antihistamine drug, on skin inflammation tured human keratinocytes. Proc Natl Acad Sci USA 1989; 86:6367– induced by repeated topical application of oxazolone in mice. 71. Br J Dermatol 2004; 151:1133–42. 24 Tuschil A, Lam C, Haslberger A et al. Interleukin-8 stimulates 11 Tamura T, Amano T, Ohmori K et al. The effects of olopatadine calcium transients and promotes epidermal cell proliferation. J Invest hydrochloride on the number of scratching induced by repeated Dermatol 1992; 99:294–8. application of oxazolone in mice. Eur J Pharmacol 2005; 524:149– 25 Watanabe M, Tagami H, Horii I et al. Functional analyses of the 54. superficial stratum corneum in atopic xerosis. Arch Dermatol 1991; 12 Tamura T, Matsubara M, Hasegawa K et al. Olopatadine hydrochlo- 127:1689–92. ride suppresses the rebound phenomenon after discontinuation of 26 Long CC, Marks R. Stratum corneum changes in patients with treatment with a topical steroid in mice with chronic contact senile pruritus. J Am Acad Dermatol 1992; 27:560–4. hypersensitivity. Clin Exp Allergy 2005; 35:97–103. 27 Yosipovitch G, Boner G. Pruritus and skin hydration during dialysis. 13 Tamura T, Masaki S, Ohmori K et al. Effect of olopatadine and Nephrol Dial Transplant 1997; 12:1769–70. other histamine H1 receptor antagonists on the skin inflammation 28 Miyamoto T, Nojima H, Shinkado T et al. Itch-associated response induced by repeated topical application of oxazolone in mice. induced by experimental dry skin in mice. Jpn J Pharmacol 2002; Pharmacology 2005; 75:45–52. 88:285–92.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp906–912 EPIDEMIOLOGY AND HEALTH SERVICES RESEARCH DOI 10.1111/j.1365-2133.2006.07707.x Cost-effectiveness of tacrolimus ointment vs. standard treatment in patients with moderate and severe atopic dermatitis: a health-economic model simulation based on a patient survey and clinical trial data J. Hjelmgren, A˚. Svensson,* E.T. Jo¨rgensen, B. Lindemalm-Lundstam and G. Ragnarson Tennvall IHE, The Swedish Institute for Health Economics, PO Box 2127, SE-220 02 Lund, Sweden *Department of Dermatology, University Hospital of Malmo¨, Malmo¨, Sweden Department of Dermatology, Kalmar Hospital, Kalmar, Sweden Department of Dermatology, Va¨stra Fro¨lunda Hospital, Va¨stra Fro¨lunda, Sweden

Summary

Correspondence Background Atopic dermatitis (AD) affects health and quality of life (QoL) and also Gunnel Ragnarson Tennvall. has great impact on both healthcare costs and costs to society. E-mail: [email protected] Objectives The aim of the study was to analyse the cost-effectiveness of treatment with tacrolimus ointment vs. standard treatment in patients with moderate to Accepted for publication 10 October 2006 severe AD. Methods A Markov simulation model was constructed capturing several key features Key words of AD and its treatment: disease severity, treatment alternatives, and QoL. The atopic dermatitis, cost-effectiveness, model model was populated with data from three sources: (i) efficacy data from a simulation, tacrolimus ointment randomized controlled trial including patients with moderate to severe AD Conflicts of interest treated with either tacrolimus ointment or standard treatment (corticosteroids), None declared. (ii) resource utilization and QoL data from a patient survey including 161 Swedish patients with AD, and (iii) official price lists. Costs were calculated according to disease severity for the two treatment alternatives using the perspective of the Swedish healthcare sector. Two analyses were performed, one based on the quantity of medication used in the trial and one based on the survey data. The relationship between effectiveness of tacrolimus ointment and the amount of medication used was tested in sensitivity analyses. Results In the model simulations patients with severe AD treated with tacrolimus ointment experienced on average 4Æ6 more AD-free weeks per year than patients given standard treatment. The corresponding figure for patients with moderate AD was 6Æ5 more AD-free weeks per year. The cost-effectiveness ratios [cost per Quality Adjusted Life Year (QALY) gained] for treatment with tacrolimus ointment vs. standard treatment were £2334 for moderate AD and £3875 for severe AD when treatment patterns from the survey were assumed, and £8269 for moderate AD and £12 304 for severe AD when treatment patterns from the clinical trial were assumed. The results of sensitivity analyses were all well within limits to be considered cost-effective. Conclusions Estimates of the incremental cost-effectiveness ratio are far below the currently discussed threshold in Sweden, corresponding to approximately £48 700 per QALY gained, and equivalent thresholds in other countries. Treat- ment with tacrolimus ointment in patients with moderate and severe AD can therefore be considered cost-effective.

Atopic dermatitis (AD) is a chronic inﬂammatory skin disorder esteem and social interaction with family, friends and col- that affects both adults and children. The disease can seriously leagues. AD has been shown to have as large an impact on affect health and quality of life (QoL) with inﬂuence on self- health-related QoL as other chronic conditions such as

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 913 914 Cost-effectiveness of AD treatment, J. Hjelmgren et al. diabetes.1 AD has been found to have a particular impact on social functioning and psychological well-being. A prevalence Severe AD Severe AD of 15–20% has been reported in Western countries and the (first line) (second line) disease has great impact on both healthcare costs and costs to society.2–4 Standard treatment of AD includes emollients and topical Moderate corticosteroids. Tacrolimus ointment is a product for local AD treatment of AD. It has shown significant effect on moderate to severe disease in both adults and children.5–7 The product was registered in Sweden and in other EC countries in 2002. Virtually The aim of this study was to design a health-economic model cleared for analysis of whether tacrolimus ointment would be a cost- effective treatment alternative for patients with moderate to severe AD in comparison with presently used standard treat- Fig 1. Markov model for health-economic simulation of treatment ment in Sweden. in patients with atopic dermatitis (AD) including four health states: (i) severe AD, first-line treatment, (ii) severe AD, second-line treatment, (iii) moderate AD, and (iv) virtually cleared. The dashed Patients and methods lines indicate that the patient has not initially responded to first-line treatment. The transition probabilities of moving between health states A further description of the health-economic methods used in are presented in Table 2. the study can be found in Appendix 1. for a cohort of patients during a defined period of time (1 year). By comparing costs and QALYs according to the Health-economic model equation below, the cost-effectiveness in terms of cost per A health-economic Markov model8,9 was developed for analy- QALY gained can be estimated: sis of the cost-effectiveness of treatment with tacrolimus oint- Coststacrolimus treatment Costsstandard care ment compared with standard treatment in patients with : QALYstacrolimus treatment QALYsstandard care moderate to severe AD. The model is mainly applicable for Swedish treatment practice and is designed according to the The model illustrates the disease progression in 3-week cycles. specifications for health-economic studies released by the Phar- This time period is assumed to be sufficiently long to capture maceutical Benefits Board (La¨kemedelsfo¨rma˚nsna¨mnden).10 the timing of different events, i.e. clearance, improvement or The model includes four health states (Table 1). The model worsening of symptoms. The perspective of the health- simulation starts with patients who have been diagnosed with economic analysis is that of the healthcare sector, which either severe or moderate AD. Patients can move between dif- means that costs borne by the healthcare sector, such as medi- ferent health states (Fig. 1) with a certain probability, a transi- cation and physician visits, are included. tion probability. Each health state is associated with a cost and a QoL weight measured as a utility between 0 and 1 (0 ¼ Data sources dead and 1 ¼ perfect health), which enable us to estimate the total expected costs and Quality Adjusted Life Years (QALYs) The model is based on three data sources: (i) a randomized double-blind clinical trial (RCT)11 including patients with Table 1 Classification of health states in the health-economic model moderate to severe AD treated with either tacrolimus 0Æ1% in relation to global evaluation of improvement made by physicians in (n ¼ 487) or corticosteroids (n ¼ 485), (ii) a patient survey a randomized clinical trial containing questions about AD symptoms, QoL and AD-related healthcare resource utilization, and (iii) unit prices of health- Health states in Definition of improvement in the care resources in Sweden. Data from the trial were used to the model clinical trial define health states and to estimate transition probabilities Virtually cleared 90–100% improvement from between health states. By summing up all transitions between baseline health states during a year the time spent in the different health Moderate 30–89% improvement from states could be estimated. Information from the patient survey baseline was used to attach resource utilization (costs) in clinical prac- Severe, first-line < 30% improvement from tice and QoL weights (utilities) to each health state for patients therapy baseline or worsening of symptoms treated with tacrolimus ointment or with standard care. Severe, second-line Patients who do not respond therapy to first-line treatment and The randomized controlled clinical trial therefore switch to second-line therapy (a mixture of corticosteroids) The RCT11 was a double-blind 6-month phase III study including adult patients (> 18 years) diagnosed with moderate to

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 Cost-effectiveness of AD treatment, J. Hjelmgren et al. 915

Table 2 Transition probabilities during 3-week cycles for patients with moderate and severe atopic dermatitis (AD) treated with tacrolimus ointment or standard care

Patients with severe AD Patients with moderate AD

Tacrolimus Standard Tacrolimus Standard Transition treatment treatment treatment treatment 1 ‘Severe, first-line’ to ‘Severe, first-line’ 0Æ3004 0Æ3002 0Æ4989 0Æ3000 2 ‘Severe, first-line’ to ‘Severe, second-line’ 0Æ0875 0Æ1401 0Æ1438 0Æ1706 3 ‘Severe, first-line’ to ‘Moderate’ 0Æ5196 0Æ5218 0Æ3573 0Æ5281 4 ‘Severe, first-line’ to ‘Virtually cleared’ 0Æ0924 0Æ0378 0 0 5 ‘Severe, second-line’ to ‘Severe, second-line’ 0Æ8352 0Æ8142 0Æ7142 0Æ7277 6 ‘Severe, second-line’ to ‘Moderate’ 0Æ1262 0Æ1858 0Æ1109 0Æ1656 7 ‘Severe, second-line’ to ‘Virtually cleared’ 0Æ0386 0 0Æ1749 0Æ1067 8 ‘Moderate’ to ‘Severe, first-line’ 0Æ0069 0Æ1083 0Æ0424 0Æ1267 9 ‘Moderate’ to ‘Severe, second-line’ 0 0 0 0 10 ‘Moderate’ to ‘Moderate’ 0Æ9229 0Æ8692 0Æ7935 0Æ7709 11 ‘Moderate’ to ‘Virtually cleared’ 0Æ0702 0Æ0226 0Æ1641 0Æ1025 12 ‘Virtually cleared’ to ‘Severe, first-line’ 0Æ0577 0 0 0 13 ‘Virtually cleared’ to ‘Severe, second-line’ 0 0 0 0 14 ‘Virtually cleared’ to ‘Moderate’ 0Æ0217 0Æ0494 0Æ9093 0Æ9068 15 ‘Virtually cleared’ to ‘Virtually cleared’ 0Æ9206 0Æ9506 0Æ0907 0Æ0968

severe AD based on the criteria of Hanifin and Rajka.12 From how they rated their present QoL and their QoL in periods the RCT we used the global evaluation of clinical response to when they experienced their most severe symptoms. Finally, classify patients into different health states. The health state the survey covered questions about occupation and absence ‘severe, second-line therapy’ (Table 1) was included because from work because of AD. patients who do not respond to first-line therapy may have a lower QoL and could use healthcare resources more frequently. Classification of disease severity Second-line therapy was defined as emollients and topical steroids. From the clinical trial we estimated time-independent To correlate costs and QoL with the level of symptoms we transition probabilities based on the percentage of patients in constructed a disease index based on the two symptom scales, each health state at different time points (Table 2). erythema and papulation. By adding the scores from each scale a disease index of maximum 20 was obtained. The severity ranges shown in Table 3 were used to classify patients into The patient survey different disease stages. The midpoint value of each range was Three dermatology centres from different parts of Southern used to estimate a QoL weight for different degrees of disease Sweden included patients in the present study. All centres severity. included patients treated at the clinic from the period when the study started and consecutively backwards in time until Resource use and cost calculation they had identified at least 80 patients. Patients were identified from the ordinary patient files at each centre. Information about use of the following resources was collec- Participating clinics mailed the patient survey to 248 ted in the survey: tacrolimus ointment, corticosteroids, emol- patients at the beginning of 2005. The study was observa- lients, light treatment, and outpatient visits. There was no tional to reflect present clinical practice in treatment of statistically significant difference in the use of topical steroids patients with moderate to severe AD. No intervention was thus for patients with or without tacrolimus treatment (P ¼ 0Æ54). used and permission from ethical committees was therefore Standard treatment is defined as the mix of topical steroid not requested. treatment based on the usage in both treatment groups. Costs The survey covered information about current symptoms were calculated in Swedish krona (SEK) at 2004 prices and and health state and resource use during the week the survey transformed to pounds sterling (£). was answered as well as information about symptoms and resource use when patients experienced their most severe Medication symptoms. For both occasions patients indicated the severity of the symptoms including pruritus, erythema and papulation In predefined questions in the survey patients were asked to on a scale of 0 (no symptoms) to 10 (worst possible symp- specify: (i) the yearly number of tubes of tacrolimus (0Æ1% toms). They also estimated on a visual analogue scale (VAS) and 0Æ03%) and corticosteroids (mild, medium and strong)

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 916 Cost-effectiveness of AD treatment, J. Hjelmgren et al.

Table 3 Health states in the health-economic model and disease and 140 g of high-potency steroids; and (ii) a cost calculation severity ranges based on the disease severity index derived from the based on medication in the clinical trial:11 either tacrolimus patient survey ointment 0Æ1% equivalent to a usage of 264 g per 6 months11 or hydrocortisone butyrate 0Æ1% equivalent to a usage of Disease QALY 264 g per 6 months11 (both extrapolated to a yearly usage of severity Midpoint weight 528 g). Health state range score (VAS scale) The relationship between disease severity and medication in Virtually cleared 0–6 3 0Æ7960 the patient survey was used to allocate the cost of medication Moderate 7–13 10Æ30Æ5843 to the different health states. The midpoint score of disease Severe, ﬁrst-line therapy 14–18 16 0Æ4205 Severe, second-line therapy 19–20 19Æ50Æ3194 severity (Table 3) was used to estimate the 3-week cycle cost for each severity group (Table 4). QALY, Quality Adjusted Life Year; VAS, visual analogue scale.

Physician visits they use; (ii) the size of the tubes; (iii) the portion (25– Costs for physician visits were estimated based on the patient 100%) of the total yearly medication utilized during periods survey. when they experience their most severe symptoms (their most severe symptoms could vary between mild to severe according Estimation of Quality Adjusted Life Years to the disease severity index); and (iv) the number of months per year they experience their most severe symptoms. QALYs were estimated from the individual VAS scores in the Two separate analyses were performed to reﬂect differences patient survey. A VAS score of 100 indicates ‘full health’ in resource use of medication and mix of medications in clin- whereas a score of 0 indicates ‘worst possible health’ (or ical practice according to the patient survey and in the clinical ‘dead’). One QALY is obtained by dividing the VAS scores by trial:11 (i) a cost calculation based on yearly medication 100. Consequently a VAS score of 100 is equal to 1 QALY or according to the patient survey: either tacrolimus 0Æ1% or 1 year of full health and a score of 80 is equal to 0Æ80 QALYs. tacrolimus 0Æ03% equivalent to an average usage of 102 g and We used an ordinary least square regression model to esti- 16 g, respectively, and/or corticosteroids equivalent to an mate a relationship between the disease severity index and the average usage of 75 g of low-potency, 57 g of mid-potency VAS score. The midpoint values of the disease severity ranges

Table 4 Healthcare costs per 3-week cycle Trial-based resource use of Survey-based resource use in different health states. Costs in pounds medication of medication sterling (£), 2004 prices

Tacrolimus Standard Tacrolimus Standard Health state treatment treatment treatment treatment Virtually cleared AD Tacrolimus ointment 12 0 4 0 Standard treatment 0 1 1 1 Physician visits 3 3 3 3 Total cost 15 4 8 4 Moderate AD Tacrolimus ointment 39 0 11 0 Standard treatment 0 4 3 3 Physician visits 7 7 7 7 Total cost 46 11 21 10 Severe AD, ﬁrst-line therapy Tacrolimus ointment 62 0 18 0 Standard treatment 0 7 4 4 Physician visits 13 13 13 13 Total cost 75 20 35 17 Severe AD, second-line therapy Tacrolimus ointment 0 0 0 0 Standard treatment 9 9 5 5 Physician visits 18 18 18 18 Total cost 26 26 23 23

AD, atopic dermatitis.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 Cost-effectiveness of AD treatment, J. Hjelmgren et al. 917 presented in Table 3 were used to estimate a QALY score for with moderate AD the corresponding figure was £8300 each degree of AD severity. (Table 5). In the analysis where the resource use was based on information from the patient survey, i.e. present clinical practice in Sensitivity analysis Sweden, the cost-effectiveness ratio for severe AD was about The relationship between the effectiveness of tacrolimus oint- £3900, while the cost-effectiveness ratio for moderate AD was ment and the amount of medication used was tested in a sen- £2300 (Table 5). In all analyses the results could be consid- sitivity analysis. We checked the results after assuming that the ered to be cost-effective and well-below presently discussed number of weeks per year spent in the state ‘virtually cleared levels for cost-effectiveness although no formal limits have yet AD’ will be reduced when the quantity of tacrolimus ointment been agreed upon.13 Figure 3 (a,b) illustrates the impact on actually used in clinical practice is lower than the quantity that the cost-effectiveness results if the lower amount of medica- was used in the RCT. tion used in the patient survey should result in a lower effectiveness than the efficacy shown in the RCT. For the group Results with severe AD length of time in the state ‘virtually cleared’ can be reduced by > 6 weeks [4Æ58)()1Æ42)] for patients The total treatment costs are highly related to the time spent treated with tacrolimus ointment compared with standard in different health states during a year. For patients classified treatment before this alternative will reach the cost per QALY as having severe AD about 17 weeks per year are spent in the threshold where a treatment cannot be considered cost-effect- state ‘virtually cleared’ when treated with tacrolimus ointment ive (Fig. 3a). Similarly, in patients with moderate AD the and approximately 13 weeks when treated with standard treat- length of time in the state ‘virtually cleared’ can be reduced ment according to the model simulation (Fig. 2a). The corres- by > 9 weeks [6Æ47)()2Æ53)] before this alternative will ponding figures for patients with moderate AD are 25 weeks reach the cost per QALY threshold (Fig. 3b). per year in the state ‘virtually cleared’ for tacrolimus-treated Characteristics for responding and nonresponding patients patients and 19 weeks for patients with standard treatment in the survey are shown in Table 6. There are statistically sig- (Fig. 2b). nificant differences between responders and nonresponders In the analysis based on medication used in the clinical regarding gender (P ¼ 0Æ04) and any tacrolimus treatment trial, the cost-effectiveness ratio for treatment with tacrolimus (P ¼ 0Æ004), indicating that a higher proportion of the ointment compared with standard treatment was approxi- responding patients were women and had been treated with mately £12 300 for patients with severe AD. For patients tacrolimus ointment.

Discussion (a) 50 The results from our model simulation support the hypothesis 12·76 17·34 that treatment with tacrolimus ointment is a cost-effective 40 treatment alternative in comparison with presently used stand-

30 ard treatment in Sweden for patients with moderate or severe 26·38 AD. Although the main conclusion remained stable in the sen- Weeks 23·95 20 sitivity analysis our analysis indicates that the results to some extent are sensitive to the amount of tacrolimus ointment that 10 7·64 7·29 is used. 3·42 5·22 0 Ideally, a health-economic evaluation should reflect the Tacrolimus ointment Standard care Severe, second line Severe, first line Moderate Virtually cleared resource use by patients in clinical practice including a sufficiently long time horizon. However, as these conditions sel- (b) 50 dom are fulfilled knowledge about cost-effectiveness has to be evaluated by other means. A common and accepted method to 18·89 40 25·36 perform health-economic analyses is to use economic models

30 that combine short-term data from an RCT with data from other sources.14 Our model combines efﬁcacy data from an Weeks 20 26·36 RCT with data on healthcare resource utilization and QoL 23·8 10 obtained from a patient survey. 4·24 According to the model simulation the gains in QoL for 1·92 0 0·9 2·5 Tacrolimus ointment Standard care patients treated with tacrolimus were considerable both for Severe, second line Severe, first line Moderate Virtually cleared patients with severe AD (0Æ033 QALYs gained, corresponding to approximately 1Æ7 weeks with full health per year) and Fig 2. Number of weeks spent per year in different health states for moderate AD (0Æ042 QALYs gained, approximately 2Æ2 weeks patients diagnosed with (a) severe and (b) moderate atopic dermatitis. with full health per year). The explanation for this is twofold.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 918 Cost-effectiveness of AD treatment, J. Hjelmgren et al.

Table 5 Results from cost-effectiveness Severe AD Moderate AD analysis of tacrolimus ointment compared with standard treatment based on the amount Tacrolimus Standard Tacrolimus Standard of medication used in the randomized clinical treatment treatment treatment treatment trial (RCT) vs. the patient survey. Costs in pounds sterling (£), 2004 prices Medication used in the RCT Tacrolimus ointment 489 431 Steroids 63 57 Second-line treatment 9 15 3 8 Physician visits 123 137 93 112 Total cost 621 215 527 177 QALY 0Æ6025 0Æ5695 0Æ6632 0Æ6209 Cost per QALY gaineda 12 304 8269 Medication used in the survey Tacrolimus ointment 147 124 Steroids 37 38 30 34 Second-line treatment 5 8 2 4 Physician visits 123 137 93 112 Total cost 311 183 249 151 QALY 0Æ6025 0Æ5695 0Æ6632 0Æ6209 Cost per QALY gaineda 3875 2334

QALY, Quality Adjusted Life Year. aDCosts/DQALYs.

Table 6 Patient characteristics of responding and nonresponding (a) 60 000 Cost per QALY gained – severe AD Cost per QALY threshold = 48 700 patients in the survey 50 000

40 000 Responders Nonresponders (n ¼ 161) (n ¼ 87) P-value 30 000 Age, mean ± SD 31 ± 16Æ529±14Æ30Æ28

20 000 Gender (%) 0Æ04 Male 46 (28Æ6) 36 (41Æ4) Cost per QALY gained (£) 10 000 Female 115 (71Æ4) 51 (58Æ6) Disease severity (%) 0Æ28 0 4·58 3·58 2·58 1·58 0·58 –0·42 –1·42 Mild 29 (18Æ0) 15 (17Æ2) Gains in AD-free weeks (virtually cleared) weeks (base case = 4·58) Moderate 76 (47Æ2) 51 (58Æ6) Severe 56 (34Æ8) 21 (24Æ1) (b) 60 000 Cost per QALY gained – moderate AD Æ Cost per QALY threshold = 48 700 Any tacrolimus treatment (%) 0 004 50 000 Yes 130 (80Æ7) 56 (64Æ4) No 31 (19Æ3) 31 (35Æ6) 40 000

30 000

20 000 patients with severe and moderate AD included in the model

Cost per QALY gained (£) 10 000 simulation was considerable. The patient survey showed that

0 patients with ‘the worst possible AD symptoms’ rated their 6·47 5·47 4·47 3·47 2·47 1·47 0·47 –0·53 –1·53 –2·53 QoL rather low and that for each unit increase in disease Gains in AD-free (virtually cleared) weeks (base case = 6·47) severity the VAS score decreased. This result is in accordance 1 Fig 3. Patients with (a) severe and (b) moderate atopic dermatitis with previous results. This emphasizes the importance of (AD) treated with tacrolimus ointment. The impact on cost- considering QoL and disease severity when AD treatment is effectiveness with an assumption of lower effectiveness of treatment chosen. than in the randomized clinical trial. Quantity of medication used is Associated with the use of medication is the efficacy of based on the patient survey. QALY, Quality Adjusted Life Year. treatment achieved in the trial and effectiveness of treatment in clinical practice. For this reason two analyses were per- Firstly, the better efficacy of tacrolimus compared with stand- formed, one reflecting the use of medication in a clinical trial ard care resulted in more virtually cleared weeks and fewer and one resource use according to a patient survey. For weeks with severe AD. Secondly, the potential gain in QoL in patients treated in clinical practice, in this case patients who

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 Cost-effectiveness of AD treatment, J. Hjelmgren et al. 919 completed the survey, no information about effectiveness of the second when they estimated their symptoms and health tacrolimus treatment was available. state when they experienced their most severe symptoms. An The two different analyses show that the use of medication analysis combining cross-sectional data with longitudinal was lower in clinical practice than in the trial. This is probably patient data would have been more appropriate. A study a common relationship because medication in a trial is usually avoiding both these weaknesses would, however, have available free of charge both for the patients and for the required many more resources. healthcare system, while in clinical daily usage the patient Due to the limitations of our data sources we made a sensi- often has to pay at least part of the cost. This could probably tivity analysis of the relationship between the effectiveness of partly explain differences in resource use in the two analyses. tacrolimus ointment and the quantity of medication used. In In a recent publication the authors focus on reduced adher- all scenarios the cost per QALY gained by tacrolimus treatment ence to long-term therapy in patients with chronic dermato- is well below the discussed threshold of SEK 655 000 in logical diseases.15 Poor compliance could therefore be another Sweden (approximately £48 700).13 The results in health- reason for a lower use of medication in the survey group economic analysis are usually context specific but if the treat- compared with the trial patients. Another consideration is that ment of AD for example in the U.K. does not differ greatly the mix of patients with moderate and severe AD differed from that in Sweden the results would also fall below the between the two sources. In the present case this reason seems threshold of £25 000–£35 000 set by the National Institute to be less important as in the trial fewer patients were classi- for Clinical Excellence.17 fied as having severe AD than in the survey. There were thus In conclusion, despite higher medication costs in patients more survey patients with more severe AD, yet they used less treated with tacrolimus ointment compared with presently medication. used standard treatment in Sweden the cost-effectiveness ratios One important question when evaluating the results is whe- are low. This is related to the higher QoL scores for patients ther the efficacy rates of tacrolimus treatment shown in the in the former group. The results compare favourably with RCT11 could be achieved in clinical practice. This issue is cost-effectiveness ratios for accepted treatments in other dis- especially important because patients in the survey used a eases. Treatment with tacrolimus ointment in patients with lower amount of medication than patients in the trial. We severe or moderate AD is a cost-effective alternative in com- have not found any dose-response studies for tacrolimus oint- parison with presently used standard treatment in Sweden. ment and it is therefore not possible to evaluate whether patients in the survey who used lower doses of tacrolimus References ointment really had a treatment effect comparable with that of patients in the RCT. However, the sensitivity analysis shows 1 Kiebert G, Sorensen SV, Revicki D et al. Atopic dermatitis is associ- that the number of weeks spent in the health state ‘virtually ated with decrement in health-related quality of life. Int J Dermatol cleared’ can be reduced by several weeks before the results 2002; 41:151–8. 2 Lamb SR, Rademaker M. Pharmacoeconomics of drug therapy for reach the cost per QALY threshold where the cost-effectiveness atopic dermatitis. Exper Opin Pharmacother 2002; 3:249–55. of tacrolimus ointment can be questioned. 3 Ellis CN, Drake LA, Prendergast MM et al. Cost-effectiveness analysis The present analysis with data collected from clinical prac- of tacrolimus ointment versus high-potency topical corticosteroids tice provides an advantage in comparison with some previous in adults with moderate to severe atopic dermatitis. J Am Acad health-economic studies of treatment and management of AD Dermatol 2003; 48:553–63. where information about resource use was mainly collected 4 Abramovits W, Boguniewicz M, Paller AS et al. The economics of from physician panels.3,16 Another advantage of the present topical immunomodulators for the treatment of atopic dermatitis. Pharmacoeconomics 2005; 23:543–66. study is that disease severity and classification of health states 5 Reitamo S, Harper J, Bos JD et al. 0.03% tacrolimus ointment and estimation of QALYs were based on how patients in the applied once or twice daily is more efficacious than 1% hydro- survey evaluated their own symptoms and the severity of the cortisone acetate in children with moderate to severe atopic disease. dermatitis: results of a randomized double-blind controlled trial. Another advantage of the present study is that the analysis Br J Dermatol 2004; 150:554–62. has been made with a conservative approach in order not to 6 Koo JYM, Fleischer Jr AB, Abramovits W et al. Tacrolimus ointment overestimate a potential cost-effectiveness of tacrolimus treat- is safe and effective in the treatment of atopic dermatitis: results in 8000 patients. J Am Acad Dermatol 2005; 53:S195–205. ment. One example is the extrapolation of the medication 7 Hanifin JM, Ling MR, Langley R et al. Tacrolimus ointment for the used in the trial to a yearly consumption of tacrolimus oint- treatment of atopic dermatitis in adult patients: part I, efficacy. ment and corticosteroids. This means that the cost difference J Am Acad Dermatol 2001; 44:S28–38. between the two treatment alternatives in the analysis based 8 Briggs A, Sculpher M. An introduction to Markov modelling for on the RCT is probably underestimated. economic evaluation. Pharmacoeconomics 1998; 13:397–409. One weakness of the analysis is the relatively low number 9 Sonnenberg FA, Beck JR. Markov models in medical decision mak- of patients included in the survey study. Another possible ing: a practical guide. Med Decis Making 1993; 13:322–38. 10 La¨kemedelsfo¨rma˚nsna¨mnden. General Guidelines for Economic Evaluations limitation of the survey is that patients only evaluated their from the Pharmaceutical Benefits Board, Vol. LFNAR 2003:2. Stockholm: symptoms and health state for two occasions, the first reflect- The Pharmaceutical Benefits Board, 2003. ing their health state when they filled in the questionnaire and

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 920 Cost-effectiveness of AD treatment, J. Hjelmgren et al.

11 Reitamo S, Ortonne JP, Sand C et al. A multicentre, randomized, Classification of disease severity double-blind, controlled study of long-term treatment with 0.1% tacrolimus ointment in adults with moderate to severe atopic The disease index including the two variables erythema and dermatitis. Br J Dermatol 2005; 152:1282–9. papulation correlated well (Pearson correlation, P ¼ 0Æ022) 12 Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. Acta with the classification of disease severity made by physicians Derm Venereol (Stockh) 1980; 92(Suppl.):44–7. including patients in the survey study. The two variables were 13 Persson U, Hjelmgren J. Ha¨lso- och sjukva˚rden beho¨ver kunskap also chosen to facilitate comparison with the efficacy measure om hur befolkningen va¨rderar ha¨lsan. La¨kartidningen 2003; 100: in the RCT (Physician Global Evaluation).11 3436–7. 14 Annemans L, Geneste´ B, Jolain B. Early modelling for assessing health and economic outcomes of drug therapy. Value Health 2000; Resource use and cost calculation 3:427–34. 15 Kjellgren KI, Ring L, Lindblad A˚K et al. To follow dermatology Pharmaceutical prices were collected from FASS (Pharmaceuti- treatment regimens – patients’ and providers’ views. Acta Derm cal Specialties in Sweden, 2004) and for other resources infor- Venereol (Stockh) 2004; 84:445–50. mation was collected from regional pricelists. 16 Abramovits W, Boguniewicz M, Prendergast MM et al. Comparisons The average exchange rate 2004 was: £1 ¼ SEK 13Æ46, of efficacy and cost-effectiveness of topical immunomodulators in the management of atopic dermatitis. J Med Econ 2003; 6:1–14. €1 ¼ SEK 9Æ13 (Swedish Central Bank, Riksbanken); €1 ¼ 17 Rawlins MD, Culyer AJ. National Institute for Clinical Excellence £0Æ6787 (European Central Bank). With the short time frame and its value judgements. BMJ 2004; 329:224–27. of the analysis (1 year) no discounting of costs and health effects was performed. Appendix 1 Medication Health-economic model Total yearly medication cost per patient was obtained by mul- Disease severity in the model is a composite measure of two tiplying the indicated total yearly number of tubes of tacro- significant symptoms of atopic dermatitis (AD): erythema and limus and corticosteroids by the price per tube of each type of papulation. With the short time frame of the analysis (1 year) medication, strength of the drug, and size of the tubes. The and because mortality is not a risk factor in AD, the risk of monthly medication cost per patient during the most severe mortality is not included in the analysis. states was then calculated by multiplying the total yearly medication cost by the portion of medication utilized during the most severe periods and then dividing it by the number Data sources of months per year with the most severe symptoms. To achieve a 3-week cycle cost this figure was then divided by The randomized controlled clinical trial 3/4. The relationship between the weekly cost of each type of In the randomized controlled clinical trial (RCT),11 patients medication and disease severity was obtained by using a sim- included were to apply twice daily either 0Æ1% tacrolimus oint- ple linear ordinary least square regression model (3-week ment (n ¼ 487) or 0Æ1% hydrocortisone butyrate (n ¼ 485) to cycle medication cost ¼ b · disease index). affected body areas during the study. The following classification of patient symptoms was made in the RCT: ‘cleared’ Physician visits (100% improvement), ‘excellent improvement’ (90–99% improvement), ‘marked’ (75–89% improvement), ‘moderate’ In the questionnaire patients were asked if they had visited (50–74% improvement), ‘slight’ (30–49% improvement), ‘no the physician during the last month. By using a binary logistic appreciable improvement’ (0–29% improvement), and ‘worse’ regression model we could estimate the relationship between for worsening of the condition. In the RCT, patients were the probability of a physician visit and disease severity (prob- assessed on days 1 and 8, at weeks 2 and 4 and monthly there- ability for a physician visit ¼ 1/(1 + eb + b · disease severity). By after up to the 6th month. From these data we estimated the multiplying the unit cost for a physician visit with this prob- time-independent transition probabilities based on the percent- ability we obtained the expected cost for physician visits age of patients in each health state at different time points depending on disease severity (Table 4). (Table 2). Other resources The patient survey As there were few patients who indicated utilization of light Two of the three participating centres included only patients therapy (n ¼ 13) and days with absence from work due to with AD who had been prescribed tacrolimus ointment during AD (n ¼ 4) it was not possible to detect a relationship some periods. To collect information also about patients trea- between disease severity and these variables (P >0Æ10). These ted with other therapies, a third centre included patients with factors have therefore not been included in the calculation of a mixed treatment pattern. costs. There was no statistically significant difference in the

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 Cost-effectiveness of AD treatment, J. Hjelmgren et al. 921 use of emollients between patients treated with or without potential differences in disease severity and other characteris- tacrolimus ointment in the survey (P ¼ 0Æ72). The cost for tics between responding and nonresponding patients. emollients was therefore not included in the model simulation. Costs of side-effects were not included in the analysis Estimation of Quality Adjusted Life Years because of limitation of data. A higher frequency of adverse events related to tacrolimus treatment compared with cortico- From the regression model we found that for each unit steroid treatment was reported from the RCT.11 In both increase in disease severity, the patient-perceived quality groups the adverse events were mostly mild to moderate and of life [visual analogue scale (VAS) score] decreased by both prevalence and severity decreased after the ﬁrst week of 2Æ889 units (P <0Æ001) (VAS score ¼ 88Æ271 – 2Æ889 · treatment. disease severity). According to the estimated equation an individual without any symptoms of AD would have a score of 88Æ271, i.e. (88Æ271 – 2Æ889 · 0 ¼ 88Æ271), whereas an Additional data from patient records individual with the ‘worst possible AD symptoms’ would have Physicians from the participating centres collected additional a VAS score of 30Æ5, i.e. (88Æ271 – 2Æ889 · 20 ¼ 30Æ5). We data from patient records. These data were not included in the used the midpoint values of the disease severity ranges pre- model. The information was mainly used for description of sented in Table 3 to estimate a Quality Adjusted Life Years basic patient characteristics and for statistical analysis of score for each degree of AD severity.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp913–921 EPIDEMIOLOGY AND HEALTH SERVICES RESEARCH DOI 10.1111/j.1365-2133.2006.07740.x Reliability of self-reported willingness-to-pay and annual income in patients treated for toenail onychomycosis P.M.H. Cham,* S.C. Chen,§– J.P. Grill, Y.C. Jonk** and E.M. Warshaw* *Department of Dermatology, University of Minnesota, Minneapolis, MN, U.S.A. Center for Chronic Disease Outcomes Research, Minneapolis Veterans Affairs Medical Center, One Veterans Drive, Minneapolis, MN 55417, U.S.A. Department of Dermatology, Emory University, Atlanta, GA, U.S.A. §Department of Health Policy and Management, Rollins School of Public Health, Emory University, Atlanta, GA, U.S.A. –Department of Health Services Research and Development, Atlanta Veterans Affairs Medical Center, Atlanta, GA, U.S.A. **Division of Health Services Research and Policy, University of Minnesota, Minneapolis, MN, U.S.A.

Summary

Correspondence Background Willingness-to-pay (WTP) is a health economics measure that has Erin M. Warshaw. recently been used for skin diseases to evaluate patients’ quality of life. However, E-mail: [email protected] the reliability of this measure has not been investigated in the dermatology literature and is essential in validating its use in health services research. Accepted for publication 26 September 2006 Objectives This study evaluated the test-retest reliability of self-reported annual income and WTP, a health economics measure of disease impact, in patients with Key words toenail onychomycosis. health services needs and demands, health status Methods Forty-six patients enrolled in a randomized clinical trial comparing two indicators, onychomycosis, questionnaires, different dosing regimens of terbinafine completed a self-administered question- reliability naire at baseline and 1 month later. The questionnaire asked: (i) how much Conflicts of interest patients would be willing to pay for a theoretical treatment with a cure rate of None declared. 85% for their current onychomycosis (10 categories: $0–50, $51–100, to > $800); and (ii) annual income (10 categories: $0–10 000 to > $200 000). The views expressed in this article are those of the Results Forty-four patients reported WTP at both visits, and 55% reported the same authors and do not necessarily reflect the position WTP. The quadratic-weighted (Fleiss–Cohen) j statistic indicated moderate or policy of the Department of Veterans Affairs. agreement (j ¼ 0Æ50, 95% confidence interval, CI 0Æ24–0Æ75, P <0Æ01) as did

the Spearman rank-order correlation coefﬁcient (rs ¼ 0Æ57, P <0Æ01; median difference ¼ 0, P ¼ 0Æ50). Strong agreement was shown among the 42 patients who reported income at both visits; 71% reported the same annual income cate-

gory (j ¼ 0Æ72, 95% CI 0Æ47–0Æ96, P <0Æ01; rs ¼ 0Æ68, P <0Æ01; median difference ¼ 0, P ¼ 0Æ77). Age, disease severity and duration, previous therapy, self-reported annual income, and medication side-effects were not statistically associated with the reliability of WTP. Conclusions WTP and annual income demonstrated moderate and strong test-retest reliability, respectively. Self-reported WTP can serve as a reliable measure for future health economics research on onychomycosis.

Onychomycosis is a common nail condition that affects 15– value, compared with smaller values from the same time 20% of people aged 40–60 years.1 The adverse impact of point, corresponds with greater perceived burden of disease. onychomycosis on patients’ health-related quality of life When WTP is used in health services research, patients are (QOL) has been well described using a variety of generic and often asked how much they would be willing to pay for a skin disease-speciﬁc health status instruments.2–6 Another way theoretical cure or symptom relief. This broadly applied quan- to quantify the burden of onychomycosis is to use willing- titative approach of valuation incorporates external factors and ness-to-pay (WTP), a health economics method that facilitates an individual’s personal beliefs, values and economic capital cost-beneﬁt analysis.7 The WTP method asks consumers to that QOL instruments may fail to assess. Thus, WTP may serve choose a monetary value for a hypothetical service or a com- as a concise measure of disease burden scaled in standardized modity such as a drug. Other things being equal, a high WTP dollar units.

2007 The Authors 922 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp922–928 Reliability of self-reported WTP and annual income, P.M.H. Cham et al. 923

While a few studies have evaluated WTP in patients with $40 001–60 000, $60 001–80 000, $80 001–100 000, psoriasis vulgaris,8 atopic dermatitis,9 port wine stains,10 basal $101 000–125 000, $125 001–150 000, $150 001–200 000 cell carcinoma11 and melanocytic naevi,12 to our best know- and > $200 000). ledge, the use of WTP in patients with onychomycosis has not The payment categories of WTP ($0–50 to > $800) were been reported. Also, the test-retest reliability of self-reported chosen based on potential VAMC costs. At the Minneapolis WTP and annual income has not been studied for any derma- VAMC, the medication cost for a standard continuous-dosed tological condition. Demonstration of the reliability of WTP terbinafine regimen (250 mg daily for 3 months) is $403Æ20, responses is important13 because WTP is a potential measure and for a pulse-dosed regimen (500 mg daily for 1 week per of QOL in dermatology. While the reliability of WTP has been month for 3 months) is $201Æ60.16 Total costs, including explored with other chronic diseases such as arthritis and laboratory, visit and medication costs, were estimated at chronic lung disease, the reliability of this measure cannot be $820Æ47 and $618Æ87 for continuous and pulse regimens, generalized across all medical and skin conditions because the respectively, using the Toenail Onychomycosis Economic degree and the components of disease burden such as emo- Model.17 tions, symptoms and function are likely to be different. The purpose of this study was to assess the reliability of self-repor- Reliability of willingness-to-pay ted WTP and annual income, using test-retest methods, in patients undergoing treatment for toenail onychomycosis. Reliability of WTP was measured by assessing the level of agreement between values reported twice,18,19 separated by a Materials and methods relatively short time interval, 1 month (test-retest reliability). Given that toenail onychomycosis is unlikely to change within The study was approved by the Human Studies Subcommittee 1 month of starting treatment and that the randomized trial of the Minneapolis Veterans Affairs Medical Center (VAMC), protocol included a 1-month visit, 1 month was chosen for and written informed consent was obtained from each study the retest. patient as a necessary condition for participation. The 46 patients who participated in this substudy were participants in Data management and statistical analysis a large randomized, controlled trial to compare two different dosing regimens of terbinafine for the treatment of onycho- Returned questionnaires were computer-scanned and the results mycosis. The results of this randomized trial have been repor- were verified using Teleform (Cardiff Software, San Marcos, ted elsewhere.14 During the later phase of recruitment for the CA, U.S.A.). Patients who responded to WTP and annual randomized trial, the decision was made to conduct this sub- income questions at the baseline and 1-month visits were used study in order to assess the reliability of a QOL questionnaire in this analysis. v2 and logistic regression analyses were per- (including WTP and annual income) completed by trial formed to compare baseline characteristics between the selected patients at baseline. Of the last 63 patients enrolled in the test-retest patients (n ¼ 46) and the remaining patients who randomized trial (from a total of 306 patients), 46 were participated in the randomized trial (n ¼ 260). Responses to asked and agreed to complete the QOL questionnaire again at the WTP and annual income questions were analysed using ori- the 1-month visit. ginal and collapsed categories. To assess for systematic changes in the patients’ perception of their nail condition, the mean difference for the self-reported number of affected toes and 16 Questionnaire details nail-related QOL items for each patient was calculated by sub- At baseline, patients completed a self-administered question- tracting the baseline value from the 1-month value (i.e. differ- naire, which consisted of demographic and QOL questions,15 ence ¼ 1-month response – baseline response). as well as WTP and annual income items. To measure WTP, The (Fleiss–Cohen) quadratic-weighted j statistic was calcu- the following question was utilized: ‘You are offered a one- lated to measure the agreement of self-reported nail counts and time treatment for your nail fungus. The treatment has an the test-retest reliability of self-reported WTP and annual 85% cure rate, almost no side-effects, and consists of taking income. A weighted j statistic was chosen because both WTP a pill for 3 months. Think about all the things for which and annual income are ordinal variables (each has 10 ordered you spend money – food, rent/mortgage, bills, etc. How categories), and a weighted j statistic indicates the level of much would you be willing to pay out-of-pocket for this?’ agreement between test vs. retest ordinal responses based not Patients then chose among a predefined payment scale of 10 only on the frequency of exactly matching responses, but also unequally spaced categories ($0–50, $51–100, $101–150, on the frequencies of different categories of partially matching $151–200, $201–300, $301–400, $401–500, $501–600, responses (i.e. test and retest responses differing by one or more $601–800 and > $800). For annual income, the following levels). A weight of 1 is assigned to exactly matching test-retest question was utilized: ‘What is your approximate annual responses, and weights decreasingly less than 1 are assigned to income (including income from investments)?’ Patients indi- test-retest responses differing by increasingly more levels. A cated their annual income from a predefined choice of 10 weight of 0 is assigned only to test-retest responses differing by categories ($0–10 000, $10 000–20 000, $20 001–40 000, the maximum number of levels. The quadratic-weighted j

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp922–928 924 Reliability of self-reported WTP and annual income, P.M.H. Cham et al. statistic was chosen in particular because it is mathematically Table 1 Baseline characteristics of substudy participantsa equivalent to the intraclass correlation coefficient (ICC),20 which is another measure of test-retest reliability. Retrospective Substudy population (n ¼ 46) power calculations indicated that our analysis had more than Demographics and other characteristics Mean ± SEM Frequency (%) 90% power to detect at least a moderate level of reliability of WTP (j ‡ 0Æ40) based on the 44 of the 46 patients who repor- Male gender 43 (93) Æ Æ ted WTP at baseline and 1 month. Age (years) 66 3±170 Age To evaluate if medication side-effects influenced the reliabil- £ 60 years 12 (26) ity of WTP and annual income, patients who reported in a > 60 years 34 (74) 4-month follow-up telephone call that they had to discontinue Target toenail involvement (%) their study medication were excluded in secondary analysis 25–49 2 (4) (n ¼ 5). We also examined the side-effect profile as categorical 50–74 2 (4) data by evaluating the relationship between the presence or 75–99 10 (22) absence of side-effects as well as the directional changes in 100 32 (70) Number of affected toes 9Æ2±0Æ30 side-effects after 1 month of treatment on WTP measures. The Number of affected fingers 0Æ4±0Æ17 dependent variable indicated whether patients’ WTP was Disease duration (years) lower, the same, or higher after 1 month ()1, 0, 1). All data 0–5 8 (17) were analysed using the statistical package SAS (version 9.1; 6–15 16 (35) SAS Institute, Cary, NC, U.S.A.). 16–30 11 (24) > 30 11 (24) Previous therapy 12 (26) Results Diabetes 11 (24)

a Demographics No statistically significant differences were found between these participants (n ¼ 46) and the other patients in the clinical study Forty-six patients enrolled in a larger randomized, clinical trial (n ¼ 260) (data not shown). comparing two different dosing regimens of terbinafine14 completed a self-administered questionnaire. Ninety-six per cent of patients (44 of 46) responded to the self-administered WTP Table 2 Baseline distribution of willingness-to-pay (WTP) for the substudy and other study participantsa question, and 91% (42 of 46) chose an annual income category at both the baseline and 1-month visits. Demographics of the larger clinical trial population (n ¼ 306) have been reported Frequency (%) 14 elsewhere. The subgroup population (n ¼ 46) was slightly Substudy population Remaining study older, had more involvement of the target toenail, and had more WTP ($) (n ¼ 44)b population (n ¼ 256)b nails infected than the rest of the clinical study population 0–50 21 (47Æ7) 104 (40Æ6) (Table 1). However, logistic regression analyses indicated no 51–100 12 (27Æ3) 51 (19Æ9) statistically significant differences in the demographic character- 101–150 2 (4Æ5) 25 (9Æ8) istics, severity measures or annual household income among 151–200 3 (6Æ8) 20 (7Æ8) those repeating responses to the WTP questions (n ¼ 46) and 201–300 5 (11Æ4) 21 (8Æ2) Æ the rest of the clinical study population (n ¼ 260). In addition, 301–400 0 9 (3 5) 401–500 0 11 (4Æ3) a v2 test showed no statistically significant difference in WTP 501–600 0 1 (0Æ4) between the two groups. The baseline distributions of WTP and 601–800 0 1 (0Æ4) annual income categories for the subgroup population and the > 800 1 (2Æ3) 13 (5Æ1) rest of the original study population are shown in Tables 2 and a 3, respectively. WTP in the substudy population was not statistically different No systematic changes in the patients’ perception of their from that in the rest of the patients in the clinical study (P ¼ 0Æ36). bTwo patients in the substudy and four patients in the nail condition were found. Among the 46 patients, there was rest of the study did not provide WTP data. very good agreement between the number of affected toes reported at baseline and the number reported at the 1-month visit (weighted j ¼ 0Æ83, P <0Æ01). In general, the agree- ture that these patients’ impressions about their nail condition ment between baseline and 1-month responses to 16 nail- did not systematically change over the 1-month interval. related QOL questionnaire items ranged from good to very good (weighted j 0Æ50–0Æ80, all P-values < 0Æ01). The mean Reliability of willingness-to-pay difference for self-reported counts for each patient and for each of the questionnaire items was not statistically significant, Fifty-five per cent of the patients (24 of 44) who reported and there was no preponderance of either positive or negative WTP at baseline and 1 month chose the same WTP cate- differences. These results would be consistent with the conjec- gory ($0–50 to > $800) at both visits. The (Fleiss–Cohen)

Table 3 Baseline distribution of annual income categories for the a Baseline vs. one-month WTP (n = 44) substudy and other study participants 10

Substudy Remaining study population (n ¼ 42)b population (n ¼ 254)b 8 Annual income category ($) Frequency (%) Frequency (%) 0–10 000 9 (21Æ4) 70 (27Æ6) 6 10 001–20 000 19 (45Æ2) 83 (32Æ7) 20 001–40 000 9 (21Æ4) 71 (28Æ0)

40 001–60 000 4 (9Æ5) 21 (8Æ3) WTP at one month 4 60 001–80 000 0 3 (1Æ2) r = 0·57 80 001–100 000 0 2 (0Æ8) 100 001–125 000 0 3 (1Æ2) 2 125 001–150 000 0 1 (0Æ4) 150 001–200 000 0 0 > 200 000 1 (2Æ3) 0 2 4 6 8 10 WTP at baseline aThe annual income in the substudy population was not statistically different from that of the rest of the patients in the clinical study (P ¼ 0Æ19). bFour patients in the substudy and six patients Fig 1. Plot of willingness-to-pay (WTP) categories at baseline vs. in the other clinical trial population did not provide this infor- 1 month. On the axes, ‘1’ refers to the smallest WTP category mation. ($0–50) and ‘10’ indicates the largest category (> $800). Spearman rank-order correlation coefficient ¼ r. quadratic-weighted j statistic, mathematically equivalent to Baseline vs. one-month annual income (n = 42) the ICC, indicated moderate agreement (test-retest reliability): 10 j ¼ 0Æ41, 95% confidence interval, CI 0Æ16–0Æ67, P ¼ 0Æ01. At the baseline visit, only one patient reported the WTP cate- 8 gory ‘> $800’ and none reported categories between $301 and $800, so the five highest categories were collapsed into one category. Thus, the original 10 categories were reduced 6 to six categories ($0–50, $51–100, $101–150, $151–200, $201–300 and > $300). When the highest five categories were collapsed, the results were similar: j ¼ 0Æ50, 95% CI 4 0Æ24–0Æ75, P <0Æ01. The Spearman rank-order correlation r = 0·68 coefficient was calculated using the original 10 (ordinal) cate-

Annual income at one month Annual 2 gories (Fig. 1). The results (rs ¼ 0Æ57, P <0Æ01; median difference ¼ 0, P ¼ 0Æ50) also indicated moderate test-retest reliability of self-reported WTP. 2 4 6 8 10 Annual income at baseline Reliability of annual income Fig 2. Plot of annual income categories at baseline vs. 1 month. On Seventy-one per cent of the patients (30 of 42) reported the the axes, ‘1’ refers to the smallest income category ($0–10 000) and same annual income category at the 1-month visit. With ‘10’ indicates the largest category (> $200 000). Spearman rank-order respect to the original 10 categories, responses to annual correlation coefficient ¼ r. income showed strong agreement with the original 10 categories (quadratic-weighted j ¼ 0Æ88, 95% CI 0Æ69–1Æ00, bility (rs ¼ 0Æ68, P <0Æ01; median difference ¼ 0, P ¼ 0Æ77) P <0Æ01). Because only one patient reported an annual with respect to the 10 original categories (Fig. 2). income over $200 000 at baseline, and no others reported an income between $60 000 and $200 000, the six highest Medication side-effects and reliability income categories were collapsed, reducing the original 10 of willingness-to-pay categories to five categories ($0–10 000, $10 001–20 000, $20 001–40 000, $40 001–60 000 and > $60 000). There During the scheduled 4-month follow-up telephone call, was still strong agreement using the collapsed categories 11% of the substudy patients (five of 46) reported that they (j ¼ 0Æ72, 95% CI 0Æ47–0Æ96, P <0Æ01). Similarly, the Spear- had had to discontinue their study medication due to severe man rank-order correlation coefficient indicated strong relia- side-effects (Table 4). Per protocol side-effect monitoring

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp922–928 926 Reliability of self-reported WTP and annual income, P.M.H. Cham et al.

Table 4 Side-effect proﬁle of patients in substudy who later Medication side-effects and reliability of annual income discontinued study medication The test-retest reliability of self-reported income remained nearly identical after excluding the four patients who possibly Status reported at 1 month experienced severe side-effects during the 1-month visit. Based Worsening of on the 38 remaining test-retest patients, the recalculated Patient New side-effects existing symptoms results for the quadratic-weighted j statistic were j ¼ 0Æ88, 1 Abdominal pain 95% CI 0Æ71–1Æ00, P <0Æ01; and the recalculated results for

2 Dyspepsia the Spearman rank-order correlation coefficient were rs ¼ 3 Headache 0Æ70, P <0Æ01; median difference ¼ 0, P ¼ 0Æ75. 4a Diarrhoea, dyspepsia, flatulence, nausea 5 Rash, abdominal pain, Reliability in patients who reported a high flatulence, nausea willingness-to-pay or a low annual income at baseline

aOne patient was excluded from reliability analyses because that Thirty-five per cent of the test-retest patients (16 of 46) individual did not report a willingness-to-pay value at the reported a WTP of > $200 (the highest WTP category with 1-month visit. two or more respondents) or an annual income of < $10 000 (the lowest income category) at baseline; none met both conditions. One of these 16 patients did not report WTP or showed that each of these patients had reported either new annual income at the 1-month visit. Reliability of WTP and or worsening of existing symptoms at the 1-month visit, annual income was recalculated based on the remaining 15 suggesting that the severe side-effects reported at 4 months patients. Compared with all the test-retest patients, the reliabil- were already present at the 1-month visit. One of these ity of WTP remained moderate for the subset of 15 test-retest five patients reported neither WTP nor annual income at patients. There was only a slight increase in both the recalcu- the 1-month visit and was therefore excluded from all of the lated j statistic (j ¼ 0Æ45, 95% CI 0Æ17–0Æ74, P ¼ 0Æ04) and reliability analyses. Excluding the other four patients did not Spearman rank-order correlation coefficient (rs ¼ 0Æ59, P ¼ result in an increase in the reliability of self-reported WTP. 0Æ02; median difference ¼ 0, P ¼ 0Æ73). The strong reliability Based on the 40 remaining test-retest patients, the recalcu- of annual income increased among the subset of 15 test-retest lated quadratic-weighted j statistic showed a slight decrease patients for both the j statistic (j ¼ 0Æ96, 95% CI 0Æ88–1Æ00, in agreement between baseline vs. 1-month WTP (j ¼ 0Æ36, P <0Æ01) and the Spearman rank-order correlation coefficient

95% CI 0Æ08–0Æ64, P ¼ 0Æ01) while the recalculated Spear- (rs ¼ 0Æ79, P <0Æ01; median difference ¼ 0, P ¼ 0Æ99). man rank-order correlation coefficient produced the same results (rs ¼ 0Æ57, P <0Æ01; median difference ¼ 0, P ¼ Discussion 0Æ24). Although we expected to find that a worsening in side-effects could lead to patients reporting a higher WTP In this substudy, we found that the test-retest reliability of a for the hypothetical treatment, these relationships were self-administered WTP question showed moderate agreement not significant when they were evaluated with different cat- while annual income showed strong agreement over a period egories: presence or absence of any side-effects at 1 month of 1 month. There are several possible explanations for these (P ¼ 0Æ69), worsening of baseline symptoms (P ¼ 0Æ99), findings. Firstly, it is intuitive that self-reported annual and improvement of baseline symptoms (P ¼ 0Æ31). incomes are less likely to fluctuate because expenses and incomes are unlikely to change within 1 month. Secondly, our patients probably had more experience with reporting Association of other factors with the reliability income than stating a WTP for a hypothetical cure; thus, they of willingness-to-pay were probably more confident and more consistent with their Within the same ordered probit analyses, we did, however, responses to income than to WTP. Thirdly, it is possible that find that men generally reported a smaller WTP category patients with 1 month of treatment might alter their WTP after 1 month of treatment than women (P ¼ 0Æ05), but based on medication side-effects or perceived efficacy, such as the interpretation of this finding is limited by the small improvement of concurrent tinea pedis. number of women in the subgroup (three of 46, 7%). While suggested minimal standards for reliability coeffi- There was also a statistical trend for those with diabetes to cients are 0Æ7–0Æ7519,21 for health state instruments and have lower WTP after 1 month of treatment than their 0Æ4–0Æ75 for ICCs,22 our results are similar to others in the lit- counterparts (P ¼ 0Æ08). Age, disease severity and duration, erature. The reliability of self-reported income has been repor- previous therapy, and baseline annual income were other ted in one study that demonstrated good agreement among categories that were found to have no statistically significant 218 responders after a 48-h retest interval (0Æ82, Spearman associations with the reliability of WTP over the 1-month rank-order correlation coefficient).23 In the health economics period. literature, the test-retest reliability of WTP values has been

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp922–928 Reliability of self-reported WTP and annual income, P.M.H. Cham et al. 927 highly variable, in contrast to the reliability of self-reported analytical methods to evaluate this hypothesis, however, we annual income, with correlation coefficients ranging from found no significant associations between side-effects and 0Æ25 to 0Æ95 for retest intervals of 1 year and 6 months, reliability of WTP. This finding could be due to small sam- respectively.24,25 A study with a longer retest interval than our ple size (n ¼ 46) and/or methodological challenge in equa- study reported that the test-retest reliability of WTP responses ting the magnitude of different side-effects such as headache for a cure of arthritis was low in patients with osteoarthritis and diarrhoea. The borderline statistically significant associ- or rheumatoid arthritis over the course of a year (correlation ation between lower WTP over 1 month with the male gen- coefficient ¼ 0Æ25, P ¼ 0Æ08).24 O’Brien and Viramontes also der and diabetic status is probably spurious owing to the reported on the reliability of WTP for a hypothetical treatment small sample size. of a chronic disease. Twenty patients were asked for their Thirdly, open-ended formats, bidding game or bargaining WTP for a hypothetical treatment of their lung disease, and a formats, and close-ended formats are other types of contingent moderate agreement was reported with a 4-week retest inter- valuation.30 The reliability of these elicitation methods in asses- val (ICC ¼ 0Æ66, P ¼ 0Æ05).26 A study comparable with ours sing certain medical treatments is unclear. We chose the pay- in the use of self-administered surveys and a 30-day retest ment scale method because it seemed more comprehensible interval reported a high test-retest reliability of WTP for a the- for patients and had been used in another investigation of skin oretical cure of hepatitis A symptoms (Spearman rank-order disease.10 Fourthly, the number and magnitude of the payment correlation coefficient ¼ 0Æ70, P <0Æ01).27 Using a 4-week and income categories used for WTP and annual income, retest interval, another study also reported good reliability of respectively, could affect the level of agreement. Nevertheless, WTP regarding a change from a hypothetical ‘poor health’ even when comparing results from the original and collapsed state to a ‘good health’ state (ICC ¼ 0Æ94, 95% CI 0Æ90– categories, the reliability of self-reported WTP and annual 0Æ99).18 The highest correlation was found in responders income changed very little. whose mean annual WTP represented 20–45% of their average Fifthly, our statistical methods could have influenced the income. In our study, no participants reported a WTP value results. In health policy literature, correlation coefficients are which represented a high percentage of their income (high used to assess the reliability of WTP responses.31 ICCs have WTP and low income). The reliability of self-reported annual been recommended for interval-level data and weighted j income over a 1-month period improved in a subgroup of values for ordinal scale values in assessing test-retest reli- patients who reported either high WTP or low annual income ability.19 We utilized quadratic-weighted j statistic values at baseline. This finding could be explained by the likelihood (Fleiss–Cohen) which are mathematically equivalent to ICCs. that these patients had a stable source of income. For example, Owing to the paucity of evidence on test-retest reliability of patients with low annual incomes may be more likely to have WTP measures for medical treatments, further research in a fixed source of income such as Social Security. These studies refining statistical methods and interpretations of WTP reli- and ours indicate that patients’ WTP may fluctuate, but that ability correlation coefficients is needed. Sixthly, we did not the agreement of responses tends to be higher with shorter collect information on employment status, education, health retest periods. insurance and other economic factors that may have influ- Our study on the test-retest reliability of WTP has several enced WTP responses. Despite this fact, our veteran popula- limitations, primarily related to study design. Firstly, agree- tion probably had similar medical coverage and represented ment of WTP responses would probably increase if the retest a high proportion of retired individuals (mean age interval were shortened from 1 month to a few days. How- 66 years). ever, retest periods that are too short can lead to recall bias.28 Finally, results from our study may not be generalizable. To overcome these issues, performing test-retest reliability Veterans typically have excellent medical coverage and there- tests with control groups (untreated patients) has been sugges- fore may be inexperienced with valuing medical services. This ted as a method to strengthen the validity of the test-retest might lead to an underestimation of reliability. Our veteran conclusion of reliability.29 In this study, we did not have a study population was also fairly homogeneous. WTP values control group, and our choice of a 1-month test-retest period obtained from a heterogeneous study population are likely to was based on the clinical trial protocol which included a be more representative of the general population.32 1-month visit. Reliable and temporally stable measures of self-reported Secondly, it is possible that other factors could influence WTP and annual income have important implications because test-retest reliability at 1 month. As the new growth of a WTP can be used both for assessing a patient’s health-related nail takes several months, the therapeutic effect of terbina- QOL and also for health economic evaluations. In this study fine after 1 month of treatment would not be likely to influ- of veterans who were treated for toenail onychomycosis, we ence a patient’s self-reported WTP. We hypothesized that found that measures of WTP showed moderate reliability WTP might decrease in patients with side-effects during whereas annual income responses showed strong reliability the first month of the clinical trial. Gastrointestinal side- over a test-retest period of 1 month. More research on the effects (flatulence, diarrhoea, heartburn, abdominal pain and construct of the WTP method involving a broader range of nausea) were the most common reasons for discontinuation patients with different skin diseases should be considered for in the clinical trial (14 of 306).14 Using several different future studies.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp922–928 928 Reliability of self-reported WTP and annual income, P.M.H. Cham et al.

Acknowledgments 14 Warshaw EM, Fett DD, Bloomfield HE et al. Pulse versus continuous terbinafine for onychomycosis: a randomized, double-blind, con- E.M.W. was supported by a VA Cooperative Studies Clinical trolled trial. J Am Acad Dermatol 2005; 53:578–84. Research Career Development Award (711B) during this 15 Warshaw EM, Chen SC. Quality of life in veterans with onychomycosis. study. S.C.C. was supported by a NIH K23 Career Develop- Presented at the 60th Annual Meeting of the American Academy of ment Award (K23 AR02185–01A1). This study was supported Dermatology, 2002 (Abstract). 16 Warshaw EM. Evaluating costs for onychomycosis treatments: by the Minneapolis VAMC and its Center for Chronic Diseases a practitioner’s perspective. J Am Podiatr Med Assoc 2006; 96:38– Research. 52. 17 Omar MA, Kahler KH. Cost-effectiveness analysis of therapies for the treatment References of toenail onychomycosis. Presented at the 61st Annual Meeting of the American Academy of Dermatology, 2003 (Abstract). 1 Baden HP. Diseases of the Hair and Nails. New York: Appleton and 18 Smith RD. The reliability of willingness to pay for changes in Lange, 1990. health status. Appl Health Econ Health Policy 2004; 3:35–8. 2 Lubeck DP, Gause D, Schein JR et al. A health-related quality of life 19 Lohr KN, Aaronson NK, Alonso J et al. Evaluating quality-of- measure for use in patients with onychomycosis: a validation life and health status instruments: development of scientific review study. Qual Life Res 1999; 8:121–9. criteria. Clin Ther 1996; 18:979–92. 3 Lubeck DP, Patrick DL, McNulty P et al. Quality of life of persons 20 Norman GR, Streiner DL. Biostatistics: the Bare Essentials. 2nd edn. with onychomycosis. Qual Life Res 1993; 2:341–8. London: B.C. Decker, 2000. 4 Drake LA, Patrick DL, Fleckman P et al. The impact of onychomyco- 21 Shrout PE, Fleiss JL. Intraclass correlations: uses in assessing rater sis on quality of life: development of an international onycho- reliability. Psychol Bull 1979; 86:420–8. mycosis-specific questionnaire to measure patient quality of life. 22 Rosner B. Fundamentals of Biostatistics. Belmont, CA: Duxbury Press, J Am Acad Dermatol 1999; 41:189–96. 1995. 5 Elewski BE. The effect of toenail onychomycosis on patient quality 23 Johnson ME, Fisher DG, Reynolds G. Reliability of drug users’ self- of life. Int J Dermatol 1997; 36:754–6. report of economic variables. Addict Res 1999; 7:227–38. 6 Whittam LR, Hay RJ. The impact of onychomycosis on quality of 24 Thompson MS, Read JL, Liang M. Feasibility of willingness-to-pay life. Clin Exp Dermatol 1997; 22:87–9. measurement in chronic arthritis. Med Decis Making 1984; 4:195– 7 Gafni A. Willingness-to-pay as a measure of benefits: relevant 215. questions ask in the context of public decision making about 25 Sorum PC. Measuring patient preferences by willingness to pay to health care programs. Med Care 1991; 29:1246–52. avoid: the case of acute otitis media. Med Decis Making 1999; 19:27– 8 Schiffner R, Schiffner-Rohe J, Gerstenhauer M et al. Willingness to 37. pay and time trade-off: sensitive to changes of quality of life in 26 O’Brien B, Viramontes JL. Willingness to pay: a valid and reliable psoriasis patients? Br J Dermatol 2003; 148:1153–60. measure of health state preference? Med Decis Making 1994; 14:289– 9 Lundberg L, Johannesson M, Silverdahl M et al. Quality of life, 97. health-state utilities and willingness to pay in patients with psoria- 27 Jacobs RJ, Moleski RJ, Meyerhoff AS. Valuation of symptomatic sis and atopic eczema. Br J Dermatol 1999; 141:1067–75. hepatitis A in adults: estimates based on time trade-off and willing- 10 Schiffner R, Brunnberg S, Hohenleutner U et al. Willingness to pay ness-to-pay measurement. Pharmacoeconomics 2002; 20:739–47. and time trade-off: useful utility indicators for the assessment of 28 Allen MJ, Yen WM. Introduction to Measurement Theory. Monterey, CA: quality of life and patient satisfaction in patients with port wine Brooks Cole, 1979. stains. Br J Dermatol 2002; 146:440–7. 29 Teisl MF, Boyle KJ, McCollum DW, Reiling SD. Test-retest reliabil- 11 Weston A, Fitzgerald P. Discrete choice experiment to derive will- ity of contingent valuation with independent sample pretest and ingness to pay for methyl aminolevulinate photodynamic therapy posttest control groups. Am J Agric Econ 1995; 77:613–19. versus simple excision surgery in basal cell carcinoma. Pharmaco- 30 Frew EJ, Whynes DK, Wolstenholme JL. Eliciting willingness to economics 2004; 22:1195–208. pay: comparing closed-ended with open-ended and payment scale 12 Schiffner R, Wilde O, Schiffner-Rohe J, Stolz W. Difference formats. Med Decis Making 2003; 23:150–9. between real and perceived power of dermoscopical methods for 31 Dong H, Kouyate B, Cairns J, Sauerborn R. A comparison of the detection of malignant melanoma. Eur J Dermatol 2003; 13:288–93. reliability of the take-it-or-leave-it and the bidding game approa- 13 Bravo G, Potvin L. Estimating the reliability of continuous meas- ches to estimating willingness-to-pay in a rural population in West ures with Cronbach’s alpha or the intraclass correlation coefficient: Africa. Soc Sci Med 2003; 56:2181–9. toward the integration of two traditions. J Clin Epidemiol 1991; 32 Streiner DL, Norman GR. Health Measurement Scales: a Practical Guide to 44:381–90. their Development. Oxford: Oxford Unversity Press, 1995.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp922–928 EPIDEMIOLOGY AND HEALTH SERVICES RESEARCH DOI 10.1111/j.1365-2133.2007.07794.x The family impact of skin diseases: the Greater Patient concept M.K.A. Basra and A.Y. Finlay Department of Dermatology, Cardiff University School of Medicine, Heath Park, Cardiff CF14 4XN, U.K.

Summary

Correspondence Background Although the impact of skin disease on patients’ health-related quality E-mail: [email protected]; of life (HRQoL) is well known, little work has been carried out to determine the [email protected] secondary impact of a patient’s skin disease on the patient’s family or partner. Objectives The aim of this study was to identify the different aspects of a family Accepted for publication 23 October 2006 member’s QoL that may be affected by having a family member with skin disease. Key words Methods Qualitative interviews were conducted with 50 family members/partners family, Greater Patient dermatology, partner, of patients attending the outpatient clinic of a university hospital, with a wide quality of life, secondary impact range of dermatological conditions (n ¼ 21). Subjects were invited to discuss in Conflicts of interest detail all the ways that their lives were affected by living with a patient with skin None declared. disease. Results The mean age of subjects (M ¼ 19; F ¼ 31) was 48Æ1 years (SD ¼ 15Æ7) This study was conducted at the University most were either parents (44%) or spouses/partners (44%) of the patients. Hospital of Wales, Cardiff, U.K. Patients’ ages (M ¼ 16; F ¼ 34) ranged from 5 months to 84 years. Fifty-nine aspects of QoL of family members were identified that were adversely affected by the patients’ skin disease. These were categorized into 18 main topic areas: Emotional distress (98%), Burden of care (54%), Effect on housework (42%), Social life (48%), Holidays (46%), Financial aspect (30%), Physical well-being (22%), Job/study (40%), Leisure activities (26%), Sleep (20%), Food/drink (12%), Restriction of liked activities (14%), Need for support (12%), People’s attitude (10%), Dissatisfaction with medical care (14%), Effect on sex life (8%), Role of religious faith (8%) and Miscellaneous (16%). There was no significant difference between male and female subjects regarding main QoL areas affected. The median number of main topic areas reported per family member was five (mean ¼ 5Æ2, range ¼ 1–10, SD ¼ 2Æ64). Conclusions This study has demonstrated that skin diseases can significantly impair the HRQoL of the patient’s family in very diverse ways. Asking family members about this impact is greatly appreciated by them. We propose the ‘Greater Patient’ concept to describe the immediate close social group affected by a person having skin disease.

Although the effect of skin disease on the quality of life by a patient’s skin condition. The awareness of the concept of (QoL) of patients has been documented extensively,1–3 very this ‘secondary impact of skin diseases’ on patients’ family little is known about the effect on the QoL of family mem- members is relatively recent and mostly limited to the families bers. Skin diseases have a major impact on patients’ psy- of children with atopic eczema.6–10 The parents of children chological well-being, social functioning and everyday with atopic eczema experience a wide range of detrimental activities.4,5 Because of the nature of many skin diseases and effects on their lives, e.g. psychological, social, lifestyle modi- the way treatment is applied, immediate family members are ﬁcations, interpersonal relationships, ﬁnancial, family activ- often involved in care-giving and are affected in many ways ities, sleep, and issues related to the practical care of the

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp929–937 929 930 Family impact of skin diseases: the Greater Patient concept, M.K.A. Basra and A.Y. Finlay patient. Other studies have focused on the psychological bers were also asked to specify their relationship to the patient effects of facial port-wine stains,11 Sturge–Weber Syndrome12 (mother, father, husband, wife, partner, offspring, sibling). and psoriasis13 on the parents or partners of the patients. Following the initial recording of demographic information, Given the existence of a wide range of skin disorders and detailed semi-structured interviews were conducted with the the extensive diverse effects that these can have on patients’ participants. During the interview, the opening question was: lives, it seems likely that patient’s families will also be affected ‘Tell me about the impact of your relative’s/partner’s skin dis- in diverse ways by different skin disorders. However, it is still ease on your life.’ unknown how skin diseases other than atopic eczema affect During the interviews, participants were at ﬁrst encouraged family quality of life. to speak at length and in detail about all the possible ways The aim of this study was to explore in detail the different they thought that their lives had been affected by the patients’ ways in which skin diseases in general affect patients’ immedi- skin disease. Later on enquiries were made into those aspects ate family members’ and/or partners’ quality of life. of the family QoL that were not mentioned by the participant but were deemed important and relevant by the interviewer, Methods based on the QoL domains of the family suggested by Poston et al.14 Individual interviews were transcribed verbatim. Transcripts produced from these interviews were analysed Ethical considerations meticulously to identify all the aspects of family members’ The study was approved by the South East Wales Local quality of life QoL affected by the patients’ skin diseases. Research Ethics Committee. Participants were provided with These individual QoL aspects were condensed and sorted detailed information about the study and were assured that into main QoL categories or topic areas according to the conﬁdentiality would be maintained. Written informed con- main themes that they presented, by a consensus of the sent was obtained prior to data collection. investigators. Based on the information revealed by this study, a questionnaire (the Family Dermatology Life Quality Index, FDLQI) has Study participants been created (and validated) to measure the impact of skin The study participants were the family members or partners of disease on the QoL of the family member or partner.15 the patients attending the dermatology outpatient clinic of the University Hospital of Wales in Cardiff. Inclusion criteria were Data analysis age above 18 years, ability to understand and read the English language, having an immediate family or partner relationship Statistical analysis was performed using the Statistical Package with the patient and living in the same household. Subjects for the Social Sciences (SPSS, 12Æ0, Chicago, IL, U.S.A.). A were excluded if they or the patients had any severe non- descriptive analysis was made of all variables. The qualitative dermatological illness or disability. variables were described by frequency and percentage of each of its categories, the quantitative variables, by means and standard deviation, median, minimum and maximum. Procedure

The study was conducted during the first half of 2005. A con- Results venience sample of family members accompanying patients with different skin diseases attending the dermatology out- Of the total 51 family members recruited for the interviews, patient clinic were approached by the investigator (M.K.A.B.) one was later excluded as he was found to have significant in the waiting area. After a brief introduction about the nature heart disease. The demographic details of the final 50 partici- of the study, subjects were invited to participate. If family pants are given in Table 1 and the dermatological characteris- members and the patients decided to participate and fulfilled tics are shown in Table 2. Most of the family members were the inclusion criteria, each of them were given information Caucasians (88%) and married (66%), and the majority were sheets to read describing the aims and protocols of the study either one of the parents (44%) or spouses/partners (44%) of and consent forms to sign. These were designed separately for the patients. The mean age of the family members was the family members and the patients. Patients’ clinical records 48Æ1 years (range 24–82) while the mean age of patients was were checked for the dermatological diagnoses and clinical 35Æ7 years (range 5 months to 84 years). Patients suffered history. Those subjects who, after reading the detailed infor- from one of 21 skin diseases (Table 2) and the mean dura- mation sheet, agreed to participate, gave written informed tion of patients’ disease was 7Æ2 years (range 3 months to consent and were taken to a quiet room for the interview. 32 years). The patient was not present at the interview, except when the Qualitative analysis is usually based on the principle of sat- patient was a young child. Demographic information about uration of data, meaning that reliable or common themes the family members and patients were recorded. Questions emerge when a number of participants say the same thing. By included marital status, level of education, employment status, the time about 30 interviews had been conducted, it became patient’s diagnosis and duration of the illness. Family mem- obvious that family members were reporting quite similar

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp929–937 Family impact of skin diseases: the Greater Patient concept, M.K.A. Basra and A.Y. Finlay 931

Table 1 Sociodemographic characteristics of family members Table 2 Dermatological characteristics of patients (n ¼ 50) Mean Mean disease Subject characteristics % patient age duration Sex Diagnosis n (years) (years) Male 38 Eczemaa 14 17Æ98Æ7 Female 62 Psoriasis 7 14Æ115Æ3 Marital status Discoid lupus erythematosus 4 64Æ87Æ5 Married 68 Acne 3 15 3 Single 22 Ichthyosis 2 15 15 Divorced 8 Granuloma annulare 2 15 2Æ5 Widowed 2 Squamous cell carcinoma 2 73Æ50Æ9 Relationship with the patient Basal cell carcinoma 2 61 1Æ8 Parent 44 Malignant melanoma 2 48 0Æ6 Spouse/partner 44 Keratoacanthoma 1 82 0Æ7 Daughter 4 Solar keratosis 1 84 10 Grandparent 4 Alopecia areata 1 10 2 Grandchildren 2 Angio-oedema 1 44 2 Sibling 2 Pemphigus 1 67 1 Educational level Vitiligo 1 29 3 Primary 10 Congenital haemangioma 1 1 1 Secondary 56 Lichen sclerosis 1 61 3 A level 8 Urticaria 1 13 1Æ5 University 26 Incontinentia pigmenti 1 4Æ50Æ4 Occupation Mycosis fungoides 1 82 23 Full-time employed 32 Dental sinus 1 39 3 Part-time employed 14 a Housewife 24 Includes atopic eczema ¼ 12; contact dermatitis ¼ 2. Retired 16 Unemployed 12 Student 2 The data from these 50 interviews are presented under the Ethnic origin 18 main topic areas in the text below and are illustrated with Caucasian 88 quotations from the interview texts. Asian 8 Afro-Caribbean 4 Psychological issues

Psychological aspects of life was the most extensive category, issues and that little new information was emerging that had with almost all (98%) family members of patients with nearly not been mentioned by previous participants. However, in all types of skin conditions being psychologically affected order to broaden the cross-section of the sample and to ensure in one way or another. The common psychological aspects that issues related to separate skin diseases were identified, described in this extremely variable domain were worry, frus- recruitment was continued. Consequently, at the point of the tration, having emotional stress, concern about the illness fiftieth interview a high level of confidence had been achieved and/or its treatment, feeling upset, depression, embarrassment that the issues of importance and relevance to most families and anxiety. Less frequently mentioned issues were feeling affected by patients’ skin conditions had been revealed. guilt, annoyance, sorry, helpless, agitated, fed-up, irritated, While the analysis of the data from family members was bothered, in agony, frightened, apprehensive, and always primarily qualitative in nature, the number of responses across thinking about the problem. As an example, a mother of a main categories was quantified to determine the frequency child with congenital haemangioma stated that ‘I feel upset, with which various QoL concerns were raised. From the con- helpless and frustrated about my daughter’s skin condition’, tent analysis of the 50 interviews, 59 different aspects of fam- while another mother whose teenage daughter had life-long ily members’ QoL affected by patients’ skin diseases were severe psoriasis said that ‘I feel embarrassed going out with identified. These were condensed into 18 main topic areas her especially when she starts picking her scales’. according to their themes (discussed below). Although the number of female participants was much larger than males, Burden of care there was no statistically significant difference among them in the way they were affected in terms of the main QoL topic This was the second most frequently expressed aspect of areas (Fig. 1). For each family member, the number of these families’ lives with 54% of family members, mostly of patients main topic areas ranged from one to 10 with a mean of 5Æ2 with psoriasis, eczema or ichthyosis, saying they felt that look- (median ¼ 5, SD ¼ 2Æ64, Fig. 2). ing after the patient took a great deal of their time and time

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp929–937 932 Family impact of skin diseases: the Greater Patient concept, M.K.A. Basra and A.Y. Finlay

Psychological aspect Burden of care Increased workload Social life Holidays Financial burden Physical well-being Female Effect on job Male Leisure activities Sleep Restrictions on liked activities Need for support

Main family QoL areas Main family People's reaction Dissatisfaction with medical care Sex life Effect on food/drink Help from religious faith Miscellaneous

0 10 20 30 40 50 60 70 80 90 100 Fig 1. Family quality of life (QoL) areas Family members (%) affected according to sex.

Distribution of the number of QoL areas affected among 50 families get the house tidy; wherever he walks, he sheds skin; I have 18 to vacuum again and again.’ 16

14 Social life 12 10 Social life was disrupted for many families, notably of patients 8 with psoriasis, acne, eczema, discoid lupus erythematosus 6 (DLE) or haemangioma, as well as different skin cancers, e.g. Number of families 4 squamous cell carcinoma (SCC) or basal cell carcinoma (BCC), 2 especially when they were located on visible sites. Forty-eight 0 1–2 3–4 5–6 7–8 9–10 per cent of participants stated that their social life had been Number of QoL areas affected affected badly. The most common themes were restriction of going out for meals or for a day out, visiting or inviting fam- Fig 2. Distribution of number of quality of life (QoL) areas affected ily and friends and strain on relationships with others, e.g. among family members. other family members, relatives and workmates. There was a need to reduce the frequency of meeting others, and inability to sustain as many outside relationships, as well as limitations management was a huge problem for them. Many stressed the on routine daily activities. One husband of a woman who had responsibility of putting on different creams during different an ulcerated BCC on her nose said that they avoid going out times of the day, others said that they had to remind the during the day and wait for night so that people may not see patient to apply treatment and take medicines on time and for the ugly lesion on her face. others it was the perceived need to keep a constant eye on the skin lesions. A husband of a woman who had psoriasis said that Holidays he even had to bathe his wife as she could not bend down. Forty-six per cent of families said that their holidays have been affected; some said that they have stopped going away Housework load on holidays altogether because the patients’ condition would A signiﬁcant increase in routine housework was a major issue not allow it. Others mentioned that there were special consid- for family members (42%), especially of patients with psoria- erations while planning holidays, for instance they were sis and eczema, which included frequent cleaning and vac- restricted in their choice of where to go depending on what uuming, changing bed linen and more washing. This put an was good or harmful for the patient’s skin or they had to take extra strain on the working partner if the patient was limited special precautions while on holiday. Most affected in this cat- in his/her mobility due to illness. Family members of patients egory were families of patients who had skin cancers, psoria- with some other dermatoses, e.g. pemphigus, ichthyosis, consis, eczema, vitiligo, acne or DLE. In the words of the wife of genital haemangioma or mycosis fungoides, also complained a patient with vitiligo: ‘I want to go to sunny places but he of an extra housework load. For example, the mother of an does not want to go there as he gets tanned there which ichthyosis patient described how frustrated she felt: ‘I can’t makes his skin lesions more obvious.’

crying. There was also a mother whose daughter had a bleed- Financial burden ing and infected congenital haemangioma that kept her in a An increase in family expenditure was a problem for the fam- miserable condition throughout the night with a frequent ilies (30%) of patients with psoriasis, acne, eczema or ichthy- need for attention. osis. This extra financial burden was associated with expenses on hospital visits, private consultations, transport, buying add- Restrictions on liked activities itional clothes and bedding and special products for the patients, e.g. creams, cosmetics or special soaps and bath addi- Fourteen per cent of the participants stated that their family tives. This left some families with the option of trying to get members having certain skin conditions had stopped them financial help from state benefits, the parents or partners from doing things that they had always loved, e.g. going out increasing their work hours or the family having to compro- in the sun, going to the beach, sunbathing, enjoying hot wea- mise on the needs of other family members or turn to cheaper ther or visiting sun-bed parlours. In view of the potential living choices. reduction in photodamage, this secondary impact could be viewed as being of long-term benefit to the family member! Physical well-being Need for support Family members of patients suffering from widespread dermatoses, e.g. psoriasis, eczema or ichthyosis, were most affected Twelve per cent of participants thought that the burden of car- in terms of physical well-being. A total of 22% of participants ing was simply more than their capacity and they were not reported that caring for the patient had affected their physical able to cope with the situation on their own. They were des- health ‘badly’ while others described this experience as tiring, perately looking for help from support groups or any other exhausting and hectic: so much so that a husband, whose wife state agency to share their burden. had resistant eczema, thought that his wife’s eczema had contributed to him suffering from diabetes and hypertension. Problems from people’s attitudes

This was the concern of ﬁve family members (10%) of Job patients with acne, alopecia areata, eczema, psoriasis or incon- Direct or indirect effect on employment was another import- tinentia pigmenti. Some parents were upset because their chil- ant aspect of life reported by 40% of family members, mostly dren were bullied at school due to their appearance, while of patients with inﬂammatory skin conditions. For some it others did not like the way that people looked at the patients’ was simply not possible to take up any employment because skin. At times people asked ‘silly’ questions and they had to of the constant attention/care required by the patient, while explain to people about the patient’s skin disease. A few other for others it was the frequent need to take time off their work participants said that some people sympathized with them. A either to attend the patients’ needs or for hospital appoint- mother of an alopecia areata patient stated ‘it was devastating ments. One participant stated that she could not concentrate for me to know that children at school call her names’. on her work because her mind was always occupied by the patient’s suffering. Dissatisfaction with medical help

Dissatisfaction with the health services offered to patients was Leisure activities an issue for 14% of the families. Some were simply not happy Twenty-six per cent of family members revealed that their rec- with the treatment that patients were getting and felt that reational activities were affected; either they were no longer something more needed to be done, while others thought that able to carry on with their personal hobbies or they had to they needed more information about the patients’ condition cut short the time they used to spend on their pastimes. Some that was not provided by the medical staff. For example, the reported that they do not get time for themselves either to do daughter of a woman who had keratoacanthoma expressed their personal chores or to relax. Most of those affected were that she was not happy with the information provided to her the relatives of patients with eczema, psoriasis, acne, DLE or about her mother’s skin lesion and was worried about its ichthyosis. The wife of a patient with psoriasis said that she cause. could no longer go swimming as she did not want to leave her husband alone. Sex life

Few subjects (8%) mentioned that their sex lives had been Sleep affected; two families had patients who were suffering from The affected family members (20%) were mostly the parents psoriasis, one had DLE and one had lichen sclerosis. A of children with eczema who reported disturbance of sleep husband said that his wife was always busy with their child during the night due to the child’s frequent scratching and who had psoriasis and neglected his needs which resulted in

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp929–937 934 Family impact of skin diseases: the Greater Patient concept, M.K.A. Basra and A.Y. Finlay friction between them and affected their sexual relationship. A details or discuss issues. This method has the advantage of woman whose husband had severe psoriasis, admitted that she being less intrusive to those being interviewed as it encour- felt an aversion to his skin appearance and was looking for ages two-way communication. When individuals are inter- other relationships. viewed they may more easily discuss sensitive issues. Furthermore, the information obtained from semi-structured interviews may provide not just answers, but the reasons for Food the answers. In our experience this type of interviewing not Living with patients suffering from eczema and urticaria affec- only provided rich information, it also produced comfort and ted some (12%) families’ food choices; they avoided buying support to the family members; many of them said they felt some types of foodstuff that they thought were responsible grateful to us for allowing them to express their feelings about for the patients’ disease even though the food was liked by the impact of the patient’s disease on their own lives. Many other family members. The mother of a patient with acne said stated that this was something that they had always wanted that she avoided bringing chocolates home which she thought from the health services providers, but had not previously made her daughter’s acne worse. On the other hand, the experienced. mother of a patient with psoriasis put on weight as she some- The present study has provided some data about the nature times used to eat more just to get rid of the frustration she and extent of the family impact resulting from a patient’s skin felt because of her daughter’s psoriasis. disease. These data demonstrate the pervasive effects that some skin conditions can have on the functioning of the family as a whole. Many of the family members reported not only a psy- Religious faith chosocial impact but also an impact on their physical well- This aspect of life was mentioned by a few participants (8%) being and financial difficulties. While these effects may seem who expressed that their faith had helped them a lot in cop- less severe than the secondary family effects of other chronic ing with the patient’s illness and was a source of strength conditions such as cancer or mental disabilities, they may still and satisfaction. The father of a patient with eczema said be a major source of disruption of family life and should be ‘my faith in God helps me, it gives me strength, hope and taken into account when measuring patient’s health and patience’. HRQoL, and should inform management strategies of affected patients. The psychological distress of having a family member with Miscellaneous skin disease was expressed extensively throughout the study in There were several QoL aspects reported (16% participants) almost every skin affliction. The spectrum of issues that family that did not fit into the above categories. Two mothers men- members relate supports the concept that they may experience tioned that caring for their children with severe skin diseases psychological distress as much as, and perhaps sometimes (ichthyosis/psoriasis) made them compromise on their care of more than, the patients. This distress seems to arise from their the rest of the family. Three subjects said that they could not lack of control and feelings of helplessness. Family’s emo- sleep in the same bed as their partners either for fear of hav- tions were also the predominant dimension in a number of ing contact or because it was too messy or smelly. On the investigations of parents with children affected by atopic other hand three subjects mentioned that their partners’ dis- eczema.6,7,16 ease had brought them even closer to each other. For some The burden of care-giving affects family members’ physical their family members’ skin condition made them more con- and psychological well-being negatively.17 In our study more scious about aspects of skin health such as awareness of moles than half of the participants, mainly those caring for patients and sun exposure. with inflammatory dermatoses, felt this burden of caring and in half of these subjects it had actually affected them physic- 8,18 Discussion ally. Other studies of atopic eczema have identified the detrimental impact of the burden of care on familial relation- This study represents an initial broad attempt to probe into ships. The impact of skin diseases on families’ social and leis- the hidden impact of skin diseases on the family members of ure lives magnifies the isolation that family caregivers may patients with skin disease. The qualitative method used for this experience and also highlights the need for social and emo- purpose was of semi-structured interviews with patients’ fam- tional support of these individuals.19,20 Social support has ily members. Semi-structured interviews are conducted with been identified as an important factor that contributes to an open framework that allows for focused, conversational, HRQoL of people living with a chronic illness.21 Lewis et al.22 two-way communication. This technique is helpful to obtain stress that social support for families with a member with specific quantitative and qualitative information from a sample chronic illness (such as many chronic skin diseases) is of great of the population on a range of insights on specific issues. importance in influencing how the family copes with the situ- Most of the questions are not phrased ahead of time but are ation. The provision of social support that is perceived by the created during the interview, allowing both the interviewer caregiver as adequate can serve as a buffer against stress for and the person being interviewed the flexibility to probe for the caregiver.23,24

Lack of information and knowledge about their relatives’ tative sample of a given population, but were the family skin condition on the part of healthcare staff was a source of members of patients attending the outpatient clinic of a sec- distress for some of the study participants, which forced them ondary referral centre only. Family members of patients with to seek information for themselves. Johansson25 also noted more severe disease treated as inpatients or of patients treated that relatives regarded the assistance from public care services at the primary care level were not included. This restricts the as not only insufficient but also poorly suited to their particu- generalizability of the quantitative findings. However, as lar needs. This is why it has been emphasized that the com- Holloway and Wheeler32 argue, in qualitative research, such munication skills and attitudes of healthcare personnel are key findings can be transferred to similar situations if they are factors for support to individuals with chronic ailments and recontextualized to the current context. their families.26 Secondly, the study participants were chosen by purposive Disruption of sleep was an issue, particularly for the parents sampling. According to Morse,33 the main criticism of this of children suffering from eczema. Sleep was also shown to method of sampling is that the sample is biased by the selec- be a huge problem for parents of children with atopic eczema tion process, i.e. the method encourages a certain type of in the study by Lawson et al.,6 while Carroll et al.8 have shown informant with a certain type of knowledge. However, in that sleep deprivation can affect all family members and that it qualitative research, this is the intent of using this sampling is a major stress-causing factor for the families. The implica- method and it is used in a positive way, as a tool to provide tions for parents can be huge; they may need to miss work or theoretical richness in seeking to describe the informants’ avoid outside work altogether, their social functioning can experiences in as much detail and as accurately as possible. be damaged, their relationships with their spouse and other The sample size of 50 subjects for this type of qualitative family members can be affected along with parenting study was considered adequate to maintain depth in the analy- behaviour.18 sis and achieve variation. While the majority of participants refrained from discussing Thirdly, the majority of study participants were white Brit- the effect on their sexual relationships, which in part may be ish/Caucasians (88%) and family members from different due to the fear of seeming unfaithful to their partners,27 ethnic backgrounds were only a small proportion. The under- spouses of some patients, notably those with lichen sclerosis representation of such a sample with different religious beliefs et atrophicus (LSA), DLE or psoriasis, did describe a change in and cultural values, who may have different experiences,34 their intimate and sexual relationships consistent with the further limits the validity of results. The generalizability and findings of Wojnarowska et al.28 Aspects of the affected part- sustainability of the findings of this study could be further ner’s disease, such as skin appearance, location of lesions on determined by prospectively studying a larger, more hetero- genitalia, or pain, set limitations on their sexual life, which geneous sample. led to strain between them. This is not surprising as chronic Fourthly, the study lacked a control group; a comparison or illnesses have been known to influence intimate relations control group would be helpful in distinguishing whether between husband and wife, and when one partner is sick, it these results are specific to family members having a relative automatically affects the other.29 This situation is more likely or partner with a skin disease or are characteristic of any fam- to occur when people find it difficult to adjust to their part- ily having a relative/partner with a nondermatological condi- ners’ disease and this in turn leads to frustration, anger and tion. Future research could compare families who have irritation often directed at those persons who most need patients with skin disease with those who do not. support and love.26 The current study has also revealed finan- Furthermore, this study was based on information from cial implications of certain skin diseases for the family. This is only one member of the family unit, usually a parent or in line with other chronic diseases including atopic eczema,6,8 spouse. Family QoL analyses may be more meaningful when which has been shown to have a negative effect on the fam- conducted with data from multiple family members living in ily’s financial resources and cause a financial burden,30 espe- the same household rather than just a single member, and cially in low-income families.27 The role of religious faith in when the entire family serves as the unit of analysis. coping with their family member’s illness was mentioned by Future research should also explore the impact of treating a few subjects who explained how their faith gave them skin diseases on the quality of life of the family members. strength to draw positive meaning and to assign purpose to The findings of this study suggest that healthcare profes- their care-giving experience. sionals who care for patients with skin disease have an The secondary impact of skin disease on the family is an important potential role to play in being aware of identifying issue not only in the developed world. For people with lep- and supporting affected families. In order to establish a good rosy, for example, one of the most significant problems relates rapport with affected family members and to be able to pro- to marital relationships and the family as a whole may be dis- mote patients’ compliance, dermatology professionals should advantaged and suffer financially.31 develop greater insight into the lives of families of patients This study was undertaken to explore and highlight an with dermatological disorders, especially if inflammatory or under-emphasized aspect of skin disease, that is, its secondary widespread. The list of descriptive categories identified in impact on the QoL of patients’ families. However, the study this study may serve as a reminder on how to react to these has some limitations. Firstly, participants were not a represen- families with respect, knowledge, involvement and availabil-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp929–937 936 Family impact of skin diseases: the Greater Patient concept, M.K.A. Basra and A.Y. Finlay ity. Patients’ family members, especially the primary caregiv- factors predict parental quality of life. Br J Dermatol 2004; 150: ers, need to be regarded as active participants in healthcare. 304–11. This consideration would potentially help to diminish their 8 Carroll CL, Balkrishnan R, Feldman SR et al. The Burden of Atopic Dermatitis: Impact on the Patient, Family, and Society. Pediatr Dermatol sense of lack of control and helplessness. Service providers 2005; 22:192–9. need to develop their awareness of these family carers and 9 Chamlin SL, Cella D, Frieden IJ et al. Development of the Childhood their experiences, so that they are fully involved in care Atopic Dermatitis Impact Scale: initial validation of a quality-of-life planning and decision-making. One practical way to achieve measure for young children with atopic dermatitis and their this is to develop a way to measure the secondary family families. J Invest Dermatol 2005; 125:1106–11. impact of skin diseases quantitatively,15 which should be 10 McKenna SP, Whalley D, Dewar AL et al. International development simple and user-friendly. This type of instrument could then of the Parents’ Index of Quality of Life in Atopic Dermatitis (PIQoL-AD). Qual Life Res 2005; 14:231–41. be used not only in busy clinics but also in evaluation 11 Miller AC, Cate IM, Watson HS, Geronemus RG. Stress and family research. satisfaction in parents of children with facial port-wine stains. In order to encourage and focus thinking about this subject Pediatr Dermatol 1999; 16:190–4. we propose a new term to describe the immediate close social 12 Rakkhit T, Chen S, Lawley L, Freedman S. The impact of Sturge– group affected by a person having a skin disease—the Greater Weber Syndrome (SWS) on patients and their families. J Am Acad Patient. This term is inspired by an analogy with a descriptor Dermatol 2006; 54:AB121 (P1414). applied to some of the world’s major cities, such as Greater 13 Richards HL, Chong SLP, Mason DL, Griffiths CEM. The impact of psoriasis on healthy partners of patients with psoriasis. Br J Dermatol London or Greater Tokyo. Just as the nucleus of a city is sus- 2002; 147 (Suppl. 62):54. tained, influenced by and interdependent with the wider sub- 14 Poston D, Turnbull A, Park J et al. Family quality of life: a qualita- urbs, so individual patients are not isolated but are the centre tive inquiry. Ment Retard 2003; 41:313–28. of a complex web of surrounding relationships. As doctors we 15 Basra MK, Sue-Ho R, Finlay AY. The Family Dermatology Life need to understand the concept and the needs of the Greater Quality Index: measuring the secondary impact of skin disease. Br J Patient in each consultation. The Greater Patient concept Dermatol 2007; 156:528–38. could also equally be used in fields of medicine other than 16 Chamlin SL, Frieden IJ, Williams ML, Chren MM. The effects of atopic dermatitis on young American children and their families. dermatology. Pediatrics 2004; 114:607–11. This study has revealed that it is not only patients with skin 17 Canam C, Acorn S. Quality of life for family caregivers of people diseases who experience an impact on their QoL but also the with chronic health problems. Rehabil Nurs 1999; 24:192–6. whole life of the family is influenced. The magnitude of this 18 Lapidus CS, Kerr PE. Social impact of atopic dermatitis. Med Health R I impact may be quite varied depending upon the diagnosis of 2001; 84:294–5. the skin disease, its duration, severity, the age of the patient 19 Garwick AW, Kohrman C, Wolman C, Blum RW. Families’ recom- and the family member and above all on the relationship mendations for improving services for children with chronic conditions. Arch Pediatr Adolesc Med 1998; 152:440–8. between them. This knowledge of family impact of skin dis- 20 Shu BC, Hsieh HC, Li SM. Toward an understanding of mothering: ease and the concept of the Greater Patient should be taken the care giving process of mothers with autistic children. J Nurs Res into consideration by healthcare service providers when for- 2001; 9:203–13. mulating treatment plans, making treatment decisions or con- 21 Taylor EJ, Jones P, Burns M. Quality of life. In: Chronic Illness Impact ducting research. and Interventions (Morlof Lubkin I, ed.). Boston: Jones and Barlett Publishers, 1998; 207–26. 22 Lewis FM, Woods NF, Hough EE, Bensley LS. The family’s func- References tioning with chronic illness in the mother: the spouse’s perspective. Soc Sci Med 1989; 29:1261–9. 1 Finlay AY, Khan GK. Dermatology Life Quality Index (DLQI)— 23 Siegel K, Revises VH, Houts P, Mor V. Caregiver burden and a simple practical measure for routine clinical use. Clin Exp Dermatol unmet patient needs. Cancer 1991; 68:1131–40. 1994; 19:210–16. 24 Blanchard CG, Albrecht TL, Ruckdeschel JC et al. The role of social 2 Chren MM, Lasek RJ, Quinn LM et al. Skindex, a Quality-of-Life support in adaptation to cancer and to survival. J Psychosoc Oncol Measure for Patients with Skin Disease: Reliability, Validity, and 1995; 13:75–95. Responsiveness. J Invest Dermatol 1996; 107:707–13. 25 Johansson L. Informal care of dependent elderly at home. Some 3 Morgan M, McCreedy R, Simpson J, Hay R. Dermatology quality Swedish experiences. Ageing and Society 1991; 11:41–58. of life scales—a measure of the impact of skin diseases. Br J Dermatol 26 Kuyper MB, Wester F. In the shadow: the impact of chronic illness 1997; 136:202–6. on the patient’s partner. Qual Health Res 1998; 8:237–53. 4 Finlay AY, Ryan TJ. Disability and handicap in dermatology. Int J 27 Rees J, O’Boyle C, MacDonagh R. Quality of life: impact of chronic Dermatol 1996; 35:305–11. illness on the partner. J R Soc Med 2001; 94:563–6. 5 Jowett S, Ryan TJ. Skin disease and handicap: an analysis of the 28 Wojnarowska F, Mayou R, Simkin S, Day A. Psychological charac- impact of skin conditions. Soc Sci Med 1985; 20:425–9. teristics and outcome of patients attending a clinic for vulval 6 Lawson V, Lewis-Jones MS, Finlay AY et al. The family impact of disease. J Eur Acad Dermatol Venereol 1997; 8:121–9. childhood atopic dermatitis: the Dermatitis Family Impact ques- 29 Larsen PD, Kahm AM, Flodberg SO. Sexuality. In: Chronic Illness tionnaire. Br J Dermatol 1998; 138:107–13. Impact and Interventions (Morlof Lubkin I, ed.). Boston: Jones and Barl- 7 Warschburger P, Buchholz HT, Petermann F. Psychological adjust- ett Publishers, 1998; 299–323. ment in parents of young children with atopic dermatitis: which

30 So¨derberg S, Strand M, Haapala M, Lundman B. Living with a 33 Morse JM. Qualitative Nursing Research: A Contemporary Dialogue. New- woman with ﬁbromyalgia from the perspective of the husband. bury Park, London, New Delhi: Sage Publications, 1991; J Adv Nurs 2003; 42:143–50. 127–45. 31 Gokhale SD. Social/economic rehabilitation. Int J Lepr Other Mycobact 34 Seltzer MM, Krauss MW, Walsh P et al. Cross-national comparisons Dis 2001; 69 (Suppl. 2):S42–51. of ageing mothers of adults with intellectual disabilities. J Intellect 32 Holloway I, Wheeler S. Qualitative Research in Nursing, 2nd edn. Disabil Res 1995; 39 (Pt 5):408–18. Oxford: Blackwell Publishing, 2002; 250–65.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp929–937 EPIDEMIOLOGY AND HEALTH SERVICES RESEARCH DOI 10.1111/j.1365-2133.2007.07805.x Factors associated with a high tumour thickness in patients with melanoma J. Baumert,* G. Plewig,* M. Volkenandt* and M.-H. Schmid-Wendtner* *Department of Dermatology and Allergology, Ludwig-Maximilian-University, Munich, Germany GSF-Institute of Epidemiology, National Research Center for Environment and Health, Neuherberg, Germany Department of Dermatology and Allergology, Rheinische Friedrich-Wilhelm-University, Sigmund-Freud-Str. 25, D-53105 Bonn, Germany

Summary

Correspondence Background Prognosis of patients with melanoma is strongly associated with Monika-Hildegard Schmid-Wendtner. tumour thickness at time of diagnosis. Therefore, knowledge of patient character- E-mail: monika-hildegard.schmid- istics and behaviour associated with a high tumour thickness is essential for the [email protected] development and improvement of melanoma prevention campaigns. Accepted for publication Objectives The present study aimed to identify sociodemographic, clinical and 26 November 2006 behavioural factors associated with high tumour thickness according to Breslow. Methods The study population consisted of 217 patients with histologically proven Key words primary invasive cutaneous melanomas seen at the Department of Dermatology epidemiology, melanoma, prevention, questionnaire, and Allergology at the Ludwig-Maximilian-University Munich, Germany, tumour thickness between January 1999 and January 2001. Personal interviews were conducted by Conflicts of interest two physicians to obtain information on sociodemographic characteristics and on None declared. patients’ knowledge of melanoma symptoms, sun behaviour, delay in diagnosis and related factors. Multivariate linear and logistic regression analysis with stepwise variable selection was used to identify risk groups with a high tumour thickness. To assess possible effect modifications, interaction terms were included in the regression analysis. Results The median tumour thickness was 0Æ8 mm (interquartile range 0Æ5–1Æ6). Fifty-seven patients (26%) had tumour thickness >1Æ5 mm. In a multivariate linear regression analysis, patients living alone and patients with a low educational level showed a significantly greater tumour thickness. The relation of melanoma knowledge to tumour thickness was modified by the melanoma subtype: whereas lack of melanoma knowledge led to an increased tumour thickness for the subtypes superficial spreading melanoma, lentigo maligna melanoma and unspecified malignant melanoma, no significant effect was estimated for the subtypes nodular melanoma (NM) and acrolentiginous melanoma (ALM). Sex, age, self-detection of melanoma, patient delay and professional delay were not significantly associated with the tumour thickness in multivariate linear regression. Similar results were found in multivariate logistic regression. Conclusions An increased tumour thickness was found in subjects living alone and having a low educational level. These subjects should be targeted in future prevention campaigns in a more focused way. Further efforts are necessary to improve knowledge and earlier detection of melanoma subtypes NM and ALM.

