THE ROVIRA RHIZOSPHERE SYMPOSIUM Celebrating 50 Years of Rhizosphere Research

THE ROVIRA RHIZOSPHERE SYMPOSIUM Celebrating 50 years of rhizosphere research

A festschrift in honour of Albert Rovira AO FTSE

Editors

V.V.S.R. Gupta Maarten Ryder John Radcliff e

Friday 15 August 2008 SARDI Plant Research Centre Waite Campus, Adelaide

2010 The Crawford Fund Mission To increase Australia’s engagement in international agricultural research, development and education for the benefi t of developing countries and Australia

The Fund Th e Australian Academy of Technological Sciences and Engineering established Th e Crawford Fund in June 1987. It was named in honour of Sir John Crawford, AC, CBE, and commemorates his outstanding services to international agricultural research. Th e fund depends on grants and donations from govern- ments, private companies, corporations, charitable trusts and individual Australians. It also welcomes partnerships with agencies and organisations in Australia and overseas. In all its activities the fund seeks to support international R&D activities in which Australian companies and agencies are participants, including research centres sponsored by, or associated with, the Consultative Group on International Agricultural Research (CGIAR), and the Australian Centre for International Agricultural Research (ACIAR). Good news is worth sharing, and the fund’s Public Awareness Campaign—of which its annual Parliamentary Conference is a key feature—increases understanding of the importance and potential of international agricultural research, its achievements and needs. And the results of research should be extended to as wide a set of users as is possible. With this objective, the fund’s Training Program and Master Classes fi ll a niche by off ering practical, highly focused non-degree instruction to men and women engaged in the discovery and delivery of new agricultural technologies, farming practices and policies in developing countries. Th e offi ce of the fund was transferred from Parkville in Melbourne to Deakin in Canberra at the beginning of 2009.

More detail is available at http://www.crawfordfund.org

Th e Crawford Fund 1 Geils Court Deakin ACT 2600 AUSTRALIA

Telephone: (612) 6285 8308 Email: [email protected]

©Th e Crawford Fund 2010 viii + 136 pp. ISBN 978 1 921388 07 1 Production editor: Alan Brown Cover: Whitefox Communications Printing: Goanna Print, Canberra

TheTR Rovira Rhizosphere R Symposium S ii Dedication

To Dr Albert Rovira AO FTSE in honour of his 80th birthday and fi ft y years of rhizosphere research and leadership Prior to his formal retirement, Dr Rovira was a Chief Research Scientist in the CSIRO Division of Soils and foundation Director of the CRC for Soil and Land Management, which was one of the pioneering ‘fi rst round’ Cooperative Research Centres. He continues to mentor current students and scientists and is still publishing.

Dr Rovira has been the Coordinator of the ATSE Crawford Fund in South Australia since its inception.

Organising Committee

Vadakattu V.S.R. Gupta Maarten Ryder Rosemary Warren John Radcliff e Paul Harvey Kathy Ophel-Keller

Acknowledgements

Th e organisers wish to thank the following organisations and people for their generous support and assistance: CSIRO SARDI Th e Crawford Fund Stasia Kroker, Jan Mahoney and Suellen Slater of CSIRO Geetha Vadakattu Cathy Reade and Alan Brown of Th e Crawford Fund Martha Hawes of Th e University of Arizona Reviewers of the manuscripts

TheTR Rovira Rhizosphere R Symposium S iii

Frontispiece 1. International participants with Albert Rovira. Left to right: Richard Smiley, Albert Rovira, Sina Adl and Jim Tiedje

TheTR Rovira Rhizosphere R Symposium S iv Baker, Baker, ompson, Th Rob Velthius, Andrew, 33–Helle –Sandy Dickson, Dickson, –Sandy ft, 49–Richard Winder, e, 15–Susan 16–Bob McKay, Hannam, 17–Duan 9–Albert Rovira, 10–Herdina, Gupta, 11–Vadakattu 12–Denis Blight, 13–Elizabeth 14–John Drew, Radcliﬀ Tingyu, 18–Monique Shearer, 19–Lyn Abbott, 20–Richard Lardner, 21–Megharaj Mallavarapu, 22–Chris Franco, 23–Graham Stirling,25–Richard 24 Smiley, 26–Doug 27–Marcus Reuter, Hicks, 28–Stasia Kroker, 29–Rowena 30–Diana Davey, 31–Rabina Sasa, Walter, 32–Neil 50–Simon Anstis, Kimber, 51–Ron 52–Neil 53–Neil Venn, Smith, 54–Murali Naidu, 55–Andrew Smith, 56–Richard Simpson, 57–Glen Bowe n, 58–Geoﬀ59–Mark Seeliger, 60–Rosemary 61–Bernard Warren, Doube, 62–Kathy Ophel-Keller Christophersen, 34–Graeme Jennings, 35–Matthew Ayres, 36–Ray Correll, 37–Nigel Wilhelm, 38–Maarten 39–Rohan Ryder, Rainbow, 40–41–Richard Burns, 42–Jim Tiedje, 43–Alan 44–Paul McKay, Harvey, 45–Alan Buckley, 46–Sally Smith, 47–Steve Barnett, 48–Roger Swi Frontispiece 2. 1–Emma Leonard, 2–Jane Greenslade, 3–Sina Adl, 4–Fitri Widiantini, 5–Evelina Facelli, 6–Tanya Bernardo, 7–Eileen Scott, 8–Laura

TheTR Rovira Rhizosphere R Symposium S v Preface A symposium to honour the 80th birthday and scientiﬁ c contributions of Dr Albert Rovira AO FTSE and to explore the latest developments in rhizosphere research

A symposium was held in Adelaide on 15 August term Rovirasphere. Th e papers in these proceedings 2008 to celebrate the 80th birthday of Dr Albert consider a variety of aspects of rhizosphere research Rovira and more than 50 years of his research and on microbial and faunal communities and their leadership in the science of agriculture. interactions with plant growth and production, and ranging from benefi cial to deleterious. Some of the Th e rhizosphere is that dynamic hub of biological latest developments in DNA and RNA technologies activity that surrounds plant roots. Since it allow us to unravel interactions at the microsite level was defi ned in 1904 by Dr Lorenz Hiltner, the and, by identifying some of the critical steps and rhizosphere has been one of the most fascinating processes involved in regulation, we are optimistic habitats for research in basic and applied that we will continue to scale-up our understanding microbiology. Our understanding of rhizosphere of what occurs at the root–soil interface to practical organisms and the many roles they play in plant applications in the fi eld and further to the agro- growth, crop production and ecosystem health ecological zone. Albert’s later work on soil biology has developed tremendously. Yet there are still led to many practical improvements in cropping considerable challenges ahead in our attempts to systems in Mediterranean and temperate regions. harness the rhizosphere for improved crop growth A contribution from the farming community is and sustainable production. Fortunately, advances included in the proceedings in recognition of this in other fi elds of science and technology (molecular important part of Albert’s career. biology, microscopy and mass spectroscopy) allow us to make continuing progress in understanding Prior to his formal retirement, Albert Rovira was the complexity and function of the rhizosphere. a Chief Research Scientist in the CSIRO Division Th is might lead to the development of ‘designer of Soils and was the foundation Director of the rhizospheres’ for specifi c purposes. Cooperative Research Centre for Soil and Land Management. Since retirement he has continued Pioneering work that combined the latest concepts to mentor students and scientists in Australia and with new analytical techniques in microbiology, also in other countries such as China, and is still plant physiology and microbiology was done by writing and publishing. His works have been cited Dr Albert Rovira in the 1950s. His seminal papers an average of 56 times per year for over 56 years. on the rhizosphere, published in 1956, started a new chapter in rhizosphere research. Since that Albert has made another signifi cant contribution time, Australian scientists have been very well in helping to establish Th e Crawford Fund in known internationally as part of research eff ort South Australia. He has been the South Australian to understand and manage the rhizosphere for Coordinator since its inception here in 2000 and improved crop production. Th e importance of has maintained a vital interest in the projects and Albert’s contribution is summed up in a recent people who have been supported by the Fund. statement by Professor Martha Hawes (University of Arizona), who said that ‘the longer I’m in rhizosphere We are pleased to present this series of papers as the research the more I appreciate his vision and work, proceedings of the ‘Rovira Rhizosphere Symposium’ and it still remains rather singular. …’ and thank all who have made contributions in organising the symposium, and in writing, editing In this volume we have assembled keynote papers and producing this volume. presented by leading national and international scientists at the symposium. Th e paper by Dr Vadakattu V.S.R. Gupta Richard Burns highlights some of the signifi cant John C. Radcliff e contributions of Albert’s research and coins the Maarten H. Ryder

TheTR Rovira Rhizosphere R Symposium S vi Contents The Crawford Fund...... ii Dedication...... iii Organising Committee...... iii Acknowledgements...... iii

Preface...... vi

Albert Rovira and a half-century of rhizosphere research...... 1 Richard G. Burns How best can we design rhizosphere plant–microbe interactions for the benefi t of plant growth?...... 11 Vadakattu V.S.R. Gupta and Oliver G.G. Knox Nature of biocontrol of take-all by the Australian bacterial isolate Pseudomonas strain AN5: a true symbiosis between plant and microbe...... 25 Murali Nayudu, Rajvinder Kaur, Christian Samundsett, John Macleod, Andrew Franklin, Kylie Groom, Yafei Zhang, Terry Murphy, Markus Koeck and Heather Millar New insights into roles of arbuscular mycorrhizas in P nutrition of crops reveal the need for conceptual changes...... 31 Sally E. Smith, Huiying Li, Emily J. Grace and F. Andrew Smith Two parallel rhizosphere programs...... 41 R.J. (Jim) Cook Root diseases, plant health and farming systems...... 47 Richard W. Smiley Rhizoctonia on the Upper Eyre Peninsula, South Australia...... 55 N.S. Wilhelm Infl uence of carbon input to soil on populations of specifi c organisms linked to biological disease suppression of rhizoctonia root rot...... 61 Rowena S. Davey, Ann M. McNeill, Stephen J. Barnett and Vadakattu V.S.R. Gupta Minimum tillage and residue retention enhance suppression of Pratylenchus and other plant-parasitic nematodes in both grain and sugarcane farming systems...... 66 Graham R. Stirling Variability among the isolates of Sclerotium rolfsii (Sacc.) causing stem rot of peanut (Arachis hypogaea L.)...... 72 S. Durgaprasad, N.P. Eswara Reddy, C. Kishore, B.V. Bhaskara Reddy, P. Sud-hakar and S.V.R.K. Rao

TheTR Rovira Rhizosphere R Symposium S vii Development of a microbial indicator database for validating measures of sustainable forest soils...... 81 Richard S. Winder, Phyllis L. Dale, Charles W. Greer and David J. Levy-Booth Long-term international research cooperation between China and Australia on soil biology in agriculture...... 90 Maarten H. Ryder and Tang Wenhua ATSE Crawford Fund international Master Class series on soil-borne pathogens of wheat...... 97 Julie M. Nicol, Lester W. Burgess, Ian T. Riley and Hugh Wallwork Plant and soil health and farming systems—a farmer’s perspective...... 109 Neil Smith Abstracts...... 112

New technologies for more in-depth understanding of the soil and rhizosphere communities...... 113 James M. Tiedje, WooJun Sul, Stephan Ganter, Mary Beth Leigh, Deborah Yoder-Himes and James R. Cole Trophic cascade and decreased survival and growth of Pinus strobus seedlings in microcosms caused by fungivory on mycorrhizae...... 114 Sina M. Adl and Melanie L. Wilson Co-opting the endorhizosphere...... 115 Christopher M. Franco Varietal diff erences in cotton—belowground...... 116 Oliver G.G. Knox, Vadakattu V.S.R. Gupta, Kellie Gordon, Richard Lardner, Paul Harvey and Marcus Hicks Root damage constrains autumn–winter pasture yield and farm productivity...... 117 Richard Simpson, Alan Richardson, Ian Riley and Alan McKay Biology of the rhizosphere: progress and prospects for the future...... 118 Albert D. Rovira

Symposium program...... 134

Crawford Fund publications since 2006...... 136

TheTR Rovira Rhizosphere R Symposium S viii Albert Rovira and a half-century of rhizosphere research

Richard G. Burns1

Abstract and encompass technical advances and experimental investigations of the rhizosphere (root Th e recognition of the soil-root interface as a exudates, microbial enumeration, ultrastruc- zone of high microbial activity is over a century ture, nutrient accession, virulence factors, etc.) old, but a rational and evidence-based confi - as well as applied aspects closely related to plant dence in the possibility of its manipulation is health and soil fertility (biological control of much more recent. Today the major emphases fungal pathogens and nematodes, ammonifi ca- in fundamental rhizosphere research are to- tion and nitrifi cation, pesticide aff ects, soil wards describing microbial diversity, translating structure, climatic impacts, soil management, the chemical language that plants and microbes etc.). Rovira’s research is that rare combination use and deciphering how the soil properties in- of fundamental studies and their successful ap- fl uence communication. Successful plication to the real (and often harsh) world of modifi cation of the rhizosphere for plant agriculture. Some of the many ways in which growth promotion and the retention or recovery Albert Rovira’s discoveries and ideas have pro- of soil quality will be dependent on a clear ap- vided signposts for current investigations and, preciation of the many and often subtle ultimately, for accomplishing the sustainable relationships that plants have with each other as management of soil are summarised in this well as with the vast numbers of harmful and article. benefi cial soil microbes in their vicinity. Th e rapidly growing catalogue of plant and micro- Introduction bial genomes and a fast-expanding knowledge of how signals are generated and perceived are Over the past century rhizosphere research and playing a big part in our improving understand- its real or anticipated application to agriculture ing. Also important is an acceptance that has enjoyed periods of popularity and long spells plant-microbe relationships have co-evolved and of stagnation. Today is a time of great excitement and optimism. A search of Web of Science reveals are continuing to do so as land use, agricultural that more than 1000 papers concerned with the practices, soil quality, climate and crop selection rhizosphere were published in 2008 and in excess change. Albert Rovira’s writings over the past of 1500 in the fi rst nine months of 2009. Eleven 50 years have played a major role in our explora- years ago, during the whole of 1998, there were 366 tion and explanation of the rhizosphere. His and twenty years ago there were just 50. (When contributions are as varied as they are profound Albert Rovira began his career there were less than ten rhizosphere papers a year!) In fact, through- 1 School of Land, Crop and Food Sciences out much of the previous century soil biologists Th e University of Queensland, Brisbane shied away from including plants in their experi- Queensland 4072, Australia ments: soil is complicated enough without adding Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 1 the ever-changing infl uence of a growing plant. and the phenotype of the hugely diverse microbiota But nowadays a more holistic real-world attitude of soil and to monitor how it responds to the grow- prevails and plants are acknowledged as essential ing plant. It is no longer necessary to be daunted by components of most soil biology research programs; the fact that as many as 95% of soil microorganisms this is refl ected in the surge of exciting papers de- have never been grown in pure culture, even though voted to all things rhizosphere. this may be a consequence of our poor knowledge of microbial nutrition rather than there being vast Why this dramatic change? One explanation is numbers of species that are inherently non-cultura- historical: the centenary of Hiltner’s 1904 concept ble. But nowadays we do not need to grow bacteria of the root-soil interface (albeit restricted to bacteria and fungi on agar in a Petri dish to be able to ascer- and legumes) prompted many celebratory meetings, tain their immense process capabilities and to gauge most notably in Munich in 2004 (Wenzel 2005; their importance in soil metabolism. In addition, Jones et al. 2006). At that time the need for regular the movement, colonisation and activities of both international rhizosphere meetings was recognised indigenous and introduced microorganisms can be and experts reconvened in Montpellier in 2007 studied using the powerful new developments in, (Jones et al. 2009a) and will do so again in Perth in for example, autofl uorescence and confocal laser 2011. Th ere have been many other recent gatherings scanning microscopy (Bloemberg 2007). to discuss aspects of plant-microbe-root communication: Lapland, Finland (2005), New Hampshire, Th is combination of technical carrots and envi- USA (2008) and Brisbane, Australia (2008) ronmental sticks has given us real hope that we are (Schenk et al. 2008). A second impetus was provid- on the verge of manipulating the soil environment ed by growing concerns about the negative impacts in a rational and predictive manner. Th e novel of climate change and any number of anthropogenic methods have also given us the confi dence to think and natural stresses on crop productivity. Suddenly imaginatively about the types of interactions that there was a need to increase our knowledge of how are occurring in the root region and to embrace the soils and plants interact in order to ameliorate idea that there is a complicated language used by some of these stresses, most pressingly in relation plants and microbes. Th e chemical cross-talk that to temperature and rainfall patterns. Th irdly, and takes place between plants and plants, microbes with perfect timing, a new tool box jammed full of and microbes, and plants and microbes, and how useful techniques has appeared. Th ese include sensi- that conversation is translated into action is further tive analytical equipment, advances in microscopy complicated by the chemical and physical character- and molecular biology, microsite sampling, some istics of the soil. clever modeling and new ideas about scale-up, plus the evaluation of complex sets of data using, for ex- Recently published books (Cooper and Rao 2006; ample, principal component analysis. Cardon and Whitbeck 2007; Pinton et al. 2007) and the very large number of insightful review ar- Many of these techniques were developed in other ticles (e.g. Bais et al. 2006; Gregory 2006; Kraemer fi elds but they are now being enthusiastically ad- et al. 2006; Bouwmeester et al. 2007; Steinkellner et opted and modifi ed by soil microbiologists, and are al. 2007; Complant et al. 2008; Jackson et al. 2008; driving research at an accelerating pace. In particu- Jones et al. 2009b; Raaijmakers et al. 2009) are a lar, there is no doubt that the DNA sequencing of testimony to the recent surge in interest in rhizobi- plants and microbes and the increasing number of ology. ways to study the proteomics, transcriptomics, me- tabolomics and metagenomics of soil populations Albert Rovira has been in the vanguard of rhizo- are powerful molecular weapons in our armory as sphere research for more that 50 years and his we struggle to understand that most labyrinthine of pre-eminence in this far reaching topic is unques- all environments, the soil. Th e techniques include tioned. His infl uence is profound and prompts the a plethora of molecular methods for extracting coining of a new soil biology noun: the rovirasphere. DNA, rRNA and mRNA from soil and then am- Th is is defi ned as ‘the area of soil-plant-microbe plifying, fi ngerprinting, cloning and sequencing research and thinking infl uenced by the intellectual (Oros-Sichler et al. 2007; Sharma et al. 2007). As a outputs and published products of Albert Rovira’. consequence, it is becoming increasingly possible to In the bibliometric world we live in this infl uence accurately describe and compare both the genotype is well illustrated by the large number of Rovira’s

TheTR Rovira Rhizosphere R Symposium S 2 publications that have been cited over 100 times, (cereal root rot) and the root- invading eelworm the Nature papers, various indices (Hirsch, Egghes’s Heterodera avenae (cereal cyst nematode). Th ese g, Impact Factor, etc.), and two papers designated pests, individually or in combination, will deci- as Citation Classics by the Institute for Scientifi c mate crops and reduce yield if left unchecked by Information (Bunt and Rovira 1955; Rovira 1969). pesticides and other management strategies. Th e But this is only a snapshot and the rovirasphere precise impact of these diseases was shown by com- is also exemplifi ed by the large number of distin- paring the yields in soils fumigated to remove the guished soil biology researchers that Rovira worked pathogens and this provided a reliable base from with and infl uenced. In a long list these include which to assess various control measures (Rovira Richard Campbell, Jim Cook, Jennifer Parke, and Bowen 1966). Th ese amelioration attempts David Weller, Martin Alexander, David Barber, Ed have run the gamut from the isolation, purifi cation Newman, Richard Smiley, Keith Martin, Maarten and identifi cation of putative biocontrol agents to Ryder, Jean-Alex Molina, David Roget, Clive their application and assessment (Cook and Rovira Pankhurst, Jack Warcup, Ralph Foster and Rovira’s 1976; Kerry et al. 1984; Rovira and McDonald perennial brother-in-arms, Glynn Bowen. Together 1986; Brisbane and Rovira 1988; Ryder et al. 1999; these two have published a dozen or so major papers Altman et al. 1990). Th e rationale behind much of and a number of highly infl uential reviews; they this phytopathological research and its relevance to could be seen as the Lennon and McCartney of modern sustainable agriculture are well described rhizosphere research! by Rovira himself in his 1989 Daniel McAlpine Lecture (Rovira 1989). It is noticeable that adopt- Rovira and Bowen, along with Jeff Ladd, Ken Lee, ing modern agricultural practices, such as the use Alan Posner, Malcolm Oades, Dennis Greenland, of knock-down herbicides, no-till and direct drill- Keith Martin and together with Ray Swaby’s in- ing of seeds, needs careful thought and thorough spired recruitment, were responsible for putting soil investigation if they are to be compatible with con- biology research at the CSIRO, Adelaide, on the trolling these potentially devastating root diseases. world map in the 1960s: a position it held for almost Soil-available phosphate (Simon and Rovira 1985) 40 years. Th ese are the scientists and the interna- and manganese (Wilhelm et al. 1988) also aff ect the tional face of the Urrbrae group, but the infl uence expression of these plant pathogens. spread way beyond this to the practitioners—the farmers who saw Albert Rovira, in particular, as Th e body of what might be described as Rovira’s someone who understood their problems and was fundamental research is impressive and includes carrying out research that was directly aimed at such topics as quantifying rhizosphere microbes making their struggle with the harsh Australian (Brisbane and Rovira 1961) and their enzyme ac- climate and the soil pests that decimate the crops a tivities (Ridge and Rovira 1971; Neate et al. 1987), little easier. Albert strode from laboratory to glass- measuring and identifying root exudates (Rovira house to fi eld with a confi dence and ease borne of and Ridge 1973) and their sites of release along a love of fundamental research combined with an the growing root (McDougal and Rovira 1970), empathy with the farmer. One brief quote that sums defi ning plant–plant interactions (Newman and this up in an understated way says ‘Albert Rovira is Rovira 1975), recording nutrient accession and root a highly respected farmer-friendly soil scientist’. Th e uptake (Rovira and Bowen 1968), assessing essential hugely infl uential 30 years of Avon trials are a won- nitrogen transformations including ammonifi ca- derful example of this and are described elsewhere tion and nitrifi cation (e.g. Molina and Rovira 1964; in this volume. Doxtader and Rovira 1968) and visualising root and rhizosphere ultrastructure. With regard to the last- Rovira’s research mentioned, the work by Foster and Rovira (1976) that used the electron microscope to observe and Th e scope of Rovira’s research is reviewed and record the microbial colonisation of wheat roots represented by many of the papers in this special and how this changes with the development of the publication and will only be cherry-picked here. It plant was a landmark in rhizosphere science. And is dominated by three major microbial enemies of this is far from a defi nitive list; you would need Australian agriculture: the fungi Gaeumannomyces to add herbicide decomposition, fungal virulence graminis (take-all of wheat) and Rhizoctonia solani factors, earthworms, rhizobia and many others to

TheTR Rovira Rhizosphere R Symposium S 3 your search to get the full picture of Albert Rovira’s a rather daunting set of characteristics and, until research vocabulary. perhaps fi ve years ago, the possibilities for resolving the rhizosphere mysteries were in the realms of the Even a cursory reading of Rovira’s papers reminds imagination — and conference workshops. Not so you time and time again of an obvious yet impor- now. tant message: soil is a multi-faceted environment. Th us, whilst a conventionally designed and con- What makes rhizosphere research so ducted laboratory experiment in which most of the interesting? variables are controlled may provide much useful information, it is not the ‘real world’. Recognising It has been variously estimated that between 5% this, and rather than studying the ‘eff ect of A on B’, and 40% of photosynthetically fi xed carbon is Rovira and his co-workers opted frequently for the released by the plant root (Cheng and Gershenson ‘eff ects of A, B, C and D, individually or in combi- 2007). Although most of these measurements have nation, under conditions E and F, in the laboratory, been made using annuals and sometimes the meth- greenhouse and fi eld’! Th ere are many examples odology is questionable, this is a level of apparent of this daunting yet pragmatic approach to soil re- ineffi ciency to which you would be hard pressed to search, for example: Eff ect of sowing point design and fi nd an explanation. Of course, what the plant is tillage practice on the incidence of rhizoctonia root rot, doing, either directly or in response to its environ- take-all and cereal cyst nematode in wheat and barley ment, is to release carbon, nitrogen and energy (Roget et al. 1996). Th is paper looks at conventional sources that will stimulate the resident microbial cultivation and three types of seed drilling, three population as the roots travel horizontally and diseases and two crops — in four fi eld experiments vertically through the soil. Th e chemical nature of over three years (I will leave it to the reader to calcu- these rhizodeposits range from the comparatively late the number of treatments and controls). Yet this simple low-molecular-mass structures (amino acids, is exactly the sort of information that the farmer fatty acids, phenolics, hexose and pentose sugars) to needs to allow him to make judgments appropriate complex macromolecules (polysaccharides, proteins, to his particular circumstances. nucleotides, antibiotics) and root cells and debris (Table 1). Th ese plant products may act as general or Periodically Rovira, alone or together with Bowen, selective nutrient sources inducing the proliferation summarised and synthesised the state of the art of those microbial strains already present in hori- in rhizosphere research and its applications. Four zons through which the developing root proceeds. such reviews stand out (Rovira 1965, 1969; Bowen On the other hand, soluble exudates may diff use and Rovira 1976, 1999) and these have become away from the plant and set up gradients which benchmarks in the subject. Scientists studying the stimulate the movement of microbes from the wider environment of the plant root would be well advised soil towards the plant root where they can benefi t to use these as a starting point for their research from a comparatively copiotrophic location. But because they are packed with ideas and intelligent carbon, nitrogen and energy for metabolism and speculation about what goes on underground. Th ere growth are not the only contributions that plant are many important messages that emerge from exudates make to microbial life in soil. reading these seminal reviews and just two of them are recorded here. Both may appear obvious in 2009 Once microbes are close to the root surface, a large but they were not when the reviews were published number of other chemicals that function as signal and they still have a strong resonance today. Th e molecules (Table 1) come into play and orches- fi rst is that root exudates are an integral component trate further changes in both the plants and the of soil chemistry, physics and biology and have ma- microorganisms. Th ese processes may result in the jor and multifarious eff ects on nutrient availability formation of complex and structured microbial and plant health and growth. Th e second is that the communities at the root surface and their retention quality and quantity of these exudates change with within biofi lm structures (Danhorn and Fuqua plant species, plant age and stage of development, 2007; Rudrappa et al. 2008). Yet other chemicals soil type and its management, the resident micro- may trigger intimate extra-, inter- and intra-cellular and macro-fl ora, and climate. In other words the relationships. rhizosphere is dynamic in terms of its processes and properties both in space and time. Th is may read as

TheTR Rovira Rhizosphere R Symposium S 4 Table 1. Some plant rhizodeposits and microbial ticulture and forestry for many years (Drinkwater secretions, and their functions in soil and Snapp 2007). Other apparently more casual and sometimes non-specifi c relationships which benefi t the plant may off er protection against phy- Material topathogens, help in the scavenging of nutrients, • Monosaccharides, polysaccharides, amino acids, aliphatic acids, aromatic acids, fatty stimulate soil genesis, improve soil structure, gener- acids ate phytohormones, improve hydraulic continuity • Proteins, peptides, enzymes, vitamins, and water retention, and even inhibit the establish- nucleotides, purines, phenolics, antibiotics ment and development of adjacent and potentially • Alcohols, alkanes, sterols, terpenes competitive plants. • Siderophores: hydroxamic acids, mugineic We have known about plant enzymes such as phos- acids phatases, amylases, invertases and proteases for • Root debris, border cells, root cap cells many years, and these may stimulate many processes • Inorganic ions: HCO –, OH–, H+ 3 in soil that lead directly to the release of nutrients • Gases: CO2, H2, ethylene from either organic macromolecules or those that • Signal molecules: fl avonoids, p-hydroxy acids, are attached to clays and humates and, at least quinones, cytokinins, phytoalexins, coumarin, temporarily, in a non-bioavailable state. Of course, rosmarinic acid, salicylic acid, dodecoic these plant enzymes are only a fraction of the total acids, furanosyl diesters, phenypropanoids, extracellular catalytic complement of soil. Microbes napthoquinones, jasmonic acid, lactones, secrete enzymes in abundance and these are an es- strigalactones, lectins sential component of the soil’s capacity to transform Functions and mineralise the vast number of organic sub- • Carbon, nitrogen and energy sources strates of plant, animal and microbial origin (Burns • Acidity and alkalinity regulators and Dick 2002; Burns 2008). • Metal ion ligands • Soil genesis and structure In addition to the chemically recognisable exudates, • Water capture and retention the number of plant metabolites that are secreted • Attraction of benefi cial microbes into the rhizosphere is in the hundreds, and it is • Repulsion or inhibition of harmful microbes believed that many of these have signaling func- • Induction of plant growth promoting activities tions. In fact, secondary metabolites may number • Adhesion and biofi lm formation in the thousands and it is probable that some are • Penetration and cellular integration of accumulated inside the plant and only released in symbiotic bacteria and fungi response to appropriate messages from the soil. Th e • Inhibition of competitive and invasive plants dialogue that takes place in the rhizosphere involves plants talking to plants, microbes and microfauna, microbes talking to microbes, and microbes talking to plants. Chemical messengers may be targeting Plant growth promotion takes many forms but individual genotypes and processes or have a more is almost inevitably the direct or indirect conse- general impact on microbial community dynam- quence of plants and microbes detecting and then ics. It is this continuous chemical chatter that we responding to each others presence. It is becom- are at last beginning to decipher, although the ing increasingly apparent that plant roots and soil subtlety of some of these interactions is astound- microbes have multiple ways of perceiving their ing. For example, diff erent enantiomers of catechin immediate environment and reacting accordingly. generate diff erent responses in adjacent plants and What usually follows from the initial recognition microorganisms (Bais et al. 2005) and the process is a cascade of events, although it is oft en diffi cult of racemisation (and therefore the nature of the to see whether the plant or the microbes are the message) may take place within the roots or post-ex- dominant partners in the relationship. At its most udation or even be mediated by certain rhizosphere developed, the signals and responses give rise to in- microorganisms. timate, intracellular and long-term associations (e.g. rhizobia and legumes, mycorrhizae) and these have Many successful bacterial pathogens, especially been recognised and exploited in agriculture, hor- those of the genera Erwinia, Agrobacterium,