In general, the incidence of melanoma has increased strongly paigns introduced there very early, which contributed to pub- for the white-skinned population over the last decades.1,2 Epi- lic and medical attention. Especially in Australia, primary demiological studies have identiﬁed a variety of characteristics prevention campaigns have been carried out with the main predicting an elevated risk for the incidence of melanomas.3 aim of avoiding or reducing sun exposure. In recent investigations, a slowing or stabilizing of this trend The most important prognostic factor for melanoma still is had been reported only for New South Wales (Australia).4 the tumour thickness at time of diagnosis.5,6 In contrast to This trend might be caused by melanoma awareness cam- advanced melanomas, the prognosis for thin melanomas is

2007 The Authors 938 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp938–944 Factors associated with a high tumour thickness, J. Baumert et al. 939 quite favourable. As only few improvements in treatment the patients, sources of their knowledge about melanoma, the modalities for melanomas with a high tumour thickness have length of patient-related delay in seeking medical attention, been made in recent decades, the detection of a melanoma in reasons for this delay in seeking medical advice, the length of an early stage is regarded as the most effective way to improve professional delay in excision of a melanoma and the suspec- melanoma prognosis.7 Therefore, knowledge of characteristics ted diagnosis at first consultation. The investigations were con- associated with a high tumour thickness is essential to target ducted in an identical manner by two specially trained specific subjects within the scope of future (secondary) mela- dermatologists. Due to the personal interview character of the noma prevention campaigns. Only few studies have so far present investigation, the response rate was 100%. More investigated associations between sociodemographic factors details are described elsewhere.13 and melanoma tumour thickness.8–12 Self-detection was assumed when patients themselves first The study presented here is a sequel to an earlier investiga- noticed a change in a pre-existing pigmented lesion or became tion of the same study group mainly aimed at examining fac- aware of a new pigmented lesion. Patients were asked about tors associated with patient and professional delay of the time interval between initial observation and first profes- melanoma diagnosis.13 The aim of the present study was to sional consultation (patient delay) and between first profes- identify factors associated with a high and prognostically un- sional consultation and definite surgical treatment with favourable tumour thickness. histopathological diagnosis (professional delay). Melanoma knowledge was assessed by asking patients about possible Patients and methods melanoma information sources before the diagnosis. Patients stating any information source were defined as patients with melanoma knowledge. Patients

The study population was drawn from patients with histo- Statistical analysis logically proven primary cutaneous melanomas diagnosed and treated at the Department of Dermatology and Allergology at Tumour thickness was analysed uni- and multivariate as a the Ludwig-Maximilian-University Munich, Germany. Between categorical variable with two categories (£1Æ5 mm, >1Æ5 mm) January 1999 and January 2001, 233 patients were inter- and as a continuous variable. As tumour thickness had an viewed with the help of a standardized questionnaire. Nearly approximately lognormal distribution (i.e. the log-transformed all patients were interviewed within 3 months of diagnosis. tumour thickness was approximately normally distributed), All patients knew that they had a melanoma at the time of the the log-transformed tumour thickness was analysed for interview. Of these, 16 patients with noninvasive melanomas tumour thickness as a continuous variable. The geometric were excluded from the study. Therefore, the study popula- mean tumour thickness with 95% confidence interval (CI) was tion of the present analysis consisted of 217 patients. calculated by back transformation and can be regarded as an approximation of the median tumour thickness. For univariate analysis, associations between categorical var- Clinical data and questionnaire iables and dichotomous tumour thickness were examined with Clinical data including site, histopathological features and the v2 test; group differences in geometric mean tumour tumour thickness of the melanoma were assessed by histo- thickness were analysed by the t test (variables with two cat- pathological examinations. Tumour site was classified as head/ egories) or the F test (variables with more than two categor- neck, trunk, upper extremities and lower extremities including ies) using the log-transformed tumour thickness. feet; melanoma subtype was assessed according to Clark; and For multivariate analysis, factors associated with tumour tumour thickness was measured in millimetres according to thickness were identified by multivariate linear and logistic Breslow. A tumour thickness >1Æ5 mm is considered to be regression analysis with stepwise variable selection (entry cri- prognostically unfavourable. Moreover, the skin type of each terion P <0Æ25 in the univariate analysis and stay criterion patient was assessed by visual inspection and questioning P <0Æ05 in the end model). In multivariate linear regression about tanning reactivity. In detail, patients were asked how analysis, log-transformed tumour thickness was used as out- long they can stay in the sun without getting sunburned and come variable and the mean ratio (MR) with 95% CI was whether they tan at all after sunbathing. calculated by back-transforming the estimated regression The 233 patients treated between January 1999 and January coefficients. In multivariate logistic regression analysis, the 2001 at our department were all patients with a primary cuta- logit of the prevalence of tumour thickness >1Æ5 mm was neous melanoma. A detailed questionnaire was used for con- modelled as outcome variable and the odds ratio (OR) with ducting an interview of each patient and included information 95% CI was calculated by back-transforming the estimated on sociodemographic factors, patients’ knowledge of mela- regression coefficients. In both multivariate analyses, we dicho- noma symptoms, sun behaviour, time interval for delay in tomized melanoma subtype [0 ¼ superficial spreading mela- diagnosis, and related factors. In detail, patients were asked noma (SSM), lentigo maligna melanoma (LMM) or unspecified which person first called attention to a melanoma. In addition, malignant melanoma (UCMM); 1 ¼ nodular melanoma (NM) they were asked about clinical signs of melanoma observed by or acrolentiginous melanoma (ALM)] and melanoma detection

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp938–944 940 Factors associated with a high tumour thickness, J. Baumert et al.

(0 ¼ not self-detected; 1 ¼ self-detected) to reach sufficient Table 1. Of all patients, 40Æ6% reported self-detection of the allocations of cells. To account for the possibility of effect melanoma (Table 2). Medical attention was sought within modifications, second-order interaction terms for all factors 1 month after noticing the appearance of a new lesion or the fulfilling the entry criterion were included as product of two onset of changes in a pre-existing lesion in 16Æ1% of the factors in the initial regression model. patients. After medical consultation, in 74Æ6% no professional For all statistical analysis, P <0Æ05 was considered to indi- delay occurred for excision of the pigmented lesion. cate a significant difference. The evaluations were performed with the statistical software package SAS (version 8.02; SAS Univariate associations of tumour thickness with Institute Inc., Cary, NC, U.S.A.). patient-, clinical- and melanoma-related factors

Results No signiﬁcant differences in the proportion of patients with a tumour thickness >1Æ5 mm were observed for men and women in the study population (P ¼ 0Æ636). Patients aged Description of study population ‡ 70 years (P <0Æ001) and living alone (P ¼ 0Æ024) had a Of all patients, 101 (46Æ5%) were male; the mean ± SD age signiﬁcantly higher percentage of melanomas with a tumour of the study population was 54Æ7±15Æ7 years. Most patients thickness >1Æ5 mm. Moreover, strong associations were were not living alone (77Æ4%) and had skin type I or II observed for tumour thickness and melanoma subtype (79Æ3%). The median tumour thickness was 0Æ8 mm (inter- (Table 1). Patients without any melanoma knowledge before quartile range 0Æ5–1Æ6). Further characteristics are displayed in the disease exhibited a higher proportion of melanomas with

Table 1 Patient and clinical factors for 217 patients with invasive melanomas: distribution in all patients, patients with tumour thickness >1Æ5 mm and geometric mean tumour thickness (GM) in mm

Patients with tumour thickness >1Æ5mm

Factor All patients, n (%) n/N (%) P-value GM (95% CI) P-value Total 217 (100Æ0) 57/217 (26Æ3) – 0Æ94 (0Æ83–1Æ06) – Sex 0Æ636 0Æ717 Male 101 (46Æ5) 25/101 (24Æ8) 0Æ91 (0Æ76–1Æ10) Female 116 (53Æ5) 32/116 (27Æ6) 0Æ96 (0Æ81–1Æ14) Age class <0Æ001 <0Æ001 <50 years 76 (35Æ0) 14/76 (18Æ4) 0Æ84 (0Æ69–1Æ03) 50–69 years 99 (45Æ6) 21/99 (21Æ2) 0Æ80 (0Æ67–0Æ96) ‡70 years 42 (19Æ4) 22/42 (52Æ4) 1Æ63 (1Æ24–2Æ15) Living condition 0Æ024 0Æ025 Living not alone 168 (77Æ4) 38/168 (22Æ6) 0Æ87 (0Æ75–1Æ00) Living alone 49 (22Æ6) 19/49 (38Æ8) 1Æ22 (0Æ94–1Æ59) Educational level 0Æ055 0Æ003 High 28 (12Æ9) 5/28 (17Æ9) 0Æ68 (0Æ48–0Æ95) Medium 107 (49Æ3) 23/107 (21Æ5) 0Æ84 (0Æ70–1Æ00) Low 82 (37Æ8) 29/82 (35Æ4) 1Æ22 (1Æ00–1Æ49) Skin type 0Æ067 0Æ131 I or II 172 (79Æ3) 50/172 (29Æ1) 0Æ99 (0Æ86–1Æ14) III or IV 45 (20Æ7) 7/45 (15Æ6) 0Æ78 (0Æ59–1Æ02) Tumour site 0Æ247 0Æ088 Head/neck 23 (10Æ6) 7/23 (30Æ4) 1Æ06 (0Æ72–1Æ55) Trunk 94 (43Æ3) 19/94 (20Æ2) 0Æ79 (0Æ65–0Æ95) Arms/hands 29 (13Æ4) 7/29 (24Æ1) 0Æ94 (0Æ67–1Æ32) Legs/feet 71 (32Æ7) 24/71 (33Æ8) 1Æ14 (0Æ91–1Æ41) Melanoma subtype <0Æ001 <0Æ001 SSM 132 (60Æ8) 13/132 (9Æ9) 0Æ66 (0Æ58–0Æ75) NM 40 (18Æ4) 28/40 (70Æ0) 2Æ46 (1Æ95–3Æ12) ALM 11 (5Æ1) 8/11 (72Æ7) 2Æ21 (1Æ41–3Æ46) LMM 9 (4Æ2) 1/9 (11Æ1) 0Æ41 (0Æ25–0Æ68) UCMM 25 (11Æ5) 7/25 (28Æ0) 1Æ20 (0Æ89–1Æ61)

CI, confidence interval; SSM, superficial spreading melanoma; NM, nodular melanoma; ALM, acrolentiginous melanoma; LMM, lentigo maligna melanoma; UCMM, unspecified malignant melanoma.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp938–944 Factors associated with a high tumour thickness, J. Baumert et al. 941

Table 2 Melanoma-related factors for 217 patients with invasive melanomas: distribution in all patients, patients with tumour thickness >1Æ5mm and geometric mean tumour thickness (GM) in mm

Patients with tumour thickness >1Æ5mm

Factor All patients, n (%) n/N (%) P-value GM (95% CI) P-value Total 217 (100Æ0) 57/217 (26Æ3) – 0Æ94 (0Æ83–1Æ06) – Melanoma knowledge <0Æ001 <0Æ001 No 38 (17Æ5) 21/38 (55Æ3) 1Æ89 (1Æ42–2Æ51) Yes 179 (82Æ5) 36/179 (20Æ1) 0Æ81 (0Æ71–0Æ92) Melanoma detectiona 0Æ361 0Æ219 Patient 88 (40Æ6) 31/88 (35Æ2) 1Æ06 (0Æ87–1Æ29) Family member 69 (31Æ8) 17/69 (24Æ6) 0Æ95 (0Æ76–1Æ19) Physician 44 (20Æ3) 8/44 (18Æ2) 0Æ80 (0Æ61–1Æ06) Other 16 (7Æ3) 1/16 (6Æ3) 0Æ69 (0Æ44–1Æ10) Time from detection to consultation 0Æ291 0Æ301 <1 month 35 (16Æ1) 7/35 (20Æ0) 0Æ83 (0Æ61–1Æ14) ‡1–12 months 97 (44Æ7) 28/97 (28Æ9) 1Æ04 (0Æ87–1Æ26) ‡12 months 62 (28Æ6) 19/62 (30Æ7) 0Æ94 (0Æ74–1Æ18) Detection by physician 23 (10Æ6) 3/23 (13Æ0) 0Æ72 (0Æ49–1Æ05) Time from consultation to treatment 0Æ049 0Æ077 <1 month 162 (74Æ6) 37/162 (22Æ8) 0Æ88 (0Æ76–1Æ02) ‡1 month 55 (25Æ4) 20/55 (36Æ4) 1Æ14 (0Æ89–1Æ46) Suspected diagnosis at ﬁrst consultation 0Æ005 0Æ015 Melanoma 163 (75Æ1) 35/163 (21Æ5) 0Æ86 (0Æ74–0Æ99) Other 54 (24Æ9) 22/54 (40Æ7) 1Æ23 (0Æ96–1Æ58)

CI, conﬁdence interval. aIn case of multiple responses, the ﬁrst statement was used.

a tumour thickness >1Æ5 mm than those with melanoma cated by the significant product term melanoma know- knowledge (55Æ3% vs. 20Æ1%, P <0Æ001) (Table 2). Time ledge · melanoma subtype (P ¼ 0Æ015). In the case of SSM, from initial observation to first professional consultation was LMM or UCMM, patients with a lack of melanoma knowledge not associated with a greater tumour thickness. A significant before the disease had a two times higher geometric mean association was found between time from first consultation to tumour thickness than patients who had any knowledge treatment and tumour thickness, with a higher percentage of a before (95% CI 1Æ41–2Æ84). In contrast, no significant effect prognostically unfavourable tumour thickness in patients with of melanoma knowledge was observed for patients with professional delay (P ¼ 0Æ049). tumour types NM or ALM (MR 1Æ01; 95% CI 0Æ66–1Æ55). The Differences in geometric mean tumour thickness were sim- MR of the tumour thickness between melanoma subtypes NM ilar with significant associations to age class, living conditions, or ALM compared with SSM, LMM or UCMM was higher for educational level, melanoma subtype, melanoma knowledge patients with than for patients without melanoma knowledge and suspected diagnosis at first consultation. (MR 3Æ64 vs. 1Æ84). Similar results were found in multivariate logistic regression, as displayed in Table 4. Instead of educational level, skin Multivariate associations of tumour thickness with type was associated with a higher percentage of patients with patient-, clinical- and melanoma-related factors a tumour thickness >1Æ5 mm. Those factors significantly associated with tumour thickness in We repeated both regression analyses with forcing age class the respective univariate analysis were included in the initial to be included in each model during the variable selection models together with those factors with a P-value from 0Æ05 process. The results were virtually equal with age class proving to 0Æ25 (see Tables 1 and 2 for respective P-values and varia- not to be significant. Moreover, similar results were found bles). In multivariate linear regression, a stepwise variable when age was included as continuous variable in the regres- selection revealed an end model with four factors and one sion models. interaction term, displayed in Table 3. Patients living alone had a 39% higher geometric mean Discussion tumour thickness than patients not living alone (MR 1Æ39). Educational level was also significantly related to tumour Prevention campaigns are generally a reasonable way to thickness. The relation between melanoma knowledge and improve the state of health for subjects of a targeted popula- tumour thickness was modified by melanoma subtype as indi- tion. For melanomas, primary prevention campaigns focusing

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp938–944 942 Factors associated with a high tumour thickness, J. Baumert et al.

Table 3 Association of patient-, clinical- and melanoma-related Table 4 Association of patient-, clinical- and melanoma-related factors with the geometric mean tumour thickness estimated by factors with patients with tumour thickness >1Æ5 mm estimated by multivariate linear regression: mean ratio (MR), 95% conﬁdence multivariate logistic regression: odds ratio (OR), 95% conﬁdence interval (CI) and P-value interval (CI) and P-value

Factor MR (95% CI) P-value Factor OR (95% CI) P-value Living conditions Living conditions Living not alone Ref. 0Æ007 Living not alone Ref. 0Æ014 Living alone 1Æ39 (1Æ09–1Æ75) Living alone 3Æ24 (1Æ27–8Æ23) Educational level Skin type High Ref. 0Æ030 III or IV Ref. 0Æ039 Medium 1Æ28 (0Æ94–1Æ74) IorII 3Æ05 (1Æ06–8Æ80) Low 1Æ53 (1Æ11–2Æ11) Interaction Interaction Melanoma subtype · 0Æ003 Melanoma subtype · 0Æ015 melanoma knowledge melanoma knowledge Melanoma subtype ¼ SSM, LMM or UCMM Melanoma subtype ¼ SSM, LMM or UCMM Melanoma knowledge Melanoma knowledge Yes Ref. Yes Ref. No 1Æ66 (1Æ07–2Æ57) No 2Æ00 (1Æ41–2Æ84) Melanoma subtype ¼ NM or ALM Melanoma subtype ¼ NM or ALM Melanoma knowledge Melanoma knowledge Yes Ref. Yes Ref. No 0Æ84 (0Æ43–1Æ64) No 1Æ01 (0Æ66–1Æ55) Melanoma knowledge ¼ Yes Melanoma knowledge ¼ Yes Melanoma subtype Melanoma subtype SSM, LMM or UCMM Ref. SSM, LMM or UCMM Ref. NM or ALM 3Æ19 (2Æ04–4Æ98) NM or ALM 3Æ64 (2Æ75–4Æ81) Melanoma knowledge ¼ No Melanoma knowledge ¼ No Melanoma subtype Melanoma subtype SSM, LMM or UCMM Ref. SSM, LMM or UCMM Ref. NM or ALM 1Æ62 (0Æ80–3Æ31) NM or ALM 1Æ84 (1Æ15–2Æ93) SSM, superficial spreading melanoma; NM, nodular melanoma; SSM, superficial spreading melanoma; NM, nodular melanoma; ALM, acrolentiginous melanoma; LMM, lentigo maligna mela- ALM, acrolentiginous melanoma; LMM, lentigo maligna melanoma; UCMM, unspecified malignant melanoma. Number of noma; UCMM, unspecified malignant melanoma. Number of patients: 217 patients with an invasive malignant melanoma; patients: 217 patients with an invasive malignant; outcome: outcome: tumour thickness >1Æ5 mm vs. £1Æ5 mm; OR: log(tumour thickness); MR: exp(regression coefficient); variable exp(regression coefficient); variable selection: stepwise selection selection: stepwise selection (entry criterion P <0Æ25, stay (entry criterion P <0Æ25, stay criterion P <0Æ05); model fit: criterion P <0Æ05); model fit: R2 ¼ 0Æ389. area under curve ¼ 0Æ857.

on the reduction of melanoma incidence are important and unfavourable tumour thickness is essential for the improve- have already led to a change, for example in leisure time ac- ment of prevention campaigns for melanomas. tivities. In particular, people know that they should protect Possible associations of sociodemographic data and tumour themselves from the sun in order not to get melanoma in the thickness have only been investigated by a few groups so far. first place. Moreover, there is now increased knowledge of Richard et al., for example, assessed the influence of several further risk factors such as dysplastic naevi or familial atypical factors on tumour thickness in a study focusing on reasons for mole syndromes.14 In addition to these efforts, improvement delay in diagnosis of melanoma.11 In the present study, two in early detection of melanoma is of relevance in order to significant associations appeared: an increased tumour thick- reduce melanoma mortality. Here, secondary prevention cam- ness was found in patients living alone and in patients with a paigns are considered as useful instruments to reach this low educational level (no high school examination or equiva- goal.15–17 As the most important marker for melanoma mor- lent). The last observation is in accordance with results of tality, tumour thickness according to Breslow is seen as crucial Richard et al. and a recent study from Southern Italy.8,11 Mon- endpoint in secondary prevention campaigns.15 Moreover, in tella et al. reported a strong association between educational contrast to other possible endpoints (e.g. regular self-examin- level and tumour thickness as well as between unemployment ation of the skin, participation in screening programmes), and tumour thickness.8 Patients with <5 years of schooling, tumour thickness is histopathologically assessed and therefore which might often lead to unemployment in the future, had a cannot be biased by patients’ statements. Therefore, know- significantly increased risk of developing a melanoma with ledge of characteristics associated with a high, prognostically a tumour thickness ‡1Æ5 mm.8 Moreover, in a study from

Florida (U.S.A.), van Durme et al. showed an increased diagnosis of the tumour was associated with a strong risk to percentage of melanomas at late stage (regional or distant detect it in an advanced stage in cases of melanoma subtypes metastases) for patients with a low educational level.18 These SSM, LMM or UCMM. However, no effect of melanoma findings are only apparent in contrast to results of another knowledge was observed for subtypes NM or ALM. In the lat- study from the U.S.A., which showed a high incidence of ter case, tumour thickness remained highly unaffected by the melanoma in people with high education and high income.9 previous knowledge about the disease. This raises the question One may speculate that people with high education and high regarding the impact of the clinical appearance of the tumour income have more time for outdoor leisure activities leading on the early detection of NM and ALM. Indeed, these tumours to intermittent sun exposure which is known as an important do not share the universal and well-known alarming signs of environmental risk factor for the development of mela- classical melanoma, i.e. their uncommon presentation may noma.19,20 Moreover, a high incidence of melanoma in upper play a key role in the delay. This may also explain why lesions class patients means a high proportion of thin melanomas which were not suspected of being melanoma at first consult- with favourable prognosis. ation because of their atypical and unusual presentation also To the best of our knowledge, the association between had the highest thickness. It can also be hypothesized that the greater tumour thickness and patients living alone had not biological compartment of ALM and NM could be different been reported before. In a series of 45 483 patients of the and more aggressive than that of SSM which could explain a Central Malignant Melanoma Registry of the German Dermato- higher tumour thickness and worse prognosis. This leads to logical Society the median tumour thickness was reported to the question: what is meant by ‘melanoma knowledge’ and be highest in male patients aged >55 years.10 Older men how was information gained? Usually, prevention pro- might be one important subgroup of patients living alone. grammes address the more frequently occurring specific symp- Another group comprises young urbans living alone, which toms of SSM and LMM (change of colour in a pre-existing accounts for more than 50% in large cities in Europe and the mole, change of shape, increase in size) as these comprise the U.S.A. majority of melanomas.14,28-30 This might have led to the In a multivariate analysis, age was not associated with positive effect of melanoma knowledge on the tumour thick- tumour thickness in our investigation. Moreover, self-detec- ness for these subtypes, recognized in our investigation. Little tion, patient and professional delay were not related to is known about signs and symptoms of NM in the general tumour thickness. This is in line with the results of other population. The diameter criterion seems to fit SSM and LMM studies revealing no association between delay and increased but is not sensitive enough for early detection of NM. Bergen- tumour thickness.11,12,21,22 Only for a very long delay was an mar et al. reported that NMs often have a small diameter association discussed.23 Gender had no significant influence on (<6Æ0 mm) and, therefore, run the risk of being ignored the tumour thickness in the present study population. This is by both patients and professionals.31 NMs are to a greater in line with two investigations in study populations with extent new lesions, which should also be added to preventive recently diagnosed melanoma24,25 but in contrast to results of messages. other studies where gender-specific differences in tumour For ALMs, the most common tumour sites are sole, palm thickness were observed, at least for some subgroups of mela- and nail bed. Especially in the case of subungual melanoma, noma patients.8,11,26 Leiter et al., for example, reported a bet- correct diagnosis may be delayed because ALM may mimic ter outcome for women with thin melanomas.26 One possible trauma, bacterial or fungal infection. In future prevention pro- reason for this difference might be the small patient sample in grammes, descriptions of specific symptoms and signs of NM our present investigation in comparison with the larger patient and ALM should be addressed to elevate the knowledge about collectives mentioned above.8,10,11 Another explanation might them in the public. be that in the present analysis patients were included between Self-detection and delay data depended mainly on the mem- 1999 and 2001 and, for the Munich patients with melanoma, ory of patients and, therefore, a recall bias cannot be totally gender differences in tumour thickness were more pro- excluded. This may be a disadvantage of studying self-detec- nounced in earlier years.27 tion and delay. In addition, there may be an information bias In multivariate logistic regression analysis, skin type was with respect to the selection of information concerning significantly associated with tumour thickness, which means ‘knowledge of melanoma’. We are conscious that ‘knowledge that patients with fairer skin types are at risk not only of get- of melanoma’ is difficult to grasp because patients may have ting sunburned but also of developing melanomas with very differing information about melanoma ranging from ‘we greater tumour thickness. This is in accordance with previous know that there is a skin tumour named melanoma’ to studies focusing on melanoma risk factors.3,7 detailed information about melanoma subtypes, prognostic Another result of the present study concerns the effect of factors, therapeutic options etc. Moreover, a confounding bias melanoma knowledge on tumour thickness. For all patients of and a selection bias cannot be totally excluded, because all our study there was an inverse relationship between the level patients of the present study are from the area of Munich, of knowledge about melanoma and tumour thickness.13 The which is a large city located in the prosperous state of Bavaria, effect of melanoma knowledge was modified by the mela- Germany. This may have an impact, for example, on the level noma subtype: a lack of melanoma knowledge before the of education, spare time activities and sunbathing behaviour

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp938–944 944 Factors associated with a high tumour thickness, J. Baumert et al. of the patients in the present investigation. In contrast to self- 10 Buettner PG, Leiter U, Eigentler TK, Garbe C. Development of detection and delay data, tumour thickness is an unbiased prognostic factors and survival in cutaneous melanoma over marker with a strong impact on melanoma mortality. There- 25 years. Cancer 2005; 103:616–24. 11 Richard MA, Grob JJ, Avril MF et al. Delay in diagnosis and mela- fore, the study of factors which influence the tumour thick- noma prognosis (I): the role of patients. Int J Cancer 2000; 89: ness may be a more effective and unbiased way to improve 271–9. further education programmes. Based on the results of the 12 Richard MA, Grob JJ, Avril MF et al. Delays in diagnosis and mela- present study, future prevention programmes especially should noma prognosis (II): the role of doctors. Int J Cancer 2000; focus on individuals living alone (who are not necessarily old) 89:280–5. and with lower education. Public education should be carried 13 Schmid-Wendtner MH, Baumert J, Stange J, Volkenandt M. Delay out with simple messages and clinical pictures using media in diagnosis of cutaneous melanoma: an analysis of 233 patients. Melanoma Res 2002; 12:389–94. such as magazines or television, which are preferred by older 14 Pfahlberg A, Gefeller O, Ko¨lmel KF. Public awareness of malignant persons and persons living alone. Another crucial issue con- melanoma risk factors in Germany. J Epidemiol Community Health sists of the elevated risk for a higher tumour thickness for 1997; 51:698–700. patients with melanomas of nodular and acrolentiginous types. 15 MacKie RM, Hole D. Audit of public education campaign to It is suggested to perform special research on these two mela- encourage earlier detection of malignant melanoma. BMJ 1992; noma subtypes to find out whether better information about 304:1012–15. the clinical signs of NM and ALM will lead to a decrease in 16 Dobes WL Jr. Melanoma skin cancer screenings. A how-to approach. Cancer 1995; 75:705–6. their mean tumour thickness as has already been described for 31 17 Rossi CR, Vecchiato A, Bezze G et al. Early detection of melanoma: SSM and LMM. an educational campaign in Padova, Italy. Melanoma Res 2000; 10:181–7. Acknowledgments 18 van Durme DJ, Ferrante JM, Pal N et al. Demographic predictors of melanoma stage at diagnosis. Arch Fam Med 2000; 9:606–11. We thank Dr Joachim Stange and Dr Karin Partscht for assist- 19 Armstrong BK. Epidemiology of melanoma: intermittent or total ance in obtaining data of patients concerning delay in diagno- accumulative exposure to the sun? J Dermatol Surg Oncol 1988; 14:835–49. sis of melanoma and Mrs Christa Sedelmaier for excellent 20 Armstrong BK, English DR. Epidemiologic studies. In: Cutaneous Mel- documentation of patients’ tumour-associated data. This work anoma: Clinical Management and Treatment Results Worldwide (Balch CM, has been supported by the Bayerisches Staatsministerium fu¨r Houghton AN, Milton GW, Sober AJ, Soong SJ, eds), 2nd edn. Landesentwicklung und Umweltfragen, which is a government Philadelphia: J.B. Lippincott, 1992; 12–26. institution. 21 Austoker J. Melanoma: prevention and early diagnosis. BMJ 1994; 308:1682–6. 22 Krige JEJ, Isaacs S, Hudson DA et al. Delay in diagnosis of cutane- References ous malignant melanoma. A prospective study in 250 patients. Cancer 1991; 68:2064–8. 1 Parkin DM, Whelan SL, Ferlay J et al. (eds). Cancer Incidence in Five 23 Temoshok L, Diclemente RJ, Sweet DM et al. Factors related to Continents, Vol. VII. Lyon: IARC, 1998. patient delay in seeking medical attention for cutaneous malignant 2 Koh HR. Cutaneous melanoma. N Engl J Med 1991; 325:171–82. melanoma. Cancer 1984; 54:3048–53. 3 Garbe C, Buttner P, Weiss J et al. Risk factors for developing cuta- 24 Brady MS, Oliveria SA, Christos PJ et al. Patterns of detection in neous melanoma and criteria for identifying persons at risk: multi- patients with cutaneous melanoma. Cancer 2000; 15:342–7. center case–control study of the Central Malignant Melanoma 25 Negin BP, Riedel E, Oliveria SA et al. Symptoms and signs of pri- Registry of the German Dermatological Society. J Invest Dermatol mary melanoma: important indicators of Breslow depth. Cancer 1994; 102:695–9. 2003; 15:344–8. 4 Marrett LD, Nguyen HL, Armstrong BK. Trends in the incidence of 26 Leiter U, Buettner PG, Eigentler TK et al. Prognostic factors of thin cutaneous malignant melanoma in New South Wales, 1983–1996. cutaneous melanoma: an analysis of the Central Malignant Melan- Int J Cancer 2001; 92:457–62. oma Registry of the German Dermatological Society. J Clin Oncol 5 Balch CM, Murad TM, Soong SJ et al. A multifactorial analysis of 2004; 22:3660–7. melanoma: prognostic histopathological features comparing 27 Volkenandt M, Schmidt M, Konz B et al. Clinical and epidemi- Clark’s and Breslow’s staging methods. Ann Surg 1978; 188:732– ological data of patients with malignant melanoma from the 42. Munich Tumor Center 1977–1997. Hautarzt 1999; 50:470–8. 6 Garbe C, Buttner P, Bertz J et al. Primary cutaneous melanoma. 28 Tho¨rn M, Ponten F, Bergstrom R et al. Trends in tumour character- Identification of prognostic groups and estimation of individual istics and survival of malignant melanoma 1960–1984: a popula- prognosis for 5093 patients. Cancer 1995; 75:2484–91. tion-based study in Sweden. Br J Cancer 1994; 70:743–8. 7 Blum A, Brand CU, Ellwanger U et al. Awareness and early detec- 29 Illig L, McCann-Roos U, Klaubert EW et al. Public education in tion of cutaneous melanoma: an analysis of factors related to delay recognizing melanoma. Z Hautkr 1989; 64:537–8. in treatment. Br J Dermatol 1999; 141:783–7. 30 Hoffmann K, Dirschka T, Schatz H et al. A local education cam- 8 Montella M, Crispo A, Grimaldi M et al. An assessment of factors paign on early diagnosis of malignant melanoma. Eur J Epidemiol related to tumor thickness and delay in diagnosis of melanoma in 1993; 9:591–8. southern Italy. Prev Med 2002; 35:271–7. 31 Bergenmar M, Hansson J, Brandberg Y. Detection of nodular and 9 Harrison RA, Haque AU, Roseman JM, Soong SJ. Socioeconomic superficial spreading melanoma with tumour thickness <2Æ0 mm. characteristics and melanoma incidence. Ann Epidemiol 1998; 8:327– An interview study. Eur J Cancer Prev 2002; 11:49–55. 33.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp938–944 EPIDEMIOLOGY AND HEALTH SERVICES RESEARCH DOI 10.1111/j.1365-2133.2007.07817.x The Dermatology Life Quality Index: assessing the efﬁcacy of biological therapies for psoriasis R.P. Katugampola, V.J. Lewis and A.Y. Finlay Department of Dermatology, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, U.K.

Summary

Correspondence Background Clinical trials show improvement in physical and health-related quality R.P. Katugampola. of life (HRQoL) measures in patients with psoriasis treated with biologics com- E-mail: [email protected] pared with placebo. However, these reports only give limited interpretation of the meaning of Dermatology Life Quality Index (DLQI) scores and provide lim- Accepted for publication 27 November 2006 ited comparison data. Objectives The aim of this paper is to identify which biological therapy provides Key words the greatest improvement in HRQoL following treatment of patients with chronic alefacept, Dermatology Life Quality Index, plaque psoriasis, as assessed by the DLQI. efalizumab, etanercept, infliximab, psoriasis Methods We reviewed all data published up to August 2006 of randomized pla- Conflicts of interest cebo-controlled trials (RCTs) of the four biologics currently licensed in some A.Y.F. is joint copyright holder of the DLQI. countries for clinical use in chronic plaque psoriasis (alefacept, efalizumab, etan- His department has received income from the use ercept and infliximab) which have used the DLQI as an outcome measure. The of the DLQI in the published studies reviewed. DLQI data were assessed based on overall improvement according to the DLQI A.Y.F. has had consultancy agreements with descriptor bands and on clinically meaningful improvement of ‡ 5. Serono, Amgen/Wyeth, Novartis, Pierre Fabre, Results Fifteen peer-reviewed articles and 59 abstracts describing 11 multicentre, Schering-Plough, Abbot Laboratories, Pfizer and 3M. This review was carried out independently double-blind RCTs were reviewed. Treatment with any one of the four biologics from any pharmaceutical company, and was not led to a clinically meaningful improvement in the DLQI of ‡ 5. However, when funded. applying the DLQI banding concept, infliximab and etanercept provided the greatest improvement in the overall HRQoL from a ‘very large effect on overall This review has been presented in part as posters HRQoL’ at baseline to ‘a small effect on overall HRQoL’ following treatment. at the European Academy of Dermatology and Conclusions The DLQI banding concept provides a further tool to assess the impact Venereology Annual Meeting, London in October 2005 and the British Association of of biologics on HRQoL of patients with psoriasis. Based on retrospective applica- Dermatologists’ Annual Meeting, Manchester in tion of DLQI bands to published RCT data, infliximab, followed by etanercept, July 2006. showed the greatest improvement in the overall HRQoL paralleled by a 75% improvement in the Psoriasis Area and Severity Index. However, some publications did not provide absolute baseline DLQI values, making interpretation of data and comparison between the agents difficult. Side-to-side comparative studies between biologics and between biologics and nonbiological psoriasis treatments will aid evidence-based psoriasis management decisions in the future.

Psoriasis is a common chronic inflammatory skin disease that At present, alefacept, efalizumab and etanercept are has a significant impact on affected persons’ health-related approved by the U.S. Food and Drug Administration for use quality of life (HRQoL) comparable with that of other major in moderate to severe chronic plaque psoriasis.3 In the U.K. medical conditions.1 Amid widespread treatment dissatisfac- and some other European countries, efalizumab, etanercept tion with existing antipsoriasis therapy,2 the emergence of a and infliximab are currently licensed for use in moderate to new group of systemic treatments collectively called ‘biologic- severe chronic plaque psoriasis.4,5 However, other biological al therapies’ or ‘biologics’ brings new hope to patients and agents continue to be developed. their clinicians.3 Four biologics, currently licensed in some In psoriasis, physical measures of disease severity such as countries for use in chronic plaque psoriasis in clinical prac- the affected body surface area or the Psoriasis Area and Sever- tice, have been used widely in clinical trials: these are alefa- ity Index (PASI) score do not always correspond with the cept, efalizumab, etanercept and infliximab. impact of psoriasis on the patient’s HRQoL.6 Therefore, both

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp945–950 945 946 DLQI and biologics for psoriasis, R.P. Katugampola et al. physical and HRQoL measures are necessary to assess disease HRQoL). The 10 questions in the DLQI can be subdivided into severity when decisions are taken over psoriasis treatment and six domains that relate to different aspects of a person’s when assessing the outcome of such decisions.4,7–9 All the HRQoL as follows: symptoms and feelings (questions 1, 2), published clinical trials on biologics for psoriasis have used daily activities (3, 4), leisure (5, 6), work/school (7), personal the percentage of subjects achieving PASI 75 (at least 75% relationships (8, 9) and treatment (10). improvement in the PASI score) as the prime physical out- Improvement in HRQoL can be demonstrated by two differ- come measure.10 In the majority of trials the Dermatology Life ent analyses of DLQI data. Clinically meaningful improvement Quality Index (DLQI) has been used as the dermatology-speci- can be demonstrated either by a score change of ‡ minimal fic HRQoL outcome measure.5,11–14 Other HRQoL measures important difference or by a shift from one descriptor band to that have been used in these trials include a general HRQoL a lower descriptor band. questionnaire, the Short Form-36 (SF36)15–18 and the Derma- Based on a study of 215 patients with various dermatologic- tology Quality of Life Scales (DQOLS), another dermatology- al diseases including psoriasis, a DLQI score change of ± 5 specific questionnaire.17 has been shown to correlate with a minimal clinically mean- The aim of this paper is to review all published randomized ingful change in a person’s HRQoL.19 In clinical trials of bio- placebo-controlled trial (RCT) data on biologics and to iden- logics using the DLQI, the total DLQI score change of ‡ 5 has tify which agent provides the greatest improvement in HRQoL been used as the benchmark of a clinically meaningful following treatment of patients with chronic plaque psoriasis, improvement in the patient’s HRQoL.5,21 using the DLQI and its interpretation with minimal important The minimal clinically important difference for the total difference and banding descriptors as outcome measures. DLQI score was reported to be lower than previously reported, ranging between 2Æ3 and 4Æ0 (mean 3Æ2) in one study using 22,23 Materials and methods adalimumab for chronic plaque psoriasis. However, at the time of writing this review, adalimumab has not yet been licensed for clinical use in chronic plaque psoriasis (confirmed Literature review by the drug information section, Abbott Laboratories, Maiden- All published clinical trials using biologics currently licensed head, U.K.). in some countries for clinical use for chronic plaque psoriasis Recently, in a study involving 1993 adult general dermatol- where the DLQI was used as an outcome measure were identi- ogy outpatients, including 60 patients with psoriasis, the fied by searching EMBASE, all EBM reviews (Cochrane DSR, meaning of absolute DLQI scores has been categorized and ACJ Journal Club, DARE and CCTR), Google Scholar, Medline, validated into ‘bands’.20 These bands describe the overall PubMed and continued review of the literature including full impact of skin disease on a person’s HRQoL as follows: 0–1, articles and published abstracts up to August 2006. Keywords ‘no effect at all’; 2–5, ‘small effect’; 6–10, ‘moderate effect’; used for the search were: biological therapy, biologics, psoria- 11–20, ‘very large effect’; 21–30, ‘extremely large effect’. sis, alefacept, efalizumab, etanercept and infliximab. Relevant This concept has not been previously used when reviewing poster presentation hand-outs from international dermatology RCT data in relation to improvement in the DLQI. meetings between 2000 and 2006 (British Association of Dermatologists’ Annual Meetings, American Academy of Data analysis Dermatology Annual Meetings, European Academy of Derm- atology and Venereology Annual Meetings, European Society To make comparisons between the different biologics, the fol- of Dermatology Research Annual Meetings) were also used as lowing data were extracted from each published trial, when a source of data in our review, in addition to the published these data were provided: the mean DLQI values at baseline, abstracts relating to these meetings. The hand-outs were col- end of the treatment period and follow-up period; the mean lected by authors attending these meetings or by contacting and/or percentage improvement in DLQI at the end of the the relevant pharmaceutical companies for the hand-outs, treatment period and follow-up period. Single case reports, using the meeting abstracts as references. The DLQI data were open-label studies, studies describing biologics for psoriatic reviewed based on clinically meaningful improvement of arthritis and those where routes of administration were cur- ‡ 5,19 and retrospectively applying the banding concept20 to rently not licensed for use in clinical practice (example: alefa- the published data. cept intramuscular route is licensed, but not intravenous route) were excluded from our data analysis. The Dermatology Life Quality Index Results The DLQI is a widely used dermatology-specific questionnaire consisting of 10 questions concerning HRQoL relating to the A total of 74 publications (59 abstracts and 15 peer- previous 1 week.11–14 The DLQI has been translated into many reviewed articles) was identified describing 11 multicentre, different languages, allowing it to be used in multicentre trials double-blind RCTs. Some abstracts included data published in different countries. The total DLQI ranges between 0 (no as full articles, or were from individual centres describing impairment of HRQoL) and 30 (maximum impairment of data from published multicentre trials. A negative DLQI

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp945–950 DLQI and biologics for psoriasis, R.P. Katugampola et al. 947 score change depicts an improvement in the HRQoL. Some articles did not provide mean baseline DLQI values. How- 30 ever, if other DLQI data such as mean change in DLQI from 35 baseline and percentage improvement were provided, the improvement 5 and baseline mean DLQI values were calculated using these data. 5 and ‡ ‡ The raw data are presented in the review without any fur- 19 b 5; ther statistical analysis. ‡ 26,27 5 nor improvement

Baseline psoriasis Dermatology Life Quality Index ‡ severity in biologic trials change from ‘very large’‘moderate’ to effect on overall HRQoL change from ‘very large’‘small’ to effect on overall HRQoL but not in DLQI band No data available Improvement in DLQI Some improvement in DLQI, Improvement in DLQI The baseline psoriasis severity of patients included in the bio- Change in DLQI following open-label extension of trials for placebo groups logic trials for alefacept,17,24 efalizumab,15,25–28 etaner- tcome measure cept16,29–34 and inﬂiximab18,35–37 was a mean total DLQI of above 10, within the ‘very large’ effect on overall HRQoL DLQI band. b

Change in Dermatology Life Quality Index following biologic treatment for psoriasis effect on overall HRQoL or ‘small’ effect onHRQoL overall effect on overall HRQoL on overall HRQoL ‘Very large’ to ‘moderate’ Improvement in overall HRQoL from baseline according to DLQI bands Table 1 summarizes the clinical trials analysed in this review in their ability to provide a clinically meaningful improvement

in the DLQI of ‡ 5, and to improve the overall HRQoL a according to the DLQI bands. Figure 1 shows the ability of the biologics to improve the overall HRQoL according to the IM Clinically meaningful improvement in DLQI Both doses ‘Very large’ to ‘moderate’ DLQI bands at the highest doses used for the individual agent

in clinical trials. 20 Table 2 summarizes the trials that published the percentage of patients who achieved a total DLQI score of 0 (‘no effect’ extension) Duration of treatment (weeks) on overall HRQoL) and the DLQI domains that improved the Improvement in total DLQI from baseline to end of treatment or follow-up period of a most following treatment with a biologic. A total DLQI score of both 0 and 1 is interpreted as meaning ‘no effect’ on overall HRQoL.20 Therefore it is possible that the percentage of patients achieving this band following treatment with etaner- 627 10–46 Both doses ‘Very large’ to ‘small’ effect Total number of patients cept and inﬂiximab was higher than shown in Table 2; how- 1965 12–24 All three doses ‘Very large’ to ‘moderate’ ever, the percentage of patients achieving a total DLQI of 1 following treatment was not published for either of the biologics. weekly, SC 2444 12at (±12-week weeks 1 1 ) ) Change in the Psoriasis Area and Severity Index score following biologics twice weekly, 50 mgweekly, twice SC The improvement in the DLQI paralleled the improvement in 0, 2 & 6,8 then weeks, every IV the PASI 75 during and/or following treatment, as shown in 10 or 15 mg weekly, IM1 or 2 mg kg 50725 mg weekly, 25 mg 3 12 or 5 mg kg 15 mg weekly, Figure 2. Although the patient inclusion criteria for all the clinical trials were similar (moderate to severe chronic & 28 &

plaque psoriasis), the routes of administration, dosages, 16,29–31,34 15,25–27 18,35–37 17,24 duration of treatment and post-treatment follow-up are not 32,33 directly comparable between the four biologics shown in Figure 2. three phase III In the alefacept trial, when the treatment groups were sub- one meta-analysis divided into responders and nonresponders according to attainment of PASI 50 (at least 50% improvement in the PASI score) and PASI 75, the responders (those who achieved PASI Summary of multicentre, double-blind, randomized, placebo-controlled trials on biologics using the Dermatology Life Quality Index (DLQI) as an ou 50 or PASI 75) had a clinically meaningful improvement in Efalizumab Four phase III Etanercept One phase II Inﬂiximab Two phase III HRQoL, health-related quality of life; SC, subcutaneous; IV, intravenous; IM, intramuscular. Biologic Trials Treatment doses Alefacept One phase III in total DLQI from baseline to end of treatment or follow-up period according to DLQI descriptor bands. 17 their DLQI compared with nonresponders. Table 1

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp945–950 948 DLQI and biologics for psoriasis, R.P. Katugampola et al.

16 Fig 1. Impact of psoriasis on the overall 15 Baseline mean total DLQI 14 Mean total DLQI at end of treatment or follow-up health-related quality of life (HRQoL): 13 ‘Very large effect’ comparison between the biologics before and 12 on overall HRQoL at the end of treatment (efalizumab and 11 10 etanercept: after 12 weeks of treatment, 9 inﬂiximab: after 10 weeks of treatment), or 8 ‘Moderate effect’ follow-up (alefacept: 2 weeks following a 7 on overall HRQoL 6 12-week treatment course). Dermatology Life

Mean total DLQI total DLQI Mean 5 Quality Index (DLQI) descriptor bands20 4 ‘Small effect’ are shown on the right-hand side: 0–1 ¼ no 3 on overall HRQoL 2 effect at all; 2–5 ¼ small effect; 6–10 ¼ 1 ‘No effect’ on moderate effect; 11–20 ¼ very large 0 overall HRQoL Alefacept Efalizumab Etanercept Infliximab effect; 21–30 ¼ extremely large effect. 15 mg week–1 2 mg kg–1 week–1 50 mg twice weekly 5 mg kg–1 IM, intramuscular; SC, subcutaneous; IM17,24 SC25 SC34 IV35–37 IV, intravenous.

Table 2 Percentage of patients achieving a total Dermatology Life Quality Index (DLQI) score of 0 and the DLQI domains that improved the most following treatment with biologics

Biologic Percentage of patients achieving a total DLQI score of 0 following treatmenta DLQI domainsb that improved following treatment Alefacept Data not available Symptoms and feelings, influence on clothing24 Efalizumab Data not available Symptoms and feelings, influence on clothing26,27 Etanercept 28% of patients treated with 50 mg twice weekly SC for 12 weeks34 Symptoms and feelings, daily activities31 ) Infliximab 47% of patients treated with 5 mg kg 1 at weeks 0, 2 and 618,35 All six domains35

SC, subcutaneous. aThe pretreatment mean baseline DLQI was above 10; bDLQI domains: symptoms and feelings (questions 1, 2), daily activities including choice of clothing (questions 3, 4), leisure (questions 5, 6), work/school (question 7), personal relationships (questions 8, 9) and treatment (question 10).

Infliximab 5 mg kg–1 IV at week 50 Infliximab 5 mg kg–1 IV at week 24 Infliximab 5 mg kg–1 IV at week 10 Infliximab 3 mg kg–1 IV at week 10 Etanercept 50 mg twice per week SC at week 24 Fig 2. Comparison between improvement in Etanercept 50 mg twice per week SC at week 12 Dermatology Life Quality Index (DLQI) and Etanercept 25 mg twice per week SC at week 24 percentage of subjects achieving PASI 75 Etanercept 25 mg twice per week SC at week 12 Etanercept 25 mg week–1 SC at week 24 (at least 75% improvement in the Psoriasis Etanercept 25 mg week–1 SC at week 12 Area and Severity Index score) for the Efalizumab 1 mg kg–1 week–1 SC at week 24 biologics. DLQI change of ‡ 5 ¼ clinically 19 Efalizumab 2 mg kg–1 week–1 SC at week 12 meaningful improvement. References: Efalizumab 1 mg kg–1 week–1 SC at week 12 alefacept,17,24 efalizumab,15,25–28 Alefacept 15 mg week–1 IM at week 24 etanercept,16,29–34 inﬂiximab.18,35–37 On the –1 Alefacept 10 mg week IM at week 24 DLQI change from baseline x-axis 0–85 represents percentage of subjects; –1 Alefacept 15 mg week IM at week 14 % of subjects achieving PASI 75 )10 to 0 represents absolute DLQI score Alefacept 10 mg week–1 IM at week 14 changes. IM, intramuscular; SC, subcutaneous; –10 –5 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 IV, intravenous.

The DQOLS is a dermatology-specific HRQoL questionnaire Changes in other health-related quality of life measures that has been used in some alefacept trials, and was shown to following biologic treatment for psoriasis improve in parallel to the DLQI following treatment.17 The DLQI is the most widely used dermatology-specific HRQoL questionnaire in biologic trials and is therefore the Discussion appropriate tool in an attempt to make comparisons between the agents. The SF36 is a general HRQoL questionnaire that Comparison between therapeutic agents for psoriasis of pub- has been used in some trials in addition to the DLQI, and was lished trial data using the DLQI as an outcome measure is shown to improve parallel to the DLQI following treatment complex. Points to consider prior to attempting to make with alefacept,17 efalizumab,15 etanercept16 and infliximab.18 such comparisons are that some interventions are RCTs

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp945–950 DLQI and biologics for psoriasis, R.P. Katugampola et al. 949 whereas others are open-label single-centre studies. The onset with widespread treatment dissatisfaction. J Invest Dermatol Symp Proc of action, frequency of administration of treatment, duration 2004; 9:136–9. of treatment and follow-up also vary between agents. Long- 3 Thomas VD, Yang EC, Kvedar JC. Biologics in psoriasis: a quick reference guide. J Am Acad Dermatol 2005; 53:346–51. term data including potential side-effects of the biologics fol- 4 Smith CH, Anstey AV, Barker JNWN et al. British Association of lowing treatment of psoriasis are awaited. Finally, the new Dermatologists guidelines for use of biological intervention in biologics are expensive compared with nonbiological psoria- psoriasis 2005. Br J Dermatol 2005; 153:486–97. 5 sis treatment; Nelson et al. have published cost estimates in 5 Nelson AA, Pearce DJ, Fleischer AB et al. New treatments for U.S. dollars per patient achieving PASI 75 and per patient psoriasis: which biologic is best? J Dermatol Treat 2006; 17:96– achieving minimal clinically meaningful change in the DLQI. 107. However, if these expensive agents do maintain patients with 6 Kirby B, Richards HL, Woo P et al. Physical and psychological measures are necessary to assess overall psoriasis severity. J Am Acad psoriasis in long-term disease remission, with improved Dermatol 2001; 45:72–6. HRQoL and enhanced productivity, then the cost could be 7 Finlay AY. Current severe psoriasis and the Rule of Tens. Br J Dermatol justified. All the above issues need to be taken into consid- 2005; 152:861–7. eration in routine clinical practice when treating the individ- 8 Katugampola RP, Hongbo Y, Finlay AY. Clinical management deci- ual patient. sions are related to the impact of psoriasis on patient-rated quality What matters to the patient is both physical improvement of life. Br J Dermatol 2005; 152:1256–62. in their psoriasis and alleviation of psychological and HRQoL 9 Krueger GG, Feldman SR, Camisa C et al. Two considerations for patients with psoriasis and their clinicians: what defines mild, impairment following treatment. Therefore, the results of the moderate and severe psoriasis? What constitutes a clinically signifi- biologic trials also need to be interpreted concerning their cant improvement when treating psoriasis? J Am Acad Dermatol 2000; ability to improve the PASI score. Further, the impact of the 43:281–5. biologics on psoriatic arthritis was not reviewed in this article, 10 Papp KA. The long-term efficacy and safety of new biological ther- but is of great importance in the subgroup of psoriatic apies for psoriasis. Arch Dermatol Res 2006; 298:7–15. patients with arthritis. 11 Finlay AY, Khan GK. Dermatology Life Quality Index (DLQI): a In conclusion, the DLQI banding concept provides a further simple practical measure for routine clinical use. Clin Exp Dermatol 1994; 19:210–16. tool to assess the impact of biologics on HRQoL of patients 12 Lewis V, Finlay AY. Ten years experience of the Dermatology Life with psoriasis. From the currently available data, treatment Quality Index (DLQI). J Invest Dermatol Symp Proc 2004; 9:169–80. with efalizumab, etanercept or infliximab leads to a clinically 13 The Dermatology Life Quality Index. http://www.DLQI.com (last meaningful improvement in the HRQoL of patients compared accessed 11 January 2007). with placebo. The mean DLQI improves by one or two bands 14 Department of Dermatology, Wales College of Medicine. http:// following treatment with alefacept, efalizumab, etanercept or www.dermatology.org.uk (last accessed 11 January 2007). infliximab. 15 Ortonne JP, Shear N, Shumack S, Henninger E. Impact of efalizumab on patient-reported outcomes in high-need patients: Until direct prospective comparative trial data between bio- results of the international, randomized, placebo-controlled phase logics for psoriasis are available, considering the improvement III Clinical Experience Acquired with Raptiva (CLEAR) trial. BMC in the DLQI scores that parallel the improvement in PASI 75, Dermatol 2005; 5:13. intravenous infliximab seems to be the most effective agent, 16 Randazzo B, Prens EP, Rustin M. Patient-reported outcomes followed by etanercept. Although the same HRQoL measure, improve significantly in psoriasis patients receiving etanercept the DLQI, has been used in many biologics trials, interpret- therapy. J Eur Acad Dermatol Venereol 2004; 18 (Suppl. 1):87. ation and comparison of data were compromised by the lack 17 Finlay AY, Salek MS, Haney J for the Alefacept Clinical Study Group. Intramuscular alefacept improves health-related quality of of reporting of raw scores in some publications. We would life in patients with chronic plaque psoriasis. Dermatology 2003; encourage editors to insist on raw HRQoL scores being 206:307–15. published. 18 Griffiths CEM, Papp K, Nestle F et al. Infliximab (IFX) treatment results in significant quality of life (QoL) improvement among patients with moderate to severe psoriasis – results from EXPRESS Acknowledgments study. J Eur Acad Dermatol Venereol 2005; 19 (Suppl. 2):FC13.15 We thank Wyeth and Serono Pharmaceuticals, U.K., for pro- (Abstr.). 19 Khilji FA, Gonzalez M, Finlay AY. Clinical meaning of change in viding copies of some posters on etanercept and efalizumab, Dermatology Life Quality Index scores. Br J Dermatol 2002; 147 respectively, previously presented and published at inter- (Suppl. 62):50 (Abstr.). national dermatology meetings. 20 Hongbo Y, Thomas CL, Harrison MA et al. Translating the science of quality of life into practice: what do Dermatology Life Quality Index scores mean? J Invest Dermatol 2005; 125:659–64. References 21 Mease PJ, Menter MA. Quality-of-life issues in psoriasis and psori- 1 Rapp SR, Feldman SR, Exum ML et al. Psoriasis causes as much dis- atic arthritis: outcome measures and therapies from a dermato- ability as other major medical diseases. J Am Acad Dermatol 1999; logical perspective. J Am Acad Dermatol 2006; 54:685–704. 41:401–7. 22 Melilli L, Shikiar R, Thompson C. Clinical responses to treatment 2 Stern RS, Nijsten T, Feldman SR et al. Psoriasis is common, carries and changes in the Dermatology Life Quality Index (DLQI) in a substantial burden even when not extensive, and is associated moderate to severe plaque psoriasis patients treated with adal-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp945–950 950 DLQI and biologics for psoriasis, R.P. Katugampola et al.

imumab. J Eur Acad Dermatol Venereol 2005; 19 (Suppl. 2):FC13.1 health-related quality of life from etanercept therapy for patients (Abstr.). with moderate to severe psoriasis. J Am Acad Dermatol 2004; 23 Meililli L, Shikiar R, Thompson C. Minimum clinically important 50:0P155. difference in Dermatology Life Quality Index in moderate to 31 Krueger GG, Langley RG, Finlay AY et al. Patient-reported outcomes severe plaque psoriasis patients treated with adalimumab. J Am Acad of psoriasis improvement with etanercept therapy: results of a ran- Dermatol 2006; 54:AB221. domized phase III trial. Br J Dermatol 2005; 153:192–9. 24 Griffiths C, Langley R, Lebwohl M et al. Alefacept improves psoria- 32 Gottlieb AB, Matheson TR, Lowe N et al. A randomized trial of sis and quality of life: results of an international study. Ann Dermatol etanercept as monotherapy for psoriasis. Arch Dermatol 2003; Venereol 2002; 129:1S280. 139:1627–32. 25 Leonardi C. Efalizumab: an overview. J Am Acad Dermatol 2003; 33 Lowe N, Lebsack M, Wanke L. Psoriasis patients show improved 49:S98–104. quality of life when treated with etanercept. Ann Dermatol Venereol 26 Menter A, Gordon K, Carey W et al. Efficacy and safety observed 2002; 129:1S762. during 24 weeks of efalizumab therapy in patients with moderate 34 Gottlieb A, Wood J, Wolley JM et al. Treatment with etanercept to severe plaque psoriasis. Arch Dermatol 2005; 141:31–8. improves patient-reported outcomes in patients with moderate to 27 Gordon KB, Papp KA, Hamilton TK et al. Efalizumab for patients severe psoriasis. J Am Acad Dermatol 2005; 52:P201. with moderate to severe plaque psoriasis. A randomized controlled 35 Reich K, Nestle FO, Papp K et al. Improvement in quality of life trial. JAMA 2003; 290:3073–80. with infliximab induction and maintenance therapy in patients 28 Menter A, Kosinski M, Bresnahan BW et al. Impact of efalizumab with moderate-to-severe psoriasis: a randomized controlled trial. on psoriasis-specific patient-reported outcomes. Results from three Br J Dermatol 2006; 154:1161–8. randomised, placebo-controlled clinical trials of moderate to severe 36 Gottlieb AB, Evans R, Li S et al. Infliximab induction therapy for plaque psoriasis. J Drugs Dermatol 2004; 3:27–38. patients with severe plaque-type psoriasis: a randomized, double- 29 Leonardi CL, Powers JL, Matheson RT et al. Etanercept as mono- blind, placebo-controlled trial. J Am Acad Dermatol 2004; 51:534–42. therapy in patients with psoriasis. N Engl J Med 2003; 349:2014– 37 Feldman SR, Gordon KB, Bala M et al. Infliximab treatment results 22. in significant improvement in the quality of life of patients with 30 Feldman SR, Kimball A, Woolley JM, Zitnik R for the Enbrel in severe psoriasis: a double-blind placebo-controlled trial. Br J Dermatol Psoriasis Study Group. Clinically meaningful improvement in 2005; 152:945–60.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp945–950 PHOTOBIOLOGY DOI 10.1111/j.1365-2133.2007.07802.x Signiﬁcant downregulation of transforming growth factor-b signal transducers in human skin following ultraviolet-A1 irradiation T. Gambichler, M. Skrygan, N.S. Tomi, S. Breuksch, P. Altmeyer and A. Kreuter Department of Dermatology, Ruhr-University Bochum, Gudrunstrasse 56, D-44791 Bochum, Germany

Summary

Correspondence Background Despite the significant role of the transforming growth factor (TGF)-b/ Thilo Gambichler. Smad pathway in cell growth and extracellular matrix regulation, relatively little E-mail: [email protected] is known regarding the effect of ultraviolet (UV) radiation on the TGF-b/Smad signalling in human skin. Accepted for publication 21 November 2006 Objectives We aimed to investigate the impact of UVA1 and UVB on the mRNA and protein expression of TGF-b/Smad signal transducers in human skin in vivo. Key words Methods Fifteen subjects were exposed to 1Æ5 minimal erythema doses (MED) (4Æ5 photoageing, signal transduction, Smads, MED cumulative) of UVA1 and UVB over a 3-day period. Skin biopsies were transforming growth factor-b, ultraviolet radiation obtained at 24 and 72 h after the last UV exposure. Real-time reverse transcrip- Conflicts of interest tion–polymerase chain reaction and immunohistology were performed. None declared. Results In the UVA1-exposed sites (24 h, 72 h), mRNA expression of TGF-b1 and Smad3/4/7 was significantly downregulated as compared with nonirradiated skin sites (P <0Æ05). At 24 h, immunohistology revealed significantly reduced TGF-b1 protein levels in fibroblasts (P <0Æ05). However, mRNA and protein expression of TGF-b/Smad proteins observed in UVB-irradiated sites did not differ significantly from control sites (P >0Æ05). Conclusions In contrast to UVB, UVA1 significantly downregulates the expression of TGF-b/Smad proteins in human skin in vivo. The extent to which the acute effects of TGF-b/Smad signalling reported in the present paper are related to the beneficial effect of UVA1-based phototherapy of fibrotic skin conditions and/or to the chronic effects of UV that result in photoaging and cancer remains to be established.

Members of the transforming growth factor (TGF)-b family, TGF-b receptor and interferes with phosphorylation of which includes three isoforms of TGF-b (TGF-b1/2/3), exert R-Smads (e.g. Smad3) by preventing their interaction with a wide spectrum of biological responses on a large variety of activated type I TGF-b receptor. As the expression of Smad7 is cell types, e.g. regulation of cell growth, differentiation, matrix induced by TGF-b1, Smad7 inhibits TGF-b signalling by a production, inﬂammation, host defence and apoptosis.1,2 Typ- negative feedback system.2 ically, TGF-b signalling initiates with binding and activating It has previously been shown that TGF-b signalling plays a speciﬁc dual cell-surface receptors (type I and II). There are dual role in skin carcinogenesis. The earlier tumour suppres- three types of Smads: receptor-regulated (R-Smads), common sive role of TGF-b1 is attributed to its growth-inhibitory effect mediator (Co-Smads) and inhibitory (I-Smads). After ligand on keratinocytes, whereas the later tumour promotion role is binding, the type II TGF-b receptor phosphorylates the type I associated with its effects on the loss of epithelial cell adhe- TGF-b, which, in turn, phosphorylates and activates the sion, extracellular matrix remodelling, and enhanced angio- R-Smads (e.g. Smad3). The R-Smads bind then to a Co-Smad genesis.3–5 Recently, the essential role of Smad3 and Smad4 in (Smad4), and this complex translocates to the nucleus, where repressing as well as promoting skin tumour formation the complex regulates transcription of TGF-b-responsive genes. through the TGF-b pathway has been documented in non- The inhibitory Smad7 associates with ligand-activated type I melanoma skin cancer.6,7 TGF-b is also the major regulator

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp951–956 951 952 Downregulation of TGF-b signal transducers following UVA1, T. Gambichler et al. of extracellular matrix synthesis in human skin, including (a) stimulation of ﬁbroblast proliferation in the dermis and down- 18·0 regulation of expression of proteolytic enzymes.8 16·0 A large body of evidence indicates that ultraviolet (UV) 14·0 radiation is the major agent of human nonmelanoma skin can- 12·0 nm)]

9 –2 cer. Apart from induction of DNA damage and mutation, 10·0

many alterations in gene expression and signalling are caused (W m 8·0 [

10–12 ) by UV radiation. It has become increasingly apparent that λ ( 6·0 Ε many of the biological effects of UV radiation on human skin Ε(λ) [ 4·0 are initiated by the triggering of cell signal transduction path- 2·0 ways that lead to alterations in gene expression. Almost all 0 changes in gene expression induced by UV radiation are likely 220·0 260·0 300·0 340·0 380·0 420·0 to be due to alterations in growth factor and cytokine signal λ (nm) 13 transduction pathways. However, despite the signiﬁcant role (b) of the TGF-b/Smad pathway in cell growth and extracellular 1·200 matrix regulation, relatively little is known regarding the effect 1·000 of UV radiation on the TGF-b/Smad signalling pathway in 14–17 0·800 human skin. The aim of the present study was to investi- nm)] –2 gate the impact of UVA1 and UVB on the mRNA and protein 0·600 (W m expression of TGF-b/Smad signal transducers in human skin [

) λ in vivo. ( 0·400 Ε(λ) [ Ε

0·200 Materials and methods 0 220·0 260·0 300·0 340·0 380·0 420·0 Subjects λ (nm)

Fifteen healthy subjects (11 men and four women; Fig 1. Spectral irradiance of the ultraviolet (UV) A1 (a) and UVB (b) mean ± SD age 55Æ8±15Æ7 years, range 24–83) were sources used in the present study. enrolled into the study after giving informed consent. All subjects were white skinned (skin type II). Exclusion criteria included: history of UV exposure for at least 2 months prior (7 · 7 cm) on the right and left medial scapular region, to the study, oral intake of medication (e.g. anti-inﬂammatory respectively. The resulting cumulative UV doses were 4Æ5 MED agents, photosensitizing agents), pregnancy, and history of both for UVB and for UVA1. One day (24 h) and 3 days photosensitivity. This study adhered to the Declaration of Hel- (72 h) after the last UV exposure, 3-mm full-thickness skin sinki and ethics approval for research was obtained from the biopsies were performed in all subjects on the centre of the ir- local review board of the Ruhr-University Bochum (Bochum, radiated (UVB, UVA1) sites on the medial scapular region and Germany). on a laterally adjacent (2Æ5 cm) nonirradiated site (control).

Ultraviolet exposures Real-time reverse transcription–polymerase chain reaction Prior to the study, UV source analysis (Fig. 1) was carried out with the spectral radiometer MSS 2040 (MSS Elektronik Quantitative analysis of real-time reverse transcription–poly- GmbH, Fro¨ndenberg, Germany).18 As recently described in merase chain reaction (RT-PCR) was performed as previously detail by Beattie et al.19 and Gambichler et al.,20 respectively, suggested:21 total cellular RNA was isolated from skin tissue the minimal erythema doses (MED) for UVA1 (340–450 nm) samples taken from 15 subjects using RNeasy Lipid Tissue and UVB (280–320 nm) were determined on the upper back Kit (Qiagen, Chatsworth, CA, U.S.A.) following the manufac- using the Sellamed 2000 System Dr Sellmeier (Sellas, Gevels- turer’s protocol. Prior to cDNA synthesis RNA was digested berg, Germany) and the Saalmann Multitester SBB LT 400 with RNase-free DNase I (Roche Diagnostics North America, (Saalmann GmbH, Herford, Germany), respectively. UVA1 Indianapolis, IN, U.S.A.). cDNA was synthesized by RT from intensity, assessed with the MP-100 Optical Radiometer DNase I-treated RNA using MultiScribeTM reverse transcriptase ) (UVA1-MED, Wennigsen, Germany), was 31Æ4mWcm 2. enzyme and random hexamer primers (TaqMan RT reagents; UVB intensity, measured with the RM-11 radiometer (Dr Applied Biosystems, Foster City, CA, U.S.A.). Real-time PCR ) Gro¨bel, Ettlingen, Germany), was 4Æ2mWcm 2. The mean was performed using a TaqMan SYBR Green PCR Master Mix ) ) MED were 40 ± 7Æ2Jcm 2 for UVA1 and 72Æ9mJcm 2 for and GeneAmp Sequence Detection System (Applied Biosys- UVB. On the following 3 days, the subjects received daily 1Æ5 tems). PCR primers for TGF-b1, Smad3, Smad4, Smad7 and MED UVA1 and 1Æ5 MED UVB on two opposite sites the housekeeping gene glyceraldehyde-3-phosphate dehydro-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp951–956 Downregulation of TGF-b signal transducers following UVA1, T. Gambichler et al. 953

Table 1 Primer sequences used in the real-time reverse transcription–polymerase chain reaction study

Forward Reverse TGF-b15¢-GGTACCTGAACCCGTGTTGCT-3¢ 5¢-TGTTGCTGTATTTCTGGTACAGCTC-3¢ Smad3 5¢-TGAGTTCGCCTTCAATATGAAGAA-3¢ 5¢-CAGGAGGTAGAACTGGTGTCTCTACTCT-3¢ Smad4 5¢-ACTGCAGAGTAATGCTCCATCAAGT-3¢ 5¢-GGATGGTTTGAATTGAATGTCCTT-3¢ Smad7 5¢-TAGCCGACTCTGCGAACTAGAGT-3¢ 5¢-GGACAGTCTGCAGTTGGTTTGA-3¢ GAPDH 5¢-CCTCAACTACATGGTTTACATGTTCC-3¢ 5¢-ATGGGATTTCCATTGATGACAAG-3¢

TGF-b, transforming growth factor-b; GAPDH, glyceraldehyde-3-phosphate dehydrogenase (housekeeping gene). genase (GAPDH) were designed using the computer program Hamburg, Germany), sections were stored for 20 min in a Primer Express (PE Biosystems, Foster City, CA, U.S.A.) and humid chamber at 25 C. Sections were covered with 200 lL produced by the custom oligonucleotide synthesis service TIB antirabbit immunoglobulin biotin TGF-b1 and Smad3/4/7 Molbiol (Berlin, Germany). The primers for TGF-b1, Smad3/ (Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.) for 4/7 and GAPDH are displayed in Table 1. PCR ampliﬁcations 30 min at 25 C in a Dako Autostainer (Dako Cytomation). were performed in a total volume of 25 lL, containing 5 lL After washing with Wash Buffer 10 · (Dako Cytomation) for ) cDNA sample, 5 lmol L 1 of each primer and 12Æ5 lL SYBR 2 min, streptavidin–alkaline phosphatase, Dako K5005 was Green PCR Master Mix. PCR was started with 2 min at 50 C used as enzyme for 15 min. Chromogen red (red permanent), and an initial 10 min denaturing temperature of 95 C, fol- Dako K5005, was used for visualization before counterstaining lowed by 40 cycles of 15 s of denaturing and 1 min of with haematoxylin and mounting in Mowiol (Roche Mole- annealing and elongation at 60 C. The reaction products were cular Biochemicals, Mannheim, Germany). In three ﬁelds of separated by 2% agarose gel electrophoresis. Relative expres- view (0Æ0625 mm),2 the mean percentage of positively sion levels were calculated by the relative standard curve stained cells was independently evaluated by two investigators method as outlined in the manufacturer’s technical bulletin. who were blinded to the UV treatments.

The comparative D)DCt method was used as previously suggested by Livak and Schmittgen.22 A standard curve was gen- Statistics erated using the fluorescent data from 10-fold serial dilutions of total RNA of the highest expression sample. This was then Data analysis was performed using the statistical package used to calculate the relative amounts of target mRNA in test MedCalc Software (Mariakerke, Belgium). Normal distribution samples. Quantities of all targets in the test samples were nor- of data was confirmed by the D’Agostino–Pearson test. Data malized to the corresponding GAPDH mRNA transcript in were expressed as mean ± SD. The results were analysed using the skin samples. In order to make the quantities of mRNA one-way analysis of variance. The Student–Newman–Keuls test levels more illustrative, the DCt values (logarithms) were was utilized for all pairwise comparisons. The relationship re-transformed. between mRNA and protein levels was analysed using the Pearson correlation procedure. Differences were considered significant when P <0Æ05. Immunohistology

Paraffin-embedded sections of skin biopsies taken from six Results subjects (exposed to UVA1, UVB, and nonirradiated, respectively) were mounted on silanized slides and stored for 1 h in A detailed description and illustration of mean ± SD TGF-b/ a humid chamber at 60 C. Sections were deparaffinized in Smad mRNA levels are given in Table 2 and Figures 2–5, res- xylene and washed with 100%, 96% and 70% ethanol for pectively. Twenty-four hours after UVA1 exposure, mRNA 5 min each and rinsed with demineralized water. After wash- expression of TGF-b1 and Smad3/4/7 was significantly ing with Target Retrieval Solution, pH 9Æ0 (ethylenediamine downregulated as compared with nonirradiated skin sites tetraacetic acid), Dako S2367 for 20 min (Dako Cytomation, (P <0Æ05). Even though slightly recovered at 72 h, the mRNA

Table 2 Data (mean ± SD) of real-time reverse transcription–polymerase chain TGF-b1 Smad3 Smad4 Smad7 reaction for transforming growth factor (TGF)-b/Smad proteins investigated in Control 0Æ020 ± 0Æ003 0Æ450 ± 0Æ176 0Æ681 ± 0Æ339 0Æ021 ± 0Æ033 nonirradiated (controls) and ultraviolet UVA1 24 h 0Æ007 ± 0Æ002* 0Æ142 ± 0Æ057* 0Æ249 ± 0Æ123* 0Æ005 ± 0Æ003* (UV)-irradiated skin at 24 and 72 h after UVA1 72 h 0Æ012 ± 0Æ008* 0Æ210 ± 0Æ088* 0Æ401 ± 0Æ344* 0Æ010 ± 0Æ009* exposure UVB 24 h 0Æ022 ± 0Æ018 0Æ350 ± 0Æ069 0Æ607 ± 0Æ344 0Æ013 ± 0Æ007 UVB 72 h 0Æ021 ± 0Æ012 0Æ342 ± 0Æ100 0Æ694 ± 0Æ269 0Æ015 ± 0Æ004

*Signiﬁcantly different from controls (P <0Æ05).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp951–956 954 Downregulation of TGF-b signal transducers following UVA1, T. Gambichler et al.

Means (error bars: 1 SD) Means (error bars: 1 SD) 0·040 1·0 0·035 0·8 0·030

0·025 0·6 0·020 0·015 0·4 1 mRNA expression β 0·010 0·2 TGF- 0·005 Smad4 mRNA expression

0·000 0·0 24 A1 24 B 72 A1 72 B Controls 24 A1 24 B 72 A1 72 B Controls UVA1 (A1) and UVB (B) exposed sites at UVA1 (A1) and UVB (B) exposed sites at 24 h and 72 h (controls: non-irradiated sites) 24 h and 72 h (controls: non-irradiated sites)

Fig 2. A significant decrease of transforming growth factor (TGF)-b1 Fig 4. As compared with the controls, a significant decrease of Smad4 mRNA expression was found in ultraviolet (UV) A1-irradiated sites at mRNA expression was observed in ultraviolet (UV) A1-irradiated sites 24 and 72 h when compared with controls (P <0Æ05). UVB-exposed at 24 and 72 h (P <0Æ05). UVB-exposed skin sites did not differ skin sites did not differ significantly from nonirradiated sites significantly from nonirradiated sites (P >0Æ05). (P >0Æ05).

Means (error bars: 1 SD) Means (error bars: 1 SD) 0·7 0·035

0·6 0·030

0·5 0·025

0·4 0·020

0·3 0·015

0·2 0·010

Smad7 mRNA expression 0·005 Smad3 mRNA expression 0·1

0·0 0·000 24 A1 24 B 72 A1 72 B Controls 24 A1 24 B 72 A1 72 B Controls UVA1 (A1) and UVB (B) exposed sites at UVA1 (A1) and UVB (B) exposed sites at 24 h and 72 h (controls: non-irradiated sites) 24 h and 72 h (controls: non-irradiated sites)

Fig 3. As compared with the controls, a significant decrease of Smad3 Fig 5. As compared with the controls, a significant decrease of Smad7 mRNA expression was observed in ultraviolet (UV) A1-irradiated sites mRNA expression was observed in ultraviolet (UV) A1-irradiated sites at 24 and 72 h (P <0Æ05). UVB-exposed skin sites did not differ at 24 and 72 h (P <0Æ05). UVB-exposed skin sites did not differ significantly from nonirradiated sites (P >0Æ05). significantly from nonirradiated sites (P >0Æ05). levels of TGF-b1 and Smad3/4/7 were still significantly (P >0Æ05) differed from controls with regard to TGF-b/Smad decreased in UVA1-irradiated sites (P <0Æ05). mRNA expres- protein expression (data not shown). sion of TGF-b/Smad proteins observed in control sites did not differ significantly from UVB-irradiated sites, although a ten- Discussion dency for downregulation of Smad4/7 levels was observed (P >0Æ05). Detailed immunohistology data are given in TGF-b family members are multifunctional cytokines whose Table 3. TGF-b1 and Smad3/4/7 immunostaining was seen cellular effects are dependent on cell type and cellular context. throughout the epidermis, particularly in basal and suprabasal For example, TGF-b inhibits growth of epithelial cells and keratinocytes, and in dermal fibroblasts and endothelial cells. thus controls the differentiation of the epidermal layer. By Twenty-four hours after UVA1 exposure, immunohistology contrast, TGF-b stimulates proliferation of fibroblasts in the revealed significantly reduced TGF-b1 levels in fibroblasts connective tissue. Hence TGF-b/Smad signalling plays an (Fig. 6). However, there was no quantitative correlation important role in cellular differentiation and biosynthesis of between protein and mRNA expression (r ¼ 0Æ36; P >0Æ05). extracellular matrix. Impairment of TGF-b responsiveness Smad3/4/7 protein expression observed in nonirradiated skin occurs in a variety of cancer cells and contributes to loss of did not differ significantly from that in UVA1-irradiated sites growth control.4,23 Han et al.17 recently reported that sun- (P <0Æ05). Moreover, UVB-irradiated sites nonsignificantly exposed skin of the elderly, compared with matched sun-

Table 3 Quantitative data of immunohistology (mean ± SD). Percentage Antibody TGF-b1 Smad3 Smad4 Smad7 of positively stained cells for transforming growth factor (TGF)-b/Smad signal Control transducers in ultraviolet (UV) A1-exposed Keratinocytes 60Æ6±10Æ882Æ3±16Æ280Æ4±13Æ944Æ2±9Æ2 skin and control sites at 24 and 72 h Fibroblasts 82Æ1±16Æ987±13Æ378Æ4±9Æ983Æ1±10Æ8 following irradiation UVA1 24 h Keratinocytes 64Æ1±12Æ383Æ5±11Æ676Æ3±10Æ239Æ3±10Æ2 Fibroblasts 61Æ3±9Æ8* 81Æ8±13Æ175Æ4±18Æ177Æ4±14Æ5 UVA1 72 h Keratinocytes 56Æ9±10Æ280Æ1±12Æ979Æ4±13Æ941Æ2±8Æ1 Fibroblasts 78Æ1±13Æ789±15Æ578Æ3±12Æ776Æ6±14Æ8

*Signiﬁcantly different from controls (P <0Æ05).

(a) (b)

Fig 6. Immunohistology of nonirradiated skin (a) showing stronger staining for transforming growth factor-b1 in the dermis as compared with ultraviolet A1-irradiated skin at 24 h after exposure (b). protected elderly skin, showed lower expression of TGF-b alterations in the TGF-b/Smad pathway. In accordance with type II receptor (epidermis), increased Smad7 (epidermis and Quan et al.,15 Yin et al.24 also observed an increase of TGF-b1 dermis), and increased Smad3 (dermis). These results, except mRNA expression in vitro at 24 h following UVA1 irradiation. for Smad3, mostly fit a pattern of lower responsiveness to In the present study we aimed to investigate the acute effect TGF-b in chronically UV-exposed skin of the elderly. Accord- of UVA1 as well as UVB on the expression of the TGF-b/Smad ingly, Quan et al.14,16 have shown that UVB blocks in vitro cel- transducers in human skin in vivo. Unlike Quan et al.,14,15 we did lular responsiveness to TGF-b through two mechanisms that not find significantly altered expression profiles of TGF-b/Smad impair TGF-b receptor function: first, the downregulation of transducers in UVB-irradiated skin. However, at 24 and 72 h TGF-b type II receptor; second, the induction of Smad7. They after exposure to UVA1 we observed significantly reduced also performed an in vivo study on healthy subjects who were mRNA expression of TGF-b1 and Smad3/4/7. A significant exposed to two MED of UVB.15 They observed a significant downregulation of TGF-b1 was also found at the protein level. increase of mRNA expression for TGF-b1 (48–72 h postirradi- Nevertheless, reduction of Smad3/4/7 mRNA levels observed ation) and Smad7 (8 h postirradiation). However, expression in UVA1-irradiated sites was not accompanied by a significant of Smad7 was significantly downregulated at 24 h and 72 h decrease of these Smads on immunohistology. Thus there was postirradiation. Quan et al.15 did not detect any significant no quantitative correlation between Smad protein and Smad changes in Smad3/4 protein expression following irradiation. mRNA expression. Possibly, this discrepancy between Smad Nevertheless, they demonstrated that UVB irradiation reduced mRNA and protein expression could be due to a faster degrad- the DNA binding of Smad3/4 in human skin. Reduced forma- ation of mRNA by UVA1 than its corresponding protein.13 The tion of retarded DNA/Smads complex was observed within stability of the protein, in particular a nuclear protein, is also an 4 h following two MED UVB. Their findings were that irradi- issue. The protein may be translated at normal levels but degra- ation with a UVB source and solar-simulated UV elicit similar ded at an abnormal level. Recent studies using genomic and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp951–956 956 Downregulation of TGF-b signal transducers following UVA1, T. Gambichler et al. proteomic techniques indicate that there is a large discrepancy 8 Mauviel A. Transforming growth factor-beta: a key mediator of between mRNA and protein levels in cells. It is widely appreci- fibrosis. Methods Mol Med 2005; 117:69–80. ated that translation and post-translational events play critical 9 Soehnge H, Ouhtit A, Ananthaswamy ON. Mechanisms of induction of skin cancer by UV radiation. Front Biosci 1997; 2:d538–51. roles in control of gene expression.25 Compared with immuno- 10 Ehrhart JC, Gosselet FP, Culerrier RM, Sarasin A. UVB-induced histology, real-time RT-PCR is a much more sensitive technique mutations in human key gatekeeper genes governing signalling able to document the slightest evidence of gene expression. pathways and consequences for skin tumourigenesis. Photochem However, immunohistochemical analysis is important because Photobiol Sci 2003; 2:825–34. it shows whether the transcript is translated and is probably 11 Verrecchia F, Pessah M, Atfi A, Mauviel A. Tumor necrosis factor- functionally available. Hence, the UVA1-induced downregula- alpha inhibits transforming growth-beta/Smad signaling in human tion of Smad mRNA, which was observed in the present study, dermal fibroblasts via AP-1 activation. J Biol Chem 2000; 275: 30226–31. did not significantly affect the translation level of the protein, at 12 Fisher GJ, Wang ZQ, Datta SC et al. Pathophysiology of premature least not within the period investigated. aging induced by ultraviolet light. N Engl J Med 1997; 337:1419–28. TGF-b1 is an important fibrogenic cytokine that enhances 13 Heck DE, Gerecke DR, Vetrano AM, Laskin JD. Solar ultraviolet collagen production, inhibits metalloproteinases and stimulates radiation as a trigger of cell signal transduction. Toxicol Appl Pharmacol their inhibitors.8,12,26 Correspondingly, TGF-b1 was found to 2004; 195:288–97. be excessively released by activated fibroblasts in morphoea and 14 Quan T, He T, Voorhees JJ, Fisher GJ. Ultraviolet irradiation blocks systemic sclerosis. El-Mofty et al.27 recently observed a signifi- cellular responses to transforming growth factor-b by down-regulating its type-II receptor and inducing Smad7. J Biol Chem 2001; cant downregulation of TGF-b mRNA in patients with mor- 276:26349–56. phoea following a course of UVA therapy (total cumulative dose 15 Quan T, He T, Kang S et al. Ultraviolet irradiation alters transform- )2 of 400 J cm ). These observations give support to our results ing growth factor beta/Smad pathway in human skin in vivo. J Invest indicating that longer wavelengths in the UVA region are cap- Dermatol 2002; 119:499–506. able of downregulating TGF-b/Smad signalling, particularly in 16 Quan T, He T, Kang S et al. Solar ultraviolet irradiation reduces col- the dermal compartment. Unlike shorter wavelengths in the lagen in photoaged human skin by blocking transforming growth UVB region, UVA1 radiation can penetrate into the deep dermis factor-beta type II receptor/Smad signaling. Am J Pathol 2004; 165:741–51. and is therefore capable of influencing TGF-b/Smad protein 17 Han KH, Choi HR, Won CH et al. Alteration of the TGF-beta/SMAD expression in dermal fibroblasts. Our data support recent studies pathway in intrinsically and UV-induced skin aging. Mech Ageing Dev indicating that UVA1 phototherapy is superior to UVB-based 2005; 126:560–7. 28 therapy of fibrotic skin conditions such as morphoea. 18 Gasparro FP, Brown DB. Photobiology 102: UV sources and dosi- Taken together, in contrast to UVB, UVA1 significantly metry – the proper use and measurement of ‘photons as a reagent’. downregulates the expression of TGF-b/Smad proteins in J Invest Dermatol 2000; 114:613–15. human skin in vivo. The extent to which the acute effects of 19 Beattie PE, Dawe RS, Ferguson J, Ibbotson SH. Dose-response and time-course characteristics of UV-A1 erythema. Arch Dermatol 2005; TGF-b/Smad signalling reported in the present paper are related 141:1549–55. to the beneficial effect of UVA1-based phototherapy of fibrotic 20 Gambichler T, Moussa G, Tomi NS et al. Reference limits for ery- skin conditions and/or to the chronic effects of UV that result in thema effective ultraviolet doses. Photochem Photobiol 2006; 82:1097– photoaging and cancer remains to be established. 102. 21 Giulietti A, Overbergh L, Valckx D et al. An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. References Methods 2001; 25:386–401. 1 Li MO, Wan YY, Sanjabi S et al. Transforming growth 22 Livak KJ, Schmittgen TD. Analysis of relative gene expression data DDC factor-beta regulation of immune responses. Annu Rev Immunol 2006; using real-time quantitative PCR and the 2 T method. Methods 24:99–146. 2001; 25:402–8. 2 Moustakas A, Souchelnytsky S, Heldin CH. Smad regulation in 23 Miyazono K, Suzuki H, Imamura T. Regulation of TGF-beta signaling TGF-b signal transduction. J Cell Sci 2001; 114:4359–69. and its roles in progression of tumors. Cancer Sci 2003; 94:230–4. 3 Cui W, Fowlis DJ, Bryson S et al. TGFbeta1 inhibits the formation 24 Yin L, Morita A, Tsuji T. The crucial role of TGF-beta in the of benign skin tumors, but enhances progression to invasive spin- age-related alterations induced by ultraviolet A irradiation. J Invest dle carcinomas in transgenic mice. Cell 1996; 86:531–42. Dermatol 2003; 120:703–5. 4 Li AG, Lu SL, Han G et al. Current view of the role of transforming 25 Hahn S. Structure and mechanism of the RNA polymerase II growth factor beta 1 in skin carcinogenesis. J Invest Dermatol Symp Proc transcription machinery. Nat Struct Mol Biol 2004; 11:394–403. 2005; 10:110–17. 26 Brenneisen P, Sies H, Scharffetter-Kochanek K. Ultraviolet-B irradi- 5 Weeks BH, He W, Olson KL, Wang XJ. Inducible expression ation and matrix metalloproteinases: from induction via signaling of transforming growth factor beta1 in papillomas causes rapid to initial events. Ann NY Acad Sci 2002; 973:31–43. metastasis. Cancer Res 2001; 61:7435–43. 27 El-Mofty M, Mostafa W, Esmat S et al. Suggested mechanisms of 6 Qiao W, Li AG, Owens P et al. Hair follicle defects and squamous action of UVA phototherapy in morphea: a molecular study. Photo- cell carcinoma formation in Smad4 conditional knockout mouse dermatol Photoimmunol Photomed 2004; 20:93–100. skin. Oncogene 2006; 25:207–17. 28 Kreuter A, Hyun J, Stucker M et al. A randomized controlled study 7 Tannehill-Gregg SH, Kusewitt DF, Rosol TJ, Weinstein M. of low-dose UVA1, medium-dose UVA1, and narrowband UVB The roles of Smad2 and Smad3 in the development of chemically phototherapy in the treatment of localized scleroderma. J Am Acad induced skin tumors in mice. Vet Pathol 2004; 41:278–82. Dermatol 2006; 54:440–7.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp951–956 PHOTOBIOLOGY DOI 10.1111/j.1365-2133.2007.07812.x Protection from photodamage by topical application of caffeine after ultraviolet irradiation S-W. Koo, S. Hirakawa,* S. Fujii, M. Kawasumi and P. Nghiem Cutaneous Biology Research Center, Massachusetts General Hospital, Harvard Medical School, 149 13th St, Charlestown, MA 02129, U.S.A. *Current address: Department of Dermatology, Ehime University School of Medicine, Toon, Ehime 791-0295, Japan Current address: Department of Medicine, Division of Dermatology, University of Washington, 815 Mercer St, Seattle, WA 98109, U.S.A.

Summary

Correspondence Background Characterization of mechanisms that can reverse residual damage from P. Nghiem. prior skin exposure to ultraviolet (UV) would be of considerable biological and E-mail: [email protected] therapeutic interest. Topical caffeine application to mouse skin that had previously been treated with UV has been shown to inhibit the subsequent development Accepted for publication 14 November 2006 of squamous cell carcinomas. Objectives We used an established mouse photodamage model to investigate other Key words possible effects of topical caffeine application after UV. apoptosis, caffeine, hairless mouse, photodamage, Methods SKH-1 hairless mice were treated with ultraviolet B (UVB) followed photoprotection, ultraviolet immediately by topical application of caffeine or vehicle three times weekly for Conflicts of interest 11 weeks. None declared. Results Caffeine applied topically after UV treatment resulted in a significant decrease in UV-induced skin roughness/transverse rhytides as assessed by treatment-blinded examiners. Histologically, topical caffeine application after a single dose of UVB more than doubled the number of apoptotic keratinocytes as evaluated by sunburn cell formation, caspase 3 cleavage and terminal deoxynucleotidyl transferase- mediated dUTP-biotin nick-end labelling (TUNEL) staining. A trend towards decreased solar elastosis was noted in the caffeine-treated group although this was not statistically significant. Other histological parameters including epidermal hyperplasia, solar elastosis and angiogenesis were increased in mice treated with UV but topical application of caffeine did not alter these particular UV effects. Conclusions These findings support the concept that topical application of caffeine to mouse skin after UV irradiation promotes the deletion of DNA-damaged keratinocytes and may partially diminish photodamage as well as photocarcinogenesis.

Prolonged sun exposure of human skin during youth leads the number of stratum corneum layers and an increase in the later in life to photodamage including wrinkle formation, number of keratinocytes expressing fillagrin (a marker of solar elastosis and degradation of matrix macromolecules.1–5 terminal differentiation).16 In humans, chronic epidermal Prior sun exposure also leads to an increased risk for the de- UV-induced changes include atypical/hyperproliferative kera- velopment of epithelial skin cancers in part via direct mutation tinocytes and an increased risk of basal and squamous cell of DNA.6,7 Effective approaches to diminish residual ultraviolet carcinoma. (UV) damage in skin may decrease photoageing and subse- Caffeine has been shown to prevent ultraviolet B (UVB)- quent skin cancer development. induced skin cancer development in an ‘at risk’ mouse model.17 The chronically UV-exposed hairless mouse has provided an In this model hairless mice are treated twice weekly with UVB important animal model to study the causal association of for 20 weeks at which time they have no skin tumours, but they chronic UV exposure with epidermal and dermal pathophysi- will go on to develop them without any further UV treatment. ology.8,9 Histological changes of photoageing include damage After all UVB treatments were completed, mice were treated to collagen fibres, excessive deposition of abnormal elastic with either vehicle or topical caffeine. Treatment with topical fibres, increase of glycosaminoglycans and matrix metallo- caffeine significantly diminished nonmalignant and malignant proteinases (MMP).10–15 tumours by 44% and 72%, respectively. One proposed mechan- Epidermal changes have also been associated with chronic ism of topical caffeine inhibition on tumorigenesis invokes low-dose UV irradiation. In mice, these include an increase in increased apoptosis in the tumours.17 One possible mediator of

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 957 958 UV photoprotection by topical caffeine, S-W. Koo et al. this effect is ATR (ataxia–telangiectasia and Rad-3-related). ATR Chronic ultraviolet treatment belongs to a family of large protein kinases related in sequence to phosphatidylinositol kinase, which are involved in sensing A group of 21 animals were divided into control (vehicle; six various cellular stresses including UV DNA damage and halting animals) and three treatment (five each) groups. The four replication so the cell has time to repair its DNA.18,19 Caffeine experimental groups were treated as follows: group 1 ¼ vehi- can ‘override’ the replication checkpoint function of ATR caus- cle (acetone); group 2 ¼ caffeine; group 3 ¼ UV + vehicle ing cells to undergo premature chromatin condensation and (acetone); group 4 ¼ UV + caffeine. UVB was used at a start- ) subsequent apoptosis.20 ing dose of 45 mJ cm 2 and was increased according to a UV The effects of topical caffeine on skin are also of interest as protocol as shown in Figure 1a and based on Kligman et al.8 this agent is included in a number of skin care products mar- Immediately after UV irradiation 100 lL of either 1Æ2% caf- keted in combination with other agents as lipolytics.21–23 Little feine in acetone or acetone only were applied. The frequency or no data has been published on the effects of topical appli- of treatment was set at three times per week (33 total treat- cation of caffeine itself on human skin although products ments during 11 weeks). Skin specimens from the central dor- including soaps are marketed with caffeine added. sum of the mice were obtained 48 h after the last treatment. In this study, we examined the role of caffeine in protec- Care was taken to harvest the same area of back skin from tion from UVB-induced chronic photodamage and in apopto- each mouse. The skin samples were fixed in 10% buffered for- sis of keratinocytes shortly after UVB exposure. We found that malin or frozen in OCT compound (Sakura Finetek USA, topical application of caffeine after UVB diminished cumula- Torrance, CA, U.S.A.). tive photodamage as assessed visually by treatment-blinded observers and was associated with histological changes includ- Acute ultraviolet/apoptosis assay ing a marked increase in the fraction of DNA-damaged keratinocytes deleted after UVB. To assess the effect of topical caffeine on apoptosis following a single dose of UV, a group of 20 hairless mice were divi- Materials and methods ded into four experimental groups: vehicle (control); caffeine; UV + vehicle (acetone); UV + caffeine. Immediately ) after a single dose of UVB (45 mJ cm 2) 100 lL of either Animals 1Æ2% caffeine in acetone or acetone alone were applied. Six This study was approved by the animal care and use commit- hours after the treatment, the mice were sacrificed and the tee of the Massachusetts General Hospital. Female SKH-1 hair- back skin of each mouse was harvested for haematoxylin and less mice were purchased from Charles River Laboratories eosin, terminal deoxynucleotidyl transferase-mediated dUTP- (Wilmington, MA, U.S.A.). The animals were 12–16 weeks biotin nick-end labelling (TUNEL) and staining for caspase 3 old at the beginning of the experiment. Mice were given cleavage. After routine haematoxylin and eosin stains were water and Purina Laboratory Chow 5001 diet from Ralston- performed on 5-lm paraffin-embedded skin sections, apop- Purina (St Louis, MO, U.S.A.) ad libitum, and they were kept totic sunburn keratinocytes were counted at 200 · magnifi- on a 12-h light/12-h dark cycle. cation. Sunburn cells were identified in the epidermis as cells with a homogeneous densely staining glassy eosinophilic cytoplasm and a small hyperchromatic condensed pyknotic Materials nucleus that can readily be seen with routine histological Caffeine (Sigma, St Louis, MO, U.S.A.) was dissolved in acet- sections of the skin using light microscopy.24 These examina- one at 1Æ2% (wt/vol) by 5 min of warming to 50 C. Mono- tions were performed blindly with respect to treatment clonal rat antimouse CD31 antibody was purchased from group. Besides sunburn cell morphological identification, PharMingen (San Diego, CA, U.S.A.) and antirat IgG conju- apoptotic cells were also identified by TUNEL staining using gated with AlexaFluor 594 was obtained from Molecular the Fluorescein-FragEL DNA fragmentation kit (Oncogene, Probes (Eugene, OR, U.S.A.). Cambridge, MA, U.S.A.) according to the manufacturer’s instructions. Apoptosis was further correlated by immunohistochemical staining of paraffin-embedded sections using a Ultraviolet radiation source polyclonal rabbit antimouse cleaved caspase 3 antibody (Cell The UV lamps used (Southern New England Ultraviolet, Bran- Signaling, Danvers, MA, U.S.A.). ford, CT, U.S.A.) emitted UVB (280–320 nm; 75–80% of total energy) and UVA (320–375 nm; 20–25% of total Visual photodamage grading energy). There was little or no radiation below 280 nm or above 375 nm. The height of the lamps was adjusted to deli- Forty-eight hours after the final treatment in the chronic ) ver 0Æ35 mW cm 2 at the dorsal skin surface. The dose of assay, each hairless mouse was anaesthetized, and visual gra- UVB was quantified with a model IL-1700 research radio- ding of transverse rhytides/skin roughness of each animal meter/photometer (International Light, Newburyport, MA, was carried out independently by four observers who were U.S.A.) fitted with a UVB sensor. blinded as to the treatment. Grading scores for photodamage

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 UV photoprotection by topical caffeine, S-W. Koo et al. 959

(a) (b) No UVB UVB 200

150 Vehicle 2

100 UVB dose mJ/cm

Caffeine

0 0 2 4 6 8 10 12 Week (3 treatments/week)

1·5 2

1·5 1

1 (analog scale) (analog scale)

0·5

Photodamage/skin roughness 0·5 Photodamage/skin roughness

0 * * Vehicle Caffeine UVB + veh UVB + caff Vehicle Caffeine UVB + veh UVB + caff

Fig 1. (a) Experimental design for topical application of caffeine after ultraviolet (UV) treatment in a chronic photodamage assay. Each dot ‘Æ’ represents one UV treatment, followed immediately by application of topical 1Æ2% caffeine or vehicle (acetone). Forty-eight hours after the final UV treatment mice were examined and photographed, and tissues were harvested for analysis. (b) Photographs of mouse back skin 48 h after final UV treatment in an 11-week course. One representative photo per treatment group is shown. (c) Visual photodamage/skin roughness graded 48 h after final treatment. The two asterisks (control) indicate mice that were graded as zero for photodamage by all four evaluators. Grading was carried out blindly as to the treatment received. Grading scores for damage severity were on a 0–3 scale. Each column represents the average grades assigned to a single mouse by the four observers. Six mice were included in the vehicle group and there were five mice in each of the other three groups. ‘caff’ ¼ caffeine; ‘veh’ ¼ vehicle. The presence of photodamage was significantly decreased in UVB/caffeine-treated mice (n ¼ 5) compared with UVB/vehicle-treated mice (P <0Æ05) with no effect of topical caffeine alone. (d) Average photodamage grading for each experimental group. Each column represents the average grades of all mice in that group as evaluated by four observers. Error bar represents standard error. P ¼ 0Æ0039 for UV/vehicle relative to vehicle, P ¼ 0Æ0159 for UV/caffeine relative to UV/vehicle. Nonparametric exact tests were used with an adjustment for multiple comparisons. n ¼ six mice in control and five mice in other groups.

severity were based on a 0–3 scale with 0 for normal skin Histology and 3 for heavily photodamaged/rough skin. Observers could use 0Æ5 increments to record their grading of each For haematoxylin and eosin staining, skin samples were ﬁxed mouse. Nonparametric exact tests were used with an adjust- in 10% buffered formalin and embedded in parafﬁn. Then, ment for multiple comparisons by the Dana-Farber Skin 5-lm sections were stained with haematoxylin and eosin. Cancer SPORE Biostatistics Core Facility (Boston, MA, Representative photographs of stained skin sections (n ¼ 15 in U.S.A.). control and UV + vehicle and n ¼ 12 in caffeine and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 960 UV photoprotection by topical caffeine, S-W. Koo et al.

UV + caffeine groups) were taken in control and treatment obtained in order to evaluate the degree of UVB-induced skin groups and subsequently analysed in a treatment-blind changes (Fig. 1b). Skin roughness and transverse rhytides manner. (wrinkles) were graded in anaesthetized mice by four treatment-blinded observers. Figure 1c shows the photodamage grade of each individual mouse with data averaged over CD31 staining the four observers as described in Materials and methods. To analyse blood vessel formation in four experimental Figure 1d shows the photodamage average grade of the groups, immunofluorescence staining for endothelial cell mar- observers for all mice in each group. Photodamage was sig- ker CD31 was performed on 5-lm frozen sections, using a nificantly increased in UVB/vehicle-treated mice (n ¼ 5) com- monoclonal rat antimouse CD31 antibody (PharMingen). Anti- pared with nonirradiated control mice (n ¼ 6, P <0Æ01; rat IgG conjugated with AlexaFluor 594 (Molecular Probes) Fig. 1c,d). The presence of photodamage was significantly was used as a secondary antibody. Representative photographs decreased in UVB/caffeine-treated mice (n ¼ 5) compared were obtained from each experimental group and blood ves- with UVB/vehicle-treated mice (P <0Æ05) with no effect of sels were counted within 50-lm distance from the dermal– topical caffeine alone (Fig. 1c,d). epidermal junction. The number of blood vessels was compared between the four experimental groups. Skin histological changes induced by ultraviolet B irradiation and topical applications of caffeine Mouse epidermal thickness and solar elastosis Forty-eight hours after final UV and/or caffeine treatment Representative photographs of haematoxylin and eosin-stained mouse back skin was harvested for histological analysis fol- skin sections (n ¼ 15 in control and UV + vehicle and n ¼ lowing photography and visual grading. No significant histo- 12 in caffeine and UV + caffeine groups) were used. Each logical abnormalities were found in mice treated with vehicle picture was measured at three representative locations for epi- or caffeine alone (Fig. 2a). The morphology of abortive hair dermal thickness. Solar elastosis was defined as irregular pink follicles and epidermal cysts that are characteristic of SKH-1 thickened collagen just below the dermal–epidermal junction. hairless mice was evaluated histologically and did not vary For solar elastosis, the following grading scores were used: among experimental groups in terms of number or size. This 0 ¼ none, 1 ¼ mild, 2 ¼ moderate, 3 ¼ severe. Each picture suggests that alterations in these structures routinely found in was evaluated by four observers blinded as to the treatment hairless mouse skin do not explain the observed differences in received. Sample photographs of each grade of solar elastosis photoageing among treatment groups (Fig. 2a). Epidermal were provided to the observers for comparison and consist- hyperplasia was markedly increased and essentially identical ency of grading. between the UV/vehicle- and UV/caffeine-treated groups compared with nonirradiated controls (Fig. 2a,b). Distinct histological changes of solar elastosis (see Materials Elastin content and methods) were observed in the UV/vehicle- and UV/ Desmosine is a cross-link amino acid that is unique in the skin caffeine-treated mice relative to nonirradiated controls to elastin. The quantity of desmosine can be used as an indica- (Fig. 2c). There was a trend to less solar elastosis in UV/caf- tor of elastin in a tissue. To evaluate whether caffeine treat- feine-treated mice than in UV/vehicle-treated mice compared ment and UV-induced photodamage was related to changes in but the difference was not statistically significant (Fig. 2c). dermal elastin, desmosine quantitation was kindly carried out The total amount of dermal elastin as assessed by desmosine by Dr Barry Starcher (UT Health Center, Tyler, TX, U.S.A.).25 quantitation did not show a significant change between the UV/vehicle and UV/caffeine groups. Values for the four treatment groups (expressed as pmol desmosine/lg skin ± SEM) Stratum corneum layers were: control ¼ 101 ± 4; caffeine ¼ 137 ± 9; UV/vehicle ¼ To quantify the number of stratum corneum layers in skin 123 ± 8; and UV/caffeine ¼ 130 ± 9. samples, frozen 5-lm sections were stained with a 1% aque- The number of stratum corneum layers was counted in each ous solution of safranin (Sigma) and observed under a micro- group under light microscopy after safranin/potassium scope within 30 min after application of 2% potassium hydroxide staining of frozen sections. Forty sections were hydroxide solution and a cover slip. counted for each treatment condition. Neither UV treatment (average 5Æ2 stratum corneum layers) nor caffeine treatment Results (5Æ6 layers) significantly affected the number of stratum corneum layers in mouse skin (control 5Æ2 layers). An increase to 6Æ8 layers in the UV/caffeine-treated mouse group, while stat- Visible skin changes induced by ultraviolet B irradiation istically significant, was not viewed as likely to explain the and topical applications of caffeine observed photodamage differences. Forty-eight hours after the final UV treatment in an 11-week To investigate the effects of caffeine on UVB-induced angio- course (Fig. 1a) photographs of mouse back skin were genesis, we performed CD31 immunofluorescence staining on

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 UV photoprotection by topical caffeine, S-W. Koo et al. 961

(a) (b) 35

Thickness (mm) 10

0 Vehicle Caffeine UVB + veh UVB + caff

Vehicle UVB + vehicle (c) 3

2·5

1·5

Solar elastosis grade 0·5

0 Vehicle Caffeine UVB + veh UVB + caff

Caffeine UVB + caffeine

(d)

Vehicle UVB + vehicle

Caffeine UVB + caffeine

Fig 2. (a) Representative haematoxylin and eosin-stained sections of mouse back skin from each treatment group at the conclusion of the chronic ultraviolet (UV) experiment. (b) Mouse epidermal thickness. Each column indicates average thickness from the basal layer to the stratum corneum in the indicated treatment group. Twelve to 15 sections were evaluated for each treatment group. Error bar indicates standard deviation. ‘caff’ ¼ caffeine; ‘veh’ ¼ vehicle. (c) Solar elastosis. Each column indicates average grade of solar elastosis in each treatment group as described in Materials and methods. Twelve to 15 sections were evaluated for each treatment group. Error bar indicates standard deviation. (d) CD31 immunostaining for UV-induced angiogenesis.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 962 UV photoprotection by topical caffeine, S-W. Koo et al. frozen skin samples as described.26 A marked increase in the Although topical caffeine had a significant protective effect number of blood vessels within 50 lm of the epidermal– on visible UVB-induced skin changes and certain histological dermal junction was noted in UV/vehicle and UV/caffeine parameters, other histological studies were not markedly treated mice relative to nonirradiated controls (Fig. 2d). altered by topical caffeine. The precise histological alterations However, UV/caffeine-treated mice demonstrated no signi- of photodamage in this model are not definitively known and ficant difference compared with UV/vehicle-treated mice we may not have assessed additional parameters that play a (Fig. 2d). role in the observed findings. However, we did observe that a significant histological finding—the extent of apoptosis observed after UVB—was mark- Effect of topical caffeine on the acute apoptotic response edly augmented by caffeine applied topically. Following a to ultraviolet B ) single dose of UVB 45 mJ cm 2, topical caffeine application In a short-term experiment (Fig. 3a) topical caffeine was after UVB more than doubled the number of apoptotic kera- applied to mouse back skin immediately after a single dose of tinocytes at 6 h. This effect was robust as evaluated by three ) UVB 45 mJ cm 2. Skin was harvested 6 h later as pilot experi- distinct measures of apoptosis: sunburn cell formation, caspase ments revealed that this was the peak timepoint for UV- 3 cleavage and TUNEL staining. The stimulatory effect of top- induced keratinocyte apoptosis under these conditions (data ical caffeine on UVB-induced apoptosis in mouse skin suggests not shown). Haematoxylin and eosin staining of back skin in that DNA-damaged skin keratinocytes can be selectively killed vehicle-treated and caffeine-treated mice showed no apoptotic by topical application of caffeine. An intriguing possibility is keratinocytes (Fig. 3b). In contrast, apoptotic keratinocytes that deletion of this subset of damaged keratinocytes prevents were observed in UV-treated mice and the addition of caffeine the retention in the skin’s cellular ‘memory’ of UV damage markedly increased the number of apoptotic/sunburn cells. that later would cause both photodamage and skin cancer These cells were further characterized as apoptotic cells by development. TUNEL staining (Fig. 3c) and caspase 3 cleavage (data not One intriguing possible target of caffeine in skin after UV shown). As shown in Figure 3d there were 1Æ5 apoptotic kera- treatment is ATR, a protein kinase involved in sensing various tinocytes per mm of UV/vehicle-treated skin compared with stresses including UV DNA damage.18,19 Caffeine is an inhibi- nearly four apoptotic keratinocytes per mm of UV/caffeine- tor of ATR and can ‘override’ the replication checkpoint func- treated skin (P ¼ 0Æ0095). tion of ATR causing cells to undergo premature chromatin condensation and subsequent apoptosis.20 Prior studies in our Discussion lab with cultured human osteosarcoma cells indicated that caffeine-induced inhibition of ATR caused premature chromatin An important unmet need in dermatology is to understand and condensation and cell death after UVB.20 Previously, we also develop ways to ameliorate residual UV skin damage that later observed that cancer cells with p53 functional deficiency are leads to photoageing and skin cancer development. Because selectively killed by ATR inhibition.20,28 As caffeine is a rela- topical caffeine applied after UVB can prevent the development tively weak inhibitor of ATR (high micromolar or low milli- of squamous cell carcinoma,17 we used the hairless mouse molar concentrations are required to inhibit ATR activity model to test whether topical caffeine applied following UVB in vitro) it has not been an option to treat cancer patients sys- exposure could prevent chronic UV damage in mouse skin. temically with caffeine due to cardiac arrhythmias and seizures Consistent with its previously described effect on preventing that are induced at concentrations below those required to UVB-induced skin cancer, topical caffeine significantly inhibited inhibit ATR. However, in the skin, caffeine applied topically prior UVB exposure from inducing photodamage in this model. can likely reach relatively high concentrations leading to bio- This effect was robust as judged by several examiners blinded logical effects, possibly through ATR inhibition. as to the treatment. We examined a number of histological Indeed, topical caffeine can selectively delete p53-mutant parameters that may relate to the decreased photodamage and colonies of keratinocytes in intact skin. Lu et al.24 reported that found a trend toward decreased solar elastosis in caffeine-trea- topical applications of caffeine immediately after UVB irradi- ted mice as well as a profound augmentation of keratinocyte ation in p53(+/+) or p53()/)) mice enhanced the UVB- apoptosis when caffeine was applied topically after UV. induced increase in apoptotic sunburn cells by 127% and A trivial explanation that we considered for this photo- 563%, respectively, as would be expected of an agent that protective effect was that caffeine, a known absorber in the may inhibit photodamage by selectively deleting DNA- UV spectrum,27 had acted as a sunscreen. This is plausible damaged cells. In vitro data suggest that the mechanism may because UVB/caffeine treatments were separated by as little as involve inhibiting the ATR–Chk1 pathway but definitive data 48 h in our protocol and residual caffeine may have remained are not yet available. in the skin until the next UVB treatment. However, this possi- The effects of topical caffeine on skin are also of interest as bility was effectively ruled out by the fact that UV-mediated this agent is included in a number of skin care products mar- induction of epidermal hyperplasia (Fig. 2a) as well as angio- keted as lipolytics.21–23 Bertin et al.21 conducted a double- genesis (Fig. 2d) were identical in UV/vehicle- and UV/caffeine- blind, randomized, placebo-controlled study with female treated mice. volunteers in order to test an anticellulite product containing

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 UV photoprotection by topical caffeine, S-W. Koo et al. 963

(a) (d) 5 0·0095 0·0095 * UVB 4 (45 mJ cm–2) 6 h 3 0·0095 Acetone (100 µL) ± Harvest for 2 * caffeine1·2% - H–E - TUNEL 1 - Caspase 3 # Apoptotic cells/mm 0 Vehicle Caffeine UVB + veh UVB + caff (b)

Vehicle

Caffeine

UVB + vehicle

UVB + caffeine

(c)

Fig 3. (a) Schematic of experiment to assess effect of topical caffeine on apoptosis ) Vehicle following a single dose of 45 mJ cm 2 ultraviolet (UV) (one minimal erythema dose ) in SKH-1 mice is 80 mJ cm 2). This design is identical to the initial phase of the chronic UV experiment (H–E, haematoxylin and eosin). (b) Apoptotic keratinocytes ‘sunburn Caffeine cells’ are indicated by white arrows in these haematoxylin and eosin-stained sections. (c) Terminal deoxynucleotidyl transferase- mediated dUTP-biotin nick-end labelling (TUNEL) staining for apoptotic keratinocytes in the basal layer, as induced by UV and UVB + vehicle augmented by subsequent topical caffeine application. (d) Quantitation of apoptotic sunburn cells. Sunburn cells were counted on haematoxylin and eosin sections from five mice from each treatment group. Asterisk indicates statistically significant difference UVB + caffeine between treatment groups. P ¼ 0Æ0095 via two-sided nonparametric Wilcoxon rank sum test. retinol, caffeine and ruscogenine. Using this combination of feine was the most common additive of cellulite creams, active components, they observed a significantly greater lipo- apparently representing an ‘active’ ingredient; however, little lytic effect than with placebo. Sainio et al.22 reported that caf- or no data has been published on the effects of topical appli-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 964 UV photoprotection by topical caffeine, S-W. Koo et al. cation of caffeine itself on skin. Increasingly, products includ- Hicks–Matthaei stains, methylation, and saponification. J Invest ing soaps (‘Shower Shock’) are marketed with caffeine added Dermatol 1961; 37:447–53. in the absence of data describing the effects of topical 11 Smith JG Jr, Davidson EA, Sams WM Jr et al. Alterations in human dermal connective tissue with age and chronic sun damage. J Invest caffeine. Dermatol 1962; 39:347–50. Because of the accepted safety profile of caffeine both topic- 12 Kligman AM. Early destructive effect of sunlight on human skin. ally and systemically, it is also possible to contemplate the JAMA 1969; 210:2377–80. addition of caffeine to sunscreen products. This would have 13 Uitto J, Fazio MJ, Olsen DR. Molecular mechanisms of cutaneous several potential benefits relating to caffeine’s ability to absorb aging. Age-associated connective tissue alterations in the dermis. as an additional sunscreen in the UV range and to its potential J Am Acad Dermatol 1989; 21:614–22. preventive effects on photodamage and photocarcinogenesis as 14 Ibbotson SH, Moran MN, Nash JF et al. The effects of radicals compared with UVB as initiating species for the induction of chronic described in mouse models. Based on these mouse models, cutaneous photodamage. J Invest Dermatol 1999; 112:933–8. detailed characterization of the effects of topical caffeine on 15 Fisher GJ, Datta SC, Talwar HS et al. Molecular basis of sun-induced human skin after UVB irradiation are thus indicated. premature skin ageing and retinoid antagonism. Nature 1996; 379:335–9. 16 Kambayashi H, Yamashita M, Odake Y et al. Epidermal changes Acknowledgments caused by chronic low-dose UV irradiation induce wrinkle forma- The authors thank Lynh Nguyen for expert technical assistance tion in hairless mouse. J Dermatol Sci 2001; 27(Suppl. 1):S19–25. 17 Lu YP, Lou YR, Xie JG et al. Topical applications of caffeine or ())- and Tim Heffernan, Xiaohui Bi, Pablo Penas, Irene Kochevar epigallocatechin gallate (EGCG) inhibit carcinogenesis and selec- and Janice Brissette for helpful comments/suggestions. We tively increase apoptosis in UVB-induced skin tumors in mice. thank Barry Starcher for desmosine/elastin quantitation stud- Proc Natl Acad Sci U S A 2002; 99:12455–60. ies. We also thank the Shiseido Corporation for support to the 18 Zhou BB, Elledge SJ. The DNA damage response: putting check- Cutaneous Biology Research Center. points in perspective. Nature 2000; 408:433–9. 19 Keith CT, Schreiber SL. PIK-related kinases: DNA repair, recombination, and cell cycle checkpoints. Science 1995; 270:50–1. References 20 Nghiem P, Park PK, Kim Y et al. ATR inhibition selectively sensitizes G1 checkpoint-deficient cells to lethal premature chromatin 1 Kligman AM. The treatment of photoaged human skin by topical condensation. Proc Natl Acad Sci U S A 2001; 98:9092–7. tretinoin. Drugs 1989; 38:1–8. 21 Bertin C, Zunino H, Pittet JC et al. A double-blind evaluation of the 2 Leyden JJ, Grove GL, Grove MJ et al. Treatment of photodamaged activity of an anti-cellulite product containing retinol, caffeine, and facial skin with topical tretinoin. J Am Acad Dermatol 1989; 21:638– ruscogenine by a combination of several non-invasive methods. 44. J Cosmet Sci 2001; 52:199–210. 3 Gilchrest BA. A review of skin ageing and its medical therapy. Br J 22 Sainio EL, Rantanen T, Kanerva L. Ingredients and safety of cellulite Dermatol 1996; 135:867–75. creams. Eur J Dermatol 2000; 10:596–603. 4 Hadshiew IM, Eller MS, Gilchrest BA. Skin aging and photoaging: 23 Tholon L, Neliat G, Chesne C et al. An in vitro, ex vivo, and in vivo the role of DNA damage and repair. Am J Contact Dermat 2000; demonstration of the lipolytic effect of slimming liposomes: an 11:19–25. unexpected alpha(2)-adrenergic antagonism. J Cosmet Sci 2002; 5 Brennan M, Bhatti H, Nerusu KC et al. Matrix metalloproteinase-1 53:209–18. is the major collagenolytic enzyme responsible for collagen dam- 24 Lu YP, Lou YR, Peng QY et al. Stimulatory effect of topical applica- age in UV-irradiated human skin. Photochem Photobiol 2003; 78:43– tion of caffeine on UVB-induced apoptosis in the epidermis of p53 8. and Bax knockout mice. Cancer Res 2004; 64:5020–7. 6 Kripke ML. Ultraviolet radiation and immunology: something new 25 Starcher B, Conrad M. A role for neutrophil elastase in the progres- under the sun—presidential address. Cancer Res 1994; 54:6102–5. sion of solar elastosis. Connect Tissue Res 1995; 31:133–40. 7 Nishigori C. Cellular aspects of photocarcinogenesis. Photochem Photo- 26 Yano K, Oura H, Detmar M. Targeted overexpression of the angio- biol Sci 2006; 5:208–14. genesis inhibitor thrombospondin-1 in the epidermis of transgenic 8 Kligman LH, Akin FJ, Kligman AM. Prevention of ultraviolet dam- mice prevents ultraviolet-B-induced angiogenesis and cutaneous age to the dermis of hairless mice by sunscreens. J Invest Dermatol photo-damage. J Invest Dermatol 2002; 118:800–5. 1982; 78:181–9. 27 Kumbaraci NM, Nastuk WL. Action of caffeine in excitation– 9 Bissett DL, Hannon DP, Orr TV. An animal model of solar-aged contraction coupling of frog skeletal muscle fibres. J Physiol 1982; skin: histological, physical, and visible changes in UV-irradiated 325:195–211. hairless mouse skin. Photochem Photobiol 1987; 46:367–78. 28 Nghiem P, Park PK, Kim YS et al. ATR is not required for p53 acti- 10 Sams WM Jr, Smith JG Jr. The histochemistry of chronically sun- vation but synergizes with p53 in the replication checkpoint. J Biol damaged skin. An investigation of mucopolysaccharides and baso- Chem 2002; 277:4428–34. philia in actinically damaged skin using alcian blue, Mowry’s, and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp957–964 THERAPEUTICS DOI 10.1111/j.1365-2133.2006.07745.x Oral liarozole vs. acitretin in the treatment of ichthyosis: a phase II/III multicentre, double-blind, randomized, active-controlled study C.J. Verfaille,* F.P. Vanhoutte, C. Blanchet-Bardon,§ M.A. van Steensel– and P.M. Steijlen–** *Departments of Dermatology and Molecular Cell Biology, GROW, Maastricht University, Maastricht, the Netherlands Barrier Therapeutics NV, Cipalstraat 3, 2440 Geel, Belgium Department of Clinical Research and Development, Janssen Research Foundation, Beerse, Belgium §Department of Dermatology, Hoˆpital St Louis, Paris, France –Department of Dermatology, University Hospital Maastricht, Maastricht, the Netherlands **Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands

Summary

Correspondence Background Liarozole, a retinoic acid metabolism blocking agent, has been granted C. Verfaille. orphan drug status for congenital ichthyosis by the European Commission and E-mail: [email protected] the U.S. Food and Drug Administration. Objectives The purpose of this trial was to investigate the efficacy, tolerability and Accepted for publication 10 October 2006 safety of oral liarozole vs. acitretin in patients with ichthyosis. Methods In this double-blind comparative trial of liarozole vs. acitretin, 32 patients Key words with ichthyosis were randomized to be treated with either oral liarozole 75 mg acitretin, ichthyosis, liarozole, randomized in the morning and 75 mg in the evening or with acitretin 10 mg in the morn- controlled trial, retinoic acid, retinoic acid ing and 25 mg in the evening for 12 weeks. Clinical efficacy, tolerability and metabolism blocking agents safety were monitored. Conflicts of interest Results Between-group comparisons for efficacy and tolerability revealed no statis- C.J.V. is a full time employee of Barrier tically significant differences except for scaling on the trunk at baseline which Therapeutics NV. M.A.v.S. has received a grant was significantly worse in the liarozole group (P ¼ 0.024) and showed a more for basic research and a fee for consultancy. pronounced improvement in this group than in the acitretin-treated patients P.M.S. has received a consultancy fee for (P ¼ 0.047). Based on the overall evaluation of the response to treatment at end- participating in this study. He has received a fee for speaking and funding for research. point, 10 of 15 patients in the liarozole group and 13 of 16 patients in the acitretin group were considered by the investigator to be at least markedly improved. The expected retinoic acid-related adverse events were mostly mild to moderate and tended to occur less frequently in the liarozole group. No serious adverse events related to the drugs occurred. Conclusions The present study indicates that liarozole at a daily dose of 150 mg is equally effective as a treatment for ichthyosis as acitretin but shows a trend towards a more favourable tolerability profile. The results of this trial warrant further clinical trials to confirm efficacy and safety of liarozole as an orphan drug in ichthyosis.

Ichthyosis is a general term used to describe a large and het- exhibiting severe scaling not sufficiently improving with mois- erogeneous group of cornification disorders that are genetic in turizing or keratolytic creams. The quality of life of these nature and are characterized clinically by the formation of vis- patients may be severely affected.2 The treatment of these ible scales all over the body surface and an excessively dry debilitating diseases is by definition life-long, but the options skin.1 Most types of ichthyosis, except for autosomal domin- for treatment are limited. ant ichthyosis vulgaris (ADIV, prevalence: 1/250), are rare As disorders of keratinization, several forms of ichthyosis diseases, e.g. X-linked recessive ichthyosis (XRI, 1/6000 can be treated with all-trans-retinoic acid (all-trans-RA), males), lamellar ichthyosis (LI, 1/200 000) and bullous a physiological derivative of vitamin A and one of the congenital ichthyosiform erythroderma (CBIE, 1/300 000), principal endogenous compounds that controls growth and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp965–973 965 966 Liarozole vs. acitretin in ichthyosis, C.J. Verfaille et al. differentiation of epithelial tissue.3 However, the pharmaco- of ichthyosis: XRI, LI or CBIE. At least one of the severity logical activity of all-trans-RA is restricted by its rapid rate of parameters according to the investigator’s assessment at base- metabolism via cytochrome P-450 (CYP) enzymes and the use line had to have a score of at least 2 on a four-point scale of systemic retinoids is limited by side-effects and long-lasting (0, absent; 1, mild; 2, moderate; 3, severe). In addition, teratogenicity.4,5 Alternatives are urgently needed. women had to be at least 2 years postmenopausal or to have Liarozole is an imidazole derivative developed in the late had a hysterectomy. Patients had to be, except for their ich- 1980s by the Janssen Research Foundation in Belgium. It thyosis, in good health according to their history and physical inhibits the CYP-dependent 4-hydroxylation of all-trans-RA and examination. Main exclusion criteria were concurrent inflam- represents a new class of drugs called retinoic acid metabolism matory skin disease, topical or ultraviolet treatment within blocking agents (RAMBAs). Liarozole has been granted orphan 2 weeks and systemic treatment within 4 weeks prior to the drug status for congenital ichthyosis by the European Com- start of the treatment phase, use of vitamin A supplements mission and the U.S. Food and Drug Administration. Liarozole (> 1000 lg daily) and clinically relevant abnormal laboratory was identified through extensive in vitro6–8 and in vivo9–11 test- test values. Patients were enrolled at two study centres: the ing as an inhibitor of several mammalian CYP isoenzymes Department of Dermatology of the University Medical Centre including the one involved in the oxidative catabolism of Nijmegen (the Netherlands) and the Department of Dermatol- all-trans-RA. By inhibiting the intracellular breakdown of ogy, Hoˆpital St Louis in Paris (France). The trial protocol was endogenous all-trans-RA, its levels in plasma and predominantly reviewed and approved by each study centre’s independent in the skin increase to slightly above normal. Unlike synthetic ethics committee and all patients provided written informed retinoids, which add massive amounts of exogenous retinoid- consent prior to enrolment. All clinical investigations were like substances to the body, liarozole uses the body’s own pro- conducted according to the Declaration of Helsinki principles. duction of retinoic acid to achieve therapeutic effects. Besides inhibiting the 4-hydroxylation of all-trans-RA, liarozole also Treatment inhibits CYP-dependent steps in the biosynthetic pathways of testicular, ovarian and adrenal steroids,12 mainly the conver- The trial was a phase II/III, multicentre, double-blind, ran- sion of androgens to oestrogens (aromatase), progestin to domized comparative study to investigate the efficacy, toler- androgens (17-hydroxylase; 17,20-lyase) and of 11-deoxycor- ability and safety of oral liarozole 150 mg daily vs. the ticosterone to corticosterone (11-hydroxylase). However, the standard treatment of acitretin 35 mg daily in patients with effect on testicular and adrenal steroid biosynthesis may not be ichthyosis. Duration of the treatment was 12 weeks. Minimum clinically relevant, as upon chronic administration of oral wash-out periods prior to starting medication were 1 month liarozole in human volunteers, recovery of plasma testosterone for systemic agents and 2 weeks for topical treatment or and cortisol levels was achieved by pituitary compensation phototherapy. During the wash-out period, patients were (unpublished data). In accordance, patients with psoriasis allowed to use only bland emollients given by the investigator. receiving oral liarozole treatment for 3 months did not Both liarozole and acitretin were supplied as capsules identi- develop abnormalities in cortisol and testosterone levels.13 cal in appearance, taste and smell and packaged in morning and Based on its mechanism of action and its pharmacokinetic evening boxes. Patients were instructed to take one capsule profile, liarozole may offer an effective treatment in keratiniza- orally in the morning with food (liarozole 75 mg, acitretin tion disorders such as ichthyosis, with a possibly more favour- 10 mg) and one capsule in the evening with a meal (liarozole able tolerability profile compared with the current treatments. 75 mg, acitretin 25 mg) with 12 h between the two intakes. At Liarozole has been extensively tested in prostate cancer and the end of week 4 or week 8 of the treatment phase, the daily psoriasis.13–15 As far as ichthyosis is concerned, oral treatment dosage could be increased as a function of tolerance and efficacy with liarozole has been evaluated in an open exploratory trial to liarozole 225 mg or acitretin 45 mg. If the patient did not where it was shown to cause substantial clinical improvement in tolerate the increased dosage, it could be lowered again. all patients at a daily dose of up to 300 mg.16 Side-effects were limited to mucocutaneous symptoms. Topical liarozole, as a 5% Randomization and blinding procedures cream, has also been proven to be very effective in ichthyosis.17 The current article describes the results of a double-blind, Patients admitted to the trial were randomly allocated to one multicentre, comparative trial to assess the efficacy and safety of the two treatment groups according to a randomization of oral liarozole vs. the standard treatment of acitretin in code generated by the Janssen Research Foundation. Balancing patients diagnosed with different types of ichthyosis. ensured that equal numbers of subjects were entered in each treatment group as required. In each centre, subject numbers Patients and methods were assigned consecutively, starting with the lowest number available. The investigator was provided with a sealed envelope for each subject, containing coded details of the treatment Patients in the double-blind phase. This code was to be broken only To participate in this trial, men and women aged 16 years or in case of emergency where the further treatment of the more had to be diagnosed with one of the following subtypes subject was dependent on the trial medication he or she had

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp965–973 Liarozole vs. acitretin in ichthyosis, C.J. Verfaille et al. 967 been receiving. If the code was broken the subject had to be to-treat population, which includes all randomized patients, withdrawn from the trial and followed up if appropriate. All who used at least one trial medication, and had postbaseline sealed envelopes were collected at the end of the trial. efficacy data. Analysis of efficacy was based on the intent-to-treat population. The primary efficacy variable was ‘overall response to Clinical evaluations treatment at endpoint’, defined as ‘both the investigator’s and At the pretrial visit, the investigator assessed whether the patient’s overall evaluation of response to treatment as at least patient met the inclusion criteria, a complete and current markedly improved’. Endpoint is defined as the last available medical history was recorded and a physical examination observation of each patient. The number of responders for the including vital signs and body weight was carried out. Fasting primary efficacy variable was compared between the treatment blood samples were taken for haematology and blood bio- groups using a two-sided Fisher exact probability test. In add- chemistry. A urine sample was collected for urinalysis. ition, 95% confidence intervals were constructed around the difference in response rate between the two treatment groups. Clinical efficacy measures. Clinical evaluation of the skin took place Possible investigator effects were examined by summarizing at weeks 0 (baseline), 4, 8 and 12 of the treatment phase. As the response rates within each centre by descriptive statistics no standardized efficacy-scoring methods are available for ich- and confidence intervals. For each visit, descriptive statistics thyosis, we had to develop our own methods. Clinical efficacy were calculated for the additional efficacy variables. was evaluated in terms of an overall evaluation of response to Absolute values of the investigator’s and patient’s evaluation treatment (compared with baseline) rated by both the investi- of response-to-treatment and of the individual severity symp- gator and the patient using a five-point scale: 0, deteriorated; tom scores were analysed for differences between treatment 1, unchanged; 2, moderately improved; 3, markedly groups at each time point by means of the Cochran–Mantel– improved; 4, cleared. Other variables over the course of the Haenszel row mean-scores test. Severity of skin lesions and its study were severity of skin lesions assessed as individual changes from baseline were evaluated for within-group symptoms (scales, erythema and bullae) scored for each loca- differences using the Wilcoxon signed-rank test and for tion (trunk, upper limbs and lower limbs) on a four-point between-group differences using the Wilcoxon–Mann–Whit- scale: 0, absent; 1, mild; 2, moderate; 3, severe. For each ney rank-sum test. symptom, the sums of the scores over the different body sites Tolerability was assessed in the intent-to-treat population were calculated and referred to as overall score for the specific both as individual symptoms and their sum as composite score symptom. In addition, for each location the sum was made for total tolerability. Absolute values of the individual tolerabil- for all symptoms and referred to as total symptom score for ity symptoms were analysed for differences between treat- the specific location. An overall symptom score was calculated ment groups at each time point by means of the Cochran– by summation over all symptoms and locations. Furthermore, Mantel–Haenszel row mean-scores test. Changes from baseline photographs were taken under standardized conditions at of the individual tolerability symptoms and total tolerability baseline and, if possible, at all other visits. score were evaluated for within-group differences using the Wilcoxon signed-rank test and for between-group differences Tolerability and safety measures. The tolerance to treatment was using the Wilcoxon–Mann–Whitney rank-sum test. assessed by the subject by rating subjective symptoms of itch- Analysis of safety was based on the all-patient population. ing, redness, dry skin, dry lips and conjunctivitis on a four- Type and incidence of all adverse events were tabulated per point scale: 0, absent; 1, mild; 2, moderate; 3, severe. Blood treatment group and phase. For the clinical laboratory data, and urine samples were collected for haematology, biochemis- descriptive statistics and pre- vs. post-treatment cross tabula- try and urinalysis. Throughout the trial the patients were tions (with classes for below, within and above normal monitored for adverse events that were rated according to ranges) were generated for all tests done. Important abnormal- their severity (mild, moderate or severe) and relationship to ities, as determined by the occurrence of pathological values, the study medication (not, possibly or definitely related). were tabulated per treatment group and phase.

Statistical analysis Results

Sample size was determined empirically. As only a small num- Patients ber of patients with ichthyosis is available, a recruitment of 40 patients was considered realistic in the available time per- Overall, 41 patients with ichthyosis were screened and 32 ran- iod. Results of hypothesis testing are reported as two-sided domized (all male, 30 of 32 white skinned), 15 to liarozole P-values. Two-sided P-values £ 0Æ05 were considered to indi- and 17 to acitretin. Baseline demographics were comparable cate statistical signiﬁcance. between the two treatment groups and are summarized in In the analysis of the trial, two patient populations were Table 1. deﬁned: (i) the all-patient population which includes patients In the liarozole group, six patients had their daily dose who received at least one dose of drug and (ii) the intent- increased up to 225 mg. One patient (CBIE) had to decrease

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp965–973 968 Liarozole vs. acitretin in ichthyosis, C.J. Verfaille et al.

Table 1 Patient demographics at baseline At baseline, there was no significant between-group difference for any of the individual symptom scores (scaling, ery- Liarozole Acitretin thema, bullae) on any of the body parts (trunk, upper and Variable (n ¼ 15) (n ¼ 17) lower limbs) apart from the scaling on the trunk. The severity Ichthyosis subtypes of scaling on the trunk at baseline was rated as severe in 10 of XRI 11 10 15 patients of the liarozole group and in only four of 16 LI 3 5 patients of the acitretin group (P ¼ 0Æ024). There was also a CBIE 1 2 significant between-group difference for the total symptom Age (years), median (range) 41 (17–74) 34 (16–52) score on the trunk (P ¼ 0Æ031) at baseline, with the liarozole Height (cm), median (range) 179 (165–197) 176 (161–193) Weight (kg), median (range) 69 (59–91) 68 (52–112) patients having more severe symptoms than the acitretin ) Heart rate (beats min 1), 68 (52–112) 64 (52–88) patients. The tolerance scores between groups at baseline were median (range) not significantly different. For haematology, one patient in the liarozole group presented at baseline with a leucocytosis XRI, X-linked recessive ichthyosis; LI, lamellar ichthyosis; CBIE, which normalized towards the end of the treatment. bullous congenital ichthyosiform erythroderma

Clinical efficacy evaluation the dose after 22 days because of an adverse event (bullous Except for one patient in the acitretin group, the intention-to- eruption) and switched to 75 mg daily on alternating days. In treat population was identical to the all-patient population. the acitretin group three patients had their daily dose In the liarozole group, the investigators considered the increased to 45 mg and one to 60 mg. One patient (XRI) had overall response to treatment at endpoint as at least markedly to decrease the daily dose to 25 mg after 57 days because of improved in 10 of 15 patients, whereas nine of 15 patients an adverse event (skin disorder). rated themselves as at least markedly improved. In the acitretin Before trial completion, three patients in the liarozole group group, the investigators scored 13 of 16 patients as at least discontinued treatment due to adverse events and two discon- markedly improved at endpoint and 12 of 16 patients scored tinued in the acitretin group: one because of noncompliance themselves as markedly improved. For both the investigator’s and one due to adverse events (Fig. 1). Two patients in the and patient’s overall evaluation of response to treatment, no liarozole group had a second skin condition other than ichthyo- statistically significant between-group difference was observed sis: one had a lipoma on the back, and another had multiple at any time point. Response to treatment at endpoint yielded seborrhoeic keratoses. nine of 15 responders in the liarozole group, while there were For analysis on an intent-to-treat basis, 15 patients were 12 of 16 responders in the acitretin group. No statistically suitable in the liarozole group and 16 in the acitretin group. significant difference between treatment groups was observed (P ¼ 0Æ458). The 95% confidence interval of the difference in )

t response rates (acitretin–liarozole) was 18% to 48%. n e

m The parameters assessed for the severity of the skin lesions l

o Eligible patients r

n n = 41 were scaling, erythema and formation of bullae on trunk, E upper and lower limbs. An overview of the individual overall scores (for scaling, erythema and bullae) and the overall total Randomized n o i n = 32 t symptom scores per treatment group at baseline vs. endpoint a c o

l is presented in Table 2. l A Liarozole Acitretin Apart from the scaling on the trunk at baseline (P ¼ n = 15 n = 17 0Æ024), between-group comparisons showed no significant difference for any of the individual symptom scores (scaling, Drop out n = 2 Drop out n = 3 erythema, bullae) at any time point, on any of the body parts Noncompliance n = 1 Fatigue n = 1 Epistaxis, granulomatous Erythematous rash n =1 (trunk, upper and lower limbs). No statistically significant lesion and skin exfoliation Diarrhoea n = 1 n = 1 between-group differences were observed for the change in severity from baseline, at any time point, except for scaling on the trunk at week 12 (P ¼ 0Æ024) and at endpoint (P ¼ Completed Completed Æ protocol protocol 0 047). n = 12 n = 15 Overall scaling (sum of scaling at all locations) at each time point had improved significantly from baseline (P £ 0Æ001) within both treatment groups. Figure 2 shows the evaluation i

s Analysed (ITT) Analysed (ITT)

l n = 15 n = 16 of the overall scaling, changes from baseline as a function of a n

Ays time. For overall erythema and overall bullae no signiﬁcant changes from baseline were observed in any of the treatment Fig 1. Participant ﬂow. ITT, intent-to-treat. groups.

Table 2 Overview of the individual overall scores (scales, erythema, bullae) and the Overall score: Overall score: Overall score: Overall total overall symptom score at baseline (B) vs. scales (B/E) erythema (B/E) bullae (B/E) symptom score (B/E) endpoint (E) for both treatment groups Liarozole (ITT, n ¼ 15) 1 XRI 9/2 0/0 0/0 9/2 2 XRI 9/1 0/2 0/0 9/3 3 XRI 4/0 0/0 0/0 4/0 4 XRI 9/2 0/0 0/0 9/2 5 XRI 9/6 0/0 0/0 9/6 6 XRI 9/1 0/3 0/0 9/4 7 XRI 9/1 0/0 0/0 9/1 8 XRI 9/2 9/3 0/0 18/5 9 XRI 7/3 0/0 0/0 7/3 10 XRI 3/4 1/1 0/0 4/5 11 XRI 6/2 3/0 0/0 9/2 12 LI 9/0 4/6 0/0 13/6 13 LI 6/1 3/9 0/0 9/10 14 LI 9/3 3/0 0/0 12/3 15 CBIE 9/6 6/6 2/1 17/13 Acitretin (ITT, n ¼ 16) 1 XRI 9/9 0/0 0/0 9/9 2 XRI 9/1 0/2 0/0 9/3 3 XRI 6/0 0/3 0/0 6/3 4 XRI 7/0 0/0 0/0 7/0 5 XRI 5/0 0/0 0/0 5/0 6 XRI 8/2 0/0 0/0 8/2 7 XRI 5/6 0/3 0/0 5/9 8 XRI 6/1 0/0 0/0 6/1 9 XRI 7/1 0/0 0/0 7/1 10 XRI 5/0 3/0 0/0 8/0 11 LI 9/3 6/3 0/0 15/6 12 LI 6/3 0/0 0/0 6/3 13 LI 7/3 0/3 0/0 7/6 14 LI 6/3 6/3 0/0 12/6 15 CBIE 9/6 0/6 0/4 9/16 16 CBIE 8/3 6/3 0/0 14/6

Maximum possible overall score for scaling, erythema and bullae is 9 each; maximum possible overall total symptom score is 27. XRI, X-linked recessive ichthyosis; LI, lamellar ichthyosis; CBIE, bullous congenital ichthyosiform erythroderma; ITT, intent-to-treat

The overall total symptom score, in both treatment groups, lips which had worsened (liarozole P ¼0Æ003, acitretin had significantly improved from baseline, reaching P <0Æ001 P <0Æ001). Itching, being absent to mild at baseline in the for liarozole and P ¼ 0Æ008 for acitretin at endpoint. No statis- majority of patients, improved in both treatment groups during tically significant between-group difference at any time point treatment except for week 4 where it had worsened in the aci- could be observed for the overall total symptom score and for tretin group. At endpoint, itching was absent in 11 of 15 and the change from baseline. Figure 3 represents the overall total mild in four of 15 patients in the liarozole group vs. 10 of 17 symptom score (¼ sum of all symptoms at all sites) changes and six of 17 in the acitretin group. One patient in the acitretin from baseline for both treatment groups as a function of time. group still had severe itching (Table 3). Example clinical photographs are presented in Figures 4 and 5. As shown in Table 4, the investigators reported 10 adverse events in 46% (n ¼ 7) of the patients in the liarozole group and 25 adverse events in 71% (n ¼ 12) of the patients in Tolerability and safety evaluation the acitretin group. Most reported adverse events were mild The evaluation of the tolerance to treatment (itching, redness, to moderate. The most frequently reported adverse events dry skin, dry lips and conjunctivitis) by the patients showed no occurring in ‡ 10% of the patients in the liarozole group were statistically significant between-group differences at any time dry mouth and skin disorder (sticky skin) and in the acitretin point. An overview of the tolerance score per treatment group is group dry mouth, skin exfoliation, skin disorder (sticky skin given in Table 3. Within both groups, significant changes from and irritated skin), eczema and epistaxis. baseline were observed at endpoint for dry skin which had Before trial completion, three patients dropped out in the improved (liarozole P ¼ 0Æ020, acitretin P <0Æ001) and dry liarozole group due to adverse events: diarrhoea (moderate,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp965–973 970 Liarozole vs. acitretin in ichthyosis, C.J. Verfaille et al.

(a)

(b)

Fig 2. Evaluation of the overall symptom score: changes in scaling from baseline as a function of time. Filled circles represent liarozole and empty circles represent acitretin median values.

Fig 4. A patient with lamellar ichthyosis with the typical phenotype consisting of large brown scales covering the arm: (a) before treatment and (b) after 2 weeks of treatment with liarozole 75 mg twice daily.

) (113 mmol L 1, upper limit 111) at week 4 and also a slight ) increase in alanine aminotransferase (78 U L 1, upper limit 60). Another patient had an increase in triglycerides at week ) 12 (3Æ22 mmol L 1, upper limit 2Æ5). In the acitretin group, five abnormal values were seen in the blood biochemistry: one patient had a limited increase in urea at week 8 ) (9Æ7 mmol L 1, upper limit 8Æ3), which almost normalized to ) 8Æ9 mmol L 1 at week 12 and four patients had elevated triglycerides (Table 5). Most biochemical factors tested did not show significant changes. None of the changes mentioned was considered of major clinical relevance. Fig 3. Evaluation of the overall total symptom score changes from baseline as a function of time. Filled circles represent liarozole and Discussion empty circles represent acitretin median values. Retinoids have been shown to normalize deregulated prolifera- not drug-related), fatigue (mild, possibly drug-related) and tive activity and exert some anti-inflammatory action.18 erythematous rash on face and hands (moderate, definitely Although the underlying genetic defect within the ichthyosis drug-related). In the acitretin group, one drop-out was due to population is heterogeneous, retinoids have been employed adverse events of epistaxis (severe), periungual granulomatous with good or excellent results in many types of ichthyosis tissue (moderate) and skin exfoliation (moderate), all consid- except in ADIV.1 However, systemic administration of retin- ered definitely drug-related. Apart from epistaxis, no other oids is frequently associated with mucocutaneous side-effects, adverse events were reported as severe. No deaths or serious liver toxicity and abnormalities of serum lipid profiles.19,20 adverse events were reported throughout the study. Today, although not approved in certain countries, e.g. the Blood biochemistry in the liarozole group showed three U.S.A., acitretin is the most effective systemic treatment for abnormal values. One patient had a slight increase in chlorine most types of severe ichthyosis. The major issues with acitretin,

Table 4 Overview of adverse events proﬁle of both treatment groups (a)

Liarozole Acitretin (n ¼ 15) (n ¼ 17) Number of patients 712 with one or more adverse events during treatment Adverse events reported in ‡ 10% of patients in any treatment group, n Dry mouth 2 3 Skin exfoliation 0 4 Skin disorder 1 3 Eczema 0 2 Epistaxis 0 2 (b) Serious adverse events 0 0 Discontinuations 3a 2b Deaths 0 0

aDue to adverse events. bOne due to adverse events and one due to noncompliance.

Table 5 Overview of values from patients with elevated triglycerides ) (mmol L 1) during the treatment period. Upper limit for triglycerides ) is 2Æ5 mmol L 1

Treatment Fig 5. Typical hyperkeratosis in the neck of a patient with X-linked group Baseline Week 4 Week 8 Week 12 recessive ichthyosis which is giving the so-called ‘dirty look’ present Liarozole 1Æ21 2Æ26 1Æ54 3Æ22 before treatment with liarozole (a). Scaling is almost completely Acitretin 2Æ24 2Æ72 4Æ52 2Æ75 absent after treatment with liarozole (b). Acitretin 2Æ27 2Æ50 2Æ54 3Æ19 Acitretin 2Æ02 1Æ65 ND 2Æ93 Acitretin 1Æ65 3Æ06 2Æ50 2Æ81 Table 3 Overview of tolerance scores of both treatment groups ND, not determined.

Scores: absent/mild/moderate/severe, n

Liarozole Acitretin to date they have not been shown to be successful because of (n ¼ 15) (n ¼ 17) their propensity for skin irritation with the possible exception of 13-cis-retinoic acid.22 Short-term topical application of Symptoms Baseline Endpoint Baseline Endpoint tazarotene, a novel receptor selective retinoid, has proven to Itching 6/8/0/1 11/4/0/0 6/9/1/1 10/6/0/1 be effective but, as with other retinoids, irritancy is a signifi- Redness 8/3/3/1 7/5/2/1 12/1/4/0 8/7/2/0 cant side-effect.23 So far, no specific treatment modalities are Dry skin 4/0/3/8 5/5/4/1 1/0/10/6 5/8/1/3 Dry lips 12/2/1/0 1/10/3/1 13/4/0/0 1/10/4/2 available for the heterogeneous group of ichthyosis. Consider- Conjunctivitis 15/0/0/0 14/1/0/0 17/0/0/0 16/1/0/0 ing the toxicity associated with existing oral therapies, there is need for safer and more effective agents. Compounds enhan- No statistically significant between-group differences were observed. cing intracellular all-trans-RA levels, RAMBAs, represent a new Significant changes from baseline were observed in both groups therapeutic concept. for dry skin (improvement) and dry lips (worsening). RAMBAs are distinctively different from synthetic retinoids. RAMBAs are ‘nonretinoid’ drugs that block the intracellular breakdown of the body’s own retinoic acid. In doing so, the from a clinical point of view, are hyperlipidaemia and its intracellular all-trans-RA concentration increases to therapeutic long-term teratogenicity. Premenopausal women are advised levels but only in those tissues where all-trans-RA is metabo- not to become pregnant for at least 2 (Europe) or 3 (U.S.A.) lized by the 4-hydroxylase, including the skin. Animal and years following treatment. During acitretin treatment in psor- human studies have shown that the pharmacological effects of iasis at a dose of 30–60 mg daily, a 35% increase in serum liarozole are mediated by enhanced levels of endogenous reti- triglycerides was observed.21 Topical retinoids may represent noic acid in the body. Oral administration of liarozole to rats good alternatives to avoid the systemic side-effects, although delayed the plasma elimination rate of intrajugularly injected

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp965–973 972 Liarozole vs. acitretin in ichthyosis, C.J. Verfaille et al. all-trans-RA and enhanced the plasma levels of endogenous types and the small number of patients within this study, a all-trans-RA, confirming the in vivo suppressive activity of liaroz- larger study will be needed to confirm these results. An inter- ole on the biodegradation of endogenous RA.9,10 In addition, national multicentre phase II/III study in patients with LI is endogenous all-trans-RA levels in various tissues were enhanced ongoing. (unpublished data) and kinetic studies both in humans and in animals revealed a rapid clearance of liarozole from the plasma Acknowledgments and a normalization of all-trans-RA levels (within 24 h) once treatment was stopped.24 Following a twice-daily dose of The authors thank Luc Meuleners and Luc Wouters for their 150 mg liarozole in healthy male volunteers, steady-state was help with the statistical analysis. attained within 2 days of dosing with mean liarozole plasma )1 concentrations fluctuating between 0Æ36 and 2Æ57 lgmL . References Plasma concentrations of liarozole hardly accumulated, the mean accumulation ratio was about 1Æ3 and the terminal half- 1 Traupe H. (ed.). The Ichthyoses. A Guide to Clinical Diagnosis, Genetic Coun- life after the last 150-mg dose averaged 8Æ7 h. In contrast to selling and Therapy. Berlin: Springer-Verlag, 1989. synthetic retinoids which are delivered to the body in large 2 Ganemo A, Lindholm C, Lindberg M et al. Quality of life in adults with congenital ichthyosis. J Adv Nurs 2003; 44:412–19. amounts and tend to stay in tissues and fat for months or even 3 Chytil F. Retinoic acid: biochemistry, pharmacology, toxicology years, RAMBAs do not expose tissues to these high all-trans-RA and therapeutic use. Pharmacol Rev 1984; 36:93–100. concentrations responsible for retinoid-related chronic toxicity 4 Orfanos CE, Ehlert R, Gollnick H. The retinoids, a review of their and teratogenicity for months to years after discontinuation of clinical pharmacology. Drugs 1987; 34:459–503. therapy. 5 Pilkington T, Brogden R. Acitretin. A review of its pharmacology Liarozole is effective in different types of ichthyosis at a and therapeutic use. Drugs 1992; 43:597–627. daily dosage of 150 mg. This finding is in agreement with the 6 Wouters W, van Dun J, Dillen A et al. Effects of liarozole, a new antitumoral compound, on retinoic acid induced inhibition of cell results from a previous trial in which liarozole was adminis- growth and on retinoic acid metabolism in MCF-7 human breast tered up to 300 mg daily to patients with ichthyosis for cancer cells. Cancer Res 1992; 52:2841–6. 16 12 weeks. Compared with acitretin, no significant differences 7 Williams J, Napoli J. Metabolism of retinoic acid and retinol dur- were observed for any of the efficacy parameters except for ing differentiation of F9 embryonal carcinoma cells. Proc Natl Acad the improvement of the scaling on the trunk at week 12 (P ¼ Sci USA 1985; 82:4658–62. 0Æ024) and at endpoint (P ¼ 0Æ047). This observation might 8 De Coster R, Wouters W, van Ginckel R et al. Experimental stud- be explained by assuming that liarozole is more effective at ies with liarozole (R75251): an antitumoral agent which inhibits retinoic acid breakdown. J Steroid Biochem Mol Biol 1992; 43:197– clearing severe scaling than is acitretin. Alternatively, as scaling 201. on the trunk at baseline was more severe in the liarozole 9 van Wauwe J, Coene MC, Goossens J et al. Effects of cytochrome group, improvement of scaling may have been more obvious P-450 inhibition on the in vivo metabolism of all-trans-retinoic acid to the observers, resulting in relatively higher scores in symp- in rats. J Pharmacol Exp Ther 1990; 252:365–9. tom improvement. However, we consider it unlikely that all 10 van Wauwe J, van Nyen G, Coene MC et al. Liarozole, an inhibitor observers had the same bias. Hence we favour the former of retinoic acid metabolism, exerts retinoid-mimetic effects in vivo. explanation. Most patients in both treatment groups had XRI, J Pharmacol Exp Ther 1992; 261:773–8. 11 Kang S, Duell E, Kim K et al. Liarozole inhibits human epidermal and only a few presented with LI or CBIE. The main reason for retinoic acid 4-hydroxylase activity and differentially augments this is probably the lower incidence (1/200 000–1/300 000) human skin responses to retinoic acid and retinol in vivo. J Invest of the latter subtypes compared with XRI (1/6000 males). Dermatol 1996; 107:183–7. Also the fact that women were excluded unless they were at 12 Bruynseels J, de Coster R, van Rooy P et al. R 75251, a new inhibi- least 2 years postmenopausal or had had a hysterectomy made tor of steroid biosynthesis. Prostate 1990; 16:345–57. inclusion of patients with LI and CBIE even harder. 13 Berth-Jones J, Todd G, Hutchinson P et al. Treatment of psoriasis The expected retinoic acid-related adverse events were with oral liarozole: a dose-ranging study. Br J Dermatol 2000; 143:1170–6. mostly mild to moderate in both groups but tended to occur 14 Dockx P, Decree J, Degreef H. Inhibition of the metabolism of less frequently in the liarozole group. The incidence of hyper- endogenous retinoic acid as treatment for severe psoriasis: an open triglyceridaemia in this trial was also lower in the liarozole study with oral liarozole. Br J Dermatol 1995; 133:426–32. group (n ¼ 1) than in the acitretin group (n ¼ 4). Import- 15 Bhushan M, Burden AD, McElhone K et al. Oral liarozole in the antly, the main advantage of liarozole over acitretin lies in treatment of palmoplantar pustular psoriasis: a randomized, the inherent property that liarozole has towards long-term double-blind, placebo-controlled study. Br J Dermatol 2001; teratogenicity, a major drawback for the use of oral retinoids 145:546–53. 16 Lucker G, Heremans A, Boegheim P et al. Oral treatment of ichthy- in women. Its efficacy and its particular pharmacokinetics osis by the cytochrome P-450 inhibitor liarozole. Br J Dermatol make the use of liarozole an attractive candidate for the treat- 1997; 136:71–5. ment of ichthyosis. 17 Lucker G, Verfaille C, Heremans A et al. Topical liarozole in In conclusion, the efficacy and safety results obtained in this ichthyosis: a double-blind, left–right comparative study followed study warrant further development of liarozole as an orphan by a long-term open maintenance study. Br J Dermatol 2005; drug in ichthyosis. Considering the diversity of the ichthyosis 152:566–9.

18 Orfanos CE, Zouboulis CC, Almond-Roesler B et al. Current use and 22 Lucker G, van de Kerkhof P, Castelijns F et al. Topical treatment of future potential role of retinoids in dermatology. Drugs 1997; ichthyosis with 13-cis-retinoic acid. A clinical and immunohisto- 53:358–88. chemical study. Eur J Dermatol 1995; 5:566–71. 19 David M, Hodak E, Lowe N. Adverse effects of retinoids. Med Toxicol 23 Hofmann B, Stege H, Ruzicka T et al. Effect of topical tazarotene 1988; 3:273–88. in the treatment of congenital ichthyoses. Br J Dermatol 1999; 20 Peck G, DiGiovanna J. Synthetic retinoids in dermatology. In: The 141:642–6. Retinoids: Biology, Chemistry and Medicine (Sporn M, Roberts A, Goodman 24 Barrett D, Bryla P, Van de Velde V et al. Liarozole Investigators’ Brochure, D, eds), 2nd edn. New York: Raven Press; 1994; 631–58. 2nd edn, version 5.0: Data on ﬁle at Barrier Therapeutics, Geel, 21 Valquist C, Selinus I, Vessby B. Serum lipids changes during acitre- Belgium, 22 February, 2005. tin (etretin) treatment of psoriasis and palmo-plantar pustulosis. Acta Derm Venereol (Stockh) 1988; 68:300–5.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp965–973 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07754.x Single application of a ﬂuorescent test cream by healthy volunteers: assessment of treated and neglected body sites E. Ulff, M. Maroti, A˚. Kettis-Lindblad,* K.I. Kjellgren, J. Ahlner, L. Ring* and J. Serup§– Department of Dermatology, Ryhov Hospital, SE-55185 Jo¨nko¨ping, Sweden *Department of Pharmacy, Uppsala University, Uppsala, Sweden Institute of Health and Care Sciences, The Sahlgrenska Academy, Go¨teborg University, Go¨teborg, Sweden Forensic Chemistry Department and §Department of Dermatology, Linko¨ping University Hospital, Linko¨ping, Sweden –Department of Dermatology, Bispebjerg Hospital, Copenhagen, Denmark

Summary

Correspondence Background Management of dermatological self-treatment is demanding. Imperfect Marianne Maroti. application of creams and ointments and poor adherence to topical treatment are E-mail: [email protected] common, resulting in unsatisfactory treatment outcome. Objectives To assess the technique and precision of test subjects’ self-application of Accepted for publication 8 November 2006 a test cream. Treated and neglected skin sites were measured after intended widespread single application of a fluorescent test cream. Key words Methods Twenty healthy volunteers (10 women, 10 men) were included. They adherence, application, compliance, cream, were asked to treat their whole skin surface with the fluorescent test cream, fluorescence, ointment except the head and neck and skin covered by underwear. Treated and untreated Conflicts of interest sites were subsequently measured under Wood’s ultraviolet radiation. None declared. Results Thirty-one per cent of the skin surface that was a target for application did not show any fluorescence and thus was assumed to have been untreated. Typical A publication of the Adherence to Dermatological neglected sites included the central back, the upper breast, the axilla with sur- Therapy Study Group, Sweden (chairperson rounding skin, the legs and the feet, particularly the sole. The posterior aspect of J. Serup). both trunk and extremities, not easily inspected, was more often neglected. In the treated sites the fluorescence was typically uneven. Conclusions Qualified and motivated persons with no obvious physical limitations practised imperfect self-application of a test cream mimicking a therapeutic cream product. As much as 31% of the skin surface was neglected. Sites especially prone to nonapplication were identified. This might imply that dermatological patients on long-term self-treatment may practise local application very poorly, a problem of major therapeutic and economic importance. A fluorescent test cream can be used for research, and as an educational tool in the training of dermatological patients on how to apply local treatment.

Reduced adherence to treatment is considered a major prob- the concentration gradient across the barrier determined by the lem in modern healthcare. In chronic illness, some 50% of applied product film, its thickness and evenness, and by the patients may not follow treatment.1 In skin disease the penetration properties of the stratum corneum in a given ana- adherence to treatment is likely to be further reduced, as tomical location. To cover all parts of the skin integument with treatment with creams and ointments is especially cumber- an even cream film during a treatment course has a number of some.2 practical and physical prerequisites additional to psychological Only limited attention has been given to accurate dosage of and social preconditions. Obviously ‘impossible regions’ such creams and ointments under long-term use despite the obvious as the hairy scalp and the upper back cannot be treated by difficulties of self-treatment with an expected high frequency patients themselves under proper visual control. Elderly patients of under-treatment and treatment failures.3 Technical aspects of often cannot apply a cream properly simply due to limitations local application have hitherto been little addressed.4 Drug related to impairment of joints, vision, cognitive or cardio- penetration across the stratum corneum barrier follows Fick’s vascular functions, and due to problems created by the skin dis- laws.5 The flux of the active chemical into the skin depends on ease itself, including fatigue.

2007 The Authors 974 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp974–978 Self-application of cream, E. Ulff et al. 975

The present study is designed as a model study under ideal fixed. Two investigators (E.U. and M.M.) independently conditions using hospital personnel in good condition physic- sketched areas that did not fluoresce. In the analysis, the rela- ally, mentally and intellectually, regarding the application of a tive area of the nonfluorescent regions was expressed as a per- local treatment. The cream was given as a single application. centage of the area of the body region (for estimation of Such an ideal scenario obviously differs from patients’ long- regional surface area see below). Initially the sketches were term treatment at home, which may easily be problematic. divided into 27 cells, which were later amalgamated into lar- We asked the study participants to apply a fluorescent test ger areas corresponding to defined body regions. Additionally, cream. This has been used previously in contact dermatitis the evenness or unevenness of fluorescence in treated areas prevention to illustrate the efficacy of application of barrier was noted, but no detailed analysis was made of the grading, creams to the hands.6–9 The objective was to detect body sites as these estimations were believed to be too approximate. typically treated and body sites typically neglected. Investigators concluded their observations as one common result. Comparison of sketches showed moderate agreement Materials and methods between the two observers (Cohen’s j 0Æ439). For estimation of regional area relative to whole body skin Healthy hospital personnel, including nurses, doctors and surface area we used the standards of the Psoriasis Area and medical students at the Ryhov Hospital in Jo¨nko¨ping, Sweden, Severity Index scoring system commonly used in severity were recruited for the study. Staff from the Department of assessment of psoriasis, as decribed by Fredriksson and Petters- Dermatology were excluded. In total, 20 volunteers were son:10 head and neck ¼ 10% of total body area, trunk includ- included. Their mean age was 39 years (range 23–65) and the ing axillae and groins ¼ 20%, upper extremities ¼ 30%, and proportion of women was 50%. All participants were in a lower extremities including the buttocks ¼ 40%. We excluded good physical, mental and intellectual condition. The study the head and neck and the underwear area from treatment, was approved by the local ethics committee (Linko¨ping Uni- estimated to average 20%. Thus our calculations were based versity Hospital, study code 03-699). on 80% of the total skin surface being the intended target of Participants were instructed by the investigators (E.U. and application in the present study. M.M.) to apply the test cream to the whole skin surface, as they Plastic tubes with cream were weighed on a laboratory bal- would normally apply a therapeutic skin product (cosmetic or ance before and after use, and the cream used was calculated. drug). The head and neck areas were excluded as the properties With the purpose of estimating cream use in de facto-treated ) of the cream made it inappropriate to apply near the eyes and skin in g m 2 corresponding to sites with fluorescence, the mouth. The underwear area was excluded for ethical reasons. The treated skin area was calculated in the knowledge of the size participants were informed to take the time they needed and to of neglected sites. For the final calculation we assumed a use the amount of cream they might wish. They were told that whole body skin area as estimated by Bailey and Briars.11 the cream was fluorescent, and that the fluorescence was later to be checked. Participants undressed except for their underwear. Results Application was conducted under relaxed conditions with a minimum of interference by the investigators. The room used was Overall, no fluorescence was detected in 31% of the skin surface neutral with normal lighting. Participants had access to a chair. that was a target for test cream application, and thus 31% of the Two investigators noted the time taken for application, the way skin was considered untreated or neglected. Neglected sites the cream package was used (application directly from package to (area, percentage in a region) were ranked as follows: back skin, application from package to hand and then spread on the (55%) « feet, sole (55%) > breast (47%) > leg (29%) > arm skin), and the motion used for spreading the cream. (18%) > hands (15%). The test cream was a commercially available fluorescent All 20 volunteers presented at least one completely neglec- cream (Dermalux Testlotion; KBD GmbH, Weinheim, Ger- ted site. Eighteen volunteers neglected the central upper back, many) already introduced for the education of industrial 14 the central upper breast, and 10 volunteers neglected the workers to prevent hand dermatitis. The cream had been val- axillae and the immediately surrounding skin. All volunteers idated in use in previous studies.8,9 It was used as supplied in neglected the skin adjacent to textiles, i.e. the underwear. Also 75-mL plastic tubes. The colour and consistency of the cream the dorsal hand and the posterior arm and leg including the were similar to a regular cosmetic or pharmaceutical cream. sole were systematically neglected. Sites with no fluorescence The cream did not emit fluorescent light under room condi- are summarized in Table 1. tions but gave a white and blue fluorescence under ultraviolet All volunteers were right handed. Nevertheless, no side- illumination, the intensity of fluorescence depending on the related difference was noted except that the posterior aspect of amount of cream applied. the leg, as compared with the anterior aspect, was more often Immediately after the end of application the entire skin sur- neglected in women, with a similar trend in men (see face was systematically (360) checked under illumination. Table 1). The participants were instructed to rotate. The two ultraviolet Within the treated sites the fluorescence was typically radiation sources, each mounted with three tubes (Wood’s uneven and scanty or lacking close to textiles (Fig. 1). A char- light, tube TLD 36W/08, peak wavelength 365 nm) were acteristic distribution with fluorescent lines along the axis of

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp974–978 976 Self-application of cream, E. Ulff et al.

) ) Table 1 Summary of anatomical sites with no fluorescence, and Women applied 6Æ7gm 2 and men 9Æ0gm 2. Women took thereby supposedly untreated with fluorescent cream (n ¼ 20) 2Æ5 min to apply the cream and men 4Æ5 min, but time for application was variable and ranged between 1 min 7 s and Men Women 9 min 19 s. One man was an outlier and took a particularly Central upper back 9 9 long time. Regarding past experience with creams all women Central upper breast 8 6 reported that they used an emollient at least once a week, Axilla and surrounding skin 5 5 contrasting with only one such report among the men. There Anterior arm 5 5 were no observed age-related associations in this study group Posterior arm 7 6 of mainly middle-aged individuals. Dorsal hand (right/left) 5 7 Anterior leg 1 2 Posterior leg 5 10 Discussion Sole 8 8 This study of healthy individuals demonstrates that application of a cream to the trunk and extremity skin is highly imperfect. Areas representing one-third of the target skin were not treated at all, and the distribution of cream in treated sites was irregular. Thus in practice, the idea of a ‘cream film’ evenly spread over the skin surface is unlikely to be the case. The study identified anatomical sites that were systematically neglected. Additional to the sites we would normally consider ‘impossible’ targets for self-application, e.g. the hairy scalp and other sites not easily inspected, the study demonstrated that the posterior aspect of the skin, particularly on the legs and the sole, is difficult to treat. The right and left body sides, however, were treated equally even though all volunteers were right handed. There was no obvious gender-related difference in application performance despite the fact that women were more used to applying moisturizers than were men. Overesti- mation of neglected sites was unlikely as the volunteers had applied a very liberal amount of test cream, indicating that they had done their best. Creams are emulsions with about 70% of water. Emulsion water evaporates swiftly, i.e. within 3–5 min, followed by an increase in viscosity and difficulty in manual spread on the skin.12 Thus uniform spread of cream or any other formulation with a vehicle undergoing fast evaporation requires swift application and spread. Ointments may better maintain viscosity and be easier to spread evenly.13 Dryness of skin and low humidity of ambient air will influence the spread of a watery emulsion on the skin, associated with reduced hydration and Fig 1. Example of self-application of a fluorescent test cream. Light poor spread. sites were considered treated. Patients cover a wide spectrum of age and comorbidities related to joints, vision and many other somatic, mental, cog- the extremities and vertical, horizontal or irregular lines or nitive and social deficiencies creating difficulties in their self- patterns on the trunk was observed. This was related to the treatment. Long-term treatment is frequently associated with observed motion of the volunteers when performing cream nonadherence even in patients on oral treatment, which is application, namely longitudinal spread on the extremities and easier to perform than self-treatment with creams and oint- a more variable or rotational application on the trunk. All vol- ments.1 In previous focus group studies in Swedish patients unteers used the palm and fingers to spread the cream. Cream and health professionals factors affecting nonadherence were tubes were squeezed a mean of six times (range three to 14 identified, including the demanding every-day procedure of times) during the test. Nineteen volunteers performed indirect applying topicals.14,15 application by squeezing the cream initially from tube to hand As mentioned, the concentration gradient across the stra- while one volunteer applied the cream directly from the tube tum corneum barrier is the driving force behind the flux of to the treatment site. The mean total amount of cream used active chemical into the skin.5 Thus, liberal, even and regu- was 15Æ2 g (range 5Æ9–38Æ8). The mean local dose calculated lar application of product over the skin surface to be treated ) in sites with fluorescence was 7Æ8gm 2 (range 3Æ1–16Æ0). is essential in order to produce effective drug concentration

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp974–978 Self-application of cream, E. Ulff et al. 977 in the level of the skin where the disease mechanism is the patient might become more aware of the necessity to be active. The robustness of dosage of pharmaceutical creams precise in using creams and ointments. may vary from one drug to another. Newer drugs are for- In conclusion, cream is a dosage form that is more difficult, mulated with a concentration of the active chemical posi- variable and questionable than hitherto thought. Imperfect tioned at a level where the dose–effect curve becomes flat application is likely to be common whenever large surfaces or in order to obtain the best therapeutic index, i.e. best effect anatomical sites that are difficult to reach are to be treated. at lowest level risk. Pharmaceutical companies must docu- Under-application with treatment failure due to the patient’s ment this in a disciplined dose-finding study whenever a imperfect self-application easily occurs. new drug is approved. Optimization of the dose at the low- Further studies addressing patients’ self-treatment at home est effective level gives limited room for variation and are warranted. The fluorescent cream is a useful instrument, both imperfect application during the patient’s routine treatment in research and in practice. Doctors and nurses may use it as an at home. Hence, there is an obvious risk of under-dosing. educational tool to instruct patients by providing direct, visual Topical drugs registered in different concentrations typically feedback on their self-application behaviour. show a factor of 3–5 between the low and the high concentration. This further indicates that effective application Acknowledgments cannot vary too much, and the gap from recommended dose to under-dosing with no clinical effect is narrow. This study was granted support from the County of O¨ stgo¨t- Older drugs often were formulated empirically and their land (ALF), Sweden. We thank the participating health volun- robustness to under-application is generally unknown. The teers for their involvement in the study by treating their stratum corneum barrier is itself variable and highly depend- whole skin surface with the fluorescent test cream. ent on anatomical region with regard to penetration by chemicals such as drugs. The penetration of the corticoster- References oid hydrocortisone through healthy skin was shown to vary by a factor of 13 at different body sites, and diseased skin 1 World Health Organization. Adherence to Long-term Therapies, Evidence is likely to show even greater variation also depending on for Action. Geneva: WHO, 2003 (order no. 1150526, publica- the state of disease.16 In our study we observed the fluores- [email protected]). 2 Serup J, Lindblad A˚K, Maroti M et al. To follow or not to follow cence of a chemical marker, and the study does not allow dermatological treatment. A review of the literature. Acta Derm us to measure the exact applied dose of the fluorescent sub- Venereol (Stockh) 2006; 86:193–7. stance mimicking an active chemical. The volunteers applied 3 Osborne JE, Hutchinson PE. The importance of accurate dosage of ) an average dose of cream, i.e. 6Æ7–9Æ0gm 2. This is within topical agents: a method of estimating involved area and applica- normal dose range and the volunteers probably did the best tion to calcipotriol treatment failures. J Eur Acad Dermatol Venereol they could to perform well.17 2002; 16:367–73. The practising dermatologist cannot easily improve the 4 Long CC, Finlay AY. Area of skin disease can be used to indicate amount of treatment needed. BMJ 1996; 313:690. situation. A recent Cochrane review on interventions for 5 Schaefer H, Redelmaier E (eds). Skin Barrier, Principles of Percutaneous helping patients to follow prescriptions for medications Absorption. Basel: Karger, 1996. 18 showed a limited effect of systematic interventions. How- 6 Wigger-Alberti W, Maraffio B, Wernli M, Elsner P. Self-application ever, it is fundamental to select the right treatment for the of a protective cream: pitfalls of occupational skin protection. right individual. If the patient has physical, mental or social Arch Dermatol 1997; 133:861–4. reasons not to practise regular self-treatment with greasy 7 Wigger-Alberti W, Maraffio B, Wernli M, Elsner P. Training work- creams and ointments, an oral or some other treatment alter- ers at risk for occupational contact dermatitis in the application of protective creams: efficacy of a fluorescent technique. Dermatology native should be found. The patient should be able to prac- 1997; 195:129–33. tise the treatment throughout a full treatment course and be 8 Bankova L, Lindenau S, Fuchs S et al. Influence of the galenic foreseen to be adherent to the programme agreed upon. form of a skin-protective preparation on the application pat- There should be good concordance between doctor and tern assessed by a fluorescent method. Exog Dermatol 2002; patient. The therapeutic aim should be clear and seen as pos- 1:313–18. sible to achieve through the efforts of the patient. Our study 9 Kelterer D, Fluhr JW, Elsner P. Application of protective creams: indicates that much attention needs to be given to the use of a fluorescence-based training system decreases unprotected areas on the hands. Contact Dermatitis 2003; 49:159–60. detailed technical aspects of local application.19 Application 10 Fredriksson T, Pettersson U. Severe psoriasis – oral therapy with a under or near clothing very easily becomes scanty as new retinoid. Dermatologica 1978; 157:238–44. observed in the present study. Creams must be spread swiftly 11 Bailey BJR, Briars GL. Estimating the surface area of the human before emulsion water evaporates. Treating large areas with a body. Stat Med 1996; 15:1325–32. cream is a special challenge likely to be achieved better 12 Blichmann C, Serup J, Winther A. Effects of single application of under humid conditions, i.e. in the bathroom after a shower. a moisturizer: evaporation of emulsion water, skin surface tem- To schedule daily treatment and tailor application to the rou- perature, electrical conductance, electrical capacitance, and skin surface (emulsion) lipids. Acta Derm Venereol (Stockh) 1989; 69:327– tine of the patient may help discipline dermatological treat- 330. ment. If the doctor pays attention to these practical details,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp974–978 978 Self-application of cream, E. Ulff et al.

13 Ivens U, Steinkjer B, Serup J, Tetens V. Ointment is evenly spread 16 Feldmann RJ, Maibach HI. Penetration of 14C hydrocortisone on the skin, in contrast to creams and solutions. Br J Dermatol 2001; through normal skin. Arch Dermatol 1965; 91:661–9. 145:264–7. 17 Long CC, Finlay AY. The ﬁnger-tip unit – a new practical measure. 14 Kjellgren KI, Ring L, Lindblad A˚K et al. To follow dermatological Clin Exp Dermatol 1991; 16:444–7. treatment regimens – patients’ and providers’ views. Acta Derm 18 Haynes RB, McDonald H, Garg AX, Montague P. Interventions for Help- Venereol (Stockh) 2004; 84:445–50. ing Patients to Follow Prescriptions for Medications (Review). The Cochrane 15 Kettis-Lindblad A˚, Kjellgren KI, Ring L et al. The role of dermatolo- Collaboration, The Cochrane Library, 2005, Issue 1. Chichester: gists, nurses and pharmacists in chronic dermatological treatment: Wiley. patient and provider views and experiences. Acta Derm Venereol 19 Long CC, Mills CM, Finlay AY. A practical guide to topical therapy (Stockh) 2006; 86:202–8. in children. Br J Dermatol 1998; 138:293–6.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp974–978 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07753.x Low basal serum cortisol in patients with severe atopic dermatitis: potent topical corticosteroids wrongfully accused I.M. Haeck, L. Timmer-de Mik, E.G.W.M. Lentjes,* E. Buskens, D.J. Hijnen, C. Guikers, C.A.F.M. Bruijnzeel-Koomen and M.S. de Bruin-Weller Department of Dermatology and Allergology, *Department of Clinical Chemistry and Haematology and Julius Center for Health Sciences and Primary Care, University Medical Centre Utrecht, 3584 CX Utrecht, The Netherlands

Summary

Correspondence Background Topical corticosteroids are used extensively to treat inflammatory skin Inge Haeck. disorders including atopic dermatitis (AD). Several studies have described tem- E-mail: [email protected] porary reversible suppression of hypothalamic–pituitary–adrenal function. How- ever, sound evidence of permanent disturbance of adrenal gland function is Accepted for publication 8 November 2006 lacking. Objectives To relate basal cortisol levels to prior use of topical corticosteroids and Key words disease activity in patients with moderate to severe AD and to investigate the atopic dermatitis, hypothalamus–pituitary–adrenal effect on basal serum cortisol levels of topical corticosteroid treatment during axis, serum cortisol levels, topical corticosteroids hospitalization. Conflicts of interest Methods Two groups of patients with AD were evaluated: 25 inpatients with severe None declared. AD who required hospitalization (group 1) and 28 outpatients with moderate to severe AD (group 2). In group 1, morning basal serum cortisol levels were measured twice, at admission and at discharge; in group 2, morning basal serum cortisol levels were measured once. Use of topical corticosteroids in the 3 months prior to the cortisol measurement was recorded and disease activity was monitored using the Six Area, Six Sign Atopic Dermatitis (SASSAD) score and serum thymus and activation-regulated chemokine (TARC) levels. Results On admission, basal cortisol levels in group 1 were significantly (P <0Æ001) decreased in 80% of the patients. In group 2, the basal cortisol levels were normal in all but three patients. Comparing the two groups, group 1 on admission had a significantly lower cortisol level than that of group 2 (P <0Æ001). Disease activity in group 1 on admission was significantly higher than that of group 2 (P <0Æ001). There was no difference in use of topical corticosteroids in the 3 months before cortisol measurement. At discharge in group 1 there was a significant increase (P <0Æ0001) of basal cortisol levels and a significant (P <0Æ001) decrease in disease activity reflected by the decrease in serum TARC levels and SASSAD score. Conclusions Disease activity, rather than the use of topical corticosteroids, is responsible for the low basal cortisol values in patients with severe AD.

For many decades topical corticosteroids have been widely results in inadequate disease control in patients with inflam- used to treat inflammatory skin disorders including atopic der- matory skin disorders. matitis (AD). Although dermatologists and general practition- The original active topical glucocorticosteroid is hydrocorti- ers often prescribe topical corticosteroids, there is widespread sone, the natural glucocorticosteroid of the adrenal cortex. concern about possible systemic side-effects, such as depres- Shortly after its introduction as a treatment for inflammatory sion of adrenal gland function, osteoporosis, growth impair- skin diseases, Malkinson and Ferguson1,2 found experimental ment in children, glaucoma and cataract. Corticophobia (fear evidence that some percutaneous absorption of hydrocortisone of topical corticosteroid use) by patients and doctors often may occur. However, several years later, Fleischmajer3 found

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp979–985 979 980 Low basal serum cortisol in atopic dermatitis, I.M. Haeck et al. no evidence of systemic effects after application of large Rajka.8 None of the patients were pregnant at inclusion. amounts of hydrocortisone in 19 patients with AD (age 5– Menopausal state (including use of oestrogen replacement 60 years). In children with AD, percutaneous absorption of therapy), use of oral contraception, use of antidepressants, hydrocortisone was proven to be significantly lower in the mean intake of alcohol per week, height and weight were convalescent phase of the disease compared with the acute recorded on inclusion. The potency of topical corticosteroids phase, probably owing to the restoration of the skin barrier.4 used was rated as class 1, 2, 3 or 4; class 1 is the least potent Several years after the introduction of hydrocortisone, new and class 4 is the most potent. Both groups used topical corti- synthetic corticosteroids were developed. Synthetic corticoster- costeroids of class 2, 3 or 4 prior to evaluation. The local oids can modulate endogenous cortisol secretion by influen- medical ethical committee approved this study. cing hypothalamic and pituitary effects on adrenal gland activities through the hypothalamic–pituitary–adrenal (HPA) Basal cortisol levels axis.5 The presence of synthetic corticosteroids in the circulation exerts a negative feedback on the release of hypothalamic Basal serum cortisol levels were determined between 08.00 corticotropin-releasing hormone (CRH). Diminished CRH and 09.00 h in group 1 (on first day of admission) and group release results in a decrease in corticotropin (ACTH) release 2 using the automated immunoanalyser Advia Centaur (Bayer from the pituitary gland, which in turn leads to decreased HealthCare, Mijdrecht, the Netherlands). Total imprecision ) production of endogenous cortisol by the adrenal gland. over the range 0Æ1–0Æ9 lmol L 1 was 7Æ5–10%. In group 1, As early as 1965, Scoggins and Kliman6 concluded that the measurement of the basal cortisol level was repeated on the cortisol content of plasma in the early morning proved to be a morning of discharge. To be sure that we solely measured very sensitive index of the suppression of pituitary–adrenal endogenous cortisol levels in the assay used, we tested the function by synthetic corticosteroid analogues. Nowadays, cross-reactivity of the various corticosteroids administered measuring total basal serum cortisol (between 08.00 and with the assay used. 09.00 h) is still the most commonly used method for the initial evaluation of adrenal gland function. Although there is Disease activity convincing evidence that percutaneous absorption of topical corticosteroids can occur, especially using potent topical corti- In group 1, disease activity was recorded on the first day of costeroids on large areas of inflamed skin and for longer peri- admission and on the day of discharge using the Six Area, Six ods, the question remains whether this is relevant in clinical Sign Atopic Dermatitis (SASSAD) score9 and by determin- practice. Several studies and case reports describe temporary ing the level of serum thymus and activation-regulated reversible suppression of HPA function,5,7 but there is no cir- chemokine (TARC/CCL17).10–12 In group 2, the disease activ- cumstantial evidence of permanent disturbance of adrenal ity was also recorded (on a visit to the outpatient clinic) using gland function. When treating patients with severe AD it is the SASSAD score and by measuring the level of TARC in peri- important to estimate the risk–benefit ratio when using potent pheral blood. topical corticosteroids, because the alternative treatment options in this patient group, such as oral immunosuppressive Topical corticosteroid use drugs, also have side-effects when used for extended periods. The aim of the current study was to investigate basal serum In both groups, the use of topical, inhaled and systemic corti- cortisol levels of adult patients with moderate to severe AD in costeroids was evaluated for the period of 3 months prior to relation both to the total amount of topical corticosteroid used admission or visit to the outpatient clinic. This was carried out in the past 3 months and to the disease activity. In addition, using a combination of the patient’s history and pharmacy the effect was investigated of intensive topical corticosteroid records obtained. We strove as accurately as possible to quan- treatment on basal serum cortisol level and disease activity in tify the exact amount of topical corticosteroid used. Using this patients with severe AD during admission to hospital. method, we anticipate that there is an overestimation of the actual use of topical corticosteroids as not all patients use the Patients and methods topical steroids they obtain from the pharmacy and/or accurately estimate their use. The topical corticosteroid use is expressed as the total amount (in g) used over the 3 months Patients prior to measurement of basal cortisol levels. During admission Fifty-three patients with moderate to severe AD were studied. (group 1), we did not impose a previously specified treatment The inpatients (group 1) consisted of 25 patients (11 men regimen and patients were treated as they would have been and 14 women, age range 18–83 years; mean age 39) with otherwise. We subsequently recorded this treatment modality. severe uncontrolled AD that required hospitalization. Twenty- eight outpatients (12 men and 16 women, age range 18– Statistical analysis 74 years; mean age 36) with moderate to severe but controlled AD served as a control group (group 2). The diag- Statistical analysis was performed using the program SPSS for nosis of AD was made according to the criteria of Hanifin and Windows (version 12, 2003; SPSS Inc., Chicago, IL, U.S.A.).

Because clearly skewed distributions in outcome parameters Comparing the two groups, the basal cortisol levels of were observed, nonparametric tests were used. Associations group 1 patients at admission were significantly lower than between variables were tested in contingency tables using those of group 2 (P <0Æ001). The mean ± SD difference Fisher’s exact test or the v2 test (with Yates’ continuity correc- between the mean basal cortisol levels of group 1 (at admis- ) tion). Differences in median values between independent vari- sion) and group 2 is 0Æ374 ± 0Æ06 lmol L 1 (95% CI of ables were tested using the Mann–Whitney test or the difference 0Æ254–0Æ494) (Fig. 1a). This difference is also Kruskal–Wallis test (corrected for tied values). The Spearman significant when correcting for use of oral contraceptives. rank correlation test was used to measure correlations between Testing the assay, the basal cortisol levels measured were variables. Probability levels of 0Æ05 and below were consid- not influenced by the addition of the various synthetic cortico- ered significant. steroids and it can be concluded that there is no cross-reactivity in this assay. Results Disease activity Group 1 (admission) vs. group 2 Disease activity in group 1 on admission was significantly (P <0Æ001) higher than the disease activity in group 2 as Basal cortisol levels indicated by a higher level of TARC in group 1 with a ) The clinical characteristics of the patients are summarized in mean ± SD of 5037 ± 5841 pg mL 1 (95% CI 2511–7563) ) Table 1. Basal cortisol levels on admission in the inpatients vs. a mean ± SD in group 2 of 1391 ± 2005 pg mL 1 (95% (group 1) were significantly (P <0Æ001) decreased in 20 of CI 581–2201) (Fig. 1b) and by a significantly (P <0Æ001) the 25 patients (80%), including six of seven patients using higher mean ± SD SASSAD score in group 1 of 41 ± 16 (95% oral contraceptives. Mean cortisol levels at admission were CI 33–49) vs. a score in group 2 of 19 ± 8 (95% CI 15–22). ) 0Æ087 lmol L 1 lower than the lower limit of the reference ) range for cortisol (0Æ20 lmol L 1) [95% confidence interval (CI) Topical corticosteroid use of difference 0Æ018–0Æ157] (P <0Æ05). In the outpatients (group ) 2), basal cortisol levels were normal (> 0Æ20 lmol L 1)inall There was no significant difference in the amount of topical but three patients. corticosteroids used between the two groups in the 3 months

Table 1 Clinical characteristics of the patients

Group 1 (inpatients Group 2 at admission) (n ¼ 25) (outpatients) (n ¼ 28) mean ± SD mean ± SD Age (years) 39 ± 16 36 ± 15 Sex (men/women) 11/14 12/16 Duration of hospitalization (days) 19 ± 5 – SASSAD score 41 ± 16 (n ¼ 17) 19 ± 8 (n ¼ 24) ) TARC level (pg mL 1) 5037 ± 5841 1391 ± 2005 Use of topical corticosteroidsa g per week 28 ± 13 27 ± 22 g per 3 months 339 ± 151 326 ± 258 Potency of topical corticosteroids usedb,c Class 2/3 8 8 Class 3 12 14 Class 3/4 5 5 Class 4 0 1 Use of inhaled/oral corticosteroidsb 89 Use of oral corticosteroidsb 59 ) Body mass index (kg m 2)23Æ4±4Æ023Æ5±3Æ4 Use of antidepressantsb 21 Alcohol consumption (units per week) 6 ± 7 4 ± 5 Postmenopausal women/oestrogen therapy 2/0 3/0 Use of oral contraceptives 7 5

SASSAD, Six Area, Six Sign Atopic Dermatitis; TARC, thymus and activation-regulated chemokine. aUse in the 3 months before cortisol measurement. bUse in the 3 months before cortisol measurement, expressed in numbers of patients. cThe potency of topical corticosteroids used was rated as class 1, 2, 3 or 4; class 1 is the least potent and class 4 is the most potent.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp979–985 982 Low basal serum cortisol in atopic dermatitis, I.M. Haeck et al.

(a) (b) 10 100 000

P < 0·001 P < 0·001

(log) 1 10 000 –1 L

(log)

–1 Fig 1. (a) Basal cortisol levels on admission mol ml

µ in group 1 (inpatients) compared with basal cortisol levels in group 2 (outpatients) 0·1 (log scale). Horizontal lines indicate median 1000 Cortisol )1 TARC pg values. The dashed line at 0Æ2 lmol L is the lower limit of the reference range. (b) Serum thymus and activation-regulated chemokine (TARC) levels on admission in group 1 0·01 (inpatients) compared with TARC levels in <0·01 100 Inpatients Outpatients Inpatients Outpatients group 2 (outpatients) (log scale). Horizontal lines indicate median values. prior to basal cortisol measurement. Group 1 had used ber of patients using antidepressants, alcohol intake per week, 339 ± 151 g (mean ± SD) in 3 months and group 2 had number of postmenopausal women and number of women used 326 ± 258 g (mean ± SD) of topical corticosteroids in using contraceptives between the two groups (Table 1). 3 months (P ¼ 0Æ8), with a mean difference of 12 g [SEM 60Æ2 and 95% CI ()133)–109]. There was no significant dif- Group 1: effect of hospitalization ference between group 1 and 2 in potency of topical corticosteroids used (P ¼ 0Æ963), use of inhaled corticosteroids In group 1 there was a significant increase during treatment (P ~ 1) and use of oral corticosteroids in the 3 months prior in hospital (P <0Æ0001) of basal cortisol levels in compari- to inclusion (P ¼ 0Æ365) (Table 2). son with the admission values, with a mean increase of ) 0Æ39 lmol L 1 (95% CI 0Æ26–0Æ52) (Fig. 2a). This increase was less but still significant (P <0Æ001) when correcting for Within-group comparison ) oral contraceptive use, with a mean increase of 0Æ26 lmol L 1 No significant correlation was found between the basal corti- (95% CI 0Æ16–0Æ37). At discharge, the serum TARC levels sol levels and use of topical corticosteroids in groups 1 and 2 had significantly (P <0Æ001) decreased in comparison with ) (P ¼ 0Æ287 and P ¼ 0Æ181, respectively; Spearman rank corre- admission, with a mean decrease of 2900 pg mL 1 (95% CI lation test). In addition, there was no association between the 1542–4261) (Fig. 2b). The mean ± SD SASSAD score of basal cortisol levels and the potency of topical corticosteroids this group on admission was 41 ± 16 and at discharge used (P ¼ 0Æ787 for group 1 and P ¼ 0Æ182 for group 2; the SASSAD score had decreased significantly to 9 ± 5 Kruskal–Wallis test), use of inhaled corticosteroids (P ¼ 0Æ514 (P <0Æ001). There was no difference in effect between the for group 1 and P ¼ 0Æ418 for group 2; Mann–Whitney test) different treatment modalities used during hospitalization in and use of oral corticosteroids (P ¼ 0Æ329 for group 1 and group 1 on the rise in basal cortisol levels (Table 3). At dis- P ¼ 0Æ634 for group 2; Mann–Whitney test). Furthermore, charge in group 1 there were four patients who still had there was no significant difference in body mass index, num- basal cortisol levels below the lower limit of the reference ) range (0Æ20 lmol L 1); however, 6 weeks after discharge they too increased to normal levels. Table 2 Comparison of the inpatient group and outpatient group in use of topical, inhaled and oral corticosteroids and potency of topical corticosteroids used Group 1 (discharge) vs. group 2

Comparing the two groups again, this time comparing group Steroid use in 3 months prior to cortisol measurement Group 1 vs. group 2 1 at discharge with group 2, neither the mean basal cortisol levels nor the serum TARC levels differed signiﬁcantly (P ¼ Mean amount of topical P ¼ 0Æ8 Æ Æ corticosteroids in g 0 846 and P ¼ 0 409). The difference in cortisol was also not Inhaled corticosteroids (yes/no) P ~ 1 signiﬁcant when correcting for use of oral contraceptives. The Oral corticosteroids (yes/no) P ¼ 0Æ365 difference in the mean basal cortisol level at discharge in ) Potency of topical corticosteroids P ¼ 0Æ963 group 1 (mean ± SD 0Æ50 ± 0Æ31 lmol L 1) and group 2 ) ) (class 2–4) (mean ± SD 0Æ49 ± 0Æ25 lmol L 1)is0Æ015 lmol L 1 [SEM ) 0Æ077 lmol L 1, 95% CI ()0Æ14)–0Æ17] and the difference in

(a) 10 (b) 100 000

P < 0·001

P < 0·0001 (log)

–1 1 10 000 (log) L

–1 mol ml

Fig 2. (a) Basal cortisol levels on admission and on discharge in group 1 (inpatients) 0·1 TARC pg Cortisol 1000 (log scale). Horizontal lines indicate median ) values. The dashed line at 0Æ2 lmol L 1 is the lower limit of the reference range. (b) Serum thymus and activation-regulated chemokine (TARC) levels on admission and discharge in 0·01 <0·01 100 group 1 (inpatients) (log scale). Horizontal Admission Discharge Admission Discharge lines indicate median values.

Table 3 Treatment group 1 during hospitalization in relation to basal cortisol levels

) Basal cortisol levels (lmol L 1) Treatment during Number of hospitalization patients (n ¼ 25) Admission Discharge Topical corticosteroids 13 0Æ10 ± 0Æ16a 0Æ44 ± 0Æ29a Topical corticosteroids under occlusion 2 < 0Æ01 0Æ12 0Æ04 1Æ13 Tar preparations 3 0Æ10Æ30 0Æ18 1Æ11 0Æ59 0Æ73 Tar preparations and topical 2 0Æ07 0Æ81 corticosteroids 0Æ39 0Æ36 Oral immunosuppressants and topical corticosteroids Ciclosporin 3 Prednisone 1 0Æ03 ± 0Æ009a 0Æ46 ± 0Æ16a Prednisone and azathioprine 1

aMean ± SD.

) ) mean TARC level is 699 pg mL 1 [SEM 836 pg mL 1, 95% CI The results of our study invalidate overall opinion that treat- ()998)–2396]. ment with potent topical corticosteroids suppresses function of the HPA axis. In the past, many studies have been per- Discussion formed linking the use of topical corticosteroids to HPA axis dysfunction, with contradictory results. Although there seems In this prospective, parallel cohort study we have demonstra- to be laboratory evidence of reversible suppression of the HPA ted that low basal serum cortisol values are not caused by axis in patients treated with topical corticosteroids, irreversible prior use of potent topical corticosteroids in patients with adrenal insufficiency is found only in rare cases.13 One of the moderate to severe AD. Within both the inpatient and out- limitations of most studies is that they were not primarily patient groups, no significant correlation was found between designed to study HPA axis function. Most studies show retro- the amount of topical corticosteroids used and basal serum spective data and no information is given on disease severity cortisol values. Furthermore, in the inpatient group (group 1) at the moment of testing nor on the amount of topical corti- with active disease, significantly lower basal serum cortisol costeroids used before testing. Although this study was levels were found compared with the outpatient group (group designed primarily to relate topical corticosteroid use and dis- 2) with controlled disease, whereas there was no significant ease activity to basal serum cortisol levels, its limitation prob- difference in topical corticosteroid use in both groups. Nota- ably lies in the difficulty of exactly quantifying the amount of bly, basal serum cortisol levels of the inpatients showed a dra- topical corticosteroids used by patients in the weeks prior to matic increase during intensive treatment with large amounts measurement of basal serum cortisol level. Weighing the corti- of potent topical corticosteroids. costeroid tubes was attempted but was very inaccurate as

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp979–985 984 Low basal serum cortisol in atopic dermatitis, I.M. Haeck et al. patients forgot their tubes and often did not know what they that was paralleled by a significant increase in basal serum had received from the pharmacy. Using the pharmacy records cortisol. These findings are in accordance with our own results in combination with the patient’s history, there was probably showing that the significant decrease in disease activity after an overestimation of the actual use of topical corticosteroids. intensive treatment with large amounts of potent topical corti- If this maximal amount of topical corticosteroids has no effect costeroids during the hospitalization period resulted in a con- on the basal cortisol level, it is safe to reason that the actual siderable increase (normalization) in basal serum cortisol amount used by patients certainly has no effect. levels. It would appear that HPA axis function is influenced Several safety studies concerning the HPA axis were per- more by disease activity than by systemic effects of potent formed after the introduction of a potent topical corticosteroid, topical corticosteroids. This hypothesis is further supported by clobetasol-17-propionate. Olsen and Cornell14 demonstrated the fact that the patients with severe and extensive disease that clobetasol-17-propionate could induce a dose-related who needed hospitalization (inpatient group) used as little as depression of cortisol level in hospitalized patients, with 30 g topical corticosteroids weekly before their admission, recovery of cortisol levels within 2 or 3 days after discontinu- whereas their basal serum cortisol was below the lower limit ation. By contrast, Jegasothy et al.15 found serum cortisol levels of the reference range for cortisol in 80% of the patients. Dur- below the normal limit in only seven of 113 outpatients with ing hospitalization, when potent topical corticosteroids were AD or psoriasis who were treated with clobetasol ointment applied by dermatological nurses, approximately 25 g twice two or three times daily (up to 50 g weekly) on two consecu- daily was used during the first week (approximately 350 g tive weeks. Cushing syndrome caused by the use of large weekly) in the acute phase and once daily in the convalescent amounts of clobetasol propionate 0Æ05% ointment during long phase (approximately 150–175 g weekly). Despite the fact treatment periods was described in two cases.16 Because that some percutaneous absorption must have taken place, patients did not regularly visit a doctor, there was an inappro- morning serum cortisol levels increased. The data from our priate use or abuse of this potent topical steroid in both cases. study and those of Matsuda et al. suggest that disease activity is In an efficacy study, using fluticasone propionate ointment in linked to low basal serum cortisol levels. This is of special adult patients with moderate to severe AD, van der Meer interest because appropriate reactivity of the HPA axis to et al.17 also evaluated basal serum cortisol levels in a subgroup stressful stimuli, such as inflammation, may be necessary to of patients for a longer period. No significant changes in basal control immunological processes. During inflammatory pro- serum cortisol were detected during the induction phase of cesses, the release of proinflammatory cytokines, such as inter- 4 weeks (intensive topical corticosteroid use, n ¼ 79), nor leukin (IL)-1b, tumour necrosis factor-a and IL-6, stimulates in the controlled maintenance phase of 16 weeks (topical the HPA axis to produce larger amounts of glucocortico- corticosteroid use twice weekly, n ¼ 13). ids.21,22 The increased adrenal glucocorticoid production can Children are believed to be especially at risk for systemic suppress inflammatory responses, thus preventing chronicity. effects of topical corticosteroids, because of their relatively Data from animal studies also suggest that the HPA axis might large body surface. Patel et al.18 studied the adrenal function in play a protective role in chronic inflammation.23 14 prepubertal children with moderate to severe AD (age 3– Interestingly, attenuated responsiveness of the HPA axis in 10 years). No difference was found in basal serum cortisol adults and children with AD who were corticosteroid free for levels between children with moderate to severe AD regularly at least 3 months was found by Buske-Kirschbaum et al.24,25 treated with topical corticosteroids compared with controls. In Significantly attenuated cortisol and ACTH responses to a stan- a more recent open-label safety study on the effect of flutica- dardized laboratory psychological stressor were found in AD sone propionate cream 0Æ05% twice daily over 3–4 weeks in patients compared with nonatopic controls, whereas basal 51 children with moderate to severe AD, no effect on basal serum cortisol levels were comparable. The possible existence serum cortisol levels was seen.19 of a defective HPA axis has been studied extensively in rheu- Evidence that factors other than topical corticosteroid use are matoid arthritis (RA). Several small studies indicate a possible responsible for aberrant HPA axis activity in patients with AD inability to mount adequate cortisol responses to inflamma- comes from a study of Matsuda et al.,20 in which children with tion. In a recent study of 50 patients with RA, Eijsbouts et al.22 AD (age 2–18 years) who did not use topical corticosteroids demonstrated that under the standardized conditions of the before evaluation were compared with children who had rou- insulin tolerance test, patients with RA have decreased plasma tinely used topical corticosteroids. Although no significant dif- cortisol levels compared with healthy controls, despite elevated ference in basal serum cortisol was found between the two levels of IL-6 in these patients. Because there was no differ- groups, basal cortisol levels and the response to ACTH of the ence in ACTH levels, the authors suggest that reduced HPA total AD group were significantly lower compared with controls. axis responsiveness may be due to a defect located at the adre- If low basal serum cortisol is not linked to prior use of top- nal level; this contrasts with what is suggested by the data of ical corticosteroids, what can be the reason for this observa- Buske-Kirschbaum et al.24 in patients with AD. In addition, tion? Matsuda et al. demonstrated that topical corticosteroid decreased activity of the HPA axis has been found in other treatment during hospitalization in a group of children with chronic inflammatory diseases, such as Crohn disease.26 AD who had not previously been treated with topical cortico- The results of our study suggest that disease activity rather steroids resulted in a significant decrease in disease activity than topical corticosteroid use is responsible for the low basal

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp979–985 Low basal serum cortisol in atopic dermatitis, I.M. Haeck et al. 985 serum cortisol levels in patients with severe AD. This hypothe- 9 Berth-Jones J. Six Area, Six Sign Atopic Dermatitis (SASSAD) sever- sis is supported by data from the literature, linking chronic ity score: a simple system for monitoring disease activity in atopic inflammatory diseases, such as AD, RA and inflammatory dermatitis. Br J Dermatol 1996; 135 (Suppl. 48): 25–30. 10 Hijnen D, De Bruin-Weller M, Oosting B et al. Serum thymus and bowel disease, to attenuated HPA axis responsiveness. activation-regulated chemokine (TARC) and cutaneous T cell- Measuring basal serum cortisol has its limitations as it attracting chemokine (CTACK) levels in allergic diseases: TARC and only reflects what occurs at the level of the adrenal gland. In CTACK are disease-specific markers for atopic dermatitis. J Allergy addition, no information is available on the responsiveness of Clin Immunol 2004; 113:334–40. the adrenal gland upon stimulation. A low basal cortisol level 11 Jahnz-Rozyk K, Targowski T, Paluchowska E et al. Serum thymus does not automatically mean that the gland is not responsive and activation-regulated chemokine, macrophage-derived chemo- to stimulation. Further research is necessary to establish if only kine and eotaxin as markers of severity of atopic dermatitis. Allergy 2005; 60:685–8. the adrenal gland is affected or if the suppression of this axis 12 Kakinuma T, Nakamura K, Wakugawa M et al. Thymus and activa- also takes place higher, at the level of the pituitary gland tion-regulated chemokine in atopic dermatitis: serum thymus and 24 and/or hypothalamus. The results of Buske-Kirschbaum et al. activation-regulated chemokine level is closely related with disease suggest that the latter could well be the case in patients with activity. J Allergy Clin Immunol 2001; 107:535–41. AD. 13 Levin C, Maibach HI. Topical corticosteroid-induced adrenocortical These findings have major implications for daily practice insufficiency: clinical implications. Am J Clin Dermatol 2002; 3:141–7. when treating patients with moderate to severe AD. Although 14 Olsen EA, Cornell RC. Topical clobetasol-17-propionate: review of its clinical efficacy and safety. J Am Acad Dermatol 1986; 15:246–55. percutaneous absorption of potent topical corticosteroids is 15 Jegasothy B, Jacobson C, Levine N et al. Clobetasol propionate ver- likely to occur, especially during the acute phase in severe AD, sus fluocinonide creams in psoriasis and eczema. Int J Dermatol the suppressive effect on adrenal gland function seems to be 1985; 24:461–5. overruled by the positive effect of adequate disease control. 16 Gilbertson EO, Spellman MC, Piacquadio DJ et al. Super potent top- Bearing these results in mind, doctors should worry more ical corticosteroid use associated with adrenal suppression: clinical about the effect of inadequate disease control than the possible considerations. J Am Acad Dermatol 1998; 38:318–21. side-effects of potent topical corticosteroids. 17 van der Meer JB, Glazenburg EJ, Mulder PG et al. The management of moderate to severe atopic dermatitis in adults with topical fluti- Finally, we advise measuring basal serum cortisol levels in casone propionate. The Netherlands Adult Atopic Dermatitis Study patients with severe AD with uncontrolled disease, with fol- Group. Br J Dermatol 1999; 140:1115–21. low-up measurements during treatment. When basal serum 18 Patel L, Clayton PE, Addison GM et al. Adrenal function following cortisol levels remain below normal level despite adequate topical steroid treatment in children with atopic dermatitis. Br J treatment, corticosteroid supplementation during stressful Dermatol 1995; 132:950–5. events, such as operations, fever or after a trauma, is advised. 19 Friedlander SF, Hebert AA, Allen DB. Safety of fluticasone propion- Further studies are needed to investigate whether attenuation ate cream 0Æ05% for the treatment of severe and extensive atopic dermatitis in children as young as 3 months. J Am Acad Dermatol of the HPA axis precedes chronic inflammation in AD or can 2002; 46:387–93. be regarded as a result of chronic inflammation. 20 Matsuda K, Katsunuma T, Iikura Y et al. Adrenocortical function in patients with severe atopic dermatitis. Ann Allergy Asthma Immunol References 2000; 85:35–9. 21 Mastorakos G, Chrousos GP, Weber JS. Recombinant interleukin-6 1 Malkinson FD, Ferguson EH. Percutaneous absorption of hydro- activates the hypothalamic–pituitary–adrenal axis in humans. J Clin cortisone-4-C14 in two human subjects. J Invest Dermatol 1955; Endocrinol Metab 1993; 77:1690–4. 25:281–3. 22 Eijsbouts AM, van den Hoogen FH, Laan RF et al. Hypothalamic– 2 Malkinson FD, Ferguson EH, Wang MC. Percutaneous absorption pituitary–adrenal axis activity in patients with rheumatoid arthritis. of cortisone-4-C14 through normal human skin. J Invest Dermatol Clin Exp Rheumatol 2005; 23:658–64. 1957; 28:211–16. 23 Farsky SP, Sannomiya P, Garcia-Leme J. Secreted glucocorticoids 3 Fleischmajer R. The lack of systemic hydrocortisone effects after regulate leukocyte-endothelial interactions in inflammation. A massive and prolonged external applications. J Invest Dermatol 1961; direct vital microscopic study. J Leukoc Biol 1995; 57:379–86. 36:11–16. 24 Buske-Kirschbaum A, Geiben A, Hollig H et al. Altered responsive- 4 Turpeinen M, Lehtokoski-Lehtiniemi E, Leisti S et al. Percutaneous ness of the hypothalamus–pituitary–adrenal axis and the sympa- absorption of hydrocortisone during and after the acute phase of thetic adrenomedullary system to stress in patients with atopic dermatitis in children. Pediatr Dermatol 1988; 5:276–9. dermatitis. J Clin Endocrinol Metab 2002; 87:4245–51. 5 Katz HI. Topical corticosteroids. Dermatol Clin 1995; 13:805–15. 25 Buske-Kirschbaum A, Jobst S, Psych D et al. Attenuated free cortisol 6 Scoggins RB, Kliman B. Percutaneous absorption of corticosteroids: response to psychosocial stress in children with atopic dermatitis. systemic effects. N Engl J Med 1965; 273:831–40. Psychosom Med 1997; 59:419–26. 7 Hengge UR, Ruzicka T, Schwartz RA et al. Adverse effects of topical 26 Straub RH, Cutolo M. Involvement of the hypothalamic–pituitary– glucocorticosteroids. J Am Acad Dermatol 2006; 54:1–15. adrenal/gonadal axis and the peripheral nervous system in rheuma- 8 Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. toid arthritis: viewpoint based on a systemic pathogenetic role. Acta Derm Venereol Suppl (Stockh) 1980; 92:44–7. Arthritis Rheum 2001; 44:493–507.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp979–985 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07760.x Treatment of axillary hyperhidrosis with botulinum toxin type A reconstituted in lidocaine or in normal saline: a randomized, side-by-side, double-blind study J. Vadoud-Seyedi and T. Simonart Department of Dermatology, Erasme University Hospital, 808 Route de Lennik, B-1070 Brussels, Belgium

Summary

Correspondence Background Botulinum toxin type A represents a safe and effective treatment for J. Vadoud-Seyedi. primary axillary hyperhidrosis. One of the most troublesome disadvantages asso- E-mail: [email protected] ciated with this therapy is pain at the injection sites. Reconstitution of botulinum toxin A in a solution of lidocaine could be an easy alternative procedure to Accepted for publication 11 November 2006 reduce the discomfort associated with those injections. However, the current recommendations are that botulinum toxin A should be reconstituted in normal Key words saline. botulinum toxin, hyperhidrosis, lidocaine, pain, Objectives To compare the efficacy and tolerance profile of saline-diluted botulinum randomized controlled trial toxin A and lidocaine-diluted botulinum toxin A in patients with axillary hyper- Conflicts of interest hidrosis. None declared. Methods In a double-blind, side-by-side, controlled, randomized clinical trial, 29 patients were injected with 100 mouse units of botulinum toxin A (Botox; Allergan Pharmaceuticals Ireland, Westport, Ireland) reconstituted in lidocaine into one axilla and with the same dosage of the toxin, reconstituted in an equal volume of saline, into the other axilla. The patients were followed up for 8 months. Quantification of sweat production was performed by iodine-starch tests and by the patients’ own rating of sweating. The intensity of pain associated with the botulinum toxin intracutaneous injections was self-assessed by the patients and was evaluated using a 100-mm visual analogue scale. Results Botulinum toxin A diluted in normal saline and botulinum toxin A diluted in lidocaine were similarly effective in terms of control of onset of sweat production, duration of effect and subjective percentage of mean decrease in sweating. Both treatments were well tolerated, and there were no lasting or severe adverse effects. However, the mean ± SD pain score during the procedure was significantly lower in the axillae treated with lidocaine-reconstituted botulinum toxin than in the axillae treated with saline-reconstituted botulinum toxin (29Æ3±20Æ1 vs. 47Æ5±24Æ0; P ¼ 0Æ0027). Conclusions Short- and long-term results show the equal effectiveness of botulinum toxin A reconstituted in saline or in lidocaine. However, because injections of botulinum toxin A reconstituted in lidocaine are associated with significantly reduced pain, lidocaine-reconstituted botulinum toxin A may be preferable for treating axillary hyperhidrosis.