TheTR Rovira Rhizosphere R Symposium S 5 Xanthomonas and Pseudomonas, mount successful fungal communities, but wake-up calls are becom- attacks on plant roots only aft er their cell densities ing loud and piercing. Rising levels of atmospheric have reached an appropriate level. Th is is known as carbon dioxide are predicted to have a profound quorum sensing (He and Zhang 2008) and serves to eff ect on our climate and this will be refl ected in inform the microbial cells that there are enough of changes to many soil properties. At the very least, them to warrant a serious attack on the plant. What any increase in photosynthesis will give rise to then follows is that virulence factors (e.g., root wall changes in root exudation patterns and to shift s degrading enzymes) are transcribed and secreted in rhizosphere microbial community diversity and and used collectively and at elevated concentrations function (Drigo et al. 2008). Th e International against their target root cells. Th is appears to be Panel on Climate Change has predicted recently very eff ective, but plants have many ways of fi ght- that climate change will increase the susceptibil- ing back (Jones and Dangle 2006). For instance, ity of plants to pests and diseases. Th is has been plants may produce enzymes that disrupt microbial commented on by many (e.g., Zavala et al. 2008) communication (quorum quenching) by degrading and understanding how plants defend themselves quorum sensing peptides and acyl homoserine lac- against attack and how these processes can be tones. Plants may also secrete chemical mimics that manipulated is of increasing importance in 21st fool the pathogenic bacteria into generating invasive century agriculture. We already know that long- enzymes long before the population is dense enough term monocultures are not always conducive to to be eff ective (Faure and Dessaux 2007). Th is on- maintaining microbial diversity and that this going evolution of attack and defense mechanisms may increase the prevalence of some diseases and is taken to the next stage by some successful patho- reduce yields. Plants (as a source of food, fi bre and gens that actually block the synthesis and secretion increasingly biofuels) are subject to huge number of plant defence chemicals. Unsurprisingly, many of pathogen and predator attacks as well as a range microbial processes that are benefi cial to plants have of abiotic stresses. Th e details of every stage of the quorum sensing at the centre of their interactions host-plant pathogen relationship in a wide variety of (Cooper 2007). soils and a changing climate is a necessary precursor for developing commercial inoculants for biocontrol (Fravel 2005). The next phase of rhizosphere research Th e turnover of organic C in soil is a major part of the global carbon cycle and has a large impact Plants and soil microbes have co-evolved. In fact, on atmospheric CO2. Th e carbon dioxide arises fossil evidence suggests that the success of the very from root respiration and the mineralisation of fi rst land plants was dependent on mycorrhizal as- rhizodeposits, as well as the degradation of the gen- sociations (Taylor and Krings 2005) that served to erally more recalcitrant humic-like organic matter. extend the root capture zone and scavenge distant Increasing temperatures will give rise to a greater nutrients. Interestingly, the process of legume rate of microbial metabolism (just think microbial nodulation may have come along much later. Th e enzymes and temperature optima) and a consequent benefi cial associations, such as those resulting in reduction in the soil organic carbon sink—accom- enhanced phosphorus capture and nitrogen fi xa- panied by yet more respired carbon dioxide. tion, are reasonably well understood although the process of nodulation is infl uenced by rhizobacteria Plants and their rhizosphere microorganisms have other than rhizobia and the tripartite association a love–hate relationship that is forever being re- between rhizobia, mycorrhizae and plants is impor- assessed and modifi ed. Th ese interactions have tant to most legumes (Johansson et al. 2004). Th ere co-evolved and will continue to do so, but our in- are many opportunities to improve the availability creasing understanding suggests that we may soon and plant capture of phosphate and nitrogen in im- be able to infl uence this process and use it to our poverished soils, and we should expect continuing advantage. advances in this area. Some of these interactions will prove critical for the Th ere is a complacency about the lasting eff ect of successful development of agriculture, forestry and shocks on the microbial world because of the well horticulture in the next 50 years, both on our planet known robustness and resilience of bacterial and and probably beyond (Table 2).

TheTR Rovira Rhizosphere R Symposium S 6 Table 2. Manipulating the rhizosphere in the 21st Conclusions century Th e signposts erected by Albert Rovira and his many colleagues and his continuing enthusiasm and • Using microbial inoculants or manipulating the involvement (e.g., Ryder et al. 2007; Gupta et al. indigenous population for rational biocontrol 2010) give us direction and optimism about the fu- and bioremediation ture. Plant–microbe–soil interactions are a big part • Controlling the release of plant nutrients of that future. In the undeniably important context and the enhancement of other plant growth of food production and environmental quality, it promoting processes could be argued that understanding the multitude • Exposing plants to microorganisms (or of relationships within the rhizosphere is the most microbial metabolites) to induce a specifi c or challenging and important aspect of 21st century general immune response to pathogens and agricultural research. Some of the science is already predators in place or there is a suffi cient momentum that en- • Planting crops that are compatible with the sures that many of the answers will be forthcoming. indigenous microfl ora, soil type and climate What we need now is the political will and fi nancial • Stimulating or designing rhizospheres that can commitment to make further breakthroughs and support plant growth in a changing climate and in soils that are stressed by salinity, pollution, convert our knowledge into practice. Future dis- erosion and low available nutrients coveries will be driven by sound and imaginative • Selecting or designing bacteria and fungi with investment and sophisticated technologies, and lim- rhizosphere ‘competence’ ited only by the imagination of the researcher. An • Breeding plants that constitutively or attitude that nothing is impossible and a refusal to inductively secrete signals that generate and be daunted by the apparently bottomless black box support a benefi cial rhizosphere of soil will lead to some startling discoveries and • Designing self-sustaining soil biospheres for some highly successful agricultural and environ- agricultural production in crowded cities and, mental applications over the next decade. eventually, for establishment on the Moon, Mars and beyond References Altman, J., Neate, S. and Rovira, A.D. 1990. Herbicide pathogen interactions and my- Th e synthesis and secretion of chemical signals by coherbicides as alternative strategies for plants and microorganisms are reciprocal, tightly weed control. American Chemical Society regulated and controlled, and are both caused by Symposium Series 439, 240–259. and initiate a cascade of events. We don’t know what we don’t know but it is likely that there are Bais, H.P., Walker, T.S., Stermitz, F.R., Hufbauer, many more interactions taking place in the rhizo- R.A. and Vivanco, J.M. 2005. Enantiomeric sphere than we suspect—but they are certain to be dependent phytotoxic and antimicrobnial intricate and somewhat resistant to understanding activity of (+/–) catechin. A rhizosecreted and ultimately manipulating. We can be certain racemic mixture from spotted knapweed. that our desire for a simple, consistent and generic Plant Physiology 137, 1485–1485. resolution will be dampened: Occam’s razor will Bais, H.P., Weir T.L., Perry L.G., Gilroy S. and be blunted when attempting to understand the Vivanco, J.M. 2006. Th e role of root exu- intermittent and oft en chaotic processes that occur dates in rhizosphere interactions with plants in the rhizosphere. Th e established scientifi c belief and other organisms. Annual Reviews of in reductionism, that posits that everything in the Plant Biology 57, 237–266. natural world can be understood through a full knowledge of its constituent parts, may not hold Bloemberg, G.V. 2007. Microscopic analysis of true for all of soil biology. plant–bacterium interactions using auto ﬂ uorescent proteins. European Journal of Plant Pathology 119, 310–319.

TheTR Rovira Rhizosphere R Symposium S 7 Bouwmeester, H.J., Roux, C., Lopez-Raez, J.A. and Cook, R.J. and Rovira, A.D. 1976. Role of bacteria Becard, G. 2007. Rhizosphere communi- in biological control of Gaeumannomyces cation of plants, parasitic plants and AM graminis by suppressive soils. Soil Biology and fungi. Trends in Plant Sciences 12, 224–230. Biochemistry 8, 269–273.

Bowen, G.D. and Rovira, A.D. 1976. Microbial Cooper, J.E. 2007. Early interaction between le- colonization of plant roots. Annual Review of gumes and rhizobia: disclosing complexity Phytopathology 14, 121–144. of molecular dialogue. Journal of Applied Microbiology 103, 1355–1365. Bowen, G.D. and Rovira, A.D. 1999. Th e rhizosphere and its management to improve plant Cooper, J.E. and Rao, J.R. 2006. Molecular growth. Advances in Agronomy 66, 1–102. Approaches to Soil, Rhizosphere and Plant Microorganism Analysis. CABI Publishing, Brisbane, P.G. and Rovira, A.D. 1961. Comparison UK, 297 pp. of methods for classifying rhizosphere bacteria. Journal of General Microbiology 26, Danhorn, T. and Fuqua, C. 2007. Biofi lm formation 379–385. by plant-associated bacteria. Annual Review Brisbane, P.G. and Rovira, A.D. 1988. Mechanisms of Microbiology 61, 401–422. of inhibition of Gaeumannomyces graminis Doxtader, K.G. and Rovira, A.D. 1968. Nitrifi cation var. tritici by fl uorescent pseudomonads. by Apergillus fl avus in sterilized soil. Plant Pathology 37, 104–111. Australian Journal of Soil Research 6, 141– Bunt, J.S. and Rovira, A.D. 1955. Microbiological 149. studies of some subantarctic soils. Journal of Drigo, B., Kowalchuk, G.A. and van Veen, J.A. Soil Science 6, 119–128. 2008. Climate change goes underground:

Burns, R.G. and Dick, R. 2002. Enzymes in eﬀ ects of elevated atmospheric CO2 on mi- the Environment: Activity, Ecology and crobial community structure and activities in Applications. Marcel Dekker, New York, 614 the rhizosphere. Biology and Fertility of Soils pp. 44, 667–679.

Burns, R.G. (ed.) 2008. Enzymes in the environ- Drinkwater, L.E. and Snapp, S.S. 2007. ment III. Soil Biology and Biochemistry 9, Understanding and managing the rhizo- 2067–2185. sphere. In: Cardon, Z.G. and Whitbeck, J.L. (eds) Th e Rhizosphere: An Ecological Cardon, Z.G. and Whitbeck, J.L. 2007. Th e Perspective. Elsevier/Academic Press, New Rhizosphere: An Ecological Perspective. York, pp. 127–154. Elsevier/Academic Press, New York, 232 pp. Faure, D. and Dessaux, Y. 2007. Quorum sensing as Cheng, W. and Gershenson, A. 2007. Carbon ﬂ uxes a target for developing control strategies for in the rhizosphere. In: Cardon, Z.G. and the plant pathogen Pectobacterium. European Whitbeck, J.L. (eds) Th e Rhizosphere: An Journal of Plant Pathology 119, 353–365. Ecological Perspective. Elsevier/Academic Press, New York, pp. 31–56. Foster, R.C. and Rovira, A.D. 1976. Ultrastructure of wheat. New Phytologist 76, 343–352. Complant, S., Nowak, J., Coenye, T., Clement, C. and Barka, E.A. 2008. Diversity and oc- Fravel, D.R. 2005. Commercialization and imple- currence of Burkolderia spp. in the natural mentation of biocontrol. Annual Reviews of environment. FEMS Microbiology Reviews Phytopathology 43, 337–359. 312, 607–626. Gregory, P.J. 2006. Roots, rhizosphere and soil: a Cook, R.J. 2010. Two parallel rhizosphere pro- route to a better understanding of soil sci- grams. In: Gupta, V.V.S.R., Ryder, M. and ence? European Journal of Soil Science 57, Radcliﬀ e, J. (eds) Th e Rovira Rhizosphere 2–12. Symposium. Proceedings, 15 August 2008, SARDI Plant Research Centre, Adelaide. Gupta, V.V.S.R., Rovira, A.D. and Roget, D.K. Th e Crawford Fund, Canberra, pp. 43–48. (2010) Principles and management of soil biological factors for sustainable rainfed

TheTR Rovira Rhizosphere R Symposium S 8 farming systems. In: Tow, P., Cooper, I., Neate, S.M., Rovira A.D. and Cruickshank, R.H. Partridge, I. and Birch, C. Rainfed Farming 1987. Pectic enzyme patterns to identify Systems. Springer Science and Business rhizoctonias involved in bare patch of cere- Media (in press). als. Phytopathology 77, 1241–1246.

He, Y.W. and Zhang, L.H. 2008. Quorum sensing Newman, E.I. and Rovira, A.D. 1975. Allelopathy and virulence regulation in Xanthomonas among some British grassland species. campestris. FEMS Microbiology Reviews 32, Journal of Ecology 63, 727–737. 842–857. Oros-Sichler, M., Costa, R., Heuer, H. and Jackson, L.E., Burger, M. and Cavagnaro, T.R. Smalla, K. 2007. Molecular fi ngerprinting 2008. Roots, nitrogen transformations and techniques to analyse soil microbial commu- ecosystem services. Annual Reviews of Plant nities. In: van Elsas, J.D., Jansson J.C. and Biology 59, 341–363. Trevors, J.T. (eds) Modern Soil Microbiology. 2nd edn. CRC Press, New York, pp. 355– Johansson, J.F., Paul, L.R. and Finlay, R.D. 2004. 386. Microbial interactions in the mycorrhizo- sphere and their signifi cance in sustainable Pinton, R., Varanini, Z. and Nannipieri, P. 2007. agriculture. FEMS Microbiology Ecology 48, Th e Rhizosphere: Biochemistry and Organic 1–13. Substances at the Soil–Plant Interface. 2nd edn. CRC Press, New York, 424 pp. Jones, J.D.C. and Dangl, J.L. 2006. Th e plant immune system. Nature 444, 323–329. Raaijmakers, J.M., Paulitz, T.C., Steinberg, C., Alabouvette, C. and Moenne-Loccoz, Y. Jones, D.L., Kirk, G.J.D. and Staunton, S. 2006. 2009. Th e rhizosphere: a playground for soil Foreword to Rhizosphere 2004. European pathogens and benefi cial microorganisms. Journal of Soil Science 57, 1. Plant and Soil 321, 341–461.

Jones, D.L., Killham, K.S. and van Hees, P. (eds) Ridge, E.H. and Rovira, A.D. 1971. Phosphatase 2009a. Rhizosphere 2. Soil Biology and activity of intact young wheat roots under Biochemistry 41, 1767–1832. sterile and non-sterile conditions. New Phytologist 70, 1017–1020. Jones, D.L., Nguyen, C. and Finlay, R.D. 2009b. Carbon ﬂ ow in the rhizosphere: carbon Roget, D.K., Neate, S.M. and Rovira, A.D. 1996. trading at the interface. Plant and Soil 321, Eﬀ ect of sowing point design and tillage 5–33. practice on the incidence of rhizoctonia root rot, take-all and cereal cyst nematode Kerry, B.R., Simon, A. and Rovira, A.D. 1984. in wheat and barley. Australian Journal of Observations on the introduction of Experimental Agriculture 36, 683–693. Verticillium chlamydiosporium and other parasitic fungi into soil for the control of cereal Rovira, A.D. 1965. Interactions between plant roots cyst nematode Heterodera avenae. Annals of and soil microorganisms. Annual Reviews of Applied Biology 105, 509–514. Microbiology 19, 241–280.