Primary hyperhidrosis is an autonomic neuronal dysfunction severe hyperhidrosis who are not responding to topical ther- that can result in uncontrollable, excessive sweating which apies, such as over-the-counter antiperspirants and topical tends to occur in areas with a greater concentration of eccrine aluminium chloride hexahydrate.3–6 Botulinum toxin A is the glands, such as the axillae, palms and soles.1 It can lead to most widely used and studied type of botulinum toxin for embarrassing social and occupational situations and can have a treating this condition. Botulinum toxin A affects the excessive psychosocial impact on the patients affected.2 sweat production by blocking the release of acetylcholine from There is now a large body of literature documenting the presynaptic membranes. The spectrum of possible adverse successful use of botulinum toxin type A in patients with effects of botulinum toxin A is broad but fortunately those

2007 The Authors 986 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp986–989 Botulinum toxin A in lidocaine vs. saline for hyperhidrosis, J. Vadoud-Seyedi and T. Simonart 987 that have been observed with hyperhidrosis treatment are gen- variation in sweat production (i.e. due to stress) may affect erally mild and transient. There are so far no unexpected the interpretation of this test as well as that of more quantita- adverse events associated with repeated injections over the tive ones, such as planimetry or gravimetry, the intensity of years. One of the most troublesome disadvantages associated hyperhidrosis was also self-assessed by the patients using a vis- with botulinum toxin treatment remains pain at the injection ual analogue scale (VAS) of 100 points for each axilla (0 ¼ sites.3,4,6 Several procedures have been proposed to reduce the no effect of the treatment on sweating; 100 ¼ total anhidro- discomfort associated with those injections.7,8 Peripheral nerve sis). The intensity of pain associated with the botulinum toxin blockade is the most effective method to reduce discomfort, injections (i.e. pain experienced during the injections and less providing greater anaesthesia than that given by topical anaes- immediate ache experienced a few minutes after) in each thetic cream under occlusion and ice.7 However, this proce- axilla was self-assessed by the patients and was also evaluated dure has potential drawbacks: vascular puncture, impaired using a 100-mm VAS.14 In order to evaluate the global dis- hand dexterity, and nerve scarring from repeated injuries.7 comfort sensation associated with the procedure (i.e. pain Moreover, this method is not feasible in certain anatomical experienced during the injections and less immediate ache sites, such as the axillae. An easy alternative technique might experienced a few minutes after), the VAS pain scores were be to reconstitute botulinum toxin A in a solution of lido- recorded 2 h after the injections. Comparisons were made by caine. However, normal saline is the manufacturer’s suggested the Wilcoxon rank-sum test. diluent.9 Analogously, the experts’ current recommendations are that botulinum toxin A should be reconstituted in sal- Results ine.6,10–12 There is still neither pharmaceutical nor bibliogra- phic evidence that reconstitution of botulinum toxin A in No differences were found at baseline between axilla groups lidocaine jeopardizes toxin potency. to be treated with saline-reconstituted or lidocaine-reconstitu- The present study was carried out to compare the efficacy ted botulinum toxin A. Two weeks after botulinum toxin and tolerance profiles of botulinum toxin A reconstituted in a treatment, sweat production was significantly reduced in all solution of lidocaine with botulinum toxin A reconstituted in patients, with most participants reporting a cessation of sweat- saline. ing in both axillae in less than 1 week (range 2–10 days, mean 5). The subjective onset of sweat production control Patients and methods was the same in both axilla groups. Duration of anhidrosis in the axillae ranged from 4 to 7 months (mean 5Æ6). There We treated 29 adult patients (two men and 27 women; age was no difference in the duration of control of sweat pro- range 18–60 years, mean 33) who met the following criteria: duction between botulinum toxin diluted in normal saline a history of excessive axillary perspiration of more than and botulinum toxin diluted in lidocaine (mean ± SD 1 year, and failure of 4 weeks of topical therapy with 20% 5Æ63 ± 0Æ69 months and 5Æ60 ± 0Æ80 months, respectively; aluminium chloride solutions applied daily. The exclusion cri- P ¼ 0Æ8125). Analogously, the subjective percentage of mean teria included the presence of neuromuscular disease, organic decrease in sweating did not differ between both axilla groups causes of hyperhidrosis such as hyperthyroidism, concomitant at any time of the follow-up. therapy for hyperhidrosis, intake of drugs affecting muscle Injections of botulinum toxin were well tolerated, and there tone or the autonomic nervous system, pregnancy, or presence was no serious adverse event during the 8 months of follow- of malignancy. The study followed a double-blind, random- up. The main adverse effect was pain during the injections. ized, comparative design. After randomization and written According to a VAS, seven patients reported no pain during the informed consent, the participants were injected with botu- injections of botulinum toxin reconstituted in lidocaine while linum toxin A (Botox; Allergan Pharmaceuticals Ireland, West- only one reported no pain during the injections of botulinum port, Ireland) diluted in 5 mL of 0Æ9% sterile normal saline in toxin reconstituted in normal saline. The mean ± SD pain one axilla and with botulinum toxin A diluted in 5 mL of score during the procedure was 47Æ5±24Æ0 in the saline- 2% lidocaine chlorhydrate contralaterally. A total dose of 100 reconstituted botulinum toxin group and 29Æ3±20Æ1 in the mouse units (MU) of botulinum toxin A was injected in both lidocaine-reconstituted botulinum toxin group (P ¼ 0Æ0027). axillae into 16 ± 2 different sites, following a spiral pattern, No patient withdrew from the study for treatment-related beginning at the periphery of the hair-bearing skin and circ- reasons. Minor adverse effects included haematoma (n ¼ 2 for ling into the centre of the axillary vault. Both axillae were axillae treated with botulinum toxin diluted in normal saline treated during the same session with the same number of and n ¼ 1 for axillae treated with botulinum toxin diluted in injections and the same volume of the drug. All patients were lidocaine) and mild fatigue after injection (n ¼ 1). treated by the same physician (J.V.-S.). The efficacy and tolerability of the two preparations were assessed 2 weeks after the Discussion injections and then monthly for up to 8 months or until sweating returned to baseline. At each visit, the area of hyper- Treating the axillary skin with intradermal injections of botu- hidrosis was visualized by the semiquantitative iodine-starch linum toxin A through a 30-gauge hypodermic needle test, as previously reported.13 As circadian and day-to-day can be accomplished without anaesthesia in most patients.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp986–989 988 Botulinum toxin A in lidocaine vs. saline for hyperhidrosis, J. Vadoud-Seyedi and T. Simonart

However, pain remains the most common side-effect as well lidocaine could be associated with an increased risk of as the most common limiting factor associated with botu- hypersensitivity reaction. linum toxin injections.3,4,6 The factors involved in pain Based on the results of our study, we conclude that recon- induced by botulinum toxin injections pain are not fully stitution of botulinum toxin A in lidocaine jeopardizes neither understood but may be associated with the volume injected, the short-term nor the long-term results achieved with botu- the concentration of active or inactive protein, or the pH of linum toxin in the treatment of axillary hyperhidrosis. How- the solution. Reconstitution of botulinum toxin in lidocaine ever, reconstitution of botulinum toxin A in lidocaine was could be an easy way to reduce the discomfort associated associated with significantly reduced pain during the injec- with botulinum toxin injections but the current guidelines tions, suggesting that lidocaine can be added to botulinum are that botulinum toxin should be reconstituted in normal toxin. This procedure could also be evaluated for patients with saline.6,9–12 To our knowledge, no study has investigated the palmar or plantar hyperhidrosis. However, further studies are anhidrotic effect of botulinum toxin after reconstitution in needed to determine if this procedure could replace peripheral lidocaine. nerve blockade for the treatment of palmar or plantar hyper- We conducted here a randomized clinical trial of a side- hidrosis. by-side comparison with 100 MU of botulinum toxin A diluted in normal saline with 100 MU of botulinum toxin References A diluted in lidocaine in patients with axillary hyperhidrosis. Various botulinum toxin dosages have been reported in the 1 Sato K, Kang WH, Saga K, Sato KT. Biology of sweat glands and literature.6 The dose of 100 MU was chosen because high- their disorders. II. Disorders of sweat gland function. J Am Acad dose botulinum toxin A may be associated with a lower Dermatol 1989; 20:713–26. 2 Weber A, Heger S, Sinkgraven R et al. Psychosocial aspects of relapse rate and with a prolongation of the antihidrotic 12 patients with focal hyperhidrosis. Marked reduction of social pho- effect. Both preparations were found to be equally effective bia, anxiety and depression and increased quality of life after in reducing the sweating initially and in the duration of the treatment with botulinum toxin A. Br J Dermatol 2005; 152:342– anhidrosis. This was demonstrated by objective measurements 5. as well as by subjective ratings, showing that lidocaine does 3 Schnider P, Binder M, Kittler H et al. A randomized, double-blind, not alter botulinum toxin in reducing sweat production. Very placebo-controlled trial of botulinum A toxin for severe axillary few data are available on the stability of botulinum toxin hyperhidrosis. Br J Dermatol 1999; 140:677–80. 4 Vadoud-Seyedi J, Heenen M, Simonart T. Treatment of idiopathic after reconstitution in a local anaesthetic for indications other palmar hyperhidrosis with botulinum toxin. Report of 23 cases than hyperhidrosis. Gassner and Sherris previously showed and review of the literature. Dermatology 2001; 203:318–21. that the injection of botulinum toxin reconstituted in lido- 5 Lowe N, Campanati A, Bodokh I et al. The place of botulinum caine with adrenaline provided the same paralysing effect on toxin type A in the treatment of focal hyperhidrosis. Br J Dermatol the injected muscle as the same dosage of the toxin reconsti- 2004; 151:1115–22. tuted in an equal volume of saline,15 which is in line with 6 Glogau RC. Treatment of hyperhidrosis with botulinum toxin. our results. However, although the efficacy of normal saline- Dermatol Clin 2004; 22:177–85. 7 Hayton MJ, Stanley JK, Lowe NJ. A review of peripheral nerve reconstituted botulinum toxin and lidocaine-reconstituted blockade as local anaesthesia in the treatment of palmar hyper- botulinum toxin were indistinguishable, the discomfort asso- hidrosis. Br J Dermatol 2003; 149:447–51. ciated with the injections was significantly lower after the 8 O’Riordan JM, Fitzgerald E, Gowing C et al. Topical local anaes- toxin was diluted in lidocaine. Because botulinum toxin thetic (tetracaine) reduces pain from botulinum toxin injections usually induces a complete, but temporary, anhidrosis, this for axillary hyperhidrosis. Br J Surg 2006; 93:713–14. procedure can make the prospect of repeated injections more 9 Allergan Inc. Botox Package Insert. Westport, County Mayo: palatable for the patients. Allergan Pharmaceuticals Ireland, 2000. 10 Heckmann M, Plewig G; Hyperhidrosis Study Group. Low-dose Lidocaine-reconstituted botulinum toxin appeared as safe efficacy of botulinum toxin A for axillary hyperhidrosis: a random- as saline-reconstituted botulinum toxin. Previous trials ized, side-by-side, open-label study. Arch Dermatol 2005; 141:1255– showed that botulinum toxin injections for axillary hyper- 9. hidrosis were generally well tolerated. Perceived increases in 11 Glaser DA. Treatment of axillary hyperhidrosis by chemodenerva- nonaxillary sweating and transient hand muscle weakness tion of sweat glands using botulinum toxin type A. J Drugs Dermatol have been noted in some patients.5 No severe allergic reac- 2004; 3:627–31. tions have been reported in studies of axillary hyperhidrosis.5 12 Wollina U, Karamfilov T, Konrad H. High-dose botulinum toxin type A therapy for axillary hyperhidrosis markedly pro- Lidocaine is used worldwide in various clinical specialties longs the relapse-free interval. J Am Acad Dermatol 2002; and some patients claim to be allergic to this drug. Never- 46:536–40. theless, true hypersensitivity reactions to lidocaine are con- 13 Naumann M, Hofmann U, Bergmann I et al. Focal hyperhidrosis: sidered to be very rare.16,17 Although a case of fatal effective treatment with intracutaneous botulinum toxin. Arch anaphylaxis associated with a Botox–lidocaine mixture given Dermatol 1998; 134:301–4. to a woman for chronic neck and back pain was previously 14 Carlsson AM. Assessment of chronic pain. I. Aspects of the reli- reported,18 there are, to our knowledge, no immunological ability and validity of the visual analogue scale. Pain 1983; 16:87–101. data suggesting that reconstitution of botulinum toxin in

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp986–989 Botulinum toxin A in lidocaine vs. saline for hyperhidrosis, J. Vadoud-Seyedi and T. Simonart 989

15 Gassner HG, Sherris DA. Addition of an anesthetic agent to 17 Amsler E, Flahault A, Mathelier-Fusade P, Aractingi S. Evaluation of enhance the predictability of the effects of botulinum toxin type A re-challenge in patients with suspected lidocaine allergy. Dermatology injections: a randomized controlled study. Mayo Clin Proc 2000; 2004; 208:109–11. 75:701–4. 18 Li M, Goldberger BA, Hopkins C. Fatal case of BOTOX-related 16 Berkun Y, Ben-Zvi A, Levy Y et al. Evaluation of adverse reactions anaphylaxis? J Forensic Sci 2005; 50:169–72. to local anesthetics: experience with 236 patients. Ann Allergy Asthma Immunol 2003; 91:342–5.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp986–989 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07800.x Rituximab in the adjuvant treatment of pemphigus vulgaris: a prospective open-label pilot study in ﬁve patients M.S.Y. Goh,* C. McCormack,* H.V. Dinh, B. Welsh, P. Foley and H.M. Prince§ *Dermatology Service and §Clinical Cancer Services, Peter MacCallum Cancer Centre, Locked Bag 1, A’Beckett Street, Melbourne, Vic. 8006, Australia Department of Dermatology and The University of Melbourne Department of Medicine, St Vincent’s Hospital Melbourne, 41 Victoria Parade, Fitzroy, Vic. 3065, Australia

Summary

Correspondence Background Rituximab is a monoclonal antibody directed against the CD20 antigen H. Miles Prince. expressed on B lymphocytes. There are reports of its efficacy in the treatment of E-mail: [email protected] autoimmune diseases, including pemphigus. Objectives Prospectively to evaluate the efficacy of rituximab as adjuvant treatment Accepted for publication for pemphigus vulgaris (PV). 15 November 2006 ) Methods Patients with PV were treated with intravenous rituximab (375 mg m 2) Key words weekly for 4 weeks in this prospective open-label pilot study. Other concurrent autoimmune, CD20, immunobullous, immunosuppression was continued. immunosuppression, pemphigus vulgaris, rituximab Results Of five patients, one achieved complete remission and was able to cease all Conflicts of interest medication, while two achieved clearance of clinical lesions but continued on None declared. systemic therapy. Two patients had progressive disease. Time to response was 2–8 months, with a 13- to 18-month response duration. Response was associated with reduction in serum antiepithelial antibodies. Two patients had significant infectious complications (one developed community-acquired pneumonia associated with delayed-onset neutropenia and the other developed cytomegalovirus infection). Conclusions Rituximab has shown efficacy in the treatment of PV. Patients on multiple immunosuppressives should be closely monitored for infectious complications.

Pemphigus vulgaris (PV) is an acquired autoimmune blister- tomyositis.2,4,7–9 The rationale for its use in autoimmune dis- ing disorder characterized by autoantibodies to desmoglein orders is the selective targeting of pathogenic B cells, thought 3, a desmosomal adhesion molecule.1 The adverse effects of to be responsible for autoantibody production, antigen presen- long-term treatment with corticosteroids and other immuno- tation and T-cell costimulation.2,6,7 suppressive drugs are major causes of morbidity and mor- Since 2001, there have been promising reports of rituximab tality.1 Thus, safe and effective alternative therapies are in the treatment of PV (17 cases), pemphigus foliaceus (three needed. cases) and paraneoplastic pemphigus (five cases).3,6,7,10–12 Rituximab is a chimeric monoclonal antibody directed Apart from one recent prospective study on four patients with against the B-cell-restricted CD20 antigen. The B-cell-specific PV,13 reports to date have been limited to retrospective case transmembrane glycoprotein CD20 plays a role in B-cell dif- reports of one to three patients only, many involving patients ferentiation and activation.2,3 The binding of rituximab to with very extensive disease. This open-label pilot study aimed CD20 results in B-cell depletion via several mechanisms, prospectively to evaluate formally the efficacy of rituximab in including antibody-dependent cellular cytotoxicity, comple- the adjuvant treatment of PV. ment-mediated cell lysis and induction of apoptosis.3–6 Ritux- imab is classically used for the treatment of CD20+ B-cell Patients and methods indolent and aggressive lymphomas either alone or in combination with chemotherapy.5 It has recently shown promising Eligibility criteria efficacy in several autoimmune disorders, including immune thrombocytopenic purpura, autoimmune haemolytic anaemia, All patients required a diagnosis of PV established by cli- rheumatoid arthritis, systemic lupus erythematosus and derma- nical, histological and direct immunofluorescence findings.

2007 The Authors 990 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 Rituximab in pemphigus vulgaris, M.S.Y. Goh et al. 991

Patients had mucocutaneous bullae or erosions, suprabasal Assessment of response acantholysis and blister formation on biopsy with intercellular IgG deposition.1 At study entry patients were required to Patients were reviewed clinically and with laboratory monitor- have persistent disease (i) with failure to respond to oral ing 1 and 3 months following treatment, and 3-monthly corticosteroids or (ii) requiring more than 10 mg daily dose thereafter. The response criteria were as follows:13,15 (i) com- of prednisolone or its equivalent or (iii) requiring additional plete remission (CR), absence of clinical disease activity with- immunosuppressive therapy or (iv) with inability to tolerate out further systemic treatment; (ii) clinical remission on oral corticosteroids. All patients were over 16 years, had a medication (CRM), absence of clinical disease but continuing

Eastern Cooperative Oncology Group performance status on systemic treatment; (iii) partial response in skin (PRS), £3,14 had no serious active infection requiring systemic reduction in number of body sites involved by at least two, or antimicrobial therapy, and were able to comprehend a writ- reduction in the body surface area involved by at least 50%; ten consent form. This open-label pilot study was approved (iv) partial reduction in medication requirements (PRM), by the Peter MacCallum Cancer Centre Ethics Committee, reduction in prednisolone dose or other immunosuppression and written informed consent was obtained from all by at least 50% (note: to meet PRM patients were allowed to patients. have unchanged skin lesions); (v) progressive disease (PD), any increase in medication or extent of skin involvement; and (vi) stable disease (SD), not meeting any of the above criteria. Ritiuximab administration The DSS was used as an indicator of improvement or pro- Rituximab was administered intravenously at a dosage of gression but was not used as a means of assessing response ) 375 mg m 2 once weekly for 4 weeks. The day of the first status. The time to response was defined as the time to a infusion was denoted day 1. Premedication with oral paraceta- reduction in number of body sites involved by at least two, or mol and loratadine was administered prior to infusions. No reduction in surface area involvement by at least 50%, or corticosteroids were used as premedication. reduction in prednisolone dose by at least 50% from baseline. The time to progression or relapse was defined as the time to an increase in clinical disease or dose of medication compared Laboratory evaluations with the best response. Laboratory evaluation at baseline included full blood examination, renal function and electrolytes, liver function tests, peri- Statistical analyses pheral B and T lymphocyte quantitation (by flow cytometry analysis using monoclonal antibodies to CD19, CD3, CD4 and The paired t-test was used for statistical analyses and P £ 0Æ05 CD8), serum immunoglobulin levels, and serum antiepithelial was considered statistically significant. antibodies assessed by indirect immunofluorescence on mon- key oesophagus epithelia. Results

Assessment of disease severity Patient population

Disease severity was graded to a disease severity score (DSS) Patient demographics and treatment history are summarized in of 0–10, based on extent of disease and intensity of therapy, Table 2. Five patients (three men and two women) were trea- adapted from Herbst and Bystryn for PV15 (Table 1). ted with rituximab while continuing on their concurrent

Table 1 Disease severity score (DSS)a Extent of disease (number of sites Prednisolone dose Score involved) (mg daily) Other immunosuppressive drugs (daily dose) 00 0 0 1 1 <15 Aza £ 100 mg, CyA £ 200 mg, MMF £ 1g 2 2–3 15–49 Aza > 100 mg, CyA > 200 mg, MMF > 1 g 3 4–5 50–89 4 ‡ 6 ‡ 90

DSS graded on a 0–10 score, derived from the sum of grades for the extent of disease, dose of prednisolone and other immunosuppression required. The extent of disease was graded 0–4 by the number of sites involved with one or more lesions (scalp, face/neck, upper torso, lower torso, upper limbs, lower limbs, oral mucosa, other mucosa). Intensity of therapy was graded 0–6 according to the dose of prednisolone (0–4) and immunosuppressive therapy (0–2). Aza, azathioprine; CyA, ciclosporin; MMF, mycophenolate mofetil. aAdapted from Herbst and Bystryn.15

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 992 Rituximab in pemphigus vulgaris, M.S.Y. Goh et al.

Table 2 Patient demographics, disease and treatment history

Age Disease Concurrent treatment at Extent of disease at day 1, (years)/ duration Previous treatment, maximum day 1, daily dose (duration body surface area Patient sex (months) doses, duration of drug, months) involved (%) ) 1 48/M 22 PNL 0Æ11 mg kg 1 (10) Severe oral and nasal MMF 3 g (9) mucosa (1%) CyA 400 mg (6) ) 2 62/F 96 Aza 50 mg daily, 1 month PNL 0Æ25 mg kg 1 (96) Oral mucosa (1%) Intramuscular gold 25 mg weekly, MMF 3 g (56) 3 weeks CyA 300 mg daily, 4 months ) IVIg 1 g kg 1, three times Plasmapheresis, 5 days Intravenous CP 500 mg per month, 3 months ) 3 57/M 2 Aza 150 mg daily, 1 month PNL 1Æ0mgkg 1 (2) Scalp, face, upper and CyA 200 mg (0Æ5) lower torso, severe oral (<5%) ) 4 46/F 43 Intravenous CP 1500 mg monthly, PNL 0Æ65 mg kg 1 (43) Scalp, face, upper and 6 months Aza 150 mg (35) lower torso, upper limbs, oral mucosa (<5%) ) 5 57/M 43 Aza 100 mg daily, 2 months PNL 0Æ20 mg kg 1 (34) Oral, nasal, laryngopharyngeal mucosa (1%)

PNL, prednisolone; MMF, mycophenolate mofetil; CyA, ciclosporin; Aza, azathioprine; IVIg, intravenous immunoglobulin; CP, cyclophosphamide.

Table 3 Response to rituximab

Time to Medication at time Time to Follow-up Current Best response of response (daily progression duration Current treatment extent of Patient response (months) dose) (months) (months) (daily dose) disease ) 1 PD NA NA 5 18 PNL 0Æ04 mg kg 1 Nil )1 )1 2CRM 7 PNL 0Æ23 mg kg NA 18 PNL 0Æ05 mg kg Nil MMF 3 g MMF 1 g ) 3 PD NA NA 2 17 PNL 0Æ04 mg kg 1 Upper torso MMF 3 g )1 )1 4CRM 2 PNL 0Æ43 mg kg NA 18 PNL 0Æ05 mg kg Nil Aza 150 mg Aza 75 mg ) 5 CR 8 PNL 0Æ09 mg kg 1 NA 13 Nil Nil

PD, progressive disease; NA, not applicable; PNL, prednisolone; CRM, absence of clinical disease but on systemic treatment; MMF, mycophenolate mofetil; Aza, azathioprine; CR, complete remission on no other treatment.

immunosuppression regimen. The median age was 57 years cessation of prednisolone at 13 months. Two patients achieved (range 46–62). remission of clinical disease while continuing on medication

(CRM, patients 2 and 4; Fig. 2). The time to clinical response ranged between 2 and 8 months. The duration of clinical Clinical response improvement was 13–18 months following rituximab. Two Clinical progress is detailed in Table 3 and Figure 1. One patients were considered to have PD, requiring the introduc- patient (patient 5) had CR with absence of clinical disease and tion of additional agents – intravenous immunoglobulin at

) Fig 1. Data following rituximab treatment for ﬁve patients showing peripheral blood CD19+ B-cell counts (normal range 0Æ10–0Æ60 · 109 L 1), ) serum antiepithelial antibody titre (1: titre), prednisolone dose (mg kg 1 daily), and disease severity score as detailed in Table 1. Arrows indicate timing of changes in medication and dose. MMF, mycophenolate mofetil (g daily); CyA, ciclosporin (mg daily); IVIg, intravenous ) immunoglobulin 2 g kg 1; Aza, azathioprine (mg daily).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 Rituximab in pemphigus vulgaris, M.S.Y. Goh et al. 993

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 994 Rituximab in pemphigus vulgaris, M.S.Y. Goh et al.

(a) Serum immunoglobulin levels There were mild transient reductions in IgG and IgM levels in three and four patients, respectively, but these were not signi- ﬁcant (P ‡ 0Æ24).

T-cell subsets

Peripheral blood CD4+ and CD8+ T-cell counts were not affected by rituximab. Patient 3, who was previously on azathioprine and concurrently on ciclosporin, had profoundly suppressed CD4+ and CD8+ T cells at baseline measurement ) (0Æ05 and 0Æ02 · 109 L 1, respectively) (normal ranges: ) ) CD4 0Æ45–1Æ8 · 109 L 1, CD8 0Æ20–1Æ15 · 109 L 1). For this (b) patient, both the CD4+ and CD8+ counts remained below ) normal range (CD4 0Æ28–0Æ43 · 109 L 1; CD8 0Æ12–0Æ17 · ) 109 L 1) until 17 months, where recovery of counts occurred in association with reduction in prednisolone and cessation of ciclosporin. Patient 4 also had a suppressed CD4+ count at ) baseline (0Æ12 · 109 L 1), but this recovered to normal by month 2.

Adverse effects

All patients tolerated rituximab infusions without immediate adverse effects. Three patients had transient mild treatment- related fatigue. Fig 2. Patient 2 with pemphigus vulgaris. (a) Oral mucosal ulcers Patients 1 and 3 required hospital admission for the treat- before treatment with rituximab and (b) healing of ulcers from ment of opportunistic infections. At 19 weeks, neutropenia 7 months following rituximab treatment, with response sustained to occurred in patient 1, complicated by community-acquired 18 months of follow-up. pneumonia. Neutrophil recovery occurred 7 days following cessation of mycophenolate mofetil and administration of fil- grastim. The neutropenic episode lasted 10 days with a nadir ) 5 months for patient 1, and mycophenolate mofetil at count of 0Æ6 · 109 L 1 on day 6. Intravenous immuno- 2 months for patient 3. These two patients subsequently globulin was also administered for severe PV oral ulcers. achieved clinical improvement and reduction in medication Patient 3 with low CD4+ T-cell counts as detailed above requirement; it is likely that the additional agents were was diagnosed with cytomegalovirus (CMV) gastritis at responsible for their improvement. 11 weeks and was treated with intravenous ganciclovir for 2 weeks. At 18 weeks there was relapse of CMV infection, with active CMV retinitis and gastritis, and this was treated B-cell depletion with intravenous ganciclovir for 3 weeks, and he continued Lymphocyte subset evaluations showed profound CD19+ thereafter on prophylactic oral valganciclovir. B-cell depletion to undetectable levels in all five patients, with rapidly undetectable B cells at 1 month after completion of Discussion treatment in four patients (Fig. 1). B-cell numbers remained suppressed in four patients at the end of the follow-up period, This is the largest study to date of rituximab as adjuvant ther- and had just returned to the normal range at 18 months in apy for PV. Although the extent of disease involvement at patient 1. baseline was low in our cohort, with <5% body surface area involvement, all patients had disease activity at significant sites affecting quality of life (oral ulcers in all patients) and had Serum antiepithelial antibody titre adverse effects related to long-term prednisolone use. There was a reduction in serum antiepithelial antibody titre Three of five patients achieved clinical improvement with in four patients with PV, which remained suppressed to the rituximab, with time to response varying between 2 and end of follow-up (patients 2, 3, 4, 5; Fig. 1). Flare of oral 8 months, and with response maintained for 13–18 months mucosal disease in patient 1 at 4 months corresponded with a of follow-up. Other reports have also shown a variable marked increase in antibody titre. time to clinical response from 1 to 20 weeks,6,10,13 and the

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 Rituximab in pemphigus vulgaris, M.S.Y. Goh et al. 995 duration of complete remission following a course of ritu- solone, ciclosporin and mycophenolate mofetil. It has been ximab from 3 to 36 months.3,6,7,13 Studies have demonstrated postulated that the development of delayed-onset neutropenia that depletion of peripheral B cells after rituximab is usually following rituximab may be related to immunological pertur- rapid and prolonged,3,5,7,13 correlating with clinical remission bation as a result of lymphocyte subset imbalance or aberrant (e.g. in systemic lupus erythematosus or PV),2,7 with gradual B-cell reconstitution.17 recovery of B cells usually after 6–12 months.5,7 The results of Patient 3 had CMV infection 11 weeks following rituximab. this study support this, with B-cell suppression persisting for It is of note that he had significantly suppressed CD4+ ) 13–18 months. It is tempting therefore to consider the possi- T lymphocyte count (0Æ05 · 109 L 1, normal range 0Æ45– ) bility of maintenance therapy for future studies. Data to date 1Æ8 · 109 L 1), and was also on prednisolone, ciclosporin suggest that if maintenance therapy is to be considered it and mycophenolate mofetil. CMV is a well-described should commence within 12 months of initial therapy. pathogen in patients with severe T-cell immunodeficiency, A reduction in serum antiepithelial antibody titre was such as transplant and human immunodeficiency virus ) observed in four patients, which remained suppressed to the patients, especially when CD4+ counts are <0Æ05 · 109 L 1.18 end of follow-up. Moreover, a flare of oral mucosal disease in Indeed, large studies to date have shown a favourable safety patient 1 at 4 months corresponded with a marked increase in profile for rituximab, with no overall significant increase in antibody titre. PV disease activity has been shown to correlate the rate and type of infections compared with controls in with levels of pathogenic autoantibodies, which directly inter- patients with lymphoma and rheumatoid arthritis.2,5 Taken fere with desmosomal function.1 together, it is likely that the bacterial infection and CMV Despite effective B-cell depletion, total IgG and IgM were infection we observed in this study were either unrelated to not significantly affected. This is consistent with other stud- rituximab or precipitated by the combination of this B-cell ies.5 CD20 is expressed solely on the B-cell lineage, and is not suppressive agent on top of already existing T-cell suppres- expressed on mature plasma cells or haematopoietic stem sion. To support the latter hypothesis, there have been several cells.2,6 The selective action of rituximab on B-cell depletion reports of severe, including some disseminated and fatal, alone allows preservation of immunoglobulin production by opportunistic infections associated with rituximab in patients plasma cells and eventual B-cell recovery from stem cells.2 It with other immunosuppression, lymphoma or transplantation; has been hypothesized that the autoantibodies produced by these include CMV, papovavirus-associated progressive multi- plasma cells may be less pathogenic than those produced by focal leucoencephalopathy, varicella-zoster virus, hepatitis B the activated B cells, or that there are other mechanisms in virus and cutaneous Mycobacterium chelonae.3,5,12,19 In PV, there effect, which account for clinical response despite unchanged are single reports of community-acquired pneumonia, total immunoglobulin levels.6,16 Pseudomonas aeruginosa arthritis, multiorganism septicaemia Rituximab is usually well tolerated with few adverse effects (P. aeruginosa, Enterococcus faecalis, Staphylococcus aureus), and fatal and low toxicity.3,5,6 No serious adverse rituximab infusion Pneumocystis carinii pneumonia after rituximab, also in conjunc- reactions were seen in any of our patients. Unlike in lymph- tion with other immunosuppressive agents.3,6 Thus, although oma where systemic infusion reactions are observed, particu- single-agent rituximab in the setting of lymphoma therapy is larly in the setting of high tumour burden, adverse reactions very rarely associated with infectious complications, vigilance are uncommon when rituximab is used to treat autoimmune is warranted in patients with PV who have/are receiving disease.7 concomitant immunosuppression. Two patients in our study had infectious complications. This study demonstrates the promising efficacy of ritu- Patient 1 who was on concurrent prednisolone, ciclosporin ximab as adjuvant therapy for PV, in inducing remission and and mycophenolate mofetil had neutropenia with commu- reducing the requirements for immunosuppressive drugs. nity-acquired pneumonia at 19 weeks. Neutropenia following This latter effect could potentially translate into a reduction rituximab treatment is relatively rare and has been described in treatment-related morbidity. Further studies are warranted to be both of early onset (within 30 days) and of delayed to examine the role of rituximab in patients requiring onset (more than 30 days after the last infusion).5,17 None immunosuppressive medications which probably should of our patients had early neutropenia during or within incorporate some form of maintenance strategy. One could 30 days of treatment. In a retrospective study on 53 conse- postulate that using this agent prior to exposure to classic cutive patients, the incidence of delayed-onset grade 4 neu- T-cell immunosuppressive agents may reduce the risk of ) tropenia (neutrophils <0Æ5 · 109 L 1) was 13%, occurring iatrogenic infection. from 32 to 168 days after the last rituximab infusion, with a 17 median of 122 days. The cause for the neutropenic episode Acknowledgments in patient 1 is likely to be multifactorial. The recovery in neutrophil counts following cessation of mycophenolate This was an investigator-driven study. Study drug (rituximab) mofetil implicates this drug. However, rituximab-induced was supplied by Roche Products Limited, Australia. The delayed-onset neutropenia is more likely, because there had authors thank Jill Davison for her role as research nurse and been no previous episodes of neutropenia in the 6 months data management and the nursing staff at Peter MacCallum prior to rituximab, while he was on treatment with predni- Cancer Centre for their patient care.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 996 Rituximab in pemphigus vulgaris, M.S.Y. Goh et al.

References 11 Herr AL, Hatami A, Kokta V et al. Successful anti-CD20 antibody treatment of pemphigus foliaceus after unrelated cord blood trans- 1 Harman KE, Albert S, Black MM. Guidelines for the management plantation. Bone Marrow Transplant 2005; 35:427–8. of pemphigus vulgaris. Br J Dermatol 2003; 149:926–37. 12 Barnadas M, Roe E, Brunet S et al. Therapy of paraneoplastic pem- 2 Pitashny M, Shoenfeld Y. B cell depletion in autoimmune rheu- phigus with rituximab: a case report and review of literature. J Eur matic diseases. Autoimmun Rev 2005; 4:436–41. Acad Dermatol Venereol 2006; 20:69–74. 3 El-Tal AK, Posner MR, Spigelman Z, Ahmed AR. Rituximab: a 13 Arin MJ, Engert A, Krieg T, Hunzelmann N. Anti-CD20 mono- monoclonal antibody to CD20 used in the treatment of pemphigus clonal antibody (rituximab) in the treatment of pemphigus. Br J vulgaris. J Am Acad Dermatol 2006; 55:449–59. Dermatol 2005; 153:620–5. 4 Virgolini L, Marzocchi V. Rituximab in autoimmune diseases. 14 Oken MM, Creech RH, Tormey DC et al. Toxicity and response Biomed Pharmacother 2004; 58:299–309. criteria of the Eastern Cooperative Oncology Group. Am J Clin Oncol 5 Kimby E. Tolerability and safety of rituximab (MabThera). Cancer 1982; 5:649–55. Treat Rev 2005; 31:456–73. 15 Herbst A, Bystryn JC. Patterns of remission in pemphigus vulgaris. 6 Schmidt E, Hunzelmann N, Zillikens D et al. Rituximab in refractory J Am Acad Dermatol 2000; 42:422–7. autoimmune bullous diseases. Clin Exp Dermatol 2006; 31:503–8. 16 Cooper HL, Healy E, Theaker JM, Friedmann PS. Treatment of 7 Arin MJ, Hunzelmann N. Anti-B-cell-directed immunotherapy resistant pemphigus vulgaris with an anti-CD20 monoclonal anti- (rituximab) in the treatment of refractory pemphigus – an update. body (rituximab). Clin Exp Dermatol 2003; 28:366–8. Eur J Dermatol 2005; 15:224–30. 17 Chaiwatanatorn K, Lee N, Grigg A et al. Delayed-onset neutro- 8 Levine TD. Rituximab in the treatment of dermatomyositis: an penia associated with rituximab therapy. Br J Haematol 2003; open-label pilot study. Arthritis Rheum 2005; 52:601–7. 121:913–18. 9 Dinh HV, McCormack C, Hall S, Prince HM. Rituximab for the 18 Hoover DR, Peng Y, Saah A et al. Occurrence of cytomegalovirus treatment of the skin manifestations of dermatomyositis – a report retinitis after human immunodeﬁciency virus immunosuppression. of three cases. J Am Acad Dermatol 2007; 56:148–53. Arch Ophthalmol 1996; 114:821–7. 10 Belgi AS, Azeez M, Hoyle C, Williams RE. Response of pemphigus 19 Damaj G, Charbonnier A, Bouabdallah R et al. Monoclonal antibodies vulgaris to anti-CD20 antibody therapy (rituximab) may be and cytomegalovirus infections. Eur J Haematol 2004; 73:73–4. delayed. Clin Exp Dermatol 2006; 31:143.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp990–996 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07814.x Evaluation of efﬁcacy and safety of rucinol serum in patients with melasma: a randomized controlled trial A. Khemis, A. Kaiafa, C. Queille-Roussel,* L. Duteil* and J.P. Ortonne Dermatology Department and *CPCAD (Centre of Clinical Pharmacology Applied to Dermatology), Hoˆpital de L’Archet 2, 06202 Nice cedex 3, France

Summary

Correspondence Background Melasma is a hyperpigmentation disorder predominantly affecting sun- J.P. Ortonne. exposed areas in women, which is often refractory to treatment. Most commer- E-mail: [email protected] cially available treatments incorporate inhibitors of tyrosinase, a key enzyme in melanin production within the melanocyte. In general, however, the efficacy of Accepted for publication 13 October 2006 these therapies is somewhat limited. Recent studies have identified other enzymes that play an important role in melanogenesis, including tyrosinase-related pro- Key words tein-1 (TRP-1), which catalyses the oxidation of the melanogenetic intermediate melasma, randomized controlled trial, rucinol 5,6-dihydroxyindole-2-carbolylic acid. Rucinol (4-n-butylresorcinol) has been serum, split-face design, vehicle-controlled shown to inhibit the activity of both tyrosinase and TRP-1. comparison Objectives To assess the efficacy of rucinol serum 0Æ3% vs. the corresponding vehi- Conflicts of interest cle as a treatment for melasma. Secondary objectives were to evaluate local and J.P.O. has acted as a paid consultant to l’Oreál, general tolerability and to assess the skin acceptability of rucinol serum in the Galderma, Pierre Fabre, Abbott and UCB and target population. as a paid speaker for Serono, Wyeth, Biogen, Methods In this prospective, single-centre, double-blind, randomized, vehicle- Schering-Plough, 3M, IBSA, Merck Me´dication controlled, bilateral (split-face) comparative trial, 32 women with melasma were Familial and Roche-Posay. provided with two identical tubes containing rucinol serum 0Æ3% or vehicle. The products were each applied to one-half of the face, according to the randomization scheme, twice daily for 12 weeks (phase 1). A broad-spectrum sunscreen (sun protection factor 60) was also applied daily. Assessments at baseline, 4, 8 and 12 weeks included clinical evaluations by a dermatologist, chromametry, ultraviolet and standard photography, and assessments of skin acceptability and tolerability. After 12 weeks, patients were given the option of an additional 3-month treatment period of open full-face rucinol treatment, with reviews at 16, 20 and 24 weeks (phase 2). Results Twenty-eight patients completed phase 1 and 26 patients completed phase 2. After 12 weeks, the clinical pigmentation score for rucinol-treated skin was significantly lower than for vehicle-treated skin (P ¼ 0Æ027). During phase 2, rucinol induced a significant reduction in mean pigmentation score on the half of the face previously treated with vehicle. There was also a further, significant improvement on the rucinol-treated side of the face. Chromametry measurements showed that skin was significantly lighter and less yellow, with a strong trend towards reduced redness, following rucinol therapy compared with vehicle. Ruci- nol serum showed good tolerability and acceptability and was considered to have good or fair efficacy by 78% of the patient population. Conclusions Rucinol serum was shown to have significant efficacy compared with vehicle alone in improving melasma after 3 months of treatment, according to clinical and objective assessments of skin colour.

Melasma is a common skin pigmentary disorder that predom- skin1 and can have a major psychological impact.2,3 Import- inantly affects women of child-bearing age, especially those of antly, treatment of melasma has been shown to enhance Asian and Hispanic origin. The condition is characterized by patients’ health-related quality of life.3 The pathogenesis varying degrees of hyperpigmentation on sun-exposed areas of of melasma is not fully understood but factors such as sun

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 997 998 Rucinol serum in melasma, A. Khemis et al. exposure, pregnancy, oral contraceptives, cosmetics and ethni- ticular relevance for cosmetic applications, was that rucinol city have all been implicated in its development or progres- was effective in reducing melanin production in B16 mouse sion.1 Exposure to ultraviolet (UV) radiation is widely thought melanoma cells without inducing cytotoxicity, instead show- to be the most important environmental factor in the developing a tendency to promote cell growth. In contrast, hydroqui- ment of melasma. none caused a significant suppression of cell growth when It is well established that tyrosinase is a key enzyme in the tested at the same concentrations. In terms of inhibition of synthesis of melanin within the melanocyte by virtue of its melanin production, rucinol showed a potency similar to that activity in the melanin synthetic pathway, catalysing the of hydroquinone, but much greater than that of either arbutin hydroxylation of tyrosine to 3,4-dihydroxyphenylalanine or kojic acid. (DOPA) and the oxidation of DOPA to dopaquinone. Tyrosin- The depigmenting efficacy of rucinol in human subjects has ase inhibitors are thus the active ingredients in most commer- been demonstrated in a number of studies. In a placebo- cially available skin-lightening cosmetics. Historically, the controlled study, UVB-induced hyperpigmentation in healthy mainstays of melasma therapy have been hydroquinone, reti- male volunteers was reduced by the application of 0Æ3% noic acid, topical corticosteroids and kojic acid. However, rucinol serum, the difference in pigmentation becoming signi- clinical results with these agents have been varied and, in ficant after 6 weeks compared with placebo.7 Another pla- some cases, the benefits of treatment have been limited by the cebo-controlled study evaluated the efficacy of rucinol 0Æ3% potential side-effects. Hydroquinone, a tyrosinase inhibitor on postlaser pigmented lesions. The rucinol group showed an and the most commonly used topical agent for hyperpigmen- improvement of the lightness (progressive decrease in delta L) tation disorders, is effective in reducing skin colour when with a significant difference compared with the placebo group used in a 3–5% formulation. However, this concentration is (P <0Æ05).8 When rucinol was tested in 14 women with associated with a high frequency of irritant reactions on pro- hyperpigmentation including liver spots, age spots and longed use, which may result in postinflammatory hyper- freckles, the extent of the pigmented area was reduced and pigmentation. Furthermore, excessive use carries the risk of the skin colour lightened after 3 months.7 In a further, exogenous ochronosis and increased pigmentation, particularly 24-week, open-treatment study, rucinol was evaluated in 62 in dark-skinned patients.1,4,5 Hydroquinone 2% formulations, women with melasma (referred to as chloasma) and was which until recently were available without prescription, lack found to be efficacious in 84% of patients.9 Rucinol treatment the efficacy of higher-concentration formulations as they have has also been assessed in an open study involving 30 patients a later onset of action. Topical tretinoin creams have also with melasma or senescence spots on the face. After 2 months shown some efficacy as monotherapy for melasma but require of treatment a reduction in pigmentation was noted in 70% of a long treatment time of 20–40 weeks to produce a thera- the patients, with a 40% decrease in pigmented spots, accord- peutic effect.4 Furthermore, contact dermatitis, erythema and ing to objective colorimetric measurements.10 desquamation are common side-effects of tretinoin therapy.1,6 The primary objective of this study was to assess the effi- Kojic acid, a tyrosinase inhibitor with similar depigmenting cacy of rucinol serum 0Æ3% as a treatment for melasma com- efficacy to hydroquinone, has recently been shown to have a pared with a vehicle control. Secondary objectives were to high sensitizing potential and has been associated with a high assess both local and general safety and tolerability and to frequency of contact dermatitis in Japanese studies.4 Cortico- evaluate the skin acceptability of rucinol serum in patients steroids are frequently used in conjunction with the other with melasma. topical depigmenting agents to reduce irritation and prevent postinflammatory hyperpigmentation. The potential side- Patients and methods effects of corticosteroids include skin atrophy, telangiectasia and acneiform reactions. Study design Recent investigations have highlighted the role of other enzymes in melanogenesis, including tyrosinase-related pro- This prospective, single-centre, double-blind, randomized, tein-1 (TRP-1), which catalyses the oxidation of the melano- vehicle-controlled study was undertaken in two 12-week genetic intermediate 5,6-dihydroxyindole-2-carbolylic acid.7 phases, in the outpatient dermatology department of the Uni- This has led to the development of rucinol (Iklen; Merck versity Hospital of Nice from January to October 2004. The Me´dication Familiale, Lyon, France), a resorcinol derivative study protocol was reviewed and approved on 12 September and the first substance to have been shown to inhibit the 2003 by the CCPPRB (IEC/IRB) of Marseille 2. In phase 1 a activity of both tyrosinase and TRP-1. In vitro data show that bilateral (split-face) design was used: rucinol (4-n-butylresorci- rucinol has a strong and dose-dependent inhibitory effect on nol) and vehicle were applied to opposite sides of the face B16 mouse melanoma TRP-1, with a 50% inhibitory concen- in a double-blinded fashion, enabling intraindividual paired )7 )1 7 tration (IC50)of9Æ3 · 10 mol L . Furthermore, the inhibi- comparisons to be made. In the second, optional stage of the tory potency of rucinol against B16 mouse melanoma study (phase 2), open treatment of the whole face was carried )1 tyrosinase (IC50 ¼ 44 lmol L ) was found to be 5Æ6, 100 out using the active product. The vehicle formulation con- and 380 times greater than that of kojic acid, hydroquinone tained (International Nomenclature Cosmetic Ingredient list): and arbutin, respectively. Another important finding, of par- aqua (water), alcohol, butylene glycol, polyethylene glycol

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 Rucinol serum in melasma, A. Khemis et al. 999

(PEG)-32, PEG-6, Pyrus cydonia (seed) extract, 2-amino- and the other to the right side of the face, as indicated by the 2-methyl-1,3-propanediol–isostearoyl hydrolysed collagen, dispenser labelling, in the morning and evening after washing sucrose cocoate, disodium ethylenediamine tetraacetic acid, the face, for a period of 12 weeks. All patients were provided methylparaben and tocopherol. with a broad-spectrum sunscreen [sun protection factor (SPF) 60+, UVA immediate pigment darkening 80/persistent pigment darkening 28] to use for the duration of the study and Inclusion and exclusion criteria were instructed to avoid sun exposure. Patients from the clinic database were eligible for inclusion if they were aged 18–50 years, had skin type III, IV or V and Clinical evaluation showed moderate-to-severe melasma. Patients were excluded from the study if they were pregnant or breastfeeding, if they Clinical evaluations by a dermatologist, chromametry measure- were receiving hormone or corticosteroid therapy or if they ments, photographs and assessments of skin acceptability of had a history of endocrine disorders or allergies. The use of the products were undertaken at baseline, 4, 8 and 12 weeks. depigmenting cream in the previous 2 weeks, a topical prod- Further reviews were conducted at 16, 20 and 24 weeks in uct containing tretinoin within the previous 3 months, or a patients who elected to join the optional second phase of the topical product containing hydroquinone within the previous study. 6 months were also grounds for exclusion. Patients were enrolled by the Clinical Trial Unit physicians under the super- Clinical assessments of efficacy vision of J.P.O. At baseline and each review, a clinical pigmentation score was allocated for the different regions of the face (forehead, malar Initial assessment region and chin on left and right sides) using a 0–10 scoring Women with melasma were invited to attend a baseline system, as follows: scores of 0 and 1 indicate no pigmentation assessment, during which a medical history was taken and a and equivocal pigmentation, respectively; scores of 2, 3 and 4 physical examination was carried out by a dermatologist. Mel- denote very pale brown pigmentation of low ()), medium asma was characterized according to pattern (centrofacial, and high (+) intensity, respectively; scores of 5, 6 and 7 rep- mandibular or malar), type (epidermal, dermal or mixed) resent pale brown pigmentation of low ()), medium and determined using Wood’s light, and overall severity, assessed high (+) intensity, respectively; and scores of 8, 9 and 10 via the Melasma Area and Severity Index.6 indicate brown pigmentation of low ()), medium and high (+) intensity, respectively. The scoring was based on visual inspection by a dermatologist. The degree of improvement in Randomization and blinding procedures colour of melasma following treatment was also graded by a Upon enrolment each subject was assigned a unique number dermatologist at each review appointment according to the corresponding to the chronological order of first application following scoring system: )1, worsened; 0, unchanged; 1, of the investigational product. Randomization was achieved slightly improved; 2, moderately improved; 3, markedly using a computer-generated list accessed only by the biostatis- improved; 4, totally disappeared. tician and designated personnel directly responsible for pack- At the last visit of each phase of the study (weeks 12 and aging and labelling of study materials. Both study substance 24), the overall response to treatment was rated on a five- and vehicle were determined to be identical in appearance, so point scale (0, no response; 1, poor; 2, fair; 3, good; 4, in phase 1 each subject was supplied with two identical pump excellent) by both the dermatologist and the patient. dispensers, one containing vehicle plus rucinol 0Æ3% and the Colorimetric measurements were performed with a chrom- other containing vehicle alone, labelled with their unique ameter (CR 200; Minolta, Osaka, Japan) operating in the identifier number and either left side (‘cote´ gauche’) or right L*a*b* system. Two successive measurements were made on side (‘cote´ droit’) according to the randomization scheme. each target area: right forehead, left forehead, right malar Using this method both patient and investigator were blinded area, left malar area, left chin and right chin. In addition, two to the contents of the pump dispensers. Unblinding of the areas of uninvolved skin (one per side and symmetrically study occurred only once the database had been formally located relative to each other) served as normal skin controls. locked. In phase 2 the commercially available product was The mean value of the data obtained from sites on each side supplied. All study materials were dispensed by the investi- of the face was calculated and compared both with the base- gator or designer. line value and that of the opposite side of the face. Both standard and UV photographs were taken at baseline and weeks 4, 8, 12, 16 and 24, using a standardized position Treatment regimen technique. The equipment used comprised a digital UV kit Patients accepted for inclusion were provided with two identi- and UV Twin Flash (Canfield Clinical Systems, Fairfield, NJ, cal product dispensers labelled with their unique identifier U.S.A.) and a digital camera (FinePix S1 Pro; Fuji, Tokyo, number. They were instructed to apply one product to the left Japan) connected to a computer with Mirror DPS (Canfield

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 1000 Rucinol serum in melasma, A. Khemis et al.

Clinical Systems) software. Three angles were standardized for Table 1 Baseline melasma characteristics of study participants photographing the face of each patient before and after treatment: front, 45 left and 45 right. Overall severity: After 12 weeks and, if applicable, 24 weeks, patients com- mean MASI pleted a questionnaire concerning the effectiveness of the Melasma pattern Melasma type score (range) study products, their skin acceptability and effects on quality Centrofacial (n ¼ 2) Epidermal (n ¼ 2) 5Æ6(5Æ6–5Æ6) of life. Centrofacial malar Epidermal (n ¼ 6) 10Æ8(2Æ7–27Æ5) (n ¼ 11) Mixed (n ¼ 5) Centrofacial mandibular Epidermal (n ¼ 1) 2Æ5 Clinical assessments of safety and tolerability (n ¼ 1) Centrofacial mandibular- Epidermal (n ¼ 7) 10Æ9(4Æ7–17Æ6) Patients graded the degree of stinging, burning and pruritus at malar (n ¼ 11) Mixed (n ¼ 4) each review, using a 0–4 scale in which 0 represents the Malar (n ¼ 1) Mixed (n ¼ 1) 7Æ5 absence of symptoms and 4 denotes severe symptoms. The Mandibular-malar Epidermal (n ¼ 1) 8Æ1(1Æ7–27Æ5) same scale was used by the investigator to score the intensity (n ¼ 4) Mixed (n ¼ 3) of erythema, dryness, peeling and desquamation. Any adverse Total (n ¼ 30) Epidermal (n ¼ 17) 9Æ6(1Æ7–27Æ5) Mixed (n ¼ 13) events were recorded. MASI, Melasma Area and Severity Index. Statistical analyses

A sample size of 30 was selected based on consideration of Table 2 Mean ± SD clinical pigmentation scores for rucinol-treated 11 relevant literature data. The statistical analyses were per- and vehicle-treated skin during phase 1 of the study (baseline to formed using SYSTAT 11.0 software (Richmond, CA, U.S.A.). 12 weeks) All participants who received at least one application of the study products were included in the intention-to-treat analysis Rucinol group used in the safety evaluation analysis. All variables were serum Vehicle P-value analysed descriptively using the mean ± SD or the percentage Baseline visit 7Æ5±1Æ97Æ5±1Æ91Æ0 and frequency of distribution. Analysis of variables with a Visit 2 (4 weeks) 7Æ1±1Æ97Æ3±2Æ00Æ157 non-normal distribution, such as clinical scores of pigmenta- Visit 3 (8 weeks) 6Æ8±2Æ16Æ9±2Æ00Æ314 tion and degree of improvement of melasma, was carried out Visit 4 (12 weeks) 6Æ2±2Æ36Æ7±2Æ10Æ027* using the Wilcoxon signed-rank test for paired data. Variables *P <0Æ05, significant product difference. with a normal distribution, such as colorimetric data, were analysed by means of Student’s t-test for paired data. (Wilcoxon test). A decrease in the mean pigmentation score Results over time was observed for both rucinol and vehicle. How- ever, at visit 4 (12 weeks) the mean pigmentation score was found to be significantly lower with rucinol than with vehicle Study population (P ¼ 0Æ027). Figure 1(a–c) displays the decrease of skin Thirty-two women aged 30–51 years (mean ± SD 40 ± 6) pigmentation compared with baseline (Fig. 1a), first on the with skin type III (n ¼ 11), IV (n ¼ 10) and V (n ¼ 11) were right side of the face (Fig. 1b) and then on both sides of the enrolled into the study. Their ethnic groups were Europeans face (Fig. 1c). (n ¼ 18), Arabians (n ¼ 13) and Indians (n ¼ 1). Two indi- At visit 5 (16 weeks), after 4 weeks of rucinol therapy, a viduals left the study shortly after visit 1 (baseline) and thus decrease in pigmentation score was observed on the side trea- 30 patients attended at least one efficacy assessment and were ted with vehicle during phase 1, such that there was no lon- included in the analysis. A total of 28 patients completed ger a significant difference in pigmentation score between the phase 1 of the study and 26 completed the whole study two sides of the face. On the side treated with rucinol from period. the start of the study, there was a further significant reduction The baseline melasma characteristics of the study partici- in pigmentation score at visit 5 compared with visit 4, but no pants are described in Table 1. The most common patterns of additional reductions thereafter. melasma observed were centrofacial malar (n ¼ 11) and cen- When pigmentation scores at visits 5, 6 and 7 were com- trofacial mandibular-malar (n ¼ 11). pared with those recorded at visit 4 (at the end of phase 1), the differences were found to be highly statistically significant at each visit for the side previously treated with vehicle Efficacy analysis (Table 3). For the side treated with rucinol throughout the Table 2 shows the mean clinical pigmentation scores for ruci- study, there was also a statistically significant improvement at nol- and vehicle-treated skin during phase 1 of the study and visit 5 compared with visit 4 (P ¼ 0Æ039). Despite a slight the results of the statistical comparison of the two products increase in mean pigmentation scores during the summer

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 Rucinol serum in melasma, A. Khemis et al. 1001

Table 3 Statistical comparisons of pigmentation scores at visits 5, 6 (a) and 7 vs. visit 4, with respect to the treatment products used during phase 1

Side treated with Side treated rucinol serum with vehicle during phase 1 during phase 1 (P-value) (P-value) Visit 5 (16 weeks) vs. visit 4 0Æ039 0Æ004 Visit 6 (20 weeks) vs. visit 4 0Æ020 0Æ001 Visit 7 (24 weeks) vs. visit 4 0Æ012 0Æ001

7·5 Rucinol serum Vehicle Rucinol serum Rucinol serum 7·0 (b)

6·5 ∗

6·0

Phase 1 Phase 2 5·5 Baseline Visit 2 Visit 3 Visit 4 Visit 5 Visit 6 Visit 7

Fig 2. Evolution of the clinical pigmentation score over time as a function of treatment. *P <0Æ05.

months (5Æ8–6Æ0), the level of significance of the improvement in pigmentation relative to visit 4 increased progressively at visits 6 and 7 as a result of a decrease in the SD of the pigmentation score over time. (c) The evolution of the clinical pigmentation score over time as a function of treatment is illustrated in Figure 2. The figure shows that the pigment-reducing effect of rucinol serum reached a plateau after visit 5 at 16 weeks, which coincided with the summer period. When the degree of improvement of hyperpigmentation on the different zones of the face was analysed, a significant difference between the test products was found at visits 3 and 4 (P ¼ 0Æ038 and 0Æ031 at 8 and 12 weeks, respectively) for the malar region. There was a trend towards greater improvement on the forehead with rucinol compared with vehicle at visits 3 and 4, but this fell slightly short of statistical significance in each case (P ¼ 0Æ058 and 0Æ057 at 8 and 12 weeks, respectively). The degree of improvement of pigmentation on the chin did not differ significantly between the products. During phase 2 of the study, the degree of improvement achieved at visit 4 was maintained on the rucinol-treated side, with further improvement observed on the forehead. On the Fig 1. Decrease of skin pigmentation compared with baseline (a), after previously vehicle-treated side of the face, the degree of 3 months of active treatment only on the right side of the face (b) and improvement increased in all zones throughout phase 2, after 6 months of active treatment on both sides of the face (c). reaching a level similar to that of the comparator side by

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 1002 Rucinol serum in melasma, A. Khemis et al.

2·5 63·3

62·8

2·0 62·3

61·8 ∗ 1·5 61·3 Rucinol serum Vehicle 60·8 Rucinol serum ∗ 1·0 Rucinol serum Vehicle ∗ 60·3 ∗ Rucinol serum Rucinol serum 59·8 Rucinol serum 0·5 Phase 1 Phase 2 59·3 Phase 1 Phase 2 0·0 58·8 Visit 2 Visit 3 Visit 4 Visit 5 Visit 6 Visit 7 Baseline Visit 2 Visit 3 Visit 4 Visit 5 Visit 6 Visit 7

Fig 3. Changes in the degree of improvement of melasma on the Fig 5. Changes in the colorimetric component L* (skin brightness) malar zone over time for the two sides of the face. *P <0Æ05. over time for the two sides of the face. *P <0Æ05.

serum was signiﬁcantly lighter by visit 3 (P ¼ 0Æ002), signi- ﬁcantly less yellow by visit 2 (P ¼ 0Æ016) and showed a 1·8 tendency towards reduced redness by visit 4 (P ¼ 0Æ051). After 12 weeks of treatment, L* component measurements (mean ± SD) were 61Æ6±3Æ3 vs. 61Æ1±3Æ4(P ¼ 0Æ013), b* 1·4 ∗ component measurements were 14Æ6±2Æ7 vs. 14Æ8±2Æ7 ∗∗ (P ¼ 0Æ008) and a* component values were 11Æ6±2Æ6 vs.

1·0 11Æ9±2Æ8(P ¼ 0Æ051) for rucinol- and vehicle-treated skin, Rucinol serum respectively. In the open-treatment phase of the study, the Vehicle colorimetric measurements on the side previously treated Rucinol serum 0·6 with vehicle reached similar values to those observed on Rucinol serum the rucinol-treated skin by visit 5 and there were no signifi- Phase 1 Phase 2 cant differences between the sides at any subsequent visit. 0·2 Visit 2 Visit 3 Visit 4 Visit 5 Visit 6 Visit 7 For both sides, however, there were significant differences in colorimetric values obtained at visits 5, 6 and 7, compared Fig 4. Changes in the degree of improvement of melasma on with visit 4 (P <0Æ05), with the exception of visit 6, when the forehead over time for the two sides of the face. *P ¼ 0Æ057, the difference in the a* component for previously rucinol- **P ¼ 0Æ058. treated skin failed to reach significance (P ¼ 0Æ068). The plateau effect observed with the clinical pigmentation scores in the last 8 weeks of the study was not observed 24 weeks. However, there were no significant differences in with the colorimetric parameters. Changes over time of the degree of improvement between the two sides for any facial colorimetric component L* (skin brightness) are shown in zone at any time point. Figure 5. Comparison of the degree of improvement at visits 5, 6 A total of 17 patients graded their overall response to ruci- and 7 with that at visit 4 revealed that, on the side previously nol therapy at visit 7 as excellent (4), good (3), fair (2), poor treated with rucinol, there were further significant improve- (1) or no response (0). In addition, a questionnaire concern- ments in forehead melasma at visits 6 and 7 (P ¼ 0Æ02 and ing the product’s effects, skin acceptability and impact on 0Æ008, respectively), while the degree of improvement in quality of life was completed by 18 patients. At the end of other zones was maintained over time. For the side previously phase 2, the majority (14 of 18, 78%) of the patients found treated with vehicle, there were significant differences in the the efficacy of rucinol good or fair on both treated sides, degree of improvement at all visits in phase 2, compared with while the same proportion rated the overall tolerance as good visit 4, for both malar and forehead zones. On the chin, the or excellent. difference in degree of improvement vs. visit 4 reached statis- A poststudy investigation was undertaken 20 months after tical significance at visit 7 (P ¼ 0Æ034). The evolution of the the end of the study in order to assess the possible phenom- degree of improvement of melasma on the malar and forehead enon of rebound hyperpigmentation which is a problem zones is illustrated in Figures 3 and 4. observed with most of the depigmenting therapies. Results of The results of the colorimetric analysis showed that, com- this investigation performed on 26 patients are detailed in pared with the vehicle-treated side, skin treated with rucinol Table 4.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 Rucinol serum in melasma, A. Khemis et al. 1003

Table 4 Long-term outcome of treatment effect according to patient opinion, 20 months after the end of treatment (n ¼ 26)

Rebound hyperpigmentation Rebound hyperpigmentation Treatment judged as observed 3–5 months after observed at least 6 months No rebound observed inefﬁcient at EOS, n (%) EOS, n (%) after EOS, n (%) since EOS, n (%) 8 (31) 5 (19) 6 (23) 7 (27)

EOS, end of study treatment.

In addition to reducing pigmentation scores, rucinol ther- Safety assessments apy resulted in significant improvements to the colour of the Very few instances of stinging, burning or pruritus were pigmented skin, showing significant superiority over vehicle reported by patients for either study product and all were in terms of its effects on skin lightness and yellowness and a mild in intensity. Similarly, the investigators observed a very trend towards reduced redness. Colorimetric measurements low frequency of erythema, dryness, peeling and desquama- continued to improve significantly when rucinol therapy was tion, and no effects with a greater than mild intensity. During prolonged for a further 12 weeks, while commencement of the study, 12 adverse events were experienced by eight rucinol treatment on previously vehicle-treated skin produced patients. Of these 12 events, nine were mild, two were mod- highly significant improvements at 20 and 24 weeks, com- erate and one was severe in intensity (blepharoplasty). How- pared with 12-week results. ever, only one of these adverse events, a depigmented spot on The apparent efficacy of the vehicle product in reducing the left malar zone acquired during vehicle treatment, was pigmentation scores in phase 1 of this study is probably judged to be probably related to the study products. attributable to the mandatory use of broad-spectrum SPF 60 sunscreen by all patients in this study. This level of UV protec- Discussion tion is somewhat higher than has been used in other studies.6,11,12 In addition, patients were instructed at baseline to In this prospective, double-blind, split-face study, rucinol serum avoid sun exposure during the course of the study and it is was shown by both clinical and objective assessments to pro- possible that some consequent behavioural change may have duce significant improvements in melasma pigmentation and contributed to the improvement in melasma on the vehicle- skin colour characteristics after 12 weeks of treatment compared treated skin. Exposure to UV radiation is known to be an im- with vehicle alone. In the optional, 12-week, open-treatment portant factor in the development of melasma and thus solar phase of the study, there was a further improvement in the level protection is a key element in its management. Ennes et al.12 of pigmentation on the rucinol-treated side of the face and this have reported a similar beneficial effect of sunscreen use in effect was maintained until the end of the study at 24 weeks. In patients with melasma. In a comparative study of hydro- addition, initiation of rucinol therapy on the vehicle-treated side quinone 4% cream vs. placebo, with concomitant use of induced a highly significant reduction in pigmentation (P ¼ sunscreen SPF 30, 8Æ3% of patients in the control arm experi- 0Æ004, at 16 weeks) and the two sides showed an equivalent enced total improvement, while 58Æ3% achieved partial degree of improvement at all time points thereafter. improvement of their melasma. The authors concluded that In phase 1 rucinol was particularly effective in improving sunscreens induce partial lightening of melasma spots and that hyperpigmentation in the malar region, with significant differ- their use is essential in preventing the condition. ences in the degree of improvement compared with the vehi- A further noteworthy observation in this study was that the cle observed at 8 and 12 weeks. There was also a strong depigmenting effects of rucinol appeared to plateau during the tendency toward greater efficacy on the forehead with rucinol. last 8 weeks of the study. This phenomenon coincided with However, on continuation of rucinol treatment in phase 2 of the summer months and may have been due to increased the study, the degree of improvement was significantly environmental UV exposure at this time, despite the use of increased on the forehead at 20 and 24 weeks compared with sunscreen. Interestingly, however, a plateau effect was not at 12 weeks. Regarding the chin zone, although no statistically observed for any of the colorimetric parameters. The discrep- significant differences were observed between the two test ancy between visually observed and colorimetrically measured products in phase 1 or between the two sides of the face in changes in pigmentation over time may be due in part to the phase 2, the degree of improvement at the end of the study fact that visual assessment involves the comparison of pigmen- (24 weeks) was significantly greater than at 12 weeks on the ted skin with nonpigmented skin surrounding the lesion. A side of the face previously treated with vehicle. Overall, these further confounding factor that may contribute to this satura- findings indicate that all the facial zones examined benefited tion phenomenon is that during the summer months the level from rucinol therapy to some degree; this benefit was main- of pigmentation is usually increased in ‘normal’ nonpigment- tained beyond 3 months and, in the case of the forehead, was ed areas of skin, despite the use of protective sunscreen, further enhanced with continued treatment. resulting in an overall darkening of the face. With colorimetric

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 1004 Rucinol serum in melasma, A. Khemis et al. evaluation, on the other hand, measurements are made on the 2 Balkrishnan R, McMichael AJ, Hu JY et al. Correlates of health- pigmented lesions only. In the present study, colorimetry related quality of life in women with severe facial blemishes. Int J measurements suggest that rucinol serum, used in combin- Dermatol 2006; 45:111–15. 3 Balkrishnan R, Kelly AP, Torok H. Improved quality of life with ation with sunscreen, is effective in improving pigmentation effective treatment of facial melasma: the pigment trial. J Drugs even in summer time, particularly in terms of reducing the Dermatol 2004; 3:377–1. yellow component of the pigmented lesion. 4 Halder RM, Richards GM. Management of dyschromias in ethnic Rucinol serum was generally extremely well tolerated by skin. Dermatol Ther 2004; 17:151–7. this patient population. Only a small number of adverse skin 5 Levin CY, Maibach H. Exogenous ochronosis. An update on clinical reactions were reported by the patients or investigator, all of features, causative agents and treatment options. Am J Clin Dermatol which were categorized as mild. Furthermore, only one of 12 2001; 2:213–17. 6 Kimbrough-Green CK, Griffiths CE, Finkel LJ et al. Topical retinoic adverse events – a depigmented spot – was considered likely acid (tretinoin) for melasma in black patients. A vehicle-controlled to be associated with a study product and this was observed clinical trial. Arch Dermatol 1994; 130:727–33. during treatment with vehicle. The majority of patients regar- 7 Katagiri T, Okubo M, Oyobikawa K et al. Novel melanogenic ded rucinol serum as an effective treatment for melasma and enzymes for controlling hyperpigmentation. 20th IFSCC International found it very acceptable in terms of overall tolerance, Congress 1998; 39:1–11. hydration effects and odour. 8 Akasaka T, Ohurazaka H, Nishioheda G et al. Topically applied 0.3% In conclusion, according to both clinical and objective 4-n-butylresorcinol decreases pigmentation after laser therapy. Envi- ron Derm 2002; 9:11–15. assessments, rucinol serum showed significant efficacy com- 9 Researching Committee of Rucinol. The study on the efficacy of pared with a vehicle control in improving facial hyperpigmen- Rucinol (4-n-butylresorcinol) in chloasma. Nishinihon J Dermatol tation in women with melasma after 12 weeks of treatment. 1999; 61:813–19. These benefits were maintained during a further 12 weeks of 10 Merck Me´dication Familiale. Data on file: Evic France, January 2002. open treatment. 11 Haddad AL, Matos LF, Brunstein F et al. A clinical, prospective, randomized, double-blind trial comparing skin whitening complex with hydroquinone vs. placebo in the treatment of melasma. Int J Acknowledgments Dermatol 2003; 42:153–6. 12 Ennes SBP, Paschoalick RC, Mota de Avelar Alchorne M. A double- This study was supported by Merck Me´dication Familiale, blind, comparative, placebo-controlled study of the efficacy and tol- Lyon, France. erability of 4% hydroquinone as a depigmenting agent in melasma. J Dermatol Treat 2000; 11:173–9. References

1 Jimbow K, Minamitsuji Y. Topical therapies for melasma and disorders of hyperpigmentation. Dermatol Ther 2001; 14:35–45.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp997–1004 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07828.x Is minocycline therapy in acne associated with antineutrophil cytoplasmic antibody positivity? A cross-sectional study H. Marzo-Ortega, K. Baxter,* R.M. Strauss,* S. Drysdale, B. Grifﬁths, S.A. Misbah, A. Gough, W.J. Cunliffe* and P. Emery Academic Unit of Musculoskeletal Disease, The University of Leeds and Chapel Allerton Hospital, Chapeltown Road, Leeds LS7 4SA, U.K. *Dermatology Department, The University of Leeds and Leeds General Inﬁrmary, Great George Street, Leeds LS1 3EX, U.K. Department of Immunology, Churchill Hospital, Old Road, Headington, Oxford OX3 7LJ, U.K.

Summary

Correspondence Background Minocycline (MN), one of the commonly prescribed therapies for acne, Paul Emery. is known to be associated with autoimmune disorders including drug-induced E-mail: [email protected] lupus. However, data are sparse regarding the prevalence of autoimmune disease in acne or in patients with acne treated with MN. Accepted for publication 5 December 2006 Objectives To establish the prevalence of antinuclear antibodies (ANA), antineutrophil cytoplasmic antibodies (ANCA) and new autoimmune syndromes in an Key words MN-exposed and unexposed population with acne. acne, autoimmune syndrome, minocycline Methods In a cross-sectional study, 252 patients with acne vulgaris were assessed. Sixty-nine per cent had been exposed to MN at some point or were taking the Conflicts of interest drug at the time of the interview. Data recorded included duration of disease None declared. (acne) and drug history as well as possible side-effects of drugs, in particular joint symptoms (pain and swelling). In addition, blood was taken for ANA, ANCA, liver function tests and HLA analysis. Results There was no statistical difference in the prevalence of ANA positivity between patients exposed (13%) or not exposed (11%) to MN. However, higher titres of ANA (1/160 or higher) were found in the MN-exposed group (45% compared with 12% in the unexposed group). ANCA positivity was found in 7% of the MN-exposed group but no positivity was found in the unexposed cohort (P ¼ 0Æ022). In 58% of cases, the ANCA detected were of the perinuclear pattern (p-ANCA) with myeloperoxidase specificity, and this finding was associated with clinical symptoms in the majority of cases. Two p-ANCA-positive patients were thought in retrospect to have developed a drug-induced lupus syndrome. Conclusions ANA positivity is seen in patients with acne irrespective of exposure to MN; however, p-ANCA appear to be a serological marker for developing autoimmune disease in patients receiving MN.

Minocycline (MN) is a semisynthetic tetracycline that is useful nuclear antibodies (ANA) as well as antineutrophil in the treatment of acne and is also effective in a variety of cytoplasmic antibodies (ANCA). More recently, an immuno- conditions including rheumatoid arthritis (RA).1 It is well tol- genetic predisposition for MN-induced autoimmune disease erated with good compliance, the latter enhanced by the sin- has been suggested.11 The British National Formulary recommends gle daily dose.2 MN has traditionally been considered a that if MN treatment is continued for longer than 6 months, relatively harmless drug with patients often remaining on this 3-monthly tests should be performed for monitoring of medication for years with little medical supervision, mainly in hepatotoxicity, pigmentation and systemic lupus erythematosus the context of general practice. However, it has become clear (SLE).12 in recent years that the use of MN is associated with an However, there is a lack of data regarding the autoimmune increasing number of autoimmune syndromes including phenomena associated with acne itself. In addition, there is serum sickness,3–6 drug-induced lupus,7 autoimmune hepati- growing concern that the incidence of these adverse effects tis7–9 and vasculitis5,10 accompanied by positivity for anti- may be underestimated. This is particularly relevant as MN is

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1005–1009 1005 1006 Minocycline, acne and ANCA, H. Marzo-Ortega et al. given to young and otherwise healthy patients. We therefore Statistical analysis aimed to establish the prevalence of autoimmune phenomena in patients with acne with and without exposure to MN. Categorical data are presented as numbers and percentages with Fisher’s test used where appropriate. P <0Æ05 was con- Patients and methods sidered statistically signiﬁcant.

Patients Results

Consecutive patients attending the Acne Clinic at a large teach- Two hundred and fifty-two patients were recruited: 54% ing hospital in the Yorkshire region (U.K.) were invited to take female and 46% male. Mean age was 29 years (range 18–65) part in the study between June 1998 and October 1999. The and mean disease duration of acne was 12 years (range study had the approval of the Local Ethics Committee. After 3 months to 36 years). Of these patients, 174 (69%) had been informed written consent, patients were asked to fill in a ques- exposed to MN at some point in the past. Of these, 31 (12% tionnaire providing demographic data as well as details on dur- of the total population) were taking MN at the time of inter- ation of acne, treatments they had received for their acne and view. Seventy-one patients (28%) had never taken MN and concomitant medication. When exposure to MN had occurred, seven (3%) could not recall ever being exposed to the drug. patients had to specify treatment duration, dosage and drug The mean duration of MN exposure was 2Æ5 years (exposure preparation. Patients were asked to enumerate any side-effects ranging from few months to over 20 years, at intermittent they may have encountered when taking any medication intervals in the majority of cases). prescribed for acne and in particular if these had occurred while exposed to MN. A ‘tick’ list of side-effects was provided which Antinuclear antibodies included skin rash, joint pain, joint swelling, muscle pain, hair loss, history of systemic lupus, jaundice, skin pigmentation and There was no statistically significant difference in the preval- hepatitis. In addition, when recalling either joint pain or ence of ANA positivity between both groups (Fig. 1). Within swelling, patients were encouraged to specify the affected joints the MN-exposed cohort (patients currently taking or ever in a drawing provided in the questionnaire. Details of drug exposed to MN, n ¼ 174) 22 (13%) were positive for ANA. rechallenge and family history were also documented. Of these, 12 were weakly positive at a 1/40 titre, with two of them (16%) reporting musculoskeletal symptoms while on the drug. The remaining 10 (45%) were strongly positive for Laboratory tests

The screening laboratory tests included liver function tests, ANA and ANCA. ANA were measured by indirect immunofluorescence (IIF) on HEp-2 cells at a screening dilution of 14 Minocycline 1 : 40. Antidouble-stranded DNA (anti-dsDNA) antibodies Non-minocycline were measured by enzyme-linked immunosorbent assay 12 (ELISA) (Cambridge Life Sciences, Ely, U.K.). ANCA testing was carried out in accordance with the recommendations of 10 the International Consensus Group on ANCA testing.13 ANCA were detected by IIF using commercially prepared ethanol- fixed neutrophils at a screening serum dilution of 1 : 40. Two 8 major staining patterns may be seen: cytoplasmic (c-ANCA) directed against proteinase-3 (PR3) (found mainly in Wegen- 6 er’s granulomatosis) and perinuclear (p-ANCA) directed against myeloperoxidase (MPO) (usually found in microscopic 4 polyangiitis). Any samples that were positive on IIF were tested for antibodies to PR3 and MPO by a commercial quali- 2 tative antigen-specific ELISA (Bio-Diagnostics Ltd, Upton- Upon-Severn, U.K.). ANCA testing was carried out by an experienced senior biomedical scientist who was blinded to 0 ANA ANCA the clinical details for each patient. The laboratory’s perform- P = 0·022 ance in ANCA assays and general autoimmune serology, inclu- (Fisher's ding ANA, was validated by satisfactory performance in the exact test) U.K. National External Quality Assurance Scheme. Major histocompatibility complex (MHC) class II typing for Fig 1. Percentage of positivity for antinuclear antibodies (ANA) and HLA-DRB1 and HLA-DQB1 alleles was performed by poly- antineutrophil cytoplasmic antibodies (ANCA) in minocycline-exposed merase chain reaction using sequence-specific primers. and unexposed groups.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1005–1009 Minocycline, acne and ANCA, H. Marzo-Ortega et al. 1007

Table 1 Clinical characteristics of the antineutrophil cytoplasmic antibody (ANCA)-positive patients

Age (years)/ Duration of Resolution of symptoms Patient sex minocycline (years) Currently on minocycline? Symptoms on cessation of therapy 1 54/M NA No, unsure when stopped Rash, hair loss Yes 2 23/M 2 Stopped 4 months ago Arthritis 8 weeks 3 46/F 11 Ongoing Arthralgia, rash, myalgia 3 days 4 19/M 3 Stopped 6 months ago Myalgia 2 weeks 5 17/M 2 Ongoing None NA 6 65/F 2 Ongoing Myalgia, dizziness 1 day 7 34/F 2 Stopped 5 years ago None NA 8 18/F 2 Stopped 5 months ago Arthralgia, rash, hair loss, No Raynaud phenomenon 9 49/F 10 Stopped 10 months ago Arthritis, skin pigmentation Yes 10 44/F 15 Ongoing Arthritis, fatigue, livedo reticularis Yes 11 40/M 20 Stopped 2 years ago None NA 12 19/F 2 Stopped 12 months ago None NA

NA, not available.

Table 2 Serological features of the antineutrophil cytoplasmic antibody (ANCA)-positive patients

Patient ANA ANCA pattern ANCA titre Anti-MPO Anti-PR3 MHC class II typing 1 Negative Flat C 160 Negative Negative DR4 DR3/6 2 Negative P + C 640 Positive Positive DR7 DR103 3 Negative Flat C 80 Weak positive Negative NA 4 Negative P 40 Weak positive Negative DR2 DR8 5 1 : 320 Homogeneous C 640 NA NA DR1 DR2 6 1 : 640 Homogeneous P > 640 Weak positive Negative DR4 7 1 : 640 Nucleolar P 160 Positive Negative DR2 DR4 8 1 : 320 P 640 Negative Negative DR1 DR11(5) 9 1 : 640 Homogeneous P 640 Weak positive Negative DR4 DR11(5) 10 1 : 160 Speckled P 320 Weak positive Negative DR4 DR103 11 1 : 40 Flat C 80 NA NA DR3 DR8 12 1 : 40 P 80 Negative Negative DR4 DR9

ANA, antinuclear antibodies; P, perinuclear; C, cytoplasmic; MPO, myeloperoxidase: PR3, proteinase 3; MHC, major histocompatibility complex; NA, not available. Flat C refers to the appearance of atypical ANCA on indirect immunoﬂuorescence.

ANA at a titre of 1/160 or higher, three of whom (30%) c-ANCA positivity (Tables 1 and 2)]. Of the ANCA-positive reported symptoms at the time of MN exposure. One of the group, seven patients had antibodies to MPO, of whom six patients (patient 8, see Tables 1 and 2) reported ongoing reported musculoskeletal type symptoms while on the drug. symptomatology at the time of the interview, with arthralgia, The mean length of exposure to MN in this group was rash, hair loss and Raynaud phenomenon. Her ANA were 5Æ8 years. Only one patient (an 18-year-old woman) had a positive at a 1 ⁄320 titre despite discontinuation of MN family history of autoimmune disease, with one sister known 5 months previously. On further enquiry, she had a family to have SLE. She was the only patient who continued to be history of autoimmune disease with one sister with SLE. In symptomatic despite discontinuation of the drug and eventu- the unexposed group (n ¼ 71) eight (11%) were ANA posit- ally required follow-up in the rheumatology clinic. The ive, of whom seven were positive at a weak titre (1/40) and remaining patients reported complete resolution of symptoms one (12%) was positive at a 1/160 titre. All were asympto- in a time frame varying from 1 day to several weeks. No matic. Levels of anti-dsDNA antibodies were not elevated in patients were ANCA positive within the non-MN group (P ¼ either group. 0Æ022, Fisher’s exact test). There were no symptomatic patients within the unexposed cohort. None of the ANA- or ANCA-positive patients was taking Antineutrophil cytoplasmic antibodies any concomitant medication that could account for the pres- In the MN-exposed group, eight of 12 patients (67%) were ence of these antibodies (e.g. chlorpromazine, hydralazine, p-ANCA positive [one had a mixed pattern with p-ANCA and isoniazid, procainamide, thyroxine or sulfasalazine).14–16

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1005–1009 1008 Minocycline, acne and ANCA, H. Marzo-Ortega et al.

No abnormalities in liver function tests were detected in This is a retrospective study involving a young population either group. Likewise, no clinical evidence of vasculitis was which represents an homogeneous cohort with a diagnosis of recorded. acne vulgaris which, unlike some very rare disorders of acne such as acne fulminans, is not associated with arthritis. To overcome the problem of patients not being able to recall Major histocompatibility complex class II typing proper lupus symptomatology, we decided to document MHC complex class II typing was available in 11 of the 12 symptoms as positive when the patient could recall both pain patients who were ANCA positive. Six of the 11 patients had and swelling of one given joint occurring while on the drug. at least one HLA-DR4 subtype (Table 2). Another two patients These symptoms have been by far the commonest associated had a DR2 subtype. Interestingly, two of the patients who with lupus-like presentations reported in the literature.21 could have been described as having MN-induced lupus Although MN-induced lupus is a difficult and not well-defined (patients 9 and 10) were DR4. diagnosis, previous reports have accepted the following criteria: (i) no history of SLE before MN was started; (ii) positive Discussion ANA along with at least one clinical feature of SLE; and (iii) recovery after MN withdrawal (with or without anti- MN has traditionally been used, especially in general practice, inflammatory drug therapy).16,22 Applying these criteria, at as a first-line oral antibiotic therapy for the treatment of acne least two of our patients (patients 9 and 10) would have been despite the lack of evidence to suggest its superiority over described as having drug-induced lupus with symptoms resol- other antibiotics. It is also prescribed as a second- or third-line ving on cessation of therapy in both cases and returning on therapy after other agents have failed and as an alternative rechallenge (as was the case in patient 10 when MN was treatment before oral isotretinoin.17 In addition, it has been represcribed by her general practitioner). As in previous considered a relatively safe drug.2 Recently, a growing body reports,16 the exposure time to MN in these patients was well of evidence has pointed to an association with severe auto- above 1 year, confirming that a long exposure time is immune disease in some patients.7 A recently published nested required to develop MN-induced lupus. Our findings contrast case–control study of 27 588 patients with acne has reported with those of Choi et al.,14 who failed to find any evidence of an 8Æ5-fold risk of developing a lupus-like syndrome with cur- ANCA seroconversion in patients receiving MN therapy for rent use of MN that increased to 16-fold with long-term use RA. Although this raises the possibility that MN-induced for the treatment of acne.18 Interestingly, women of child- ANCA positivity is predominantly a feature of acne, the relat- bearing age appear to be most at risk of autoimmune-medi- ively short duration of treatment (< 12 months) may be a ated adverse effects from MN,19 although not in our study. As contributing factor. MN-induced ANCA-positive vasculitis has already highlighted by other authors, identification of serolog- recently been reported in RA,23 suggesting that sporadic cases ical markers would be of great benefit in preventing severe may occur. side-effects.11 The current study demonstrates that positive The exact mechanism by which induction of p-ANCA ANA occur in around 10% of patients with acne irrespective occurs is still unclear; however, it has been postulated that of MN exposure. Mild clinical symptoms were reported, par- adverse effects attributable to MN may relate to the production ticularly in association with a higher titre, but importantly of a reactive metabolite.24 p-ANCA are antibodies directed only MN-exposed patients had associated p-ANCA which cor- predominantly against neutrophil MPO. MPO appears to be related with more severe clinical symptoms. We believe that able to oxidize MN into reactive metabolites that could modify this may be an underestimated prevalence as other patients the enzyme to induce the formation of p-ANCA. MPO can also could have had p-ANCA titres which had resolved with cessa- convert many other drugs associated with drug-induced lupus tion of drugs prior to enrolment in this study. to reactive metabolites.25 A different proposed mechanism There are, however, a number of limitations in this study suggested that reactive metabolites could induce an auto- that need addressing when interpreting these results. Firstly, immune reaction analogous to a graft-versus-host disease by the high prevalence of ANA positivity in our study may be binding to the class II MHC antigen.26 Indeed, an association nonspecific and consistent with other reports that have estab- between HLA-DR4 and hydralazine-induced lupus has been lished up to a 31Æ7% incidence of low ANA positivity (titre reported.27 Our results suggest that two of the ANCA-positive 1/40) in a healthy asymptomatic population.20 However, our patients who were symptomatic were carrying a DR4 allele, results show that 30% of the patients with high-titre ANA which is in agreement with the findings by other groups in were symptomatic at the time of drug exposure. Secondly, the MN-induced lupus-like syndrome,11 although these numbers fact that ANCA positivity was confined to the MN-exposed are small and would need to be confirmed in larger cohorts. group confirms the potential diagnostic specificity of ANCA In conclusion, our results show that higher levels of ANA in over ANA. These findings are in agreement with other studies an MN-exposed population with acne were associated with in patients with MN-induced lupus-like syndrome that repor- musculoskeletal symptoms in a subset of patients. In addition, ted all patients to be ANCA positive.11 Further prospective the finding of ANCA positivity in this group may represent a longitudinal cohorts would need to be studied to address this marker for MN exposure and associated autoimmune disease. issue. Larger numbers of patients would need to be followed in

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1005–1009 Minocycline, acne and ANCA, H. Marzo-Ortega et al. 1009 longitudinal studies to establish the true incidence of MN- arteritis nodosa associated with minocycline therapy for acne induced autoimmune disease and the role of ANCA in this vulgaris. J Am Acad Dermatol 2001; 44:198–206. process. 11 Dunphy J, Oliver M, Rands AL et al. Antineutrophil cytoplasmic antibodies and HLA class II alleles in minocycline-induced lupus- like syndrome. Br J Dermatol 2000; 142:461–7. Acknowledgments 12 BNF 51. British National Formulary. London: BMJ Publishing, 2006; 5.1.3:285–7. We thank sisters Jayne Moore, Geraldine Jackson and Claire 13 Savige J, Gillis D, Benson E et al. International Consensus Statement Brown for their help recruiting patients, staff at the outpatient on testing and reporting of antineutrophil cytoplasmic antibodies. setting in the Dermatology Department at the Leeds General Am J Clin Pathol 1999; 111:507–13. Infirmary, Bridget Montague for HLA-DR typing, Jill Hirst 14 Choi HK, Slot MC, Pan G et al. Evaluation of antineutrophil cytoplasmic antibody seroconversion induced by minocycline, sulfasal- for help with the ANA and ANCA testing and Paul Astin for azine or penicillamine. Arthritis Rheum 2000; 43:2488–92. statistical analysis. We also thank Dr Sinisa Savic for helpful 15 Gunton JE, Stiel J, Clifton-Bligh P et al. Prevalence of positive anti- comments. neutrophil cytoplasmic antibody (ANCA) in patients receiving anti- thyroid medication. Eur J Endocrinol 2000; 142:587–90. 16 Schlienger RG, Bircher AJ, Meier CR. Minocycline-induced lupus. References Dermatology 2000; 200:223–31. 1 O’Dell JR, Blakely KW, Mallek JA et al. Treatment of early seropos- 17 Garner SE, Eady EA, Popescu C et al. Minocycline for acne vulgaris: itive rheumatoid arthritis: a two-year, double-blind comparison efficacy and safety. Cochrane Database Syst Rev 2000; 2: CD002086. of minocycline and hydroxychloroquine. Arthritis Rheum 2001; 18 Sturkenboom MCJ, Meier CR, Jick H, Stricker BHC. Minocycline 44:2235–41. and lupus-like syndrome in acne patients. Ann Intern Med 1999; 2 Goulden V, Glass D, Cunliffe WJ. Safety of long-term high-dose 159:493–7. minocycline in the treatment of acne. Br J Dermatol 1996; 134: 19 Shapiro LE, Uetrecht J, Shear NH. Minocycline, perinuclear 693–5. antineutrophilic cytoplasmic antibody, and pigment: the biochemi- 3 Knowles SR, Shapiro L, Shear NH. Serious adverse reactions cal basis. J Am Acad Dermatol 2001; 45:787–9. induced by minocycline. Arch Dermatol 1996; 132:934–9. 20 Tan EM, Feltkamp TE, Smolen JS et al. Range of antinuclear anti- 4 Shapiro LE, Knowles SR, Shear NH. Comparative safety of tetracyc- bodies in ‘healthy’ individuals. Arthritis Rheum 1997; 40:1601–11. line, minocycline and doxycycline. Arch Dermatol 1997; 133:1224– 21 Eichenfield AH. Minocycline and autoimmunity. Curr Opin Pediatr 30. 1999; 11:447–56. 5 Elkayam O, Yaron M, Caspi D. Minocycline-induced autoimmune 22 Hess E. Drug-related lupus. N Engl J Med 1988; 318:1460–2. syndromes: an overview. Semin Arthritis Rheum 1999; 28:392–7. 23 Marzo-Ortega H, Misbah S, Emery P. Minocycline induced auto- 6 Hess EV. Minocycline and autoimmunity. Clin Exp Rheumatol 1998; immune disease in rheumatoid arthritis: a missed diagnosis? J Rheu- 16:519–21. matol 2001; 28:377–8. 7 Gough A, Chapman S, Wagstaff K et al. Minocycline induced auto- 24 Allen J. Minocycline. Ann Intern Med 1976; 85:482–7. immune hepatitis and systemic lupus erythematosus-like syndrome. 25 Jiang X, Khursigara G, Rubin RL. Transformation of lupus-inducing Br Med J 1996; 312:169–72. drugs to cytotoxic products by activated neutrophils. Science 1994; 8 Angulo JM, Sigal LH, Espinoza LR. Coexistent minocycline-induced 266:810–13. systemic lupus erythematosus and autoimmune hepatitis. Semin 26 Uetrecht J. The role of leucocyte-generated metabolites in the patho- Arthritis Rheum 1998; 28:187–92. genesis of idiosyncratic drug reactions. CRC Crit Rev Toxicol 1992; 9 Crosson J, Stillman MT. Minocycline related lupus erythematosus 20:299–366. with associated liver disease. J Am Acad Dermatol 1997; 36: 27 Batchelor JR, Welsh KI, Tinoco RM et al. Hydralazine-induced 867–8. systemic lupus erythematosus: influence of HLA-DR and sex on 10 Schaffer JV, Davidson DM, McNiff JM, Bolognia JL. Perinuclear susceptibility. Lancet 1980; i:1107–9. antineutrophilic cytoplasmic antibody-positive cutaneous poly-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1005–1009 THERAPEUTICS DOI 10.1111/j.1365-2133.2007.07829.x Two years of experience with etanercept in recalcitrant psoriasis K. Ahmad and S. Rogers City of Dublin Skin and Cancer Hospital, Hume Street, Dublin 2, Ireland

Summary

Correspondence Background The safety and efficacy of etanercept have been demonstrated in Kashif Ahmad. patients with rheumatoid arthritis, psoriatic arthritis and ankylosing spondylitis. E-mail: [email protected] Placebo-controlled trials have indicated the efficacy of etanercept in moderate to severe psoriasis. Accepted for publication 10 December 2006 Objectives To observe the efficacy and safety profile of etanercept in patients with severe psoriasis resistant to other systemic agents over a 2-year period. Key words Methods In this retrospective study, 49 patients were treated with etanercept etanercept, psoriasis, tuberculosis, tumour necrosis between March 2004 and March 2006. All patients were screened for tuberculo- factor-a sis with tuberculin test and a chest X-ray. Thirty-nine patients started on etaner- Conflicts of interest cept 25 mg twice weekly (BIW) and 10 started at 50 mg BIW when judged to S.R. has been paid as a consultant by Wyeth; be clinically indicated. In 19 of those on 25 mg BIW, the dose was increased to she has received educational and lecture fees from, 50 mg BIW because of poor response and psoriasis flaring. Response to treatment and participated in advisory panels for, Wyeth was assessed by Psoriasis Area and Severity Index (PASI) and static Physician Glo- and Schering Plough. bal Assessment (PGA). Patients were reviewed at 8-week intervals, when clinical response and adverse effects were noted. Results Forty-four patients (90%) had chronic plaque psoriasis, two (4%) were suberythrodermic, one (2%) had palmoplantar pustular psoriasis and two (4%) had acrodermatitis continua of Hallopeau. At least 75% reduction in PASI was achieved in 47% of patients at week 24 and 66% at week 48. At week 24, 44% had a PGA score of excellent, and at week 48, 58% scored excellent. In 12 who cleared, etanercept was stopped. Ten of these relapsed and etanercept was recommenced, while two remained in remission (mean 12Æ5 weeks). One patient developed extrapulmonary tuberculosis. Conclusions Etanercept was effective in severe psoriasis recalcitrant to other systemic medication. The drug was well tolerated. Development of tuberculosis in one patient underlines the need for rigorous tuberculosis screening.

Psoriasis is characterized by infiltration of the skin with activa- ankylosing spondylitis.4–6 Placebo-controlled trials have indicated T cells and abnormal proliferation of keratinocytes, result- ted the efficacy of etanercept in moderate to severe psori- ing in a higher concentration of tumour necrosis factor asis.7,8 We carried out this retrospective study to assess the (TNF)-a in psoriatic lesions.1 TNF-a is a proinflammatory efficacy and safety of etanercept in patients with severe psori- cytokine found in increased concentrations in the joints and asis over a 2-year period. skin of patients with rheumatoid arthritis, psoriatic arthritis 2 and psoriasis. It plays an active role in Langerhans cell migra- Patients and methods tion, maturation, and in leucocyte recruitment.3 Etanercept is a recombinant human receptor fusion protein which competit- The study was retrospective. Patients treated with etanercept ively inhibits the interaction of TNF-a with cell-surface recep- between March 2004 and March 2006 were included and, tors, preventing TNF-a-mediated cellular responses and with the exception of one who was withdrawn from the treat- modulating the activity of other proinflammatory cytokines ment at week 8, they were on etanercept for a minimum of regulated by TNF-a.1 24 weeks. They were identified from a departmental database The safety and efficacy of etanercept have been demonstra- and were under the care of one dermatologist (S.R.). The fol- ted in patients with rheumatoid arthritis, psoriatic arthritis and lowing data were collected: age, sex, duration of psoriasis,

2007 The Authors 1010 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1010–1014 Experience with etanercept in psoriasis, K. Ahmad and S. Rogers 1011 family history, number of hospital admissions, previous treat- Table 1 Demographic and clinical characteristics of patients ments, concomitant treatment, joint involvement, initial and maintenance dose of etanercept, response to treatment and Total number of patients 49 adverse effects. Male, n (%) 32 (65) Pretreatment screening included full blood count, urea and Age (years), mean (range) 51Æ6 (24–75) electrolytes, liver function tests and antinuclear antibodies Duration of psoriasis (years), mean (range) 21Æ3 (5–53) Baseline PASI, mean (range) 16Æ2(6Æ5–30) (ANA). A personal and family history of tuberculosis was Psoriatic arthritis, n (%) 19 (39) taken and patients were screened for tuberculosis with the No. of hospital admissions, mean 3Æ75 tuberculin test (Mantoux), two tuberculin units, and a chest Mean duration on etanercept, weeks (range) 58Æ2 (8–104) X-ray. Those with a positive Mantoux and/or an abnormal chest X-ray were seen by a respiratory physician and treated PASI, Psoriasis Area and Severity Index. with isoniazid for 9 months for a minimum of 2 months before etanercept as prophylaxis. The severity of psoriasis was assessed by Psoriasis Area and Table 2 Previous treatments Severity Index (PASI).9 Response to treatment was also documented by the static Physician Global Assessment (PGA)10 on Previous treatments n (%) a five-point scale of excellent (80–100%), good (50–79%), Narrowband ultraviolet B therapy 32 (65) moderate (30–49%), poor (10–29%) and failed response PUVA 44 (90) (< 9%). Re-PUVA 14 (29) Patients received verbal and written information about the Oral retinoids 16 (33) Methotrexate 40 (82) drug and written consent was obtained. They viewed a Ciclosporin 30 (61) video on the administration of etanercept which was then Hydroxycarbamide 11 (22) self-administered by subcutaneous injection under supervi- Fumaric acid esters 13 (27) sion of a dermatology nurse specialist. Patients who devel- Mycophenolate mofetil 2 (4) oped infection during therapy required temporary cessation Infliximab 7 (14) of etanercept until they recovered. Etanercept was stopped PUVA, psoralen plus ultraviolet A phototherapy; Re-PUVA, reti- temporarily if psoriasis was clear and recommenced on noid with PUVA. relapse. Relapse was defined as return of psoriasis to 50% of the area or extent of rash before treatment or patient demand for further treatment.11 Patients were reviewed at Dosage regimen 8-week intervals when clinical response and adverse effects were noted. Thirty-nine (80%) patients started on etanercept 25 mg twice weekly (BIW). Ten (20%) started at 50 mg BIW when judged Results to be clinically indicated. This decision was taken by the senior physician (S.R.) on a case-by-case basis. Factors taken into account included flaring, and poorly controlled, unstable Study population psoriasis. Poor response to previous systemic treatment was also All 49 patients were white skinned, 32 (65%) men and 17 taken into account. In 19 of those on 25 mg BIW, the dose was (35%) women, with a mean age of 51Æ6 years (range 24– increased to 50 mg BIW because of poor response (n ¼ 10), 75). Forty-four patients (90%) had chronic plaque psoriasis and psoriasis flaring (n ¼ 9), after a mean of 20 weeks (range (CPP), two (4%) were suberythrodermic, one (2%) had 8–56). A patient with breast carcinoma received etanercept palmoplantar pustular psoriasis (PPP) and two (4%) had 50 mg BIW, because of the severity of her psoriasis, after acrodermatitis continua of Hallopeau. The mean duration of consultation with her oncologist. Five patients were on psoriasis was 21Æ3 years (range 5–53). All patients were methotrexate, five on ciclosporin and one on hydroxy- admitted to hospital more than once (mean 3Æ75) for topical carbamide during an overlap period at the start of therapy. These treatment. Thirty-two (65%) patients had had narrowband drugs were discontinued at a mean of 12Æ4 weeks (range 8–40) ultraviolet (UV) B therapy. Patients had been on two or with the exception of three patients who remained on more systemic agents including psoralen plus UVA (PUVA) concomitant methotrexate for psoriatic arthritis at the request of (n ¼ 44; 90%), retinoid with PUVA (n ¼ 14; 29%), metho- the rheumatologists. trexate (n ¼ 40; 82%), acitretin (n ¼ 16; 33%), ciclosporin (n ¼ 30; 61%), hydroxycarbamide (n ¼ 11; 22%), fumaric Efficacy acid esters (FAE; n ¼ 13; 27%), mycophenolate mofetil (n ¼ 2; 4%) and infliximab (n ¼ 7; 14%). Patients were on Psoriasis Area and Severity Index etanercept for a mean period of 58Æ2 weeks (range 8–104). Nineteen (39%) had psoriatic arthritis. The results are sum- PASI was determined in 39 patients: mean baseline score was marized in Table 1 and 2. 16Æ2 (range 6Æ5–30). It was not determined in 10 patients

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1010–1014 1012 Experience with etanercept in psoriasis, K. Ahmad and S. Rogers

Failure 90

80 Treatment was discontinued in 10 patients: five who failed to respond (two with CPP, one suberthyrodermic, one with PPP, 70 one with acrodermatitis continua), and in three (CPP) who, 60 despite an initial good response, became resistant to the drug (mean 60 weeks). Two were withdrawn from treatment 50 because of adverse effects. 40 Patients (%) 30 Intermittent treatment 20 PASI 75 Twelve patients (24%) cleared and etanercept was stopped at 10 PASI 90 a mean of 36Æ5 weeks (range 24–52). Ten relapsed and were 0 recommenced on etanercept after a mean remission period of 8 16 24 32 40 48 64 72 80 88 13Æ4 weeks (range 6–20). The response was equally good on Weeks the second cycle of treatment. Rebound did not occur in any of these patients. Two patients remain in remission (mean of Fig 1. Percentage of patients achieving at least 75% reduction in Æ Psoriasis Area and Severity Index (PASI 75) and at least 90% reduction 12 5 weeks). Two patients cleared but etanercept was not in Psoriasis Area and Severity Index (PASI 90) at 8-week intervals. stopped at the request of the rheumatologists. Thirty-seven patients (76%) continue on etanercept. Thirty (61%) have been on etanercept for 72 weeks or more at the time of wri- with acrodermatitis continua (n ¼ 2), PPP (n ¼ 1) and CPP ting (mean 84Æ4 weeks, range 72–108). Seventeen of 19 (n ¼ 7). At least 75% reduction in PASI (PASI 75) was (89%) reported improvement in joint pain. achieved in 31% (12 of 39) of patients at week 16, 47% at week 24 and 66% at week 48. At least 90% reduction in PASI Adverse effects was achieved in 23% of patients at week 16, 39% at week 24 and 45% at week 48. The PASI scores between 8 weeks and Etanercept was generally well tolerated. Infections included 88 weeks are shown in Figure 1. streptococcal pharyngitis (n ¼ 3), recurrent chest infection (n ¼ 3), ear infection (n ¼ 2), vulval candidiasis (n ¼ 1), abscess (n ¼ 1), cellulitis of the breast (n ¼ 1) and influenza- Static Physician Global Assessment like symptoms (n ¼ 1). Other minor adverse effects included At week 24, 44% had a PGA score of excellent, 20% good, headache (n ¼ 1) and lethargy (n ¼ 3). A 36-year-old man 16% moderate, 15% poor and 4% failed to respond. At week with a normal chest X-ray and negative Mantoux test devel- 48, 58% scored excellent, 20% good, 12% moderate, 6% poor oped tuberculosis which presented as unilateral cervical lymph- and 4% failed to respond (Fig. 2). Of the two patients with adenopathy at week 24. Histology of a gland showed caseating acrodermatitis continua, one had an excellent response while granulomas consistent with tuberculous lymphadenitis. Ziehl– the other patient, with severe disease, failed to respond. Neelsen stain for acid-fast bacilli was negative. Culture was not requested as, at the time of biopsy, the working diagnosis was lymphoma. Etanercept was stopped and he was treated with triple therapy (rifampicin, isoniazid, pyrazinamide) for 60 PGA at week 24 2 months followed by 4 months of rifampicin and isoniazid. PGA at week 48 He was recommenced on etanercept and responded well. 50 A 66-year-old man developed diarrhoea at week 50 which proved to be due to Crohn disease. Two patients developed 40 basal cell carcinomas; both had previous phototherapy and ciclosporin. A 37-year-old woman, with an excellent response 30 to etanercept, reported depression at week 56. She refused to see a psychiatrist. Halving the dose of etanercept to 25 mg Patients (%) 20 BIW led to lessening of symptoms which cleared on cessation of therapy. A 40-year-old woman, in whom infliximab had been discontinued 8 weeks earlier, started on etanercept 10 50 mg BIW. Injection site reactions developed which koebner- ized rapidly, resulting in a generalized flare of psoriasis. Treat- 0 Excellent Good Moderate Poor Fail ment was discontinued at week 8. A 46-year-old man, previously in good health, died suddenly at week 36. His is a Fig 2. Static Physician Global Assessment (PGA) at weeks 24 and 48. coroner’s case and there is no further information available.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1010–1014 Experience with etanercept in psoriasis, K. Ahmad and S. Rogers 1013

tudinal studies are needed to resolve the continuous or inter- Laboratory abnormalities mittent treatment options. It is interesting that our three ) ) Leucopenia (2Æ1 · 109 L 1) and lymphopenia (0Æ6 · 109 L 1) patients who had an initial good response, and became resist- were noted in eight patients, present at baseline in four (pre- ant to the drug at a mean of 60 weeks, had had a similar viously on methotrexate, FAE and infliximab), and transient in experience with infliximab. ) four. Transient thrombocytopenia (110 · 109 L 1) occurred Recurrent chest infections in three patients (three episodes in two patients. Two patients had a raised creatinine in 9 months) were considered to be drug related as they were ) (120 lmol L 1, normal 40–95) at baseline; both had previ- uncharacteristic for the patients. We had one case of extrapul- ously been on ciclosporin. One patient developed a gradual monary tuberculosis in a patient who may have been rendered ) rise in creatinine after 36 weeks (170 lmol L 1) and is under more susceptible by prior treatment with FAE which is an further investigation by the nephrologists. Eight patients had immunosuppressive agent.13 Reactivation of tuberculosis is a up to four times normal liver enzymes: five were abnormal at major concern with TNF-a inhibitors. Keane et al.14 reported baseline (previously on methotrexate) and in three they were 70 cases, 40 of whom had extrapulmonary tuberculosis, out transiently raised. Five patients developed positive ANA of 147 000 patients treated with infliximab. Twenty-five cases (1 : 160 to 1 : 650) after a mean of 28 weeks; one pati- of tuberculosis associated with etanercept have been reported ent, previously treated with infliximab, had positive ANA to the U.S. Food and Drug Administration between November (1 : 1650) prior to etanercept. The titre dropped to 1 : 650 at 1998 and March 2002.15 Thirteen of these patients had extra- week 12. Etanercept was not discontinued in any of the pulmonary tuberculosis. U.S. and Canadian monographs do patients because of laboratory abnormalities. not require pretreatment tuberculosis screening for etanercept.16 We followed the British guidelines17 which state that Discussion all patients should be screened for tuberculosis. Injection site reactions have been reported in 37% of Placebo-controlled trials have shown etanercept to be effective patients on etanercept in controlled trials. They were described in moderate to severe psoriasis,7,8 and our results are no as mild to moderate and usually did not necessitate drug dis- exception. The difference between those studies and ours lies continuation. Only one of our 49 patients developed injection in severity of psoriasis and length of follow-up. The nature of site reactions. These were severe enough to warrant discon- such studies ensures that only patients matching strict inclu- tinuation of treatment. The sudden death of a previously well sion/exclusion criteria are included, i.e. those with stable pla- 46-year-old man remains unexplained. It may have been sud- que psoriasis, a minimum PASI of 10, and one previous den adult death as he had been in excellent health. Depression systemic treatment or PUVA. By contrast, all our patients had has been reported with high levels of TNF-a18,19 and so, anti- been admitted to hospital at least once and had taken a mini- TNF-a agents such as etanercept would not be expected to mum of two systemic agents to which they had failed to induce depression. However, in randomized controlled trials respond or were intolerant. Our patients were not excluded of rheumatoid and psoriatic arthritis, and in postmarketing on the basis of comorbidity unless it was an absolute contrain- reports, depression was reported in patients treated with etan- dication, e.g. congestive heart failure, or on the basis of ercept.20 A patient known to us since childhood, and a good abnormal laboratory tests. We were dealing, therefore, with historian, developed depression despite clearance of her psori- the typical patient with recalcitrant psoriasis that evolves over asis. Her symptoms reduced on halving the dose and cleared years of phototherapy and systemic agents. The surprising on cessation of treatment. thing is that our results are similar to those of such trials. Excluding baseline abnormal results which could be PASI 75 is the most frequently used measure of psoriasis explained by previous treatment with methotrexate, FAE and treatment outcome. In previous studies, approximately 30% of infliximab, the overall laboratory abnormalities were transient. patients achieved it at week 12.7,8 Fifteen per cent of our Five (10%) of our patients developed positive ANA but they patients achieved PASI 75 at week 8, 31% at week 16 and did not rise beyond 1 : 650 titre. In clinical trials 11% of 47% at week 24 (Fig. 1). Seventy-two per cent achieved PASI patients on etanercept developed a positive ANA titre of 75 at week 64 and, although this appears impressive, it must 1 : 40 or greater, compared with 5% of patients in the pla- be remembered that failures and nonresponders were excluded cebo group.21 None of our patients developed lupus or anti- by that time. double-stranded DNA antibodies. In 10 (20%) patients whose psoriasis cleared, the drug was The development of Crohn disease on etanercept is interest- discontinued and was reintroduced when relapse occurred fol- ing. It has been reported in a 21-year-old man in whom it lowing a mean remission of 13Æ4 weeks. Their response was developed during etanercept therapy.22 Our patient developed equally good on the second cycle of treatment. No patient Crohn disease at age 66 years, after 50 months on etanercept. experienced rebound as has been reported with efalizumab.12 His treatment was changed to adalimumab after consultation Some workers, including Leonardi (C.L. Leonardi, St Louis with his gastroenterologist. The decision to treat a 46-year-old University School of Medicine, St Louis, MO, U.S.A., personal women with carcinoma of the breast was taken in conjunction communication), consider that etanercept should be given with her oncologist. She was erythrodermic and had exhausted continuously to prevent the development of resistance. Longi- phototherapy and other systemic treatments. Her response to

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1010–1014 1014 Experience with etanercept in psoriasis, K. Ahmad and S. Rogers etanercept was excellent and she remains on etanercept 2 years 8 Leonardi CL, Powers JL, Matheson RT et al. Etanercept as monotherapy later, with no recurrence of the carcinoma. in patients with psoriasis. N Engl J Med 2003; 349:2014–22. To date, this is the longest retrospective study showing 9 Fredriksson T, Pettersson U. Severe psoriasis—oral therapy with a new retinoid. Dermatologica 1978; 157:238–44. the efficacy of etanercept in psoriasis. We have found 10 Ashcroft DM, Li Wan Po A, Williams HC, Griffiths CEM. Clinical etanercept to be effective in severe psoriasis recalcitrant to measures of disease severity and outcome in psoriasis: a critical other systemic medication. Three (6%) patients developed appraisal of their quality. Br J Dermatol 1999; 141:185–91. resistance to the drug despite having an initial good 11 Levell NJ, Shuster S, Munro CS, Friedmann PS. Remission of ordin- response. Unmasking of latent tuberculosis in one patient ary psoriasis following a short clearance course of cyclosporin. underlines the need for rigorous tuberculosis screening. Our Acta Derm Venereol (Stockh) 1995; 75:65–9. results suggest that etanercept can be used intermittently 12 Golda N, Benham SM, Koo J. Rebound of psoriasis during treatment with efalizumab. J Drugs Dermatol 2006; 5:63–5. without rebound, with psoriasis responding again on 13 Lehman M, Risch K, Asadullah K et al. Fumaric acid esters are reintroduction of etanercept. Randomized controlled trials are potent immunosuppressants: inhibition of acute and chronic rejec- needed to establish the intermittent use of etanercept and for tion in rat kidney transplantation models by methyl hydrogen its long-term safety. fumarate. Arch Dermatol Res 2002; 294:399–404. 14 Keane J, Gershon S, Wise RP et al. Tuberculosis associated with infliximab, a tumour necrosis alpha-neutralising agent. N Engl J Med References 2001; 345:1098–104. 1 Ettehadi P, Greaves MW, Wallach D. Elevated tumour necrosis fac- 15 Mohan AK, Cote TR, Block JA et al. Tuberculosis following the use tor-alpha (TNF-alpha) biological activity in psoriatic skin lesions. of etanercept, a tumor necrosis factor inhibitor. Clin Infect Dis 2004; 39:295–9. Clin Exp Immunol 1994; 96:146–51. 2 Partsch F, Steiner G, Leeb BF et al. Highly increased levels of 16 Amgen/Wyeth Pharmaceuticals. Enbrel Canadian and US Product tumor necrosis factor-alpha and other proinflammatory cyto- Monograph. Thousand Caves, CA ⁄Philadelphia, PA: Amgen/Wyeth kines in psoriatic arthritis synovial fluid. J Rheumatol 1997; Pharmaceuticals, 2000. 24:518–23. 17 British Thoracic Society Standards of Care Committee. BTS recom- 3 Tutrone WD, Kagen MH, Barbagallo J, Weinberg JM. Biologic ther- mendations for assessing risk and for managing Mycobacterium tuber- apy for psoriasis: a brief history, II. Cutis 2001; 68:367–72. culosis infection and disease in patients due to start anti-TNF-alpha 4 Moreland LW, Schiff MH, Baumgartner SW et al. Etanercept therapy treatment. Thorax 2005; 60:800–5. in rheumatoid arthritis: a randomized, controlled trial. Ann Intern 18 Tuglu C, Kara SH, Caliyurt O et al. Increased serum tumor necrosis Med 1999; 130:478–86. factor-alpha levels and treatment response in major depressive 5 Mease P, Goffe B, Metz J, Vanderstoep A. Etanercept in the treat- disorder. Psychopharmacology 2003; 170:429–33. ment of psoriatic arthritis and psoriasis: a randomised trial. Lancet 19 Tyring S, Gottlieb A, Papp K. Etanercept and clinical outcomes, 2000; 356:385–90. fatigue, and depression in psoriasis: double-blind placebo- 6 Davis JC, van der Heijde D, Braun J et al. Recombinant human controlled randomised phase III trial. Lancet 2006; 367:29–35. tumor necrosis factor receptor (etanercept) for treating ankylosing 20 Etanercept [package insert]. Seattle, WA: Immunex Corporation and spondylitis: a randomized, controlled trial. Arthritis Rheum 2003; Wyeth-Ayerst Pharmaceuticals, 2002. 48:3230–6. 21 Shakoor N. Drug-induced systemic lupus erythematosus associated 7 Gottlieb AB, Matheson RT, Lowe N et al. A randomized trial of with etanercept therapy. Lancet 2002; 359:579–80. etanercept as monotherapy for psoriasis. Arch Dermatol 2003; 22 Oh J, Arkfeld DG, Horwitz DA. Development of Crohn’s disease in 139:1627–32. a patient taking etanercept. J Rheumatol 2005; 32:752–3.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1010–1014 CONCISE COMMUNICATION DOI 10.1111/j.1365-2133.2007.07806.x Keratitis–ichthyosis–deafness syndrome: disease expression and spectrum of connexin 26 (GJB2) mutations in 14 patients J. Mazereeuw-Hautier,* E. Bitoun, J. Chevrant-Breton, S.Y.K. Man,§ C. Bodemer,– C. Prins,** C. Antille,** J.-H. Saurat,** D. Atherton, J.I. Harper, D.P. Kelsell§ and A. Hovnanian *Service de Dermatologie, Hoˆpital Rangueil, 1 avenue Jean Poulhe`s, TSA 50032, 31059 Toulouse cedex 9, France Inserm, U. 563, Toulouse, F-31300, France Department of Dermatology, CHU Pontchaillou, Rennes, France §Centre for Cutaneous Research, Institute of Cell and Molecular Sciences, Queen Mary University of London, U.K. –Department of Dermatology, Necker Hospital, Paris, France **Department of Dermatology, Cantonal Hospital, Geneva, Switzerland Department of Paediatric Dermatology, Great Ormond Street Hospital, London, U.K. Department of Medical Genetics, CHU Purpan, Toulouse, France

Summary

Correspondence Background Keratitis–ichthyosis–deafness (KID) syndrome is a rare congenital dis- Juliette Mazereeuw-Hautier. order characterized by the association of skin lesions, hearing loss and vasculariz- E-mail: [email protected] ing keratitis. KID syndrome is caused by autosomal dominant mutations in the connexin 26 gene (GJB2). Accepted for publication 23 November 2006 Objectives To establish whether there is a correlation between genotype and phenotype in KID syndrome. Key words Methods Clinical examination and molecular analysis of GJB2 were performed in a connexin 26, deafness, ichthyosis, keratitis, cohort of 14 patients with KID syndrome originating from 11 families. We keratitis–ichthyosis–deafness syndrome also reviewed the 23 cases with molecular analysis previously reported in the Conflicts of interest literature. None declared. Results The patients displayed the classical signs of KID syndrome with the additional finding of inflammatory nodules in six patients (43%); this clinical finding has not been described previously in the literature. One patient presented at the age of 18 years with a fatal carcinoma of the tongue, an extremely rare reported complication. For seven of the 11 families (64%) the disease was sporadic, whereas it was familial in the remaining four families (36%). Twelve patients (86%) were heterozygous for the p.Asp50Asn mutation and two patients (14%) were heterozygous for the p.Ser17Phe mutation. Surprisingly, a family in which we personally examined the healthy parents had two affected children heterozygous for the p.Asp50Asn mutation, suggesting germinal mosaicism. Com- pared with patients with the p.Asp50Asn mutation, the two patients with the p.Ser17Phe mutation had more severe skin involvement. One of these two patients experienced a carcinoma of the tongue. Conclusions Familial cases appear to be more frequent than reported in the literature. The possibility of germinal mosaicism must be taken into account for genetic counselling. This study also suggests that patients with the p.Ser17Phe mutation may have a more severe phenotype and could be at higher risk for tongue carcinoma.