Kraemer, S.M., Crowley, D.E. and Kretzschmar, R. Rovira, A.D. 1969. Plant root exudates. Botanical 2006. Geochemical aspects of phytosidero- Reviews 35, 25–57. phore promoted iron acquisition by plants. Advances in Agronomy 91, 1–46. Rovira, A.D. 1989. Ecology, epidemiology and control of take-all, Rhizoctonia bare patch and McDougal, B.M. and Rovira, A.D. 1970. Sites of cereal cyst nematode in wheat. 1989 Daniel exudation of C-14 labelled compounds from McAlpine Memorial Lecture. http://www. wheat roots. New Phytologist 69, 999–1006. australasianplantpathologysociety.org.au/ Pathology/McAlpine.DM7.htm Molina, J.A.E. and Rovira, A.D. 1964. Inﬂ uence of plant roots on autotrophic nitrifying bac- Rovira, A.D. and Bowen, G.D. 1966. Eﬀ ects teria. Canadian Journal of Microbiology 10, of microorganisms upon plant growth. 249–259. Detoxication of heat sterilized soils by fungi and bacteria. Plant and Soil 25, 129–140.

TheTR Rovira Rhizosphere R Symposium S 9 Rovira, A.D. and Bowen, G.D. 1968. Anion uptake Sharma, S., Aneja, M.K. and Schloter, M. 2007. by apical region of seminal wheat roots. Functional characterization of soil microbial Nature 218, 685–687. communities by messenger RNA analysis. In: van Elsas, J.D., Jansson J.C. and Trevors, Rovira, A.D. and McDonald, H.J. 1986. Eff ects of J.T. (eds) Modern Soil Microbiology. 2nd edn. the herbicide chlorsulfuron on rhizoctonia CRC Press, New York, pp. 337–354. bare patch and take-all of barley and wheat. Plant Disease 70, 879–882. Simon, A. and Rovira, A.D. 1985. Th e infl u- ence of phosphate fertilizer on the growth Rovira, A.D. and Ridge, E.H. 1973. Exudation of and yield of wheat in soil infested with C-14-labeled compounds from wheat roots: cereal cyst nematode (Heterodera avenae infl uence of nutrients, microorganisms, and Woll.). Australian Journal of Experimental added organic compounds. New Phytologist Agriculture 25, 191–197. 72, 1081–1087. Steinkellner, S., Lendzemo, V., Langer, I., Schweiger, Rudrappa, T., Biedrzycki, M.L. and Bais, H.P. 2008. P., Khaosaad, T., Toussaint, J-P. and Causes and consequences of plant associated Vierheilig, H. 2007. Flavonoids and strin- biofi lms. FEMS Micriobiology Ecology 5464, golactones in root exudates as signals in 153 –166. symbiotic and pathogenic plant–fungus interactions. Molecules 12, 1290–1306. Ryder, M.H., Yan, Z.N., Terrace, T.E. and Rovira, A.D. 1999. Use of strains of Bacillus isolated Taylor, T.N. and Krings, M. 2005. Fossil microor- in China to suppress take-all and rhizoctonia ganisms and land plants: associations and root rot, and promote seedling growth of interactions. Symbiosis 40, 119–135. glasshouse-grown wheat in Australian soils. Soil Biology and Biochemistry 31, 19–29. Wenzel, W.W. 2005. Rhizosphere conference. Journal of Environmental Quality 34, 2156. Ryder, M.H., Pankhurst, C.E., Rovira, A.D., Correll, R.L. and Ophel-Keller, K.M. 2007. Wilhelm, N.S., Graham, R.D. and Rovira, A.D. Detection of introduced bacteria in the 1988. Control of Mn status and infection rhizosphere using marker genes and DNA rate by genotype of both host and pathogen probes. In: O’Gara, F., Dowling, D.N. and in the wheat take-all interaction. Plant and Boesten, Ir. B. (eds) Molecular Ecology of Soil 123, 267–275. Rhizosphere Microorganisms. Wiley, UK, pp. 29–47. Zavala, J.A., Casteel, C.L., DeLucia, E.H. and Berenbaum, M.R. 2008. Anthropogenic in- Schenk, P.M., McGrath, K.C., Lorito, M. and creases in carbon dioxide compromises plant Pieterse, C.M.J. 2008. Plant–microbe and defense against invasive insects. Proceedings plant–insect interactions meet common of the National Academy of Sciences of the grounds. New Phytologist 179, 251–256. United States of America 105, 10631–10631.

TheTR Rovira Rhizosphere R Symposium S 10 How best can we design rhizosphere plant–microbe interactions for the benefi t of plant growth?

Vadakattu V.S.R. Gupta1 and Oliver G.G. Knox2

Abstract for improved fi eld performance. Th e eff ect of foliar sprays of herbicides and nutrients on root Th e rhizosphere represents a dynamic front or exudation and microbial communities opens region where plants meet and interact with the possibility of managing rhizosphere benefi cial and pathogenic microbes, biological activity from above ground, that is a invertebrates, other plant roots and soil. Since ‘designer rhizosphere’ to suit edaphic and the identifi cation, in the early 1950s, of environmental variation. Although new involvement of root exudates in the plant– knowledge about the enormous diversity of the microbe interaction a lot has become known soil microbial genome and the nature of about the composition of the compounds and chemical language that can occur suggests a the complex nature of the rhizodeposits vast complexity to the potential interactions, involved, their possible role in controlling recent developments in techniques provide hope specifi c plant–biota interactions and soil, and for the identifi cation of critical factors to help plant and environmental factors that aff ect the manage this dynamic front for the benefi t of the process. However, our ability to specifi cally plant. manipulate these interactions for the benefi t of plant health and growth is yet to successfully and reliably reach the fi eld environment. Introduction Examples of root exudate or rhizodeposition Th e importance of plant–microbe interactions in induced changes in plant–microbe interactions the rhizosphere region has been recognised and include (i) proliferation of specifi c genera or appreciated for more than 50 years (Rovira 1956; groups of biota, (ii) induction of genes involved Lynch 1990; Drinkwater and Snapp 2007; Hawkes in symbiosis and virulence, (iii) promoter et al. 2007). A number of reviews and books detail activity eff ects in biocontrol agents and (iv) the various aspects of the rhizosphere from both genes correlated with root adhesion. Th e the plant and microbial perspective (Bowen and observation of plant variety-based diff erences in Rovira 1999; Singh et al. 2004; Watt et al. 2006; root exudation/rhizodeposition and associated Cardon and Whitbeck 2007). We now know a changes in rhizosphere microbial diversity lot about the spatial and temporal dynamics of suggests the possibility for the development of diff erent microbial groups in the rhizosphere and varieties with specifi c root–microbe interactions have some knowledge of the factors that infl uence the populations and activities of soil biota in the

1 CSIRO Entomology, PMB No 2, Glen Osmond, rhizosphere. SA 5064, Australia Th rough rhizodeposition plants can aff ect Email: [email protected] rhizosphere microbial diversity and activity and 2 Scottish Agricultural College, Edinburgh, EH9 3JG, resistance to pests and diseases; support benefi - Scotland

TheTR Rovira Rhizosphere R Symposium S 11 and structure, which infl uences the quantity of root exudation, whereas chemical properties can interfere with or enhance the eff ectiveness of chemical signals by plants and microbes. In this paper we review, briefl y, what is known about plant–microbe interactions and provide examples where rhizosphere microbial populations have been infl uenced through above-ground management. Link between plant and rhizosphere microbial communities

Th e key link between a plant and the microbial community is the release of a diverse range of root exudates and rhizodeposits by the plants belowground. A plethora of organic compounds have been identifi ed in root exudates and rhizodeposits, for example root-specifi c chemical signals, low and high molecular weight carbon and nutritional compounds, growth regulators and secondary metabolites (Lynch 1990; Bowen and Rovira 1999; Bais et al. 2006; Badri and Vivanco 2009). Figure 1. Root exudate or rhizodeposition mediated Root exudation is the major source of organic C plant–microbe–soil interactions with impacts on plant growth and productivity (Elizabeth Drew and released by plant roots. Whipps (1990) reported V.V.S.R. Gupta, CSIRO, unpublished) that young seedlings exude as much as 30–40% of their fi xed carbon. Th e quantity and quality of root exudates are determined by the plant species and the age of the plant modulated by the cial symbioses; aff ect nutrient cycling and alter external abiotic and biotic stress factors (Rovira the chemical and physical properties of soil and 1965). Although rhizodeposition is sometimes allelopathy against competing plants (Fig. 1). considered as a burden to the plant through loss of photosynthetic product, it is now established that Root–microbe, root–biota and root–insect inter- plants use this physiological process to benefi t from actions can be grouped as benefi cial, deleterious the rich diversity of soil microorganisms. From the or symbiotic associations in relation to nutrient soil biota perspective, the rhizosphere is a niche cycling, plant health and growth. Compounds in for large microbial populations and heightened root exudates and border cells have been shown to activity, in particular in low-organic-matter (i.e. act as chemo-attractants or suppressors infl uencing oligotrophic) agricultural soils. Plants can aff ect population levels of rhizosphere biota including the composition and/or activity of benefi cial and bacteria, fungi and nematodes (Bowen and Rovira deleterious microbial communities and thus alter 1999). Root-exudate-induced gene expression in the complex trophic interactions and relations legume–Rhizobium symbiosis has been well stud- between plant, microorganisms and soil fauna. ied. However, root-exudate-induced gene expression Larger populations of microfl ora in the rhizosphere in non-obligate plant–microbe relationships is less encourage the predator–prey interactions that well understood. For example, it may be possible to are important in stimulating plant growth both construct organisms with rhizosphere-controlled through the ‘microbial loop in soil’ and a number of benefi cial genes and to use them as gene delivery signifi cant indirect feed-backs between consumers vehicles for specifi c purposes. A number of soil, of rhizosphere microorganism and plant roots plant and environmental factors and management (Bonkowski et al. 2009). practices can aff ect the quantity and quality of rhizodeposition that in turn aff ect the composition Th e rhizosphere is a dynamic changing environment and activity of rhizosphere biota communities. Soil diff ering throughout the plant growth period. Th e physical structure can aff ect the rate of root growth rhizosphere eff ect is considered to extend only a few millimetres from the root, but its extent will depend

TheTR Rovira Rhizosphere R Symposium S 12 upon the diff usivity of particular root exudates • Th e quantity and composition of root exudates as infl uenced by soil characteristics and the water varies depending upon the type, age and status of soil. Spatial diff erences in rhizosphere physiological status of the plant. microbial communities can also be seen within the • Soil physical structural properties that root system from the root tip to behind the zone of cause mechanical impedance aff ecting root elongation (Foster 1986; Bowen and Rovira 1999), morphology, for example high bulk density with the maximum rhizosphere eff ect postulated to and soil compaction, can increase root be in the region behind the zone of elongation. exudation. Th e composition and activity of rhizosphere • Soil chemical characteristics including pH, microbiota (microfl ora and protozoa) not only nutrient status and the presence of particular varies between plant species, but intraspecifi c (e.g. minerals and toxic metals can alter the variety-level) variation within a plant type has also quantity and composition of root exudates. For been demonstrated. For example, Brassica plants example, acid soil pH increases organic anion support a signifi cantly diff erent composition of malate exudation. Similarly plant roots have fungal and bacterial communities compared with been shown to exude specifi c organic acids cereal plants, while diff erent canola varieties also diff er in their rhizosphere bacterial populations (e.g. citric, oxalic and malic acids) to detoxify (Siciliano and Germida 1998; Gupta et al. 2009; high levels of aluminium in soils (Badri and Hartmann et al. 2009). Plant eff ects can also be Vivanco 2009). Phosphorus-defi cient plants modifi ed by the nutrient status of the plant, by develop greater amounts of fi ne roots and mycorrhizal colonisation and by pathogen infection. can secrete phenolic compounds and specifi c organic anions. Higher salt concentrations in soil increase the amount of root exudation. Factors that aff ect root exudation or • Environmental factors such as temperature, rhizodeposition light and rainfall can modulate root exudation or rhizodeposition processes; for example A large body of evidence exists indicating the Watt and Evans (1999) reported that the root infl uence of diverse physical, chemical and exudation process follows diurnal rhythms, biological factors on root exudation and/or with higher exudation during periods of light. rhizosphere microbial populations (Bowen and Rovira 1999; Cardon and Gage 2006). In Rainfall and soil moisture conditions aff ect addition the root system architecture, a plant root exudation through water stress or oxygen trait determined by its genetic predisposition concentrations in soil. and subsequently modifi ed by several biotic and • Exposure of plants to agrochemicals (e.g. abiotic factors can alter exudation characteristics insecticides, herbicides and fungicides), (Badri and Vivanco 2009). In seminal papers hormones and nutrients can alter both the published during 1956, Rovira et al. described the quantity and composition of root exudation. composition of root exudates and demonstrated • Th e presence of specifi c microorganisms or the link between plant species, exudate compounds microbial metabolites can alter the secretion and changes in specifi c microbial populations. of root exudates. For example, Meharg and Despite more than 50 years of subsequent research, Killham (1995) reported that microbial the underlying genetics for the diff erences in plant inoculation of the rhizosphere may increase response to factors aff ecting root exudation and root exudation by a number of modes of rhizodeposition remain unclear. action—that is, benefi cial metabolites increase exudation through stimulation of root As plant roots in soil are exposed to a variety growth—whereas fungal infection of plants of abiotic and biotic stresses, they release a can alter the composition of root exudate. complex blend of chemicals to encourage positive interactions and protect against negative infl uences. Th e eff ects of soil, environment, plant and management factors on root exudation have been reviewed by Rovira (1969), Cardon and Whitbeck (2007) and Badri and Vivanco (2009). Th ese can be briefl y summarised as:

TheTR Rovira Rhizosphere R Symposium S 13 Response of specifi c functional Table 1. Some examples of the root-exudate-induced groups of microbes, populations changes in plant–microbe interactions and function • Induction of genes involved in symbiosis and virulence (Downie 2010) Soil microorganisms utilise their capabilities • Proliferation of specifi c genera and/or groups for chemotaxis, induced gene expression and of biota competitiveness to colonise roots and grow in the rhizosphere. Some examples of root exudate * nif H phylotypes (Bürgmann et al. 2005) mediated plant–microbe interactions are listed * Suppressive bacteria (Smith et al. 1999) in Table 1. Most rhizosphere microorganisms, * Plant beneﬁ cial pseudomonads (de Weger et al. 1995) being heterotrophic, depend on rhizodeposits • Promoter activity in PGPR / biocontrol agents as carbon and nutrient substrates. Rhizosphere (van Overbeek and van Elsas 1995; Kloepper et microorganisms also use minor, non-nutrient al. 2004) components in root exudates as signals to guide • Gene expression related to root adhesion their movement towards the root surface and (Downie 2010) elicit changes in gene expression appropriate to • Genes associated with border cell quantity and the environment. Examples of such interactions quality (Hawes et al. 1998) involving symbiotic rhizobia and mycorrhizae have been extensively investigated (Bauer and Caetanoanolles 1990; Long 2001; Bais et al. 2006). Similarly certain compounds in root exudates, Border cells even at low concentrations, can serve as chemo- attractants for rhizosphere bacteria. For example, One of the major components of rhizodeposition the ability of Azospirillum spp. to detect low is the border cells, originally called ‘sloughed root concentrations of aromatic compounds such as cap’ cells, which are enmeshed in the mucilage benzoate confers an advantage in its survival and but become detached in the presence of free water colonisation of rhizospheres (Lopez-de-Victoria (Hawes et al. 1998). It is suggested that border and Lovell 1993). In addition to attracting specifi c cells act as a ‘front line’ of detached living cells that microorganisms, components or root exudates help the parent plant cope with attack by an array can serve as specifi c inducers of gene expression, of soilborne organisms awakened to growing root for example virulence and catabolic genes, and signals. Th ey are living cells that can survive as long promoter activity for specifi c genes. van Overbeek as appropriate nutrients are available and they are and van Elsas (1995) reported that root exudates protected from predators and other stresses (Hawes such as proline induced specifi c promoter activity et al. 1998). in plant-growth-promoting P. fl uorescens in Diverse border-cell-mediated responses in soil the wheat rhizosphere. Burgmann et al. (2005) organisms—both benefi cial and pathogenic found specifi c components of root exudates (e.g. bacteria, fungi and nematodes)—have been selectively altered the structure and activity of soil reported (Hawes et al. 1998). Th ey include the diazotrophic communities—for example, sugar- general stimulation of growth and sporulation of containing substrates were able to induce nitrogen bacteria and fungi, chemoattraction or repulsion fi xation—but the presence of organic acids and of benefi cial and pathogenic organisms, and substrate concentration may have additional eff ects production of specifi c extracellular signals that on the active diazotrophic population. Exudation infl uence microbial gene expression. Evidence also of antimicrobial metabolites has been suggested exists for border cell production of extracellular as a major mechanism for plants to withstand enzymes, antibiotics, phytoalexins and a number of pathogen attacks (Hartmann et al. 2009). Th e unknown proteins of functional signifi cance. It is ability of plants to produce antimicrobials, such as also proposed that border cells may act as a decoy antioxidant enzymes, necessitates the requirement for pathogens (fungi and nematodes) before they for successful rhizosphere colonisers to avoid these can reach the growing root tip and cause infection. chemicals. Although border cells are sometimes seen as just a source of nutrients for invading microorganisms, a

TheTR Rovira Rhizosphere R Symposium S 14 number of studies have reported host- and tissue- signal molecules between nearby cells that enables specifi c responses of border cells to microorganisms: individual cells or small colonies of bacteria to that is, the ability of any given microorganism to coordinate the expression of specifi c genes and associate with border cells may depend upon the thereby act like a multicellular organism. Plants plant genotype (Hawes and Brigham 1992). Knox have been shown to release compounds that mimic et al. (2007) reported varietal-based diff erences bacterial signals and take advantage of bacterial in the number of border cells produced by cotton dependence on QS (Bauer and Mathesius 2004; seedlings. In general, border cell production diff ered Juhas et al. 2005) and produce enzymes that considerably among cotton cultivars, but border degrade quorum-sensing compounds and disrupt cell production in the transgenic cultivars of cotton microbial communication (quorum quenching) (e.g. cultivars expressing Cry1Ac and Cry2Ab) was before the population reaches the critical level similar to that of both donor and elite parents. required to be eff ective. Th is phenomenon has been However, one of the parental cultivars, Sicot 189, shown to exist both in benefi cial and pathogenic produced substantially greater numbers of border bacteria and fungi (Fuqua et al. 1994; Nickerson cells compared to all its transgenic derivatives. A et al. 2006; Cooper 2007). N-acyl homoserine comparison of border cell number with varietal lactones (AHLs) in gram-negative bacteria and disease resistance ranking against Fusarium wilt of small peptides in gram-positive bacteria are the cotton found a limited relationship (r2 = 0.65). commonly reported QS signals. In addition to the evidence for QS signal production by diverse Border cell production is not generally a continuous bacterial genera, disruption of QS regulation by by-product of constitutive turnover of the root other bacteria (i.e. signal degraders) adds additional cap, but can be turned on and off by the plant. In complexity to plant–bacterial communication. addition, border cell production can be infl uenced Th e bacterial responses to QS signals include by environmental conditions. Zhao et al. (2006) altered biofi lm dynamics, motility, plasmid observed that CO : O concentrations in the soil 2 2 transfer, stress response, virulence, nitrifi cation atmosphere can infl uence the development and and enzyme production (Pierson et al. 1998, Bauer separation of border cells in pea seedlings, but no and Mathesius 2004; d’Angelo-Picard et al. 2005). such eff ect was seen in alfalfa. Examples of plant responses to bacteria QS signals Th e nature of the interaction between border are defence-related gene expression, stress responses cells and specifi c members of the soil microbial and expression of symbiosis genes. Th is research community is thought to be regulated by (i) the is currently in its infancy; before we can expect to carbon and nutrient composition of border cells manage plant responses through the regulation of or (ii) defense structures or attractants produced QS signals we require a better understanding of by border cells or (iii) the nature of the mucigel. their production and degradation, community-level For example, zoospores of Pythium dissotocum responses and the diverse array of traits that respond accumulate on border cells of cotton (Goldberg et to QS communication. Bauer and Mathesius (2004) al. 1989) whereas border cells of single maize can suggested that genome-level transcriptional studies synthesise defence structures that repel penetration are needed to gain a better understanding of the by Colletotrichum graminicola hyphae (Hawes et dynamics of QS signals and their infl uence on plant- al. 1998). Such specifi c associations, combined related functions. with designed border cell production and release, could be used to improve plant nutrition (e.g. Eff ect of inoculation with through border cells producing nutrient-solubilising micro-organisms on rhizosphere enzymes), impart disease resistance (e.g. border cells delivering antibiotics to evade pathogen infection) microbial communities and help with bioremediation. As indicated before, the presence of specifi c microorganisms in the rhizosphere can modify the Quorum-sensing communication quality and quantity of root exudation. In recent times, a great deal of research has been done to Quorum-sensing (QS) behaviour refers to the inoculate seeds with bacterial, actinomycete and population-density-dependent regulation of gene fungal isolates for the purpose of bio-protection expression in bacteria. It works by the exchange of against biotic stresses including pathogens or

TheTR Rovira Rhizosphere R Symposium S 15 plant growth promotion (Kloepper et al. 2004; ylate (ACC) deaminase have been shown to help Raaijmakers et al. 2009). A number of these plants withstand both abiotic and biotic stresses organisms are known to produce biologically active (Hontzeas et al. 2004). Some of the known mecha- compounds, for example hormones, antifungal nisms regarding root–microbe–soil interactions compounds and other types of antibiotics that when exposed to abiotic and biotic stressors include: have the potential to modify the composition of rhizosphere microbial communities. In general, • Bacterially produced indole acetic acid (IAA) transient changes in indigenous bacterial, fungal or nitric oxide stimulating root growth under and protozoan populations, carbon turnover drought, salinity and metal toxicity and nutri- and enzyme activities have been observed in ent defi ciencies response to inoculation of plants with specifi c • Bacterial ACC deaminase reducing host plant organisms, but many of these eff ects are based on stress ethylene level laboratory experiments and information from • Changes in plant physiological and phenotypic fi eld environments is limited. Natsch et al. (1997) characteristics, for example cell membrane. reported that inoculation with antibiotic-producing P. fl uorescens inoculants resulted in only a transient Since the occurrence of multiple stresses is not reduction in resident pseudomonads on wheat uncommon in fi eld environments, it would be roots. Glandorf et al. (2001) found that application benefi cial to identify microbial inoculants that can of genetically modifi ed phenazine (PCA)- provide cross-protection against both biotic and producing P. putida (engineered to have improved abiotic stressors, to sustain agricultural production antifungal activity) exerted non-target eff ects on in response to climate change. the composition of natural fungal microfl ora in the wheat rhizosphere when measured using 18S rDNA Modifi cation of rhizosphere ARDRA analysis. Th ey found that PCA-producing composition through above-ground genetically modifi ed (GM) plants can transiently alter the composition of rhizosphere fungal treatment populations of fi eld-grown wheat. However, the In high-input agricultural systems, the needs of inoculants had no eff ect on metabolic activity and the plant are generally met by external applications biological processes such as nitrifi cation potential of nutrients and other agrochemicals, but in low- and cellulose decomposition. Robleto et al. (1998) input agro-ecosystems, especially on soils with showed that the inoculation of fi eld-grown lower organic matter, there is a need to broaden Phaseolus vulgaris with Rhizobium etli strains, the rhizosphere contributions to encompass a wide producing peptide antibiotic trifolitoxin, caused a range of plant-essential biological processes in order reduction in the diversity of trifolitoxin-sensitive to maximise crop growth and yields. Until now α-proteobacterial populations. Th ese studies most of the deliberate management of rhizosphere suggest that it may be possible to alter rhizosphere plant–microbe interactions has focused on the microbial communities, at least transiently, to a level control of plant pathogens and improvement of that aff ects plant growth. symbiotic associations such as nitrogen fi xation and Over the last two decades, there is a growing mycorrhizae. Th e eff ect of management practices interest in exploiting rhizosphere- or endophytic- on other rhizosphere microbial processes has colonising non-pathogenic bacteria to increase plant been researched for over 50 years, but eff orts to resistance to abiotic stresses such as salinity, drought modify these processes to benefi t crop growth and and metal or contaminant toxicity (Dimpka et production have been inconsistent or ineff ective al. 2009). For example, it has been suggested that (Handelsman and Stabb 1996; Rovira 1991). osmolytes such as glycine betaine produced by Here we discuss, briefl y, examples of changes in osmo-tolerant bacteria could potentially act syn- rhizosphere microbial diversity and/or functions ergistically with plant-produced glycine betaine due to genetic variation (e.g. crop or variety choice), in response to stress and thus increase drought application of chemicals or nutrients as part of crop tolerance by plants (Dimpka et al. 2009). Th e plant management. growth promoting rhizobacteria (PGPR) eff ects of bacteria possessing 1-aminocyclopropane-1-carbox-

TheTR Rovira Rhizosphere R Symposium S 16 Plant variety-based diff erences in plant– munities of more modern wheat cultivars were microbe interactions more diverse than those of ancient land races, and were aggressively colonised by endophytic Plant genotype-based diff erences in rhizosphere and pseudomonads. Siciliano et al. (1998) suggested that endophytic microbiota populations have been well the root morphologies and chemical composition demonstrated for a variety of plant types. Neal et of modern cultivars aff ected the ability of certain al. (1973) reported that even a single chromosome rhizosphere bacteria to colonise the root interior. substitution in the plant genotype has the potential Gupta et al. (2009) reported that populations and/ to alter the composition of microbial communities. or composition of a number of phenotypic and Th e role of plant species, and inter-specifi c and functional groups of microfl ora—for example co- intra-specifi c variation, in determining rhizosphere piotrophic and oligotrophic bacteria, cellulotyic microbial communities in an agricultural context microfl ora, total pseudomonads, spore-forming was reviewed by Drinkwaer and Snapp (2007) and bacteria and nitrifying bacteria—diff ered in the Hawkes et al. (2007). rhizosphere soils of diff erent wheat varieties. Wheat Until recently plant breeding programs have varieties also diff ered in terms of rhizosphere generally intended to improve above-ground protozoan composition (Fig. 2). Community- characteristics and agronomic fi tness of plants, level physiological profi ling analyses indicated even though such modifi cations could alter below- variety-based diff erences in bacterial composition ground plant parts—that is, root growth pattern and rhizodeposition, and root-associated microbial community and biological functions. Reported diff erences in root architecture (distribution in depth, morphological features) and exudate quality for wheat cultivars have been linked to tolerance of moisture and salt stresses, heavy metal contamination, root disease avoidance and improved nutrient use effi ciency.

During the last decade, in a series of glasshouse- and fi eld-based research projects, we explored the relationship and interaction between genetically modifi ed and conventional cotton varieties with their associated rhizosphere microbiology. Results indicated that cotton rhizosphere plant–microbe interactions are signifi cantly infl uenced by cultivar type, irrespective of their GM status (Gupta et al. 1998; Knox et al. 2004, 2009). A very strong relationship was observed from the start of the season Figure 2. Infl uence of foliar herbicide exposure of between the bacterial communities that develop in plants on the catabolic diversity of soil microbial the rhizosphere of cotton varieties. Although there communities in the rhizosphere of canola, barley were seasonally-based diff erences in the popula- and varieties of wheat. Data on the carbon substrate tions of rhizosphere microbial communities, a clear utilisation profi les were obtained using a modifi ed varietal separation was observed. Diff erences in the Microresp® method (V.V.S.R. Gupta, 2007, genetic and catabolic diversity of microorganisms unpublished) with rhizosphere soils collected 5 between varieties suggest that rhizosphere microbial days after the foliar application of the herbicide ® communities may be adapted to the quantity and Sprayseed (equivalent of 0.081 g of Diquat and quality of root exudates from cotton plants. 0.069 g of Paraquat in 1 L of distilled water) on 4-week-old seedlings in a glasshouse experiment.

Germida and Siciliano (2001) reported that there Canonical variate analysis was conducted on the CO2 was signifi cant variation between the bacteria data normalised against the average response for 31 generally associated with modern and older wheat diff erent carbon substrates. Green-fi lled symbols are cultivars. For example, bacterial endophyte com- for control plants and black-fi lled symbols are for herbicide-exposed plants.