Keratitis–ichthyosis–deafness (KID) syndrome is a rare dis- mutations in the connexin 26 (Cx26) gene (GJB2).2,3 Cx26 order characterized by the association of keratitis, skin lesions is a 26-kDa protein of 225 amino acids, encoded by two and hearing loss.1 It is an autosomal dominant condition, the exons (the ﬁrst exon is noncoding) localized on chromosome majority of cases being sporadic. KID syndrome is caused by 13.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1015–1019 1015 1016 KID syndrome, J. Mazereeuw-Hautier et al.

To date, molecular analysis of GJB2 has been reported in 23 Ocular anomalies and deafness patients with KID syndrome,2–9 including two series of 10 and four patients whose clinical characteristics were not Keratitis was present in 12 of the 14 patients (86%) and was described in detail. The vast majority of patients carried the diagnosed at a mean ± SEM of 25Æ6±6Æ7 months. Visual p.Asp50Asn mutation. Here, we report the largest series of 14 impairment was severe in nine of the 12 patients (75%). patients with detailed phenotypic and molecular analysis. Deafness was a constant feature and was diagnosed at a mean ± SEM of 30Æ3±9Æ3 months. Deafness was profound Patients and methods for 13 of the 14 patients (93%).

Patients Malignant lesions

We studied a cohort of 14 patients with KID syndrome with Four of the 14 patients (29%) developed a squamous cell car- unrelated parents. The diagnosis was based on dermatological, cinoma. For three of them, it was located on the skin and ophthalmological and hearing evaluation. It was confirmed by arose between the age of 30 and 40 years. The fourth patient molecular analysis of GBJ2. Written consent for publication of presented at the age of 18 years with a poorly differentiated the pictures was obtained from the patients. carcinoma of the tongue. He had chemo/radiotherapy and rapidly died. Mutation analysis of GJB2 coding exon Mutation detection Following local ethical approval and informed consent, genomic DNA was extracted from blood leucocytes using standard Inheritance methods.10 GJB2 exon 2 was amplified by polymerase chain reaction (PCR) using forward (5¢-GCTATGTTCCTGTGT- Of the 11 families, seven (64%) had a sporadic form and four TGTGTG-3¢) and reverse (5¢-TTGGGAAATGCTGGCGACTG-3¢) (36%) a familial form. Parent to child transmission in families primers. PCR products (0Æ777 kb) were sequenced and muta- 2 and 6 was verified by molecular analysis. A similar transmis- tions were identified by digesting with HphI, BsmIorTth111I sion was likely for patients 1 and 9 who had an affected par- restriction enzymes (New England Biolabs Ltd, Hitchin, U.K. ent. Interestingly, we noted occurrence of KID syndrome in and Life Technologies Ltd, Paisley, U.K.). the two children (6.1 and 6.3) born from unaffected parents whom we personally examined. Results Mutations in GJB2 Patients We identified two different pathogenic mutations in exon 2 Patients’ features are summarized in Table 1. Clinical features of GJB2. Twelve of the 14 patients (86%) had the hetero- of patients 1, 8 and 10 were previously reported.11–13 zygous c.148GfiA mutation causing the substitution of an aspartic acid residue for an asparagine at position 50 (p.Asp50Asn). The remaining two patients (14%) had a C to Skin appearance T transition (c.50CfiT), which substitutes serine at position All patients presented with generalized thickening of the 17 for a phenylalanine (p.Ser17Phe). skin, characteristic palmoplantar keratoderma (Fig. 1a), erythematous verrucous lesions (Fig. 1b, c) and aged facial Genotype–phenotype correlation appearance with grooves around the mouth. Of the 14 patients, three (21%) had epidermal cysts, seven (50%) had Compared with patients with the p.Asp50Asn mutation, the hyperkeratotic lesions and six (43%) had inflammatory nod- two patients with the p.Ser17Phe mutation had more extensive ules (Fig. 1d, e). Histological examination of the nodules hyperkeratotic lesions and nodules, associated with more skin revealed either a folliculitis with foreign body reaction or infections. Three patients with the p.Asp50Asn mutation had a in situ squamous cell carcinoma. Two patients had hyper- carcinoma on the skin while one of the patients with the keratotic lesions (Fig. 1f, g) and nodules in an extensive p.Ser17Phe mutation had a carcinoma on the tongue. distribution. Discussion Associated features The 14 patients had the characteristic clinical features of KID Onychodystrophy was a constant feature. Alopecia was noted syndrome.1 However, the occurrence of inflammatory nodules in 13 of the 14 patients (93%). Recurrent skin infections were had not been previously reported. Histological findings sug- reported in nine of the 14 patients (64%), two of them hav- gest that they reflect folliculitis but can also be a squamous ing extremely frequent and refractory episodes. cell carcinoma.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1015–1019 ora Compilation Journal 07TeAuthors The 2007

Table 1 Clinical and molecular features of the 14 patients with keratitis–ichthyosis–deafness syndrome 07BiihAscaino Dermatologists of Association British 2007 Appearance of the skin Age at Degree of Recurrent Carcinoma the ﬁrst Visual Deafness deafness Age At At skin (age at ocular acuity (age at at GJB2 Familya (Y) Sex Origin birth present infection Onychodystrophy Alopecia diagnosis) sign at present diagnosis) present Inheritance mutation 1 30 F France D GTS, PPK, EVP (face, ) + I Scalp (30 Y), 5 Y 1/10 ND Profound F (AD) p.Asp50Asn limbs), EC (chest), foot (30 Y) IN (scalp, pelvis), HL (scalp) 2.1 42 F France D GTS, PPK, EVP ) + I Foot (40 Y) 33 Y 0/10 1 Y Profound S p.Asp50Asn Mother (face, limbs), HL and 5/10 (scalp) 2.2 10 F France HK GTS, PPK, EVP, HL ) +N) 5 Y 10/10 8 Y Mild F (AD) p.Asp50Asn Daughter (nose) (scalp) 3 12 F U.K. D GTS, PPK, EVP (face, + + C congenital ) 4 Y ND (mild) 6 M Profound S p.Asp50Asn limbs) )

• 4 14 M Greece D GTS, PPK, EVP (face), ++ I 7 M 1/10 5 Y Profound S p.Asp50Asn rts ora fDermatology of Journal British HL (limbs) and 2/10 5 39 M U.K. D and GTS, PPK, EVP (face, + + I Buttock Birth Blind 1 Y Profound S p.Asp50Asn E limbs), HL (limbs) (38 Y) 6.1 33 F France ND GTS, PPK, EVP (diffuse), ++ C) 1 Y Severe 7 M Profound F p.Asp50Asn Mother IN (scalp) 6.2 6 M France N GTS, PPK, EVP (face, limbs) + + I ) No ocular N 6 M Profound F (AD) p.Asp50Asn Son sign 6.3 35 F France D GTS, PPK, EVP (diffuse), ++ C) 1 Y Severe 1 Y Profound F p.Asp50Asn Sister IN (scalp) of 6.1 2007 7 23 F France N GTS, PPK, EVP (face, ) +I) No ocular N 3 Y Profound S p.Asp50Asn limbs), EC (face) sign Mazereeuw-Hautier J. syndrome, KID

156, 8 11 F Algeria E GTS, PPK, EVP (face) ) +I) ND ND 7 M Profound S p.Asp50Asn 9 54 F France PPK GTS, PPK, EVP (face), ++ I ) 3 Y 1/10 8 Y Profound F (AD) p.Asp50Asn pp1015–1019 EC (trunk), IN (trunk) and 2/10 10 28 F Switzerland E GTS, PPK, EVP, + Permanent + I ) Birth Blind 8 M Profound S p.Ser17Phe IN (diffuse), HL (diffuse) 11 18 M U.K. N GTS, PPK, EVP, IN + Permanent + I Tongue Birth Blind 3 Y Profound S p.Ser17Phe (diffuse), HL (diffuse) (18 Y)

aSome families have several affected members. Y, year(s); D, dry and scaly skin; HK, hyperkeratosis; E, erythroderma; ND, not determined; PPK, palmoplantar keratoderma; N, normal; GTS, generalized thickened skin; EVP, erythematous verrucous plaques; EC, epidermal cysts; IN, inﬂammatory nodules; HL, hyperkeratotic lesions; I, incomplete; C, complete; M, months; F, familial; AD, autosomal dominant; S, sporadic. tal. et 1017 1018 KID syndrome, J. Mazereeuw-Hautier et al.

(a) (d) (f)

(b)

(e) (g)

(c)

Fig 1. Clinical features of the patients with keratitis–ichthyosis–deafness syndrome. Characteristic palmoplantar keratoderma with grainy leather- like surface (a), well-circumscribed erythematous verrucous plaques on the face in patient 3 (b) and limbs in patient 1 (c), inﬂammatory nodules on the scalp (d) and genital area (e) in patient 1, diffuse hyperkeratotic lesions localized in patient 10 with the p.Ser17Phe mutation on the body (f), and on the face (g).

Of the 23 reported patients with molecular analysis, only parents. This strongly suggests germinal mosaicism in one of two presented with a squamous cell carcinoma in the skin the parents. Unfortunately, this mode of inheritance remains associated with the p.Asp50Asn mutation.2,5 Here, we report uncertain as no molecular analysis and formal verification of three additional patients with skin carcinoma with the same paternity could be performed. Another possibility is that of mutation. We also report the third case of carcinoma of the incomplete penetrance of the disease but this has not been tongue14,15 and show that the patient had the p.Ser17Phe described in the literature. mutation. Our series confirms that the p.Asp50Asn mutation is a com- In their review of 61 patients, Caceres-Rios et al.1 found mon mutation in KID syndrome. The percentage of 87% familial occurrence in four reports only, one of them cor- found in our series is comparable with the percentage of 78% responding to patient 1.11 According to our series, the occur- found in the literature. The mutation p.Ser17Phe has previous- rence of familial disease seems to be more frequent. Parent- ly been reported only once in the literature.3 We report here to-child transmission of the p.Asp50Asn mutation has been two further patients with this mutation. None of the other verified in the literature in only two cases.3,4 We were able to three missense mutations that have occasionally been reported verify this transmission in two additional patients. We report was identified in our cohort: p.Asp50Tyr,6 p.Gly45Glu4,8 and here the first family with two children born from unaffected p.Gly12Arg.3

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1015–1019 KID syndrome, J. Mazereeuw-Hautier et al. 1019

The progressive deterioration in the clinical features and the 2 van Steensel MA, van Geel M, Nahuys M et al. A novel connexin 26 rarity of patients with a mutation different from p.Asp50Asn are mutation in a patient diagnosed with keratitis–ichthyosis–deafness difﬁculties in correlating genotype to phenotype. Nevertheless, syndrome. J Invest Dermatol 2002; 118:724–7. 3 Richard G, Rouan F, Willoughby CE et al. Missense mutations in compared with patients with the p.Asp50Asn mutation, the two GJB2 encoding connexin-26 cause the ectodermal dysplasia patients with the p.Ser17Phe mutation had more severe skin keratitis–ichthyosis–deafness syndrome. Am J Hum Genet 2002; 70: involvement. Furthermore, one of them developed a carcinoma 1341–8. of the tongue. A correlation between genotype and phenotype 4 Janecke AR, Hennies HC, Gunther B et al. GJB2 mutations in kerati- is difﬁcult to establish for the other mutations p.Asp50Tyr and tis–deafness syndrome including its fatal form. Am J Med Genet p.Gly12Arg reported in the literature, as no precise clinical 2005; 133:128–31. descriptions are available.3,6 In contrast, the two patients with 5 van Geel M, van Steensel MA, Ku¨rster W et al. HID and KID syndromes are associated with the same connexin 26 mutation. Br J the p.Gly45Glu mutation died early in life,4,8 suggesting that Dermatol 2002; 146:938–42. this mutation predicts a poor prognosis. This mutation in the 6 Yotsumoto S, Hashiguchi T, Chen X et al. Novel mutations in GJB2 homozygous form is associated with nonsyndromic hearing encoding connexin-26 in Japanese patients with keratitis–ichthyo- 16 loss. The cellular mechanisms explaining these genotype– sis–deafness syndrome. Br J Dermatol 2003; 148:649–53. phenotype differences are still poorly understood. 7 Alvarez A, del Castillo I, Pera A et al. De novo mutation in the gene In conclusion, we report here the largest cohort of 14 encoding connexin-26 in a sporadic case of keratitis–ichthyosis– patients with KID syndrome. This study provides new insights deafness (KID) syndrome. Am J Med 2003; 117:89–91. 8 Binder B, Hennies HC, Kraschl R, Smolle J. Connexin 26 mutation into the mode of transmission that must be taken into account and keratitis–ichthyosis–deafness (KID) syndrome. J Dtsch Dermatol for genetic counselling. This study suggests that patients with Ges 2005; 3:105–8. the p.Ser17Phe mutation could be more severely affected and 9 Bygum A, Betz RC, Kragballe K et al. KID syndrome: report of a at higher risk for tongue carcinoma. Scandinavian patient with connexion-26 gene mutation. Acta Derm Venereol (Stockh) 2005; 85:152–5. 10 Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Acknowledgments Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. We sincerely thank the patients and their families for their 11 Grob JJ, Breton A, Bonafe´ JL et al. Keratitis, ichthyosis, and deaf- participation. We thank M. Larregue for his involvement with ness (KID) syndrome. Vertical transmission and death from this group of patients. We thank A.M. Mazarguil for molecular multiple squamous cell carcinomas. Arch Dermatol 1987; 123:777– analysis. We are grateful to GENESKIN (European coordinating 82. action) and to Ce´line Deraison and Laeticia Lacaze-Buzy (Cen- 12 Boudghene-Stambouli O, Merad-Boudia A, Abdelali S. KID- tre de Re´fe´rence des Maladies orphelines de la Peau, Toulouse, syndrome, pachydermatoglyphie et syndrome du Dandy Walker. France). We thank the Research Advisory Board of Barts and Ann Dermatol Venereol 1994; 121:99–102. 13 Harms M, Gilardi S, Levy PM, Saurat JH. KID syndrome (keratitis, the London for funding some of the research presented in this ichthyosis and deafness) and chronic mucocutaneous candidiasis: study. case report and review of the literature. Pediatr Dermatol 1984; 2:1– 7. References 14 Lancaster L, Fournet LF. Carcinoma of the tongue in a child: report of case. J Oral Surg 1969; 27:269–70. 1 Caceres-Rios H, Tamayo-Sanchez L, Duran-McKinster C et al. Kerati- 15 Baden HP, Alper JC. Ichthyosiform dermatosis, keratitis, and deaf- tis, ichthyosis and deafness (KID syndrome): review of the litera- ness. Arch Dermatol 1977; 113:1701–4. ture and proposal of a new terminology. Pediatr Dermatol 1996; 16 Abe S, Usami S, Shinkawa H et al. Prevalent connexin 26 gene 13:105–13. (GJB2) mutations in Japanese. J Med Genet 2000; 37:41–3.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1015–1019 CONCISE COMMUNICATION DOI 10.1111/j.1365-2133.2007.07813.x Topical pimecrolimus and tacrolimus transiently induce neuropeptide release and mast cell degranulation in murine skin S. Sta¨nder, H. Sta¨nder, S. Seeliger,* T.A. Luger and M. Steinhoff Department of Dermatology and Boltzmann Institute for Immuno- and Cell Biology of the Skin, University of Mu¨nster, Von-Esmarch-Strasse 58, D-48149 Mu¨nster, Germany *Department of Pediatrics, University of Mu¨nster, Mu¨nster, Germany

Summary

Correspondence Background The topical calcineurin inhibitors pimecrolimus and tacrolimus have Sonja Sta¨nder. been demonstrated to be an effective new anti-inflammatory therapy. The only E-mail: [email protected] clinically relevant side-effect reported is transient application site burning and stinging itch at the beginning of topical therapy. Accepted for publication 20 June 2006 Objectives In order to understand the underlying mechanism of this effect, we examined whether or not the compounds are able to stimulate neuropeptide Key words release in normal murine skin as well as in a mouse model of experimentally burning, calcineurin inhibitor, pruritus, sensory induced irritant contact dermatitis. neuron, transient receptor potential vanilloid 1 Methods Balb/c mice were treated with 1% pimecrolimus cream or 0Æ1% tacro- Conflicts of interest limus ointment. Untreated and corresponding vehicle-treated mice served as None declared. controls. Skin specimens were investigated by light, immunofluorescence and electron microscopy as well as enzyme-linked immunosorbent assay and polymerase chain reaction. Results Topical application of pimecrolimus and tacrolimus was followed by an initial release of substance P and calcitonin gene-related peptide from primary afferent nerve fibres in murine skin during the early inflammatory response. The release of the neuropeptides and their binding to mast cells (MCs) led to MC degranulation. Mediators of MCs such as histamine and tryptase may induce pruritus and burning by binding to the corresponding receptors (histamine receptor 1, proteinase-activated receptor 2) on sensory nerve fibres, which explains the initial side-effects during therapy with calcineurin inhibitors. Conclusions It may be speculated that calcineurin inhibitors directly stimulate intracellular signalling pathways or bind to ion channels such as transient receptor potential vanilloid 1 or receptors involved in nociception.

The topical calcineurin inhibitors pimecrolimus (SDZ ASM Materials and methods 981, Elidel) and tacrolimus (FK 506, Protopic) have been demonstrated to be an effective and safe treatment for atopic Studies were performed in Balb/c mice aged 8–10 weeks. Per- dermatitis and pruritus of inflammatory cause.1–3 The import- mission for mouse studies was given by Animal Defence and ant clinically relevant side-effect is a transient application site Ethical Committees of the University of Mu¨nster, Germany, burning and stinging itch at the beginning of topical ther- the latter in accordance with the ethical standards of the 1964 apy.4–11 The side-effects subside within the first days of ther- Declaration of Helsinki. apy, resulting in effective suppression of inflammation and Healthy Balb/c mice were treated on the shaved back twice pruritus. In order to understand the underlying mechanism of daily with either 1% pimecrolimus cream or 0Æ1% tacrolimus this effect, we examined whether or not pimecrolimus and ointment for 2 (n ¼ 5), 4 (n ¼ 5) or 8 (n ¼ 5) days. tacrolimus were able to stimulate neuropeptide release in nor- Untreated and corresponding vehicle-treated mice (each n ¼ mal murine skin as well as in a mouse model of experiment- 3) served as controls. Skin specimens were investigated by ally induced irritant contact dermatitis (ICD). light (haematoxylin and eosin, Giemsa, anti-S100 staining),

2007 The Authors 1020 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1020–1026 Calcineurin inhibitors and neuropeptide release, S. Sta¨nder et al. 1021

Table 1 Immunohistochemical results of pimecrolimus or tacrolimus application in mice

Substance P immunoreactivity CGRP immunoreactivity Substance Histological changes of nerve ﬁbres of nerve ﬁbres 2 days Pimecrolimus No degranulation of mast cells Reduced Reduced Tacrolimus Single mast cells degranulated Reduced to normal Reduced Vehicle to pimecrolimus None Normal Normal Vehicle to tacrolimus None Normal Normal Untreated control None Normal Normal 4 days Pimecrolimus Epidermis thickened, single mast Reduced Reduced cells degranulated Tacrolimus Mast cells degranulated Reduced to normal Reduced Vehicle to pimecrolimus Epidermis thickened Normal Normal Vehicle to tacrolimus None Normal Normal Untreated control None Normal Normal 8 days Pimecrolimus Epidermis thickened, mast cells Reduced Reduced degranulated Tacrolimus Mast cells degranulated Reduced to normal Reduced Vehicle to pimecrolimus Epidermis thickened Normal Normal Vehicle to tacrolimus None Normal Normal Untreated control None Normal Normal

CGRP, calcitonin gene-related peptide.

(a) (b)

Nerve fibre

Fig 1. No mast cell degranulation is visible after a 2-day application of pimecrolimus (a) or an 8-day application of the corresponding pimecrolimus vehicle (b), while extracellular mast cell granules were present after a 2-day treatment with tacrolimus (c) or an 8-day treatment with pimecrolimus (d). Arrows, mast cells; arrowheads, mast cell granules; anti-S100 staining; original magniﬁcation: (a–c), · 200; (d), · 400.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1020–1026 1022 Calcineurin inhibitors and neuropeptide release, S. Sta¨nder et al. immunofluorescence [rabbit antisubstance P (SP) antibody, In order to verify or falsify modulation on the neuropeptide 1 : 200, Chemicon, Hofheim, Germany; rabbit anticalcitonin receptor level, expression of the neurokinin receptor 1 gene-related peptide (CGRP) antibody, 1 : 200, Genosys, (NK1R; receptor for SP) was quantified from mouse ears Cambridge, U.K.] and electron microscopy. 2–8 h after treatment as described above by semiquantitative In addition, 1% pimecrolimus cream, 0Æ01% tacrolimus reverse transcription-polymerase chain reaction (RT-PCR). ointment or the corresponding cream vehicle was used in a mRNA from mouse ears was isolated as described12 using TRI- model of experimentally induced ICD. Here, the topical zol reagent (Life Technologies, Karlsruhe, Germany), accord- irritant benzalkonium chloride (5%) was applied on the ing to the manufacturer’s instructions. One microgram of right ear, followed 6 h later by treatment with 1% pimecro- RNA was subjected to reverse transcription using Promega limus solution or 0Æ01% tacrolimus solution. Left ears served tools (Promega, Mannheim, Germany). For PCR amplifications as negative controls (with or without dermatitis, vehicle con- the following primer pairs were used: NK1R forward primer trol). Additionally, 0Æ025% capsaicin ointment served as a 5¢-CCAGCTAGCCAAAGTCACCAT-3¢ and reverse primer positive control. For enzyme-linked immunosorbent assay 5¢-GTCTCGGAGCCATACAGGATT-3¢ (fragment size 354 bp). (ELISA) measurements, mouse ears were harvested 30 min For reliable semiquantitative comparison of NK1R expression, after application of calcineurin inhibitors or capsaicin and PCR products were compared with corresponding a-tubulin prepared for the detection of neuropeptide release (SP), as (housekeeping gene) bands from different samples. The described.12 amplification programmes used were: NK1R, one cycle of

(a) (b)

Fig 2. Reduced expression of calcitonin gene-related peptide (CGRP) in pimecrolimus-treated skin after 2 days (a) and 8 days (b). Arrowheads indicate normal immunoreactivity for CGRP in nerves while in the overlying papillary dermis nerve ﬁbres reveal reduced (arrow) or absent CGRP reactivity. Conserved expression for substance P in some nerve ﬁbres after 2 days of tacrolimus application (c, arrow) which is markedly reduced after 8 days (d, arrow). E, epidermis.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1020–1026 Calcineurin inhibitors and neuropeptide release, S. Sta¨nder et al. 1023

94 C, 5 min; 58 C, 2 min; 72 C, 1 min; followed by 31 (a) 7 cycles of 94 C, 45 s; 58 C, 45 s; 72 C, 1 min; and a final 6 cycle of 94 C, 45 s; 58 C, 45 s; 72 C, 10 min; a-tubulin, 5 one cycle of 94 C, 5 min; 57 C, 45 s; 72 C, 2 min; fol- 4 lowed by 31 cycles of 94 C, 45 s; 57 C, 45 s; 72 C, µm 3 2 min. An aliquot of reaction products was run on 1% agarose 2 gels and product size was analysed compared with a coampli- 1 fied control template. To semiquantify the amounts of NK1R 0 1234567 mRNA, the signal intensity of PCR products was compared by densitometer reading with that of the a-tubulin PCR product (b) 70 amplified from the same cDNA in a separate PCR reaction. All 60 experiments were repeated at least three times. 50 * 40 * Statistical analysis µm 30 20 Results are expressed as mean ± SEM, as indicated in figure 10 legends. Comparisons between groups were made using a 0 two-way analysis of variance and Student–Newman–Kuels test 1234567 (multiple groups). P £ 0Æ05 was considered significant. Fig 3. Ear swelling responses in mouse ears after topical treatment Results with the calcineurin inhibitors 1% pimecrolimus cream and 0Æ1% tacrolimus ointment. Ear swelling responses (lm) after (a) 5 min Following tacrolimus application, single (day 2) and up to and (b) 30 min. 1, no treatment; 2, ointment vehicle control for 70% as judged by semiquantitative analysis (day 4, 8) but not tacrolimus; 3, 0Æ1% tacrolimus ointment; 4, cream vehicle control for all mast cells (MCs) were found to be degranulated, often in pimecrolimus; 5, 1% pimecrolimus cream; 6, 0Æ025% capsaicin close vicinity to nerve fibres (Table 1, Fig. 1). No MC degran- ointment; 7, ointment vehicle control for capsaicin. Results are shown as mean ± SEM, n ¼ 9(*P <0Æ01). ulation was observed in skin treated with pimecrolimus for 2 days. Four-day application of pimecrolimus led to sporadic MC degranulation, while 8-day treatment resulted in abundant MC degranulation. The untreated control as well as the corres- 275 ± 41%) and CGRP (114 ± 56%) even in the early phase ponding vehicle controls showed nondegranulated MCs in all (0Æ5 h) after pimecrolimus treatment of mouse ears (Fig. 4). sections. Immunofluorescence staining revealed a reduced Protein concentrations for SP were slightly enhanced at 6 h ) staining of the neuropeptides SP and CGRP in papillary nerve (44 ± 15 vs. 9 ± 5 fmol g 1) in the ICD model, indicating fibres after the application of pimecrolimus or tacrolimus higher release of SP in the inflammatory skin as compared (Fig. 2). This was observed after 2, 4 and 8 days. Comparing with controls. both neuropeptides, CGRP showed a more reduced staining Similarly, tacrolimus ointment was capable of inducing SP than SP. The untreated and vehicle-treated mice revealed a in the experimentally induced mouse model of ICD. Neuro- preserved presence of both neuropeptides in superficial and peptide release (SP) was measured by ELISA in homogenates deep nerve fibres. Moreover, at the ultrastructural level, tacro- of mouse ears after treatment with 0Æ01% tacrolimus or 1% limus- and pimecrolimus-treated skin nerve fibres were found pimecrolimus ointment. SP concentrations were compared in to be regular, without signs of degeneration or inflammation the supernatant of slices of normal ears 30 min after topical (data not shown). application; ear slices pretreated with 0Æ025% capsaicin (four In order to investigate the effects of pimecrolimus and times daily for 6 days), followed by topical treatment with tacrolimus on ear swelling responses in vivo, we used 1% tacrolimus, pimecrolimus or capsaicin; ear slices of mice with pimecrolimus cream, 0Æ1% tacrolimus ointment and 0Æ025% experimentally induced ICD, followed by topical treatment; capsaicin ointment as well as cream vehicle control for each and ear slices pretreated with 0Æ025% capsaicin (four times substance (Fig. 3). Five minutes after application, no signifi- daily for 6 days), followed by topical treatment. Our data cant differences on ear swelling responses were observed in all clearly demonstrate that tacrolimus enhances SP homogenate groups investigated. After 30 min, however, statistically signi- concentrations both in untreated and in inflamed (ICD) tissue. ficant changes were obtained after application of capsaicin, This is in good agreement with results observed for SP release pimecrolimus and tacrolimus, respectively, as compared after capsaicin stimulation (Fig. 5). Pimecrolimus also induced with the corresponding vehicle controls. Capsaicin induced a SP release in both groups (Fig. 4), although statistically sig- 346Æ1% increase in ear swelling, followed by pimecrolimus nificantly only in the ICD group. Together, these results indi- with 188Æ8% and tacrolimus with 102Æ2%. cate that calcineurin inhibitors stimulate neuropeptide release These results were supported by ELISA experiments. Pimecro- predominantly in inflamed skin, and to a lesser extent also in limus cream induced enhanced release of SP (mean ± SEM normal skin (Fig. 5). After capsaicin pretreatment, no statistic-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1020–1026 1024 Calcineurin inhibitors and neuropeptide release, S. Sta¨nder et al.

(a)110 (b) 110 100 100 90 90 80 80 ) ) –1 70 –1 70 60 60 50 50 40 40 Sp-IR (fmol g Sp-IR (fmol g 30 30 20 20 10 10 0 0 12345 123 45

–1 70 –1 70 60 60 50 50 40 40 Sp-IR (fmol g Sp-IR (fmol g 30 30 20 20 10 10 0 0 12345 12 34 5

Fig 4. Detection of neuropeptide release (substance P, SP) in mouse ears after treatment with 1% pimecrolimus solution. (a, b) normal skin; (c, d) inflamed skin (irritant contact dermatitis, ICD). Measurement of SP concentrations in the supernatant of (a) slices of normal ear tissue 30 min after topical application of pimecrolimus or capsaicin, (b) ears slices pretreated with 0Æ025% capsaicin (four times daily for 6 days), followed by topical treatment with pimecrolimus or capsaicin, (c) ear slices from mice with experimentally induced ICD, followed by topical treatment with pimecrolimus or capsaicin, (d) ear slices from mice with ICD pretreated with 0Æ025% capsaicin, followed by topical treatment with pimecrolimus or capsaicin. 1, no treatment; 2, 1% pimecrolimus; 3, negative control (Ringer’s solution); 4, 0Æ025% capsaicin solution; 5, control. Results are shown as mean ± SEM, n ¼ 5(P <0Æ01). ally significant change in SP release was observed, indicating with calcineurin inhibitors. The observation of MC degranula- specificity of neuronal secreted SP after treatment with cal- tion after application of calcineurin inhibitors is in agreement cineurin inhibitors. with other studies showing inhibition of IgE-mediated but Neither pimecrolimus cream nor tacrolimus ointment not neuropeptide-mediated MC degranulation by calcineurin affected NK1R mRNA levels as detected by semiquantitative inhibitors.13–15 Thus, the observed tachyphylaxis of clinically RT-PCR analysis (data not shown). observed burning and pruritus may not be due to responses at the receptor mRNA level. However, effects on receptor intern- Discussion alization and endocytosis pathways cannot be excluded at this stage. The present data indicate that topical application of pimecroli- The initial side-effects and the morphological changes mus or tacrolimus is followed by an initial release of SP and occurring during application of topical calcineurin inhibitors CGRP from primary afferent nerve fibres in murine skin dur- resemble the clinical signs of neurogenic inflammation as ing the early inflammatory response but does not induce up- observed during topical capsaicin therapy.16 The vanilloid cap- regulation of the corresponding receptor. The release of the saicin binds to the transient receptor potential vanilloid 1 neuropeptides and their binding to MCs leads to MC degranu- (TRPV1) expressed on cutaneous sensory nerve fibres leading lation as regularly observed in treated mice. Mediators of MCs to depolarization and release of the neuropeptides SP and such as histamine and tryptase may induce pruritus and burn- CGRP17 followed by burning and stinging itch. After desensiti- ing by binding to the corresponding receptors (histamine zation of the receptor, the symptoms subside and pruritus and receptor 1, proteinase-activated receptor 2) on sensory nerve painful sensations are suppressed, as regularly observed also fibres, which explains the initial side-effects during therapy during therapy with calcineurin inhibitors. It may be specula-

(a)160 (b) 160 150 150 140 140 130 130

) 120 ) 120 –1 110 –1 110 g 100 g 100 90 90 80 80 70 70 60

Sp-IR (fmol 60 Sp-IR (fmol 50 50 40 40 30 30 20 20 10 10 0 0 12345 123 45

(c)160 (d) 160 150 150 140 140 130 130 ) ) 120 120 –1 –1 110 110 g g 100 100 90 90 80 80 70 70 60 60 Sp-IR (fmol Sp-IR (fmol 50 50 40 40 30 30 20 20 10 10 0 0 12345 12 34 5

Fig 5. Detection of neuropeptide release (substance P, SP) in mouse ears after treatment with 0Æ01% tacrolimus solution. (a, b) normal skin; (c, d) inflamed skin (irritant contact dermatitis, ICD). Measurement of SP concentrations in the supernatant of (a) slices of normal ear tissue 30 min after topical application of tacrolimus or capsaicin, (b) ear slices pretreated with 0Æ025% capsaicin (four times daily for 6 days), followed by topical treatment with tacrolimus or capsaicin, (c) ear slices from mice with experimentally induced ICD, followed by topical treatment with tacrolimus or capsaicin, (d) ear slices from mice with ICD pretreated with 0Æ025% capsaicin, followed by topical treatment with tacrolimus or capsaicin. 1, no treatment; 2, 0Æ1% tacrolimus; 3, negative control; 4, 0Æ025% capsaicin; 5, control. Results are shown as mean ± SEM, n ¼ 5 (P <0Æ01). ted that these substances may bind to the TRPV1 or another 3 Sta¨nder S, Schu¨rmeyer-Horst F, Luger TA, Weisshaar E. Treatment receptor of the same family. Alternatively, calcineurin inhibi- of pruritic diseases with topical calcineurin inhibitors. Ther and Clin tors may directly activate neuronal intracellular signal trans- Risk Manag 2006; 2:213–18. 4 Reitamo S, Wollenberg A, Scho¨pf E et al. Safety and efficacy of duction pathways such as macrophilins. This is currently 1 year of tacrolimus ointment monotherapy in adults with atopic under investigation. dermatitis. Arch Dermatol 2000; 36:999–1006. 5 Soter NA, Fleischer AB Jr, Webster GF et al. Tacrolimus ointment Acknowledgments for the treatment of atopic dermatitis in adult patients: part II, safety. J Am Acad Dermatol 2001; 44(Suppl. 1):S39–46. IZKF (2/127/06; M.S., S.S.), SFB 293 (A14), DFG (STE 6 Paller A, Eichenfield LF, Leung DY et al. A 12-week study of tacro- 1014/1-1), C.E.R.I.E.S, France, Serono Germany, Novartis limus ointment for the treatment of atopic dermatitis in pediatric patients. J Am Acad Dermatol 2001; 44(Suppl. 1):S47–57. research foundation, Vienna, Rosacea foundation (M.S.), 7 Kang S, Lucky AW, Pariser D et al. Long-term safety and efficacy of Astellas (S.S.). tacrolimus ointment for the treatment of atopic dermatitis in children. J Am Acad Dermatol 2001; 44(Suppl. 1):S58–64. References 8 Luger T, van Leent EJM, Graeber M et al. SDZ ASM 981: an emerging safe and effective treatment for atopic dermatitis. Br J Dermatol 1 Alomar A, Berth-Jones J, Bos JD et al. European Working Group on 2001; 144:788–94. Atopic Dermatitis. The role of topical calcineurin inhibitors in 9 Meurer M, Folster-Holst R, Wozel G et al. CASM-DE-01 Study atopic dermatitis. Br J Dermatol 2004; 151(Suppl. 70):3–27. Group. Pimecrolimus cream in the long-term management of 2 Tomi NS, Luger TA. The treatment of atopic dermatitis with topical atopic dermatitis in adults: a six-month study. Dermatology 2002; immunomodulators. Clin Dermatol 2003; 21:215–24. 205:271–7.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1020–1026 1026 Calcineurin inhibitors and neuropeptide release, S. Sta¨nder et al.

10 Eichenfield LF, Lucky AW, Boguniewicz M et al. Safety and efficacy mediator release from human dermal mast cells and peripheral of pimecrolimus (ASM 981) cream 1% in the treatment of mild blood basophils. J Allergy Clin Immunol 2001; 108:275–80. and moderate atopic dermatitis in children and adolescents. JAm 15 Hultsch T, Mu¨ller KD, Meingassner JG et al. Ascomycin macrolac- Acad Dermatol 2002; 46:495–504. tam derivative SZD ASM 981 inhibits the release of granule-associ- 11 Wahn U, Bos JD, Goodfield M et al. Flare Reduction in Eczema ated mediators and of newly synthesized cytokines in RBL 2H3 with Elidel (Children) Multicenter Investigator Study Group. Effic- mast cells in an immunophilin-dependent manner. Arch Dermatol Res acy and safety of pimecrolimus cream in the long-term manage- 1998; 290:501–7. ment of atopic dermatitis in children. Pediatrics 2002; 110:1–8. 16 Sta¨nder S, Luger T, Metze D. Effective treatment of prurigo 12 Seeliger S, Derian CK, Vergnolle N et al. Proinflammatory role of nodularis with topical capsaicin. J Am Acad Dermatol 2001; 44:471– proteinase-activated receptor-2 in humans and mice during cutan- 8. eous inflammation in vivo. FASEB J 2003; 17:1871–85. 17 Sta¨nder S, Moormann C, Schumacher M et al. Expression of vanil- 13 DePaulis A, Stellato C, Cirillo R. Anti-inflammatory effect of FK- loid receptor subtype 1 (VR1) in cutaneous sensory nerve fibers, 506 on human skin mast cells. J Invest Dermatol 1992; 99:723–8. mast cells and epithelial cells of appendage structures. Exp Dermatol 14 Zuberbier T, Chong SU, Grunow K et al. The ascomycin macrolac- 2004; 13:129–39. tam pimecrolimus (Elidel, SDZ ASM 981) is a potent inhibitor of

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1020–1026 CASE REPORT DOI 10.1111/j.1365-2133.2007.07792.x Ultrastructural features of ichthyosis hystrix strongly resembling Lambert type W-H. Wang, L-F. Li, Q. Zhang, S-M. Yang,* W. Jiang, Y-Y. Wang, P-C. Lei and X-R. Chen Department of Dermatology, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100083, China *Department of Pathology, Peking University, Beijing, China

Summary

Correspondence Ichthyosis hystrix (IH) is characterized by spiny hyperkeratotic scale, and Lin-Feng Li. includes Brocq type, Lambert type, Curth–Macklin type, Rheydt type and Ba¨fver- E-mail: [email protected] stedt type. The first documented cases of familial IH were of Lambert type. How- ever, the ultrastructural features of IH Lambert type have not been reported. Accepted for publication 7 November 2006 Three patients in two generations of a family from north China were observed. The patients showed widespread verrucose lesions without blister formation. The Key words face, palms and soles were unaffected. This presentation strongly resembled IH binuclear cell, ichthyosis hystrix, shell, Lambert type. The lesions faded dramatically in summer, without treatment. tonofilament Light microscopic examinations showed binuclear cells and shell formation in Conflicts of interest the granular and upper spinous layers in all specimens, with similar findings in None declared. winter, when lesions were prominent, and in summer, when lesions had subsi- ded. Electron microscopic examination revealed binuclear keratinocytes and con- centric, thin to thick, unbroken shells of tonofilaments surrounding the nuclei, and segregation of cytoplasmic components. This family is the first with familial IH strongly resembling Lambert type to be reported in China. Binuclear cells and tonofilaments shells surrounding the nucleus in upper keratinocytes were characteristic features, which were similar to those reported in IH Curth–Macklin type. The basic histopathological defects were not changed despite significant clinical improvement of the lesion.

We describe a family in which three members in two genera- Physical examination showed symmetrically distributed, tions were affected with a condition strongly resembling ich- band-like, cobblestone-like, thickened, verrucous, black and thyosis hystrix (IH) Lambert type (pedigree, Fig. 1). The hyperkeratotic skin. The axillary region, antecubital and family was of Han race, and from Hebei Province in north popliteal fossae and the waist band area were less markedly China. The proband was a 16-year boy. His mother and one affected. His face, scalp, hair, oral mucosa, teeth, nails, palms sister were also affected. The intrafamilial variance was small. (Fig. 2c) and soles were unaffected. His nonverrucose skin was The mother was said to have 10 sibs, none of whom was normal, as well as his general physical and mental condition. affected. The proband’s father and two other sisters were not His mother and one sister were also affected, showing sim- affected. Light microscopic examinations and electron micro- ilar disease histories and clinical ﬁndings (Fig. 2d). Their gen- scopic examinations of the lesions were performed. The study eral physical and mental condition was normal. was approved by the local ethics committee and written informed consent was given by the family. Microscopic ﬁndings

Case report Skin biopsies taken in winter from the arm of the proband and the leg of his affected sister showed a papillomatous pro- The proband was normal at birth following a normal preg- liferation which had undergone striking hyperkeratosis. The nancy and delivery. Subsequently, verrucose lesions developed stratum corneum had a basket-weave appearance. Many dou- over much of the body by the age of about 3 months. The ble nuclei were seen in the granular and upper spinous layers. lesions were prominent in winter (Fig. 2a), but faded signiﬁ- Cellular boundaries were distinct with no vacuolation and cantly in summer (Fig. 2b) without treatment. At no time did there were large irregular spaces separating well-outlined cells any blisters occur. and groups of cells. The basal layer, dermis and dermal

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1027–1031 1027 1028 Ichthyosis hystrix Lambert type, W-H. Wang et al.

crest-like papillomatosis into the horny layer also persisted, and double nuclei and shells were also frequently seen, despite the significant clinical improvement of the lesion. Electron microscopic examination of a skin lesion of the proband’s sister showed binuclear cells and thin to thick, unbroken shells surrounding the nucleus in the granular and upper spinous layers. The shells divided the cytoplasm into three sharply delineated compartments. Between the shells and the nuclei was a cytoplasmic zone containing an abundance of ribsomes and no fibrils. Outside the shell the tonofilaments Fig 1. Pedigree of the family with ichthyosis hystrix strongly formed normal bundles and terminated on normal desmo- resembling Lambert type through two generations. Filled symbols somes. No tonofibrillar clumps or acantholysis were seen. The indicate individuals carrying the disease. Arrow indicates the proband. shells were composed of rather loosely arranged, reticular tonofilament areas where the tonofilaments lacked the normal appendages were normal except for a mild perivascular tendency to form bundles (Fig. 4a–c). lymphocytic infiltration (Fig. 3a). His sister also showed histological features of epidermodysplasia verruciformis (Fig. 3c). Discussion Similar changes (Fig. 3b) were revealed in a biopsy taken in summer on adjacent skin of the proband to that biopsied in IH is a poorly descriptive but historical term, and embraces winter, except that the horny layer was thinner. Prominent all ichthyoses that display striking hyperkeratotic verrucous

(a) (b) (c)

(d)

Fig 2. Lesions of the proband (a) in winter, and (b) in summer, when lesions faded dramatically without treatment. (c) The palms were spared in winter. (d) The proband’s affected sister showed similar lesions on her legs.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1027–1031 Ichthyosis hystrix Lambert type, W-H. Wang et al. 1029

(a) (a)

(b)

(c)

Fig 4. (a–c) Electron microscopic examination of the proband’s affected sister. Binuclei and perinuclear shells could be seen. The inner perinuclear cytoplasm contains an abundance of ribosomes and no fibrils. Outside the shell is the peripheral cytoplasm where additional keratins are gradually joining the shell and keep contact with normal desmosomes. The shells are composed of rather loosely arranged, reticular tonofilament. Original magnification: (a) ·2000; (b) ·5000; (c) ·20 000.

dark-brown ridges. ‘Porcupine man’ and ‘epidermal naevus’ have also been used to describe these linear lesions and epidermolytic hyperkeratosis (bullous ichthyosiform hyperkerato- Fig 3. (a,b) Light microscopic examinations in the proband. (a) In 1 winter, many double nuclei are seen in the granular and upper sis) could also be presented as IH. spinous layers; (b) in summer, similar changes are revealed to those In 1972, Curth et al. divided IH into four groups: erythro- in winter. (c) Light microscopic examination of the proband’s affected dermie congenitale ichthyosiforme type bulleuse (Brocq), sister. Haematoxylin and eosin; original magniﬁcation: (a) ·400; ichthyosis hystrix gravior (Lambert family), maleformatio (b) ·400; (c) ·200. ectodermalis generalisata (Ba¨fverstedt) and ichthyosis hystrix

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1027–1031 1030 Ichthyosis hystrix Lambert type, W-H. Wang et al. type Curth–Macklin.2 A new type reported in 1977, Rheydt type, we postulate that they might be one entity which could type, has subsequently been added.3–5 be divided into two categories of palms and soles affected/ In Brocq type, blistering is characteristic, erythroderma is unaffected (PS/NPS), just like epidermolytic hyperkeratosis, more marked and naevoid forms are less common.3 Acantho- which is divided into PS and NPS phenotypes. keratolytic hyperkeratosis is seen histopathologically, and Another kind of ichthyosis with shell formation is congen- defects of tonofibrils, clumps and perinuclear shells are seen ital reticular ichthyosiform keratinization disorder.6 Binuclear ultrastructurally.2 In our patients, blisters never occurred, and cells and perinuclear shells are also seen, but these shells do the ultrastructural features did not support Brocq type, either. not consist of tonofilaments that are attached to their outer IH Ba¨fverstedt type was described in an isolated case report surface; instead, they are formed by a three-dimensional net- of a mentally retarded young Swedish man with striking hys- work of fine interdigitating filaments, ultrastructurally similar trix-like follicular hyperkeratosis but mildly affected palms; to glycoproteins.6 histopathology showed hyperkeratosis, acanthosis, enlarge- After the Lambert family, only two solitary patients with ment of the granular layer and occasional dyskeratotic cellular IH resembling Lambert type have been reported. One case degeneration, and ultrastructural features were not reported.2,3 was reported by Capetanakis et al. in 1975.14 The patient had In IH Rheydt type, skin hyperkeratosis was most prominent a negative family history and two squamous cell epithelio- on the face and extremities, hearing loss was present, and ultra- mas; light microscopic examination showed hyperkeratosis structurally there was an unusual synthesis of large amounts and vacuolation of the spinous cells, but electron microscopy of mucous granules combined with a lack of normal tonofila- was not performed. The other case was reported by Kriner ments under the large spines.5 These types of IH are obviously and Montes from Argentina in 1997.15 The patient also had different from that in our patients. a negative family history, and light microscopic examination The clinical expression of IH Curth–Macklin type varies results were described as marked hyperkeratosis, acanthosis, from palmoplantar keratoderma to a severe generalized prominent vacuolated granular layer with fragmentation of involvement, with autosomal dominant inheritance.2 Histopa- keratohyaline granules, identical to epidermolytic hyperkera- thology shows granular cells with perinuclear oedema and tosis, which were different from our results; however, in shell formation, and binuclear cells; ultrastructural features are that case, blister formation was not mentioned, palms and segregation of cytoplasmic components, perinuclear tonofila- soles were thickened, and electron microscopy was not per- ment shells and binuclear keratinocytes.2,6–11 formed. So, the diagnosis of IH Lambert type could not be The first documented cases of familial IH were of Lambert confirmed. In our opinion, this might be a case of epi- type.12 Between 1731 and 1851, the Lambert family of Suf- dermolytic hyperkeratosis. folk, England, had 11 affected members in four generations. Niemi et al. and Kanerva et al. have reported a family includ- Some affected members were known as ‘porcupine men’, and ing five patients in three generations8 and a solitary patient7 appeared in circuses as ‘a new species of man’. A review in diagnosed as having IH Curth–Macklin type. The diagnosis 1958 showed that females were also affected and that the ich- was based on the distinct electron microscopic finding of con- thyosis was autosomal dominant. Their skin, normal at birth, tinuous perinuclear tonofibril shells in the upper keratinocytes. developed dark warty scaling after 7 weeks of age. There was The patients in their reports had normal palmar and plantar no blistering, and the face, palms and soles were spared. The skin, and according to the review of Curth et al.2 they should histopathology was not reported.12 be better classified as having IH Lambert type. Whether palms and/or soles are affected is a differential Another interesting finding in our observations was that point between IH Curth–Macklin type and IH Lambert type.2 similar basic histopathological changes could be found at In our family, the affected members showed generalized stri- nearly the same site of the proband’s skin in summer as well king hyperkeratotic verrucous lesions without blisters, the as in winter, although a significantly improved clinical appear- inheritance pattern was autosomal dominant, palms and soles ance was seen in summer. These results indicated that the were not affected and intrafamiliar variance was small, thus underlying pathogenetic factors, which should be gene muta- strongly resembling IH Lambert type. tions, were not changed. The underlying gene mutations will Histological examinations revealed acanthosis, papillomato- be investigated in our further study. In the patients with IH sis and severe orthokeratotic hyperkeratosis, with frequent bi- Curth–Macklin type mentioned above (who should be better nuclear cells and prominent perinuclear shells, which was very classified as having IH Lambert type in our opinion), the same similar to IH Curth–Macklin type. Histological features remi- ultrastructural changes were also revealed in uninvolved and niscent of epidermodysplasia verruciformis were seen in the involved skin;8 in addition, the basic defect did not change specimen from the proband’s sister, which can be also seen in under treatment with oral retinoids, although the patient the histological pictures of IH Curth–Macklin type.13 greatly improved.7 However, the lesions of our patients faded On electron microscopy, there were binuclear cells and con- dramatically in summer and the exposed areas were less centric, thin to thick, unbroken shells of tonofilaments involved. The reason is still unclear. Sunlight exposure may surrounding the nuclei. These features were similar to IH help to alleviate the disease. Curth–Macklin type. Considering that the clinical features of Keratin 1 (K1) and keratin 10 (K10) gene mutations in the IH Lambert type are also similar to those of IH Curth–Macklin critical position of the rod domain have been reported in IH

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1027–1031 Ichthyosis hystrix Lambert type, W-H. Wang et al. 1031

Brocq type, with K1 mutations giving rise to PS phenotype 7 Kanerva L, Karvonen J, Oikarinen A et al. Ichthyosis hystrix and K10 mutations causing NPS phenotype.16 Connexin 26 (Curth–Macklin). Light and electron microscopic studies performed mutation was confirmed in IH Rheydt type (hystrix-like before and after etretinate treatment. Arch Dermatol 1984; 120:1218–23. ichthyosis–deafness syndrome).17 Two heterozygous frame- 11 18 8 Niemi KM, Virtanen I, Kanerva L, Muttilainen M. Altered keratin shift mutations (1609GGfiA and 1566delG ) in the tail expression in ichthyosis hystrix Curth–Macklin. A light and elec- domain of K1 were found in IH Curth–Macklin type with tron microscopic study. Arch Dermatol Res 1990; 282:227–33. involvement of the palms/soles. In contrast, linkage analysis 9 Anton-Lamprecht I. Ultrastructural identification of basic abnormal- in a family diagnosed as having IH Curth–Macklin type with- ities as clues to genetic disorders of the epidermis. J Invest Dermatol out palm/sole involvement (possibly a variant form of IH 1994; 103 (Suppl. 5):S6–12. Lambert type in our opinion) excluded the disease from kera- 10 Baleviciene G, Schwartz RA. Epidermolytic hyperkeratosis with ichthyosis hystrix. Cutis 2000; 66:319–22. tin gene loci.19 Considering the basic abnormality of supraba- 11 Sprecher E, Ishida-Yamamoto A, Becker OM et al. Evidence for sal binuclear cells and keratin filament shells and normal novel functions of the keratin tail emerging from a mutation caus- palms/soles, we postulate that the tail domain of K10 is the ing ichthyosis hystrix. J Invest Dermatol 2001; 116:511–19. first candidate to search for the gene mutation of the family 12 Penrose LS, Stern C. Reconsideration of the Lambert pedigree (ich- presented here, and K1 and regulatory genes of keratin expres- thyosis hystrix gravior). Ann Hum Genet 1958; 22:258–83. sion mutations could also be possible candidates. 13 Curth HO, Macklin MT. The genetic basis of various types of ichthyosis in a family group. Am J Hum Genet 1954; 6:371–82. 14 Capetanakis J, Stratigos J, Tsambaos D et al. Ichthyosis hystrix of References ‘porcupine man’ type. Report of a case. Dermatologica 1975; 151:177–83. 1 Adam JE, Richards R. Ichthyosis hystrix. Epidermolytic hyperkera- 15 Kriner J, Montes LF. Gigantic ichthyosis hystrix. J Am Acad Dermatol tosis; discordant in monozygotic twins. Arch Dermatol 1973; 1997; 36:646–7. 107:278–82. 16 DiGiovanna JJ, Bale SJ. Clinical heterogeneity in epidermolytic 2 Curth HO, Allen FH Jr, Schnyder UW, Anton-Lamprecht I. Follow- hyperkeratosis. Arch Dermatol 1994; 130:1026–35. up of a family group suffering from ichthyosis hystrix type Curth– 17 van Geel M, van Steensel MA, Kuster W et al. HID and KID syn- Macklin. Humangenetik 1972; 17:37–48. dromes are associated with the same connexin 26 mutation. Br J 3 Griffiths WAD, Judge MR, Leigh IM. Disorders of keratinization. In: Dermatol 2002; 146:938–42. Textbook of Dermatology (Champion RH, Burton JL, Burns DA, Breathn- 18 Richardson ES, Lee JB, Hyde PH et al. A novel mutation and large ach SM, eds), 6th edn. Oxford: Blackwell Science, 1998; 1509–11. size polymorphism affecting the V2 domain of keratin 1 in an 4 Plewig G, Wolff HH. Dermatology. Berlin: Springer-Verlag, 1991; African-American family with severe, diffuse palmoplantar kerato- 518–19. derma of the ichthyosis hystrix Curth–Macklin type. J Invest Dermatol 5 Gulzow J, Anton-Lamprecht I. Ichthyosis hystrix gravior typus 2006; 126:79–84. Rheydt: an otologic-dermatologic syndrome. Laryngol Rhinol Otol 19 Bonifas JM, Bare JW, Chen MA et al. Evidence against keratin gene (Stutt) 1977; 56:949–55. mutations in a family with ichthyosis hystrix Curth–Macklin. J Invest 6 Anton-Lamprecht I. Genetically induced abnormalities of epidermal Dermatol 1993; 101:890–1. differentiation and ultrastructure in ichthyoses and epidermolyses: pathogenesis, heterogeneity, fetal manifestation, and prenatal diagnosis. J Invest Dermatol 1983; 81 (Suppl. 1):S149–56.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1027–1031 CASE REPORT DOI 10.1111/j.1365-2133.2007.07827.x Sclerodermatous graft-versus-host disease: clinical spectrum and therapeutic challenges J.M.L. White, D. Creamer, A.W.P. du Vivier, A. Pagliuca,* A.Y. Ho,* S. Devereux,* J.R. Salisbury and G.J. Mufti* Departments of Dermatology, *Haematology and Histopathology, King’s College Hospital, London SE5 9RS, U.K.

Summary

Correspondence Sclerodermatous graft-versus-host disease (GVHD) is a rare complication of bone Jonathan M.L. White. marrow transplantation. While GVHD is often associated with the beneficial graft E-mail: [email protected]; vs. tumour effect, it also contributes towards significant morbidity and mortality. [email protected] No reliably effective treatment has yet been established. We present 10 patients Accepted for publication with haematological malignancies who underwent an allogeneic stem cell trans- 26 November 2006 plant and developed sclerodermatous GVHD. Donor lymphocyte infusion administered for relapse or reducing donor T-cell chimerism was a known trigger for Key words sclerodermatous GVHD in four of the patients. Treatment with immunosuppres- chronic graft-versus-host disease, clinical subtypes, sants, psoralen plus ultraviolet A (PUVA) and extracorporeal photopheresis has graft-versus-host disease, review, sclerodermatous been largely unsuccessful in their management. Intensive immunosuppression graft-versus-host disease, treatment including the use of anti-CD20 monoclonal antibody may have contributed to Conflicts of interest relapse of leukaemia in one patient 10 years after her transplant. Sclerodermatous None declared. GVHD may occur without a preceding lichenoid stage. Clinical heterogeneity is common, although sclerodermatous GVHD has a predilection for the limbs. Treatment options are largely unsatisfactory if conventional immunosuppression fails. PUVA may give some symptomatic benefit and extracorporeal photopheresis seems to be less efficacious than previously published work suggests.

Sclerodermatous graft-versus-host disease (GVHD) is a rare GVHD to topoisomerase I, PM-Scl, La/SSB and nucleolin form of chronic GVHD with a prevalence of approximately (C23), in comparison with patients with nonsclerodermatous 3% in patients receiving allogeneic bone marrow transplants.1 GVHD.5 Sclerodermatous GVHD may be generalized or localized and is Exogenous factors implicated in the aetiology of scleroder- characterized by cutaneous features such as sclerosis, atrophy, matous GVHD include donor lymphocyte infusion (DLI), telangiectasia, hyper- or hypopigmentation, erythema, contrac- which is dose dependent (up to 59% of patients affected4). tures, ulceration, hair loss and nail changes (dystrophy, atro- Other risk factors provoking sclerodermatous GVHD include phy and koilonychia). Mucocutaneous features include skin trauma, e.g. herpes zoster, physical trauma or blistering.1 xerophthalmia, xerostomia and sclerodermatous plaques on Trauma causes increased release of interferon-c from both the lips and oral cavity, which may restrict mouth opening. CD4 and CD8 T-cell clones,6 which may (with interleukin-4 Transformation of acute to chronic GVHD occurs in general- also secreted by T cells) induce sclerodermatous GVHD,7 by ized sclerodermatous GVHD but not necessarily in the locali- stimulating fibroblast collagen production. Exogenous inter- zed form.2 feron-a also may induce chronic GVHD in up to 78% of trea- Generalized forms of sclerodermatous GVHD cause signifi- ted patients8 and can cause sclerodermatous GVHD.9 cant functional disability due to reduced mobility. Mortality Skin biopsy in sclerodermatous GVHD may show a normal may be approximately 20–40%, due to extracutaneous or atrophic epidermis, basal cell layer vacuolar degeneration, involvement,3 although some series show reduced mortality in inflammation and eosinophilic body formation. Fibrosis and sclerodermatous GVHD due to an enhanced graft vs. tumour destruction of adnexal structures are commonly seen in the effect.4 While sclerodermatous GVHD is associated with dermis and fibrosis may extend to the subcutaneous fat.1 reduced relapse rate (and hence increased disease-free sur- Pigmentary incontinence may also be seen in the dermis. We vival), extracutaneous sclerodermatous GVHD may actually present 10 patients with sclerodermatous GVHD to illustrate increase mortality (thereby reducing disease-free survival). its clinical heterogeneity, and review treatment options of this There is increased positivity in patients with sclerodermatous disabling disease.

2007 The Authors 1032 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 Sclerodermatous GVHD, J.M.L. White et al. 1033

Case reports

Patient 1

A 35-year-old woman with acute myeloid leukaemia (AML M0) developed progressive tightening of the skin at acral sites causing functional restriction, 8 months after a sibling allograft. Skin biopsy showed epidermal atrophy with a grossly sclerotic dermis composed of expanded bundles of pale hyalinized collagen. Adnexal structures such as hair follicles and sweat glands were replaced by dense sclerosis (Fig. 1), features seen in all subsequent cases. She was commenced on topical tacrolimus ointment 0Æ1% and later was treated with rituximab. Neither agent improved her symptoms.

Patient 2

A 30-year-old woman with AML (M1) received a matched unrelated donor (MUD) allograft at her ﬁrst complete remission. She showed signs of acute cutaneous GVHD 5 weeks post-transplant which resolved spontaneously. She received DLI 1 year later for cytogenetic relapse. Two infusions were ) given with 1 · 107 and 1Æ3 · 108 CD3+ cells kg 1. Twelve months later, she developed erythematous plaques with pale, atrophic centres as well as diarrhoea and weight loss. Over the next 2 years, the eruption progressed to involve the whole body, causing tight skin and contractures (Fig. 2), and she became wheelchair bound. Fig 2. Patient 2. Severe generalized sclerodermatous graft-versus-host Treatments given without clinical improvement include disease that did not respond to any treatment. ciclosporin, oral tacrolimus, prednisolone, mycophenolate mofetil (MMF), thalidomide, intravenous immunoglobulin, AML relapsed 9 years after her original bone marrow trans- extracorporeal photopheresis (ECP), pentostatin and anti-CD20 ) plant and she subsequently died 1 year later. therapy (rituximab 375 mg m 2 weekly for 4 weeks). Her

Patient 3

A 40-year-old man with AML (M4), treated with a standard female sibling allograft 2 years previously, presented with a progressive, scaly eruption predominantly over the trunk and upper arms. The eruption was not itchy and had ﬁrst been noticed incidentally by the haematologist. Clinically there were multiple atrophic brown plaques over the torso and upper arms with surface scale (Fig. 3). Treatment is ongoing with systemic oral psoralen plus ultraviolet A (PUVA) with an ) increasing dose to 5 J cm 2 with this dose maintained twice weekly. There was some slight softening of the lesions in the initial 8 weeks of PUVA, but no sustained improvement after 1 year of photochemotherapy.

Patient 4 Fig 1. This skin biopsy shows basket-weave keratin overlying an epidermis showing focal lymphocyte exocytosis, particularly in the A 26-year-old man with AML (M4) was transplanted with basal layers. An occasional necrotic keratinocyte is present. The upper marrow from a MUD after standard conditioning. He experi- dermis shows homogenization of the collagen, dilated capillaries and enced maculopapular acute GVHD over the trunk within numerous melanin pigment-containing macrophages (haematoxylin 3 weeks of the transplant. Over the next 6 months, he devel- and eosin). oped ﬁrm, brown areas on his trunk and limbs causing signi-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 1034 Sclerodermatous GVHD, J.M.L. White et al.

Fig 3. Patient 3. Atrophic brown plaques of sclerodermatous graft-versus-host disease on the back.

ficant restriction of back movement. His disease proved resist- Fig 4. Patient 5. Active, acral, sclerodermatous graft-versus-host ant to potent topical and systemic corticosteroids. He disease on the leg. ultimately relapsed with AML initially in the right testis and, despite further chemotherapy, died 3 years after initial Patient 6 presentation. A 28-year-old woman with essential thrombocythaemia with a t(3,22)(q25,q11) chromosomal translocation received a Patient 5 female sibling allograft. She developed mild acute GVHD A 68-year-old man with refractory anaemia with excess blasts 2 months after the transplant (palmar erythema and mucosi- was transplanted with peripheral blood stem cells from a male tis). She was commenced on ciclosporin at this time but over sibling. He had never displayed signs of any form of acute or the next 6 months developed lichenoid chronic GVHD. One chronic GVHD before presentation. Over the first 18 months year after the allograft, she developed tight, waxy areas over post-transplant, he noticed a progressive tightening of his her distal limbs with some involvement of the upper back, arms and legs and dryness of both eyes. Examination revealed some of these sites being previously affected by lichenoid marked skin tethering over the lower legs and medial fore- GVHD. This restricted movement but was otherwise asymp- arms, with sclerodermatous plaques on the medial aspect of tomatic. Treatment with oral prednisolone (20 mg daily) both upper arms, having mauve, active borders (Fig. 4). He resulted in some softening of the lesions, with slight improve- was commenced initially on photochemotherapy (systemic ment in range of movement. PUVA) with little clinical benefit after 5 months of treatment, before he was commenced on ECP and ciclosporin 50 mg Patient 7 daily. The total volume of cells treated so far is 5229 mL; the cumulative dose of 8-methoxypsoralen (Uvadex; Therakos, A 34-year-old woman with Philadelphia-positive chronic mye- Exton, PA, U.S.A.) is 88Æ1 mL after 21 treatments with a loid leukaemia (CML) was treated with a standard sibling allo- cumulative photoactivation time of 609 min. There has been graft. She developed lichenoid GVHD of the hands and mouth no improvement in the sclerodermatous plaques after 3 months after transplantation, with no extracutaneous GVHD. 12 months of treatment, although there has been some reduc- Twelve months after the allograft, she developed symmetrical tion in the restriction of limb movement. hardening of the skin with stiffness and contractions over her

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 Sclerodermatous GVHD, J.M.L. White et al. 1035 elbows, shoulders, knees and ankles, causing functional prob- ted with stem cells from a MUD and required three infusions lems. On examination, the skin was grossly thickened and of donor lymphocytes in the ensuing 9 months (1 · 107, ) indurated on palpation, with some dimpling. She is currently 5 · 107 and 1 · 108 CD3+ cells kg 1). Two months after the being treated with ECP. The total volume of cells treated so third DLI, he developed tightness of the lower arms and legs far is 4192 mL; the cumulative dose of 8-methoxypsoralen and examination also revealed mottled hyperpigmentation (Uvadex)is71Æ0 mL after 16 treatments with a cumulative over these sites. Treatment was initially with prednisolone photoactivation time of 840 min. After 12 months of treat- 20 mg daily, with no improvement. He obtained some soften- ment, she reports softening of the sclerodermatous areas with ing of the affected areas with ECP but while there was no pro- improved mobility. gression with treatment, his disease did not remit.

Patient 8 Discussion

A 50-year-old man with Philadelphia-positive CML was Clinical details of our patients are summarized in Table 1. Our treated with a reduced-intensity bone marrow transplant from patients had a range of different underlying haematological a MUD. Three years later, he showed new clonal cyto- malignancies. They had sex-matched (three of 10) and sex- genetic abnormalities and mixed chimerism. Three months unmatched sibling allografts (two of 10) as well as MUDs of after two infusions of donor lymphocytes (5 · 106 and unknown sex (five of 10). Median age at diagnosis of sclero- ) 1 · 107 CD3+ cells kg 1), he developed progressive thicken- dermatous GVHD was 34Æ5 years. DLI was a trigger factor for ing of the skin over the arms and legs which was tender and sclerodermatous GVHD in four of 10 patients and none of the prevented him walking. Treatment was initially with predniso- patients had preceding trauma or skin infection at the sites lone 20 mg daily, reduced after 3 months to alternate days. subsequently affected by sclerodermatous GVHD. Two of 10 There was some softening of the thickened areas, enabling patients had preceding acute GVHD affecting the skin. Only him to walk; however, the lesions remained painful. He then two patients had preceding lichenoid GVHD, which demon- worsened on thalidomide 200 mg daily. MMF 500 mg twice strates that this clinical variant is not necessary for the subse- daily produced no improvement after 4 months of treatment. quent development of sclerodermatous GVHD. Three months of daclizumab 80 mg weekly also gave no clin- Clinically, there was heterogeneity with features of dermal ical benefit. Latterly he has received ECP on 2 days per month. nodules, atrophic white plaques, hyperpigmentation and There has been some softening of the lesions but no resolu- tethered skin with dimpling. A feature common to all pre- tion of the pain. sentations was of indurated plaques. Histology was remarkably similar for all patients, despite the heterogeneity of site affected and morphology. Sclerodermatous GVHD has a pre- Patient 9 dilection for the arms and legs (nine of 10). Median body A 33-year-old man with stage IVB primary refractory Hodgkin surface area affected was 10%. All of our patients would be disease was treated with a standard conditioned unrelated classified as having generalized sclerodermatous GVHD on bone marrow transplant. Following a further relapse, the previously published criteria2 of at least two distinct ana- patient received six courses of DLI (1 · 106,5· 106, tomical areas being affected. Eight of 10 patients had ) 1 · 107,1Æ9 · 107,5· 107 and 4Æ7 · 107 CD3+ cells kg 1) restriction of daily activities due to their sclerodermatous followed by interferon-a. He had a 3-month history of itchy GVHD. patches over the abdomen, appearing 2 weeks after inter- None of the patients showed complete remission on any feron-a, when he was also commenced on thalidomide treatment. Some softening of lesions was noted with the fol- 100 mg daily, given as treatment for his lymphoma. Examina- lowing treatments: oral corticosteroids (two of 10); PUVA tion revealed two discrete, hypopigmented, atrophic plaques, (two of three) and ECP (two of five). No benefit was seen one on each side of the lower abdomen. The centres were with ciclosporin (two patients treated); oral tacrolimus (one xerotic with an erythematous margin, surrounded by indurat- patient treated); topical tacrolimus (two patients treated); ed hyperpigmentation, occurring at sites of subcutaneous MMF (two patients treated); thalidomide (two patients trea- injections of interferon-a. The lesions were treated initially ted); intravenous immunoglobulin (one patient treated); ritux- with topical tacrolimus 0Æ1% ointment with no clinical imab (two patients treated); pentostatin (one patient treated) response and eventually with photochemotherapy (PUVA). and daclizumab (one patient treated). The plaques have remained atrophic 3 months after initial There are inherent difficulties in clinical trials for sclero- diagnosis; however, the hyperpigmented areas have softened dermatous GVHD. Early clinical features may be nonspecific, considerably. histopathological evaluation is always difficult and clinical outcomes are difficult to quantify objectively. In this regard, skin thickness, as assessed by ultrasonography,10 may be of help. Patient 10 Oral corticosteroids and immunosuppressants such as A 44-year-old man with IgGj myeloma received conditioning ciclosporin are standard treatments for sclerodermatous GVHD. with total-body irradiation and melphalan. He was transplan- Unfortunately, good clinical responses are rarely seen, adverse

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 1036 Sclerodermatous GVHD, J.M.L. White et al.

Table 1 Clinical details

Transplant Surface area Patient Diagnosis type DLI Site Prior GVHD affected (%) Therapy 1 AML (M0) Sibling No Arms, hands, No 5 Pred, Rxm, TTac allograft legs, feet 2 AML (M1) MUD Total: 1Æ4 · Whole body Acute GVHD 100 Cic, ECP, IvIg, MMF, ) 108 cells kg 1 OTac, Pent, Pred, Rxm, Thal 3 AML (M4) Sibling No Trunk, arms No 25 Pred, PUVA allograft 4 AML (M4) MUD No Trunk, arms, legs Acute GVHD 15 Pred 5 RAEB Sibling No Arms, legs No 5 Cic, ECP, Pred, PUVA allograft 6 Essential Sibling No Forearms, legs, Acute GVHD 10 Pred thrombocythaemia allograft back 7 CML Sibling No Shoulders, elbows, Lichenoid 10 ECP, Pred allograft knees, ankles chronic GVHD 8 CML MUD Total: 1Æ5 · Arms, legs No 10 Dzm, ECP, MMF, ) 107 cells kg 1 Pred, Thal 9a Primary refractory Autologous Total: 1Æ32 · Abdomen No 3 Pred, PUVA, TTac ) Hodgkin then MUD 108 cells kg 1 disease (IVB) and IFN-a 10 Myeloma MUD Total: 1Æ6 · 108 Forearms, legs No 5 ECP, Pred ) cells kg 1

DLI, donor lymphocyte infusion; GVHD, graft-versus-host disease; AML, acute myeloid leukaemia; Pred, prednisolone; Rxm, rituximab; TTac, topical tacrolimus 0Æ1%; MUD, matched unrelated donor; Cic, ciclosporin; ECP, extracorporeal photopheresis; IvIg, intravenous immunoglobulin; MMF, mycophenolate mofetil; OTac, oral tacrolimus; Pent, pentostatin; Thal, thalidomide; PUVA, psoralen plus ultraviolet A photochemotherapy; RAEB, refractory anaemia with excess blasts; CML, chronic myeloid leukaemia; Dzm, daclizumab; IFN-a, interferon-a. aPreviously reported.

drug events are frequent and mortality is high (overall survival infliximab,18 rituximab19 and combination treatment with at 1 year is only 56–71%).11 daclizumab and etanercept.20 Two of our series with sclero- Azathioprine12 and tacrolimus13 have also been used for dermatous GVHD (patients 1 and 2) were treated with ritux- the treatment of unclassified chronic GVHD. One of our imab. Neither made a clinical response and patient 1 suffered series (patient 2) was given oral tacrolimus with no clinical relapse of her AML soon after treatment. Patient 8 had no response and a number had been given tacrolimus as GVHD improvement with daclizumab monotherapy. prophylaxis before sclerodermatous GVHD developed. Top- Antithymocyte globulin21 has been found to be of similar ical tacrolimus at 0Æ1% was given initially in two of our efficacy to oral corticosteroids in the treatment of acute GVHD patients, with no clinical response. A single case report14 of but there is no published evidence in chronic GVHD. Theo- successful treatment of chronic GVHD with penicillamine retically, denileukin diftitox, a recombinant fusion protein exists from 1983. derived from diphtheria toxin, may be a promising treatment MMF has been used for GVHD prophylaxis as well as treat- for chronic GVHD by targeting high-affinity interleukin-2 ment of the acute and chronic forms. A study15 investigated receptors.22 the efficacy of MMF in 21 patients with unclassified chronic Thirty-two patients with sclerodermatous GVHD were trea- GVHD. Some had localized disease (six of 21). Doses of MMF ted with retinoids as an adjunct to standard immunosuppres- of 1 g twice daily were given with a favourable clinical sives such as corticosteroids and ciclosporin.23 Etretinate ) response in 72% of the patients. Adverse events included seri- 1mgkg 1 daily was added to the treatment regimen. Twenty ous infections (38% of patients) and nausea (33%), with of 27 evaluable patients had some clinical improvement, other studies confirming this recently.16 Only two of the including two with near clearance; four had no response and patients in our series (patients 2 and 8) were treated with three had progressive disease. MMF, with no clinical response. Thalidomide has been investigated as an adjunct to existing Biological agents have been used to treat cutaneous GVHD standard immunosuppressives. There may be a modest of all subtypes. Small numbers of patients with both acute and improvement in clinical end-points with thalidomide at up to chronic cutaneous GVHD have been treated successfully with 800 mg daily.24,25 Patients in these studies did not tolerate alemtuzumab17 (in conjunction with cyclophosphamide), the treatment well. Sedation, neutropenia, neuropathy and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 Sclerodermatous GVHD, J.M.L. White et al. 1037 constipation were common side-effects. Other studies have GVHD, unlike previously published data; and (v) ECP, in our found no benefit with the use of thalidomide.26 In our series, experience, is not as effective to treat sclerodermatous GVHD patients 2 and 8 made no response to thalidomide, while as trial data would suggest. patient 9 developed his sclerodermatous GVHD while on thalidomide. References Clofazimine3 has shown good improvement of clinical end-points (nine of 16 or 56% of patients with cutaneous 1 Chosidow O, Bagot M, Vernant J-P et al. Sclerodermatous chronic GVHD responding well to 300 mg daily for the first graft-versus-host disease. J Am Acad Dermatol 1992; 26:49–55. 90 days followed by 100 mg daily). There was no apparent 2 Penas PF, Jones-Caballero M, Aragues M et al. Sclerodermatous graft-vs-host disease. Arch Dermatol 2002; 138:924–34. difference in efficacy of clofazimine between the lichenoid 3 Lee SJ, Wegner SA, McGarigle CJ et al. Treatment of chronic and sclerodermatous subgroups (although the data are not graft-versus-host disease with clofazimine. Blood 1997; 89:2298– presented separately). The medication is well tolerated with 302. occasional side-effects of skin discoloration, nausea and 4 Jones-Caballero M, Fernandez-Herrera J, Cordoba-Guijarro S et al. diarrhoea. Sclerodermatous graft-versus-host disease after donor leucocyte Phototherapy with ultraviolet B has been used with mod- infusion. Br J Dermatol 1998; 139:889–92. est success in the treatment of unclassified chronic GVHD.27 5 Bell SA, Faust H, Mittermuller J et al. Specificity of antibodies in scleroderma-like chronic graft-versus-host disease: clinical correl- Photochemotherapy as a treatment specifically for scleroder- ation and histocompatibility locus antigen association. Br J Dermatol matous GVHD may be delivered either by conventional 1996; 134:848–54. PUVA or extracorporeally. PUVA has been used in the treat- 6 Bernabei P, Rigamonti L, Ariotti S et al. Functional analysis of T ment of chronic GVHD but most of the positive literature lymphocytes infiltrating the dermis and epidermis of post-burn involves patients with a lichenoid or unclassified type.28,29 hypertrophic scar tissues. Burns 1999; 25:43–8. Another, isolated case report of definite sclerodermatous 7 Ferrara JL, Deeg HJ. Graft-versus-host disease. N Engl J Med 1991; GVHD suggests that PUVA is not effective;30 however, 324:667–74. 8 Grigg A, Kannan K, Schwarer AP et al. Chemotherapy and gra- patients 3 and 9 in our series made partial responses to nulocyte colony stimulating factor-mobilized blood cell infusion PUVA, whereas patient 5 made no response. Recently, treat- followed by interferon-alpha for relapsed malignancy after ment of sclerodermatous GVHD with ultraviolet A1 (340– allogeneic bone marrow transplantation. Intern Med J 2001; 400 nm) without psoralen with standard immunosuppression 31:15–22. has shown three of five patients with a complete response 9 White JML, Devereux S, Pagliuca A et al. Koebnerizing scleroderma- and two of five with a partial response.31 However, four of tous graft versus host disease caused by donor lymphocyte infusion a the five patients had very localized disease. The data from and interferon- . Br J Dermatol 2006; 155:621–3. 10 Gottlober P, Leiter U, Friedrich W et al. Chronic cutaneous sclero- this study also show that relapse is common and that main- dermoid graft-versus-host disease: evaluation by 20-MHz sonogra- tenance treatment is needed. phy. J Eur Acad Dermatol Venereol 2003; 17:402–7. ECP causes PUVA damage to T cells and differentiation of 11 Fimiani M, di Renzo M, Rubegni P. Mechanism of action of extra- monocytes into active dendritic antigen-presenting cells.11 In corporeal photochemotherapy in chronic graft-versus-host disease. a series32 of 12 patients with sclerodermatous GVHD alone Br J Dermatol 2004; 150:1055–60. or with concomitant lichenoid change, all patients responded 12 Sullivan KM, Witherspoon RP, Storb R et al. Prednisone and favourably to ECP. Nine of 12 made a complete response azathioprine compared with prednisone and placebo for treatment of chronic graft-versus-host disease: prognostic influence of pro- and three of 12 made a partial response. Other authors quote longed thrombocytopaenia after allogeneic marrow transplantation. a cutaneous response rate of approximately 75%, with 35% Blood 1988; 72:546–54. 11 achieving complete clearance. Treatment with ECP may 13 Kanamaru A, Takemoto Y, Kakishita E et al. FK506 treatment of convey a steroid-sparing effect, with consequently lower graft-versus-host disease developing or exacerbating during pro- morbidity.33 There is hence some evidence to support the phylaxis and therapy with cyclosporin and/or other immunosup- use of ECP in chronic GVHD;34 however, there is a paucity pressants. Japanese FK506 BMT Study Group. Bone Marrow Transplant of evidence specifically regarding sclerodermatous GVHD. 1995; 15:885–9. 14 Summerfield GP, Bellingham AJ, Bunch C, Woodrow JC. Successful Five of our patients have been treated with ECP using previ- 11 treatment of chronic cutaneous graft-versus-host disease (GVHD) ously described methods and equipment. Patients 2, 5, 7 with penicillamine. Clin Lab Haematol 1983; 5:313–18. and 10 made no response to ECP and patient 8 had some 15 Busca A, Locatelli F, Marmont F et al. Response to mycophenolate softening of lesions with no progression but no improve- mofetil therapy for refractory chronic graft-versus-host disease. ment of his pain. Haematologica 2003; 88:837–8. The following conclusions may be drawn: (i) lichenoid 16 Lopez F, Parker P, Nademanee A et al. Efficacy of mycophenolate chronic GVHD does not always precede generalized scleroder- mofetil in the treatment of chronic graft-versus-host disease. Biol Blood Marrow Transplant 2005; 11:307–13. matous GVHD, contradicting all the previously published data; 17 Gupta V, Ball SE, Yi QL et al. Favorable effect on acute and chronic (ii) there is considerable clinical heterogeneity, making diag- graft-versus-host disease with cyclophosphamide and in vivo anti- nosis for the nondermatologist difficult; (iii) from our small CD52 monoclonal antibodies for marrow transplantation from cohort, sclerodermatous GVHD has a predilection for the HLA-identical sibling donors for acquired aplastic anemia. Biol Blood limbs; (iv) PUVA may significantly improve symptoms of Marrow Transplant 2004; 10:867–76.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 1038 Sclerodermatous GVHD, J.M.L. White et al.

18 Jacobsohn DA, Hallick J, Anders V et al. Inﬂiximab for steroid- and prednisolone as initial therapy for chronic graft-versus-host refractory acute GVHD: a case series. Am J Hematol 2003; 74:119– disease. Biol Blood Marrow Transplant 2001; 7:265–73. 24. 27 Enk CD, Elad S, Vexler A et al. Chronic graft-versus-host disease 19 Ratanatharathorn V, Ayash L, Reynolds C et al. Treatment of chronic treated with UVB phototherapy. Bone Marrow Transplant 1998; graft-versus-host disease with anti-CD20 chimeric monoclonal anti- 22:1179–83. body. Biol Blood Marrow Transplant 2003; 9:505–11. 28 Volc-Platzer B, Honigsmann H, Hinterberger W, Wolff K. Photo- 20 Wolff D, Roessler V, Steiner B et al. Treatment of steroid-resistant chemotherapy improves chronic cutaneous graft-versus-host acute graft-versus-host disease with daclizumab and etanercept. Bone disease. J Am Acad Dermatol 1990; 23:220–8. Marrow Transplant 2005; 35:1003–10. 29 Vogelsang GB, Wolff D, Altomonte V et al. Treatment of chronic 21 Doney KC, Weiden PL, Storb R, Thomas ED. Treatment of graft- graft-versus-host disease with ultraviolet irradiation and psoralen versus-host disease in human allogeneic marrow graft recipients: a (PUVA). Bone Marrow Transplant 1996; 17:1061–7. randomized trial comparing antithymocyte globulin and cortico- 30 Jampel RM, Farmer ER, Vogelsang GB et al. PUVA therapy for steroids. Am J Hematol 1981; 11:1–8. chronic cutaneous graft-vs-host disease. Arch Dermatol 1991; 22 Eklund JW, Kuzel TM. Denileukin diftitox: a concise clinical 127:1673–8. review. Expert Rev Anticancer Ther 2005; 5:33–8. 31 Calzavara Pinton P, Porta F, Izzi T et al. Prospects for ultraviolet A1 23 Marcellus DC, Altomonte VL, Farmer ER et al. Etretinate therapy for phototherapy as a treatment for chronic cutaneous graft-versus-host refractory sclerodermatous chronic graft-versus-host disease. Blood disease. Haematologica 2003; 88:1169–75. 1999; 93:66–70. 32 Greinix HT, Volc-Platzer B, Rabitsch W et al. Successful use of 24 Koc S, Leisenring W, Flowers MED et al. Thalidomide for treatment extracorporeal photochemotherapy in the treatment of severe acute of patients with chronic graft-versus-host disease. Blood 2000; and chronic graft-versus-host disease. Blood 1998; 92:3098–104. 96:3995–6. 33 Coyle TS, Nam TK, Camouse MM et al. Steroid-sparing effect 25 Kulkarni S, Powles R, Sirohi B et al. Thalidomide after allogeneic of extracorporeal photopheresis in the treatment of graft-vs-host haematopoietic stem cell transplantation: activity in chronic but disease. Arch Dermatol 2004; 140:763–4. not in acute graft-versus-host disease. Bone Marrow Transplant 2003; 34 McKenna KE, Whittaker S, Rhodes LE et al. Evidence-based practice 32:165–70. of photopheresis 1987–2001: a report of a workshop of the British 26 Arora M, Wagner JE, Davies SM et al. Randomized clinical trial of Photodermatology Group and the U.K. Skin Lymphoma Group. Br J thalidomide, cyclosporine and prednisolone versus cyclosporine Dermatol 2006; 154:7–20.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1032–1038 CASE REPORT DOI 10.1111/j.1365-2133.2007.07831.x Complete response of deep neutrophilic dermatosis associated with myelodysplastic syndrome to 5-azacytidine K. Raj, A. Ho, J.D. Creamer,* A.W.P. du Vivier,* J.R. Salisbury and G.J. Mufti Departments of Haematological Medicine, *Dermatology, and Histopathology, King’s College London and King’s College Hospital, Denmark Hill, London SE5 9RS, U.K.

Summary

Correspondence Cutaneous manifestations of myelodysplastic syndromes (MDS) may predict dis- Ghulam J. Mufti. ease progression and a poorer prognosis. We describe a patient in whom a deep E-mail: [email protected] neutrophilic dermatosis preceded evolution of disease from refractory anaemia to RAEB (refractory anaemia with excess blasts) and resolved completely on treating Accepted for publication 11 November 2006 the disease with 5-azacytidine. The dermatological response was accompanied by complete bone marrow remission and trilineage haematological improvement. Key words We suggest that 5-azacytidine should be considered in the treatment of immune 5-azacytidine, myelodysplastic syndromes, mediated cutaneous manifestations of MDS. neutrophilic dermatosis

Conﬂicts of interest None declared.

Cutaneous manifestations of myelodysplastic syndromes neutrophilic dermatosis in a patient with MDS RAEB (refract- (MDS) include infections, vasculitis, leukaemia cutis and neu- ory anaemia with excess blasts) II (> 10% bone marrow trophilic dermatoses.1 The neutrophilic dermatoses are a group blasts) who responded completely to 5-azacytidine. of inflammatory skin diseases characterized by sterile neutrophilic infiltrates of the dermis, epidermis or subcutaneous tis- Case report sue. They are frequently associated with systemic disorders such as rheumatoid arthritis and Crohn disease but are well- A 74-year-old male presented with MDS, refractory anaemia recognized complications of haematological malignancies, par- with trilineage dysplasia and diploid cytogenetics [haemoglo- ) ) ticularly myelodysplasia and acute myeloid leukaemia.2,3 bin 10Æ2gL 1 (normal, 13–16Æ5gL 1), white blood cells ) ) ) Neutrophilic panniculitis has been described as a rare condi- 4 · 109 L 1 (4–11 · 109 L 1), neutrophils 1Æ7 · 109 L 1 and ) ) tion, characterized by plum-coloured plaques or nodules, sys- platelets 89 · 109 L 1 (150–450 · 109 L 1)]. He was transfu- temic symptoms (fever, arthralgia and malaise), histological sion-dependent but responded well to treatment with granulo- lobular infiltrate of neutrophils and a significant association cyte colony-stimulating factor (G-CSF) and erythropoietin ) ) with myelodysplasia.4,5 However, its definition as a distinct (haemoglobin 12Æ8 · 109 L 1 and neutrophils 3Æ5 · 109 L 1). disease entity is debated and subcutaneous Sweet’s syndrome A year later he developed painless infiltrated violaceous should be considered in its differential diagnosis.6 plaques over his scalp, forehead, cheeks, neck and shoulders MDS are disorders of haemopoietic stem cells that manifest (Fig. 1a,b) and marked livedo reticularis on his thighs. He as peripheral blood cytopenias and predispose to acute leukae- simultaneously lost his response to erythropoietin and G-CSF, mia. Paraneoplastic cutaneous eruptions such as the neutrophi- manifested as progressive anaemia and neutropenia (haemo- ) ) lic dermatoses (Sweet’s syndrome, pyoderma gangrenosum globin 6Æ97 g L 1 and neutrophils 0Æ59 · 109 L 1). Withhold- and neutrophilic panniculitis) frequently precede or accom- ing G-CSF had no effect on the eruption. Investigations for pany a diagnosis of MDS.7,8 autoantibodies, porphyrins and paroxysmal nocturnal haemo- 5-Azacytidine (Vidaza; Pharmion Ltd, Windsor, Berks, globinuria screens were negative. Skin biopsies showed a deep U.K.) is a novel pyrimidine analogue and DNA demethylating neutrophilic dermatosis with inflammation centred on the agent that is effective in all subtypes of MDS and is the only superficial subcutaneous fat (Fig. 2a). The infiltrate was com- drug that has been shown to prolong the time to leukaemic posed of a mixture of degenerate neutrophils and foamy transformation.9 Recently, 5-azacytidine was licensed by the macrophages with smaller numbers of lymphocytes and U.S. Food and Drug Administration (FDA) for the treatment plasma cells (Fig. 2b). Immunohistochemical staining demon- of all subtypes of MDS.10 We describe the first case of deep strated the lymphocytes to be both B and T lymphocytes.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1039–1041 1039 1040 Deep neutrophilic dermatosis and MDS, response to 5-azacytidine, K. Raj et al

(a) (a)

(b)

Fig 2. (a) Low-power photomicrograph showing the location of the inflammatory infiltrate in the superficial subcutaneous fat. (b) High- power photomicrograph showing the infiltrate is composed of degenerate neutrophils and foamy macrophages with smaller numbers of lymphocytes and plasma cells. Haematoxylin and eosin staining, original magnification (a) · 4, (b) · 40.

(normal < 5%). He commenced treatment with 5-azacytidine ) Fig 1. Showing violaceous plaques and nodules of neutrophilic 75 mg m 2 subcutaneously for 7 days every 28 days. His skin dermatosis on (a) the arm, and (b) the scalp. lesions began to fade after 6 weeks of treatment and resolved completely by 2 months. This coincided with his becoming There was no evidence of leukaemia cutis. Over the following transfusion-independent. After 4 months of treatment the 9 months the skin lesions persisted, his transfusion require- bone marrow showed < 5% blasts (bone marrow complete ments increased and bone marrow blasts increased to 12% remission) and a trilineage major haematological response. At

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1039–1041 Deep neutrophilic dermatosis and MDS, response to 5-azacytidine, K. Raj et al 1041

23 months he continues to be in bone marrow remission and References his rash has not recurred. 1 Avivi I, Rosenbaum H, Levy Y, Rowe J. Myelodysplastic syndrome and associated skin lesions: a review of the literature. Leuk Res Discussion 1999; 23:323–30. 2 Cohen PR, Kurzrock R. Sweet’s syndrome and malignancy. Am J Neutrophilic dermatoses are a spectrum of disorders that Med 1987; 82:1220–6. include Sweet syndrome, pyoderma gangrenosum and neutro- 3 Cohen PR, Kurzrock R. Sweet’s syndrome revisited: a review of philic panniculitis. Their appearance may antedate or present disease concepts. Int J Dermatol 2003; 42:761–78. 4 Sutra-Loubet C, Carlotti A, Guillemette J et al. Neutrophilic pannic- simultaneously with the diagnosis of MDS and they are often 11 ulitis. J Am Acad Dermatol 2004; 50:280–5. associated with rapid disease progression. In addition to the 5 Matsumura Y, Tanabe H, Wada Y et al. Neutrophilic panniculitis prognostic implications, cutaneous manifestations can be both associated with myelodysplastic syndromes. Br J Dermatol 1997; disabling and psychologically demanding. Oral steroids com- 136:142–4. bined with chemotherapy to treat the underlying disease are 6 Cohen PR. Subcutaneous Sweet’s syndrome: a variant of acute feb- often effective and lead to resolution of the cutaneous lesions. rile neutrophilic dermatosis that is included in the histopathologic Treatments with ciclosporin,8 cyclophosphamide,12 thalido- differential diagnosis of neutrophilic panniculitis. J Am Acad Dermatol 2005; 52:927–8. mide,13 infliximab (anti-TNF-a),14 radiotherapy and immuno- 7 Reuss-Borst MA, Pawelec G, Saal JG et al. Sweet’s syndrome associ- suppressive therapy have met with limited success and are ated with myelodysplasia: possible role of cytokines in the patho- associated with significant side-effects. In our patient, disease genesis of the disease. Br J Haematol 1993; 84:356–8. acceleration made treatment of the underlying MDS imperative. 8 Sharpe GR, Leggat HM. A case of Sweet’s syndrome and mye- However, his general state was not robust enough for high-dose lodysplasia: response to cyclosporin. Br J Dermatol 1992; 127:538– acute myeloid leukaemia-type combination chemotherapy and 9. outpatient therapy with 5-azacytidine was the preferred option. 9 Silverman LR, Demakos EP, Peterson BL et al. Randomized controlled trial of azacitidine in patients with the myelodysplastic syn- 5-Azacytidine achieves transfusion independence in 50% of 9 drome: a study of the Cancer and Leukemia Group B. J Clin Oncol patients and remission in up to 23%. It acts slowly and a 2002; 20:2429–40. median of four cycles (months) of treatment is often neces- 10 Kaminskas E, Farrell AT, Wang Y-C et al. FDA drug approval sum- sary to elicit a response. It is delivered subcutaneously, mary: azacitidine (5-azacytidine, VidazaTM) for injectable suspen- administered as an outpatient therapy and results in an sion. Oncologist 2005; 10:176–82. improved quality of life.15 5-Azacytidine is a demethylating 11 Soppi E, Nousiainen T, Seppa A et al. Acute febrile neutrophilic agent. Epigenetic changes, such as methylation, are reversible dermatosis (Sweet’s syndrome) in association with myelodysplastic syndromes: a report of three cases and a review of the literature. chemical modifications of DNA or its chromatin packaging Br J Haematol 1989; 73:43–7. that result in altered gene expression without changes in 12 Evans AV, Sabroe RA, Liddell K et al. Lymphocytic infiltrates as 16 their DNA sequence. Methylation-dependent silencing of a presenting feature of Sweet’s syndrome with myelodysplasia key tumour-suppressor genes is increasingly described in and response to cyclophosphamide. Br J Dermatol 2002; 146: tumours making reactivation of such genes by demethylating 1087–90. agents an attractive therapeutic option.17 In MDS, methyla- 13 Browning CE, Dixon JE, Malone JC et al. Thalidomide in the tion of the tumour-suppressor gene CDKN2B (encodes treatment of recalcitrant Sweet’s syndrome associated with myelodysplasia. J Am Acad Dermatol 2005; 53:S135–8. p15INK4b, a cyclin-dependent kinase inhibitor that inhibits 14 Foster EN, Nguyen KK, Sheikh RA et al. Crohn’s disease associa- cells from replicating) occurs with increasing frequency in ted with Sweet’s syndrome and Sjogren’s syndrome treated with 18 advanced disease. Whether 5-azacytidine effects remission infliximab. Clin Dev Immunol 2005; 12:145–9. in MDS by demethylation of critical genes, cytotoxicity or 15 Kornblith AB, Herndon JE II, Silverman LR et al. Impact of altering immunity is not clear. azacytidine on the quality of life of patients with myelodysplastic Impaired immunity, abnormal chemotaxis of neutrophils syndrome treated in a randomized phase III trial: a Cancer and and uncontrolled release of cytokines have been implicated in Leukemia Group B study. J Clin Oncol 2002; 20:2441–52. 16 Bird A. DNA methylation patterns and epigenetic memory. Genes the pathogenesis of Sweet’s syndrome.19,20 Isolated lympho- Dev 2002; 16:6–21. cytic infiltrates preceding classical neutrophilic infiltrate in two 17 Jones PA, Baylin SB. The fundamental role of epigenetic events in patients with Sweet’s syndrome suggest an immune compo- cancer. Nat Rev Genet 2002; 3:415–28. 12 nent to these disorders. Demethylation by 5-azacytidine 18 Uchida T, Kinoshita T, Hotta T et al. High-risk myelodysplastic syn- alters T-lymphocyte function,21 which may have led to the dromes and hypermethylation of the p15Ink4B gene. Leuk Lymphoma dramatic responses. 1998; 32:9–18. Two years from commencing therapy our patient continues 19 von den Driesch P, Simon M Jr, Schlegel Gomez R et al. Impair- ment of some granulocyte functions in Sweet’s syndrome. Acta Derm to be in bone marrow remission from MDS having received 14 Venereol 1992; 72:109–11. cycles of 5-azacytidine. His cutaneous lesions, which resolved 20 Nunzi E, Crovato F, Dallegri F et al. Immunopathological studies on completely 2 months after starting treatment, have not recurred. a case of Sweet’s syndrome. Dermatologica 1981; 163:393–400. As neutrophilic dermatoses often predate disease progression in 21 Richardson B. DNA methylation and autoimmune disease. Clin MDS, we suggest that 5-azacytidine be considered in the treat- Immunol 2003; 109:72–9. ment of immune-mediated cutaneous manifestations of MDS.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1039–1041 Gene Corner

A novel H1 domain mutation in the keratin 2 gene in a Japanese family with ichthyosis bullosa of Siemens

DOI: 10.1111/j.1365-2133.2007.07832.x (a) (b)

Ichthyosis bullosa of Siemens (IBS) is a rare autosomal dominant skin disorder characterized by blister formation in the upper suprabasal layers of the epidermis. Clinical features of the disease, which include blistering after mechanical trauma, lichenified hyperkeratosis over the flexural areas of the limbs, and superficial peeling of the skin, are similar to those of epidermolytic hyperkeratosis/bullous congenital ichthyosiform erythroderma (EHK/BCIE). This clinical resemblance makes diagnosis difficult. Recent molecular studies have identified mutations in the keratin 2 (K2) gene (KRT2; this new designation is used throughout this report according to the current nomenclature for mammalian keratins1) in patients with IBS, (c) in contrast to the keratin 1 or 10 mutations that have been detected in patients with EHK/BCIE, enabling us to differentiate between IBS and EHK/BCIE.2 Thus far, 29 missense mutations that result in amino acid substitutions in K2 have been identified in patients with IBS; all such mutations reside in the helix initiation or termination motifs of K2. Here, we describe a novel mutation in the H1 region of K2 in a Japanese family with IBS.

Case and methods

A 65-year-old Japanese man came to our department com- Fig 1. Clinical findings in the patient with ichthyosis bullosa of plaining of dryness and roughness of the skin on his extrem- Siemens (IBS). (a) The flexural site of the left calf shows slightly ities since his childhood. Examination revealed slightly rough roughened skin with superficial denudation (arrow). (b) Mild skin with a greyish-brown hue found primarily on the flexural hyperkeratosis with lichenification is noted on the knees. (c) Pedigree sites of the extremities (Fig. 1a), as well as mild hyperkerato- of the Japanese family with IBS. Arrow, proband; oblique lines, sis with lichenification on the knees and ankles (Fig. 1b). deceased individuals. Superficial denuded areas were observed in the hyperkeratotic regions (Fig. 1a, arrow); the palms and soles were not involved. The pedigree of his family reveals that the disorder conditions for the detection of KRT2 mutations were described has been inherited through at least five generations (Fig. 1c). elsewhere.3 In order to be certain that the mutation detected The proband’s daughter aged 33 years (Fig. 1c, IV-3) exhibit- in this study was not a common polymorphism, we screened ed the same clinical appearance. His 6-year-old granddaughter 102 normal controls by restriction fragment length poly- (V-1) was similarly but less severely affected, while his 3- morphism analysis, utilizing mismatch polymerase chain year-old grandson (V-2) showed no skin abnormality. A reaction (PCR) with the forward primer 5¢-AGAGATCCA- biopsy from the hyperkeratotic skin in the proband revealed GAATGTGAAGGCCCGA-3¢, bearing an alteration from A to G hyperkeratosis, acanthosis and epidermolysis localized in the at nucleotide position 581 (shown in bold face), and the granular layer and upper sections of the spinous layer. A tenta- reverse 5¢-CCCAGGCTACTGCGGTACAC-3¢, such that AvaI tive diagnosis of IBS was made and, following informed con- would specifically digest the resulting 203-bp PCR product sent, mutation analysis was performed. Experimental from the wild-type allele but not from the mutated allele.

2007 The Authors 1042 Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1042–1044 Novel mutation in KRT2 in IBS, A. Nishizawa et al. 1043

residues in H1 with the canonical acidic residues of the (a) end of the 2B rod domain segment.4 The glutamic acid to lysine substitution alters the charge of the side chain and presumably affects the function of the H1 domain, resulting in the disruption of filament stability. Thus far, pathogenic mutations of the amino acid residues in H1 domains have been demonstrated in keratins 1, 2, 5, 8 and 16. Early mutation studies of EHK/BCIE cases have suggested that substitutions in the H1 domain of keratin 1 result in a less severe clinical presentation than those located at the beginning of the 1A or at the end of the 2B rod domains,5,6 although a controversial case of severe EHK/BCIE with a (b) mutation in H1 has been described.7 The symptomatic individuals in the current family appear to be mild cases, suggesting that the H1 mutation in K2 may cause a mild phenotype of IBS. However, a genotype/phenotype correlation between the KRT2 mutation and the IBS phenotype still remains to be elucidated. Indeed, an amino acid substitution from glutamic acid to lysine at position 487 in K2 was identified in individuals with mild and severe IBS phenotypes.2 A p.E168K mutation affecting the last residue of the H1 domain of keratin 5 has been identified in a patient Fig 2. A novel KRT2 mutation in a family with ichthyosis bullosa of with the most severe subtype of epidermolysis bullosa sim- Siemens (IBS). (a) Analysis of the sequence encoding the H1 region plex, the Dowling–Meara type.8 Further exploration of the of keratin 2. The protein and genomic sequences of the coding strand are shown right-to-left. The mutated nucleotide and amino acid K2 mutation in patients with IBS will help answer this residue are in bold face. (b) Mismatch polymerase chain reaction question. followed by AvaI digestion analysis. Affected IBS family members (III-1, IV-3 and V-1) reveal 203-bp and 181-bp fragments for the Acknowledgments normal and mutant alleles, respectively, while an unrelated normal control (CTL) and an asymptomatic family member (V-2) show only We thank Ms Eiko Soma for preparation of this manuscript. the 181-bp fragment.

Department of Dermatology, Hirosaki University A. NISHIZAWA School of Medicine, 5 Zaifu-cho, Y. TOYOMAKI Results and discussion Hirosaki 036-8562, Japan A. NAKANO *Department of Dermatology, Yamagata S. TAKEUCHI Sequence analysis of KRT2 from the proband revealed a University School of Medicine, Yamagata, Japan Y. MATSUZAKI novel heterozygous missense mutation in exon 1. This Correspondence: Hajime Nakano. H. TAKEDA G-to-A transition at nucleotide position 532 (c.532GfiA) E-mail: [email protected] T. KANEKO results in a shift from a glutamic acid residue to a lysine at Y. MITSUHASHI* amino acid position 184 (p.E178K) (Fig. 2a). Mismatch H. NAKANO PCR followed by AvaI digestion analysis revealed that the heterozygous c.532GfiA mutation was also present in the proband’s symptomatic daughter and granddaughter, but not References in the grandson or any of the 102 controls (Fig. 2b and 1 Schweizer J, Bowden PE, Coulombe PA et al. New consensus nomen- data not shown), suggesting that the missense mutation is clature for mammalian keratins. J Cell Biol 2006; 174:169–74. not a common polymorphism but rather a pathogenic mu- 2 Rothnagel JA, Traupe H, Wojcik S et al. Mutations in the rod domain tation. All mutations in IBS reported to date are present in of keratin 2e in patients with ichthyosis bullosa of Siemens. Nat Genet the helix initiation or termination motifs of the K2 protein. 1994; 7:485–90. The substitution mutation we have identified, p.E178K, 3 Smith FJD, Maingi C, Covello SP et al. Genomic organization and fine mapping of the keratin 2e gene (KRT2E) V1 domain polymorphism resides at the C-terminal end of the H1 domain. This gluta- and novel mutations in ichthyosis bullosa of Siemens. J Invest Dermatol mic acid residue is highly conserved and is present in all 1998; 111:817–21. mammalian K2 genes identified thus far and in all 64 4 Steinert PM, Parry DAD. The conserved H1 domain of the type II human epithelial and hair keratins, except keratin 23. It has keratin 1 chain plays an essential role in the alignment of nearest been suggested that the H1 domain is involved in the neighbor molecules in mouse and human keratin 1/keratin 10 inter- alignment of nearest-neighbour molecules in keratin intermediate filaments at the two- to four-molecule level of structure. mediate filaments, perhaps by ionic interactions of the basic J Biol Chem 1993; 268:2878–87.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1042–1044 1044 Novel mutation in KRT2 in IBS, A. Nishizawa et al.

5 Compton JG. Epidermal disease: faulty keratins take their toll. simplex: implications for disease phenotype and keratin filament Nat Genet 1994; 6:6–7. assembly. Hum Mutat 2006; 27:719–20. 6 McLean WHI, Lane EB. Intermediate filaments in disease. Curr Opin Cell Biol 1995; 7:118–25. Accepted for publication: 5 December 2006 7 Yang JM, Nam K, Park KB et al. A novel H1 mutation in the keratin 1 chain in epidermolytic hyperkeratosis. J Invest Dermatol 1996; Key words: ichthyosis bullosa of Siemens, keratin 2, mutation 107:439–41. Conflicts of interest: none declared. 8Mu¨ller FB, Ku¨ster W, Wodecki K et al. Novel and recurrent mutations in keratin KRT5 and KRT14 genes in epidermolysis bullosa

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1042–1044 Correspondence

Audit of erythema in patients with psoriasis descriptions of different grades of erythema was introduced in undergoing phototherapy with narrowband our department in 2004 (Fig. 1). Erythema was graded as (TL-01) ultraviolet B: impact of the barely perceptible asymptomatic erythema (E1), well-defined introduction of a comprehensive erythema- erythema associated with mild discomfort (E2), painful well- reporting protocol defined erythema (E3) and blistering erythema (E4). A revised phototherapy treatment sheet was also introduced to include a DOI: 10.1111/j.1365-2133.2007.07775.x specific column for documentation of erythema grade at each patient visit. SIR, Narrowband ultraviolet (UV) B (TL-01) phototherapy is Data on episodes of erythema were obtained from the treat- an effective treatment for psoriasis. The delivery of photother- ment charts of all patients with psoriasis treated in our unit apy, however, is associated with potential adverse effects and with TL-01 UVB from January to June 2005 and compared it has previously been shown that approximately 50% of suc- with data on patients treated during the same period in 2001. cessful litigation claims for dermatology in Scotland relate to During a 6-month period in 2001 (January–June 2001), phototherapy events.1 Symptomatic erythema is the most fre- 123 patients with psoriasis were treated with TL-01 UVB. quent acute adverse event associated with treatment but the Only 16% of these patients had been documented to have at incidence of this adverse effect in patients undergoing therapy least one episode of erythema. The specific grade of the ery- is not clearly established, with figures of between 10% and thema was recorded in 12% of patients. In contrast, following 94% quoted in the literature.2 We audited the incidence of the introduction of the erythema-grading chart, the absence or erythema in patients with psoriasis undergoing UVB TL-01 presence of erythema and the grade were recorded at each therapy in the phototherapy unit of the Leeds General Infirm- visit in 113 of the 114 patients with psoriasis treated during ary and the impact of the introduction of a standard ery- the same 6-month period in 2005. A total of 143 episodes of thema-reporting scheme for nursing staff. erythema were experienced by 52 patients (45Æ6%). These Patients were treated using a standard protocol consisting of consisted of 121 episodes of E1, 21 episodes of E2 and one a starting dose of 70% of the minimal erythema dose, with episode of E3. 20% increments at each visit, adjusted according to erythema The introduction of a simple erythema-reporting system has response. A standard erythema-grading scheme for nursing resulted in very comprehensive reporting of erythema in our staff in conjunction with an illustrated guidance chart with unit. Published clinical trials report erythema in patients with

Erythema action chart

Patient complains of sunburn type reaction from previous exposure

Assess degree of erythema

Grade 1 erythema (mild) Grade 2 erythema Grade 3/4 erythema (severe) barely perceptible (moderate) symptomatic erythema and/or bullae asymptomatic erythema well defined, mildly symptomatic

Action Action Action Repeat previous dose. Postpone treatment until No treatment and review by a settled then give doctor on call. penultimate dose at next visit. May need to reduce to 10% increments. Discuss this with senior phototheraphy nurse on duty. Fig 1. Erythema action chart.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1045 1046 Correspondence psoriasis undergoing TL-01 UVB ranging from 10% to 94%. other drugs—such as tetracycline, chlorhexidine, antimalarial This variation most probably relates to differences in treatment or chemotherapeutic agents—that might induce oral pigmen- protocols and definitions of erythema. Standardization of defi- tation. Furthermore, no dental treatment including amalgam nition and reporting would reveal a more accurate picture of restorations were performed during the previous year. the levels of patient erythema and provide a basis to monitor Oral examination revealed several brown patches on her this important aspect of treatment. lower lip (Fig. 1a) and bilateral white stripes on her buccal mucosa (Fig. 1b). No abnormalities were detected in the Department of Dermatology, R.J. BATCHELOR remaining oral soft tissues. Her blood tests were normal Leeds General Infirmary, Leeds LS1 3EX, U.K. R.F. ROSE including serum adrenocorticotrophic hormone (ACTH) and E-mail: [email protected] A. YUNG cortisol levels. B. RATHMELL A tentative diagnosis of pigmented and lichenoid reaction D. TURNER to escitalopram was made. Upon approval of her psychiatrist V. GOULDEN the medication was discontinued and psychological support References continued. There were no withdrawal symptoms and no further treatment was recommended except the use of a lip 1 Drummond A, Kane D, Bisland D. Legal claims in Scottish National lubricant. Health Service Dermatology Departments 1989–2001. Br J Dermatol The patient was examined monthly and a gradual improve- 2003; 149:111–14. ment in both the lip and oral lesions was noted. Five months 2 Ibbotson SH, Bisland D, Cox NH et al. An update and guidance on after presentation, only traces of the lip pigmentation were narrowband ultraviolet B phototherapy: a British Photodermatology Group Workshop Report. Br J Dermatol 2004; 151:283–97. seen and the intraoral lesions and symptoms resolved completely (Fig. 1c,d). Conflicts of interest: none declared. Escitalopram (Cipralex ) is the active S-enantiomer of the racemic selective serotonin reuptake inhibitor (SSRI) citalopram.2 SSRIs have improved patient adherence to, and persistence with, antidepressant pharmacotherapy in clinical practice mainly due to the reduction in adverse events. The most Oral adverse effects for escitalopram common adverse events reported with escitalopram use are Ò (Cipralex ) nausea (15%), ejaculation disorder (9%), insomnia (9%), diarrhoea (8%), somnolence (7%) and dizziness (6%).2 DOI: 10.1111/j.1365-2133.2007.07767.x Several dermatological adverse reactions have been reported including allergic reactions (not specified, up to 10%) and SIR, Adverse drug reactions manifest in the orofacial region in diaphoresis (5%). Regarding the orofacial complex, toothache a number of ways including pigmentation of the soft and/or (up to 10%), tic disorder (< 1%), oral vesiculation (not speci- hard tissues, mucosal eruptions mimicking lichen planus (lich- fied, up to 19%), dysgeusia (< 1%) and bruxism (< 1%) was enoid eruption, lichen planus-like) and lupus erythematosus, reported.1 and lesions may also resemble vesiculo-ulcerative condi- Herein is presented a case where lip and intraoral adverse tions such as pemphigus vulgaris or mucous membrane effects were observed. pemphigoid.1 The appearance of white striae on the buccal mucosa, also Here I present a case of a young woman treated with escit- known as Wickham’s striae, is pathognomonic for oral lichen alopram who developed a dark lip pigmentation as well as a planus. The distinction between the histopathological features of lichenoid reaction on the buccal mucosa. Five months after lichen planus and lichenoid reaction is not clear in most cases; cessation of the drug, the oral and perioral lesions resolved. lichenoid lesions may have a more diffuse lymphocytic infiltrate A 24-year-old caucasian female initially attended the Oral and contain eosinophils and plasma cells, with more colloidal Medicine Clinic of the Hebrew University Hadassah School of bodies than in classic lichen planus. This lack of specific features Dental Medicine, Jerusalem, in June 2005 with a complaint of emphasizes that the information gleaned in the medical/drug pigmentation of her lower lip as well as an uncomfortable history is the primary source for the differential diagnosis. Con- sensation in her mouth. sequently, a biopsy was not performed in this case. The patient had taken escitalopram for 4 months due to A wide variety of drugs may cause lichenoid eruptions: mild depression and further stated that the lip lesion devel- antimalarials, beta blockers, chloropropamide, furosemide, oped approximately 1 month after initiation of drug therapy; gold, methyldopa, phenothiazines, quinidine, thiazides and the burning or uncomfortable sensation followed 1 month tolazamide.1 In this case no dental restorations had been done, later. The patient started taking Harmonet (20 lg ethinyl est- ruling out lichenoid reaction to amalgam. In the oral cavity, radiol + 75 lg gestodene, a low-dose oral contraceptive) soft tissue involvement is usually limited to the buccal 2 months prior to presentation noting that the oral lesions mucosa, but may also affect the dorsal, lateral or ventral sides were already present. The patient reported no tobacco use and of the tongue as well as the gingivae. The texture of the le- no known allergies to foods or medications and no use of any sions can vary from white lines and papules with well-defined

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1047

(a) (b)

Fig 1. (a) Brown patches on lower lip. (b) White stripes on buccal mucosa. (c) Five months after presentation, only traces of the lip pigmentation on the lower lip can be seen. (d) Five months after presentation, white stripes on buccal mucosa have resolved completely. borders, to red atrophic lesions or vesiculo-bullous lesions References causing painful erosions or ulcerations. 1 Litt JZ. Litt’s Drug Eruption Reference Manual, 11th edn. London: Taylor & The development of pigmentation on the lips may be a sign Francis, 2005; 195. for Addison disease. In this case, the blood work revealed nor- 2 Murdoch D, Keam SJ. Escitalopram: a review of its use in the man- mal cortisol and ACTH levels. Oral contraceptives may also agement of major depressive disorder. Drugs 2005; 65:2379–404. cause mucosal pigmentation.3 The patient began taking Harm- 3 Scully C, Bagan JV. Adverse drug reactions in the orofacial region. onet after the pigmentation appeared. The patient did not Crit Rev Oral Biol Med 2004; 15:221–39. suffer from gastrointestinal problems and did not smoke, rul- 4 Inaloz HS, Kirtak N, Herken H et al. Citalopram-induced photo- ing out the diagnosis of Peutz–Jeghers syndrome or smoking- pigmentation. J Dermatol 2001; 28:742–5. associated melanosis. Conflicts of interest: none declared. Interestingly, Inaloz et al.4 presented a woman with diffuse photopigmentation upon citalopram intake,4 suggesting the option of a photopigmentation effect in the patient presented here. To my knowledge, this is the first report of intraoral lichenoid (lichen planus-like) lesions due to escitalopram use. The Unilateral cutaneous heterotopic meningeal signs and symptoms resolved with cessation of medication nodules with neural, smooth muscle and use. As escitalopram is a potent antidepressant drug and is connective tissue hamartomas: a field defect prescribed frequently,2 dermatologists, psychiatrists and oral of cephalic neural crest-derived tissues medicine specialists should be aware of the potential oral and perioral adverse affects. DOI: 10.1111/j.1365-2133.2007.07769.x

Salivary Gland Clinic, Department of D.J. AFRAMIAN SIR, Neural crest cells give rise to the meninges, peripheral Oral Medicine, The Hebrew University neurones and craniofacial mesenchyme (which inﬂuences the Hadassah School of Dental Medicine, development of cutaneous appendages).1 Recent studies in P.O.B 12272, Jerusalem, Israel 91120 transgenic mice have demonstrated that the coronal suture E-mail: [email protected] represents an interface between neural crest-derived (frontal

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1048 Correspondence

(a) (b)

Fig 1. Skin-coloured, pedunculated papules on the right eyebrow, upper eyelid and alar rim (a,b). Hypertrichosis is evident overlying nodules along the right coronal suture/anterior fontanelle (a) and in a vertical band on the right mid-forehead (b). Note the facial asymmetry. bone) and mesodermal (parietal bone) portions of the mam- ventricular system and no bony defects, but possible mild malian skull vault.2 We report an infant with cutaneous metopic craniosynostosis. The peripheral blood karyotype was heterotopic meningeal nodules and hamartomas composed of normal (46, XX). neural, smooth muscle, connective tissue and follicular ele- Excisional biopsy specimens from the facial papules demon- ments in a unilateral distribution in the region of the frontal strated increased nerve bundles within a dense fibrous stroma bone and coronal suture. (Fig. 2a,b). Surgical specimens from several scalp nodules A 6-month-old girl presented with several skin-coloured, showed large clusters of meningeal cells in the deep dermis exophytic papules on the right eyebrow, upper eyelid and and subcutis (Fig. 2c), which were highlighted by immuno- nasal alar rim (Fig. 1) that had been apparent since birth. She histochemical stains for epithelial membrane antigen also had multiple firm, fixed congenital scalp nodules distri- (Fig. 2d), vimentin and the progesterone receptor. The men- buted primarily along the right coronal suture. There was ingeal cells formed cystic cavities and encircled collagen bun- hypertrichosis overlying the nodules as well as a vertical band dles within a fibrous stroma. No mitotic activity or cytological of terminal hairs on the forehead just right of midline (see atypia was present. In the overlying dermis there was an in- Fig. 1). Her face was asymmetrical, with a depressed forehead creased density of hair follicles and eccrine glands as well as and a more wide-eyed appearance on the right. increased, thickened smooth muscle bundles (Fig. 2e) that The patient’s growth and development were normal, with a stained positively for smooth muscle actin. head circumference that had followed the 60th percentile. Our patient lacked the ipsilateral ocular and brain abnormal- Neurological and ophthalmological evaluations disclosed no ities that characterize encephalocraniocutaneous lipomatosis abnormalities. A computed tomographic scan of the head (ECCL) and oculocerebrocutaneous syndrome (OCCS), two at age 12 months revealed a normal-appearing brain and conditions that can present with multiple congenital papules

Fig 2. Biopsy specimens from skin tag-like facial papules (a) showing increased nerve bundles within a dense ﬁbrous stroma (b). Excisional biopsy specimen from a scalp nodule revealing large subcutaneous clusters of meningeal cells (c), which stained positively for epithelial membrane antigen (d). Increased smooth muscle bundles were evident in the overlying dermis (e). Haematoxylin and eosin (a–c,e); original magniﬁcation: (a,e) · 40; (b) · 200; (c) · 100; (d) · 400.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1049

(a) (b)

(e)

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1050 Correspondence and nodules in a unilateral distribution on the face and scalp.3 4 El Shabrawi-Caelen L, White WL, Soyer HP et al. Rudimentary Moreover, the hamartomas in these disorders are composed of meningocele: remnant of a neural tube defect? Arch Dermatol 2001; connective tissue plus either fat with associated alopecia 137:45–50. 5 Theaker JM, Fletcher CD, Tudway AJ. Cutaneous heterotopic men- (ECCL) or striated muscle (OCCS) rather than the meningeal ingeal nodules. Histopathology 1990; 16:475–9. tissue and smooth muscle seen in our case. 6 Di Tommaso L, Fortunato C, Eusebi V. Meningothelial hamartoma Cutaneous heterotopic meningeal nodules are typically located in the forehead. Virchows Arch 2003; 442:509–10. solitary or few in number and usually occur along the 7 Stone MS, Walker PS, Kennard CD. Rudimentary meningocele pre- midline, reflecting their classification as rudimentary men- senting with a scalp hair tuft. Arch Dermatol 1994; 130:775–7. ingoceles (i.e. a remnant of a neural tube defect).4 Some 8 Penãs PF, Jones-Caballero M, Amigo A et al. Cutaneous meningioma authors have argued that a subset of these lesions may repre- underlying congenital localized hypertrichosis. J Am Acad Dermatol 1994; 30:363–6. sent ectopic development of meningeal cells (e.g. in a peri- 9 Sanchez-Carpintero I, Mihm MC, Mizeracki A et al. Epithelial and neural milieu) or result from faulty migration of meningeal mesenchymal hamartomatous changes in a mature port-wine stain: 5,6 precursor cells from the neural crest. Heterotopic menin- morphologic evidence for a multiple germ layer field defect. JAm geal nodules are often surrounded by a hair collar (a fre- Acad Dermatol 2004; 50:608–12. quent feature of both full-blown and atretic neural tube 10 Takeyama J, Hayashi T, Sanada T et al. Rhabdomyomatous mesen- defects);4 hypertrichosis covering the entire lesion has also chymal hamartoma associated with nasofrontal meningocele and been noted.7,8 In addition, histological evidence of increased dermoid cyst. J Cutan Pathol 2005; 32:310–13. eccrine glands, apocrine glands, smooth muscle bundles and Conflicts of interest: none declared. nerves as well as hair follicles may occasionally be observed in these lesions.4 A combination of neural, mesenchymal and epithelial ele- ments has been identified in hamartomatous skin lesions of the head and neck such as mature port wine stains, neuroc- ristic hamartomas and folliculosebaceous cystic hamartomas, Ulcerated haemangioma of infancy: underscoring the pluripotent potential for differentiation of a retrospective review of 47 patients neural crest-derived cells and the inductive interplay among 9 neuroectodermal, neuromesenchymal and epithelial tissues. DOI: 10.1111/j.1365-2133.2007.07771.x A congenital rhabdomyomatous mesenchymal hamartoma (RMH) adjacent to a nasofrontal meningocele and dermoid SIR, Haemangiomas—the most common benign tumour of 10 cyst has also been described. Interestingly, both RMH and infancy—have a unique and dynamic natural history with three aplasia cutis congenita, which is hypothesized to represent a phases: a rapid proliferation during the first year of life, a brief forme fruste of a neural tube defect, are features of OCCS. plateau, then a slow involution that lasts several years. Most To our knowledge, cutaneous heterotopic meningeal tissue require only watchful waiting; however, some haemangiomas in association with multifocal neural and mesenchymal ha- require intervention for problems including ophthalmological martomas in a segmental distribution has not been previously complications, airway compromise and ulceration. Ulceration is reported. In addition, our patient had asymmetry of the fron- believed to be the most common complication of haemangio- tal skull. We postulate that this case reflects a field defect in mas with an estimated 5–21% incidence.1–5 Treatment of ulcer- the right frontal area due to aberrant migration and differentiation is mandatory, as significant pain, potential for bleeding ation of neural crest cells. and infection, and increased risk of scarring exist. Two studies have focused on haemangioma ulceration.3,6 Both evaluated fea- Departments of *Dermatology, Pathology and C.M. HUNZEKER* tures of ulcerated haemangiomas but lack comparison data from Pediatrics, New York University D. BORYS nonulcerated haemangiomas. In this study, charts of patients School of Medicine, M.A. GRECO diagnosed with haemangiomas referred to the Pediatric Derma- 560 First Avenue, New York, NY 10016, U.S.A. S.J. ORLOW* tology Unit at New York University over a 9-year period (July Correspondence: Julie V. Schaffer. J.V. SCHAFFER* 1992 to January 2001) were reviewed. All haemangiomas were E-mail: [email protected] analysed to determine anatomical and other predisposing factors for ulceration. References There were 316 patients who had a total of 379 haemangiomas (female to male ratio 2Æ5 : 1). Of these haemangio- 1 Chai Y, Maxson RE Jr. Recent advances in craniofacial morpho- mas, 216 (57Æ0%) occurred on the head and neck, 73 genesis. Dev Dyn 2006; 235:2353–75. (19Æ2%) on the trunk, 53 (14Æ0%) on the extremities and 37 2 Jiang X, Iseki S, Maxson RE et al. Tissue origins and interactions in (9Æ8%) in the perineum. Of the 216 haemangiomas on the the mammalian skull vault. Dev Biol 2002; 241:106–16. 3 Hunter AG. Oculocerebrocutaneous and encephalocraniocutaneous head and neck, 190 were focal and 26 segmental. Forty-five lipomatosis syndromes: blind men and an elephant or separate patients had two to eight haemangiomas; 12 patients had nine syndromes? Am J Med Genet 2006; 140:709–26. or more (benign cutaneous haemangiomatosis).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1051

) ) Forty-seven patients developed ulceration (female to male prednisolone, with initial dose of 2Æ5mgkg 1 day 1 increas- ) ) ) ratio 3Æ3 : 1); no patient had more than one ulcerated ing to 4Æ5mg 1 kg 1 day 1, with duration of treatment haemangioma. Ulceration occurred at a mean age of 83 days ranging from 5 days to 10 months. Fifteen patients received ) (range 6 days to 9 months), and 55% occurred on the head intralesional corticosteroids, typically 2–3 mg kg 1 of triam- and neck, 25Æ5% in the perineum, 8Æ5% on the trunk and cinolone per injection. Most received two to three injections 11% on the extremities. Of the 216 haemangiomas located on (range 1–4) at monthly intervals. Ten of 15 patients respon- the head and neck, 26 (12%) developed ulceration. Of the 37 ded well to intralesional corticosteroid therapy with rapid perineal haemangiomas, 12 were ulcerated (32Æ4%). The trunk ulcer healing and decreased pain. Ultrapotent topical cortico- and extremities had a low incidence of ulceration (5% and steroids (e.g. clobetasol) were used in six ulcerated haeman- 9%, respectively). Twelve (25Æ5%) ulcerated haemangiomas giomas with variable response. Three patients received were segmental and 35 (74Æ5%) were localized. adjunctive pulsed dye laser treatment with good response. The majority of haemangiomas that ulcerated were of the Hypopigmentation, scarring and cartilage damage were mixed (superficial and deep) type (79%); 21% of ulcerated noted sequelae of ulcers. Pseudomonas was cultured from one haemangiomas were of the superficial type. No deep haeman- ulcer. One patient developed hoarseness from occult laryngeal giomas ulcerated. haemangioma; oral corticosteroid therapy was effective. One Segmental haemangiomas of the head and neck had the infant developed steroid myopathy and growth delay during highest incidence of ulceration (35%). Focal haemangiomas of oral corticosteroid treatment; all resolved after corticosteroid the lip frequently ulcerated also (24%). Tables 1 and 2 illus- discontinuation. One infant had PHACE syndrome.7 Hypothy- trate ulceration incidence by anatomic location. roidism was diagnosed in one patient. Most ulcerated haemangiomas were treated with a combin- Ulceration of haemangiomas causes significant pain, poorer ation of local wound care, emollients, barrier creams, topical cosmetic outcome (e.g. increased scarring), and a risk of antibiotics and systemic or intralesional corticosteroids. bleeding and infection (see Figs 1, 2). The oft-cited theory Twenty patients with ulcerated haemangiomas received oral that the ‘haemangioma outgrows its blood supply’ has not been subjected to experimental scrutiny and cannot be proven by clinical observations. A sonographic study showed that Table 1 Incidence of ulceration based on anatomic site; there was an blood vessel flow characteristics failed to correlate with likeli- 8 overall ulceration incidence of 12% (47/379) hood of ulceration. Increased apoptosis of overlying epidermal keratinocytes may play a role in ulcer pathogenesis.8 Total Physical factors such as friction, moisture and maceration may Total ulcerated Ulcerated be significant, especially for lip and perineal haemangiomas. haemangiomas, haemangiomas, for anatomic Biological differences in haemangiomas likely exist, as seg- Anatomic site n (%) n (%) site, % mental haemangiomas have a higher risk of ulceration and Head and neck 216 (57) 26 (55) 12 other associated complications.4,9 Additionally, as confirmed Perineal 37 (10) 12 (26) 32 by our study, ulceration occurs disproportionately in mixed Trunk 73 (19) 4 (9) 5 type haemangiomas, less frequently in superficial haemangio- Extremity 53 (14) 5 (11) 9 mas and almost never in deep haemangiomas. Total 379 47 Physiological changes during haemangioma proliferation may also play a role in ulceration. Ulceration occurs predom-

Table 2 Incidence based on anatomic site for head and neck haemangiomas. There was an Anatomic site (haemangiomas Total haemangiomas Total ulcerated Ulcerated for overall ulceration incidence of 12% for the are focal except for category on the head and haemangiomas on anatomic head and neck (26/216) speciﬁed as segmental) neck, n head and neck, n site, % Forehead 29 0 0 Periorbital 13 0 0 Cheek, parotid or preauricular 22 1 5 Nose 29 2 7 Scalp or retroauricular 47 4 9 Neck, chin or submandibular 19 3 19 Ear 10 2 20 Lip 21 5 24 Segmentala head and neck 26 9 35 Total 216 26

aOf the nine segmental haemangiomas with ulceration, three ulcerated at the cheek, three ulcerated at the lip, and one ulcerated at each of the following locations: tongue, nostril, and retroauricular skin.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1052 Correspondence

Acknowledgment

This study received exemption by the Institutional Board of Research Associates of NYU School of Medicine.

Joseph M. Sanzari Children’s Hospital, H.T. SHIN Hackensack University Medical Center, S.J. ORLOW* Hackensack, NJ, U.S.A. M.W. CHANG *The Ronald O. Perelman Department of Dermatology and the Department of Pediatrics, NYU School of Medicine, New York, NY, U.S.A. Connecticut Children’s Medical Center, and the Departments of Dermatology and Pediatrics, University of Connecticut School of Medicine, Fig 1. A 6-week-old, former 36-week gestation premature female 282 Washington St, Hartford, CT 06106, U.S.A. infant. A haemangioma on the thigh was noted at birth, which began Correspondence: Mary Wu Chang. ulcerating at 3 weeks of age. The patient was referred to dermatology E-mail: [email protected] at 6 weeks for worsening ulceration. The ulcer was 4-cm wide and 1-cm deep at initial visit. References

1 Esterly NB. Cutaneous hemangiomas, vascular stains and malformations, and associated syndromes. Curr Probl Pediatr 1996; 26:3–39. 2 Maleville J, Taieb Al, Roubaud E et al. Hemangiomes cutanes imma- tures: etude epidemiologique de 351 cas. Ann Dermatol Venereol 1985; 112:603–8. 3 Kim HJ, Colombo M, Frieden IJ. Ulcerated hemangiomas: clinical characteristics and response to therapy. J Am Acad Dermatol 2001; 44:962–72. 4 Waner M, North PE, Scherer KA et al. The nonrandom distribution of facial hemangiomas. Arch Dermatol 2003; 139:869–75. 5 Achauer BM, Chang CJ, Vander Kam VM. Management of hemangi- oma of infancy: review of 245 patients. Plast Reconstr Surg 1997; 99:1301–8. 6 Wananukul S, Chatproedprai S. Ulcerated hemangiomas: clinical features and management. J Med Assoc Thai 2002; 85:1220–5. 7 Frieden IJ, Reese V, Cohen D. PHACE syndrome. Arch Dermatol 1996; ) ) ) Fig 2. The infant received oral prednisolone (3 mg 1 kg 1 day 1, 132:307–11. with subsequent taper), acetaminophen for pain, and local wound 8 Frieden IJ, Haggstrom AN, Drolet BA et al. Infantile hemangiomas: care including irrigation, metronidazole cream, and petrolatum gauze current knowledge, future directions, proceedings of a research and self-adhesive dressing (Coban). A home nurse visited twice workshop on infantile hemangiomas. Pediatr Dermatol 2005; 22:383– weekly. Dramatic improvement was seen by week 4 on prednisolone. 405. 9 Chiller KG, Passaro D, Frieden IJ. Hemangiomas of infancy clinical A depressed scar with an erythematous border resulted, with no characteristics, morphologic subtypes, and their relationship to race, functional disability of the leg. ethnicity, and sex. Arch Dermatol 2002; 138:1567–76.

Conflicts of interest: none declared. inantly during the rapid proliferative phase, as demonstrated in this and other studies.3,6 Treatment goals include slowing haemangioma proliferation, promoting ulcer healing, and pain management. Treat- ment must be individualized. No single treatment is uniformly effective and combination treatment is usually required.3,6 Fibrous hamartoma of infancy in a patient In summary, the incidence of ulceration was 12Æ4% in our with Williams syndrome paediatric dermatology referral centre. Ulceration occurred disproportionately in segmental haemangiomas of the head and DOI: 10.1111/j.1365-2133.2007.07772.x neck, and haemangiomas of the perineum and lip, with 24–35% incidence. Infants with mixed or superficial type haem- SIR, Fibrous hamartoma of infancy (FHI) is a benign soft angiomas at these sites (particularly segmental haemangiomas) tissue tumour composed of an organoid pattern of fibrous should be followed closely, especially during the first 9 months tissue, primitive mesenchyme and adipose tissue.1 Williams of life when problematic ulceration is most likely to occur. syndrome (WS) is a developmental disorder involving the

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1053 cardiovascular and central nervous system. A rare disorder, WS in situ hybridization (FISH) analysis showing deletion of the is caused by a hemizygous microdeletion of 1Æ55 Mb spanning elastin gene in the WS critical region (WSCR) at chromosome 26–28 genes on chromosome 7q11.23 including the elastin 7q11.23. The patient’s entire skin showed soft texture, lack of gene.2 Deletion of the elastin gene is responsible for a supra- a firm consistency, abnormal smoothness, and easy mobility valvular aortic stenosis as well as soft texture and easy mobil- from underlying subcutaneous tissue, but no abnormal trans- ity of the skin. Here we present a case of FHI in a patient parency, bruising, scarring or hyperextensibility. These find- with WS. To our knowledge, the association of these two dis- ings were compatible with typical skin changes in WS.3 eases has never been previously described. Total excision of the nodule including 5 mm of surround- A 5-year-old boy with WS was referred because of an ing normal skin was performed. Histopathological examin- asymptomatic cutaneous lesion on the back that had been pre- ation revealed a poorly circumscribed lesion within the entire sent since birth. On examination, an oval, pale-pink, well- dermis and subcutis (Fig. 1b). The lesion contained three circumscribed, elastic soft nodule with overlying coarse hairs components:1,4 (i) spindle fibroblasts forming well-defined was noted on the midline of the upper back. The nodule bundles of fibrous tissue, which branch, interweave and inter- measured 55 mm in diameter and 22 mm in height (Fig. 1a). sect the fat tissues; (ii) nests or bands of primitive mesen- The centre of the nodule was brownish. The whole lesion was chyme containing immature cells with obviously small easily depressed on finger pressure. polygonal nucleus; and (iii) mature adipose cells admixed This patient had previously been diagnosed with WS because with other components (Fig. 1c,d). of the presence of growth retardation, distinctive ‘elfin-like’ Alcian blue staining showed glycosaminoglycan (GAG) facial appearance, mental retardation, mental disability with deposition in the fibrous trabeculae and in the nests of outgoing personality, hoarse voice, as well as supravalvular primitive mesenchyme. Increased GAG deposition was noted aortic stenosis. The diagnosis was confirmed by fluorescent in the smaller nests of adipose cells at the uppermost part of

Fig 1. Clinical appearance and histopathological examination of fibrous hamartoma of infancy. (a) On the midline of the upper back, an oval, pale-pink, well-circumscribed, elastic soft nodule with multiple coarse hairs. (b–d) Histopathology of the excised nodule. A poorly circumscribed lesion within the entire dermis and subcutis composed of fibrous trabeculae (c) and adipose tissue and nests of primitive mesenchyme containing cells with small polygonal nucleus (d). Arrows depict the boundary of the lesion. Haematoxylin and eosin staining; original magnification (b) · 12Æ5; (c,d) · 100.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1054 Correspondence

Fig 2. Glycosaminoglycan deposition and lack of elastic fibre and elastin. (a) A small nest of adipose cells at the uppermost part of the lesion also contained capillary as well as primitive mesenchymal cell-like cells. Haematoxylin and eosin staining. (b) Alcian blue staining. (c) Elastica van Gieson staining. (d) Immunohistochemical staining with antielastin monoclonal antibody and Cy3-conjugated antimouse antibody. Arrows indicate boundary of the lesion in the left-lower field. Original magnification: (a,b,d) · 200; (c) · 40. the lesion, together with capillaries and primitive mesenchy- tened, rarefied and scattered, which was in accordance with a mal cell-like cells (Fig. 2a,b). previous report.6 Within the FHI lesion, elastic fibres were Elastica van Gieson staining and immunohistochemistry completely diminished. Because there are no reports descri- with antielastin antibody (E-4013; Sigma, St Louis, MO, bing elastic fibres of FHI, it cannot be determined whether U.S.A.) demonstrated a complete absence of elastic fibre and loss of elastic fibres is a common feature of FHI or happened elastin in the lesion (Fig. 2c,d). The elastic fibres in the because this patient had WS. It may be that somatic mutation patient’s intact dermis showed fragmentation and decrease in within the WSCR occurred in the mesenchymal progenitor amount compared with normal control. Azan–Mallory staining cells within the FHI lesion, leading to homozygous deletion of showed no muscle component within the lesion. the elastin gene. On the basis of these clinical and histopathological charac- We found deposition of GAG in the fibrous bundles and teristics, this case was diagnosed as FHI. The wound after the nest of primitive mesenchyme as was previously report- excision healed normally. ed.1,4 Furthermore, GAG deposition was detected within the This case is thought to present typical features of FHI in small nests surrounded by fibrous bundles in the upper part that this was a solitary, painless, subcutaneous nodule on the of the lesion, where adipose cells and a few primitive mesen- upper trunk seen in a male since birth,1,4 although hyper- chymal cell-like cells reside with capillaries. The primitive trichosis has been noted in only four cases.5 As no FHI has mesenchymal cell-like cells in this area could be the source of previously been reported in association with familial or syn- the surrounding adipose cells. dromic diseases, our case is the first reported FHI associated Regarding the pathogenesis of FHI, Dickey and Sotelo-Avila with another congenital syndrome. proposed that FHI is a proliferation of the primitive mesen- Because WS is known to have elastin gene deletion, elastic chymal cells, which can differentiate into adipose tissue or fibres and elastin in the excised specimen were examined. fibrous connective tissues.1 Combining this hypothesis and the Elastic fibres in the normal dermis of this patient were shor- fact that FHI occurred in the patient with WS, the molecules

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1055 located at the WSCR or tumorous proliferation of these cells might be responsible for the developmental process of mesenchymal tissues. However, more detailed work would need to be done to prove any genetic link between the two conditions WS and FHI.

Departments of Plastic and Reconstructive T. TOGO Surgery and *Dermatology, Kyoto University, E. ARAKI* Graduate School of Medicine and Laboratory of M. OTA Diagnostic Pathology, Kyoto University Hospital, T. MANABE 54 Kawahara-Cho, Shogoin, Sakyo-Ku, S. SUZUKI Kyoto 606-8507, Japan A. UTANI* Correspondence: A. Utani. E-mail: [email protected]

References

1 Dickey GE, Sotelo-Avila C. Fibrous hamartoma of infancy: current review. Pediatr Dev Pathol 1999; 2:236–43. 2 Antonell A, Del Campo M, Flores R et al. [Williams syndrome: its clinical aspects and molecular bases]. Rev Neurol 2006; 42 (Suppl. 1): S69–75. 3 Urban Z, Peyrol S, Plauchu H et al. Elastin gene deletions in Wil- liams syndrome patients result in altered deposition of elastic fibers in skin and a subclinical dermal phenotype. Pediatr Dermatol 2000; 17:12–20. 4 Paller AS, Gonzalez-Crussi F, Sherman JO. Fibrous hamartoma of infancy. Eight additional cases and a review of the literature. Arch Dermatol 1989; 125:88–91. Fig 1. The soles of the patient before treatment with intravenous 5 Yoon TY, Kim JW. Fibrous hamartoma of infancy manifesting immunoglobulin, with pronounced orange pigmentation, as multiple nodules with hypertrichosis. J Dermatol 2006; 33:427– hyperkeratosis and fissuring. 9. 6 Dridi SM, Ghomrasseni S, Bonnet D et al. Skin elastic fibers in Wil- liams syndrome. Am J Med Genet 1999; 87:134–8. dystrophy, with thickening and subungual hyperkeratosis. Blood indices and chest X-ray were normal and no fungi were Conflicts of interest: none declared. found in nail clippings. Skin biopsy showed marked hyperkeratosis and parakeratosis with epidermal acanthosis. A diagnosis of type II adult-onset PRP was made. The patient was admitted for treatment with topical cortico- Type II adult-onset pityriasis rubra pilaris steroids, emollients and salicylic acid, and was commenced on successfully treated with intravenous acitretin 40 mg daily. Over the next 2 years, the dose of aci- immunoglobulin tretin was increased to 60 mg daily but then discontinued due to limited efficacy and adverse effects. During this period, one DOI: 10.1111/j.1365-2133.2007.07773.x course of each of narrowband ultraviolet (UV) B and psoralen plus UVA (PUVA) phototherapy produced erythema but no SIR, We report a patient with type II adult-onset pityriasis clinical improvement. Following this, methotrexate up to rubra pilaris (PRP) resistant to multiple therapies whose con- 17Æ5 mg weekly was tried but was stopped after 4 months dition improved markedly with high-dose human intravenous due to severe malaise and lack of efficacy. A 3-month course ) immunoglobulin (IVIg) infusions. of isotretinoin 1 mg kg 1 daily also led to no improvement A 50-year-old man presented in 1996 with a 10-week his- and to dry eyes. tory of thickened skin over the palms, soles, elbows and He was assessed by a dermatologist with a special interest knees. He gave a 20-year history of ‘dry skin’ on acral sites in PRP who recommended a trial of hydroxycarbamide which had been treated with emollients and topical cortico- 250 mg for 4 days weekly. Although there was initial steroids. He worked as a roofing contractor and was a smoker. improvement, this was not sustained and side-effects (head- Examination revealed nonconfluent, folliculocentric erythema- aches, diplopia, weight loss) necessitated discontinuation after tous patches on the face, trunk and limbs. The palms and soles 3 months. Ciclosporin up to 450 mg daily was tried next, but displayed orange pigmentation with gross hyperkeratosis and again no real improvement resulted. At this stage, due to deep fissuring (Fig. 1). There was also fingernail and toenail being unable to work and the stress on his family life, the

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1056 Correspondence patient suffered depressive symptoms and was referred to a References clinical psychologist. 1 Coras B, Vogt TH, Ulrich H et al. Fumaric acid esters therapy: a new Four years after presentation, he was admitted for a trial of treatment modality in pityriasis rubra pilaris? Br J Dermatol 2005; )1 IVIg (total dose of 2 g kg over 3 days) because its beneficial 152:388–9. immunomodulatory effects had been reported in dermatoses 2 Manoharan S, White S, Gumparthy K. Successful treatment of type I resistant to other therapies. This was repeated every 4 weeks adult-onset pityriasis rubra pilaris with infliximab. Australas J Dermatol and the patient reported significant improvement with thinning 2006; 47:124–9. of the acral hyperkeratosis. After each infusion, the patient 3 Haenssle HA, Bertsch HP, Emmert S et al. Extracorporeal photo- typically reported 2 weeks of benefit followed by 2 weeks of chemotherapy for the treatment of exanthematic pityriasis rubra pilaris. Clin Exp Dermatol 2004; 29:244–6. deterioration, and therefore the period between infusions was 4 Jolles S, Hughes J. Use of IGIV in the treatment of atopic dermatitis, shortened to 3 weeks. Azathioprine 75 mg daily, homoeopathy urticaria, scleromyxedema, pyoderma gangrenosum, psoriasis, and and most recently infliximab (two doses of 480 mg) have all pretibial myxedema. Int Immunopharmacol 2006; 6:579–91. been tried concomitantly with his IVIg, but with no significant 5 Jolles S, Hughes J, Whittaker S. Dermatological uses of high-dose additional effect. Direct radical X-ray therapy was administered intravenous immunoglobulin. Arch Dermatol 1998; 134:80–6. to the left palm (80 kV; 16 Gy, four fractions) but as no benefit was seen, no other sites were treated. Although IVIg did not Conflicts of interest: none declared. produce clearance, the improvement in disease activity has allowed the patient to return to work, now in a managerial role. To date the patient has had over 80 separate IVIg infusions with no significant adverse effects. His infusions have been given over the weekends since his return to work. Angio-oedema induced by bicycling PRP is a rare disorder of keratinization which often presents a therapeutic challenge. Systemic acitretin and topical keratolytics DOI: 10.1111/j.1365-2133.2007.07781.x are often first-line therapies. Several other therapies including phototherapy, PUVA, methotrexate, azathioprine, ciclosporin, SIR, Discomfort caused by sports and recreational activities mycophenolate mofetil and hydroxycarbamide have been repor- interferes considerably with quality of life and leads to con- ted, with variable success. More recently, infliximab, fumaric sultation of physicians.1 A 24-year-old student reported acid esters and extracorporeal phototherapy have been suggested transient swelling and erythema of both arms with a feeling as possibly useful treatment modalities in difficult cases.1–3 of tenseness and slight pruritus immediately when bicycling IVIg is produced from pooled human plasma which has on rough ground (Fig. 1a), persisting for 10–20 min before ) been screened for infectious agents. High-dose 1–2 g kg 1 disappearing spontaneously. Additionally, jogging or fast therapy is usually given in either 3- or 5-day cycles. Common walking induced similar symptoms located on hips and side-effects including headache, myalgia, flushing, nausea and thighs. Symptoms developed without consumption of food vomiting often occur within 30–60 min of the infusion and prior to bicycling or jogging. She did not report any aller- are usually self-limiting. Rarely, more serious effects of throm- gies and did not take any medication. No other family bosis, anaphylaxis in IgA-deficient patients who have anti- member was affected. bodies to IgA, and aseptic meningitis have been reported.4 Its Abrupt and short-lived, elevated, erythematous or skin- immunomodulatory effect probably occurs as a result of sev- coloured areas of oedema due to local vasodilatation and eral mechanisms, including antiproliferative actions, alteration increased vascular permeability involving the reticular dermis of cytokine levels and inhibition of deposition of activated and/or subcutaneous tissue are known as angio-oedema.2 complement.4 In dermatology, IVIg is used primarily in auto- Anamnestic details of our case made several differential diag- immune diseases, particularly dermatomyositis and mucocuta- noses very unlikely. Angio-oedema was not accompanied by neous blistering disorders. However, its use has increasingly weals and did not occur in a generalized pattern (cholinergic been reported in a diverse range of conditions including atop- urticaria) but was restricted to specific parts of the body and ic dermatitis, chronic urticarias, psoriasis, pyoderma gangre- developed independently of temperature (cold urticaria), nosum and erythema multiforme.4,5 To our knowledge, this is pressure (delayed pressure urticaria) or rubbing (factitial the first report of IVIg used successfully in PRP. urticaria). Specific provocation tests showed that only vibratory stim- Acknowledgments uli, and not physical exercise itself, induced angio-oedema, suggesting nonhereditary, sporadic vibratory angio-oedema, We acknowledge the assistance of Dr R.S. Dawe in the prepar- which has to be differentiated from variants of kinin-mediated ation of this manuscript. angio-oedema or mastocytosis, which may also be induced by mechanic stimuli. The initial provocation test (climbing stairs) Photobiology Unit, Ninewells Hospital and A.C. KERR produced angio-oedema with mild erythema on both hips and Medical School, Dundee DD1 9SY, U.K. J. FERGUSON anterior thighs. After provocation with a vibratory device used E-mail: [email protected] for body massaging (5 min, lower back) a pronounced angio-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1057

(a) out mastocytosis or generalized anaphylactic mast cell degranulation at either time point. Normal values of complement factor C4 and C1 esterase inhibitor excluded hereditary or acquired kinin-mediated angio-oedema. Exposure of 20 healthy control subjects for 5 min to the same vibratory stimulus as the patient led in 10 subjects to mild erythema with moderate pruritus but no angio-oedema or wealing. Physical urticarias that may be associated with angio- oedema include cold urticaria, solar urticaria, cholinergic urticaria and vibratory angio-oedema.2 Mechanically induced forms of urticaria are factitial urticaria (symptomatic dermographism), delayed pressure urticaria and vibratory angio-oedema. In contrast to delayed pressure urticaria and symptomatic dermographism, which are frequently diagnosed in combination with chronic urticaria, vibratory angio-oedema is extremely rare. Since the first description in 1972 of a Swedish family with hereditary vibratory angioedema (OMIM 193050) only one other Lebanese family with hereditary vibratory angio-oedema can be found in the medical literature.3,4 Single cases published in the 1980s and one case published in 2001 of a nonhereditary sporadic vibratory angio-oedema are summarized in Table 1. Seconds or minutes after the onset of a specific mechanical stimulus, vibration or rubbing with high frequency, angio-oedema develops with clinical features of mere nonpitting swelling. Main complaints of patients are a feeling of heat and pain, but rarely any itching. Sporadic vibratory angio-oedema commonly develops without an underlying cause and persists for several years (sometimes for decades) before disappearing spontaneously. (b) In contrast, persistence of symptoms is typical for the reported familial, hereditary forms of vibratory angio-oedema. Vibrations are periodic, low-to-middle frequency and low amplitude oscillations of elastic components of skin, subcutis and muscles. The term vibration defines the direct perceptibil- ity of the process by receptors which do not react to mere contact but to periodic mechanical stimuli. The vibration inducing angio-oedema typically has a low frequency, which is reached during fast walking or jogging, massaging or bicycling on rough ground. Rapid local vasodilatation and increased vascular permeability due to vasoactive mast cell-derived mediators such as histamine are pivotal in the pathophysiology of vibration-induced angio-oedema.2 In vitro assays and efficacy

Fig 1. (a) Swelling and moderate erythema accompanied by a of H1 antihistamines imply that the vibratory angio-oedema feeling of tenseness on both arms 2 min after the onset of bicycling may also be histamine induced.5 In cases of persisting oedema on cobblestones in the mediaeval city of Wu¨rzburg, Germany. chemotactic mediators of mast cells are responsible for the (b) Angio-oedema localized on the lower back after 5 min of inﬂammatory inﬁltrate. In both of their patients Keahey et al. provocation with a vibratory device used for body massaging. described a dual late-phase reaction and maximal erythema and oedema 4–6 h after mast cell degranulation.6 Therapy includes thorough education of the patient con- oedema persisting 2–4 h with sensations of heat and pain was cerning trigger factors and symptoms of the vibratory induced (Fig. 1b). In contrast, simple exercise with a dynamo- angio-oedema. There is a clear dose correlation between the meter did not induce clinical symptoms, ruling out choliner- intensity of the vibratory stimulus and the degree of symp- gic or exercise-induced urticaria and angio-oedema. Similarly, toms, but life-threatening anaphylaxis has not yet been provocation tests for pressure or rubbing were negative. Addi- described. Oral H1 antihistamines given 1 h prior to the tionally, tryptase measurements prior to and following vibra- vibration stimulus partially suppress clinical symptoms in tory provocation did not reveal elevated serum levels, ruling our patient. For patients with high motivation and compli-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1058 Correspondence

Table 1 Summary of previously reported cases with vibratory angio-oedema

Age at onset Reference n (years) Duration Familial Provocation Associated urticaria Patterson et al. (1972)3 1 · M 1 (birth) Lifelong (since Yes, AD Massage, vibration, jogging, No 3 · F age 14, 23, rubbing with towel, showering 35, 69 years) Epstein and Kidd (1981)4 3 · M 1 (birth) Lifelong Yes, AD Running, scratching, massage, Factitial urticaria 13 · F showering Ting et al. (1983)7 1 · M 16 > 3 months No Motorcycling, mowing the lawn No Wener et al. (1983)8 1 · M 31 > 1 year No Occupation: metal grinder No Keahey et al. (1987)6 2 · M 34, 23 > 3 years No Rubbing with high frequency 1 · Chronic urticaria 1 · F 28 > 5 years No 1 · No Lawlor et al. (1989)9 1 · F 18 > 10 years No Walking, jogging Pressure and factitial urticaria Mathelier-Fusade 1 · F 30 > 4 years No Mountain-biking No et al. (2001)10

AD, autosomal dominant.

ance tolerance induction with repetitive exposure to vibratory stimuli is possible.7 High-dose intravenous immunoglobulin infusion as treatment for diffuse scleroderma Department of Dermatology, Venereology and B. SCHUBERT Allergology, University of Wu¨rzburg, C.S. SEITZ DOI: 10.1111/j.1365-2133.2007.07777.x Josef Schneider Strasse 2, C. WEIGEL D-97080 Wu¨rzburg, Germany E.B. BRO¨ CKER SIR, Scleroderma or systemic sclerosis (SSc) is characterized by Correspondence: A. Trautmann. A. TRAUTMANN E-mail: [email protected] fibrosis of the skin and internal organs, which develops mainly from lesions of the microvascular system, vascular wall thickness, and infiltration of monocytes and T cells adjacent to acti- References vated fibroblasts.1 These events are considered to be involved in 1 Brooks C, Kujawska A, Patel D. Cutaneous allergic reactions immune system activation and autoimmunity. Immunosuppres- induced by sporting activities. Sports Med 2003; 33:699–708. sive therapy, given at an early stage of disease, might interrupt 2 Kaplan AP, Greaves MW. Angioedema. J Am Acad Dermatol 2005; the immune-mediated portion of the pathogenetic cycle, result- 53:373–88. ing at disease improvement. Controlled trials of various immuno- 3 Patterson R, Mellies CJ, Blankenship ML, Pruzansky JJ. Vibratory suppressive therapies have been attempted for SSc, including angioedema: a hereditary type of physical hypersensitivity. J Allergy chlorambucil, methotrexate, 5-fluorouracil, cyclophosphamide Clin Immunol 1972; 50:174–82. and ciclosporin, but results have been inconsistent.2 The need 4 Epstein PA, Kidd KK. Dermo-distortive urticaria: an autosomal dominant dermatologic disorder. Am J Med Genet 1981; 9:307–15. for more effective and safe immunotherapy prompted the study 5 Metzger WJ, Kaplan AP, Beaven MA et al. Hereditary vibratory angio- of high-dose intravenous immunoglobulin (IVIG), a potent im- edema: confirmation of histamine release in a type of physical munomodulating agent whose efficacy has been demonstrated hypersensitivity. J Allergy Clin Immunol 1976; 57:605–8. in a wide range of immune-mediated disorders, such as Kawa- 6 Keahey TM, Indrisano J, Lavker RM, Kaliner MA. Delayed vibratory saki’s syndrome, dermatomyositis/polymyositis (DM/PM) and angioedema: insights into pathophysiologic mechanisms. J Allergy multiple sclerosis.3,4 We performed an open trial of IVIG ther- Clin Immunol 1987; 80:831–8. apy in diffuse cutaneous SSc (dcSSc). 7 Ting S, Reimann BE, Rauls DO, Mansfield LE. Nonfamilial, vibration-induced angioedema. J Allergy Clin Immunol 1983; 71: We studied five patients (women aged 38–68 years, 546–51. mean ± SD 56Æ2±5Æ0) with dcSSc. The disease duration of 8 Wener MH, Metzger WJ, Simon RA. Occupationally acquired SSc was 2, 2, 4, 15 and 15 years, respectively. All patients ful- vibratory angioedema with secondary carpal tunnel syndrome. filled the American College of Rheumatology (formerly the Ann Intern Med 1983; 98:44–6. American Rheumatism Association) criteria for the classifica- 9 Lawlor F, Black AK, Breathnach AS, Greaves MW. Vibratory angio- tion of SSc.5 Eligible patients had active disease characterized edema: lesion induction, clinical features, laboratory and ultrastruc- by progressive skin thickness which was quantified using the tural findings and response to therapy. Br J Dermatol 1989; 120:93–9. 6 10 Mathelier-Fusade P, Vermeulen C, Leynadier F. [Vibratory angio- modified Rodnan skin thickness scoring technique (m-R TSS) edema]. Ann Dermatol Venereol 2001; 128:750–2. over more than 3 months before the study. All patients signed a consent form approved by the Institutional Review Board. Conflicts of interest: none declared. During the study, treatments that might modify SSc, such as

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1059

Before IVIG After IVIG

Case 1

Fig 1. The modified Rodnan skin thickness scoring technique (m-R TSS) was used to assess the efficacy of intravenous immunoglobulin (IVIG) therapy as an index of tightening of the skin. All five patients had marked improvement in m-R TSS from 2 weeks after the IVIG infusion to the end of the trial (P <0Æ01, Dunnett’s multiple comparison test). penicillamine and immunosuppressive agents, were not used, Case 2 while the dose of other medicines in use remained ) unchanged. Patients received infusions of IVIG 400 mg kg 1 daily for five consecutive days. All patients were followed for 34–70 weeks after completion of the infusions. Skin thickness was quantified using m-R TSS, in which skin thickness was assessed clinically at each of 17 body sites on a 0–3 scale: 0, normal; 1, mildly thickened skin; 2, moderately thickened skin; 3, severely thickened skin; the maximum possible m-R Fig 2. Histological examination revealed that the skin thickness 6 TSS was 51. Skin biopsy was also performed from the dorsal was dramatically reduced at 6 months following intravenous forearm before and after the IVIG therapy to determine the immunoglobulin therapy: from 2Æ8mmto1Æ8 mm in case 1 and skin thickness histologically in two of the five patients. from 2Æ5mmto1Æ0 mm in case 2. The efficacy of IVIG therapy was assessed by m-R TSS as an index of tightening of the skin (Fig. 1). All of the five patients the inhibition by immunoglobulin of the effector functions of had marked improvement in m-R TSS from 2 weeks after the activated T cells and released cytokines or on its competition IVIG infusion to the end of the trial (P <0Æ01, Dunnett’s multi- with major histocompatibility complex molecules.4 Another ple comparison test). Histological examination revealed that the action is the blockade of Fcc receptor, or the induction of skin thickness was dramatically reduced after the IVIG therapy: inhibitory Fcc receptor.4 Many other mechanisms are also pro- from 2Æ8mmto1Æ8 mm in one patient and from 2Æ5mmto posed, such as the inhibition of complement pathway, the 1Æ0 mm in the other (Fig. 2). Furthermore, a digital tip ulcer in neutralization of circulating autoantibodies by anti-idiopathic one patient disappeared during the trial. Adverse effects included antibodies in immunoglobulin, and the neutralization of patho- headache in one patient and nausea in another. However, these gens.4 Several of these mechanisms may work together in each adverse effects disappeared spontaneously after the infusion. clinical situation, and the major mechanism acting in the case IVIG therapy is known to be effective for various auto- of SSc has yet to be determined. immune diseases, such as systemic lupus erythematosus and As there is no accepted reversal treatment for SSc, IVIG ther- DM/PM. There are some reports of patients with SSc whose total apy should undergo a large-scale double-blind study in this skin thickness score improved after IVIG therapy.7–9 IVIG ther- condition. apy also resulted in an improvement in skin fibrosis in tight skin 10 mice. In the present study, five patients with SSc showed *Department of Dermatology, Faculty of Medicine, H. IHN* marked improvement in m-R TSS from 2 weeks following IVIG University of Tokyo, Tokyo, Japan Y. MIMURA* treatment, and long-term benefit was also confirmed by the fol- Department of Dermatology & Plastic and N. YAZAWA* low-up estimation. Furthermore, the effect of IVIG therapy was Reconstructive Surgery, Graduate School of Medical and M. JINNIN* confirmed by histological examination in this study. Pharmaceutical Sciences, Kumamoto University, Y. ASANO* Among the postulated immunomodulating actions of 1-1-1 Honjo, Kumamoto 860-0078, Japan K. YAMANE* immunoglobulin, several are relevant to SSc. One is based on E-mail: [email protected] K. TAMAKI*

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1060 Correspondence

References Patients are seen in this clinic if the referral letter mentions any solitary or multiple skin lesions. The history sheet 1 Ihn H. The role of TGF-b signaling in the pathogenesis of fibrosis enabled the CNS to document the patient’s history, describe in scleroderma. Arch Immunol Ther Exp 2002; 50:325–31. 2 Clements PJ, Lachenbruch PA, Sterz M et al. Cyclosporine in sys- and mark the site of the lesion and present the information temic sclerosis. Results of a forty-eight-week open safety study in to the consultant. The consultant added his diagnosis and ten patients. Arthritis Rheum 1993; 36:75–83. management plan leaving the CNS to finish the consultation. 3 Steele RW, Burks AW Jr, Williams LW. Intravenous immunoglobu- This enabled us to see seven extra patients on each list and lin: new clinical applications. Ann Allergy 1988; 60:89–94. gave the CNS the opportunity to assess over 500 skin lesions 4 Cherin P, Herson S, Wechsler B et al. Intravenous immunoglobulin over 2 years. for polymyositis and dermatomyositis. Lancet 1990; 336:116. Since 2003 we have used a protocol that allowed the CNS 5 Subcommittee for Scleroderma Criteria of the American Rheuma- tism Association Diagnostic and Therapeutic Criteria Committee. to see patients alone and to refer to the dermatologist only in Preliminary criteria for the classification of systemic sclerosis specific cases (Table 1). The protocol demands only that she (scleroderma). Arthritis Rheum 1980; 23:581–90. asks for help in uncertainty or if there is a suspected malig- 6 Clements P, Lachenbruch P, Siebold J et al. Inter and intraobserver nancy. At the end of the first year we prospectively audited variability of total skin thickness score (modified Rodnan TSS) in her decision making. She was asked to code 102 consecutive systemic sclerosis. J Rheumatol 1995; 22:1281–5. patients into three categories, as follows: 7 Levy Y, Sherer Y, Langevitz P et al. Skin score decrease in systemic 1 Benign: discharge/no treatment; sclerosis patients treated with intravenous immunoglobulin—a preliminary report. Clin Rheumatol 2000; 19:207–11. 2 Benign and treat: no referral; and 8 Amital H, Rewald E, Levy Y et al. Fibrosis regression induced by 3 Needs specialist help (refer to dermatologist). intravenous immunoglobulin treatment. Ann Rheum Dis 2003; Every patient was then seen by one of two dermatologists 62:175–7. who formed their own opinion on which code was most 9 Levy Y, Amital H, Langevitz P et al. Intravenous immunoglobulin appropriate if the CNS had adhered to the protocol. Both par- modulates cutaneous involvement and reduces skin fibrosis in ties documented their actual clinical diagnosis. It was double systemic sclerosis: an open-label study. Arthritis Rheum 2004; blinded. The results were collated by an independent observer 50:1005–7. 10 Blank M, Levy Y, Amital H et al. The role of intravenous immuno- (N.G.) and with the support of the audit department they globulin therapy in mediating skin fibrosis in tight skin mice. were entered into a Microsoft Excel spreadsheet. Arthritis Rheum 2002; 46:1689–90. Fifty-nine of 102 patients seen were coded 3 for referral. The dermatologist thought that 38 of these were correctly Conflicts of interest: none declared.

Table 1 Criteria for diagnostic activity. R, refer for doctor’s opinion; NR, referral not necessary

Development of a diagnostic role for a clinical Pigmented lesions nurse specialist Polypoid Worrying features R No worrying features NR, treat if symptoms DOI: 10.1111/j.1365-2133.2007.07785.x Macular lesions R Other palpable lesions SIR, Nurses have traditionally been associated with the admin- Shiny or ulcerated R istration of treatments prescribed by doctors. Increasing pres- Warty or keratotic sure on dermatological services has fuelled an enhancement of Obvious seborrhoeic keratosis NR, treat if symptoms Not obvious seborrhoeic keratosis R the nursing contribution to the management of dermatology 1–4 Moles patients both in the hospital setting and in the community. Obviously benign NR This is usually managing chronic conditions such as psori- Any doubt R asis with an improvement in patient outcomes and disease Nonpigmented lesions remission.4,5 Warty or keratotic Dermatology departments have a large volume of work relat- Viral wart or seborrhoeic keratosis NR, treat if symptoms ing to the assessment of solitary skin lesions. We decided to Nonindurated solar keratosis NR, treat if symptoms Uncertain R extend the role of a senior dermatology nurse into this area Nodules and we describe here the clinical background of the nurse, the All other palpable R way in which we developed the role and ﬁnally the outcome Ulcerated as measured by a diagnostic audit. All ulcerated lesions R The clinical nurse specialist (CNS) had 13 years’ experi- All other lesions ence in the department. In 2001, we devised a history sheet Does not ﬁt the above criteria R for patients seen in the Changing Lesion Clinic (CLC).

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1061 referred, 13 cases should have been coded 2 and eight cases should have been coded 1. There were 43 cases coded 1 or Sclerodermoid graft-versus-host disease-like 2 and in one of these the dermatologist felt it should have lesions occurring after drug-induced been coded 3. Further breakdown of the figures showed hypersensitivity syndrome that: 1 In 67 cases, both the nurse and dermatologist were in DOI: 10.1111/j.1365-2133.2007.07784.x agreement over the code. The nurse gave the same diagnosis as the dermatologist in 60 of these cases. SIR, Drug-induced hypersensitivity syndrome (DIHS) is a 2 The CNS thought that 34 cases were malignant and the der- severe multiorgan systemic reaction with reactivation of matologist agreed in 26 of these. human herpesviruses such as human herpesvirus 6 (HHV-6), After a period of experiential learning and competency Epstein–Barr virus and cytomegalovirus.1–3 Recently we have achievement the CNS made the safe protocol-driven decision demonstrated that these herpesviruses reactivate sequentially in in 101 out of 102 cases. She made the same clinical diagnosis this setting, as observed in graft-versus-host disease (GVHD);4 as the dermatologist in 70% of cases but in those cases where coincident with these herpesvirus reactivations, clinical mani- the diagnosis differed it would never have led to omission to festations of this syndrome occur despite discontinuation of treat a significant lesion. the culprit drug.2,3 In addition, various complications fre- The most important distinction was between both 1 or 2 quently occurring during the course of DIHS are also often (nonworrying lesions) and 3 (potentially malignant). She observed in GVHD. In view of the similarity to GVHD with erred on the side of caution and there was only one case in regard to the clinical manifestations, it is likely that DIHS and which a dermatologist had concern (code 3) but the CNS did GVHD have similar underlying mechanisms. Thus, the auto- not (code 1). Later histology revealed this to be a benign immune manifestations observed in patients with chronic junctional naevus. A dermatology CNS working in the manner GVHD could also be seen in patients with DIHS. We describe described can achieve high rates of safe triage as well as form- for the first time a patient who developed sclerodermoid ing an accurate diagnosis and carrying out a management GVHD-like lesions with a gradual increase in autoantibody plan. Our nurse specialist has made a significant contribution titres long after the clinical resolution of DIHS. in sharing the workload of new patient referrals to the depart- A 46-year-old woman was admitted to our hospital ment and her work brings in an income of £70,000 per because of general fatigue and thyroid dysfunction. She annum for the Trust. Although the circumstances may not be noticed diffuse alopecia on the scalp and general fatigue in easily transferable to other units, we feel that the time inves- September 2000. Then, in January 2003, Raynaud’s phenom- ted in the competency framework has brought benefits to enon and sclerodermatous lesions on the legs appeared. In patients and the organization. August 2004, she was referred by a physician to our department with pancytopenia and sclerodermatous lesions locali- Department of Dermatology, Royal Liverpool & N.N. GOYAL zed on the arms and legs. Broadgreen University Hospitals NHS Trust, G.B. COLVER* Her past medical history revealed that a meningioma had Liverpool, U.K. been diagnosed, and zonisamide (200 mg daily) and low *Department of Dermatology, Chesterfield doses of corticosteroids (2 mg daily) were initiated for pre- Royal Hospital, Chesterfield, U.K. vention of convulsions and brain oedema. Ten days later, Correspondence: N.N. Goyal. chickenpox had developed and had been treated with aciclo- E-mail: [email protected], [email protected] vir. The meningioma was removed by brain surgery in December 1999. Three months after the surgery, she devel- References 1 oped a severe drug reaction after approximately 42 months’ 1 Cox NH. The expanding role of nurses in surgery and prescribing therapy with zonisamide. Examination revealed erythematous in British departments of dermatology. Br J Dermatol 1999; rashes, high-grade fever, leucocytosis, severe liver dysfunction, 140:681–4. lymphadenopathy and prominent increases in anti-HHV-6 IgG 2 Godsell G. A nurse-surgical post cuts waiting times and extends titres, consistent with a diagnosis of DIHS. She was given nurses’ skills base. Prof Nurse 2004; 19:453–5. pulse therapy with corticosteroids and intravenous immuno- 3 Peters J. Combining nursing roles in dermatology. Prof Nurse 1999; globulin. No antinuclear antibodies (ANA), antimitochondrial 15:91–4. antibodies or rheumatoid factor (RF) were detected at that 4 Cork MJ, Britton J, Butler L et al. Comparison of parent knowledge, therapy utilization and severity of atopic eczema before and after time. Systemic corticosteroids were gradually reduced after the explanation and demonstration of topical therapies by a specialist complete resolution of liver dysfunction (Fig. 1). dermatology nurse. Br J Dermatol 2003; 149:582–9. On examination, during the first visit to our department, 5 Brown MH. A nurse-led clinic in chronic and allergic contact multiple ill-defined brownish, indurated plaques with xerosis dermatitis. Br J Nurse 2005; 14:260–3. were prominent on the extremities with finger stiffness and diffuse alopecia on the scalp (Fig. 2a,b). Abnormal laborat- Conflicts of interest: none declared.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1062 Correspondence

Fig 1. Clinical and laboratory course of patient. HHV-6, human herpesvirus 6; IVIG, intravenous immunoglobulin. ory findings were as follows: white blood cell count ing the resolution of DIHS. These findings suggest that scle- ) ) 3Æ8 · 109 L 1; platelet count 51 · 109 L 1; red blood cell rodermatous lesions developed as sequelae of DIHS in this ) count 3Æ05 · 1012 L 1; ANA 1: 5120 (normal < 80), RF patient. In view of the fact that ANA and RF were not detected ) 130 IU mL 1 (normal < 25), antisingle strand DNA anti- during the course of DIHS, this patient may have exhibited ) bodies 46Æ2UmL 1 (normal < 40), anticentromere anti- increased activity of the associated autoimmune diseases bodies (by enzyme-linked immunosorbent assay) 74Æ5 shortly after resolution of DIHS. ) (normal < 16), anticardiolipin antibodies 14 U mL 1 (nor- It has been shown that autoimmune disease-like lesions mal < 10) and thyroid-stimulating hormone receptor anti- resembling scleroderma or lupus erythematosus often develop bodies 71Æ4% (normal < 15). Thyroid function data were as as manifestations of chronic GVHD after organ transplant- ) follows: free triiodothyronine 0Æ54 pg mL 1 (normal range ation.5,6 In this setting, generalized sclerodermatous lesions ) 1Æ63–3Æ20); free thyroxine 0Æ31 ng dL 1 (normal range appeared between days 332 and 876 in a group of patients ) 0Æ73–1Æ53); and thyroid-stimulating hormone 75Æ7 mUI mL 1 after donor leucocyte infusion.7 Interestingly, in our patient, (normal range 0Æ41–5Æ27). Other examinations, including autoimmune reactions ranging from thyroid dysfunctions to anti-Scl-70, chest X-ray and computed tomographic scan, were sclerodermoid GVHD-like lesions appeared 1–4 years after the within normal ranges. Positive lymphocyte transformation test onset of DIHS, a time frame that is similar to chronic GVHD. reactions to zonisamide were still present. Skin biopsy speci- Although the sclerodermoid GVHD has some similarities to men from the arm revealed a prominent increase in collagen systemic sclerosis, some major differences should be noted.8–10 bundles in the dermis and subcutaneous tissue with mild Clinically, hyperpigmented lesions and atrophy of the lesions lymphocytic infiltration around the vessels and eccrine ducts are more common in sclerodermoid GVHD than in systemic (Fig. 2c). Treatment with levothyroxine sodium and then low scleroderma; xerosis and ichthyosiform changes are more often doses of systemic prednisolone (10 mg daily) was initiated seen in sclerodermoid GVHD. Indeed, in this patient, typical (Fig. 1). Although thyroid function returned to normal, no hyperpigmented and atrophic lesions with xerosis were improvement was observed in the sclerodermatous lesions and observed on the extremities, indicating the resemblance to scle- alopecia at the 5-month follow-up. rodermoid GVHD. This patient developed a wide variety of manifestations Although it remains unknown whether herpesviruses including pancytopenia, diffuse alopecia, thyroid dysfunction, sequentially reactivated during the course of DIHS and GVHD Raynaud’s phenomenon and sclerodermatous lesions with could be aetiological factors in the development of scleroder- increases in various autoantibody titres in the 4 years follow- matous lesions, our observations suggest that patients with

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1063

(a) DIHS are at greater risk of eventually developing autoimmune diseases.

Department of Dermatology, Kyorin University Y. KANO School of Medicine, 6-20-2 Shinkawa Mitaka, K. SAKUMA Tokyo 181-8611, Japan T. SHIOHARA E-mail: [email protected]

References

1 Suzuki Y, Inagi R, Ando T et al. Human herpesvirus 6 infection as a risk factor for the development of severe drug-induced hypersensitivity syndrome. Arch Dermatol 1998; 134:1108–12. 2 Shiohara T, Inaoka M, Kano Y. Drug-induced hypersensitivity syndrome (DIHS): a reaction induced by a complex interplay among herpesviruses and antiviral and antidrug immune responses. Allergol Int 2006; 55:1–8. 3 Kano Y, Hirahara K, Sakuma K, Shiohara T. Several herpesviruses can reactivate in a severe drug-induced multiorgan reaction in the same sequential order as in graft-versus-host disease. Br J Dermatol 2006; 155:301–6. 4 Zaia JA. Viral infections associated with bone marrow transplant- (b) ation. Hematol Oncol Clin North Am 1990; 4:603–23. 5 Zhang C, Todorov I, Zhang Z et al. Donor CD4+ T and B cells in transplants induce chronic graft-versus-host disease with autoimmune manifestations. Blood 2006; 107:2993–3001. 6 Ichiki Y, Bowlus CL, Shimoda S et al. T cell immunity and graft- versus-host disease. Autoimmun Rev 2006; 5:1–9. 7 Jones-Caballero M, Fernandez-Herrera J, Cordoba-Guijarro S et al. Sclerodermatous graft-versus-host disease after donor leucocyte infusion. Br J Dermatol 1998; 139:889–92. 8 Schaffer JV, McNiff JM, Seropian S et al. Lichen sclerosus and eosinophilic fasciitis as manifestations of chronic graft-versus-host disease: expanding the sclerodermoid spectrum. J Am Acad Dermatol 2005; 53:591–601. 9 White JML, Devereux S, Pagliuca A et al. Koebnerizing sclerodermatous graft-versus-host disease caused by donor lymphocyte infusion and interferon-a. Br J Dermatol 2006; 155:621–3. 10 Chosidow O, Bagot M, Vernant JP et al. Sclerodermatous chronic graft-versus-host disease. Analysis of seven cases. J Am Acad Dermatol 1992; 26:49–55.

Conﬂicts of interest: none declared.

(c)

A case of hereditary angio-oedema type III presenting with C1-inhibitor cleavage and a missense mutation in the F12 gene

DOI: 10.1111/j.1365-2133.2007.07778.x

SIR, Hereditary angio-oedema (HAE) has been associated with C1-inhibitor (C1-INH) deficiency since its first description in 1963. Recently Bork et al.,1 Binkley and Davis2 and Martin et al.3 described the first cases of HAE type III (HAE-III) in Fig 2. (a) Diffuse alopecia on scalp; (b) sclerodermatous lesions on patients with normal C1-INH protein concentration and func- legs; (c) increase in collagen bundles in dermis (haematoxylin and tion, and normal C4 concentration (OMIM 300268). Only eosin, low-power view). women are affected; occurrence is familial and may be influ-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1064 Correspondence

Plasma Pl + C1s Plasma Pl + C1s Plasma Pl + C1s Plasma Pl + C1s Plasma Pl + C1s C1-INH-C1s

Native C1-INH C1-INH breakdown Nov 2001 June 2003 Sept 2004 Dec 2004 May 2005

25 ) 3rd pregnancy first month Angioedema attack –1 20 6000 Delivery with dead baby Fig 1. C1-inhibitor (C1-INH) proﬁles and Fourth month Seventh month

) plasma esterase activity. C1-INH activity is 15 4500 –1 measured from the residual esterase activity of

plasma samples after incubation with C1s 10 3000 )1

(pKat mL (reference values: 22Æ3±5Æ1UmL , 2 SD; solid bars).5 Spontaneous plasma esterase 5 1500 C1-INH activity (U mL activity is expressed on benzoyl-Arg ethyl ester ) Spontaneous esterase activity (reference values: 522 ± 100 pKat mL 1, 0 0 2 SD; open bars). Anti-C1-INH immunoblots are given for five representative plasma samples (native condition and after incubation Oct 2004 June 2001Nov 2001June 2003June 2004Aug 2004Sept 2004 Nov 2004Dec 2004May 2005 with C1s). enced by hormonal events or combined oestrogen/progesto- The spontaneous plasma esterase activity on the arginine gen oral contraceptives.4 substrate BAEe (benzoyl-Arg ethyl ester), depending on contact We report a woman (born in 1972) who had had monthly phase protease activities, was inversely correlated with C1-INH episodes of typical angio-oedema since the age of 19 years. function (parametric Spearman rank test, P <0Æ0001) and was She had had three laryngeal attacks and had frequent abdom- also associated with its proteolysis (Fig. 1). The 1032CfiA inal attacks. Corticosteroids and antihistamines were of no missense heterozygous mutation described in HAE-III patient benefit. Combined oral contraceptives worsened the disease. families7 was detected after analysis of the F12 coding The patient’s sister (born in 1974) had cutaneous angio- sequence in DNA samples from both sisters. This observation oedema that was also exacerbated with combined oral contra- represents the first familial case of HAE-III in which the muta- ceptives and pregnancy, with C1-INH function at 80% of the tion of Hageman factor is presented with decreased C1-INH reference value.5 All other relatives were asymptomatic. No function concomitantly to its proteolysis. We hypothesize that mutations were detected in the SERPING1 gene after analysis HAE-III may occur in the context of uncontrolled proteolysis of DNA samples from the two sisters, obtained following of C1-INH serpin by contact phase protease (e.g. Hageman informed consent, according to a previously described factor) whose expression is promoted by oestrogens.8 method.6 Our patient’s first daughter was born in 1997 following a pregnancy with frequent severe abdominal attacks. In De´partement de Me´decine Interne and L. BOUILLET 1999 treatment with tranexamic acid 1 g three times daily *Laboratoire d’Immunologie, Universite´ Joseph Fourier, D. PONARD* improved our patient’s condition. In 2001, a second pregnancy CHU de Grenoble, BP 217, 38043 Grenoble cedex 09, H. ROUSSET was painful, with an in utero death nearly at delivery, with- France S. CICHON out any identified aetiology. At delivery, C1-INH function De´partement de Me´decine Interne, Hospices Civils de Lyon, C. DROUET* decreased to 50% and was found to be associated with C1-INH Lyon, France protein cleavage upon immunoblot analysis. After delivery, Institut fu¨r Humangenetik, Universita¨t Bonn, Bonn, Germany C1-INH function increased to normal except during attacks E-mail: [email protected] where it decreased markedly, with C1-INH breakdown. A third pregnancy in 2004 was very painful, with weekly attacks. Tran- References examic acid 1 g three times daily was administered from the second term. A laryngeal oedema attack was successfully arrested 1 Bork K, Barnstedt SE, Koch P, Traupe H. Hereditary angioedema with with C1-INH concentrate (500 U · 2). Finally our patient was normal C1-inhibitor activity in women. Lancet 2000; 356:213–17. hospitalized during the last month and delivery was prepared 2 Binkley KE, Davis III A. Clinical, biochemical, and genetic characterization of a novel estrogen-dependent inherited form of with C1-INH concentrate (500 U · 2). Both newborn and angioedema. J Allergy Clin Immunol 2000; 106:546–50. mother were well. C1-INH function had progressively 3 Martin L, Degenne D, Toutain A et al. Hereditary angioedema type decreased during pregnancy to nearly 50% at delivery, with III: an additional French pedigree with autosomal dominant trans- important C1-INH serpin cleavage without serpin-protease mission. J Allergy Clin Immunol 2001; 107:747–8. association (Fig. 1). C1-INH function increased to normal 4 Bouillet L, Drouet C, Ponard D et al. Angioedema and oral contra- 4 months after delivery and our patient’s condition improved. ception. Dermatology 2003; 206:106–9.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1065

5 Drouet C, Alibeu C, Ponard D et al. A sensitive method to assay blood complement C1 inhibitor activity. Clin Chim Acta 1988; 174:121–30. 6 Drouet C, Blanch A, Roche O et al. Mutation analysis of the C1NH gene. J Allergy Clin Immunol 2004; 114:S66–74. 7 Cichon S, Martin L, Hennies HC et al. Increased activity of coagula- tion factor XII (Hageman factor) causes hereditary angioedema type III. Am J Hum Genet 2006; 79:1098–103. 8 Farsetti A, Misiti S, Citarella F et al. Molecular basis of estrogen regulation of the Hageman factor XII gene expression. Endocrinology 1995; 136:5076–83.

Conﬂicts of interest: none declared.

Coexistence of sacral dimple, solitary collagenoma and mid-dorsal hypertrichosis in a child with occult spinal dysraphism

DOI: 10.1111/j.1365-2133.2007.07780.x

SIR, Sacral dimple is a developmental anomaly that develops as an invagination on the midline dorsal skin.1 Solitary collagenoma is a rare hamartomatous malformation of dermal collagen that is characterized by a firm, elastic nodule or plaque resembling a scar. We describe an 8-year-old white girl with the coexistence of sacral dimple, solitary collagenoma and Fig 1. Sacral dimple (small arrow) associated with a solitary, pale, mid-dorsal hypertrichosis of the lumbosacral region that was flesh-coloured plaque resembling a scar (large arrow) near the area of mid-dorsal hypertrichosis. associated with a posterior fusion defect and diastometamyelia of the sacrum. An 8-year-old girl with hypertrichosis and asymptomatic sacral dimple, are considered to be diagnostic predictors for skin changes on the lumbosacral region that had been present neural diseases.2,3 During gestational days 18–27, the superficial since birth was admitted to our department. There was no ectoderm is destined to form the skin and spinal cord.4 During family history of similar cutaneous lesions. Psychomotor and this period of embryogenesis, dysmorphogenesis is thought to mental development was normal. On examination, a sacral be influenced by genetic factors and local stresses caused by skin dimple was noted over the sacrum, and there was mid- neighbouring tissues. Sacral dimples that are deep, larger than dorsal hypertrichosis in the lumbar region. We also observed 0Æ5 cm, and located within the superior gluteal crease have been a solitary pinkish-coloured, firm, elastic plaque, 4 cm in diam- reported to be associated with a higher incidence of neuro- eter, located near the area of hypertrichosis (Fig. 1). There ectodermal abnormalities.3 Other cutaneous markers related were no other skin or mucosal abnormalities. to spinal cord defects include mid-dorsal hypertrichosis, Histopathological examination of a 3-mm punch biopsy haemangioma, lipoma, aplasia cutis congenita, and dermal specimen obtained from the solitary plaque showed bundles sinuses of the sacral region.5 A recent study indicated that a of dense and coarse collagen fibres that resulted in thickening combination of two or more congenital midline skin lesions, as of the dermis (Fig. 2a). Verhoeff–van Gieson elastin staining in our patient, is the strongest marker for occult spinal dysra- showed a diminished number of thin and fragmented elastic phism.6 To the best of our knowledge, this is the first case fibres. Epidermal changes and mucin deposition were not report of solitary collagenoma, sacral dimple and hypertrichosis detected. A diagnosis of solitary collagenoma was established of the midline dorsal skin in association with spinal anomaly. according to clinical and histopathological findings. Computed Solitary collagenoma is a rare connective tissue naevus of tomography was performed to rule out spinal anomalies and the collagen type, that is characterized by a pinkish or flesh- presacral masses. The fourth and fifth lumbar vertebrae were coloured, firm, elastic plaque, nodule or swelling.7 Histologi- found to be defective. A posterior fusion defect and diasto- cally, a marked increase in the number of collagen fibres with metamyelia of the sacrum were determined (Fig. 2b). She was thickening of the dermis, and a decreased amount of thin or referred to the neurosurgery clinic. fragmented elastic fibres, are observed. The aetiology of the As the skin and neural tissue are of ectodermal origin and disease is unclear. It has been suggested that the pathogenesis share a common mechanism of formation during the third and of collagenoma involves a reduced production of collagenase fourth week of gestation, midline cutaneous anomalies, such as that leads to a decrease in the local degradation of collagen,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1066 Correspondence

(a) was found in our case, have been associated with mid-dorsal hypertrichosis.9 Solitary collagenoma has not been described as a unique ﬁnding in patients with spinal anomalies. It is not possible to establish a relationship between both anomalies. As our patient also has hypertrichosis and a sacral dimple we can only suggest that sacral collagenoma may be considered as an additional marker. In summary, adequate investigations for spinal anomalies should be carried out in patients with sacral dimple associated with cutaneous abnormalities such as solitary collagenoma or mid-dorsal hypertrichosis of the lumbosacral region.

Departments of Pediatric Surgery, *Dermatology, A. SENAYLI Pediatrics, Anaesthesiology, §Pathology and E. SEZER* –Radiodiagnostics, Gaziosmanpasa University T. SEZER School of Medicine, Tokat 60100, Turkey Y. SENAYLI Correspondence: Engin Sezer. D. KOSEOGLU§ E-mail: [email protected] N. FILIZ§ B. SARIKAYA¶ (b) References

1 Korsvik HE. Ultrasound assessment of congenital spinal anomalies presenting in infancy. Semin Ultrasound CT MR 1994; 15:264–74. 2 Cornette L, Verpoorten C, Lagae L et al. Closed spinal dysraphism: a review on diagnosis and treatment in infancy. Eur J Paediatr Neurol 1998; 2:179–85. 3 Drolet BA. Cutaneous signs of neural tube dysraphism. Pediatr Clin North Am 2000; 47:813–23. 4 Kanev PM, Park TS. Dermoids and dermal sinus tracts of the spine. Neurosurg Clin N Am 1995; 6:359–66. 5 Gibson PJ, Britton J, Hall DM, Hill CR. Lumbosacral skin markers and identification of occult spinal dysraphism in neonates. Acta Paediatr 1995; 84:208–9. Fig 2. (a) Histopathological examination of the solitary plaque 6 Guggisberg D, Hadj-Rabia S, Viney C et al. Skin markers of occult revealed dense and coarse collagen bundles in the dermis spinal dysraphism in children: a review of 54 cases. Arch Dermatol (haematoxylin and eosin; original magnification · 15). (b) Computed 2004; 140:1109–15. tomography showed spinal dysraphism, a posterior fusion defect and 7 Togawa Y, Nohira G, Shinkai H, Utani A. Collagenoma in Down diastometamyelia. syndrome. Br J Dermatol 2003; 148:596–7. 8 Botella-Estrada R, Alegre V, Sanmartin O et al. Isolated plantar cere- as well as an enhanced proliferative capacity of the regional briform collagenoma. Arch Dermatol 1991; 127:1589–90. 9 Olsen EA. Hair disorders. In: Fitzpatrick’s Dermatology in General Medicine fibroblasts.8 Solitary collagenoma has a persistent course with- (Freedberg IM, Eisen AZ, Wolff K et al, eds), 5th edn, Vol. 1. New out spontaneous resolution. York: McGraw-Hill, 1999; 746–8. Aplasia cutis congenita may also resemble a scar clinically. However, in our patient, the lesion lacked a flattened epider- Conflicts of interest: none declared. mis, there was no history of an ulcerated or denuded skin lesion at birth, and there was a decrease in the number of elastic fibres in the dermis; thus aplasia cutis congenita could be excluded. Tuberosclerosis is an autosomal dominant neurocutaneous disorder characterized by connective tissue naevi of Two patients with localized epidermolysis the collagen type (Shagreen patch), hypopigmented macules, bullosa acquisita: diagnostic value of laser adenoma sebaceum, periungual fibromas, seizures and mental scanning confocal microscopy retardation. In our case, the absence of intracranial findings such as cortical tubers and subependymal nodules on com- DOI: 10.1111/j.1365-2133.2007.07793.x puted tomography scans, and the lack of characteristic clinical features, ruled out the diagnosis of tuberosclerosis. SIR, Circumscribed skin lesions during the course of an Neuroectodermal abnormalities such as spina bifida, spina autoimmune subepidermal bullous disease were originally bifida occulta, meningocele manque´ and diastometamyelia, as described by Brunsting and Perry.1 In their cases blisters and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1067 erosions were predominantly localized on the upper part of the back and/or the head, healing with atrophic scars and milia. Further studies demonstrated that these patients had fulfilled the immunoelectron microscopy (IEM) criteria for cicatricial pemphigoid (CP).2 However, until now there have been only a few well-documented reports on localized epidermolysis bullosa acquisita (EBA). Four separate groups described four single patients presenting blisters localized exclusively to the face or scalp with immunological findings characteristic for EBA.3–6 In addition, there is one report on EBA limited to the mucous membrane of the oesophagus in a patient with Crohn disease.7 We describe two patients with a localized form of EBA who expand the clinical spectrum of this entity. Patient 1, an 8-year-old girl, presented with a 6-month history of numerous vesiculobullous lesions localized symmetrically on the cheeks (Fig. 1a). Skin lesions healed with scars and formation of milia. Mucous membrane involvement was never observed. Direct immunofluorescence showed the presence of in vivo bound IgG and C3 linear deposits along the basement membrane zone (BMZ). An overlay antigen (a) mapping study using laser scanning confocal microscopy (OAM-LSCM) according to a previously described method was performed8 and showed the presence of in vivo bound IgG below the localization of collagen IV (Fig. 2a). Indirect immunofluorescence showed the presence of circulating antibodies directed against the BMZ which reacted with the dermal side of salt-split skin. Immunoblotting showed reactivity of antibodies with a 290-kDa protein in dermal extract. The bullous lesions responded well to dapsone 50 mg daily and prednisone 20 mg daily, healing with atrophic scars and numerous milia. Patient 2, a 40-year-old man, presented with a 1-year history of a recurrent bullous eruption on the lateral surface of the neck (Fig. 1b). Mucous membrane involvement was never observed. Direct immunofluorescence showed the presence of in vivo bound IgG and C3 linear deposits along the BMZ which were shown by OAM-LSCM to be localized below collagen IV (Fig. 2b). Indirect immunofluorescence and immunoblotting were negative. The introduction of dapsone 50 mg daily led to rapid improvement of skin lesions which healed with atrophic scarring and a few milia; however, the vesiculobul- (b) lous eruption showed a tendency to recur after withdrawal of the treatment. Although the most characteristic criterion for EBA is skin Fig 1. (a) Patient 1: vesiculobullous eruptions localized on the cheek healing with scars and formation of numerous milia. (b) Patient 2: fragility,9 none of the reported cases with localized EBA, bullous eruption on the lateral surface of the neck healing with including our patients, developed blisters on traumatized atrophic scarring and formation of a few milia. areas. The localized form of EBA usually affects middle-aged individuals;3,5–7 however, Joly et al. described an 84-year-old man who was affected.4 We extend this observation by descri- lesions. This was probably due to an unusual clinical history bing an 8-year-old girl. Thus, the age at onset of the localized and to atypical clinical features. In addition, in most form of EBA ranges from childhood to old age. patients with localized EBA, including patient 2, serum Interestingly, in all the reported patients with localized studies gave negative results, and thus it was not possible EBA the final diagnosis was established after several months to determine the target antigen. In the past the diagnosis of or even years of recurrent skin lesions. This was the case in EBA was established in such cases by the presence of in vivo patient 2, who was initially suspected to have artefactual bound IgG within and below the lamina densa as shown

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1068 Correspondence

(a) (b) (c)

Fig 2. Overlay antigen mapping study by laser scanning confocal microscopy showed the presence of in vivo bound IgG (green) below the localization of collagen IV (red) in patient 1 (a) and patient 2 (b). The presence of linear IgG deposits (green) above collagen IV (red) is seen in a control case of localized cicatricial pemphigoid (c). Bar ¼ 5 lm. by direct IEM,3–5,7 which is a time-consuming technique References that is difficult to apply in routine study. Therefore we 1 Brunsting LA, Perry HO. Benign pemphigoid: a report of seven applied a practical technique, OAM-LSCM, which allowed cases with chronic scarring, herpetiformis plaques about the head rapid distinction of EBA (Fig. 2a,b) from CP (Fig. 2c) and and neck. Arch Dermatol 1957; 75:489–501. pemphigoid based on the localization of in vivo bound IgG 2 Bernard P, Prost C, Lecerf V et al. Studies of cicatricial pemphigoid below collagen IV, corresponding to their ultrastructural autoantibodies using direct immunoelectron microscopy and localization below the lamina densa, which is characteristic immunoblot analysis. J Invest Dermatol 1990; 94:630–5. for EBA.8 The diagnosis of EBA was confirmed by immuno- 3 Choi GS, Lee ES, Kim SC, Lee S. Epidermolysis bullosa acquisita blotting in patient 1. localized to the face. J Dermatol 1998; 25:19–22. 4 Joly P, Ruto F, Thomine E et al. Brunsting–Perry cicatricial bullous All reported patients with localized EBA, including ours, pemphigoid: a clinical variant of localized acquired epidermolysis showed a relatively mild disease course as compared with gen- bullosa? J Am Acad Dermatol 1993; 28:89–92. eralized EBA; however, all of them finally needed systemic 5 Karpouzis A, Prost C, Cordoliani F et al. Acquired localized treatment with corticosteroids or sulphone derivatives.3–7 epidermolysis bullosa. A case with scalp involvement and immuno- Based on the above observations one should expect that the electron microscopic study. Ann Dermatol Venereol 1993; 120:464–8. incidence of localized EBA is probably much higher than has 6 Lee CW, Jun KM. Epidermolysis bullosa acquisita presenting with been reported. It is possible that some cases considered to be localized facial blisters. Clin Exp Dermatol 1992; 17:363–5. 7 Schattenkirchner S, Lemann M, Prost C et al. Localized epidermolysis localized pemphigoid or localized CP based on the clinical pic- bullosa acquisita of the esophagus in a patient with Crohn’s disease. ture and the presence of in vivo bound IgG along the BMZ by Am J Gastroenterol 1996; 91:1657–9. routine direct immunofluorescence may represent a variant of 8 Wozniak K, Kazama T, Kowalewski C. A practical technique for dif- localized EBA. ferentiation of subepidermal bullous diseases: localization of in vivo In conclusion, we present two patients with localized EBA bound IgG by laser scanning confocal microscopy. Arch Dermatol in whom the diagnosis was established by a practical OAM- 2003; 139:1007–11. LSCM technique which is recommended for differentiation of 9 Roenigk HH Jr, Pearson RW. Epidermolysis bullosa acquisita. Arch Dermatol 1981; 117:383. autoimmune subepidermal bullous diseases, especially when circulating anti-BMZ antibodies are not detectable. Conflicts of interest: none declared.

Acknowledgments

This paper was supported by a grant from the Polish Scientiﬁc Research Committee (No. 2 P05B 065 30). An infant with extensive Mongolian spot, naevus ﬂammeus and cutis marmorata Department of Dermatology, K. WOZNIAK telangiectatica congenita: a unique case of Medical University of Warsaw, C. KOWALEWSKI phakomatosis pigmentovascularis Koszykowa 82a, D. ROSINSKA-BORKOWSKA* 02-008 Warsaw, Poland M. CIUPINSKA* DOI: 10.1111/j.1365-2133.2007.07798.x *Municipal Dermatological Hospital in Warsaw, Warsaw, Poland SIR, Phakomatosis pigmentovascularis (PPV) is a rare congen- E-mail: [email protected] ital disorder characterized by the presence of cutaneous vascu-

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1069

Fig 1. Mongolian spots involving the infant’s trunk, back, buttocks and arms. Cutis marmorata telangiectatica congenita (CMTC) on the chest, back, buttocks, arms and legs. Mongolian spots intermingled with CMTC over the chest, back, arms and buttock. lar and melanocytic lesions. We report a 12-day-old infant A 12-day-old female infant was referred to the Department exhibiting an unusual association of extensive cutis marmorata of Pediatrics, Mackay Memorial Hospital, Taipei, Taiwan, for telangiectatica congenita (CMTC), naevus flammeus, aberrant evaluation of congenital cutaneous abnormalities. On examin- Mongolian spot and bilateral congenital glaucoma. The com- ation, extensive greyish-blue hyperpigmentation with clear-cut bination of CMTC, naevus flammeus and aberrant Mongolian margins (Mongolian spot) involving her trunk, back, buttocks spot has not been reported, and this patient cannot be classi- and arms was noted. Marble-like vascular lesions consistent fied as having any of the currently accepted types of PPV. with CMTC were present over her chest, back, buttocks, arms and legs (Fig. 1). Flat, homogeneous erythematous patches with clear margins (naevus flammeus) were noted on her face (Fig. 2). The Mongolian spots were intermingled with CMTC over her chest, back, arms and buttock. Extremities were symmetrical and no atrophy or hypertrophy of soft tissue was present. Her left cornea was cloudy and ophthalmological examination revealed bilateral congenital glaucoma, more severe on the left. Echocardiogram revealed an asymptomatic, secundum type atrial septal defect. At the time of writing, the infant is 3 months old and showing normal development. The skin lesions are persistent.

Table 1 Traditional classiﬁcation of phakomatosis pigmentovascularis3

Type Vascular naevus Pigmentary naevus I Naevus flammeus Naevus pigmentosus et verrucosus II Naevus flammeus ± Mongolian spots naevus anemicus III Naevus flammeus ± Naevus spilus naevus anemicus IV Naevus flammeus ± Mongolian spots, naevus anemicus naevus spilus

Each type is divided into two subtypes: subtype a, cutaneous disease only; subtype b, cutaneous and systemic disease including disorders of the bones, eyes, central nervous system and internal organs. Fig 2. Naevus ﬂammeus on the face and cloudy left cornea.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1070 Correspondence

Table 2 Classiﬁcation of phakomatosis pigmentovascularis proposed by Happle7

Traditional name New name Coexistent naevi Reported additional skin lesions PPV type II a/b Phakomatosis cesioflammea Naevus cesius (blue spot) Naevus anemicus, hairlessness, Naevus flammeus hypoplastic nail PPV type III a/b Phakomatosis spilorosea Naevus spilus Hairlessness, granular cell tumours, Telangiectatic naevus lymphoedema PPV type V a/b Phakomatosis cesiomarmorata Naevus cesius (blue spot) & CMTC None PPV type IV a/b PPV, unclassifiable type Various type of vascular and Cafe´-au-lait or hypomelanotic macules, and no name pigmentary naevi naevus anemicus, naevus sebaceus

PPV, phakomatosis pigmentovascularis; CMTC, cutis marmorata telangiectatica congenita.

PPV is a rare disorder with approximately 200 reported lepsy, renal agenesis, and haemangioma. Glaucoma, which cases.1 Most cases have been reported in Argentinian and was present in our patient, is a well-documented extracutane- Japanese patients, although a large portion of affected indi- ous disorder associated with CMTC.9 Other reported ophthal- viduals is of Mediterranean and Indian ancestry. The occur- mological manifestations of PPV include buphthalmos, scleral rence in certain populations may be due to the 50–80% melanosis, iris hamartomas, ocular melanoma, and retinal, incidence of Mongolian spots in Afro-American, native choroidal and iris haemangiomas. American and Asian infants. PPV is rare in white-skinned The pathogenesis of PPV remains controversial. The genetic individuals. concept of twin loci has been suggested to explain the associ- Ota et al. first used the term PPV to describe the coexistence ation of vascular and pigmentary abnormalities.10 Alter- of naevus flammeus, a congenital vascular malformation natively, it has been proposed that abnormalities in consisting of dilated thin-walled capillaries and small veins embryogenesis at the end of the first month of gestation varying from pink to red to purple, with melanotic lesions affecting vascular development and melanocytic migration including epidermal naevus and dermal melanocytosis, the may be responsible for the condition.1 most common being the Mongolian spot.2 Our patient exhibited a triad of naevus flammeus, aberrant Hasegawa and Yasuhara proposed classifying PPV into four Mongolian spot and CMTC. This constellation does not fit any major types (Table 1) according to the combination of a of the traditional categories of PPV; however, it has features naevus flammeus and melanocytic lesion.3 Each type is further present in traditional PPV type II (Table 1) and type V. In classified as cutaneous disease only (subtype a), or cutaneous addition, this patient does not fulfil the criteria for any of the with coexistent systemic disease (subtype b). Type II is the three types proposed by Happle, and can only be included in most common form of PPV, representing approximately 80% the unclassifiable category (Table 2). of reported cases.1 Our literature review indicates this is the first report of a Enjolras and Mulliken reported the first case of PPV with case of PPV with the triad of naevus flammeus, aberrant Mon- the combination of CMTC, a rare congenital vascular anomaly golian spot and CMTC, and it may represent a heretofore characterized by persistent cutis marmorata, phlebectasia, undescribed variant of PPV. telangiectasia, and occasional ulceration and atrophy of the 4 involved area, and extensive Mongolian spot. Torrelo et al. Departments of Pediatrics, *Dermatology and B.P-H. CHANG reported two additional cases of CMTC and Mongolian spot, Ophthalmology, Mackay Memorial Hospital, C-H. HSU and proposed the classification of PPV type V for this associ- No. 92, Section 2, Chungshan North Road, H-C. CHEN* 5,6 ation. In 2005, Happle proposed a new, simplified classifi- Taipei, Taiwan J-W. HSIEH cation of PPV into three categories using descriptive terms. Correspondence: Chyong-Hsin Hsu. The three categories are: phakomatosis cesioflammea (PPV E-mail: [email protected] type II a/b), phakomatosis spilorosea (PPV type III a/b) and 7 phakomatosis cesiomarmorata (PPV type V a/b) (Table 2). References Happle did not consider PPV type I to be a unique clinical entity, hence it is not included in his classification scheme. 1 Vidaurri-de la Cruz H, Tamayo-Sanchez T, Duran-McKinster C et al. Because of its rarity, PPV type IV, traditionally considered to Phakomatosis pigmentovascularis IIA and IIB: clinical findings in be an admixture of types II and III, is grouped together with 24 patients. J Dermatol 2003; 30:381–8. 2 Ota M, Kawamura T, Ito N. Phakomatosis pigmentovascularis (Ota). unclassifiable PPV.7 Jpn J Dermatol 1947; 52:1–3. The rate of association of systemic disease with PPV is 3 Hasegawa Y, Yasuhara M. Phacomatosis pigmentovascularis type approximately 50% in all categories, with Sturge–Weber syn- IVa. Arch Dermatol 1985; 121:651–5. drome and Klippel–Trenaunay syndrome the most common 4 Enjolras O, Mulliken JB. Vascular malformations. In: Textbook of Pedi- identifiable disorders.8 Other reported conditions associated atric Dermatology (Harper J, Oranje A, Prose N, eds), 1st edn. Oxford: with PPV include central nervous system dysfunction, epi- Blackwell Science, 2000; 975–96.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1071

5 Torrelo A, Zambrano A, Happle R. Cutis marmorata telangiectatica congenita and extensive Mongolian spots: type 5 phacomatosis (a) pigmentovascularis. Br J Dermatol 2003; 148:342–5. 6 Torrelo A, Zambrano A, Happle R. Large aberrant Mongolian spots coexisting with cutis marmorata telangiectatica congenita (phacomatosis pigmentovascularis type V or phacomatosis cesiomarmorata). J Eur Acad Dermatol Venereol 2006; 20:308–10. 7 Happle R. Phacomatosis pigmentovascularis revisited and reclassi- ﬁed. Arch Dermatol 2005; 141:385–8. 8 Al-Robaee A, Banka N, Alfadley A. Phakomatosis pigmentovascularis type IIb associated with Sturge–Weber syndrome. Pediatr Dermatol 2004; 21:642–5. 9 Amitai DB, Fichman S, Merlob P et al. Cutis marmorata telangiectatica congenita: clinical ﬁndings in 85 patients. Pediatr Dermatol 2000; 17:100–4. 10 Koopman RJJ. Concept of twin spotting. Am J Med Genet 1999; 85:355–8.

Conﬂicts of interest: none declared.