TheTR Rovira Rhizosphere R Symposium S 17 (Sicliano et al. 1998; Gupta et al. 2004). Since the Overall, these observations suggest that further eff ect of the plant on the soil microbial community understanding of mechanisms governing rhizo- is primarily through the changes in rhizodeposi- sphere plant–microbe interactions will be crucial tion, catabolic profi ling can provide links to plant in the development of crop-breeding strategies that infl uences on rhizosphere microbial communities. target the selection of plant–microbe consortia or Such diff erences in microbial genetic and catabolic a ‘designer rhizosphere’ approach for the benefi t of diversity and abundance between varieties can be re- agriculture in the future. A number of edaphic, en- fl ected in the biological processes involved in C and vironmental and management-related factors have N cycling (Gupta et al. 2009; Knox et al. 2009). been shown to infl uence the complex association between plant roots and soil microbial communi- Gupta et al. (2004) reported that wheat cultivars ties—both the numbers and types of organisms and diff erentially select for diff erent microbial commu- their functionality. Th e manipulation of plant– nities that can aff ect the growth and productivity of microbe interactions can be achieved by (i) altering the following wheat crop. Wheat-following-wheat rhizodeposition through variety or crop choice, in fi eld trials can result in a 5–20% yield penalty and/or (ii) modifying rhizosphere microbial diver- due to a build-up of deleterious microfl ora, and sity and functionality through management, that is there is a strong eff ect of variety. For example, larger tillage, rotation or application of chemicals. populations of fast-growing bacteria (copiotrophs) were associated with poor-performing varieties, while larger populations of slow-growing bacteria Eff ect of above-ground treatment of plants (oligotrophs) were associated with high-performing on rhizosphere communities varieties. In addition, wheat cultivars as seedlings A variety of management practices involve the diff er in their ability to select for a disease-suppres- above-ground treatment of plants with agrochemi- sive microbial community in wheat-soil bioassays cals, hormones and nutrients to either control pests (Dr S. Barnett, SARDI, pers. comm., 2008). and diseases or help improve plant nutrient status. A plant’s infl uence on the root-associated mi- Such treatments generally improve plant health, but crobiota (e.g. microfl ora and protozoa) can vary sometimes may cause short-term or transient invigo- at diff erent microsites along the root, and it can ration or stress in the plant. A number of studies change during the growing season. In addition, have reported increased severity of root diseases the eff ect of the plant on rhizosphere communities following the exposure of plants to herbicides, even is modulated by the soil type in which the plant at low levels (Bowen and Rovira 1999), and such grows and by the nutritional status of the system. observations have been attributed to the increased For example, endophytic bacterial and actinomycete susceptibility through increased and/or altered root communities in the roots of crops are a subset of exudation infl uencing root–pathogen–microbe the rhizosphere community (Siciliano et al. 1998; interactions. In addition, aerial sprays of pesticides Conn and Franco 2004). Guemouri-Athmani et or nutrients have been shown to infl uence the rhizo- al. (2000) found that the genetic composition of sphere microfl ora of a number of crops (Agnihotri Pseudomonas polymyxa populations varied across 1964; Rovira 1965). Aerial sprays of plants with the chronosequence in Algerian soils that had been urea were shown to modify bacterial and fungal under wheat cultivation for from 5 to 2000 years. populations in the rhizosphere of a variety of crops Th e longevity of wheat cultivation was correlated such as wheat, maize and tea (Rovira 1965), and with decreased genetic and phenotypic diversity these changes were attributed to modifi cations in and higher frequency of N-fi xing strains ofP. poly- the quality and quantities of root exudates. Other myxa in rhizosphere soils. Schallmach et al. (2000) examples of foliar-spray-mediated modifi cation to found that low N status increased the proportion of rhizosphere microfl ora occur with antibiotics and α-proteobacteria relative to the entire bacterial pop- hormones in the sprays; results have been variable. ulations near the root-tip of common bean. Briones Th e introduction of herbicide-tolerant (HT) crops et al. (2002) reported that links between plant ge- has changed the timing and spectrum of herbicides notypic and phenotypic diff erences in rhizosphere used ‘in crop’ and provided farmers with an eff ec- processes occur in nitrifying bacterial populations tive in-crop weed-management tool. For example, in the rhizosphere of traditional versus modern rice glyphosate-resistant varieties of crops such as canola, cultivars.

TheTR Rovira Rhizosphere R Symposium S 18 soybean and wheat have been quickly and widely it would be possible to manipulate plant–microbe adopted (Beckie et al. 2006). HT crops change interactions as required through above-ground soil environmental conditions and can infl uence chemical application. As Bowen and Rovira (1999) microbial communities through (i) direct eff ects of suggested, since herbicide exposure can aff ect herbicides on microbes, (ii) introduction of plant both the pathogenic and benefi cial plant–microbe material (dying weeds) from post-emergent herbi- interactions it may be possible to direct specifi c cide use, and (iii) infl uencing microbial dynamics rhizosphere microbes from the above-ground in the rhizosphere. Th e eff ects of HT crops on soil management of crops, that is achieve ‘designer microbial communities are variable depending upon rhizospheres’ to suit specifi c edaphic and environ- the herbicide chemistry, plant type and edaphic fac- mental conditions. tors (Hart et al. 2009). Recent reports suggest that Until now rhizosphere responses have been gener- roots of glyphosate-resistant soybean cultivars treat- ally investigated in terms of the release of C and ed with glyphosate may be colonised by Fusarium nutrients, whereas mechanisms involving the sp. (Kremer 2003; Means and Kermer 2007). production and release of other signal molecules Kremer et al. (2005) reported that glyphosate ap- that can infl uence molecular cross-talk between plication increased exudation of carbohydrates plants and microbes or among rhizosphere micro- and amino acids. In vitro bioassays indicated that bial communities have not been investigated. New the presence of glyphosate and root exudate com- developments in molecular-based methods can now pounds stimulated growth of selected rhizosphere help us unravel the molecular interactions underly- fungi and reduced populations of bacteria such as ing the plant- and microbial-based mechanisms in pseudomonads. Gupta et al. (1998) reported that order to successfully apply ecological knowledge to application of herbicide pyrithiobac-Na increased agricultural management. the level of microbial activity (by over 40%) and altered the catabolic diversity of bacterial communities in the rhizosphere of GM cotton, but had only What is needed? a slight eff ect in the parent cotton. Research from Since Lorenz Hiltner coined the term ‘rhizosphere’ Canada clearly demonstrated diff erences in the more than hundred years ago, ample evidence has endophytic and rhizosphere communities of trans- been obtained to demonstrate the selection of genic and non-transgenic canola varieties grown at microbes by plant roots. However, the complexity the same fi eld site (Siciliano et al. 1998). Research of plant–microbe interactions within both the root conducted in Australia has indicated that the geno- and the rhizosphere still requires the unravelling typic and catabolic diversity of rhizosphere bacterial of major steering factors that control specifi c and fungal communities of herbicide-tolerant and interactions. We need to improve our ability to conventional canola varieties diff er in their response alter rhizodeposition to selectively stimulate and/or to in-crop herbicide application (Gupta et al. 2009). suppress certain groups of microorganisms, leading Yousseff et al. (1987) reported that herbicide appli- to new community structures and ultimately cation to cotton increased amino acids in exudates improving plant growth and productivity, especially and that this increase was linked to an increase in in the fi eld environment. fungal populations, and that the eff ects were soil- type-dependent. Our work has added to the body of evidence that identifi es that changes are brought about in Results depicted in Figure 2 show signifi cant population size in both phenotypic and functional changes in the catabolic diversity of microbial com- groups of microbial and microfaunal communities munities when diff erent plants (canola, wheat and and in their ability to function (e.g. nitrifi cation, barley) are exposed to the same chemical, and that free-living N2- fi xation, C turnover) through the such responses can also vary between varieties of selection of varieties and in-crop management the same crop, for example wheat varieties Yitpi and practices. However, the science with regard to Axe. Plants express stress symptoms when exposed how we can design rhizosphere plant–microbe to unfavourable conditions (including chemical interactions for the benefi t of plant growth remains exposure) through altered quantity and quality in its infancy, and we now need to develop it by of rhizodeposition, resulting in modifi cations to addressing some of the outstanding issues, which the composition and or functionality of microbial include, but are not limited to: communities. Overall, these examples indicate that

TheTR Rovira Rhizosphere R Symposium S 19 • Signalling molecules that stimulate Finally, the path to achieving a designer rhizosphere rhizosphere population growth. Th ese could will be through the description of the dynamics be simple sugars or more complex molecules of microbial composition and defi ning the factors triggering growth responses, such as plant that regulate their functionality (Burns 2010, pp. fl avonoids, homoserine lactones (HSL), or 1–10 this volume). In achieving this, key areas of IAA. What is the benefi t of increasing some interest include (i) identifying the plant signals populations? Can pathogen control be eff ected and microbial receptors that cause and recognise through competition or physical barriers? the changes, (ii) identifying what changes in either Could increased populations simply attract population composition, functional activity or both higher trophic groups (protozoa or nematodes) are eff ected, (iii) identifying why the changes are and thus enhance nutrient cycling? important within the wider function of evolution • Signalling molecules that stimulate and ecology of the production system, and (iv) the function. Increased function has been scope of the environmental conditions and/or other observed where the size of the population external factors under which the changes can be involved does not correlate well with activity, eff ected. which implies a shift in functional capabilities, possibly due to genetic switches or channel- Conclusions stimulating molecules and signals. When would stimulation of a function without a In the last 50 years the science of the rhizosphere population change be benefi cial? Is functional and the plant–microbe interactions occurring stimulation better by being more controlled within this narrow frontier has come a long way. or targeted than population control, thus Th e ability to use management or crop variety se- potentially avoiding proliferation of pathogens lection to eff ect change in rhizosphere population or organisms that could benefi t neighbours? composition or functional activity has been clearly • Below-ground drivers of above-ground demonstrated. On the back of this comes clear rec- diversity. Th ere is a growing body of work that ognition of the potential to develop methods within demonstrates that a more diverse mycorrhizal existing agricultural systems that could either take soil community will support a more diverse advantage of or be managed for benefi cial manipu- plant community. Is it possible that bacterial lations of the associated microbiota within this communities could be having a similar eff ect dynamic front, that is a ‘designer rhizosphere’. Th e on plant diversity, or are they simply too decades ahead will hopefully see many of the chal- numerous, functionally capable, recalcitrant lenges we have outlined here addressed and, perhaps and resistant to have a role as a driver in this in another 50 years, we will no longer have to ask process? how best to manage the plant–microbe interactions of the rhizosphere for plant growth, because we will With the current focus on security of food to feed already know. the growing global population and a need to address issues of soil health maintenance, agricultural pro- Acknowledgements ductivity and greenhouse gas production, we need improved ecosystem strategies that require knowl- Financial support for the authors was provided edge of regulators and feedbacks for rhizosphere by CSIRO Divisions of Land and Water and interactions against background soil environment Entomology and through projects funded by and function over longer temporal scales (Gupta Grains and Cotton Research and Development et al. 2010). A better understanding of the dynam- Corporations. Technical support for laboratory ics of rhizodeposition in natural and agricultural analyses was provided by Stasia Kroker. systems will be needed in order to establish the underlying genetic background for both the produc- References tion and reception of the signal molecules involved. Expansion of these systems-level processes to a range Agnihotri, V.P. 1964. Studies on Aspergilli. XIV. of plant species and habitats will also be required, Eﬀ ect of foliar spray of urea on the Aspergilli with the acceptance that in some cases habitat- and of the rhizosphere of Triticum vulgare L. species-specifi c signal molecules will need to be Plant and Soil 20, 364–370. identifi ed where present.

TheTR Rovira Rhizosphere R Symposium S 20 Badri, D.V. and Vivanco, J.M. 2009. Regulation and Cardon, Z.G. and Whitbeck, J.L. 2007. Th e function of root exudates. Plant, Cell and Rhizosphere: An Ecological Perspective. Environment 32, 666–681. Academic Press, NY.

Bais, H.P., Weir, T.L. et al. 2006. Th e role of root Conn, V.M. and Franco, C.M.M. 2004. Analysis of exudates in rhizosphere interactions with the endophytic actinobacterial population plants and other organisms. Annual Review in the roots of wheat (Triticum aestivum of Plant Biology 57, 233–266. L.) by terminal restriction fragment length polymorphism and sequencing of 16S Bauer, W.D. and Caetanoanolles, G. 1990. rRNA clones. Applied and Environmental Chemotaxis, induced gene-expression and Microbiology 70, 1787–1794. competiveness in the rhizosphere. Plant and Cooper, J.E. 2007. Early interactions between Soil 129, 45–52. legumes and rhizobia: disclosing complexity Bauer, W.D. and Mathesius, U. 2004. Plant in a molecular dialogue. Journal of Applied responses to bacterial quorum sensing Microbiology 103, 1355–1365. signals. Current Opinion in Plant Biology 7, 429–433. D’Angelo-Picard, C., Faure, D.P.I. and Dessaux, Y. 2005. Diversity of N-acyl homoserine Beckie, G.H., Harker, K.N. et al. 2006. A decade lactone-producing and degrading bacteria in of herbicide-resistant crops in Canada. soil and tobacco rhizosphere. Environmental Canadian Journal of Plant Science 86, Microbiology 7, 1796–1808. 1243–1264. de Weger, L.A., van der Bij, A.J. et al. 1995. Bonkowski, M., Villenave, C. and Griffi ths, B. Colonization of the rhizosphere of crop 2009. Rhizosphere fauna: the functional and plants by plant-benefi cial pseudomonads. structural diversity of intimate interactions FEMS Microbiology Ecology 17, 221–228. of soil fauna with plant roots. Plant and Soil 321, 213–233. Dimpka, C., Weinand, T. and Asch, F. 2009. Plant-rhizobacteria interactions alleviate Bowen, G.D. and Rovira, A.D. 1999. Th e abiotic stress conditions. Plant, Cell and rhizosphere and its management to improve Environment 32, 1682–1694. plant growth. Advances in Agronomy 66, 1–101. Downie, J.A. 2010. Th e role of extracellular proteins, polysaccharides and signals in the Briones, A.M., Okabe, S. et al. 2002. Infl uence interactions of rhizobia with legume roots. of diff erent cultivars on populations FEMS Microbiology Reviews 34, 150 –170. of ammonia oxidizing bacteria in the root environment of rice. Applied and Drinkwater, L.W. and Snapp, S.S. 2007. Environmental Microbiology 68, 3067–3075. Understanding and managing the rhizosphere in agroecosystems. In: Bürgmann, H., Meier, S. et al. 2005. Eff ects of Cardon, Z.G. and Whitbeck, J.L. (eds) model root exudates on structure and Th e Rhizosphere: An Ecological Perspective. activity of a soil diazotrophic community. Academic Press, NY, pp. 127–174. Environmental Microbiology 7, 1711–1724. Foster, R.C. 1986. Th e ultrastructure of the Burns, R.G. 2010. Alber Rovira and a half-century rhizoplane and the rhizosphere. Annual of rhizosphere research. In: Gupta, V.V.S.R., Review of Phytopathology 24, 211–234. Ryder, M. and Radcliff e, J. (eds) Th e Rovira Rhizosphere Symposium. Proceedings, 15 Fuqua, W.C., Winans, S.C. and Greenberg, E.P. August 2008, SARDI Plant Research 1994. Quorum sensing in bacteria: the Centre, Adelaide. Th e Crawford Fund, luxR-luxI family of cell density-responsive Canberra, pp. 1–10. transcriptional regulators. Journal of Bacteriology 176, 269–275. Cardon, Z.G. and Gage, D.J. 2006. Resource exchange in the rhizosphere: molecular Germida, J.J. and Siciliano, S.D. 2001. Taxonomic tools and the microbial perspective. Annual diversity of bacteria associated with the Review of Ecology, Evolution and Systematics roots of modern, recent and ancient wheat 37, 459–488. cultivars. Biology and Fertility of Soils 33, 410–415.