(b) Nail bed lichen planus associated with onychopapilloma

DOI: 10.1111/j.1365-2133.2007.07797.x

SIR, A 19-year-old woman presented to the Department of Dermatology (University of Lie`ge, Belgium) with a several- month history of longitudinal onycholysis in the central portion of the right thumbnail and enlarging at the base and the top of the nail plate (Fig. 1a). She did not mention any pain, but only a mild discomfort and a cosmetic handicap, mostly because of the keratotic process emerging from under the free edge of the nail plate (Fig. 1b). The patient was a student and did not report any trauma or habit tic. The other nails were Fig 1. Longitudinal onycholysis of the right thumb (a) with an normal and no skin, scalp or mucosal lesions were noticed on onychopapilloma emerging from the free edge (b). general examination. She was in good health, but reported a history of Mycoplasma pneumoniae and herpes zoster infections. The clinical diagnosis was onychopapilloma but, as the lesion was wide and impairing her picking up small objects, she underwent nail surgery and the onychopapilloma was removed with a longitudinal nail bed excision (Fig. 2). Histo- logical examination revealed a typical nail bed lichen planus characterized by a band-like lymphocytic infiltrate in the superficial dermis that extended to the nail bed epithelium. The latter showed acanthosis and hypergranulosis. Foci of vacuolar alterations in the basal layer with apoptotic keratinocytes were also present (Fig. 3). Healing was uneventful, leaving only a slight longitudinal leuconychia. Although there has been no recurrence after 1 year of follow up, a recurrence might be expected according to the histological diagnosis. This would then benefit from intralesional steroids. The diagnosis was very surprising as onychopapilloma is not a clinical presentation for nail lichen planus. The term ‘onychopapilloma’ was proposed by Baran and Perrin in 20001 for a localized distal subungual keratosis with multi- Fig 2. Partial nail avulsion showing the onychopapilloma.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1072 Correspondence

References

1 Baran R, Perrin C. Longitudinal erythronychia with distal subungual keratosis: onychopapilloma of the nail bed and Bowen’s disease. Br J Dermatol 2000; 143:132–5. 2 Lambert DR, Siegle RJ, Camisa C. Lichen planus of the nail presenting as a tumor: diagnosis by longitudinal nail bed biopsy. Dermatol Surg Oncol 1988; 14:1245–7. 3 Gee BC, Millard PR, Dawber RPR. Onychopapilloma is not a distinct clinicopathological entity. Br J Dermatol 2002; 146:156–7. 4 de Berker DAR, Perrin C, Baran R. Localized longitudinal erythronychia: diagnostic signiﬁcance and physical explanation. Arch Dermatol 2004; 140:1253–7. 5 Reuter G, Keller F, Samama B, Boehm N. Bowen ungueale a` type d’erythronychie longitudinale. Aspect dermoscopique et e´tude viro- logique. Ann Dermatol Venereol 2005; 132:569. 6 Baran R, Dawber RPR, de Berker DAR et al. Baran and Dawber’s Diseases of the Nails and their Management, 3rd edn. Oxford: Blackwell Science, Fig 3. Histology revealing nail bed lichen planus (haematoxylin and 2001. eosin; original magniﬁcation · 100).

Conflicts of interest: none declared. nucleated cells. Clinically, this is characterized by longitudinal erythronychia of the nail plate that may be associated with distal onycholysis and nail splitting. Removal of the nail plate reveals a longitudinal thickening extending from the matrix/ nail bed junction to the hyponychium where it ends in a kera- Schnitzler syndrome: a case report of tinized expansion. This lesion is usually painless. As in our successful treatment using the anti-CD20 case, the patient sought medical advice because of functional monoclonal antibody rituximab problems and cosmetic concerns, especially due to the free edge of the nail plate that tends to catch on objects. DOI: 10.1111/j.1365-2133.2007.07799.x We herein report the second case of nail bed lichen planus presenting as a tumour. To the best of our knowledge, there SIR, Schnitzler syndrome (SS) was first reported in 1974 as a has been only one previous report, by Lambert et al.,2 of a case of chronic urticaria, monoclonal IgM gammopathy and keratotic tumour of the nail bed in the right thumb of a bone lesions together with recurrent fever and arthralgia.1 It is 67-year-old woman. probably an under-diagnosed disorder with approximately 80 We wish to stress that specific attention has to be paid each cases having been reported since 1974. time an onychopapilloma is identified under the nail plate, Most cases of SS have a chronic benign course. However, especially because uncertainty remains if it is a distinct entity a small percentage of patients can eventually progress to or not.3 Longitudinal excision with removal of the entire le- lymphoproliferative disease such as lymphoplasmacytic sion has to be performed; excision of the keratotic end does lymphoma or Waldenstro¨m macroglobulinaemia.2 Approxi- not result in cure and the lesion recurs in a few months.4 It mately 90% of patients experience recurrent fevers, which can hide a benign disorder, as in our case, but also a malig- may not be related to the skin rash.3 No treatment is consis- nant one.1,5 For this reason, removal and pathological examin- tently effective and spontaneous remissions have not been ation are mandatory in order to plan adequate treatment. reported. Experience with rituximab therapy in SS is limited Nail lichen planus can occur in the absence of skin, scalp or to one case report with transient improvement in skin mani- mucosal involvement, as in our case, but the disease usually festations.4 affects several or most nails. Lichen planus of the nail is more A 64-year-old woman had a 3-year history of intermittent frequently located in the nail matrix whereas nail bed lichen urticarial skin rash, periorbital swelling and recurrent fever. planus is quite rare and is characterized by onycholysis with The rash was mildly pruritic, involving mainly her face, trunk or without subungual hyperkeratosis.6 and extremities, and resolved within 24 h. These symptoms were resistant to therapy with antihistamines, nonsteroidal Department of Dermatology, University of Lie`ge, B. RICHERT anti-inflammatory drugs and corticosteroids. On examination, 45 quai Kurth, 4020 Lie`ge, Belgium M. IORIZZO* she had a widespread, erythematous, maculopapular rash and *Department of Dermatology, A. TOSTI* cervical lymphadenopathy. University of Bologna, Bologna, Italy J. ANDRE´ Laboratory investigations revealed normal full blood count, Department of Dermatology, Free University of Brussels, renal and liver function tests, serum calcium, lactate de- Brussels, Belgium hydrogenase, complement (C3 and C4) levels and C1 esterase E-mail: [email protected] inhibitor levels. No antinuclear antibodies, rheumatoid factor,

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1073

Table 1 Summary of the clinicopathological findings in Schnitzler the diagnostic criteria for SS, and other diagnoses such as syndrome acquired C1 esterase inhibitor deficiency and cryoglobulinae- mia have been excluded. % reported The treatment of SS is known to be difficult and often Present in cases with unsatisfactory.3 Antihistamines do not control skin rash and a Factor this case this factor can only be partially helpful if the rash is pruritic.5 Ciclospo- Clinical rin was reported to be effective in one patient at a dosage of ) Urticarial rash Yes 100 2.6 mg kg 1 daily.6 Intravenous immunoglobulin, plasma- Pruritus Yes 37 pheresis and psoralen plus ultraviolet A therapy showed no Fever Yes 98 3,7 Arthralgia or arthritis No 63 activity in the management of SS. Worm and Kolde repor- 8 Bone pain No 75 ted two patients who responded to thalidomide. Single chemo- Palpable lymph nodes Yes 59 therapy agents such as cyclophosphamide were previously Liver or spleen enlargement No 40 tried and can be helpful.9 In a more recent report, three Facial swelling Yes 0 patients with SS treated with the interleukin-1 receptor antag- Laboratory investigations onist (anakinra) showed complete and durable remission with Monoclonal gammopathy Yes 100 10 ) an acceptable side-effect profile. There was one case report IgM > 10 g L 1 No 38 Raised IgG and/or IgA levels No 39 of using the anti-CD20 monoclonal antibody rituximab in a Bence-Jones proteinuria No 71 patient with SS who developed marginal zone lymphoma, 4 Abnormal bone marrow Yes 25 with partial improvement in clinical condition. morphology There are reports suggesting activation of complement through deposition of IgM complexes, or uncontrolled activa- aThis was based on the first reported 52 cases of Schnitzler tion of interleukin-1a or tumour necrosis factor-a as the syndrome as summarized by Lipsker et al.3 potential mechanisms through which SS symptoms manifest. In our patient, rituximab treatment has resulted in disappearance of the IgMj paraprotein which was probably responsible for the cytokine/complement activation and, therefore, her cold agglutinins or cryoglobulins were detected. Hepatitis B symptoms. and C virus serologies were nonreactive. Protein electrophor- In conclusion, SS is a very rare condition with distressing )1 esis revealed IgMj paraprotein of 4 g L with normal IgG, intermittent urticarial eruptions and recurrent fever that are IgA and IgE levels. Urine was negative for Bence-Jones pro- typically resistant to treatment. Rituximab was very useful in tein. Cervical lymph node biopsy showed nonspecific reactive controlling SS symptoms in this patient with no reported side- follicular hyperplasia. Bone marrow (BM) aspirate showed small effects. This observation offers another treatment option for lymphoid infiltrate with normal haematopoiesis. Immuno- those patients with SS and resistant to or with unacceptable phenotyping of BM revealed a small monoclonal population of side-effects to other therapies. B lymphocytes, j type (CD19+, CD20+, CD22+, CD79b+, ) ) ) CD23 , CD5 and CD10 ). Skeletal survey showed no lytic *Division of Hematology, K.M. RAMADAN* lesions. Computed tomographic scanning revealed scattered Leukemia/BMT Program of British Columbia, H.A. ESWEDI lymph nodes of <1 cm diameter. The clinicopathological find- Vancouver General Hospital and M.R. EL -AGNAF ings in this patient and previously reported patients with SS Health Sciences Centre, 10th Floor, are summarized in Table 1. Diamond Health Centre, 2775 Laurel Street, This patient received four doses of weekly rituximab at Vancouver, BC V5Z 1M9, Canada )2 375 mg m . This resulted in a complete resolution of her Division of Hematology, Vancouver General Hospital, symptoms with a follow-up period of 12 months. Repeated Vancouver, BC, Canada BM aspirate, 4 months post-therapy, was negative for mono- Department of Haematology, Ulster Hospital, Belfast, U.K. clonal B lymphocytes by immunophenotyping, accompanied E-mail: [email protected] with disappearance of the IgMj paraprotein. In this report we describe a patient with SS who had com- References plete and durable response to rituximab therapy. To date there is no effective treatment to control the symptomatology of SS. 1 Schnitzler L, Schubert B, Boasson M. Urticaire chronique, le´sions Rituximab is a promising agent that needs further evaluation osseuses, macroglobuline´mie IgM: maladie de Waldenstro¨m? 2e in patients with SS. pre´sentation. Bull Soc Fr Dermatol Syphiligr 1974; 81:363. Diagnostic criteria for SS include urticarial skin rash, mono- 2 Machet L, Vaillant L, Machet MC et al. Schnitzler’s syndrome (urticaria and macroglobulinemia): evolution to Waldenstro¨m’s disease clonal IgM component, and at least two of the following cri- is not uncommon. Acta Derm Venereol (Stockh) 1996; 76:413. teria: fever, arthralgia/arthritis, bone pain, lymphadenopathy, 3 Lipsker D, Veran Y, Grunenberger F et al. The Schnitzler syndrome. hepato/splenomegaly, elevated erythrocyte sedimentation rate, Four new cases and review of the literature. Medicine (Baltimore) leucocytosis and abnormal BM morphology.3 Our patient fits 2001; 80:37–44.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1074 Correspondence

4 Dalle S, Balme B, Sebban C et al. Schnitzler syndrome associated described in native North Americans,3 the mestizo population with systemic marginal zone B-cell lymphoma. Br J Dermatol 2006; and some Indian groups from Mexico,2,4 Guatemala, 155:827–9. Honduras, Colombia,5 Bolivia and Peru, as well as in some 5 Baty V, Hoen B, Hudziak H et al. Schnitzler’s syndrome: two populations from North Western Europe (England,6 Ireland7 case reports and review of the literature. Mayo Clin Proc 1995; 8 70:570–2. and Scotland ). 6 Pascual-Lo´pez M, Hernańdez-Nuń˜ez A, Sańchez-Pe´rez J et al. Schnit- Multiple studies report association of HLA genes with the 4–9 zler’s syndrome with monoclonal IgG kappa gammopathy: susceptibility to develop AP. Increased frequencies of HLA- good response to cyclosporin. J Eur Acad Dermatol Venereol 2002; A28, HLA-B39 and HLA-DR4 have been shown in Mexican 16:267–70. patients with AP, HLA-DR4 being present in 92Æ8% of patients 7 Modiano P, Barbaud A, Laveine E et al. Efficacite´ de la PUVA and HLA-DRB1*0407 in 80Æ7%.5 Nevertheless, it is not known the´rapie dans un syndrome de Schnitzler. Nouv Dermatol 1995; if Mexican patients who do not present the HLA-DRB1*0407 14:362–3. 8 Worm M, Kolde G. Schnitzler’s syndrome: successful treat- allele show clinical manifestations of AP. ment of two patients using thalidomide. Br J Dermatol 2003; The aim of this study was to determine HLA-B and HLA- 148:601–2. DR4 subtypes in patients with AP in order to make correl- 9 Peterlana D, Puccetti A, Tinazzi E et al. Schnitzler’s syndrome trea- ations with clinical manifestations. We included 48 Mexican ted successfully with intravenous pulse cyclophosphamide. Scand J mestizo patients who attended a referral dermatological clinic Rheumatol 2005; 34:328–30. in Mexico City. All had AP confirmed by histopathology. Gene 10 de Koning H, Bodar EJ, Simon A et al. Beneficial response to frequencies of HLA alleles were compared with those present anakinra and thalidomide in Schnitzler’s syndrome. Ann Rheum Dis 2006; 65:542–4. in 99 ethnically matched healthy individuals. Mexican mestizos have a proportion of 56% Amerindian genes, 40% Cauca- 9 Conflicts of interest: none declared. sian genes and 4% African genes. HLA alleles were determined by high-resolution DNA typing. Gene frequencies, odds ratios (ORs) and 95% confidence intervals (CIs) were determined by using the Epi InfoTM statistical package (Centers for Disease Control and Prevention, Class I and class II major histocompatibility Atlanta, GA, U.S.A.). complex genes in Mexican patients with Seventy per cent of the patients were female, and mean ± actinic prurigo SD age was 29Æ9±15Æ9 years. The mean age at onset of photosensitivity was below 13 years. Most patients had DOI: 10.1111/j.1365-2133.2007.07801.x persistent lesions in mucosa, sun-exposed skin and conjunctiva. Table 1 shows HLA-DR4 subtypes in 38 patients (76 alleles). SIR, Actinic prurigo (AP) is a rare photodermatosis that is The gene frequency of the HLA-DRB1*0407 allele was signifi- relatively frequent among Amerindians.1 The prevalence in cantly increased in the patients group as compared with con- ) Mexicans is 3Æ5%.2 Clinical manifestations include dissemin- trols (0Æ605 vs. 0Æ106, respectively) (OR 12Æ9, P ¼ 1 · 10 8, ated dermatosis in sun-exposed areas, predominantly the face, 95% CI 6Æ4–26), followed by the HLA-DRB1*1406 allele ear lobes, neck and arms. Clinical findings usually appear in (OR 4Æ5, P ¼ 0Æ03, 95% CI 0Æ9–24Æ8). We also found in the childhood. It has a 2 : 1 female/male ratio. It has been patients group a significantly decreased frequency of the

Table 1 Gene frequencies of the HLA-DR4 Cases Controls allele subtypes in patients with actinic prurigo (n ¼ 76) (n ¼ 198) compared with healthy Mexican mestizos controls HLA-DR4 n GF n GF P-value OR 95% CI ) *0407 46 0Æ605 21 0Æ106 1 · 10 8 12Æ96Æ4–26 *1406 5 0Æ065 3 0Æ015 0.03 4Æ50Æ9–24Æ8 *0802 3 0Æ039 30 0Æ150 0.01 0Æ20Æ05–0Æ8 *0402 3 0Æ039 7 0Æ035 NS *0301 1 0Æ013 9 0Æ045 NS *1301 1 0Æ013 4 0Æ020 NS *0406 1 0Æ013 1 0Æ005 NS *1502 1 0Æ013 3 0Æ015 NS *1501 1 0Æ013 9 0Æ045 NS *0410 1 0Æ013 2 0Æ010 NS *0408 1 0Æ013 1 0Æ005 NS

GF, gene frequency; CI, conﬁdence interval; OR, odds ratio; NS, nonsigniﬁcant. Only relevant alleles are shown.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1075

Table 2 Gene frequencies of the HLA-B locus alleles in patients with Dermatology Department, Hospital General S. ZULOAGA-SALCEDO actinic prurigo compared with healthy Mexican mestizos controls ‘Dr Manuel Gea Gonza´lez’, Mexico City, M. CASTILLO-VAZQUEZ* Mexico E. VEGA-MEMIJE Cases Controls *Immunology and Rheumatology O. ARELLANO-CAMPOS* (n ¼ 36) (n ¼ 198) Department, Instituto Nacional de Ciencias J.M. RODRI´ GUEZ-PE´ REZ Me´dicas y Nutricioń, Salvador Zubirań, N. PE´ REZ-HERNA´ NDEZ HLA-B n GF n GF P-value OR 95% CI Vasco de Quiroga 15, Tlalpan 14000, L. DOMI´ NGUEZ-SOTO 39 14 0Æ388 11 0Æ105 0Æ0005 5Æ15 1Æ8–14Æ2 Mexico City, Mexico T. HOJYO-TOMOKA 35 8 0Æ222 29 0Æ270 NS ´ 40 4 0Æ111 10 0Æ095 NS Physiology Department, G. VARGAS-ALARCON 15 3 0Æ083 6 0Æ070 NS Instituto Nacional de Cardiologıá, J. GRANADOS* 48 2 0Æ055 3 0Æ025 NS Ignacio Chavez, Mexico City, Mexico 52 2 0Æ055 2 0Æ015 NS Correspondence: Julio Granados. 810Æ027 3 0Æ025 NS E-mail: [email protected] 14 1 0Æ027 6 0Æ060 NS 51 1 0Æ027 5 0Æ050 NS References GF, gene frequency; CI, confidence interval; OR, odds ratio; NS, nonsignificant. 1 Birt AR, Davis RA. Hereditary polymorphic light eruption of American Indians. Int J Dermatol 1975; 14:105–11. 2 Hojyo-Tomoka MT. Actinic prurigo: an update. Int J Dermatol 1995; 34:380–4. 3 Wiseman MC, Orr PH, Macdonald SM et al. Actinic prurigo: clinical HLA-DRB1*0802 allele (OR 0Æ2, P ¼ 0Æ01, 95% CI 0Æ05–0Æ8). features and HLA associations in a Canadian Inuit population. JAm HLA-B typing in the patients group showed a significantly Acad Dermatol 2001; 44:952–6. increased frequency of HLA-B39 (OR 5Æ15, P ¼ 0Æ0005, 95% 4 Hojyo-Tomoka T, Granados J, Vargas-AlarcońGet al. Further evi- CI 1Æ8–14Æ2) (Table 2). dence of the role of HLA-DR4 in the genetic susceptibility to acti- Although the aim of this study was to establish whether nic prurigo. J Am Acad Dermatol 1997; 36:935–7. 5 Suarez A, Valbuena MC, Rey M, de Porras Quintana L. Association there was an association of clinical features of AP with HLA of HLA subtype DRB10407 in Colombian patients with actinic alleles, this work shows that Mexican patients with AP have a prurigo. Photodermatol Photoimmunol Photomed 2006; 22:55–8. relatively high degree of clinical homogeneity that makes it 6 Grabczynska SA, McGregor JM, Kondeatis E et al. Actinic prurigo difficult to correlate clinical features with HLA markers. and polymorphic light eruption: common pathogenesis and the Nevertheless, the study confirms the direct role of HLA- importance of HLA-DRB1*0407. Br J Dermatol 1999; 140:232–6. DRB1*0407 in the pathophysiology of AP; it also shows the 7 O’Reilly FM, Spencer S, Darke C, Murphy GM. HLA-DR4B1*0407 additional role of HLA-DRB1*1406 in the genetic susceptibil- strong association with actinic prurigo in Ireland. Br J Dermatol 1996; 135 (Suppl. 47):65. ity to develop AP. Interestingly, this study shows the possible 8 Dawe RS, Collins P, O’Sullivan A, Ferguson J. Actinic prurigo and protective role of HLA-DRB1*0802 in AP. The existence of an HLA-DR4. J Invest Dermatol 1997; 108:233–4. HLA-B39-DRB1*0407 haplotype suggests a more comprehen- 9 Lisker R, Pe´rez Bricenõ R, Granados J et al. Gene frequencies and sive susceptibility region within the human sixth chromo- admixture estimates in a Mexico City population. Am J Phys Anthropol some. 1986; 71:203–7. These findings are concordant with studies in Latin Amer- 10 De Leo C, Castelan N, Lopez M et al. HLA class I and class II alleles ica5,6 and Western Europe7–9 regarding the role of class II and haplotypes in Mexican mestizos established from serological typing of 50 families. Hum Biol 1997; 69:809–18. major histocompatibility complex (MHC) alleles in the patho- 11 Salzano FM. Molecular variability in Amerindians: widespread but physiology of AP; in addition, we propose a class I and class uneven information. An Acad Bras Cienc 2002; 74:223–63. II MHC haplotype and suggest that it would include other genes located within the class I and class II MHC regions, such Conflicts of interest: none declared. as tumour necrosis factor and heat shock proteins. The relevant alleles involved in both susceptibility and protection regarding the development of AP (HLA-DRB1*0407, HLA- DRB1*1406, HLA-B39 and HLA-DRB1*0802) are particularly frequent in Amerindians from Mexico,10 strongly suggesting Anti-p200 pemphigoid in a 17-year-old that the autochthonous genetic background in the mestizo girl successfully treated with systemic population is at play. This information is valuable considering corticosteroid and dapsone that the genetic background of Amerindians has evolved geo- graphically by natural selection during the last five centuries as DOI: 10.1111/j.1365-2133.2007.07810.x a result of survival against infectious agents.11 Thus, the genes associated with AP might represent the price this race has paid SIR, Anti-p200 pemphigoid is an autoimmune subepidermal for survival. Unravelling the mechanisms of development of blistering disease first described in 1996.1,2 It is associated AP will confirm or refute this hypothesis. with psoriasis in some patients, but not in others. Anti-p200

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1076 Correspondence pemphigoid has been shown to present various clinical fea- seems to be different from laminins 1, 5 and 6, and type VII tures.3–5 Various treatments have been attempted. We describe collagen, which are known to be the target antigens involved a new case of anti-p200 pemphigoid in a young woman, as in other autoimmune bullous dermatoses.2,3,6 Shimanovich well as her good response to treatment with systemic cortico- et al. reported that p200 is a noncollagenous glycoprotein.7 steroid and dapsone. Thus, p200 is currently thought to be one of the novel anti- A 17-year-old Japanese girl was referred to us with a gens of autoimmune bullous disease. However, it is not 2-month history of numerous pruritic bullous skin lesions known whether the IgG antibodies against the 200-kDa lamina over her entire body. Neither she nor her family had a past lucida antigen play any causative role(s) in the pathogenesis history of psoriasis. On physical examination, small blisters of this bullous disease. with erythema, and erosions similar to the skin lesions of bul- Passive transfer experiments with autoantibodies from lous pemphigoid, were found over her entire body. Palmo- patients provide potential evidence to prove direct pathogen- plantar lesions were especially severe (Fig. 1). Oral and genital icity of autoantibodies and improve our understanding of the mucous membranes were spared. Histology of lesional skin pathogenesis in autoimmune blistering diseases. Passive trans- showed subepidermal blistering with an abundant infiltrate of fer of autoantibodies from patients with pemphigus and EBA neutrophils, eosinophils and lymphocytes (Fig. 2a,b). led to successful generation of skin lesions in mice,8,9 whereas Direct immunofluorescence (IF) showed linear deposits of autoantibodies from patients with bullous pemphigoid failed IgG and C3 at the dermoepidermal junction (DEJ). Indirect IF to induce skin lesions. Better to understand the pathogenicity using normal human skin sections as a substrate showed circu- of anti-p200 pemphigoid, we tried passive transfer experi- lating IgG autoantibodies against the basement membrane ments with autoantibodies from this patient. Firstly, to deter- zone (> 1 : 160), which were reactive exclusively with the mine whether the purified antibodies of this patient reacted ) dermal side of 1 mol L 1 NaCl-split human skin (> 1 : 320; with murine skin, we performed indirect IF analysis on both Fig. 2c). Immunoblotting with epidermal and dermal extracts human and murine skin. The IgG fraction from the serum sam- of normal human skin was performed using methods ples was prepared by affinity chromatography using a HiTrap described elsewhere.1–3 The patient’s serum reacted with a Protein G high performance column (Amersham Biosciences, 200-kDa protein from dermal extracts (Fig. 2d). The 290-kDa Tokyo, Japan). The IgG fractions were dialysed against phos- epidermolysis bullosa acquisita (EBA) antigen was not detected. phate-buffered saline and concentrated by ultrafiltration (Am- We diagnosed her disease as anti-p200 pemphigoid. icon, Lexington, MA, U.S.A.). As shown in Fig. 2e, the IgG Because of the severe skin lesions, systemic prednisolone fraction did not react with mouse skin; in contrast, it reacted 60 mg daily and dapsone 50 mg daily were started. After the strongly with human skin (> 1 : 640; data not shown). Then, initial dose had been continued for 2 weeks, prednisolone and we injected the IgG serum fraction from our patient into neo- dapsone were gradually tapered to 12Æ5 mg and 25 mg daily, natal mice to elicit an immune response. Neonates of BALB/c respectively, and maintained at that dosage thereafter. The mice received the IgG fraction as described elsewhere.8 Briefly, lesions healed, leaving mild scarring or formation of milia. five mice were given single intraperitoneal injections of IgG at ) Anti-p200 pemphigoid was identified as a new, distinct entity 5mgg 1 body weight. At 48 h after the injection, we and named by Zillikens et al.6 Studies by indirect immunogold observed the mice carefully. The mice were killed and the skin electron microscopy localized the autoantigen to the lower samples studied by direct IF using fluorescein isothiocyanate- portion of the lamina lucida.1,2 The 200-kDa autoantigen conjugated rat antihuman IgG (1 : 100; Jackson Immuno-

(a) (b)

Fig 1. (a) Clinical appearance of the buttock: multiple, small, tense blisters on a background of diffuse erythema that resembled bullous pemphigoid skin lesions. (b) Clinical appearance of right sole: large, painful tense bullae and inﬂammatory erythema.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1077

(a) (c) (d) Dermal

1 2 3

290 kDa

200 kDa

(b) (e) Patient p200 control EBA control

Fig 2. (a) Skin biopsy from a blister showing a subepidermal blister containing an inflammatory infiltrate (haematoxylin and eosin; low power magnification). (b) Neutrophils, eosinophils and lymphocytes in the blister (haematoxylin and eosin; high power magnification). (c) Indirect ) immunofluorescence (IF) of 1 mol L 1 NaCl-split human skin. Circulating IgG antibodies in the serum of our patient reacted with the dermal side. (d) Results of immunoblotting with normal human dermal extracts. Control epidermolysis bullosa acquisita (EBA) serum reacted with the 290-kDa EBA antigen (lane 3). Control anti-p200 pemphigoid serum reacted with the 200-kDa antigen (lane 2). IgG from the present patient reacted with the 200-kDa antigen (lane 1). (e) Indirect IF of mouse skin. The IgG fraction did not react with mouse skin. research Laboratories, West Grove, PA, U.S.A.). No mice trea- autoimmune blistering diseases. Combinations of oral cortico- ted with purified IgG fractions showed any cutaneous lesion steroid and dapsone were particularly effective in patients in including blisters and erosions (data not shown). The mice whom the disease was not associated with psoriasis vul- treated with IgG fractions from normal individuals also showed garis,11,12 so we selected this therapy for our patient with no skin lesions. Direct IF showed no deposits of IgG or C3 at severe manifestations, resulting in a good outcome. the DEJ. Indirect IF using the treated mice as a substrate showed no DEJ immunoreactivity. We think that the specific Department of Dermatology, N. YAMANE epitope region within the 200-kDa antigen might contain sig- Hokkaido University Graduate School of Medicine, D. SAWAMURA nificant sequence differences between humans and mice. All Sapporo 060-8638, Japan W. NISHIE mouse procedures were approved by the Institutional Animal *Kushiro Skin Clinic and M. ABE Care and Use Committee of Hokkaido University. Kushiro City General Hospital, Kushiro, Japan K. KODAMA Anti-p200 pemphigoid primarily occurs in the elderly; to Department of Dermatology, K. ADACHI* date, the youngest patient reported has been a 28-year-old Kurume University School of Medicine, H. NAKAMURA 5 man. Our 17-year-old patient now represents the youngest Fukuoka, Japan N. ISHII case. The clinical features of anti-p200 pemphigoid are E-mail: [email protected] T. HASHIMOTO 3–5 diverse. Patients with this disease showed bullous pemphi- H. SHIMIZU goid-like features, vesicular pemphigoid features, erythroderma, dermatitis herpetiformis-like features, inflammatory EBA-like References features and mixed features of bullous pemphigoid and linear IgA bullous dermatosis. 1 Chen KR, Shimizu S, Miyakawa S et al. Coexistence of psoriasis and Various treatments have been attempted. Patients in whom an unusual IgG-mediated subepidermal bullous dermatosis: identi- the disease was associated with psoriasis showed a good thera- fication of a novel 200-kDa lower lamina lucida target antigen. Br J Dermatol 1996; 134:340–6. peutic response to ciclosporin.4 In contrast, various treatments 2 Zillikens D, Kawahara Y, Ishiko A et al. A novel subepidermal have been reported in patients in whom the disease was not blistering disease with autoantibodies to a 200-kDa antigen of the associated with psoriasis vulgaris. Those included oral cortico- basement membrane zone. J Invest Dermatol 1996; 106:465–70. steroids,10 dapsone,11 tetracyclines (and colchicine or nicotin- 3 Kawahara Y, Zillikens D, Yancy KB et al. Subepidermal blistering amide),2,3 and combined treatment with steroids and disease with autoantibodies against a novel dermal 200-kDa antigen. azathioprine,5 which are generally used for the treatment of J Dermatol Sci 2000; 23:93–102.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1078 Correspondence

4 Yasuda H, Tomita Y, Shibaki A et al. Two cases of subepidermal immunocompetent patients without skin tumours (non-RTR) blistering disease with anti-p200 or 180-kD bullous pemphigoid for the presence of 24 EV/cutaneous and 37 genital HPV antigen associated with psoriasis. Dermatology 2004; 209:149–55. types. 5 Umemoto N, Demitsu T, Toda S et al. A case of anti-p200 pemphi- About five hairs were plucked from each of six different goid clinically mimicking inflammatory epidermolysis bullosa acquisita. Br J Dermatol 2003; 148:1058–60. regions at the same time-point from nine immunosuppressed 6 Zillikens D, Ishiko A, Jonkman MF et al. Autoantibodies in RTR with SCC (mean age 57Æ6 years; 51 specimens) and from anti-p200 pemphigoid stain skin lacking laminin 5 and type VII nine immunocompetent patients (mean age 58 years; 54 spec- collagen. Br J Dermatol 2000; 143:1043–9. imens) at the Department of Dermatology, Skin Cancer Center 7 Shimanovich I, Hirako Y, Sitaru C et al. The autoantigen of anti- Charite´ (Berlin, Germany). DNA was isolated from hairs using p200 pemphigoid is an acidic noncollagenous N-linked glyco- a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and was protein of the cutaneous basement membrane. J Invest Dermatol finally eluted in 200 lL AE buffer (Qiagen) as previously 2003; 121:1402–8. 6 8 Anhalt GJ, Labib RS, Voorhees JJ et al. Induction of pemphigus in described. All hair specimens were examined by b-globin poly- neonatal mice by passive transfer of IgG from patients with the merase chain reaction (PCR) to estimate the quantity of DNA disease. N Engl J Med 1982; 306:1189–96. and to control DNA quality: only b-globin-positive hair speci- 9 Woodley DT, Ram R, Doostan A et al. Induction of epidermolysis mens were included in this study. Detection of EV/cutaneous bullosa acquisita in mice by passive transfer of autoantibodies from HPV types was performed with c. 10 ng template DNA as patients. J Invest Dermatol 2006; 126:1323–30. described earlier using the consensus primer-mediated b/c 10 Salmhofer W, Kawahara Y, Soyer HP et al. A subepidermal blister- cutaneous PCR method, amplifying a 72-base pair L1 fragment ing disease with histopathological features of dermatitis herpetiformis and immunofluorescence characteristics of bullous of 24 HPV types belonging to the b and c genera followed by 6,7 pemphigoid: a novel subepidermal blistering disease or a variant reverse line blotting (RLB). Detection of 37 genital HPV of pemphigoid? Br J Dermatol 1997; 137:599–604. types was performed by a similar method using the consensus 11 Inoh Y, Nishikawa T, Hashimoto T. The vesicular pemphigoid primer-mediated GP5+/GP6+ PCR followed by RLB for typ- phenotype may be related to antibodies to a 200 kDa antigen in ing.8 All clinical specimens were analysed twice on different the lower lamina lucida. Br J Dermatol 1998; 139:738–9. days, and HPV types were only scored if both experiments 12 Egan CA, Yee C, Zillikens D et al. Anti-p200 pemphigoid: diagnosis revealed consistent results. and treatment of a case presenting as an inflammatory subepidermal blistering disease. J Am Acad Dermatol 2002; 46:786–9. Genital HPV types were detected in only six hair specimens from five RTR, from the eyebrow (HPV 16, 40 and 51), trunk Conflicts of interest: none declared. (HPV 70) and leg (HPV 33 and 52), and were absent in non- RTR (Table 1). Altogether, 16 and 14 different EV/cutaneous HPV types were detected in hairs from RTR and non-RTR, respectively. Forty-nine of 51 (96%) hair specimens from RTR were positive for EV/cutaneous HPV types, as were 27 of 54 Multifocal distribution of cutaneous human (50%) specimens from immunocompetent non-RTR. In HPV- papillomavirus types in hairs from different positive hair specimens from RTR or non-RTR, single infec- skin areas tions were present in 10 of 49 (20%) and 11 of 27 (41%) and multiple infections (up to seven types) in 39 of 49 DOI: 10.1111/j.1365-2133.2007.07809.x (80%) and 16 of 27 (59%), respectively. Patterns of EV/cutaneous HPV types differed between patients but were similar in SIR, A causal relationship of genital human papillomaviruses hairs of different regions from the same patient, both in sun- (HPV) with the pathogenesis of cervical cancer has been estab- exposed and in nonsun-exposed skin areas. Between one and lished, and cutaneous HPV types seem to be involved in cuta- six HPV types were consistently present in hairs from more neous squamous cell carcinoma (SCC).1–3 HPV types originally than three regions examined from all RTR and four non-RTR. detected in skin lesions of patients with Epidermodysplasia The mean numbers of HPV types in all specimens and in verruciformis (EV) were found in hairs from eyebrows, legs viral-positive hair specimens were higher at sun-exposed sites and arms isolated from healthy volunteers and immunosup- vs. nonsun-exposed sites both in RTR (3Æ0 vs. 2Æ9 and 3Æ2 vs. pressed renal transplant recipients (RTR).4 Thus, hair follicles 3Æ0) and in non-RTR (2Æ0 vs. 1Æ4 and 3Æ8 vs. 2Æ8), but the dif- seem to be the reservoir of EV-associated HPV types, and the ferences were statistically not significant (Table 1). presence of HPV DNA in eyebrow hairs was associated with a Boxman et al.4 analysed for the first time EV/cutaneous HPV history of cutaneous SCC.5 Eyebrow hairs are easier to collect types in hairs from eyebrows, arms and legs of 26 RTR and than normal skin tissues and may be useful to monitor the 22 healthy volunteers. EV/cutaneous HPV types were detected HPV types present in each individual. However, whether eye- in 92% of RTR and 45% of healthy volunteers. In our study, brow hairs represent the HPV types present in each individual similar numbers of EV/cutaneous HPV-positive hairs were independent of the skin area and the immune status has not found in RTR and non-RTR. In another study, genital HPV been examined in detail. Here, we describe a comprehensive types were present in hair specimens from the pubic (36%) analysis of hairs from six different regions including sun- and perianal regions (50%) and were absent in eyebrow hairs exposed and nonsun-exposed areas from nine RTR and nine of 25 patients with genital warts.9 In contrast, EV HPV types

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 ora Compilation Journal 07TeAuthors The 2007

Table 1 Detection of 24 Epidermodysplasia verruciformis/cutaneous and 37 genital types of human papillomavirus (HPV) in hairs from different skin areas of renal transplant recipients (RTR) and immunocompetent patients (non-RTR)

HPV types in hairs HPV types present in 07BiihAscaino Dermatologists of Association British 2007 Sun-exposed sites Nonsun-exposed sites Sex/age TC At least All regions Patient (years) (years) Head Eyebrow Arm Trunk Leg Pubic region four sites examined RTR 1 M/69 2 23, 36, 37 23, 36, 37, (40) ND 23, 36, 37, 50 23, 36, 37, 50 23, 36, 37 23, 36, 37 23, 36, 37 2 M/44 16 9, 14, 17 14, 17 8, 9, 14, 17 8, 9, 14, 17 8, 9, 17 8, 9, 14, 17 8, 9, 14, 17 17 3 M/60 21 9, 15, 24 15, 20, 21, 23, 24 9, 15, 20, 21, 15, 20, 21, 24 15, 20, 21, 24, 25 9, 15, 20, 21, 15, 20, 21, 24 15, 24 23, 24, 36 24, 25 4 M/53 22 8, 9, 15, 17 8, 17, 50, (51) 8, 15, 50 8, 15, 17, 24, 50 ) 88 ) 5 F/61 4 5 5 ND 5 (52) 5 5 ) 6 M/59 16 14, 23 8, 14, 15, 23 ND 23 8, 15, (33) 23 23 ) 7F/5318 ) 9, 12, 14, 20, 23, 20, 25 23, 25, (70) 12, 20, 25, 38 20, 25 20, 25 ) 25, (16) • rts ora fDermatology of Journal British 8 M/69 19 37 37 15, 37 37 23, 37 23, 37 37 37 9 M/50 24 8, 15, 23 8, 9, 20, 23 8, 15, 23 8, 20, 23, 38 8, 9, 14, 20, 23 8, 14, 23, 38 8, 23 8, 23 Mean age 57Æ6 years Mean number of HPV types: Mean number of HPV types: Mean ± SD TC 15Æ8±7Æ3 years All specimens: 3Æ0 (73/24) All specimens: 2Æ9 (78/27) (NS)a Total HPV positive: 49/51 (96%) Only HPV positives: 3Æ2 (73/23) Only HPV positives: 3Æ0 (78/26) (NS) Non-RTR 10 M/71 14, 15, 37, 50 14, 15, 37 14, 15, 37, 50 14 14, 15, 21, 50 14 14, 15 14 11 M/72 5, 19, 20, 21, 37 5, 19, 20, 37 5, 37 19 ) 19 19 ) 2007 12 M/41 )))))15 )) 13 M/75 12, 15, 19, 23 8, 12, 14, 15, 8, 12, 14, 15, 8, 12, 14, 15, 23 8, 12, 14, 15, 8, 12, 14, 15, 8, 12, 14, 12, 15, 23 156, 19, 23 17, 19, 23 17, 19, 23 17, 19, 23 15, 19, 23 )) )))) pp1045–1092 14 M/53 15 15 15 F/44 )))))))) 16 M/63 23 ))))))) 17 F/53 )))) 15 )) ) 18 F/50 5, 15, 19, 20, 24, 38 5, 12, 15, 20, 23 15 12, 15, 19, 20, 23, 38 ) 515) Mean age 58 years Mean number of HPV types: Mean number of HPV types: a Total HPV positive: 27/54 (50%) All specimens: 2Æ0 (53/27) All specimens: 1Æ4 (37/27) (NS) Correspondence Only HPV positives: 3Æ8 (53/14) Only HPV positives: 2Æ8 (37/13) (NS)

aStatistical analysis was performed using the Wilcoxon, Mann and Whitney U-test. Genital HPV types are shown in parentheses. TC, time after transplantation; ND, not determined; ), HPV negative; NS, not significant. 1079 1080 Correspondence were detected in hairs from the eyebrow (62%) and pubic high-throughput identification of human papillomavirus genotypes. region (62%), showing that EV types are present at different J Clin Microbiol 2002; 40:779–87. regions of the body. We detected EV/cutaneous HPV types in 9 Boxman ILA, Hogewoning A, Mulder LHC et al. Detection of human papillomavirus types 6 and 11 in pubic and perianal hair from hair specimens from sun-exposed sites (head, eyebrow and patients with genital warts. J Clin Microbiol 1999; 37:2270–3. arm) and nonsun-exposed sites (trunk, leg and pubic region) both in RTR and in immunocompetent patients. Genital HPV Conflicts of interest: none declared. types were only found sporadically in some regions from RTR, showing that EV/cutaneous rather than genital types were multifocally distributed. Furthermore, each patient had an individual pattern of EV/cutaneous HPV types but similar types were present in different skin areas from the same Sunscreens and thyroid function in humans patient. Thus, eyebrow hairs contain the predominant EV/ after short-term whole-body topical cutaneous HPV types present in individuals and can be used to application: a single-blinded study monitor HPV infections, particularly in case–control studies. DOI: 10.1111/j.1365-2133.2007.07803.x Acknowledgments SIR, The three sunscreens benzophenone-3 (BP-3), 3-(4-methyl- We are grateful to E.-M. de Villiers for providing plasmid benzylidene) camphor (4-MBC) and octylmethoxycinnamate clones for HPV 4, 5, 8, 37, 38, 48 and 65, and to G. Orth for (OMC) are widely used in commercial sun protection products providing plasmid clones for HPV 9, 12, 14, 15, 17, 19–25, at a maximum use concentration of 10% for OMC and BP-3 and 36, 49 and 50. This work was supported by a grant of the 4–6% for 4-MBC in the European Union. All three compounds DKH, Germany (grant no. 70-2588). have shown to have oestrogenic effects in vitro and in animal studies.1 We recently reported in the same groups included in Department of Dermatology, Charite´, A. KO¨ HLER this study a substantial systemic absorption and urinary excre- Skin Cancer Center Charite´, T. FORSCHNER tion of the three sunscreens in men and postmenopausal women University Hospital of Berlin, Charite´platz 1, T. MEYER* after whole-body topical application; no effect was observed on 2 D-10117 Berlin, Germany C. ULRICH the levels of reproductive hormones. However, recent studies *Institute of Pathology and Molecular Biology, M. GOTTSCHLING in rats have demonstrated a direct effect on thyroid hor- D-22339 Hamburg, Germany E. STOCKFLETH mone synthesis by OMC and 4-MBC after 12 weeks of oral 3,4 Correspondence: I. Nindl. I. NINDL treatment. E-mail: [email protected] We now investigate for the first time whether the three sunscreens BP-3, OMC and 4-MBC have any effect on the hypo- References thalamic–pituitary–thyroid axis in humans after whole-body topical application. 1 International Agency for Research on Cancer. Human Papillomaviruses. In this 2-week single-blinded study approved by the ethics IARC Monographs on the Evaluation of Carcinogenic Risks to committee of Copenhagen and Frederiksberg [No. (KF) 11– Humans, No. 64. Lyon: IARC, 1995. 088/03], 15 young men (age range 23–29 years, mean 26) 2 Pfister H. Human papillomavirus and skin cancer. J Natl Cancer Inst and 17 postmenopausal women (age range 54–86 years, mean Monogr 2003; 31:52–6. 3 Akgul B, Cooke JC, Storey A. HPV-associated skin disease. J Pathol 65) were assigned to daily whole-body topical application )2 2006; 208:165–75. (2 mg cm ) of basic cream in week 1 and with a mixture of 4 Boxman ILA, Berkhout RJM, Mulder LHC et al. Detection of human the three sunscreens at 10% (w/w) each in week 2. The daily papillomavirus DNA in plucked hairs from renal transplant recipi- mean ± SD amount of cream applied over 4 days for each ents and healthy volunteers. J Invest Dermatol 1997; 108:712–15. subject was 40 ± 3 g for men and 35 ± 3 g for women. All 5 Struijk L, Bouwes Bavinck JN, Wanningen P et al. Presence of subjects were healthy and not taking any regular medication. human papillomavirus DNA in plucked eyebrow hairs is associated Thyroid and postmenopausal status was verified about 4 weeks with a history of cutaneous squamous cell carcinoma. JInvestDermatol 2003; 121:1531–5. before enrolment, with a blood test. Hormone levels were 6 Brink AA, Lloveras B, Nindl I et al. Development of a general- measured by commercially available automated immunoassay primer-PCR-reverse-line-blotting system for detection of beta and systems. Normal distribution of data was verified by a Kol- gamma cutaneous human papillomaviruses. J Clin Microbiol 2005; mogorov–Smirnov test and P-values were calculated with a 43:5581–7. paired t-test. ¨ 7 Dang C, Kohler A, Forschner T et al. E6/E7 expression of human We observed no biologically significant effects on hormone papillomavirus types in cutaneous squamous cell dysplasia and levels, indicating that the concentrations of sunscreen com- carcinoma in immunosuppressed organ transplant recipients. Br J Dermatol 2006; 155:129–36. pounds absorbed were not capable of disturbing the homeo- 8 van den Brule AJC, Pol R, Fransen-Daalmeijer N et al. GP5+/6+ stasis of thyroid hormones in adult humans. Minor but PCR followed by reverse line blot analysis enables rapid and statistically significant differences in hormone levels between

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1081

TBG TSH

400 2·0

350 1·5 –1 –1

L 300

L 1·0 250 miu nmol 200 0·5

150 0·0

0 1 2 3 4 24 48 72 96 0 1 2 3 4 24 48 72 96 h h

T4 FT4 110 15·5 15·0 * 100 14·5 14·0 –1

–1 13·5 L

90 L 13·0 80 12·5 pmol

nmol 12·0 11·5 70 11·0 10·5 Fig 1. Mean ± SD serum concentrations of 60 10·0 0 1 2 3 4 24 48 72 96 hormones in men during the week of 0 1 2 3 4 24 48 72 96 h treatment with control cream (open circles) h and with cream containing sunscreens (ﬁlled T3 FT3 5·5 circles). Signiﬁcant differences in hormone 2·0 ** levels at the same time points between the 1·8 5·0 * * ** –1 –1 L two weeks are indicated by *P <0Æ05, L 1·6 4·5 **P <0Æ01. Differences were compared using 1·4 4·0 nmol a paired t-test. TBG, thyroxine-binding pmol 3·5 globulin; TSH, thyroid-stimulating hormone; 1·2 T4, total thyroxine; FT4, free thyroxine; 1·0 3·0 T3, total triiodothyronine; FT3, free 0 1 2 3 4 24 48 72 96 0 1 2 3 4 24 48 72 96 h h triiodothyronine.

the two weeks were observed in free thyroxine (FT4), free tri- orally with OMC and 4-MBC. Hence, average highest total iodothyronine (FT3) and total triiodothyronine (T3) for men intake of 4-MBC can be estimated to be above 26 g per ani- (Fig. 1) and in thyroxine-binding globulin (TBG), FT4, FT3, mal during this period, which is > 10% of the animals’ body total thyroxine (T4) and T3 for women (Fig. 2). These differ- weight. However, recent studies6,7 showed that after single ences did not seem to be related to the exposure to sunscreens oral and topical administration of 4-MBC to rats and humans and at least some of these statistically significant differences a higher concentration of 4-MBC was measured in rats and between the two weeks may be chance findings due to mass humans after topical administration as compared with rats significance (when six different hormones are tested at seven after oral administration. This is due to an extensive first-pass different time-points in both genders approximately four sig- metabolism in the liver and/or gut wall. The authors also esti- nificant findings can be expected just by chance when using a mated that < 1% of 4-MBC is absorbed in humans. In the significance level of 0Æ05). Normal biological variations in light of these findings the authors concluded that the extent of hormone levels may have contributed to some of the differ- hormonal effects of 4-MBC in rodents depends on bioavail- ences. This is supported by the fact that FT4 and T3 in both ability of 4-MBC, and the extent of formation of metabolites genders and FT3 in men and TBG and T4 in women were and oral toxicity of 4-MBC are less relevant as a basis for generally at a higher level during the control week and before human health risk assessment, given that the major pathway the first application of the active formulation. There was no of 4-MBC exposure for humans is dermal. Furthermore, under ) effect on the thyroid-stimulating hormone (TSH) levels and natural conditions humans use sunscreens at < 2 mg cm 2, ) additionally we did not observe any increase in the T4 or T3 typically between 0Æ5 and 1Æ5mgcm 2, which gives lower level in either gender. Oestrogen is known to increase exposure concentrations and lower doses in comparison with serum TBG concentrations, thereby increasing serum T4 our study.8 concentrations. Serum FT4 concentrations, however, remain We applied all three sunscreen compounds simultaneously normal.5 We did not observe any of these effects in either and might expect an additive or possibly even a synergistic gender. effect. The above findings may indicate that adult humans In terms of exposure, our short-term study is not compar- have a high threshold for regulation of thyroid hormone levels able with the rat studies,3,4 as animals were fed for 12 weeks in terms of sunscreen use, which is in accordance with the

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1082 Correspondence

TBG TSH 400 3·5 ** 350 3·0 2·5 –1 –1 L 300

L 2·0

250 1·5 miu nmol 1·0 200 0·5 150 0·0 0 1 23424 48 72 96 0 1 2 3 4 24 48 72 96 h h

T4 FT4 120 * * 16 110 * * 15 *

–1 100 –1

L 14

L 90 13 nmol

80 pmol 12

70 11 60 10 Fig 2. Mean ± SD serum concentrations of 0 1 2 3424 48 72 96 0 1 2 3 4 24 48 72 96 h h hormones in women during the week of treatment with control cream (open squares) T3 FT3 and with cream containing sunscreens (ﬁlled 2·00 6 * 1·75 * * squares). Signiﬁcant differences in hormone 5 levels at the same time points between the

–1 1·50 –1 L

L two weeks are indicated by *P <0Æ05, 1·25 4 **P <0Æ01. Differences were compared using nmol

1·00 pmol 3 a paired t-test. TBG, thyroxine-binding 0·75 globulin; TSH, thyroid-stimulating hormone; 0·50 2 T4, total thyroxine; FT4, free thyroxine; 0 1 23424 48 72 96 0 1 23424 48 72 96 h h T3, total triiodothyronine; FT3, free triiodothyronine.

fact that treatment of postmenopausal women with conjugated application and reproductive hormone levels in humans. J Invest Der- oestrogens caused a significant rise in TSH, while the FT4 matol 2004; 123:57–61. index remained unchanged.5 Furthermore, another study 3 Schmutzler C, Hamann I, Hofmann PJ et al. Endocrine active compounds affect thyrotropin and thyroid hormone levels in serum as showed that four oral contraceptives had only minor effects well as endpoints of thyroid hormone action in liver, heart and kid- on thyroid function with a rise in T4 and T3 in young ney. Toxicology 2004; 205:95–102. women (age range 18–35 years), indicating that thyroid 4 Seidlova-Wuttke D, Christoffel J, Rimoldi G et al. Comparison of function is not, or is only slightly affected by, oral contracep- effects of estradiol with those of octylmethoxycinnamate and tives.9 Alternatively, the tested sunscreen compounds have a 4-methylbenzylidene camphor on fat tissue, lipids and pituitary very low potency for hormone disruption in this short-term hormones. Toxicol Appl Pharmacol 2006; 214:1–7. study. 5 Marqusee E, Braverman LE, Lawrence JE et al. The effect of droloxif- ene and estrogen on thyroid function in postmenopausal women. J Clin Endocrinol Metab 2000; 85:4407–10. Department of Dermatology, N.R. JANJUA 6 Vo¨lkel W, Colnot T, Schauer U et al. Toxicokinetics and Bispebjerg Hospital, DK-2400 Copenhagen, Denmark B. KONGSHOJ biotransformation of 3-(4-methylbenzylidene) camphor in rats *Department of Biostatistics, University of J.H. PETERSEN* after oral administration. Toxicol Appl Pharmacol 2006; 216:331– Copenhagen, Copenhagen, Denmark H.C. WULF 8. E-mail: [email protected] 7 Schauer UM, Vo¨lkel W, Heusener A et al. Kinetics of 3-(4-methylbenzylidene) camphor in rats and humans after dermal application. Toxicol Appl Pharmacol 2006; 216:339–46. References 8 Diffey B. Sunscreen isn’t enough. J Photochem Photobiol B 2001; 64:105–8. 1 Schlumpf M, Smid P, Durer S et al. Endocrine activity and develop- 9 Wiegratz I, Kutschera E, Lee JH et al. Effect of four oral contracep- mental toxicity of cosmetic UV filters – an update. Toxicology 2004; tives on thyroid hormones, adrenal and blood pressure parameters. 205:113–22. Contraception 2003; 67:361–6. 2 Janjua NR, Mogensen B, Andersson A-M et al. Systemic absorption of the sunscreens benzophenone-3, octylmethoxycinnamate, and Conflicts of interest: none declared. 3-(4-methyl-benzylidene) camphor after whole-body topical

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1083

Table 1 Diagnostic criteria for drug-induced hypersensitivity syndrome (DIHS) established by a Japanese consensus group6 The diagnosis of a DRESS syndrome has been sufficiently established on the basis of typical 1 Maculopapular rash developing > 3 weeks after starting clinical features and viral reactivations with a limited number of drugs 2 Prolonged clinical symptoms 2 weeks after discontinuation of DOI: 10.1111/j.1365-2133.2007.07807.x the causative drug 3 Fever (> 38 C) ) 4 Liver abnormalities (alanine aminotransferase > 100 U L 1)a SIR, We read with great interest the article entitled ‘Variability 5 Leucocyte abnormalities (at least one present) in the clinical pattern of cutaneous side-effects of drugs with ) a Leucocytosis (> 11 · 109 L 1) systemic symptoms: does a DRESS syndrome really exist?’ by b Atypical lymphocytosis (> 5%) 1 ) Peyrie`re et al. Based on data collected retrospectively from the c Eosinophilia (> 1Æ5 · 109 L 1) French Pharmacovigilance database, the authors concluded that 6 Lymphademopathy the acronym ‘DRESS’ is both inaccurate and quite imprecise 7 Human herpesvirus 6 reactivation with no clear definition regarding both cutaneous and system- The diagnosis is confirmed by the presence of the seven cri- ic signs. We believe, however, that many of the authors’ con- teria above (typical DIHS) or of the five (1~5) (atypical DIHS). siderations are in contrast to the current knowledge about this aThis can be replaced by other organ involvement, such as syndrome and may be based on misinterpretations of these renal involvement. data probably due to their unawareness of several important findings uniquely observed in this syndrome. Thirty years ago, the rules concerning the diagnosis of this syndrome had for the most part been formulated by non- ling the criteria of DIHS may represent those with a more dermatologists who defined this disease in terms of each severe form of DRESS. organ involvement. As a result, sufficient attention had not Based on these findings, we concluded that HHV-6 reactiva- been paid to the cutaneous features of this syndrome. In tion may be used to confirm a clinical diagnosis. Although there 1996, Bocquet et al.2 coined the term ‘drug rash with eosino- exists considerable clinical heterogeneity at onset even among philia and systemic symptoms’ (DRESS) for this syndrome to patients in whom HHV-6 reactivations can be detected, a fol- encompass these diverse clinical presentations. Subsequently, low up several months after onset reveals a strikingly homo- during the past 10 years, the clinical spectrum of this syn- geneous clinical and biological profile: the other six criteria drome was defined: there have been no significant differences could be seen in sequence in all patients showing HHV-6 re- in the clinical findings of these cases reported under the name activation when they were followed up for a sufficient length of DRESS. The lack of a specific and sensitive diagnostic test, of time. By the time our papers were published in 1998,3,4 however, was a major obstacle to correct identification of all the link between this syndrome and HHV-6 reactivation was patients with this syndrome. In this regard, my group and well established in Japan. However, concern has been raised Hashimoto’s group independently demonstrated that human about the appropriateness of the criteria as a clinical tool to herpesvirus 6 (HHV-6) can be reactivated at a particular time identify patients with this syndrome, because the timing of point, namely 2–3 weeks after onset of rash in the vast major- sampling for detecting the rise in HHV-6 IgG levels is critical: ity of patients with this syndrome, despite the diverse clinical unless sampling is performed at the right time, HHV-6 reacti- presentations at onset: HHV-6 reactivation as evidenced by the vation can be easily missed. Thus, the concept of an atypical rise in HHV-6 IgG titres and HHV-6 DNA levels commonly syndrome can be used for patients with typical clinical presen- occurs 2–3 weeks after onset regardless of treatment.3–6 tations, in whom HHV-6 reactivation cannot be detected In 2006, we, a Japanese consensus group, established a set probably due to inappropriate timing of sampling. Following of criteria for diagnosis of drug-induced hypersensitivity syn- wide acceptance of the criteria, there has been little disagree- drome (DIHS; Table 1), which have stood the test of time. ment among dermatologists about the diagnosis of this syn- Diagnosis of the typical syndrome requires all seven criteria. drome in patients with obvious findings. However, we should Importantly, our series of > 60 patients diagnosed by clinical bear in mind that the clinical criteria for this syndrome are findings has consistently shown that HHV-6 reactivation can not all present on any given day and that the severity of these be detected in the vast majority of patients who satisfy the clinical symptoms at onset provides only a guide to prognosis other six criteria and show clinical manifestations consistent and is not absolute: usually patients initially develop two or with those reported by Bocquet et al.,2 but not in those with three features of this syndrome followed by a step-wise devel- other types of drug eruption such as papulomacular rash, Ste- opment of other symptoms. Thus, a long-term follow up is vens–Johnson syndrome and toxic epidermal necrolysis; in needed to identify patients with this syndrome accurately. contrast, HHV-6 reactivation is rarely detected in patients with Because eosinophilia is seen at most in 60–70% of patients a tendency toward milder disease. These results will be repor- who satisfy the criteria, we propose that DRESS be replaced by ted by Tohyama and Hashimoto (Tohyama M and Hashimoto the term DIHS to avoid confusion due to the lack of consensus K, manuscript submitted). Thus, it appears that patients fulfil- in the literature about its terminology.5–7 Thus, the important

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1084 Correspondence criterion for the diagnosis of DIHS is the determination of References HHV-6 reactivation, regardless of whether this is a causal 1 Peyrie`re H, Dereure O, Breton H et al. Network of the French Phar- factor or a consequence of disease. Unfortunately, however, macovigilance Centers. Variability in the clinical pattern of cutane- Peyrie`re et al. did not specify this point in their patients, rais- ous side-effects of drugs with systemic symptoms: does a DRESS ing the possibility that they may have studied a very hetero- syndrome really exist? Br J Dermatol 2006; 155:422–8. geneous group of patients, presenting as a continuum from 2 Bocquet H, Bagot M, Roujeau JC. Drug-induced pseudolymphoma mild papulomacular rashes to full-blown DIHS. and drug hypersensitivity syndrome (drug rash with eosinophilia This syndrome has several unique features that cannot be and systemic symptoms: DRESS). Semin Cutan Med Surg 1996; explained solely by a drug-based aetiology: they include 15:250–7. 3 Suzuki Y, Inagi R, Aono T et al. Human herpesvirus 6 infection as a delayed onset in relation to introduction of the causative drug risk factor for the development of severe drug-induced hypersensi- and paradoxical worsening of clinical symptoms after discon- tivity syndrome. Arch Dermatol 1998; 134:1108–12. 6,8 tinuation of the causative drug. A major difficulty in estab- 4 Tohyama H, Yahata Y, Yasukawa M et al. Severe hypersensitivity lishing a correlation between causative drugs and the onset of syndrome due to sulfasalazine associated with reactivation of human this syndrome is such a long lag period before onset of clinic- herpesvirus 6. Arch Dermatol 1998; 134:1113–17. al symptoms. However, large series of patients from Japan 5 Hashimoto K, Yasukawa M, Tohyama M. Human herpesvirus 6 and revealed that the drugs responsible for the development of drug allergy. Curr Opin Allergy Clin Immunol 2003; 3:255–60. 6 Shiohara T, Inaoka M, Kano Y. Drug-induced hypersensitivity syn- DIHS are limited to eight drugs in the vast majority of drome (DIHS): a reaction induced by a complex interplay among patients: they include carbamazepine, phenytoin, phenobarbi- herpesviruses and antiviral and antidrug immune responses. Allergol tal, zonisamide, mexiletine, dapsone, sulfasalazine and allopur- Int 2006; 55:1–8. inol.8 Atypical cases caused by other drugs, although reported, 7 Kano Y, Inaoka M, Shiohara T. Association between anticonvulsant are much less common. hypersensitivity syndrome and human herpesvirus 6 reactivation The lack of a longitudinal study including viral load evalu- and hypogammaglobulinemia. Arch Dermatol 2004; 140:183–8. ation in the authors’ study may have made the unique clin- 8 Shiohara T, Kano Y. Drug-induced hypersensitivity syndrome and viral reactivation. In: Drug Hypersensitivity (Pichler W, ed.). Basel: ical entity of DIHS uncertain. Once the suspicion of DIHS Karger (in press). arises on the basis of initial history-taking and clinical pre- 9 Chiou C-C, Chung W-H, Hung S-L et al. Fulminant type 1 diabetes sentations, a thorough investigation of viral reactivations mellitus caused by drug hypersensitivity syndrome with human should follow. As the recognition of this syndrome as a herpesvirus 6 infection. J Am Acad Dermatol 2006; 54:S14–17. distinct clinical entity with highly reproducible clinical and laboratory features increases, it becomes clear that DIHS has Conflicts of interest: none declared. potential long-term complications, such as type 1 diabetes mellitus,9 even after disease-free intervals of months or years. The diagnosis is unlikely to be missed if the possibility of this syndrome is considered in the differential diagnosis of any patients with fever, rash, lymphadenopathy and hepatitis, and if HHV-6 IgG titres are routinely examined at the right A case of herpes zoster in a child with time. HHV-6 reactivation would be the diagnostic marker for congenital insensitivity to pain with anhidrosis DIHS that is reliable and easy to determine on a routine basis. The incidence of this syndrome is much greater than DOI: 10.1111/j.1365-2133.2007.07804.x previously thought. If this unique disease is viewed only as a reaction pattern and a search for viral reactivations is SIR, During primary infection with varicella-zoster virus not made, the disease may remain idiopathic as it was in the (VZV), the virus ascends the sensory nerve from the skin sen- past. sory nerve ending to which it disseminates through viraemia, and migrates up the dorsal root and trigeminal ganglia, where Department of Dermatology, Kyorin University T. SHIOHARA it usually remains latent for the lifetime of the individual. School of Medicine, 6-20-2 Shinkawa, Mitaka, M. IIJIMA* When VZV-specific cellular immunity is reduced, the latent Tokyo 181-8611, Japan Z. IKEZAWA VZV is reactivated, descends the sensory nerve, reaches the 1,2 *Department of Dermatology, Showa University K. HASHIMOTO skin, and causes herpes zoster. In this paper, we describe a School of Medicine, Shinagawa, case of herpes zoster associated with congenital insensitivity to Tokyo 142-5666, Japan pain with anhidrosis (CIPA). Department of Dermatology, A 3-year-old boy with CIPA had developed varicella at Yokohama City University School of Medicine, 2 months of age. His elder brother has CIPA, and his par- Yokohama, Kanagawa 236-0004, Japan ents and a sister are normal. Vesicles were distributed in the Department of Dermatology, right alinasal region 2 days before presentation, and had Ehime University School of Medicine, gradually deteriorated. Oedematous erythema with a clear Onsen-gun, Ehime 791-0295, Japan boundary and grouped vesicles were noted in the region E-mail: [email protected] below the right nasal foramen, over the right cheek and

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1085

In an axon reflex test with intradermal injection of histamine, a weal response was observed, but a diffuse area of erythema corresponding to a flare response was not observed. Based on the diagnosis of herpes zoster, the patient was treated with an intravenous drip infusion of aciclovir and application of vidarabine ointment, and the symptoms improved. CIPA is an autosomal recessive disorder characterized by recurrent episodic fevers, anhidrosis, an absence of reaction to noxious stimuli, self-mutilating behaviour and mental retardation,3,4 and is classified as a type IV hereditary sensory and autonomic neuropathy.4,5 Sweat glands are present on skin biopsy of CIPA, and electron microscopic6 and immunohistological7 studies have shown the absence of innervation of eccrine sweat glands, which could explain the anhidrosis. Rafel et al.8 reported that a biopsy of the cutaneous branch of the radial nerve showed an almost complete absence of small myelinated and unmyelinated nerve fibres (Ad and C fibres) that transmit pain and temperature sensation. TRKA (NTRK1), which encodes the receptor tyrosine kinase for nerve growth factor (NGF), is the gene responsible for CIPA.9 Defects in NGF signal transduction at its receptor lead to failure to survive as various NGF-dependent neurones are not maintained, most probably due to apoptosis during development.5,9 Skin biopsy was performed in this patient, and the secretory region of eccrine sweat glands was noted on haematoxylin and eosin staining, suggesting the possibility that the Fig 1. Clinical appearance, showing oedematous erythema with a cause of anhidrosis was the absence of sweat gland-innervat- clear boundary and grouped vesicles. ing nerves. In the axonal reflex test of a normal control, the redness of the flare surrounding the site of the acute injury to anterior to the ear (Fig. 1). The lesions were characteris- the skin was due to arteriolar dilation and an increase in vas- tically localized to the trigeminal nerve-innervated region cular permeability through C fibres.10 The occurrence of a (maxillary region). weal without a flare reaction in the surrounding area, as seen Results of laboratory investigations showed a white cell in this patient, indicates that C fibres are absent. Peripheral ) count of 6Æ5 · 109 L 1 with 2Æ0% atypical lymphocytes, and nerve localization was investigated immunohistologically using the antibody titres by enzyme immunoassay were: VZV IgG several antibodies to nerve tissue-related substances, but no 70Æ9 (+) (normal 0–1Æ9); VZV IgM 0Æ85 (±) (normal apparent positive reactions were noted at the light micro- 0–0Æ79); herpes simplex virus (HSV) IgG 2Æ0()) (normal scopic level. As the presence or absence of nerve fibres was 0–2Æ0); and HSV IgM 0Æ36 ()) (normal 0–0Æ79). not investigated by electron microscopy in this case, the ques- Multinucleated giant cells were noted on Tzanck smear. tion remains whether peripheral nerves were completely Biopsy of a vesicular skin lesion showed intraepidermal bullae. absent. Although nerves are lost due to apoptosis in CIPA, Necrotic, acantholytic keratinocytes with ballooning degener- considering that the patient was only 3 years old, the possibil- ation were seen at the floor of the vesicle. Typical multinucle- ity of the presence of residual nerves that had partially lost ated giant cells and eosinophilic inclusion bodies were not their function cannot be excluded. It is interesting how VZV noted. Eccrine gland secretory regions were present, but the infects epidermal cells and causes herpes zoster, but the presence of sweat ducts was unclear. Arrector muscles of hairs mechanism remains unclear. were present. Immunostaining was performed to examine the presence of viruses and peripheral nerves. VZV, HSV, neurone- Acknowledgments specific enolase, serotonin, calcitonin, somatostatin, vasoactive intestinal polypeptide, protein gene product 9Æ5 and substance P We thank the Department of Anesthesiology, Saga University were negative, while nerve fibres were positive in the control Faculty of Medicine, for performing the sweating test in this skin. patient, and Dr Yasuhiro Indo, Department of Pediatrics, VZV was identified by virus isolation. In the sweating test, Kumamoto University School of Medicine, for providing us no sweating was noted in the dorsal region or bilateral palms. with literature.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1086 Correspondence

Division of Dermatology, Department of M. OGATA Internal Medicine, Saga University N. MISAGO Faculty of Medicine, Nabeshima 5-1-1, Y. SUZUKI Saga 849-8501, Japan N. HIRASHIMA E-mail: [email protected] T. INOUE M. YAMASAKI Y. NARISAWA

References

1 Gershon AA, Takahashi M, Seward J. Varicella vaccine. In: Vaccines (Plotkin SA, Orenstein WA, eds), 4th edn. Philadelphia: W.B. Saunders, 2003; 783–824. 2 Arvin AM. Varicella-zoster virus. In: Fields Virology (Knipe DM, How- ley PM, Griffin DE et al., eds), 4th edn. Philadelphia: Lippincott Williams & Wilkins, 2001; 2731–67. 3 Swanson AG. Congenital insensitivity to pain with anhidrosis. A unique syndrome in two male siblings. Arch Neurol 1963; 8:299– 306. 4 Dyck PJ. Neuronal atrophy and degeneration predominantly affecting peripheral sensory and autonomic neurons. In: Peripheral Neuro- pathy (Dyck PJ, Thomas PK, Griffin JW et al., eds), 3rd edn. Philadelphia: W.B. Saunders, 1993; 1065–93. 5 Indo Y. Genetics of congenital insensitivity to pain with anhidrosis (CIPA) or hereditary sensory and autonomic neuropathy type IV. Clinical, biological and molecular aspect of mutations in TRKA (NTRK1) gene encoding the receptor tyrosine kinase for nerve growth factor. Clin Auton Res 2002; 12 (Suppl. 1):I20–32. Fig 1. Perfectly formed spiral of pus in the patient’s right ring finger 6 Langer J, Goebel HH, Veit S. Eccrine sweat glands are not inner- nail bed. vated in hereditary sensory neuropathy type IV. An electron-microscopic study. Acta Neuropathol 1981; 54:199–202. 7 Nolano M, Crisci C, Santoro L et al. Absent innervation of skin and sweat glands in congenital insensitivity to pain with anhidrosis. pustular psoriasis characterized by pustules, skin atrophy, ony- Clin Neurophysiol 2000; 111:1596–601. chodystrophy and osteolysis. Over the years, she received top- 8 Rafel E, Alberca R, Bautista J et al. Congenital insensitivity to pain with anhidrosis. Muscle Nerve 1980; 3:216–20. ical and systemic therapies including psoralen plus ultraviolet 9 Indo Y, Tsuruta M, Hayashida Y et al. Mutations in the TRKA/NGF A (PUVA), methotrexate, oral retinoids plus PUVA, and receptor gene in patients with congenital insensitivity to pain with ciclosporin but her disease increased in severity, limiting her anhidrosis. Nat Genet 1996; 13:485–8. ability to walk or dress herself. In 2001, she commenced 10 Izumi H, Karita K. Investigation of mechanisms of the flare and anti-tumour necrosis factor (TNF)-a antibody, infliximab in wheal reactions in human skin by band method. Brain Res 1988; combination with methotrexate. Her condition cleared but in- 449:328–31. creasing antinuclear antibody and liver enzyme levels necessitated discontinuing treatment. On stopping infliximab, she Conflicts of interest: none declared. developed generalized pustular psoriasis. She recently commenced adalimumab, a fully humanized monoclonal IgG antibody to TNF-a, anecdotally successful in treating recalcitrant acrodermatitis continua of Hallopeau. At a recent clinic, we noted a perfectly formed spiral of pus in her right ring finger nail bed (Fig. 1), of which the patient was unaware. Life imitating art City of Dublin Skin and Cancer Hospital, F.J. MOLONEY Hume Street, Dublin, Ireland S. ROGERS DOI: 10.1111/j.1365-2133.2007.07811.x E-mail: [email protected]

SIR, Cox et al., in their recent correspondence, illustrated at a microscopic level how life can imitate art.1 We describe a fur- Reference ther clinical example in a 72-year-old woman attending the 1 Cox NH, Dawn G, Gangopadhyay M. ‘The Scream’ relocated by skin City of Dublin Skin and Cancer Hospital since 1998 with a histopathology. Br J Dermatol 2006; 155:1304–5. recurrent pustular eruption affecting her ﬁngers and toes. The diagnosis was acrodermatitis continua of Hallopeau, a form of Conﬂicts of interest: none declared.

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1087

(a) An unusual terminal hair growth on the nose tip associated with geﬁtinib therapy

DOI: 10.1111/j.1365-2133.2007.07816.x

SIR, The epidermal growth factor receptor (EGFR) pathway, a key driver in regulating normal epithelial cell growth and differentiation, also plays a role in promoting proliferation of malignant epithelial cells1 by increasing proliferation, adhesion and invasive capacity, and also by blocking apoptosis.1–4 For this reason, EGFR expression is associated with metastasis, late-stage disease, resistance to therapy and poor prognosis. Therapies targeting EGFR are now under development, such as antibodies to EGFR or EGFR-specific tyrosine kinase inhibitors. Gefitinib, also known as ZD 1839 or (b) Iressa, is a low-molecular-weight compound that inhibits the activation of EGFR tyrosine kinase through competitive binding of the receptor.1–4 A 65-year-old woman presented with a 2-month history of asymptomatic, brown to black hairs on the nose tip that had been gradually thickening and lengthening (Fig. 1). Six months before, she had been diagnosed with metastatic lung adenocarcinoma and had undergone treatment with radiotherapy (whole brain and femur, 3000 cGy · 2 cycles) and chemotherapy (docetaxel 100 mg daily every 3 weeks for 2 months). Two months before, she began treatment with gefitinib 250 mg daily. One week after starting treatment, she noticed tiny brown to black spots on her nose tip. Ever since, hairs have been growing at these sites. When she presented to our department, the hairs were 1–3 mm in length, localized to the nose tip. There were no vellus hairs, which normally there should be. There was no abnormality of hair density or length at other body sites. She denied a personal history of other cutaneous problems, trauma or administration of any drugs such as might induce hair growth. Skin biopsy revealed multiple hair follicles in anagen phase that were located in the superficial dermis (Fig. 2). The hair shaft

was 0Æ054 mm in diameter and was myelinated, indicative of terminal hair. There was also solar elastosis and a mild in- Fig 1. Multiple, dark brown to black hairs on the nose tip. ﬂammatory inﬁltrate in the papillary dermis. On the basis of

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1088 Correspondence

of epidermal growth factor. Acta Derm Venereol (Stockh) 2004; Fig 2. (a) Multiple terminal hair follicles in anagen phase in the 84:23–6. superficial dermis. (b) The hair shaft was myelinated and its diameter 3 Segaert S, van Cutsem E. Clinical signs, pathophysiology and was more than 0.03 mm. There was a Demodex folliculorum mite in management of skin toxicity during therapy with epidermal the follicular unit. Haematoxylin and eosin; original magnification: growth factor receptor inhibitors. Ann Oncol 2005; 16:1425– (a) · 40; (b) · 400. 33. 4 van Doorn R, Kirtschig G, Scheffer E et al. Follicular and epidermal alterations in patients treated with ZD1839 (Iressa), an inhibitor of the epidermal growth factor receptor. Br J Dermatol 2002; 147:598– these findings, the patient was diagnosed with terminal hair 601. growth associated with gefitinib and was recommended to 5 Agero AL, Dusza SW, Benvenuto-Andrade C et al. Dermatologic discontinue gefitinib. However, as the patient’s lung adeno- side effects associated with the epidermal growth factor receptor carcinoma had had a poor response to radiochemotherapy, inhibitors. J Am Acad Dermatol 2006; 55:657–70. gefitinib could not be discontinued and the hairs have con- 6 Bouche O, Brixi-Benmansour H, Bertin A et al. Trichomegaly of the tinued to grow. eyelashes following treatment with cetuximab. Ann Oncol 2005; 16:1711–12. Cutaneous eruptions that have been reported as associated 7 Pascual JC, Banuls J, Belinchon I et al. Trichomegaly following with gefitinib include acneiform eruption, seborrhoeic derma- treatment with gefitinib (ZD1839). Br J Dermatol 2004; 151:1111– titis-like facial rash, xerosis, desquamation of the distal parts 12. of the extremities, paronychia and ingrown nails, ulcer of the 8 Lee LW, Burt PA. Hair growth after gefitinib treatment. Clin Oncol oral or nasal mucosa and urticaria.1–3,5 2005; 17:492–3. In addition, changes of the hairs can be noticed. Very characteristic are long, curly, rigid eyelashes, so-called tricho- Conflicts of interest: none declared. megaly.6–8 The eyebrows also become thicker and more rigid, and hypertrichosis develops by the increase of small vellus hairs on the face and the female lip. Alternatively, the scalp hairs grow more slowly and adopt a finer, more brittle 5 and curly aspect. Such mild hair loss can also be seen on Milia and cutaneous leishmaniasis the arms or legs. To our knowledge, however, there has been no report on terminal hair growth in an area that nor- DOI: 10.1111/j.1365-2133.2007.07815.x mally shows only vellus hairs. It has been suggested that al- kip1 teration of p27 (negative growth regulator) may be the 1 SIR, I read with great interest the report by Walker et al. des- mechanism by which the EGFR inhibitor can affect follicular cribing milia following successful treatment of cutaneous and epidermal homeostasis.6 We speculate that this upregula- leishmaniasis in three children. We have observed a similar tion of p27kip1 which induces apoptosis and maturation of phenomenon in one child. A 10-year-old boy presented with hair follicles can transform vellus hairs into terminal ones. In a superficial and crusted plaque of the cheek (Fig. 1a). Direct our patient, terminal hair growth started shortly after com- examination of skin smears showed Leishmania amastigotes and mencement of gefitinib therapy. A complete regression or culture in special medium grew Leishmania further identified reversal of this growth could not be obtained because gefiti- as L. infantum. The boy had never travelled outside Southern nib could not be withdrawn due to disease progression of France; the leishmaniasis was therefore considered as an the lung adenocarcinoma. endemic cutaneous leishmaniasis.2,3 He was treated with Our purpose in reporting this case is to highlight the fact local intralesional sodium stibogluconate and the lesion that gefitinib can induce terminal hair growth, which healed within 15 days. Numerous firm monomorphic white should be kept in mind as one of the adverse effects of papules identified as milia developed within the scar gefitinib. (Fig. 1b). Southern France is endemic for visceral and cutaneous leish- Department of Dermatology, St Mary’s Hospital, S.Y. KIM maniasis caused by L. infantum. We have estimated the inci- College of Medicine, The Catholic H-J. CHOI dence of cutaneous leishmaniasis as 0Æ5 cases per million University of Korea, 62 Youido-dong, H.J. PARK persons per year.2,3 Milia seem to be a rare phenomenon in Youngdeungpo-ku, Seoul 150-713, Korea J.Y. LEE cutaneous leishmaniasis. They had not been observed previ- Correspondence: Jun Young Lee. B.K. CHO ously in cutaneous leishmaniasis caused by L. infantum. Our E-mail: [email protected] case confirms the report by Walker et al. showing that milia may follow a successful treatment of cutaneous leishmaniasis References caused by various species.

1 Mak KK, Chan SY. Epidermal growth factor as a biologic switch in hair growth cycle. J Biol Chem 2003; 278:26120–6. Dermatology and Infectious Disease Department, P. DEL G IUDICE 2 Lee MW, Seo CW, Kim SW et al. Cutaneous side effects in non-small Hoˆpital Bonnet, Fre´jus, France cell lung cancer patients treated with Iressa (ZD1839), an inhibitor E-mail: [email protected]

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 Correspondence 1089

(a) Type 2 segmental Cowden disease vs. Proteus syndrome

DOI: 10.1111/j.1365-2133.2007.07818.x

1 SIR, Loffeld et al. recently reported an unusual case of systematized epidermal naevus showing loss of heterozygosity (LOH) for a PTEN mutation. Because this 3-year-old boy had various additional anomalies including hydrocephalus, lipomas, cutis marmorata-like lesions of the legs and asymmetrical growth of limbs with unilateral macrodactyly, the authors categorized the case as an example of Proteus syndrome (PS). I should like to propose another name for this disorder. For the following reasons, the designation ‘type 2 segmental Cowden disease (CD)’ seems more appropriate. The patient’s mother had the same PTEN germline mutation as her son and clinical features of CD. Moreover, the authors found LOH for the PTEN mutation in DNA extracted from the epidermal naevus, which is why this disorder can undoubtedly be categorized as a type 2 segmental manifestation of CD. In autosomal dominant skin disorders, we can distinguish today two different types of mosaic manifestation.2 A type 1 segmental involvement reflects heterozygosity for the underlying mutation and shows a degree of severity corresponding to that encountered in the nonsegmental phenotype. By con- (b) trast, a type 2 segmental manifestation results from LOH in a heterozygous embryo. The degree of segmental involvement is far more pronounced and these lesions are superimposed on the ordinary, nonsegmental phenotype. This conception of dichotomous types of severity has recently been proven in Hailey–Hailey disease.3 The interesting case presented by Loffeld et al. can be taken as additional molecular confirmation of the concept in a family with CD. In classical cases of PS, a search for PTEN germline mutations has so far yielded negative results.4,5 Therefore, despite some clinical similarities, I advocate discriminating between PS and type 2 segmental CD. The following clinical criteria may help to distinguish the two phenotypes: (i) relatives of a Fig 1. (a) Ulcerated and crusted plaque (active cutaneous patient with type 2 segmental CD may be affected with non- leishmaniasis). (b) Scar with milia. segmental CD,1 whereas the relatives of a patient with PS tend to be phenotypically healthy; (ii) if patients with a type 2 segmental CD reach adulthood, they will develop, in addition, the disseminated, nonsegmental lesions of CD, because all of their cells harbour the underlying PTEN mutation. By contrast, References adult patients with PS will not develop features of CD. 1 Walker SL, Whittam L, Vega-Lopez F, Lockwood DNJ. Milia Future combined clinical and molecular research will most complicating successfully treated cutaneous leishmaniasis in three likely enable the establishment of additional diagnostic criteria children. Br J Dermatol 2006; 155:860–1. to distinguish the two phenotypes. In both disorders, the asso- 2 Del Giudice P, Marty P, Lacour JP et al. Cutaneous leishmaniasis due ciated nonorganoid epidermal naevi are of a soft, velvety type, to Leishmania infantum, case report and review. Arch Dermatol 1998; but the epidermal naevus associated with type 2 segmental CD 134:193–8. 1,6 3 Del Giudice P, Marty P, Lacour JP. La leishmaniose cutaneé auto- may be thicker and more papillomatous when compared 7 chtone. Ann Dermatol Venereol 2001; 128:1057–62. with that encountered in PS. The cerebriform hyperplasia of plantar connective tissue that, when present, constitutes a hall- Conflicts of interest: none declared. mark of PS,7 may turn out to be absent in type 2 segmental

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1090 Correspondence

CD. Conversely, the cutis marmorata-like skin lesions as he received no medication. He had a family history of arterial described by Loffeld et al.1 may be absent in PS. hypertension. Prior therapies for his psoriasis included ultra- We cannot so far discount that PS is a genetically hetero- violet (UV) A and narrowband UVB phototherapy, as well as geneous disorder. From a heuristic point of view, however, it topical steroids and topical calcipotriol cream. He had received seems appropriate to exclude cases of Proteus-like syndrome nonsteroidal anti-inflammatory drugs for the PsA. showing a PTEN germline mutation from the spectrum of PS Blood tests before the initiation of infliximab showed TG ) and to categorize them as examples of type 2 segmental CD. levels of 348 mg dL 1 (normal < 155), decreased high-density lipoprotein (HDL) cholesterol levels and normal total and low- Department of Dermatology, R. HAPPLE density lipoprotein (LDL) cholesterol levels. At week 2, before Philipp University of Marburg, the second infusion of infliximab, we observed a marked eleva- ) Deutschhaus-Str. 9, 35033 Marburg, Germany tion of TG levels (1129 mg dL 1) and a mild elevation of total, E-mail: [email protected] HDL and LDL cholesterol. The remaining laboratory values remained within normal range. References Despite the fact that both psoriasis and PsA had been significantly improved, infliximab had to be discontinued. Repeat 1 Loffeld A, McLellan NJ, Cole T et al. Epidermal naevus in Proteus blood tests taken a month after the discontinuation of inflix- syndrome showing loss of heterozygosity for an inherited PTEN mu- imab showed normal levels of total cholesterol and a decrease ) tation. Br J Dermatol 2006; 154:1194–8. in TG to approximately pretreatment levels (491 mg dL 1). 2 Happle R. A rule concerning the segmental manifestation of auto- Five months after the discontinuation of infliximab, TG levels somal dominant skin disorders: review of clinical examples provid- )1 ing evidence for dichotomous types of severity. Arch Dermatol 1997; were 437 mg dL , and total and LDL cholesterol levels were 133:1505–9. normal. There was a mild decrease in HDL cholesterol levels. 3 Poblete-Gutie´rrez P, Wiederholt T, Ko¨nig A et al. Allelic loss under- Psoriasis per se has been associated with abnormal plasma lies type 2 segmental Hailey–Hailey disease, providing molecular lipid metabolism, thus resulting in a more atherogenic profile, confirmation of a novel genetic concept. J Clin Invest 2004; which could be associated with the increased frequency of 114:1467–74. cardiovascular events observed with this disease.2,3 Diverse 4 Biesecker LG, Rosenberg MJ, Vacha S et al. PTEN mutations and Pro- findings in plasma lipid concentrations of patients with psoria- teus syndrome. Lancet 2001; 358:2079–80. 5 Barker K, Martinez A, Wang R et al. PTEN mutations are uncommon sis have been reported, such as a significant decrease in HDL in Proteus syndrome. J Med Genet 2001; 38:480–1. cholesterol, and an increase in both LDL cholesterol and very 6 Smith JM, Kirk EPE, Theodosopoulos G et al. Germline mutation of low-density lipoprotein TGs.2–4 As psoriasis is a genetic dis- the tumour suppressor PTEN in Proteus syndrome. J Med Genet 2002; order, there is a possibility that genetic alterations in the HDL 39:937–40. cholesterol and/or apolipoprotein A-I genes may be linked 7 Biesecker LG, Happle R, Mulliken JB et al. Proteus syndrome: diag- with this disease.4 nostic criteria, differential diagnosis, and patient evaluation. Am J Limited data suggest an increased cardiovascular mortality Med Genet 1999; 84:389–95. in PsA compared with the general population. This has Conflicts of interest: none declared. been attributed to the presence of various cardiovascular risk factors, such as smoking, abnormal lipid profile, hypertension, increased fibrinogen level, inflammation and hyperco- agulability.5 TNF-a plays an important role in lipid metabolism by decreasing the activity of 7a-hydroxylase and Elevated triglyceride and cholesterol levels lipoprotein lipase and by stimulating the liver production of after intravenous antitumour necrosis factor-a TGs.6,7 therapy in a patient with psoriatic arthritis Nevertheless, the effect of infliximab treatment on lipid lev- and psoriasis vulgaris els remains controversial. Decreased HDL cholesterol levels and no changes of TGs were reported in a group of patients DOI: 10.1111/j.1365-2133.2007.07835.x with rheumatoid arthritis (RA) treated with infliximab.8 Simi- larly, a significant decrease in HDL cholesterol levels and a SIR, Infliximab, a chimeric antitumour necrosis factor (TNF)-a mild rise in TG levels were reported in a different group of monoclonal antibody, has been shown to be effective in the patients with PsA and RA treated with infliximab.6 Another treatment of both psoriasis and psoriatic arthritis (PsA).1 We recent study, however, showed an increase in both total and report a patient who developed elevated triglyceride (TG) and HDL cholesterol after treatment with infliximab for RA, cholesterol levels after the administration of infliximab. although the atherogenic index was not influenced.9 A 35-year-old, nonobese man with a 2-year history of High levels of TNF-a have been linked to congestive heart severe, disabling PsA and a 7-year history of severe psoriasis failure (CHF) and atherosclerosis.7 However, in a study of ) vulgaris, was treated with infliximab 5 mg kg 1. He had a infliximab for severe CHF, mortality was increased in pati- medical history of hypertension and hyperuricaemia. He also ents treated with high-dose infliximab. No benefit, and no had a history of mild hypertriglyceridaemia for which increased mortality, was seen in the two larger clinical trials

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 News and Notices 1091 that evaluated etanercept as treatment for moderate to severe References CHF.7,10 Due to the lack of evidence of a beneficial effect of 1 Antoni CE, Kavanaugh A, Kirkham B et al. Sustained benefits of inflix- anti-TNF-a agents in treatment of CHF, it is recommended imab therapy for dermatologic and articular manifestations of psori- that they should be avoided in patients with New York Heart atic arthritis: results from the infliximab multinational psoriatic 7 Association class III or IV heart failure. arthritis controlled trial (IMPACT). Arthritis Rheum 2005; 52:1227–36. The effects of TNF-a blockers on incident cases of CHF in 2 Rocha-Pereira P, Santos-Silva A, Rebelo I et al. Dislipidemia and RA remain unclear.7 It has recently been shown that the risk oxidative stress in mild and in severe psoriasis as a risk for cardio- of developing first-time cardiovascular disease (CVD) is lower vascular disease. Clin Chim Acta 2001; 303:33–9. in patients with RA treated with infliximab or etanercept, 3 Skoczynska AH, Turzyn B, Barancewicz-Losek M et al. High-density lipoprotein cholesterol in patients with psoriatic arthritis. J Eur Acad compared with untreated patients with RA.10 However, limita- Dermatol Venereol 2003; 17:348–72. tions of this study were both the lack of information regard- 4 Reynoso-von Drateln C, Martinez-Abundis E, Balcazar-Munoz BR ing coexisting risk factors such as hyperlipidaemia, and the et al. Lipid profile, insulin secretion, and insulin sensitivity in absence of subgrouping of individual CVD events, as TNF psoriasis. J Am Acad Dermatol 2003; 48:882–5. inhibitors could have a differential effect on arterial thrombo- 5 Peters MJ, van der Horst-Bruinsma IE, Dijkmans BA et al. Cardiovas- embolic events and CHF.10 cular risk profile of patients with spondylarthropathies, particularly We report a new case of infliximab-induced hypertriglice- ankylosing spondylitis and psoriatic arthritis. Semin Arthritis Rheum 2004; 34:585–92. ridaemia and hypercholesterolaemia. To our knowledge, this 6 Cauza E, Cauza K, Hanusch-Enserer U et al. Intravenous anti TNF-a is the first case report of a patient with psoriasis and PsA antibody therapy leads to elevated triglyceride and reduced who developed such a marked increase in TG levels after HDL-cholesterol levels in patients with rheumatoid and psoriatic a single infusion of infliximab. The implication of infliximab arthritis. Wien Klin Wochenschr 2002; 114:1004–7. in the development of hyperlipidaemia is extremely likely, 7 Sarzi-Puttini P, Atzeni F, Doria A et al. Tumor necrosis factor-a, given the close temporal correlation between the onset of biologic agents and cardiovascular risk. Lupus 2005; 14:780–4. hyperlipidaemia and the time of infusion, coupled with its 8 Irace C, Mancuso G, Fiaschi E et al. Effect of anti TNF alpha therapy on arterial diameter and wall shear stress and HDL cholesterol. resolution following withdrawal of the drug. Atherosclerosis 2004, 177:113–18. Further studies are warranted on the effect of intravenous 9 Vis M, Nurmohamed MT, Wolbink G et al. Short term effects of anti-TNF-a therapy on lipid metabolism in patients with psor- infliximab on the lipid profile in patients with rheumatoid arthritis. iasis or PsA, together with its possible association with cardio- J Rheumatol 2005; 32:252–5. vascular risk. 10 Jacobsson LTH, Turesson C, Gulfe A et al. Treatment with tumor necrosis factor blockers is associated with a lower incidence of first cardiovascular events in patients with rheumatoid arthritis. Department of Dermatology, A. Syngros Hospital, C. ANTONIOU J Rheumatol 2005; 32:1213–18. University of Athens, Athens, Greece C. DESSINIOTI Correspondence: Clio Dessinioti. A. KATSAMBAS Conflicts of interest: none declared. E-mail: [email protected]; [email protected] A.J. STRATIGOS

– Psoriasis in children and pregnancy News and Notices – Difﬁcult to treat localisations – Topical Treatment: what to choose and how to use DOI: 10.1111/j.1365-2133.2007.07958.x – Risk management and treatment optimisation: combination and rational strategies Congress: 2nd International Congress on Psoriasis – Phototherapies: what to choose and how to use Dates: JUNE 21–24, 2007 – Alternative treatment Venue: Paris, Palais des congre`s, FRANCE – Biologics Web site: http://www.pso2007.com – Extracutaneous manifestations in Psoriasis Contact: PSO 2007 c/o MCI International Short Course on Dermoscopy 24 rue Chauchat Date: July 17–21, 2007 75009 Paris Venue: Department of Dermatology, Medical University of FRANCE Graz, Auenbruggerplatz 8, A-8036 Graz Phone: +33 (1) 53 85 82 59 Organizer: Medical University of Graz, Department of Derma- Fax: +33 (1) 53 85 82 83 tology Email: [email protected] Type of Event: Course Main topics: Language: English – Scoring and monitoring the severity of the disease Contact: – Management of the severe clinical manifestations Katrin Steinmann, Graz, Austria

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 1092 News and Notices

Telephone: +43-699-11081567 British Skin Foundation Fax: +43-316-696110 2007 Awards Email: [email protected] Call for Grant Applications Website: http://www.meduni-graz.at/dermoscopy/ The Trustees of the British Skin Foundation have pleasure in annou- Description: This course is for residents in dermatology ncing that funding is once again available for skin disease research. and for dermatologists from universities or private practice Applicants are asked to apply for funding from the category most as well as for physicians or nurses interested in the diagnosis appropriate to the research they wish to undertake. Please note appli- of pigmented skin lesions. cations may only be entered under one category. The closing date is 28th September 2007 with awards being made in December. Congress: 8th Annual Meeting of the Austrian Academy of The Research Award: A project grant of up to 2 years duration Cosmetic Surgery in cooperation with the American and and maximum funding of £70,000 (£35,000 per annum). Asian Academy of Cosmetic Surgery The BSF Fellowship: A grant of £60,000 to support a dermato- Venue and date: Vienna/Austria – Hotel Marriott, September logical clinician through one year of research. Applications are 13–16, 2007 made by a head of department. It is envisaged that the Main topics: Safety in Cosmetic Surgery, Facial Surgery, successful fellow will pursue a career in dermatology. Anatomy, Laser Therapy, Breast Operations, Liposuction, The BSF Studentship: Available to any UK based research Abdominoplasty, Brachioplasty, Leg-Lift, Medico-Cosmetics, institution seeking to fund dermatological research at a Ph.D. Hormonal Therapy, Botox, Fillers, New Methods and Tech- student level. The 3-year Studentship is a fixed amount of nologies £75,000 (£25,000 per year). Chair: In addition the Trustees are pleased to announce the first BSF Dr Peter Lisborg, Vienna Medical Academy Clinical Trial. The award will support a multi-centre clinical Phone: +43/1/405 13 83 10 trial up to a maximum of £70,000 per year over 4 years – Fax: +43/1/407 82 74 £280,000 in total. e-mail: [email protected] Application forms and details of each award are available Information: online at www.britishskinfoundation.org.uk or you can contact A¨rztezentrale Med.Info the BSF office, specifying the type of grant you are interested in. Helferstorferstrasse 4, A-1014 Wien Tel: 020 7391 6341 Phone: (+43/1) 531 16 – 75 British Skin Foundation Fax: (+43/1) 531 16 – 61 4 Fitzroy Square e-mail: [email protected] London WIT 5HQ

2007 The Authors Journal Compilation 2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1045–1092 ABSTRACTS DOI 10.1111/j.1365-2133.2007.07822.x British Society for Investigative Dermatology Annual Meeting

University of Nottingham 16–18 April 2007

Programme and Abstracts

Monday 16 April

11.30 Trainee lecture Dr Michael Ardern-Jones, University of Oxford, UK Introduction to immunology research BSID Skin Club Symposium – Chairperson: Richard Weller Pathogenesis of complex disease Welcome: Graham Ogg, Chairman BSID Hywel Williams, local organizer and chairman of BEES 13.30 Prof. Irwin McLean, University of Dundee, UK Genetics of atopic dermatitis 14.15 Prof. Keith Godfrey, University of Southampton, UK Developmental inﬂuences on health and disease: mechanistic and evolutionary insights 15.00 Coffee/tea 15.30 Dr Carolyn Byrne, Queen Mary School of Medicine and Dentistry, London, UK Akt signalling, fetal skin barrier formation and environmental defence in the adult 16.15 Prof. Hywel Williams, University of Nottingham, UK The role of the environment in childhood eczema

17.00 UK Professors of Dermatology Meeting Prof. Jonathan Rees, University of Edinburgh, UK 18.30 Educational session – Chairperson: Edel O’Toole Prof. Robin Eady, St John’s Institute of Dermatology, London, UK Reﬂections of an EB keeper 19.15 Welcome Reception 20.00 Dinner

Tuesday 17 April Scientiﬁc Session A – Chairperson: Rachel Watson

08.30 O1 Intradermal injection of allogeneic normal human fibroblasts promotes type VII collagen deposition at the dermal-epidermal junction in individuals with recessive dystrophic epidermolysis bullosa T. Wong, L. Gammon, L. Liu, L. Ozoemena, P.J.C. Dopping-Hepenstal, C. Jones, I.M. Leigh, H. Navsaria and J.A. McGrath 08.45 O2 Human dermal fibroblasts ameliorate in vitro graft-versus-host reactions and are functionally indistinguishable from bone marrow mesenchymal stromal cells M.A. Haniffa, X.N. Wang, U. Holtick, M.C. Rae, S. Alshemali, N.J. Reynolds, A.M. Dickinson, J.D. Isaacs, C.M.U. Hilkens and M.P. Collin 09.00 O3 Location, mobility and secretion of cyclophilin B in keratinocytes is regulated through its ciclosporin A binding site A.A. Lonsdale-Eccles, P. Fearon, K. Ross, F. Allain and N.J. Reynolds 09.15 O4 Keratinocyte apoptosis induced by allergen-specific T cells M.R. Ardern-Jones, A.P. Black and G.S. Ogg 09.30 O5 Langerhans cell migration provoked by interleukin-1b proceeds normally in uninvolved skin of patients with late-onset psoriasis M. Cumberbatch, C.E. Kleyn, N. Khan, R.J. Dearman, I. Kimber and C.E.M. Griffiths 09.45 O6 Early changes in draining lymph node cell activation following topical exposure to chemical contact and respiratory allergens C. Portsmouth, M. Cumberbatch, R. Dearman, C.E.M. Griffiths and I. Kimber 10.00 O7 Acidified nitrite speeds wound healing in diabetic and nondiabetic mice M. Finnen and R. Weller

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1093 1094 BSID abstracts

Scientiﬁc Session B – Chairperson: David Kelsell

10.45 O8 The R381Q variant of the interleukin-23 receptor gene (IL23R) confers protection against psoriasis vulgaris F. Capon, P. Di Meglio, M. Allen, L. Baumber, D. Burden, J.N.W.N. Barker, R.C. Trembath and F. Nestle 11.00 O9 The effect of pachyonychia congenita type 1 mutations in keratinocyte adhesion and desmosome formation and associated signal transduction R. van Koningsveld, C.J. Fitchett, E.L. Rugg, D.P. Kelsell and E.A. O’Toole 11.15 O10 Analysis of wild-type and mutant connexin 31 reveals nongap junction functions and altered cell signalling D. Tattersall, C.A. Scott, T. Aasen, H.C. Unsworth and D.P. Kelsell 11.30 O11 Single nucleotide polymorphisms in adenosine receptors and response to methotrexate therapy in psoriasis R.B. Warren, R.L. Smith, E. Campalani, C.H. Smith, J.N.W.N. Barker, J. Worthington and C.E.M. Grifﬁths 11.45 O12 A proteomic approach to identify targets of LEKTI – a protein implicated in the barrier function of the skin K. Bennett, K. Mills, R. Callard, J. Harper and W.L. Di 12.00 O13 Allelic imbalances and microdeletions affecting the PTPRD gene in cutaneous squamous cell carcinomas detected using single nucleotide polymorphism microarray analysis K. Purdie, S. Lambert, M. Teh, T. Chaplin, G. Molloy, M. Raghavan, D.P. Kelsell, I.M. Leigh, C.A. Harwood, B. Young and C.M. Proby 12.15 Keynote Guest Speaker Prof. Irma Thesleff, University of Helsinki, Finland The pathogenesis of ectodermal dysplasia syndromes

Scientiﬁc Session C – Chairperson: Eugene Healy

14.00 O14 Ultraviolet B radiation upregulates arginase in human epidermis via a nitric oxide-dependent pathway M. Mowbray, N. Bredenkamp, L. van Overloop, L. Declercq and R. Weller 14.15 O15 Ultraviolet A induces rapid photolysis of nitric oxide stores in human skin M. Mowbray and R. Weller 14.30 O16 Epidermal akt signalling regulates SREBP transcription, epidermal lipogenesis and skin barrier activity J.C. Welti, R.F.L. O’Shaughnessy and C. Byrne 14.45 O17 Ultraviolet irradiation directly influences the structure of fibrillin microfibrils S.M. Reilly, N.K. Gibbs, C.E.M. Griffiths, R.E.B. Watson and M.J. Sherratt 15.00 British Photodermatology Group Guest Lecture Prof. Steve Ullrich, University of Texas, USA Sunlight and skin cancer: lessons from the immune system 15.45 Posters 17.15 Annual General Meeting 19.30 Annual Dinner

Wednesday 18 April Scientiﬁc Session D – Chairperson: John Mee

08.45 O18 How ‘atopic’ is ﬂexural eczema? Findings from the International Study of Asthma and Allergies in Childhood (ISAAC) Phase 2 C. Flohr, S.K. Weiland, H.C. Williams and the ISAAC Phase 2 Study Group 09.00 O19 A comprehensive survey of 28 candidate genes for atopic dermatitis using a hapTAG approach in a unique Bangladeshi population of East London C. Sinclair, E.A. O’Toole, D. Paige, C.A. Mein and D.P. Kelsell 09.15 O20 Regular antihelminthic therapy increases allergen skin sensitization: a randomized, double-blind, placebo-controlled trial in Vietnam C. Flohr, L.N. Tuyen, S. Lewis, R. Quinnell, T.T. Minh, J. Campbell, D. Pritchard, T.T. Hien, J. Farrar, J. Britton and H.C. Williams 09.30 British Epidermo-Epidemiology Society Guest Speaker Dr Richard Smith, former editor of BMJ The future of publishing 10.15 Posters

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1095

Scientiﬁc Session E – Chairperson: Edel O’Toole

11.15 O21 The role of type VII collagen in squamous cell carcinoma invasion in recessive dystrophic epidermolysis bullosa V.L. Martins, J.J. Vyas, K.J. Purdie, M. Chen, J.A. McGrath, A. Storey, A.P. South and E.A. O’Toole 11.30 O22 Combining endoplasmic reticulum stress-inducing agents with protein disulphide isomerase inhibitors as a novel therapeutic strategy for metastatic melanoma P.E. Lovat, C.P.F. Redfern and M.A. Birch-Machin 11.45 O23 RANK is a regulator of keratinocyte growth and apoptosis: potential role in cutaneous malignancy J-B.O. Barbaroux, C.G. Mueller and R.W. Groves 12.00 O24 Deﬁning the role of B-RAF-induced extracellular signal-related kinase in the resistance of metastatic melanoma to apoptosis D.S. Hill, J.L. Armstrong, M.A. Birch-Machin and P.E. Lovat 12.15 Local Guest Speaker Prof. Sir Peter Mansﬁeld FRS, University of Nottingham, UK Nobel Prize winner 2003 13.00 Close of meeting and prizes

Poster presentations

P1 Telomerase-dependent protection of mitochondrial DNA in response to oxidative stress M.J. Birket, M.A. Birch-Machin, S. Ahmed, T. Vonzglinicki and G. Saretzki P2 Cell-penetrable peptide-based delivery of oligonucleotide antisense/peptide nucleic acid directed against tyrosinase P. Kumar, C. Pickard, M.A. Fara, M. Bradley, P.S. Friedmann and E. Healy P3 Lithium inhibits the transcriptional activation, mRNA and protein expression of transglutaminase 1 in keratinocytes P.J. Hampton, O.K. Ross and N.J. Reynolds P4 Unusual clinical and molecular findings in Kindler syndrome K. Arita, V. Wessagowit, A.C. Inamadar, J.E. Lai-Cheong and J.A. McGrath P5 The role of human keratinocytes in T-cell activation A.P. Black, M. Ardern-Jones, L. Jones and G.S. Ogg P6 The effect of acute social stress on cutaneous T-cell trafficking C.E. Kleyn, L.F. Cotterell, R.E.B. Watson, H.L. Richards, G. Terenghi and C.E.M. Griffiths P7 Seborrhoeic warts are the benign cutaneous change most associated with skin cancer in renal transplant recipients A. Lally, B. Imko, D. Casabonne, R. Newton and F. Wojnarowska P8 Erythemal sensitivity does not predict ultraviolet B-induced epidermal CD1a+ Langerhans cell loss or caspase-3 activation in polymorphic light eruption J. Tye, A. Blackburn, S.M. Winhoven, M. Brownrigg, L.E. Rhodes and N.K. Gibbs P9 Withdrawn P10 Ultraviolet radiation activates the transcription factor NFAT and derivation of the action spectrum for NFAT activation R.J. Flockhart, B.L. Diffey, P.M. Farr and N.J. Reynolds P11 Characterization of IL-1F9 activity in human keratinocytes J.B. Mee and R.W. Groves P12 The effect of repeated low doses of solar-simulated radiation on immune responses in human skin J. Narbutt, A. Lesiak and M. Norval P13 International Study of Asthma and Allergies in Childhood (ISAAC) Phase 1 and 3 Study Groups H.C. Williams, A. Stewart, E. von Mutius, W. Cookson and H. Ross Anderson P14 Cutaneous human papillomavirus early genes downregulate serine phosphorylated Akt1 while upregulating Akt2 expression R.F.L. O’Shaughnessy, B. Akgul, A. Storey, H. Pfister, C.A. Harwood and C. Byrne P15 Identification of the molecular signatures in cutaneous squamous cell carcinoma excised from patients with recessive dystrophic epidermolysis bullosa by using integrated genomic techniques X. Mao, C. Pourreyron, K. Purdie, M.V. Holder, N. Baksh, T. Wong, H. Fassihi, A. Volz, I.R. Hart, C.A. Harwood, C.M. Proby, L. Bruckner-Tuderman, D.P. Kelsell, J.A. McGrath, I.M. Leigh and A.P. South P16 Association of single nucleotide polymorphisms in the PTPN22 gene region and type I psoriasis R.L. Smith, R.B. Warren, S. Eyre, X. Ke, H.S. Young, J.N.W.N. Barker, C.E.M. Griffiths and J. Worthington P17 The a-melanocyte stimulating hormone analogues (NDP-aMSH, MTII, SHU 9119, KPV) suppress phytohaemagglutinin-induced lymphocyte proliferation in vitro R. Sihota, C. Pickard, P. Friedmann and E. Healy P18 Psoriasis shows no association with filaggrin-null alleles M.H. Allen, Y. Zhao, A. Terron-Kwiatkowski, H. Liao, S.P. Lee, P.R. Hull, L.M. Campbell, R.C. Trembath, F. Capon, G. O’Regan, C.E.M. Griffiths, D. Burden, R. McManus, R. Hughes, B. Kirby, O. Fitzgerald, D. Kane, A.D. Irvine, C.N.A. Palmer, J.N.W.N. Barker and W.H.I. McLean

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1096 BSID abstracts

P19 Nonmelanoma skin cancer and the DNA damage response F. Ismail, M. Ikram, C.A. Harwood, C.M. Proby and A. Storey P20 Interventions for the prevention of nonmelanoma skin cancers in high-risk groups F. Bath-Hextall, J. Leonardi-Bee, S. Somchand and W. Perkins P21 Multiple self-healing squamous epithelioma in different ethnic groups: more than a founder mutation disorder M. D’Alessandro, S.M. Morley, S.E. Coats, D.R. Goudie and E.B. Lane P22 Fast Fourier Transform signal analysis of accelerometer data to measure itch C.S. Murray, S.D. Pye, K. McBride and J.L. Rees P23 Immunomodulatory effects of schistosome cercarial interactions with human keratinocytes and Langerhans cells G.R. Nanayakkara, A. Bartlett, P.J. Whitfield, M.B. Brown and R.W. Groves P24 Ciprofloxacin-induced photosensitivity in human keratinocytes and fibroblasts J.P. Tolland, J.S. Elborn, G. Skibinski, R.J.H. Davies and K.E. McKenna P25 Interventions to reduce Staphylococcus aureus for atopic eczema A.J. Birnie, F. Bath-Hextall, J.C. Ravenscroft and H.C. Williams P26 Epidermolysis bullosa in calves in the UK A.P. Foster, A.M. Skuse, R.J. Higgins, D.C. Barrett, A.W. Philbey, J.R. Thomson, H. Thompson, M.A. Fraser and M.J. Day

Oral presentations

O1 allogeneic normal human fibroblasts could potentially restore Intradermal injection of allogeneic normal human key structural and protein defects within the DEJ in RDEB fibroblasts promotes type VII collagen deposition at the and that this may have direct clinical relevance in developing dermal-epidermal junction in individuals with recessive better treatments for this genodermatosis. dystrophic epidermolysis bullosa 1 T. Wong, L. Gammon, L. Liu, L. Ozoemena, O2 1 P.J.C. Dopping-Hepenstal, C. Jones, I.M. Leigh, Human dermal fibroblasts ameliorate in vitro graft-versus- 1 H. Navsaria and J.A. McGrath host reactions and are functionally indistinguishable from Genetic Skin Disease Group, St John’s Institute of Dermatology, King’s College bone marrow mesenchymal stromal cells School of Medicine, London and 1Centre for Cutaneous Research, Institute of M.A. Haniffa,1,2,3 X.N. Wang,1 U. Holtick,1 M.C. Rae,1 Cell and Molecular Science, Queen Mary Hospital, London, UK S. Alshemali,1 N.J. Reynolds,3 A.M. Dickinson,1 Corresponding author: [email protected] J.D. Isaacs,2 C.M.U. Hilkens2 and M.P. Collin1 Recessive dystrophic epidermolysis bullosa (RDEB) is a severe 1Haematological Sciences, 2Cellular Therapy Group and 3Dermatological inherited blistering skin disease caused by mutations in the Sciences, Institute of Cellular Medicine, University of Newcastle upon Tyne, UK COL7A1 gene which encodes the anchoring fibril protein type Corresponding author: [email protected] VII collagen. Affected individuals have reduced or absent stain- Bone marrow (BM) mesenchymal stromal cells (MSC) have ing for type VII collagen at the dermal-epidermal junction potent immunoregulatory properties and are being evaluated (DEJ) and rudimentary anchoring fibrils. Recent mouse studies in clinical trials of graft-versus-host disease. We show that have shown that intradermal injections of normal human fibro- dermal fibroblasts (Fb) have equivalent immunomodulatory blasts or COL7A1 gene-corrected RDEB fibroblasts can lead to functions to MSC. Fb were obtained by digesting 200 lm der- new type VII collagen and anchoring fibrils at the DEJ. In this mal sheets with collagenase. MSC were obtained from BM study, we investigated the therapeutic potential of fibroblast- aspirate. Tissue dendritic cells (DC) were isolated by spontan- based cell therapy in human subjects with RDEB by giving single eous migration from epidermal and dermal sheets. CD14+ intradermal injections of low-passage (passage 2) autologous monocytes were used for in vitro DC (moDC) generation with (nongene corrected) or allogeneic fibroblasts (5 · 106 cells in granulocyte/macrophage colony-stimulating factor and inter- 350–500 lL of phosphate-buffered saline) in five subjects with leukin (IL)-4, while CD3+ T cells were isolated by negative RDEB (four men and one woman; age range 21–40 years). For selection. The following results are representative of at least the allogeneic fibroblast-treated sites, immunostaining revealed two independent experiments. a sustained increase in type VII collagen at the DEJ in three of Fb and MSC had an identical immunophenotype: CD73+, the five subjects at 3 months; no increase was observed with CD90+, CD105+, major histocompatibility complex class I+, autologous fibroblasts. Ultrastructural evidence for new anchor- CD14–, CD19–, CD31–, CD45– and HLA-DR–. Up to 20% of ing fibrils was seen although this was patchy and few fibrils had all dermal cells had clonogenic potential, compared with 1 in a fan-shaped appearance or central cross-banding. None of the 30 000 of BM mononuclear cells; the functional properties of patients developed any detectable antitype VII collagen anti- Fb observed were therefore not due to the expansion of rare bodies in skin or serum over 3 months and there was no evi- subpopulations of cells. Fb could transdifferentiate into dence of a clinically significant host response to any of the cartilage, bone and fat in appropriate culture conditions. Fb injected cells. Our observations suggest that cell therapy using suppressed allogeneic T-cell responses to moDC by 50–80% in

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1097 a ratio-dependent manner (Fb : T cell ratios of 1:1 to 1:100), The CsA-binding domain may represent a novel molecular comparable with the effect of MSC. Allogeneic T-cell responses mechanism retaining CyB in the ER. to Langerhans cells and dermal DC were inhibited by freshly isolated Fb from the same skin sample. Neutralizing antibodies O4 to interferon-c and exogenous 1-methyltryptophan abrogated Keratinocyte apoptosis induced by allergen-specific suppression of T-cell proliferation. Transient exposure to stro- T cells mal cells during allogeneic stimulus reprogrammed T cells by M.R. Ardern-Jones, A.P. Black and G.S. Ogg upregulating IL-10 and IL-4 upon restimulation [IL-10, mean Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, fold induction (MFI) 4.3 for Fb and 9.1 for MSC; IL-4, MFI 2.3 UK for Fb and 5.8 for MSC]. T-cell modulation by Fb ameliorated Corresponding author: [email protected] pathological changes in an in vitro cutaneous model of human Atopic dermatitis (AD) is characterized histologically by cuta- graft-versus-host disease. Fb are potent immunomodulatory neous lymphocyte infiltration and spongiosis. Allergen-specific cells and may play a physiological role in immunoregulation. CD4+ T cells are thought to contribute to the disease pathogenesis. Approximately 80% have specific IgE to the house O3 dust mite protein, Der p 1. In this study we demonstrate that Location, mobility and secretion of cyclophilin B in allergen-specific CD4+ Th2 cells are able to induce apoptosis keratinocytes is regulated through its ciclosporin A of allergen-pulsed keratinocytes. binding site We utilized cultured ELISpot assays of interleukin (IL)-4 A.A. Lonsdale-Eccles, P. Fearon, K. Ross, F. Allain1 secretion to map a novel Der p 1 epitope and construct a Der and N.J. Reynolds p 1–HLA-DRB1*1501 class II tetramer. Tetramer-based cell Institute of Cellular Medicine, University of Newcastle upon Tyne, UK and sorting was used to generate clonal Der p 1-specific CD4+ T 1Unite´ de Glycobiologie Structurale et Fonctionnelle, Universite´ des Sciences cells, and to undertake subsequent functional analyses. We et Technologies de Lille, France utilized DRB1*1501 keratinocytes to model the allergen- Corresponding author: [email protected] specific response. Ciclosporin A (CsA), an effective treatment for psoriasis, binds Autologous B cells were able to efficiently present Der p 1 to a family of intracellular proteins known as cyclophilins. antigen to the clonal CD4+ Th2 cells as demonstrated by IL-4 Cyclophilin B (CyB) has high affinity for CsA, and CsA treat- ELISpot assay. B cells (susceptible to perforin killing but with ment promotes CyB secretion from HeLa cells. In keratinocytes a low level of constitutive Fas expression) were resistant to and HaCaT cells, we assessed the subcellular localization, allergen-specific killing. However, allergen-specific CD4+ Th2 mobility and secretion of wild-type CyBWT-GFP and CyBW128A- clones were able to induce keratinocyte apoptosis in an anti- GFP harbouring a mutation at residue 128 in the CsA-binding gen-specific manner. This was partially inhibited by monensin, domain of CyB that prevents binding to CsA. which prevents upregulation of FasL to the lymphocyte cell Endogenous CyB and CyBWT-GFP localized to the endoplas- surface. We were also able to demonstrate that incubation mic reticulum (ER) and nucleus of keratinocytes. Real-time con- with anti-LFA1 monoclonal antibody blocked the induction of focal imaging of CyBWT-GFP and Western blotting of culture apoptosis by 51–68%. medium showed dissociation of CyB from the ER and CyB secre- ) In conclusion, lesions of AD are recognized to contain apop- tion in response to CsA (1 lmol L 1). Fluorescence recovery totic keratinocytes, but these are the first data to demonstrate after photobleaching (FRAP) studies showed that mobility of that this is likely to be mediated in some part by CD4+ Th2 cells the CyBWT-GFP construct was reduced in response to CsA. Speed responding to allergen presentation in the skin. This has impli- of diffusion (t ) and completeness of recovery, mobile frac- 1/2 cations for the understanding and treatment of AD. Monoclonal tion (MF), were reduced compared with untreated controls antibodies which interfere with T cell–antigen-presenting cell [means (n = 10): t =3.9s,MF = 72.8%; t = 1/2 control control 1/2 CsA interaction, as demonstrated here, are licensed for use in other 6.1 s (P < 0.05), MFCsA = 54.5% (P < 0.05)]. FRAP studies W128A conditions and their role in AD should be explored. of CyB -GFP also showed a similar reduction in t1/2 and MF [t1/2 W128A = 7.5 s (P < 0.01), MFW128A = 46.1% W128A (P < 0.05)] in the absence of CsA. Moreover, CyB -GFP O5 was secreted into the media in the absence of CsA, suggesting Langerhans cell migration provoked by interleukin-1b that the CsA-binding domain is necessary for ER retention. Sup- proceeds normally in uninvolved skin of patients with porting this, colocalization coefficients, Pearson’s (PE) and over- late-onset psoriasis WT 1 1 lap (OE), between CyB -GFP and an ER marker were lower M. Cumberbatch, C.E. Kleyn, N. Khan, 1 after CsA treatment (two-way ANOVA interaction: PE P < 0.019, R.J. Dearman, I. Kimber and C.E.M. Griffiths W128A 1 OE P < 0.021) and lower in the mutant CyB -GFP (PE Syngenta CTL, Alderley Park, Macclesfield, Cheshire and Dermatology

P < 0.005, OE P < 0.0002) (n = 23–26 cells). Centre, The University of Manchester, Manchester, UK In summary, CsA and W128A mutation in the CsA-binding Corresponding author: [email protected] domain of CyB both resulted in dissociation of CyB from Psoriasis vulgaris may be divided into two distinct subsets the ER, altered mobility and increased secretion of CyB. based on age at onset: early onset where patients ﬁrst present

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1098 BSID abstracts before the age of 40 years (type I) and late onset which CD4 (2.1-fold), CD8 (2.2-fold), B220 (3.4-fold), major histo- is diagnosed typically after the age of 40 years, peaking at compatibility complex (MHC) class IIlow (3.7-fold), MHC class 55–60 years (type II). Type I, but not type II, psoriasis is IIhigh (2.0-fold) and CD11c (3.8-fold) after 16 h of exposure associated with HLA-Cw6 but the two types appear identical to DNCB, changes which increased further up to 72 h. The clinically. It has been demonstrated previously that Langerhans early increases preceded marked proliferative responses. Sim- cell (LC) migration in uninvolved skin of patients with type I ilar changes were observed for TMA but with delayed kinetics. psoriasis is virtually absent in response to migratory stimuli Analyses of LN cell supernatants by cytokine protein array such as intradermal administration of tumour necrosis factor-a revealed increased secretion of interleukin (IL)-2 (39-fold), or interleukin (IL)-1b. We have now examined the influence IL-17 (85-fold), IL-10 (56-fold) and interferon (IFN)-c (675- of IL-1b on LC mobilization in five patients (Ps) with late- fold) 16 h after exposure to DNCB, but not to TMA. Although onset (type II) disease (mean ± SD age 62.0 ± 6.6 years, early IL-2 and IL-10 secretion declined after 16 h exposure to age at onset 54.4 ± 3.6 years) and four normal (N) healthy DNCB, IL-17 and IFN-c levels increased further. TMA failed to volunteers (mean ± SD age 67.5 ± 3.1 years). Homologous induce IL-2 production at any time point examined. However, recombinant IL-1b (100 U in 50 lL), or an equivalent raised IL-17 (53-fold), IL-10 (294-fold), IFN-c (1104-fold) volume of saline alone, was administered intradermally into and IL-13 (11-fold) levels were recorded by 48 h. We have nonsun-exposed buttock skin (in the case of Ps, >5 cm from demonstrated that DNCB induces LN activation with more a psoriatic plaque) and punch biopsies (6 mm) taken 2 h later rapid kinetics than TMA, with the selective induction of IL-2. for preparation of epidermal sheets and assessment of LC These observations may be relevant to the development of frequencies following immunofluorescent staining for CD1a preferential Th1 and Th2 responses induced by these chemical (4 Ps and 1 N) or HLA-DR (1 Ps and 1 N) expression. allergens. We report that IL-1b provoked a similar reduction in LC densities in Ps with type II psoriasis and in N regardless of whether LCs were identified on the basis of CD1a or HLA-DR O7 expression (overall mean ± SD reduction 26.8 ± 9.3% and Acidified nitrite speeds wound healing in diabetic and 25.4 ± 13.9% for Ps and N, respectively). Morphologically, nondiabetic mice LCs appeared similar between Ps and N, although small focal M. Finnen and R. Weller1 points of cells stained more intensely for HLA-DR were Strakan Pharmaceuticals, Galashiels and 1University Department of observed in Ps compared with N. Together, these data indicate Dermatology, Edinburgh, UK that type I and II psoriasis may be associated with different Corresponding author: [email protected] pathomechanisms. Nitric oxide (NO) plays an important role in wound healing, and NO levels are reduced in diabetic ulcers. NO therapy may thus help healing of diabetic ulcers. We have measured the O6 effects of applying an NO-generating acidified nitrite cream Early changes in draining lymph node cell activation comprising sodium nitrite and citric acid, on the healing of following topical exposure to chemical contact and incisional wounds in diabetic and nondiabetic mice. The respiratory allergens effects of acidified nitrite on wound healing were critically C. Portsmouth,1,2 M. Cumberbatch,1 R. Dearman,1 dependent on the time of application after wounding in ICR C.E.M. Griffiths2 and I. Kimber1 nondiabetic mice. The half time to closure and extent of 1Syngenta CTL, Alderley Park, Macclesfield, Cheshire and 2Dermatology wound closure were both significantly inhibited by application Centre, The University of Manchester, Manchester, UK of acidified nitrite starting on the day of wounding and con- Corresponding author: [email protected] tinued on consecutive days thereafter. In contrast, the rate and We have shown in mice that the contact allergen 2,4-dinitro- extent of wound healing were significantly augmented by chlorobenzene (DNCB) and the respiratory allergen trimellitic application starting on days 1–4 after wounding and on con- anhydride (TMA) provoke activation of T-helper (Th)1 and secutive days thereafter. Optimal effects on improving wound Th2 cells, respectively. To explore how these chemical aller- healing were observed with cream concentrations of 3.0% gens may initiate divergent immune responses, we have stud- (w/v) sodium nitrite and 4.5% (w/v) citric acid. Starting ap- ied changes in cellular composition and cytokine production plication on day 5 after wounding had no effect on the rate in draining lymph nodes (LNs) isolated from BALB/c strain or extent of wound healing. In diabetic Lepr db/db mice, mice at 16, 24, 48 and 72 h following a single topical appli- starting treatment at day 2 after wounding, acidified nitrite at cation of 1% DNCB, 25% TMA or vehicle control. A signifi- 3.0% (w/v) sodium nitrite and 4.5% (w/v) citric acid significant increase in LN cellularity was observed early following cantly increased the rate and extent of wound healing. This exposure to DNCB (16 h: 1.6-fold, n =3, P = 0.05; 24 h: suggests that acidified nitrite is effective in improving wound 2.3-fold, n =6, P = 0.01). Similar changes in LN cellularity healing against a diabetic background. Acidified nitrite cream were emerging for TMA by 48 h (3.0-fold, n =5,P = 0.01). has the potential to speed wound healing in both diabetic and Flow cytometric analyses of LN cell suspensions revealed nondiabetic mice. We now plan to perform such studies in increases in the number of cells expressing CD3 (2.0-fold), humans.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1099

O8 Retroviral supernatant was used to infect immortalized HKs The R381Q variant of the interleukin-23 receptor gene (nTERT) with target genes cloned into the retroviral vector (IL23R) confers protection against psoriasis vulgaris pLXSN. Whole genome expression data were generated using F. Capon, P. Di Meglio, M. Allen, L. Baumber, Affymetrix chips. Expression of desmosomal proteins was D. Burden, J.N.W.N. Barker, R.C. Trembath and investigated by Western blotting and immunofluorescence F. Nestle (IF). Patient biopsies were stained for junctional proteins and Division of Genetics and Molecular Medicine, King’s College London, London, UK cell-cell adhesion was assessed by the dispase adhesion Corresponding author: [email protected] assay. Psoriasis is an inflammatory skin disorder inherited as a multi- Affymetrix Gene Chip analysis identified altered expression factorial trait. Genetic analyses have repeatedly identified a of several genes involved in cell-cell adhesion. Western blot- significant disease susceptibility locus within the major histo- ting of cellular fractions showed (i) a lower molecular weight compatibility complex (MHC), on chromosome 6p21. A small desmoplakin variant in the membranous fraction of cells over- number of non-MHC susceptibility regions has also been iden- expressing WT and mutant K6a and K16 and (ii) changes in tified, but the small effect size of the underlying variants has desmoglein-1 and plakophilin-1 expression. Interestingly, IF confounded refinement and resolution of these loci. Here, we staining showed that cells overexpressing mutant K6a and K16 report the initial findings of a whole-genome association scan, had plakoglobin (PG)-staining protrusions emerging from the designed to robustly locate non-MHC psoriasis susceptibility inner surface of the cell membrane, suggesting that PC1 muta- genes. We used a DNA pooling strategy, employing cases tions disrupt the keratin-desmosomal interaction. Staining of (n = 318) and controls (n = 300). Genotyping was carried patient sections showed that the K16R127C mutation causes out on the Illumina HumanHap300 BeadChip, which includes PG to translocate to the nucleus. Furthermore, cells over- 317 511 single nucleotide polymorphism (SNP) markers. expressing mutant K16 displayed a twofold reduction in cell- Among our association findings, we observed a significant cell adhesion. In summary, PC1 mutations alter desmosomal increase among controls of the IL23R gene R381Q variant. protein expression and localization, altering cell-cell adhesion Importantly, this SNP has recently been shown to have a pro- and desmosome formation. These results may help to explain tective effect against Crohn disease. The association between the clinical phenotype seen in PC1. R381Q and psoriasis was confirmed by individually genotyping the pooled DNA samples (v2 = 16.8; P = 0.00004) and by analysing a replication cohort including 498 cases and 517 O10 2 controls (v = 5.58; P = 0.018). As a combined sample, the Analysis of wild-type and mutant connexin 31 reveals frequency of the R381Q allele was 3.6% in cases and 7% in nongap junction functions and altered cell signalling )5 controls, yielding a P-value of 1.6 · 10 . Resequencing of D. Tattersall, C.A. Scott, T. Aasen, H.C. Unsworth the IL23R coding region in 16 patients carrying the R381Q and D.P. Kelsell allele failed to identify any nucleotide change that was in link- Centre for Cutaneous Research, Institute of Cell and Molecular Science, Queen age disequilibrium with the associated SNP. Bioinformatic ana- Mary University of London, London, UK lyses showed that amino acid 381 is highly conserved across Corresponding author: [email protected] higher vertebrates. Taken together, these data indicate that The traditional role of connexins is to form gap junction R381Q is likely to be a functional allele, conferring significant channels, mediating cell-cell communication. The discovery protection against epithelial inflammatory disorders. that distinct mutations in connexin 31 (Cx31) underlie different disease phenotypes such as the skin disease erythrokerato- O9 derma variabilis, hearing loss and/or neuropathy has allowed The effect of pachyonychia congenita type 1 mutations further dissection of the function of Cx31 in keratinocytes and in keratinocyte adhesion and desmosome formation other cell types. Recently, we have shown a role for Cx31 in and associated signal transduction neuronal differentiation (Unsworth HC, Aasen T, McElwaine R. van Koningsveld, C.J. Fitchett, E.L. Rugg,1 S, Kelsell DP. Tissue-specific effects of wild-type and mutant D.P. Kelsell and E.A. O’Toole connexin 31: a role in neurite outgrowth. Hum Mol Genet 2007; Centre for Cutaneous Research, ICMS, Barts and the London School of 16:165–72). Overexpression of wild-type (WT)Cx31 in SH- Medicine and Dentistry, Queen Mary, University of London, London, UK and SY5Y cells induced a differentiation phenotype characterized 1Department of Dermatology, University of California Irvine, USA by increased neurite outgrowth, whereas the overexpression Corresponding author: [email protected] of the (66delD)Cx31 neuropathy mutant decreased the level Keratins are cytoskeletal proteins forming the intermediate fila- of differentiation, suggesting a disease mechanism for this ment cytoskeleton within epithelial cells. Mutations in keratins mutation. In contrast, the skin mutants R42P and C86S K6a and K16 cause pachyonychia congenita type 1 (PC1). The induced neurite outgrowth to the same degree as (WT)Cx31, aim of this study was to investigate the effect of overexpression despite these mutants having impaired trafficking to the of wild-type (WT) or mutant K6a (K6aN171del) and K16 plasma membrane. In addition, the (WT)Cx31 induction of (K16R127C) on human keratinocyte (HK) cell-cell adhesion neuronal differentiation did not correlate with an increase and desmosome formation. in intercellular communication. These data reveal that the

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1100 BSID abstracts neuronal differentiation function of Cx31 is distinct from its O12 role as an intercellular channel at the cell surface membrane. A proteomic approach to identify targets of LEKTI – To explore this nongap junction function for Cx31 further, a protein implicated in the barrier function of the skin 1 we have performed detailed microscopy of the intracellular K. Bennett, K. Mills, R. Callard, J. Harper and W.L. Di localization of these Cx31 mutants. Although all mutants are Departments of Immunobiology and 1Biochemistry, Institute of Child Health, visible on punctuate structures (suggesting they remain mem- London, UK brane bound), the precise subcellular localization differs: the Corresponding author: [email protected] neuropathy mutant 66delD is present on small, diffuse struc- SPINK5 gene encodes for the serine protease inhibitor LEKTI tures throughout the cell, compared with the R42P and C86S (lympho-epithelial Kazal-type-related inhibitor), a protein skin mutants’ localization on large bright structures. Currently involved in skin barrier formation. Mutations in this gene result we are working to elucidate the precise subcellular localization in the development of Netherton syndrome, an autosomal of these mutants. In tandem, we are identifying specific sig- recessive skin disorder characterized by a defective skin barrier. nalling pathways regulated by different aspects of Cx31 func- A recombinant LEKTI (rLEKTI) fragment containing domains tion in keratinocytes and neuronal cells. 6–9’ has been demonstrated to inhibit the activity of both stratum corneum trypsin/chymotrypsin-like enzymes SCTE and O11 SCCE (Schechter NM, Choi EJ, Wang ZM et al. Inhibition of Single nucleotide polymorphisms in adenosine receptors human kallikreins 5 and 7 by the serine protease inhibitor lym- and response to methotrexate therapy in psoriasis pho-epithelial Kazal-type inhibitor (LEKTI). Biol Chem 2005; R.B. Warren, R.L. Smith,1 E. Campalani,2 C.H. Smith,2 386:1173–84). However, as LEKTI is a multidomain protease J.N.W.N. Barker,2 J. Worthington1 and C.E.M. Griffiths inhibitor, we speculate that LEKTI may target multiple serine The Dermatology Centre, The University of Manchester, Manchester, proteases in the epidermis. In this study we detect endogenous 1ARC-EU, The University of Manchester, Manchester and 2St John’s targets of LEKTI in the skin using protein array technology. Institute of Dermatology, London, UK Using state-of-the-art ProteinChip Array technology, rLEKTI, a Corresponding author: [email protected] gift from Dr Kenji Mitsudo, was bound covalently to a reactive Methotrexate (MTX), a first-line systemic therapy for moder- chip surface, followed by incubation with either protein extracts ate-to-severe psoriasis, is limited by unpredictable efficacy from normal skin or a cultured normal keratinocyte cell line and and toxicity. Pharmacogenetic studies of MTX in patients analysed by surface-enhanced laser desorption ionization time- with rheumatoid arthritis have concentrated on isolated single of-flight mass spectrometry. All proteins bound to rLEKTI would nucleotide polymorphisms (SNPs) mainly within the gene for be detected according to their mass/charge ratio. Several condi- methylenetetrahydrofolate reductase (MTHFR). However, con- tions required optimization, including protein concentration, the flicting results in small cohorts of patients have left the influ- evaluation of different detergents and their concentrations to ence of genetic variation within MTHFR upon MTX treatment reduce nonspecific binding, incubation time and lysis conditions. outcomes unanswered. Furthermore, it is likely that the anti- Identical proteins from different skin samples and keratino- inflammatory/immune-modulating effects of MTX are medi- cytes were found to bind to rLEKTI: two low molecular ated more via adenosine receptors than by MTHFR. Therefore weight (MW) markers (<15 kDa), one medium-sized protein we hypothesized that in patients with psoriasis SNPs in (~25 kDa) and a much heavier MW protein (>100 kDa). Pre- adenosine receptors A1 and A2A (ADORA A1 and ADORA liminary database searching, using the MW of these markers,

A2A) and not MTHFR are associated with clinical response to has indicated potentially five binding partners which are pro- MTX. DNA was collected from 378 patients with psoriasis teins involved in skin barrier formation. who had been treated with MTX and defined as either a ‘responder’ or ‘nonresponder’ to therapy. Haplotype tagging 2 SNPs (r > 0.8) for ADORA A1 (n = 15), ADORA A2A O13 (n = 7) and MTHFR (n = 12), with a minor allele frequency Allelic imbalances and microdeletions affecting the PTPRD of >5%, were selected from the HAPMAP phase II data, giv- gene in cutaneous squamous cell carcinomas detected ing 91%, 98% and 96% gene coverage, respectively. Geno- using single nucleotide polymorphism microarray analysis typing was undertaken using the mass array spectrometric K. Purdie, S. Lambert, M. Teh,1 T. Chaplin,2 method (Sequenom). No SNPs in MTHFR, including previ- G. Molloy,2 M. Raghavan,2 D.P. Kelsell, I.M. Leigh,3 ously described functional SNPs, were associated with C.A. Harwood, B. Young2 and C.M. Proby response to MTX in patients with psoriasis. One SNP, Centre for Cutaneous Research and 1Centre for Clinical and Diagnostic Oral 2 rs5760410 (ADORA A2A), was significantly associated Sciences, Institute of Cell and Molecular Science and Cancer Research UK (P = 0.046) with efficacy of MTX, becoming more significant Medical Oncology Laboratory, Barts and the London School of Medicine and upon trend testing (P = 0.0226). These data indicate that Dentistry, Queen Mary, University of London and 3College of Medicine,

SNPs in the adenosine receptor ADORA A2A may prove im- Dentistry and Nursing, Ninewells Hospital and Medical School, Dundee, UK portant when identifying patients with psoriasis suitable for Corresponding author: [email protected] therapy with MTX. Ideally, these results should be validated Cutaneous squamous cell carcinomas (SCCs) are the second in a prospective trial. most commonly diagnosed cancers in white-skinned popula-

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1101 tions, yet the genetic mechanisms involved in SCC tumorigen- Arginase activity is increased in human skin following UVB esis remain poorly understood. We have employed single nuc- irradiation and NO exposure. We believe that UV-induced NO leotide polymorphism (SNP) microarray analysis to examine release upregulates arginase, which competes for the common genome-wide allelic imbalance in 16 primary and two meta- substrate arginine, and thus negatively feedbacks on NO syn- static SCCs against paired nontumour samples. The commonest thesis. These data do not show NOS upregulation in the epigenetic change was loss of heterozygosity (LOH) on chromo- dermis. NO may be released following cleavage of bound some 9p, observed in 13 of 16 primary SCCs. Copy number- epidermal NO stores on nitrosothiols or nitrite, or may diffuse neutral LOH was observed in a proportion of samples, implying from the dermis, where iNOS is known to generate NO. that somatic recombination had led to acquired uniparental disomy, an event not previously demonstrated in SCC. O15 As well as recurrent patterns of gross chromosomal changes, SNP microarray analysis revealed, in two primary SCCs, a homo- Ultraviolet A induces rapid photolysis of nitric oxide zygous microdeletion on chromosome 9p23 within the protein stores in human skin M. Mowbray and R. Weller tyrosine phosphatase receptor type D (PTPRD) locus. This region University Department of Dermatology, Edinburgh, UK represents an emerging frequent target of homozygous deletion Corresponding author: [email protected] in lung cancer and neuroblastoma. A third sample exhibited a Nitric oxide (NO) properties in the skin include wound heterozygous microdeletion within this locus; reverse transcrip- healing, keratinocyte proliferation/differentiation, regulation of tion–polymerase chain reaction revealed an aberrant pattern of inflammation and antimicrobial activities. The inducible NO PTPRD expression, suggesting a possible dominant negative synthase enzyme peaks 24 h after ultraviolet (UV) irradiation, mechanism. Interestingly, two of the three primary SCCs with producing erythema. An alternative source of NO has recently PTPRD deletion had demonstrated metastatic potential. Our data been described in the form of nitrosospecies (nitrate, nitrite, identify PTPRD as a candidate tumour suppressor gene in cutane- nitrosothiols) stored in the skin. These enzyme-independent ous SCC, with a possible association with metastasis. sources release NO maximally 20 min following UV irradiation. Using dermal microdialysis and a chemiluminesence-based O14 technique we measured nitrosospecies in normal human skin Ultraviolet B radiation upregulates arginase in human ) during 60 min of exposure to UVA (60 J cm 2). Interindividual epidermis via a nitric oxide-dependent pathway 1 1 variability was found in resting nitrosospecies levels in the super- M. Mowbray, N. Bredenkamp, L. van Overloop, )1 L. Declercq1 and R. Weller ficial dermis (mean ± SD 10.26 ± 5.3 mmol L nitrite). There was a significantly higher yield of nitrosospecies in the irradiated University Department of Dermatology, Edinburgh, UK and 1Estee Lauder, than the unirradiated group which peaked 30 min after the start Oevel, Belgium of irradiation. The mean total nitrosospecies recorded during Corresponding author: [email protected] ) irradiation was: irradiated, 49.5 mmol L 1 nitrite; unirradiated, Nitric oxide (NO) and citrulline are synthesized from arginine ) 38.7 mmol L 1 nitrite. The yield of nitrosospecies was reduced by members of the NO synthase (NOS) enzyme family. Argin- on dialysing noradrenaline compared with normal saline. ine is also a substrate for arginase, which synthesizes ornithine We conclude that exposure to UVA results in rapid release of and urea. Ultraviolet (UV) B radiation upregulates inducible NO in the superficial dermis. We hypothesize that photolysis of NOS (iNOS) and causes NO release in the skin. nitrosospecies in the skin releases NO which plays an important We irradiated the backs of eight healthy volunteers with role in the cutaneous response to UV radiation (absorption 0, 0.75, 1 and 2 minimal erythema doses (MED) of TL-01 nitrite 354 nm, nitrosothiols 330–340 nm). Significant interin- UVB radiation. We treated an adjacent site with two applica- dividual variability exists in nitrosospecies levels in normal tions of the NO donor, Zeolite-NO, 24 h apart. This pro- human skin. We have previously shown that skin nitrite levels duced an erythema equivalent to 1 MED for a total of correlate with blood nitrite levels. Dietary nitrate intake influen- around 8 h. One hour, 24 h and 2 weeks after irradiation, ces blood nitrite levels and may account for the interindividual each treated site was sampled by 20 sequential tape strips variability seen in tissue nitrosospecies which may potentially with ‘D-squame’ tape. The 10th strip was analysed by high- influence an individual’s response to UV radiation. performance liquid chromatography for ornithine and citrulline. Levels of each were normalized against total protein recovered. O16 There was no change in ornithine or citrulline with UV Epidermal AKT signalling regulates SREBP transcription, irradiation at 1 h or 1 day after irradiation. However, 2 weeks epidermal lipogenesis and skin barrier activity after irradiation there was a significant dose-dependent J.C. Welti, R.F.L. O’Shaughnessy and C. Byrne mean ± SD increase in ornithine of 1.27 ± 0.55, 2.27 ± Institute of Cell and Molecular Science, Barts and the London, Queen Mary, ) 1.19, 3.21 ± 1.64 and 4.39 ± 2.45 lgmg 1 protein for University of London, UK 0, 0.75, 1 and 2 MED. Zeolite-NO-treated skin produced an Corresponding author: [email protected] ) increase of ornithine to 2.17 ± 1.32 lgmg 1, comparable AKT, a kinase with a number of different targets, is implicated in with 0.75 MED. Citrulline levels were not altered. many cellular processes including cell survival, tumorigenesis

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1102 BSID abstracts and differentiation. A peak of AKT activity associates with fibrils with highly diffuse interbead regions and an increased terminally differentiated keratinocytes of the epidermis. axial periodicity were observed following UVR exposure. These keratinocytes are crucial in the synthesis of the lipid- STEM mass mapping analysis of fibrillin microfibrils isolated corneocyte barrier, essential for protection from toxins, from non-UVR- and UVR-exposed microfibrils identified a allergens, ultraviolet radiation and the arid external environ- significant mass loss of 350 kDa repeat (Student’s t-test; ment. P < 0.001). In retinal epithelial cells, AKT signalling regulates These data provide evidence for direct UVR-induced lipogenesis via sterol regulatory element binding protein changes to the structure of a key extracellular matrix compon- (SREBP) activity. Therefore, we postulated that one role of ent. The fibrillin-1 protein is particularly rich in aromatic keratinocyte AKT could be to regulate epidermal lipid synthe- amino acids, especially disulphide bond-forming cysteines sis, crucial for barrier maintenance, via a similar pathway. ( 20%; cf. fibrillar collagens 2%), in theory making it We demonstrate that all three SREBP isoforms are present susceptible to direct solar UVR photochemical damage and in the epidermis, with expression of SREBP 1a and 1c coin- subsequent enhanced proteolysis by matrix metalloproteinases. ciding with AKT activity. Pharmacological and genetic mani- S.M.R. is funded by the arc. pulation of this AKT activity alters SREBP expression and stratum corneum lipid composition. Examination of AKT- null mice shows that AKT1 and AKT2 regulate SREBP pro- O18 cessing, probably via SREBP cleaving activating protein How ‘atopic’ is flexural eczema? Findings from the (SCAP), a sterol sensor. Hence, SREBP factors in the epider- International Study of Asthma and Allergies in Childhood mis are under the control of AKT activity and we show (ISAAC) Phase 2 that signalling via AKT regulates SREBP and the lipid com- C. Flohr, S.K. Weiland,1 H.C. Williams and the ISAAC position of the stratum corneum. Phase 2 Study Group These data demonstrate a novel signalling pathway regu- Centre of Evidence Based Dermatology, University of Nottingham, Notting- lating epidermal lipogenesis, key to epidermal barrier ham, UK and 1Institute of Epidemiology, University of Ulm, Ulm, Germany homoestasis. Predictions arising from this work are that AKT Corresponding author: [email protected] and SREPB via SCAP lipid sensor activity may regulate barrier The association between allergic sensitization and eczema has formation during development and barrier homeostasis/repair been debated for years. We examined the link between aller- in adults after damage. gic sensitization and eczema in a population-based data set from the International Study of Asthma and Allergies in Childhood Phase 2, in which 28 591 randomly selected 8–12- O17 year-old schoolchildren were physically examined for flexural Ultraviolet irradiation directly influences the structure eczema and also received skin prick testing to Dermatophagoides of fibrillin microfibrils pteronyssinus, D. farinae, cat hair, Alternaria tenuis, and mixed tree S.M. Reilly,1,2 N.K. Gibbs,2 C.E.M. Griffiths,2 and grass pollen. Study centres were encouraged to add aller- R.E.B. Watson2 and M.J. Sherratt1 gens of local relevance. 1Regenerative Medicine and 2Dermatological Sciences, The University of The proportion of atopic flexural eczema varied between Manchester, Manchester, UK 0% and 74%. The age- and sex-adjusted odds ratios (ORs) Corresponding author: [email protected] with 95% confidence intervals for a positive association Age-related degenerative alterations in the biomechanical between flexural eczema and atopy ranged between 0.74 properties of dynamic tissues, such as skin, severely com- (0.31–1.81) and 4.53 (1.72–11.93), with a significantly promise their function. Elastic fibres, which are composed stronger association in affluent compared with nonaffluent of elastin and fibrillin microfibrils, permit long-range defor- countries [pooled age- and sex-adjusted ORaffluent = 2.69 mability and passive recoil. Skin ageing is the sum of (2.31–3.13) vs. ORnonaffluent = 1.17 (0.81–1.70)]. The mean intrinsic time-dependent changes and extrinsic environmental population-attributable fraction (PAF) for atopy in flexural effects, most notably long-term exposure to solar ultraviolet eczema was 27.9% for affluent and 1.2% for nonaffluent radiation (UVR). In this study we have examined whether country centres. Plotting gross national income (GNI) as a UVR can act directly on the structure of fibrillin micro- continuous variable against either ORs or PAFs for atopy in fibrils. flexural eczema confirmed a highly significant positive asso- Fibrillin microfibrils were isolated by bacterial collagenase ciation (P = 0.006 and P < 0.001, respectively). We found digestion/size-exclusion chromatography from photoprotected a linear trend between flexural eczema probability and human buttock skin. Following extraction, one half of the the number of positive skin prick tests only where ) microfibril suspension was irradiated with 50 mJ cm 2 broad- the association between allergic sensitization and flexural band UVR (Philips TL-12, 280–400 nm; minimal erythema eczema was significant. ) dose 70 mJ cm 2) prior to visualization by atomic force The association between atopy and flexural eczema is weak microscopy and mass mapping by scanning transmission elec- and more variable than previously suggested, and the strength tron microscopy (STEM). Morphologically abnormal micro- of this association is positively linked to GNI.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1103

O19 hypothesis by assessing the effect of helminth eradiation A comprehensive survey of 28 candidate genes for atopic on allergic outcomes in a randomized double-blind placebo- dermatitis using a hapTAG approach in a unique controlled trial in children in central Vietnam. Bangladeshi population of East London We randomly allocated 1566 schoolchildren aged 6–17 years C. Sinclair, E.A. O’Toole, D. Paige, C.A. Mein and to receive either helminth eradication therapy or placebo at 0, D.P. Kelsell 3, 6 and 9 months, and compared change in exercise-induced Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and the bronchoconstriction, allergen skin sensitization to Dermatophago- London School of Medicine and Dentistry, Queen Mary, University of London, UK ides pteronyssinus, D. farinae and cockroach allergen, questionnaire- Corresponding author: [email protected] reported wheeze and rhinitis as well as flexural dermatitis on Atopic dermatitis (AD) is a common skin disease of childhood physical examination between 0 and 12 months. and, like many common complex disorders, it has a multifactorial Of the 1566 children, 1487 (95%) completed the study. genetic component. Here we report a genetic investigation into Hookworm was the commonest helminth with a prevalence of the Bangladeshi population of East London in 80 families with two 65% (1015 of 1566). Antihelminthic treatment was efficacious or more siblings with AD. Mutations in the gene encoding the proin eradicating infection (odds ratio, OR for albendazole vs. tein filaggrin (FLG) have been reported to be a major predisposing placebo = 0.10, 95% confidence interval, CI 0.08–0.13). There factor for AD (Palmer CN, Irvine AD, Terron-Kwiatkowski A et al. was no effect of therapy on exercise-induced bronchoconstric- Common loss-of-function variants of the epidermal barrier protein tion (P = 0.8), but the prevalence of sensitization to any one of filaggrin are a major predisposing factor for atopic dermatitis. Nat the three allergens tested increased in the treatment group Genet 2006; 38:441–6). The previously reported rare alleles within (adjusted OR for any positive skin prick test = 1.37, 95% CI FLG were not seen to be associated with AD in this population. In 1.03–1.82). There were nonsignificant increases in the preva- addition, five hapTAG single nucleotide polymorphisms (SNPs) lence of questionnaire-reported wheeze (OR 1.18, 95% CI 0.36– were not found to be associated (P < 0.05) with either affected 3.88) and rhinitis (OR 1.39, 95% CI 0.89–2.16), and in the status or total serum IgE levels. occurrence of flexural dermatitis (OR 1.15, 95% CI 0.38–3.42). Towards understanding the genetic association to AD in this This study suggests that helminth eradication increases the population, 27 candidate genes were screened using the new Illu- prevalence of allergic skin sensitization. Prolonged deworming mina technology. We undertook a hapTAG SNP approach to target may therefore also increase the prevalence of clinical allergic common genetic variation. SNPs were picked using a version of disease. Tagger implemented in Haploview with a minor allele frequency 2 of 0.15 and an r = 0.8. A preliminary analysis of the studied O21 genes shows strong association with ST2. Mutations in the distal The role of type VII collagen in squamous cell carcinoma promoter of ST2 have previously been associated with AD (Shimizu invasion in recessive dystrophic epidermolysis bullosa M, Matsuda A, Yanagisawa K et al. Functional SNPs in the distal V.L. Martins, J.J. Vyas, K.J. Purdie, M. Chen,1 promotor of the ST2 gene are associated with atopic dermatitis. J.A. McGrath,2 A. Storey, A.P. South and Hum Mol Genet 2005; 14:2919–27). ST2 encodes interleukin-1 E.A. O’Toole receptor-related proteins and is widely expressed in haemato- Centre for Cutaneous Research, ICMS, Queen Mary, University of London, poietic,helperT,andvariouscancercells.SixteentagSNPswere UK, 1Department of Dermatology, University of Southern California, USA picked and, of these 16 markers, seven had a P <0.05.Someof and 2St John’s Institute of Dermatology, Guy’s, King’s College and the other 26 genes analysed, known AD and novel AD genes, also St Thomas’ School of Medicine, London, UK demonstrated a strong genetic association and will be presented. Corresponding author: [email protected] In conclusion, we have found using a candidate gene asso- In recessive dystrophic epidermolysis bullosa (RDEB) due to ciation study that FLG is not associated with AD and that ST2 mutations in the type VII collagen gene, metastatic squamous is associated with AD in the Bangladeshi population. cell carcinoma (SCC) is the major cause of mortality in young adults. Because reduction in type VII collagen expression is a O20 hallmark of RDEB, we investigated whether type VII collagen Regular antihelminthic therapy increases allergen levels affected proteinase expression or cell migration and inva- skin sensitization: a randomized, double-blind, sion, factors involved in tumour progression. SCC cell lines placebo-controlled trial in Vietnam derived from patients with and without RDEB, as well as C. Flohr,1,2 L.N. Tuyen,2 S. Lewis,1 R. Quinnell,3 COL7A1-transduced RDEB SCC cell lines were established. RNA T.T. Minh,2 J. Campbell,2 D. Pritchard,1 T.T. Hien,2 interference (RNAi) was used to downregulate collagen VII J. Farrar,2 J. Britton1 and H.C. Williams1 expression in a non-RDEB SCC cell line. Levels of metalloprote- 1Institute of Clinical Research, Nottingham University, Nottingham, UK, inase (MMP) and serine proteinase expression were measured in 2Oxford University Clinical Research Unit, Ho Chi Minh City, Vietnam the different cell lines by Western blotting and gelatin zymogra- and 3Faculty of Biological Sciences, Leeds University, Leeds, UK phy, and scratch and colloidal gold assays were performed to Corresponding author: [email protected] assess cell migration. Observational evidence suggests that infection with geohelm- Organotypic cultures of RNAi cells were performed. An inths protects against allergic disorders. We have tested this RDEB SCC cell line with absent expression of type VII collagen

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1104 BSID abstracts showed reduced levels of the metalloproteinase MMP-2 and O23 the serine proteinase PAI-1, and increased levels of the metal- RANK is a regulator of keratinocyte growth and loproteinase inhibitor TIMP-1, after COL7A1 transduction. apoptosis: potential role in cutaneous malignancy 1 RNAi for type VII collagen in MET1 cells (siMET1) resulted in J-B.O. Barbaroux, C.G. Mueller and R.W. Groves complete knock-down of the protein in these cells. siMET1 St John’s Institute, Kings College London, UK and 1IBMC, Strasbourg, France cells showed a 60% (n = 3) increase in cell motility, and in- Corresponding author: [email protected] creased expression and activity of MMP-2. Organotypic cul- The tumour necrosis factor (TNF) superfamily signalling path- tures of siMET1 had a significant decrease in involucrin and way, consisting of RANK, its ligand (RANKL) and a decoy K10 staining when compared with control cells, suggesting receptor osteoprotegerin (OPG), has been associated with that loss of type VII collagen may result in decreased SCC dif- numerous activities including regulation of dendritic cell func- ferentiation. Our data suggest that type VII collagen directly tion, differentiation and activation of osteoclasts as well as modulates proteinase activity and cell migration, and may also major functions in epithelial systems. We have previously be involved in regulating SCC differentiation, factors which demonstrated expression of RANK and its ligand in epidermis may contribute to the aggressive behaviour of RDEB SCC. and were therefore interested to explore the potential growth regulatory role of this system in normal and transformed keratinocytes (KCs). O22 Normal human skin samples (n = 3) were analysed by Combining endoplasmic reticulum stress-inducing agents immunofluorescence and flow cytometry for RANK, RANKL with protein disulphide isomerase inhibitors as a novel and OPG expression. Immunofluorescent labelling demonstra- therapeutic strategy for metastatic melanoma ted that RANK and RANKL were expressed by KCs and were P.E. Lovat,1,2 C.P.F. Redfern2 and M.A. Birch-Machin1 significantly regulated with differentiation in situ. OPG could 1Dermatological Sciences and 2Northern Institute for Cancer Research, School not be detected. Flow cytometric analysis of fresh epidermal of Clinical and Laboratory Sciences, University of Newcastle upon Tyne, UK cell suspensions demonstrated intracellular RANKL in all KCs, Corresponding author: [email protected] with additional cell surface bound RANKL in the suprabasal Malignant melanoma remains largely untreatable due to the population. RANK was expressed by all KCs. Functionally, notorious resistance of such tumours to apoptosis induced by RANKL had a marked protective effect against TNF-related conventional mechanisms. Currently there is considerable clin- apoptosis-inducing ligand-induced apoptosis in HaCaT cells ical interest in two agents, fenretinide (a synthetic derivative of (mean D = 12.19%; n =3; P = 0.0103) and significantly vitamin A) and velcade (a 26S proteosome inhibitor), both of increased their growth threefold (n =3; P < 0.001). RANK which induce potent apoptosis of melanoma cells while having and RANKL expression was next analysed in basal cell carci- no effect on normal melanocytes and which we have demon- noma (BCC; n = 5) and in actinic keratoses (n = 3). KCs in strated to induce cell death by targeting mechanisms culmin- both tumours expressed RANKL and demonstrated increased ating in endoplasmic reticulum (ER) stress. Targeting ER stress- expression of RANK and dysregulated differentiation-associated induced apoptosis presents a powerful therapeutic approach expression of both molecules, with increased labelling of the but may be counteracted by the defensive homeostatic unfolded basal compartment. protein response resulting in the upregulation of protein disul- These data indicate that RANK and RANKL are regulated phide isomerase (PDI) family members, key chaperones which upon KC differentiation and transformation. Signalling assist in the clearance of unfolded proteins and promotion of through RANK sustained HaCaT growth and survival. In other cell survival. The aim of the current study was to test the hy- cell types RANK mediates activation of NFjB, AKT and JNK pothesis that the efficacy of ER stress-induced apoptosis in pathways, all known to play key roles in skin cancers. We response to fenretinide or velcade would be increased by the hypothesize that RANKL signalling may protect transformed combination of these agents with inhibitors of PDI. Dose- KCs in BCC and actinic keratoses from apoptosis and promote response and fixed dose ratio experiments with bacitracin and their proliferation. novel PDI inhibitors were performed in combination with fenretinide or velcade in a panel of melanoma cell lines and apoptosis evaluated by flow cytometry. ER stress-induced apoptosis O24 was confirmed by Western blotting for GADD153, the key tran- Defining the role of B-RAF-induced extracellular scription factor regulating the transition from prosurvival to signal-related kinase in the resistance of metastatic proapoptotic signalling during ER stress. Results demonstrated melanoma to apoptosis there was no apparent toxicity using PDI inhibitors alone and D.S. Hill,1 J.L. Armstrong,2 M.A. Birch-Machin1 and confirmed that a synergistic apoptotic response was induced by P.E. Lovat1,2 the combination of fenretinide or velcade (e.g. for the combin- 1Dermatological Sciences and 2Northern Institute for Cancer Research, School ation of bacitracin and fenretinide at a fixed dose ratio of 50:1, of Clinical and Laboratory Sciences, University of Newcastle upon Tyne, UK

ED50, CI = 0.096). These data support the novel concept of Corresponding author: [email protected] combining ER stress-inducing agents with PDI inhibition as a Malignant melanoma, the most aggressive form of skin cancer, more effective therapeutic strategy for metastatic melanoma. is largely unresponsive to current chemotherapy due to the

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1105 notorious resistance of such tumours to apoptosis. During mechanisms governing this stress resistance are unknown, melanoma progression melanocytes become transformed due although the demonstrated export of telomerase from the nuc- to DNA mutations which frequently involve the B-RAF kin- leus to the cytoplasm under oxidative stress suggests that this ase. Activated mutants of B-RAF (e.g. B-RAFV600E) occurring function could be regulated from outside the nucleus. in 70% of all melanomas result in enhanced activation of The present study has assessed the effects of stable extracellular signal-regulated kinase (ERK) pathways resulting telomerase transfection in MRC5 fibroblasts on mitochondrial in tumour survival and progression. The mechanism(s) by DNA (mtDNA) damage and repair in response to oxidative which the downstream effects of B-RAF-induced ERK activa- stress from long-term hyperoxic culture (40% oxygen) and tion result in the resistance of melanoma cells to apoptosis, hydrogen peroxide treatment. mtDNA encodes essential sub- however, remain entirely unclear but are likely to involve the units of the mitochondrial respiratory chain, and damage to activation of inhibitor of apoptosis proteins (IAPs) which this genome from a variety of genotoxins has been linked with block caspase activation. The aim of the current study was to the induction of apoptosis. Using a novel real-time polymerase test the hypothesis that mutation of B-RAF increases IAP chain reaction assay we have found that telomerase expression expression and that blocking B-RAF-induced ERK signalling confers significant resistance to mtDNA damage in response to sensitizes melanoma cells to drug-induced apoptosis in both stresses and also blocks the adaptive increase in mitochon- response to agents able to target apoptosis via endoplasmic dria under long-term hyperoxic culture. The potentially pivotal reticulum (ER) stress. RNA interference (RNAi)-mediated role of mtDNA damage in triggering apoptosis and senescence knockdown of B-RAFV600E in B-RAF-mutated melanoma means that this novel role for telomerase may have crucial cells significantly increased apoptosis in response to the implications for the development and treatment of hyperprolif- ER stress-inducing agents fenretinide or velcade (both erative skin conditions such as psoriasis and skin carcinomas. P < 0.001). Treatment of cells with a MEK-specific inhibitor also increased both fenretinide- and velcade-induced apoptosis (both P < 0.01), and RNAi-mediated knockdown of both P2 V600E B-RAF and MEK inhibition resulted in at least a twofold Cell-penetrable peptide-based delivery of oligonucleotide downregulation of expression of X-linked IAP and survivin. antisense/peptide nucleic acid directed against These results suggest that blocking B-RAF-induced ERK tyrosinase signalling increases the sensitivity of melanoma cells to ER P. Kumar, C. Pickard, M.A. Fara,1 M. Bradley,1 stress-induced apoptosis through the downregulation of IAPs P.S. Friedmann and E. Healy and defines a novel therapeutic strategy for B-RAF-mutated Department of Dermatopharmacology, University of Southampton and melanoma in which the combination of agents to abrogate 1Department of Chemistry, University of Edinburgh, UK B-RAF-induced ERK with agents to target the IAP family Corresponding author: [email protected] member most crucial for melanoma cell survival will over- Poor absorption of many drugs through the stratum corneum come the apoptotic resistance of such tumours. limits the availability of topical therapeutic agents to treat skin disorders. Cell-penetrable peptides are carrier molecules which have the ability to deliver cargo molecules into cells and occasionally through the stratum corneum. Poster presentations We have previously developed a polypseudolysine (PPL)- based carrier molecule which can deliver a-melanocyte stimula- P1 ting hormone (aMSH) into cells and skin. To investigate Telomerase-dependent protection of mitochondrial DNA whether this PPL compound could transport agents capable of in response to oxidative stress interfering with gene function in cells, we designed PPL-conju- M.J. Birket, M.A. Birch-Machin, S. Ahmed,1 gated antisense compounds aimed at switching off tyrosinase T. Vonzglinicki1 and G. Saretzki1 gene function. A PPL-conjugated antisense oligonucleotide and Dermatological Sciences, Institute for Cellular Medicine and 1Institute for PPL-linked peptide nucleic acid (PNA) which targeted the trans- Ageing and Health, University of Newcastle upon Tyne, UK lational start site of the tyrosinase gene were generated and tes- Corresponding author: [email protected] ted in an in vitro B16F10 cell-based tyrosinase and melanin assay. In somatic tissues such as skin, cell division results in progres- Our results show that the PPL-oligonucleotide antisense ) ) sive telomere shortening which acts to limit replicative capacity. inhibits the baseline tyrosinase activity at 10 5 mol L 1 in three ) ) Telomerase is a ribonucleoprotein which counteracts telomere separate experiments. In addition, PPL-PNA (10 5 mol L 1) ) ) shortening and is able to immortalize cells. The catalytic subunit inhibited aMSH (10 10 mol L 1) induced tyrosinase activity in ) ) of this enzyme is downregulated in the majority of somatic tis- each experiment (n = 3). Furthermore, aMSH (10 10 mol L 1) sues but is reactivated in 90% of human cancers and has also induced pigmentation of B16F10 cells was inhibited by PNA- ) ) been identified in psoriatic lesions as well as in normal sun- PPL at 10 5 mol L 1 (n = 2). exposed skin. Intriguingly, telomerase activity has been shown Further work is ongoing; however, the results indicate that to promote cell survival and stress resistance by mechanisms a PPL-based approach may be useful in targeting skin-related largely independent of its role in telomere maintenance. The genes.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1106 BSID abstracts

P3 by loss-of-function mutations in the KIND1 gene which Lithium inhibits the transcriptional activation, mRNA encodes kindlin-1, an actin cytoskeleton–focal contact-associ- and protein expression of transglutaminase 1 in ated protein that is predominantly expressed in keratinocytes. keratinocytes We investigated the molecular basis of KS in a 16-year-old P.J. Hampton, O.K. Ross and N.J. Reynolds Indian boy who had additional unusual clinical findings, Dermatological Sciences, University of Newcastle upon Tyne, UK including scleroatrophic changes of the hands and feet, pseudo- Corresponding author: [email protected] ainhum and early onset of squamous cell carcinoma on his Lithium (Li) is used to treat bipolar disorder and may induce foot. Immunostaining for kindlin-1 in the patient’s skin was or exacerbate psoriasis. The signalling mechanisms underlying completely absent and sequencing of KIND1 genomic DNA Li-provoked psoriasis are unknown. Li inhibits a number of showed a homozygous splice site mutation at the –6 position, enzymes including glycogen synthase kinase 3 (GSK-3) and IVS9-6TfiA. No other potentially pathogenic sequence variants inositol monophosphatase (IMPase). In the brain, Li inhibits were found in any other KIND1 exon or flanking intron. Ampli- IMPase leading to inositol depletion, and a reduction in phos- fication and sequencing of cDNA from the skin revealed aber- phoinositide and intracellular calcium signalling. In psoriasis, rant splicing with either deletion of exon 10 or deletion of expression of the protein transglutaminase 1 (TGase 1) is exons 9, 10 and 11, both of which involve loss of the pleck- increased. We investigated whether Li regulates TGase 1 pro- strin homology domain of kindlin-1 that is thought to play a moter activity via GSK-3- or IMPase-dependent mechanisms. role in cytoskeletal attachment and integrin-mediated cell sig- Cultured human keratinocytes were transfected with a lucif- nalling. Pathogenic splice site mutations at the –6 position are erase reporter containing the promoter region from the TGase unusual and have rarely been reported for any genetic disorder. 1 gene. Li decreased basal promoter activity (2.4-fold decrease In silico analysis of the impact of IVS9-6TfiA on splicing pre- )1 with 10 mmol L Li, subset ANOVA P = 0.006, n =3· 3). Li dicts only a minor effect, despite the cDNA findings in this also inhibited increased extracellular calcium-induced activation case. An alternative explanation is that the cryptic splicing in of the luciferase reporter (3.2-fold decrease, ANOVA P < 0.005, this patient is caused by a lariat branchpoint mutation (predic- n =3· 3). To investigate the effect of GSK-3b on the TGase 1 ted to be at –8 position for intron 9) rather than by abolition promoter, dominant negative and constitutively active GSK-3 of the acceptor splice site. This case of KS has unusual clinical (caGSK-3) mutants were cotransfected with the TGase 1 lucif- and molecular features which provide further insight into erase reporter. Inhibition of GSK-3 activity increased promoter genotype–phenotype correlation in this rare genodermatosis. activation (2.6-fold increase, P < 0.005, n =3· 3) while caG- SK-3 reduced promoter activity (2-fold decrease, P = 0.06, P5 n =2· 3). This suggested that Li, which inhibits GSK-3 activ- The role of human keratinocytes in T-cell activation ity, was mediating its effects on TGase 1 through a GSK-3-inde- A.P. Black, M. Ardern-Jones, L. Jones and G.S. Ogg pendent pathway. Keratinocytes transfected with the TGase 1 MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, reporter were treated with the specific IMPase inhibitor Oxford, UK L690,330 and a reduction in promoter activity was seen (3-fold Corresponding author: [email protected] decrease, P = 0.002, n =2· 3). By real-time polymerase The role of keratinocytes in the stimulation of T cells is not chain reaction, Li induced a 2-fold reduction in TGase 1 clear. Indeed, some studies have suggested that keratinocytes mRNA. Li also reduced expression of TGase 1 protein by West- are able to induce a state of unresponsiveness in T cells. In ern blot. Li reduced uridine triphosphate-induced intracellular this study, we aimed to investigate the ability of keratinocytes calcium influx, which may reflect reduced availability of inosi- to induce a functional response in antigen-specific memory tol trisphosphate following inhibition of IMPase by Li. CD4+ and CD8+ T cells. It seems unlikely that inhibition of TGase 1 by Li accounts We initially characterized the phenotype of keratinocytes by for Li-induced psoriasis but the effect of Li on other calcium- flow cytometry and found that they constitutively express sensitive proteins warrants further investigation. major histocompatibility complex (MHC) class I and can be induced to express MHC class II molecules and intercellular P4 adhesion molecule-1 by treatment with interferon (IFN)-c. Unusual clinical and molecular findings in Kindler syndrome Keratinocytes were also able to phagocytose fluorescent beads K. Arita,1 V. Wessagowit,1,2 A.C. Inamadar,3 following IFN-c treatment (n = 3). J.E. Lai-Cheong1 and J.A. McGrath1 We next showed that keratinocytes infected with recombin- 1Genetic Skin Disease Group, St John’s Institute of Dermatology, King’s ant virus were able to process and present virally encoded pro- College School of Medicine, London, UK, 2Institute of Dermatology, Bangkok, tein via class I to antigen-specific CD8+ T cells, as measured Thailand and 3Department of Dermatology, Venereology and Leprosy, by cytokine production in an ELISpot assay (more than Karnataka, India 15 000 cytokine spot-forming units per million effector cells; Corresponding author: [email protected] n = 5). In addition, up to 90% of keratinocytes pulsed with Kindler syndrome (KS) is a rare inherited skin disorder with peptide were killed by CD8+ T cells in a cytotoxicity assay blistering and poikiloderma as its main clinical features (n = 4). T cells stimulated in this way survived in culture for although clinical heterogeneity is well recognized. It is caused over 2 weeks and showed no loss of function (n = 3).

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1107

Lastly, IFN-c-treated keratinocytes pulsed with recombinant P7 protein were able to induce cytokine secretion by CD4+ T cells Seborrhoeic warts are the benign cutaneous change most specific for an epitope within the recombinant protein (> 5000 associated with skin cancer in renal transplant recipients 1 1 cytokine spot-forming units per million effector cells; n = 3). A. Lally, B. Imko, D. Casabonne, R. Newton and These data show that keratinocytes are able to process and F. Wojnarowska present both endogenous and exogenous antigens via class I Department of Dermatology, Oxford Radcliffe Hospitals, Oxford and 1 and class II pathways to CD8+ and CD4+ T cells, respectively. Cancer Epidemiology Unit, University of Oxford, UK We suggest that keratinocytes play a pivotal role in the induc- Corresponding author: [email protected] tion and maintenance of memory T-cell activation during the Renal transplant recipients (RTRs) are at an increased risk of cutaneous immune response. skin cancer. Sebaceous hyperplasia has been reported to be associated with skin cancer in this population. We carried out a case–control study to investigate whether seborrhoeic warts P6 and other benign cutaneous changes were associated with The effect of acute social stress on cutaneous T-cell greater risk of skin cancer in RTRs. trafficking Data were collected prospectively between May 2005 and C.E. Kleyn, L.F. Cotterell, R.E.B. Watson, August 2006 on an unselected group of 308 RTRs. Complete H.L. Richards, G. Terenghi1 and C.E.M. Griffiths cutaneous examination was carried out and histopathology The Dermatology Centre and 1Blond McIndoe Laboratories, The University of records reviewed. Statistical analysis was carried out using SPSS Manchester, Manchester, UK (Chicago, IL, USA). Corresponding author: [email protected] Seventy-eight (25.3%) RTRs had a history of skin cancer in- Acute stress is an evolutionary survival mechanism known to cluding 53 (17.2%) with squamous cell carcinoma (SCC), and have immunoenhancing effects that may be deleterious for 168 (54.5%) RTRs were found to have seborrhoeic warts on inflammatory skin disease but beneficial for immunoprotection clinical examination. Seborrhoeic warts increased in prevalence in terms of wound healing or infection. We examined the with increasing age (P < 0.001) and duration of transplant effect of acute social stress on cutaneous T-cell trafficking and (P < 0.001). Logistic regression analysis identified that skin dermal adhesion molecule expression. cancer was almost eight times more likely in RTRs with sebor- We used a laboratory stress task (modified Trier) to induce rhoeic warts (odds ratio, OR 7.78, P < 0.001). When con- social stress by instructing volunteers to give a short speech to founding factors were considered, a significant association was an expert audience. All volunteers (n = 28; 12 male; mean age still identified (OR 3.67, P = 0.001). A greater association was 24 years, range 18–45) had a baseline 6-mm biopsy taken found between seborrhoeic warts and SCC (unadjusted OR under local anaesthetic from sun-protected buttock skin. 8.93, P < 0.001; adjusted OR 4.01, P = 0.004). The associ- Cohort 1 (n = 14) had a second biopsy taken from contralater- ation between skin tags and skin cancer was weaker (OR 2.29, al buttock skin 24 h after exposure to the Trier stressor. Con- P = 0.002) and became insignificant when confounding factors trols (nonstressed; cohort 2: n = 14) did not take the Trier and were adjusted for (OR 1.81, P = 0.062). Sebaceous hyperplasia had biopsies taken 24 h apart. Cryosections (10 lm) were was not associated with skin cancer (OR 1.36, P = 0.291). prepared to detect T-cell infiltrate, using a pan T-cell We found that RTRs with seborrhoeic warts were more likely marker (anti-CD3), and E-selectin expression (anti-CD62E) to develop skin cancer even when age, duration of transplant, was assessed by standard immunoperoxidase histochemistry gender, ethnicity, sun exposure and immunosuppression were and light microscopy. Expression of dermal CD3+ cells was taken into consideration. No other benign cutaneous changes scored on a semiquantitative five-point scale (0 = none; were as strongly associated. We hypothesize that a shared aetiol- 4 = abundant) while epidermal CD3 and E-selectin expression ogy such as infection with human papillomavirus may give rise were scored on a semiquantitative four-point scale (0–3). A to the association between seborrhoeic warts and skin cancer. CD3+ T-cell infiltrate was observed predominantly in a peri- Future studies are required to investigate this further. vascular distribution in the papillary and reticular dermis. Isola- ted CD3+ T cells were observed in the epidermis. At 24 h, the P8 mean ± SD dermal CD3 scores increased from 1.52 ± 0.5 to Erythemal sensitivity does not predict ultraviolet 1.92 ± 0.7 in the Trier group in contrast to a reduction from B-induced epidermal CD1a+ Langerhans cell loss or 1.74 ± 0.6 to 1.40 ± 0.6 in the control group. The difference caspase-3 activation in polymorphic light eruption (0.74; 95% confidence interval 0.02–1.53) between the groups J. Tye, A. Blackburn, S.M. Winhoven, M. Brownrigg, achieved statistical significance (P = 0.04). However, a signifi- L.E. Rhodes and N.K. Gibbs cant difference between the groups was not observed in terms Dermatological Sciences, The University of Manchester Medical School, of either epidermal CD3 or E-selectin expression. Manchester, UK This suggests that acute social stress induces trafficking of T Corresponding author: [email protected] cells to the skin. These data may be important to our under- Studies based on individual erythemal photosensitivity suggest standing of the role of the ‘brain–skin’ axis in stress-respon- that reduced photoimmunosuppression may be involved in the sive inflammatory skin disease. aetiology of polymorphic light eruption (PLE) (e.g. van de

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1108 BSID abstracts

Pas CB, Kelly DA, Seed PT et al. Ultraviolet-radiation-induced consequences of NFAT activation remain to be defined. In this erythema and suppression of contact hypersensitivity responses in study, five UV radiation sources with differing spectral emis- patients with polymorphic light eruption. J Invest Dermatol 2004; sion were used to determine the wavelength dependency of 122:295–9). Loss of epidermal Langerhans cells (LCs) follow- transcriptional activity (luciferase assay) and cellular localiza- ing ultraviolet (UV) B irradiation is an important event in tion (GFP-NFAT2) of NFAT in HaCaT cells and normal human photoimmunosuppression. In this study we investigate the epidermal keratinocytes (NHEK). All five UV sources increased relationship between erythemal sensitivity, loss of CD1a+ LCs and NFAT transcriptional activity (n =3· 3, P £ 0.001) in a dose- activation of the apoptotic effector caspase-3 (c-3) in normal indi- dependent manner, with effectiveness inversely associated with viduals and subjects with PLE. wavelength. The greatest change was observed with TL-12 Nine healthy subjects and eight with PLE were irradiated on lamps (53% UVB; 8-fold) compared with Arimed B lamps (4% ) buttock skin with a series (21–200 mJ cm 2) of broadband UVB; 4-fold). The dose required to induce a 3-fold increase in (TL-12) UVB. Twenty-four hours later, biopsies were taken NFAT activity was 238 times greater with Arimed B compared ) from the 200 mJ cm 2 site and a nonirradiated site. Diastron with TL-12. The action spectrum for NFAT activation was erythema meter readings were used to calculate D0.025 as an determined by mathematical induction exploring three candi- objective measure of individual erythemal sensitivity. CD1a+ date models and was distinct from the action spectra for DNA LCs were scored in epidermal sheets. Cryosections were dou- damage and erythema. UV radiation also induced NFAT nuclear ble stained with antibodies against CD1a+ and activated c-3. translocation in HaCaT cells and NHEK, more specifically UVB-induced CD1a+ LC loss was similar (P = 0.34) in nor- GFP-NFAT2 (n =3· 3, P £ 0.001) in a parallel wavelength- mal (mean ± SEM loss 60.3 ± 7.1%) and PLE (69.6 ± 6.2%) dependent fashion. The greatest increase in nuclear transloca- skin. A relationship between CD1a+ LC loss and individual tion was 14-fold with TL-12 compared with 6-fold with 2 D0.025 was observed in normal (R = –0.68) but not in PLE Arimed B. There was a correlation between the UV doses subjects (R2 = 0.03). Epidermal c-3 staining after UVB in- required to activate NFAT and doses that induced keratinocyte creased similarly (P = 0.75) in normal (mean ± SEM number apoptosis quantified by flow cytometry (sub-G1 population and of cells per high-power field 18.2 ± 4.7; P = 0.005) and PLE annexin V). TL-12 and Arimed B induced apoptosis only when skin (23.0 ± 5.4; P = 0.016). c-3 activation correlated with ‘NFAT-activating’ doses were administered. These data identify 2 individual D0.025 in normal skin (R = –0.35) but not in PLE UVB as a potent activator of NFAT in keratinocytes and suggest skin (R2 = 0.0075). Colocalization of CD1a+ was observed in that NFAT may play a role in UV-induced apoptosis. two of 911 normal c-3+ cells and none of 787 PLE c-3+ cells. In both normal and PLE skin there was little evidence that P11 CD1a+ LCs undergo c-3-mediated apoptosis in response to Characterization of IL-1F9 activity in human keratinocytes UVB. UVB-induced CD1a+ LC loss and c-3 activation are J.B. Mee and R.W. Groves quantitatively normal in PLE but are not individually correl- St John’s Institute of Dermatology, King’s College London, UK ated with erythemal sensitivity. This suggests that, unlike in Corresponding author: [email protected] normals, erythemal sensitivity may not be a good predictor of The interleukin (IL)-1 family cytokines IL-1a, IL-1b and IL-18 photoimmunosuppression in PLE. are well-characterized mediators of cutaneous inflammation. A further seven structurally related molecules have been cloned (IL-1F5–IL-1F11) but their relevance to cutaneous biology P9 remains to be determined. We have previously used microarray Poster withdrawn. analysis of human keratinocytes to demonstrate a strong induction of IL-1F9 following exposure to IL-1a but not to inter- P10 feron (IFN)-c and were interested to determine the specificity Ultraviolet radiation activates the transcription factor and functional consequences of this effect. NFAT and derivation of the action spectrum for NFAT Second-passage adult human keratinocytes were exposed to activation IL-1a, IL-18, tumour necrosis factor (TNF)-a, IFN-c (all ) ) R.J. Flockhart, B.L. Diffey, P.M. Farr and N.J. Reynolds 100 ng mL 1) or lipopolysaccharide (10 lgmL 1) for 24 h, Dermatological Sciences, University of Newcastle upon Tyne, UK prior to lysate preparation and Western blot analysis. Signifi- Corresponding author: ross.fl[email protected] cant upregulation of IL-1F9 was observed from very low con- Investigating the molecular targets of ultraviolet (UV) radiation stitutive levels only in the IL-1a-treated cells, with minor and the signal transduction pathways activated may increase induction by TNF-a. To assess the functional consequence of understanding of both its detrimental and therapeutic effects. this, keratinocytes were exposed directly to IL-1F9 (30– ) Nuclear factor of activated T cells (NFAT) is a Ca2+ regulated 300 ng mL 1, 24 h) and supernatants tested for IL-8 release transcription factor expressed in a variety of tissues, exerting by enzyme-linked immunosorbent assay, as an indicator of diverse functions ranging from embryonic development and proinflammatory activity. In addition, IL-1a-stimulated kera- cytokine expression to apoptosis. NFAT proteins are func- tinocytes were coincubated with increasing concentrations tionally active in skin but the various physiological and of either recombinant IL-1F9 or an anti-IL-1F9 monoclonal ) environmental signals that activate NFAT and the biological antibody (0.5–10 lgmL 1, 24 h) and IL-8 levels measured.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1109

IL-1F9 failed to give dose-dependent direct induction of IL-8 P13 and exhibited neither inductive nor repressive effects on IL-1- International Study of Asthma and Allergies in Childhood mediated IL-8 release. Real-time reverse transcription–poly- (ISAAC) Phase 1 and 3 Study Groups 1 2 merase chain reaction confirmed the transcription of IL-1R6, H.C. Williams, A. Stewart, E. von Mutius, 3 4 the ligand-binding receptor chain for IL-1F9, by keratinocytes, W. Cookson and H. Ross Anderson and fluorescence-activated cell sorting analysis of IL-1a-stimu- Centre of Evidence-Based Dermatology, University of Nottingham, Notting- 1 lated keratinocytes indicated that the vast majority of IL-1R6 ham, UK, Department of Community Health, University of Auckland, 2 3 was intracellular, rather than membrane associated. New Zealand, University Children’s Hospital, Munich, Germany, Asthma These data demonstrate specific interactions between IL-1a Genetics Group, Wellcome Trust Centre for Human Genetics, Oxford, UK 4 and IL-1F9, further increasing the complexity of regulation of and Department of Public Health Sciences, St George’s Hospital, London, UK the IL-1 family in skin. Although the function of IL-1F9 Corresponding author: [email protected] remains to be established, the failure to elicit a response fol- We sought to investigate world-wide trends in childhood lowing exposure to IL-1F9 and the localization of IL-1R6 sug- eczema by conducting repeat prevalence surveys of schoolchil- gest either potential intracellular functions in keratinocytes or dren 5–10 years apart [International Study of Asthma and Aller- a role in sequestration-related innate immune mechanisms. gies in Childhood (ISAAC) Phase 1 and 3] in the same study centres using validated and translated questionnaires. P12 Study participants were children (n = 302 159) aged 13–14 The effect of repeated low doses of solar-simulated years in 105 centres from 55 countries and children aged 6–7 radiation on immune responses in human skin years (n = 187 943) in 64 centres in 35 countries participating J. Narbutt, A. Lesiak and M. Norval1 in both Phase 1 and 3 of the ISAAC surveys. Children with an Dermatology Department, Medical University of Lodz, Lodz, Poland and itchy relapsing flexural skin rash in the last 12 months were 1Biomedical Sciences, University of Edinburgh Medical School, Edinburgh, UK considered to have eczema. Severe eczema was defined as Corresponding author: [email protected] eczema that led to one or more disturbed nights per week. Our Although it is recognized that ultraviolet (UV) radiation can main outcome measure was annual average change in preva- suppress cutaneous immunity in human subjects, the impact lence plotted against average prevalence across Phase 1 and 3. of chronic suberythemal solar-simulated radiation (SSR) has Annual changes in prevalence were generally small and mixed not been evaluated. We tested this impact, particularly to in direction according to age of participants and world region. determine if photoadaptation and photoprotection develop For the 13–14-year group, eczema symptom prevalence fell in over time. some of the previously highest prevalence centres from the To assess photoadaptation, groups of at least seven volun- developed world such as the UK, Scandinavia and New Zealand, teers were whole-body irradiated each day, for up to 30 days, whereas that in centres with previously high prevalence rates with a low dose of SSR. To assess photoprotection, this was from developing countries continued to rise. In the 6–7-year followed, in some instances, by a single erythemal UVB dose age group, most centres showed a rise in eczema symptom on a small body area. Erythema was measured 24 h after the prevalence for eczema symptoms in the last year. Similar pat- final SSR or UVB exposure and the contact hypersensitivity terns to these were noted for those with severe eczema at both (CHS) response to diphenylcyclopropenone was tested. Skin ages. biopsies were collected for the measurement of thymine dimers by immunohistochemistry, cyclooxygenase (COX)-1 and P14 COX-2 proteins by immunohistochemistry and expression of Cutaneous human papillomavirus early genes several cytokine mRNAs [interleukin (IL)-1b, IL-6, IL-10 and downregulate serine phosphorylated Akt1 while tumour necrosis factor-a] by reverse transcription–polymerase upregulating Akt2 expression chain reaction. Comparisons were made between the groups R.F.L. O’Shaughnessy,1 B. Akgul,1 A. Storey,1,2 and with a group of unirradiated controls. H. Pfister,3 C.A. Harwood1,2 and C. Byrne1,2 The SSR did not cause erythema but induced suppression of 1Institute of Cell and Molecular Science, Cutaneous Research and CHS, and an increase in thymine dimers, COX-1 and COX-2 2Cancer Research UK Skin Tumour Laboratory, Queen Mary University of proteins and cytokine mRNAs. As the number of SSR exposures London, UK and 3Institute of Virology, University of Cologne, Germany rose, there was increased suppression of CHS and increased Corresponding author: [email protected] expression of COX proteins but decreased thymine dimers and The role of AKT signalling in epithelial cancers is a subject of cytokine mRNAs, indicating that some photoadaptation for intense research. The current consensus is that there is an over- these last two factors had occurred. When tested by irradiating all increase in AKT activity measured by the expression levels with an erythemal UVB dose, a limited degree of photoprotec- of Ser 473 phosphorylated AKT (pSerAkt). In this paper we tion was apparent as a result of the pre-exposures to SSR for demonstrate that, paradoxically, the early genes of the high- erythema, thymine dimers and cytokine mRNAs but not for risk human papillomavirus (HPV)-8 initially function to down- the COX proteins. Thus personal protective strategies are advis- regulate Akt1 and pSerAkt expression while increasing the able to prevent some adverse immune outcomes from solar expression of Akt2. Thr 308 phosphorylated Akt levels irradiation, even in subjects who have developed a tan. remained unchanged. This resulted in alteration of expression

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1110 BSID abstracts of epidermal differentiation markers, leading to cornified compatibility between Affymetrix and Illumina expression envelope fragility, which we hypothesize is exploited by HPV microarray platforms when using GeneSpring software. to allow virion escape and increased infectivity. It is only during malignancy that pSerAkt activity is re-established; however, P16 now it is linked with Akt2 activity as Akt1 expression remains Association of single nucleotide polymorphisms in the absent. We show that the HPV transcriptional regulator E2 is PTPN22 gene region and type I psoriasis 1 1,2 1 1 responsible for the downregulation of both Akt1 and pSerAkt, R.L. Smith, R.B. Warren, S. Eyre, X. Ke, 2 3 2 while the E7 oncoprotein did not increase pSerAkt expression H.S. Young, J.N.W.N. Barker, C.E.M. Griffiths and 1 in organotypic cultures. Analysis of human viral warts revealed J. Worthington 1 2 that the initial loss of Akt1 and pSerAkt was a common occur- arc Epidemiology Unit and The Dermatology Centre, University of 3 rence, whereas rare instances of Akt2 increase and reinitiation Manchester, Manchester and Skin Therapy Research Unit, St John’s Institute of pSerAkt correlated with the severity of the neoplasia. of Dermatology, King’s College London, St Thomas’ Hospital, London, UK Together, these data demonstrate for the first time a pathology Corresponding author: [email protected] that exploits the specific downregulation of pSerAkt activity. A polymorphism (rs2476601, C1865T) in the protein tyrosine phosphatase (PTPN22) gene, a haematopoietic-specific regulator of T-cell activity, has previously been associated with a number of chronic inflammatory and autoimmune diseases including P15 type I diabetes and rheumatoid arthritis. A study of psoriasis Identification of the molecular signatures in cutaneous patients in Germany found no association to this single nucleo- squamous cell carcinoma excised from patients with tide polymorphism (SNP) but did detect association to other recessive dystrophic epidermolysis bullosa by using SNPs in the PTPN22 gene region. We investigated association of integrated genomic techniques SNPs in the PTPN22 region in UK patients with psoriasis. Using X. Mao, C. Pourreyron, K. Purdie, M.V. Holder, N. Baksh, T. Wong,2 H. Fassihi,2 A. Volz,3 I.R. Hart,1 Sequenom MassArray technology we genotyped 13 SNPs map- C. Harwood, C.M. Proby, L. Bruckner-Tuderman,3 ping to the PTPN22 region in 647 patients with type I psoriasis D.P. Kelsell, J.A. McGrath,2 I.M. Leigh and A.P. South (age at disease onset £ 40 years) and 566 controls. Centre for Cutaneous Research, ICMS and 1Cancer Research UK Clinical Association to three SNPs was detected (P < 0.05). These Centre, Barts and The London, 2Genetic Skin Disease Group, St John’s three SNPs were genotyped in an additional 253 unrelated Institute of Dermatology, London, UK and 3Department of Dermatology, patients with type I psoriasis and 2024 controls. Further evi- University of Freiburg, Germany dence of association of these SNPs was obtained: rs1217414 Cutaneous squamous cell carcinoma (SCC) is the second most (P = 0.05), rs3789604 (P = 0.10) and rs11102685 (P = common type of skin cancer. Fifty per cent of young adults 0.003). In a combined analysis (psoriasis patients, n = 900; with recessive dystrophic epidermolysis bullosa (RDEB) die controls, n = 2590) all three SNPs demonstrated significant from metastatic SCCs which originate in regions of persistent genotypic association with type I psoriasis. SNP rs1217414 scarring. To establish if there are distinct or consistent molecu- (P = 0.003), which resides in intron 2 of PTPN22, conferred lar signatures in RDEB SCC compared with non-EB SCC, we are risk by carriage of two copies of the minor allele with an odds conducting integrated genomic and transcriptomic studies of ratio (OR) = 1.56 (95% confidence interval, CI 1.16–2.08, cutaneous SCC in these two groups. Here we briefly report our P = 0.0027); and SNP rs3789604 (P = 0.0002), located down- initial gene expression profilings of low-passage keratinocyte stream of the gene, conferred risk under a dominant model for cultures derived from eight RDEB SCCs, seven non-EB SCCs the major allele (OR = 1.35; 95% CI 1.16–1.58, P = 0.0001). and six normal skin samples by using the combination of This study provides further evidence for a role of the Affymetrix 133A and Illumina SENTRIX HUMAN-6 gene chips. PTPN22 gene region in type I psoriasis that is not conferred GeneSpring analysis of Affymetrix 133A gene chip reveals a by the C1865T SNP previously associated with other cluster of 241 genes clearly separating RDEB SCC from non-EB inflammatory diseases. SCC. There were 25 highly expressed genes including SERPINB3, SERPINB4, S100A12 and SPRR1A in RDEB SCC, with P17 lower expression in both non-EB SCC and normal keratinocyte The a-melanocyte stimulating hormone analogues controls. In addition, GeneSpring analysis of Illumina SENTRIX (NDP-aMSH, MTII, SHU 9119, KPV) suppress HUMAN-6 chips demonstrated a cluster of 949 genes separ- phytohaemagglutinin-induced lymphocyte proliferation ating RDEB SCC from non-EB SCC. Furthermore, nine RNA in vitro samples comprising four RDEB SCCs, three non-EB SCC and R. Sihota, C. Pickard, P. Friedmann and E. Healy two normal keratinocyte cultures were simultaneously tested Department of Dermatopharmacology, University of Southampton, UK with Affymetrix 133A and Illumina SENTRIX HUMAN-6 chips, Corresponding author: [email protected] which showed over 70% gene consistency between these two a-Melanocyte stimulating hormone (aMSH) has been reported types of gene chips. In conclusion, our expression profiling to have anti-inflammatory and immunomodulatory actions. data indicate the presence of distinct molecular signatures When administered epicutaneously or systemically, aMSH differentiating RDEB and non-EB SCC, and there is a general inhibits induction and elicitation of contact hypersensitivity

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1111 responses in murine skin and promotes hapten-specific toler- alleles for the filaggrin (FLG) gene on 1q21 are important gen- ance. We have previously reported that aMSH suppresses anti- etic factors in AD. We examined the role of FLG variants in psor- gen-induced lymphocyte proliferation in humans in vitro. iasis vulgaris by case–control association studies comparing In this study, we have investigated whether analogues of cohorts of Irish and British patients with psoriasis (combined aMSH could suppress lymphocyte proliferation, and whether n = 599) with ethnically matched populations (combined any of the analogues was more potent than aMSH. NDP- n = 2117). No association was present for the two common aMSH (superpotent analogue of aMSH in terms of pigmenta- European FLG mutations R501X and 2282del14 (combined v2 tion), MTII and SHU 9119 (cyclic analogues of aMSH) and P = 0.559). The 3’ end of the FLG open reading frame was ) KPV (the c-terminal tripeptide of aMSH) were used at 10 13, sequenced in patients with different subtypes of psoriasis ) ) ) ) 10 11,10 9 and 10 7 mol L 1. (plaque, guttate, palmoplantar and late-onset), which excluded Peripheral blood mononuclear cells were stimulated with the possibility of a gain-of-function frameshift mutation such as phytohaemagglutinin (PHA) and cultured in the presence of the those found in loricrin or some keratin genes. This study sug- above peptides. PHA-induced lymphocyte proliferation was sig- gests that FLG mutations are unlikely to be involved in genetic nificantly inhibited by aMSH (P = 0.0038, ANOVA), NDP-aMSH susceptibility to psoriasis and implies that there may be within- (P = 0.0026), MTII (P = 0.0018), SHU 9119 (P £ 0.0001) locus heterogeneity in chromosomal regions involved in both and KPV (P = 0.0018), n = 10 for each compound. However, AD and psoriasis. the mean suppression by each of the compounds was similar, )13 )1 )11 )1 with 20% at 10 mol L and 15% at 10 mol L . We also P19 investigated suppression by forskolin, which, like aMSH, Nonmelanoma skin cancer and the DNA damage response increases intracellular cAMP. Forskolin significantly suppressed F. Ismail, M. Ikram, C.A. Harwood, C.M. Proby and proliferation (P £ 0.0001), but the effect was no greater than A. Storey that induced by aMSH. Finally, we looked at the suppressive Centre for Cutaneous Research, Institute of Cell and Molecular Science, effects of leptin on PHA-induced lymphocyte proliferation. Lep- St Bartholomew’s and the Royal London School of Medicine and Dentistry, tin interacts with aMSH in regulating food intake and has also Queen Mary University of London, London, UK been implicated in stimulating the immune response. However, Corresponding author: [email protected] ) ) ) ) no significant effect of leptin (10 13,1011,109 and 10 7 Recent evidence suggests that an initial barrier to the emer- ) mol L 1) was observed (P = 0.9971). Overall, the results sug- gence of tumour cells is a DNA damage response that evokes a gest that aMSH and related compounds can suppress PHA- counter-response that eliminates damaged cells. Early precursor induced proliferation, but that none of the synthetic analogues lesions express markers of an activated DNA damage response of aMSH is more potent than aMSH in this regard. in several types of tumour, with a diminishing response in more advanced cancers (Bartkova J, Horejsi Z, Koed K et al. DNA damage response as a candidate anti-cancer barrier in P18 early human tumorigenesis. Nature 2005; 434:864–70). An Psoriasis shows no association with filaggrin-null alleles important marker of DNA damage is the ATM protein which M.H. Allen, Y. Zhao,1 A. Terron-Kwiatkowski,1 H. Liao,1 S.P. Lee,2 P.R. Hull,1 L.M. Campbell,1 becomes phosphorylated (pATM) upon activation. No studies R.C. Trembath,3 F. Capon,3 G. O’Regan,3 have reported the role of ATM in skin cancer. We have investi- C.E.M. Griffiths,4 D. Burden,5 R. McManus,6,7 gated pATM expression patterns in a spectrum of premalignant R. Hughes,7,8 B. Kirby,7,8 O. Fitzgerald,7,9 D. Kane,7,9 to malignant lesions in the skin by immunohistochemistry. A.D. Irvine,10 C.N.A. Palmer,2 J.N.W.N. Barker and Tissue sections from actinic keratoses, Bowen’s disease and W.H.I. McLean1 cutaneous squamous cell carcinoma were stained for pATM St John’s Institute of Dermatology, King’s College London, 1Epithelial Genetics with both fluorescent and nonfluorescent antibody labelling. Group, Human Genetics Unit and 2Population Pharmacogenetics Group, Similar staining was also performed on untreated and ultra- University of Dundee, Ninewells Hospital and Medical School, Dundee, violet (UV)-irradiated human keratinocyte monolayer cells 3Medical and Molecular Genetics, King’s College London, 4Dermatology Centre, including normal (NHEK), premalignant (PM1) and malignant University of Manchester, 5Dermatology, Western Infirmary, Glasgow, UK, (MET1) cell lines. In addition, tissue and cell lines from non- 6Clinical Medicine, Trinity College, Dublin, 7Genetic Repository in Ireland for epidermal origin (e.g. breast) were stained for comparison. Psoriasis and Psoriatic Arthritis, 8Dermatology and Rheumatology, St Vincent’s We found that in skin, pATM was mainly localized to the University Hospital, Dublin, 9Rheumatology, Adelaide and Meath Hospital and Golgi apparatus, which is in contrast to its nuclear localization National Children’s Hospital, Dublin and 10Paediatric Dermatology, Our in other tissues. Upon UV irradiation there is transient expres- Lady’s Children’s Hospital, Dublin, Ireland sion of pATM in nuclear foci consistent with its recruitment to Corresponding author: [email protected] the sites of DNA damage. The finding of differential subcellular Psoriasis is a common skin disease with a multifactorial aetiol- localization of pATM has not been previously reported in skin. ogy. Several psoriasis susceptibility loci are known, with a num- Our results suggest that pATM has other functions but also that ber implicated in predisposition to atopic dermatitis (AD), the DNA damage response in skin is different compared with including the epidermal differentiation complex on chromo- other tissues. This may be a result of its constant exposure to UV some 1q21. Replicate studies have shown that prevalent null irradiation and has implications for skin carcinogenesis.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1112 BSID abstracts

P20 genodermatosis with an autosomal dominant inheritance. Interventions for the prevention of nonmelanoma skin Affected patients have recurrent skin lesions, resembling cancers in high-risk groups well-differentiated squamous cell carcinomas, which, if left, 1 1 F. Bath-Hextall, J. Leonardi-Bee, S. Somchand and undergo spontaneous regression, leaving pronounced scarring. 1 W. Perkins Most MSSE cases previously described were of Scottish ancestry Centre for Evidence Based Dermatology, University of Nottingham and and shared the same at-risk haplotype, suggesting that this dis- 1 University of Nottingham, UK order was caused by a founder mutation. The candidate locus Corresponding author: [email protected] for MSSE lies in a region of < 4 cM in chromosome 9q22, A Cochrane systematic review of randomized controlled trials between the markers D9S119 and D9S1816 (Goudie DR, was conducted to evaluate interventions for the prevention of Yuille MA, Leversha MA et al. Multiple self-healing squamous nonmelanoma skin cancer (NMSC) in people at high risk of epitheliomata (ESS1) mapped to chromosome 9q22-q31 in developing NMSC. Primary outcome was time to the develop- families with common ancestry. Nat Genet 1993; 3:165–9). In ment of a first NMSC. Secondary outcomes were: number of this study, we investigated three MSSE families (one Italian, new NMSCs, mortality, number of other cancers and adverse one Danish and one English) and three isolated cases of effects. non-Scottish origin (two Japanese and one American). We Ten studies were identified (7229 participants). Overall, there obtained a detailed clinical history, with particular attention to has been little good-quality research on interventions for the the age at onset, distribution and clinical course of the skin prevention of NMSC in high-risk groups, and the interventions lesions and performed haplotype analysis on DNA from studied gave inconsistent results with regards to efficacy. One patients and their families using eight microsatellite markers. study found that T4N5 Liposome lotion significantly reduced Polymerase chain reaction products were directly sequenced the rate of appearance of new basal cell carcinomas (BCCs) in using BigDye terminator and analysed by capillary electro- people with xeroderma pigmentosum. Three studies included phoresis on an ABI 3100 Genetic Analyser (PerkinElmer, renal transplant recipients. A significant reduction in the risk of Boston, MA, USA). This haplotype analysis was repeated at new NMSCs was seen when acetretin was compared with pla- least three times for every sample. Our results show that the cebo (relative risk, RR 0.22, 95% confidence interval, CI 0.06– at-risk haplotype in the non-Scottish families differs from the 0.90); however, a pooled analysis suggested an increased risk of Scottish one, suggesting that MSSE is not caused by a founder adverse events (RR 1.80, 95% CI 0.70–4.61). Several studies mutation. There is also an interesting variation in the age at were conducted in people with a history of NMSC. While the onset, number of lesions, locations of tumours and response evidence was inconclusive for the development of BCCs, the risk to radiotherapy between the families. This project shows that of a new squamous cell carcinoma (SCC) (hazard ratio, HR MSSE might be a more common condition than originally 1.79, 95% CI 1.16–2.76) and adverse events (RR 1.76, 95% CI thought and that accurate diagnosis is important, especially if 1.57–1.97) were significantly increased in the isotretinoin radiotherapy is considered. group as compared with placebo. Retinol significantly reduced the risk of SCCs as compared with placebo (HR 0.74, 95% CI 0.55–0.99). Selenium reduced the risk of other types of cancer P22 as compared with placebo (RR 0.65, 95% CI 0.50–0.85); how- Fast Fourier Transform signal analysis of accelerometer ever, a significant increase in NMSCs was seen (HR 1.17, 95% data to measure itch CI 1.02–1.34). The evidence for beta-carotene was inconclu- C.S. Murray, S.D. Pye,1 K. McBride1 and J.L. Rees sive, and a reduced fat diet did not significantly reduce the num- Department of Dermatology, University of Edinburgh and 1Medical Physics ber of new NMSCs (RR 0.16, 95% CI 0.02–1.31). Department, NHS LUHD, Edinburgh, UK Further prevention studies are needed to confirm these Corresponding author: [email protected] apparent effects and should be a priority not only from the We are interested in enhancing detection of itch-related patient perspective but also in terms of financial savings for movements by improving the signal : noise ratio of acceler- the Health Service. ometer data. Newer accelerometers allow Fast Fourier Trans- form (FFT) of data. We present aspects of our developing the use of such instruments (Benjamin K, Waterston K, Rus- P21 sell M et al. The development of an objective method for Multiple self-healing squamous epithelioma in different measuring scratch in children with atopic dermatitis suitable ethnic groups: more than a founder mutation disorder for clinical use. J Am Acad Dermatol 2004; 50:33–40). Previ- M. D’Alessandro, S.M. Morley, S.E. Coats, ously, parent-recorded sleep/rising times denoted hours for D.R. Goudie1 and E.B. Lane data analysis. An early evening ‘peak’ in accelerometer score CR (UK), Dundee University, Dundee and 1Human Genetics, Ninewells was noticed: was this itch or not? Using infrared videos Hospital, Dundee, UK (n = 6, 15 nights), comparison of observed sleep/rising Corresponding author: [email protected] times with parent-recorded times was undertaken. Parent- Multiple self-healing squamous epithelioma (MSSE), also recorded sleep times were ~40 min earlier while rising times known as Ferguson–Smith disease, is a rare cancer-associated were ~30 min later than observed. As subjects being awake

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 BSID abstracts 1113

) artificially inflates accelerometer scores, we propose analysis LCs (mean ± SD 625 ± 58 LCs mm 2; control skin 693 ± ) of mid-night hours only. To separate itch-related movement 58 LCs mm 2, P < 0.05). This number, however, was from other movement by using ‘frequency of action’ deter- significantly (P < 0.05) greater than in skin treated for 2 h ) mined by FFT of accelerometer data, FFT acceleration score with 1% oxazolone (545 ± 78 LCs mm 2), a potent contact per epoch for 0.5–2.5 Hz was compared with movement on sensitizer. video (n = 6). The score predicted the type of movement These data suggest a complex cutaneous immunological occurring: <50 G s, no movement; >450 G s, ‘out of bed’; response to cercariae, which may have the ability to downreg- 50–450 G s, itch-related movement. For enrichment of data ulate local immune responses by inducing anti-inflammatory to further separate scores of itchy subjects (n = 26) from cytokines (IL-1ra and IL-10) and to interfere with cercarial those of control nonitchy subjects (n = 26), separation was antigen presentation by migrating LCs. first compared for different frequency bands (0.5–2.5, 1–3, 0.5–5 and 0.16–10 Hz) and secondly, separation for 0.5– 2.5 Hz was further enriched for amplitude/acceleration and analysed. The best separation was for frequency enrichment P24 (0.5–2.5 Hz) followed by enrichment for amplitude 100– Ciprofloxacin-induced photosensitivity in human 400 G s: itchy mean ± SEM 18 165 ± 1363 G s; control keratinocytes and fibroblasts mean ± SEM 14 762 ± 928 G s; t-test P = 0.0046. J.P. Tolland, J.S. Elborn,1 G. Skibinski,2 R.J.H. Davies3 In conclusion: (i) critical analysis of subject/parent-recor- and K.E. McKenna ded data is necessary and (ii) appropriately enriched FFT Departments of Dermatology and 1Respiratory Medicine, Belfast City accelerometer data appear to offer a more specific measure of Hospital, Belfast, 2Department of Biochemistry and Metabolic Medicine, itch-related movement. Queen’s University, Belfast and 3School of Biological Sciences, Queen’s University, Belfast, UK Corresponding author: [email protected] The fluoroquinolone group of antibiotics is well known to P23 cause phototoxic reactions. In vitro tests demonstrating photo- Immunomodulatory effects of schistosome cercarial toxicity with ciprofloxacin and ultraviolet (UV) A radiation interactions with human keratinocytes and Langerhans have been carried out using murine fibroblasts and lymphoma cells cells (but not on human cells). The aim of this study was to G.R. Nanayakkar, A. Bartlett, P.J. Whitfield, investigate the effect of ciprofloxacin and UVA radiation on M.B. Brown and R.W. Groves human keratinocyte and fibroblast cell lines. St John’s Institute of Dermatology, King’s College London, UK HaCaT keratinocyte and HS68 fibroblast cell lines were util- Corresponding author: [email protected] ized. Cell proliferation was assessed by the dimethylthiazolyl The human parasite Schistosoma mansoni is known to modulate diphenyltetrazolium bromide (MTT) assay and DNA damage host immune responses in order to promote its own survival. assessed by comet assay. Experiments (n = 3) were repeated However, studies investigating the interaction between the in triplicate for each cell type. Keratinocytes (1 · 104) and skin-invading cercarial stage and cells of the epidermis and fibroblasts (5 · 103) were exposed to 0, 50, 75, 150 and ) immune system are limited and largely based on animal mod- 200 lgmL 1 ciprofloxacin for 1 h and then irradiated with ) els. In this study we have used cultured human skin cells and one of 0, 3.75, 7.5 or 11.25 J cm 2 UVA radiation. MTT human skin explants to gain further insight into the immunoassay was carried out 24 h later. For comet assay keratinocytes biology of cercarial/skin interactions. (0.5 · 106) and fibroblasts (2 · 105) were exposed to 0, 5, ) HaCaT keratinocytes (n = 3 replicates) were exposed to 10, 25 and 50 lgmL 1 ciprofloxacin for 1 h, prior to irradi- ) S. mansoni cercarial lysate for 4 and 24 h. Supernatants were ation with either 0 or 3.75 J cm 2 UVA radiation. Results analysed by enzyme-linked immunosorbent assay for the were analysed by one-way ANOVA. presence of inflammatory/immunomodulatory mediators. Both UVA (P < 0.0001) and ciprofloxacin (P < 0.0001) After 4 h, significant (P < 0.05) increases were observed independently in increasing doses and also UVA and ciproflox- in the levels of interleukin (IL)-1a (mean ± SD 12.17 ± acin in combination (P < 0.0001) had a negative effect on ) ) 0.85 pg mL 1), IL-10 (23.38 ± 2.17 pg mL 1) and IL-1 cell proliferation (MTT assay) and significantly increased the ) receptor antagonist (IL-1ra) (271.27 ± 20.38 pg mL 1). At percentage tail DNA (comet assay) in both cell types. In MTT ) 24 h, only IL-1a (17.51 ± 1.12 pg mL 1) and IL-10 assay the percentage decrease in cell proliferation for both ) ) (22.44 ± 2.15 pg mL 1) concentrations remained significantly cell types at 50 lgmL 1 ciprofloxacin between 0 and ) above those of controls (P < 0.05). Levels of IL-1b were con- 11.25 J cm 2 UVA was 50%. In comet assay the mean per- sistently below the level of detection. Epidermal Langerhans centage increase in tail DNA with 0 compared with ) ) cell (LC) migration in response to cercarial penetration was 3.75 J cm 2 UVA at 50 lgmL 1 ciprofloxacin was 30% for assessed using a Franz cell system. Epidermal sheets (n = 11) keratinocytes and 38% for fibroblasts. Our results demonstrate prepared from full-thickness skin exposed to cercariae for the phototoxic potential of ciprofloxacin in combination with 2 h showed a small reduction in the number of remaining UVA radiation in human cutaneous cell lines.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114 1114 BSID abstracts

P25 may be useful in clinically infected AE and further studies are Interventions to reduce Staphylococcus aureus recommended. for atopic eczema A.J. Birnie, F. Bath-Hextall,1 J.C. Ravenscroft and H.C. Williams1 1 Department of Dermatology, Queen’s Medical Centre and Centre for Evidence P26 Based Dermatology, University of Nottingham, UK Epidermolysis bullosa in calves in the UK Corresponding author: [email protected] A.P. Foster, A.M. Skuse,1 R.J. Higgins,2 D.C. Barrett,3 It has been suggested that Staphylococcus aureus (SA) exacerbates A.W. Philbey,3 J.R. Thomson,4 H. Thompson,3 atopic eczema (AE); thus by reducing SA one could improve M.A. Fraser5 and M.J. Day1 AE. A Cochrane systematic review of randomized controlled Veterinary Laboratories Agency – Shrewsbury, Shrewsbury, 1Division of trials (RCTs) was conducted to assess the efficacy and adverse Veterinary Pathology, Infection and Immunity, School of Clinical Veterinary effects of interventions to reduce SA for treating AE. Science, University of Bristol, Langford, 2Veterinary Laboratories Agency – Primary outcomes were global degree of improvement rated Lasswade, Penicuik, 3Divisions of Animal Production and Public Health, and by patient or physician. Secondary outcomes were severe and Division of Pathological Sciences, Institute of Comparative Medicine, Univer- minor adverse events, and emergence of antibiotic-resistant sity of Glasgow Veterinary School, Glasgow, 4Scottish Agricultural College, SA. Tertiary outcomes were global changes in published com- Veterinary Science Division, Penicuik and 5School of Nursing, Midwifery and posite rating scales, changes in individual signs as rated by a Social Care, Napier University, Edinburgh, UK physician, duration of remission, and change in isolation rates Corresponding author: [email protected] and bacterial counts of SA. Epidermolysis bullosa (EB) was diagnosed in eight calves Twenty-one RCTs were identified covering seven therapeutic from four farms in the UK. Three affected farms used pedi- categories. Overall, methodological quality of the trials was gree Simmental bulls mated to Simmental-cross cows. Clinical poor. In one study, placebo had a significantly better global out- lesions variably consisted of multifocal ulceration and erosion come compared with oral flucloxacillin in nonclinically infected of the hard and soft palate, tongue and gingiva, with ony- AE (odds ratio, OR 6.48, 95% confidence interval, CI 1.79– chomadesis/dysungulation. There was also alopecia and ero- 23.44). Another study showed a nonsignificant global improve- sions of coronets, carpal, hock, flank and axillary areas. ment with cefadroxil compared with placebo in clinically Histopathological findings included separation of variable ‘superinfected’ AE (OR 0.26, 95% CI 0.05–1.26). The categor- lengths of intact full-thickness epidermis from the dermis by ies antibacterial soaps, topical steroid plus antibacterial and anti- larger clefts containing variably eosinophilic fluid, extravasat- fungal, antibacterial bath additives, topical antiseptic/antibiotic, ed red blood cells and rarely small numbers of neutrophils. topical steroid plus antibiotic and silver-impregnated textiles Both interfollicular and follicular areas of skin were exten- provided little evidence to support the use of the intervention sively affected. Cleft formation extended around hair follicles over placebo. In particular, there was no good evidence to sup- to varying depths, sometimes involving whole follicles. Ultra- port the addition of antibiotics to topical steroid preparation. structural findings included clear evidence of vacuolar change There was no significant difference in adverse events between within basal keratinocytes accounting for the observed clef- intervention and placebo. A number of studies showed a signifi- ting and were considered similar to those seen in other spe- cant reduction in SA without significant clinical improvement. cies with EB simplex. Although uncommon, the impact on There is no good RCT evidence at present to support the breeding programmes could be dramatic for this fatal condi- use of antistaphylococcal interventions in AE. Oral antibiotics tion of cattle.

2007 British Association of Dermatologists • British Journal of Dermatology 2007 156, pp1093–1114