TheTR Rovira Rhizosphere R Symposium S 21 Glandorf, D.C.M., Jansen, V.P. et al. 2001. Eff ect Hartmann, A., Schmid, M. et al. 2009. Plant-driven of genetically modifi ed Pseudomonas putida selection of microbes. Plant and Soil 321, WCS 358r on the fungal rhizosphere 235–257. microfl ora of fi eld grown wheat. Applied and Environmental Microbiology 67, 3371–3378. Hawes, M.C. and Brigham, L.B. 1992. Impact of root border cells on microbial populations in Goldberg, N.P., Hawes, M.C. and Stanghellini, the rhizosphere. Advances in Plant Pathology M.E. 1989. Specifi c attraction to and 8, 119–148. infection of isolated cotton root cap cells by zoospores of Pythium dissotocum. Canadian Hawes, M.C., Brigham, L.A. et al. 1998. Function Journal of Botany 67, 1760–1767. of root border cells in plant health: pioneers in the rhizosphere. Annual Review of Guemouri-Athmani, S., Berge, O. et al. 2000. Phytopathology 36, 311–427. Diversity of Paenibacillus polymyxa populations in the rhizosphere of wheat Hawkes, C.V., DeAngelis, K.M. and Firestone, (Triticum durum) in Algerian soils. European M.K. 2007. Root interactions with soil Journal of Soil Biology 36, 149–159. microbial communities. In: Cardon, Z.G. and Whitbeck, J.L. (eds) Th e Rhizosphere: An Gupta, V.V.S.R., Crisp, P. and Neate, S.M. 1998. Ecological Perspective. Academic Press, NY, Herbicide eff ects on the microbial diversity pp. 1–30. in the rhizosphere of genetically modifi ed and conventional cotton. Proceedings of the Hontzeas, N., Saleh, S. and Glick, B.R. 2004. 14th Australasian Biotechnology Conference, Changes in gene expression in canola roots Adelaide, p. 120. induced by ACC-deaminase containing plant-growth-promoting bacteria. Molecular Gupta, V.V.S.R., Roget, D.K. and Coppi, J.A. 2004. Plant–Microbe Interactions 17, 951–959. Identifi cation of a previously unrecognized constraint to yield in sequential wheat Juhas, M., Eberl, L. and Tummler, B. 2005. crops. In: Ophel-Keller, K. and Hall, B. Quorum sensing: the power of cooperation (eds) Proceedings of 3rd Australian Soilborne in the world of Pseudomonas. Environmental Disease Symposium. SARDI, Adelaide, pp. Microbiology 7, 459–471. 13–14. Kloepper, J.W., Ryu, C.M. and Zhang, S.A. 2004. Gupta, V.V.S.R., Kroker, S.K. et al. 2009. Induced systemic resistance and promotion Rhizosphere microbial composition is of plant growth of Bacillus sp. Phytopathology infl uenced by crop varieties. In: Proceedings 94, 1259–1266. of the 5th Australian Soilborne Disease Knox, O.G.G., Gupta, V.V.S.R. and Roberts, G. Symposium. Program handbook, Th redbo, 2004. Genetically modifi ed cotton infl uence NSW, pp. 42–44. on soil microbiota. In: Ophel-Keller, K. Gupta, V.V.S.R., Rovira A.D. and Roget, D.K. 2010. and Hall, B. Proceedings of 3rd Australian Principles and management of soil biological Soilborne Disease Symposium. SARDI, factors for sustainable rainfed farming Adelaide, pp. 166–167. systems. In: Tow, P., Cooper, I., Partridge, Knox, O.C.G., Gupta, V.V.S.R., Nehl, D.B. and I. and Birch, C. Rainfed Farming Systems. Stiller, W.N. 2007. Constitutive expression Springer Science and Business Media (in of Cry proteins in roots and border cells of press). transgenic cotton. Euphytica 154, 83–90. Handelsman, J. and Stabb, E.V. 1996. Biocontrol Knox, O.G.G., Gupta, V.V.S.R. and Lardner, R. of soilborne plant pathogens. Plant Cell 8, 2009. Cotton cultivar selection impacts on 1855–1869. microbial diversity and function. Aspects of Hart, M.M., Powell, J.R. et al. 2009. Separating Applied Biology 98, 129–136. the eff ect of crop from herbicide on soil Kremer, R.J. 2003. Soil biological processes are microbial communities in glyphosate- infl uenced by roundup-ready soybean resistant corn. Pedobiologia 52, 253–262. production. Phytopathology 93, S104.

TheTR Rovira Rhizosphere R Symposium S 22 Kremer, R.J., Means, N.E. and Kim, S. 2005. Robleto, E.A., Borneman, J. and Triplett, E.W. 1998. Glyphosate aff ects soybean root exudation Eff ects of bacterial antibiotic production on and rhizosphere microorganisms. rhizosphere microbial communities from a International Journal of Environmental culture-independent perspective. Applied and Analytical Chemistry 85, 1165–1174. Environmental Microbiology 64, 5020–5022. Long, S.R. 2001. Genes and signals in the Rovira, A.D. 1956. Plant root excretions in relation rhizobium–legume symbiosis. Plant to the rhizosphere eff ect I. Th e nature of root Physiology 125, 69–72. exudate from oats and peas. Plant and Soil 7, 179–194. Lopez-de-Victoria, G. and Lovell, C.R. 1993. Chemotaxis of Azospirillum species Rovira, A.D. 1965. Interactions between plant roots to aromatic compounds. Applied and and soil microorganisms. Annual Review of Environmental Microbiology 59, 2951–2955. Microbiology 19, 241–266.

Lynch, J.M. 1990. Th e Rhizosphere. Wiley Rovira, A.D. 1969. Plant root exudates. Botanical Interscience, London, p. 581. Reviews 35, 35–57.

Means, N.E. and Kremer, R.J. 2007. Inﬂ uence Rovira, A.D. 1991. Rhizosphere research: 85 years of soil moisture on root colonization of of progress and frustration. In: Keister, D.L. glyphosate-treated soybean by Fusarium and Cregan, P.B. (eds) Th e Rhizosphere and species. Communications in Soil Science and Plant Growth. Kluwer Academic Publishers, Plant Analysis 38, 1713–1720. Dordrecht, Th e Netherlands, pp. 3–13.

Meharg, A.A. and Killham, K. 1995. Loss of Schallmach, E., Minz, D. and Jurkevitch, E. 2000. exudates from the roots of perennial ryegrass Culture-independent detection of changes inoculated with a range of microorganisms. in root-associated bacterial populations Plant and Soil 170, 345–349. of common bean (Phaseolus vulgaris L.) following nitrogen depletion. Microbial Natsch, A., Keel, C. et al. 1997. Infl uence of biocontrol strain Pseudomonas fl uorescens Ecology 40, 309–316. CHA0 and its antibiotic overproducing Siciliano, S.D. and Germida, J.J. 1999. Taxonomic derivative on the diversity of resident diversity of bacteria associated with the roots root colonizing pseudomonads. FEMS of fi eld-grown transgenic Brassica napus cv. Mcrobiology Ecology 23, 341–352. Quest, compared to the non-transgenic B. Neal, J.L., Larson, R.I. and Atkinson, T.G. 1973. napus cv. Excel and B. rapa cv. Parkland. Changes in rhizosphere populations of FEMS Microbiology Ecology 29, 263–272. selected physiological groups of bacteria related to substitution of specifi c pairs of Siciliano, S.D., Th eoret, C.M. et al. 1998. chromosomes in spring wheat. Plant and Soil Diff erences in the microbial communities 39, 209–212. associated with the roots of diff erent cultivars of canola and wheat. Canadian Nickerson, K.W., Atkin, A.L. and Hornby, J.M. Journal of Microbiology 44, 844–851. 2006. Quorum sensing in dimorphic fungi: farnesol and beyond. Applied and Singh, B.K., Millard, P., Whiteley, A.S. and Environmental Microbiology 72, 3805–3813. Murrell, J.C. 2004. Unravelling rhizosphere- microbial interactions: opportunities and Pierson, E.A., Wood, D.W. et al. 1998. limitations. Trends in Microbiolog y 12, Interpopulation signaling via N-acyl- 386–393. homoserine lactones among bacteria in the wheat rhizosphere. Molecular Plant Microbe Smith, K.P., Handelsman, J. and Goodman, R.M. Interactions 11, 1078–1084. 1999. Genetic basis in plants for interactions with disease-suppressive bacteria. Proceedings Raaijmakers, J.M., Paulitz, T.C. et al. 2009. Th e of National Academy of Sciences of the USA rhizosphere: a playground and battlefi eld 96, 4786–4790. for soilborne pathogens and benefi cial microorganisms. Plant and Soil 321, 341– 361.

TheTR Rovira Rhizosphere R Symposium S 23 van Overbeek, L.S. and van Elsas, J.D. 1995. Root Whipps, J.M. 1990. Carbon economy. In: Lynch, exudate-induced promoter activity in J.M. (ed.) Th e Rhizosphere. John Wiley and Pseudomonas fl uorescens mutants in the wheat Sons Ltd, UK, pp. 59–97. rhizosphere. Applied and Environmental Microbiology 61, 890–898. Youssef, B.A., Amr, A.H. et al. 1987. Eff ect of herbicides on the soluble sugar and amino Watt, M. and Evans, J.R. 1999. Linking acid contents of root exudates and on the development and determinancy with organic rhizosphere microfl ora of cotton. Agricultural acid effl ux from proteoid roots of white lupin Research Review 65, 161–172. grown with low phosphorus and ambient or Zhao, X., Misaghi, I.J. and Hawes, M.C. 2006. elevated atmospheric CO2 concentration. Plant Physiology 120, 705–716. Stimulation of border cell production in response to increased carbon dioxide levels. Watt, M., Kirkegaard, J.A. and Passioura, J.B. 2006. Plant Physiology 122, 181–188. Rhizosphere biology and crop productivity a review. Australian Journal of Soil Research 44, 299–317.

TheTR Rovira Rhizosphere R Symposium S 24 Nature of biocontrol of take-all by the Australian bacterial isolate Pseudomonas strain AN5: a true symbiosis between plant and microbe

Murali Nayudu1,5, Rajvinder Kaur2, Christian Samundsett1, John Macleod3, Andrew Franklin4, Kylie Groom1, Yafei Zhang5, Terry Murphy1, Markus Koeck1 and Heather Millar1

Abstract We have shown Ps. str. AN5 wheat root colonisation is a specifi c process in which the Pseudomonas Biological control of the take-all fungal pathogen Ggt induces erosion zones leading to the bacteria colonis- by Pseudomonas bacteria is dependent on its ability ing the epidermal and cortical regions. Transposon to colonise wheat roots and produce an anti-fungal agent. Pseudomonas strain AN5 (Ps. str. AN5) is a mutants involved in biocontrol have been identifi ed non-fl uorescent bacterial isolate from Australia that and characterised. We have developed TaqMan as- has been shown to suppress take-all disease and in- says for bacterial genes involved in biocontrol such as crease wheat yield by up to 20% in fi eld trials. Ps. str. root colonisation and gluconic acid production. Using AN5 has been developed as a commercial biocontrol Aff ymetrix genechip microarray technology we have agent. Pseudomonas fl uorescence biocontrol bacteria identifi ed wheat genes up- and down- regulated by producing the anti-fungal agents 2,4-diacetylphlo- Ps. str. AN5 symbiosis with wheat roots. From this roglucinol or phenazine-1-carboxylic acid, which we have developed TaqMan assays for wheat genes suppress the take-all pathogen, have been well char- involved in this symbiosis. Th e coordinated expression acterised previously. Ps. str. AN5 does not produce of plant and bacterial genes strongly suggests that this these anti-fungal agents. It produces the sugar acid interaction is symbiotic in nature. D-gluconic acid in suppression of the take-all pathogen. We have identifi ed, cloned and sequenced eight regions in the Ps. str. AN5 genome responsible for Introduction biocontrol. Biological control of the take-all fungal pathogen

Gaeumannomyces graminis var. tritici (Ggt) by 1 School of Botany and Zoology, Faculty of Science, Pseudomonas bacteria is dependent on its ability to Australian National University, Canberra, ACT colonise wheat roots and produce an anti-fungal 0200, Australia agent (Haas and Keel 2003). Pseudomonas fl uo- 2 Department of Plant and Microbial Biology, rescens biocontrol bacteria isolated in Europe and University of California, 111 Koshland Hall, the US can produce the anti-fungal agent 2,4-di- Berkeley, CA 94720-3102, USA acetylphloroglucinol or phenazine-1-carboxylic 3 Research School of Chemistry, Australian National acid, which inhibits Ggt, the take-all pathogen University, Canberra, ACT 0200, Australia (Weller et al. 2007). Th e genes involved in pro- 4 Th e Children’s Hospital, Harvard University duction of these anti-fungal agents and their Medical School, Boston KARP 9, 1 Blackfan regulation are well understood (Haas and Keel Circle, Boston, MA 02115, USA 2003). Th e Australian continent contains unique 5 Australian Phenomics Facility, John Curtin soil microbes as it has been geographically iso- School of Medical Research, Australian National lated. Pseudomonas strain AN5 (Ps. str. AN5) is University, Canberra, ACT 0200, Australia a non-fl uorescent bacterial soil isolate from New 6 E-mail: [email protected] South Wales in Australia (Nayudu et al. 1994a).

TheTR Rovira Rhizosphere R Symposium S 25 Ps. str. AN5 was shown to produce a radically tion between this bacteria and its legume host can diff erent type of anti-fungal agent (i.e. gluconic be well defi ned. However, the interaction between acid) against Ggt (Kaur et al. 2006). Gluconic Pseudomonas biological control bacteria and its acid is the fi rst anti-fungal agent to be identifi ed wheat host has always been considered transient. which is a simple sugar and hydrophilic in nature, In this paper we show that Pseudomonas bacteria compared to the hydrophobic benzene-based anti- actually invade and live inside the wheat roots, and fungal compounds discovered previously. Using using Aff ymetrix genechip microarray technol- molecular genetic analysis (Nayudu et al. 1994b) ogy we show this leads to diff erential expression of we have elucidated the nature of take-all biocon- certain wheat genes. In conclusion—for the fi rst trol by this bacteria. Th e role of Ps. str. AN5 genes time—evidence is presented to show the biological involved in biocontrol of the take-all pathogen rhizosphere interaction between pseudomonads and will be outlined in this paper. wheat roots is a well-defi ned process and could be considered as a ‘plant–microbe’ symbiosis. Th e eff ective control of soil-borne fungal pathogens such as Ggt by antagonistic microorganisms off ers an alternative to the use of Results chemicals in agriculture. Previously Ggt and spe- Biocontrol cies of Pseudomonas, Bacillus, Trichoderma and Actinomycetes have been isolated from Australian Pseudomonas str. AN5 inhibits take-all hyphal soils and studied for biological control of the growth by 60–70% in agar plate bioassays. It con- take-all disease (Weller et al. 2002). Recently the sistently suppresses take-all disease in pot trials. Australian isolate Pseudomonas strain AN5 (Ps. Take-all disease symptoms are reduced signifi cantly str. AN5) has been shown to have a completely new on wheat roots from 2.5 (on a scale where 0 is no mechanism in inhibiting Ggt, in that it produces the disease and 5 is maximum disease observed) for Ps. sugar gluconic acid as an anti-fungal agent (Kaur et str. AN5 treatment with take-all added compared al. 2006). In this paper we report the ability of Ps. to 4.5 for no bacterial treatment with take-all str. AN 5 to suppress the take-all pathogen in vitro added. ANOVA of total plant biomass at the end and in vivo. of the experiment showed there were signifi cant differences between treatments. Ps. str. AN5 treatment Root colonisation is essential in Pseudomonas forming with take-all added was signifi cantly better than a symbiotic association with wheat. Chemotaxis to- the negative take-all treatment control with no bac- wards the wheat root, attachment to the rhizoplane teria (about a 100% increase). In fi eld trials there was and utilisation of carbon sources present in the a signifi cant decrease of take-all diseases symptoms root exudate (rhizosphere competence) have been in wheat roots and in the crown with Ps. str. AN5 identifi ed as essential components in this process compared to untreated controls. In cases where (Lugtenberg et al. 2001). Global regulators have there was signifi cant take-all disease in the fi eld, been identifi ed in Pseudomonas that are involved wheat yield increases of 10–20% were observed with in controlling this process (Lugtenberg et al. 2001). Ps. str. AN5. Ps. str. AN5 was shown to be a good Quorum sensing at high cell density, which leads to coloniser of wheat roots (about 105 g–1 of wheat root) higher levels of expression of some Pseudomonas in diff erent soil types but there was no strong correla- genes, has also been implicated in this process (Wei tion with any environmental parameters such as soil et al. 2006). Th e infection process of Rhizobium moisture. Importantly it was able to survive well at bacteria in root nodule nitrogen-fi xing symbiosis all fi eld trial sites even under very low soil moisture has been clearly defi ned (Bender et al. 1987). Th e of less than 10%v/v (Fig. 1). process by which Pseudomonas bacteria interact with wheat roots, however, is still poorly understood. In this paper we describe the precise mode by Anti-fungal agent production which Pseudomonas strain AN5 (Ps. str. AN5) colo- Pseudomonas str. AN5 is able to produce the cor- nises wheat roots and identify transposon mutants responding aldonic acid when provided with aldose defi cient in this process. sugar galactose or mannose (Fig. 2). However, only gluconic acid production was detected on wheat Rhizobium bacteria induce a visual response on roots, showing it is the only sugar acid produced by the plant host and as such the symbiotic interac- Ps. str. AN5 involved in take-all biocontrol.

TheTR Rovira Rhizosphere R Symposium S 26 Pseudomonas str. AN5 produces about 5.0 mg –1 Soil moisture (%v/v) ml gluconic acid when glucose is provided as the sole carbon source. Th is is signifi cantly more than Soil temperature (degC) the microgram levels of other anti-fungal agents AN5(log10 cfu/g) produced by other Pseudomonas bacteria. Using 30 transposon mutagenesis we identifi ed two regions 25 in the Ps. str. AN5 genome essential for sugar acid production. Mutants in both these regions 20 completely lost take-all biocontrol in pot trials. Complementation studies using genes or gene prod- 15 ucts restored take-all biocontrol. Th e genes present 10 in these regions were sub-cloned from cosmid vec- tors and their DNA sequence determined. In one 5 region the glucose oxidase gene (GOD) was identi- 0 fi ed (Nayudu et al. 2008b). In another region, six

44 66 89 genes required for the production of the cofactor 105 134 157 175 198 253 287 pyrroloquinoline quinone (PQQ) were identifi ed in Time after sowing (days) an operonic structure (Nayudu et al. 2008b). Using RT-PCR we have shown these seven Ps. str. AN5 Figure 1. Environmental conditions and survival of biocontrol genes are expressed on wheat roots in the Ps. str. AN5 on wheat roots at a ﬁ eld trial in Galong, fi eld, suggesting that they are involved in take-all NSW biocontrol (Nayudu et al. 2008a).

Colonisation of wheat roots by Pseudomonas bacteria Pseudomonas str. AN5 induces erosion zones in the mucigel layer of the rhizoplane on wheat roots. A clear degradation zone is present

Abundance around individual bacteria. Th is was consistently observed using Mass/charge scanning electron microscopy on the wheat root surface of plants inoculated with Ps. str. AN5. Transmission electron microscopy of sectioned wheat roots inoculated with Ps. str. AN5 showed bacteria were consistently present in epidermal cells. Th ey were also found in the inter-cellular region of the cortex, but not as frequently. However, they were not observed in the endodermis. We have iden- Abundance tifi ed two Tn5 gus transposon mutants (Ps. str. AN5MN3 and Mass/charge Ps. str. AN5MN4) that lacked this phenotype when inoculated onto wheat roots (Table 1). Figure 2. Mass spectrum of biologically active puriﬁ ed silica column material for Ps. str. AN5 using diﬀ erent aldose sugars as carbon source: (a) galactose; (b) mannose. Th e mass spectrum observed in (a) is identical to that of galactonic acid and in (b) to that of mannonic acid.

TheTR Rovira Rhizosphere R Symposium S 27 Table 1. Infection characteristic of Ps. str. AN5 controlled environmental conditions. Individual compared to the colonisation-deﬁ cient mutants jars were demounted aft er 4 weeks and total RNA was isolated in duplicate from wheat roots of Ps. Bacterial Erosion Wheat root invasion strain AN5-treated (AN5) or untreated control Ps. strain zones Epidermis Cortical plants (C). AN5 + + + AN5MN3 – – – A GeneChip® experiment was performed using 5 μg each total RNA sample isolated. Four AN5MN4 – – – samples, named AN5(1), AN5(2), C(l) and C(2), were each hybridised to a GeneChip® Wheat Genome Array (Nayudu et al. 2008a). Th e fl uo- AN5 AN5MN3 AN5MN4 rescent signals have been detected by the Aff ymetrix Genechip Scanner and extracted by GCOS soft ware. 12 Th e Signal and Detection of each gene are gener- 10 ated. Th e wheat genome annotation is downloaded from the Aff ymetrix web site and incorporated to 8 the gene data sheet. Th e paired comparisons AN5(1) 6 versus C(l), AN5(1) versus C(2), AN5(2) versus C(l), AN5(2) versus C(2), C(l) versus C(2) and AN5(1)

wheat root wheat 4 versus AN5(2) have been done in GCOS, based 2 on the Aff ymetrix algorithms. Signal Log Ratio and Change have been generated for each comparison

Log viable count per gram of of gram per count Log viable 0 2468 (Nayudu et al. 2008a). Th e data mining tool Acquity Time (weeks) 4.0 was used to perform two group t-tests (group 1: Figure 3. Root colonisation of wild-type Ps. str. AN5(1) and AN5(2); group 2: C(l) and C(2)). AN5, compared to the colonisation deﬁ lement mutants Ps. str. AN5MN3 and Ps. str. AN5MN4 in Th e gene list obtained was sorted according to pot trials in controlled environment cabinets Signal and Detection. About 50% of genes were absent and signals close to background across the four samples were eliminated. Th en the list was sorted by Both these strains had a reduced ability to colonise the Signal Log Ratio and Change; only the changed wheat roots (Fig. 3). Ps. str. AN5MN3 had similar genes with Signal Log Ratio of treatments (AN5(1) growth characteristics to the parent Ps. str. AN5 and AN5(2)) versus controls (C(l) and C(2)) larger invitro. However, Ps. str. AN5MN4 is signifi cantly than 1 (a two-fold change) and with no change or delayed in growth on artifi cial media (nutrient very little change within the treatments and con- agar/broth; potato dextrose agar/broth), compared trols have remained. to parent strain Ps. str. AN5. Ps. str. AN5MN4 colonisation mutant was shown to have a single Most wheat genes identifi ed from this Aff ymetrix transposon insert in the DTDP-glucose 4, 6-dehy- analysis encode products of unknown function as dratase gene in this bacteria. analysis of the wheat genome is still in its infancy. Established Sequence Tags (EST) can be used in Plant gene expression as a result of BLAST searches to try and identify the unknown Pseudomonas colonisation gene. Th e Aff ymetrix analysis does identify putative gene function of well-characterised genes if they To determine the response of the host wheat plant have been characterised in wheat or if their homol- to Ps. str. AN5 inoculation, wheat seeds were ogy is similar to genes identifi ed in other organisms sterilised and germinated on agar plates (over- (e.g. Oryza sativa—rice). Table 2 shows an example night so that the root just started to emerge). Th e of a wheat gene that is up-regulated and one that is wheat seeds were then treated with Ps. strain AN5 down-regulated by Ps. str. AN5. grown in nutrient broth (in 3.5% methylcellulose solution to bind the bacteria to the seed). Either Ps. Th e total numbers of wheat genes altered signifi - strain AN5-treated or untreated control seeds were cantly (as shown by the t-test at two confi dence transferred to sterile Magenta jars. Th e Magenta jars levels) by to the Ps. strain AN5 treatment were: were placed in the same growth cabinet under

TheTR Rovira Rhizosphere R Symposium S 28 Table 2. Diﬀ erential pattern of RNA expression Rhizobium (Bender et al. 1987). Two reduced-col- in response to Ps. strain AN5 inoculation. Wheat onisation mutants have been identifi ed which are untreated is labelled ‘C’, while wheat treated with impaired in this process. One of them has been Ps. str. AN5 is labeled as ‘AN5’. Gene expression is characterised and shown to be in the dehydratase shown in standardised units. gene involved in LPS production in bacteria. Th e homologous gene in Neisseria gonorrhoeae has Treatments Gene identity been shown to be involved in human pathogen- AN5(1) AN5(2) C(1) C(1) esis, and in the case of Rhizobium strain NGR234 Putative cyto- 226.4 171.0 20.6 1.7 in nodulation of legumes. chrome P450 Moderately 41.1 51.4 351.8 254.7 Using Aff ymetrix genechip microarray tech- similar to XP nology we have identifi ed wheat genes up- and 462851 of Oryza sativa down-regulated by infection of Ps. str. AN5 on (rice), (function wheat roots. We have confi rmed this fi nding by not known) designing TaqMan probes for a few of these wheat genes diff erentially expressed and using them in • 208 genes at the 90% confi dence level RT-PCR. We have also shown that bacterial genes involved in biocontrol are expressed well on wheat • 132 genes at the 95% confi dence level. roots in soil in the fi eld. Finally we have presented To confi rm these results we took four wheat genes that conclusive evidence for the fi rst time showing that were altered in expression by Ps. str. AN5 inoculation Pseudomonas bacterial interaction with wheat and designed TaqMan RT-PCR probes for them. roots in the rhizosphere in biological control is a Using the RNA isolated for the gene chip experi- specifi c process in which the bacteria invade and ment (Nayudu et al. 2008a) we were able to confi rm reside inside the wheat roots. Th is process involves the altered expression of wheat genes due to Ps. the expression of both Pseudomonas and wheat str. AN5 inoculation in three of the cases, using the genes coordinately, and as such should be considered TaqMan assay with RT-PCR. as a plant–microbe symbiosis.

Discussion References Our results strongly suggest that Ps. str. AN5 Bender, G.L., Nayudu, M., Goydych, W. and Rolfe, produces anti-fungal gluconic acid in take-all bio- E.G. 1987. Early infection events in the nod- control by oxidation of the aldose sugar glucose to ulation of the non-legume Parasponia andersonii the corresponding aldonic acid using the enzyme by Bradyrhizobium. Plant Science 51, 285–293. GOD. Th e PQQ cofactor is essential for this pro- Haas, D. and Keel, K. 2003. Regulation of an- cess in donating ATP required for the enzymatic tibiotic production in root colonizing reaction involving GOD. Pseudomonas spp. and relevance for biological control of plant disease. Annual Review of Pseudomonas str. AN5 is an excellent coloniser of Phytopathology 41, 117–153. wheat roots in diff erent soil types and suppresses take-all disease symptoms, potentially leading to Kaur, R., Macleod, J., Foley, W. and Nayudu, M. an increase in wheat yield due to biological control 2006. Gluconic acid: an antifungal agent protection. In particular, its ability to survive well produced by Pseudomonas species in biological at low soil moisture content paves the way for it control of take-all. Phytochemistry 6, 595–604. to be developed as a biocontrol agent against take-all for the oft en dry environmental conditions of dryland Lugtenberg, B.J.J., Dekkers, L. and Bloemberg, G.V. 2001. Molecular determinants of rhizosphere wheat cropping in Australia. colonization by Pseudomonas. Annual Review of Pseudomonas str. AN5 has a specifi c process in in- Phytopathology 39, 461–490. fecting wheat roots by inducing erosion zones leading to the bacteria invading the epidermal and cortical regions. Similar erosion zones have been observed in nodulation of the non-legume Parasponia by

TheTR Rovira Rhizosphere R Symposium S 29 Nayudu, M., Groom, K.A.E., Fernance, J., Wong, Nayudu, M., Samundsett, C., Kaur, R., Franklin, P.T.W. and Turnbull, K. 1994a. Th e genetic A., Kreck, M., Murphy, T., Millar, H., nature of biological control of the take-all Khan, S., Groom, K., Singh, J., Macleod, J. fungal pathogen by Pseudomonas. In: Ryder, and Zhang, Y. 2008b. New mechanisms used by M., Stephens, P.M. and Bowen, G.D. (eds) Pseudomonas bacteria in biological control of the Plant Growth Promoting Bacteria. CSIRO take-all fungal pathogen of wheat. In: Porta- Publishing, Melbourne, Australia, pp. Puglia, A. and Gonthier, P. (eds). Ninth 122–124. International Congress of Plant Pathology. Journal of Plant Pathology 90(2), S2.121. Nayudu, M., Murphy, T., Wong, P.T.W. and Ash, J. 1994b. Th e use of bioluminescence (using Wei, H.L. and Zhang, L.Q. 2006. Quorum-sensing luciferase or lux) as a marker for detection system infl uences root colonization and bio- of biological control Pseudomonas bacteria. logical control ability in Pseudomonas fl uorescens In: Ryder, M., Stephens, P.M. and Bowen, 2P24. Antonie Van Leeuwenhoek 89, 267–280. G.D. (eds) Plant Growth Promoting Bacteria. CSIRO Publishing, Melbourne, Australia, Weller, D.M., Raaijmakers, J.M, McSpadden- pp. 181–183. Gardener, B.B. and Th omashow, L.S. 2002. Microbial populations responsible for specifi c Nayudu, M., Murphy, T., Koeck, M., Franklin, A., soil suppressiveness to plant pathogens. Annual Zhang, Y., Samundsett, C. and Millar, H. Review of Phytopathology 40, 309-348. 2008a. Take-all biocontrol by Pseudomonas bacteria on wheat: plant-bacterial gene ex- Weller, D.M., Landa, B.B., Mavrodi, O.V., pression. In: Porta-Puglia, A. and Gonthier, Schroeder, K.L., De La Fuente, L., Blouin P. (eds) Ninth International Congress of Bankhead, S., Allende Molar, R., Bonsall, Plant Pathology. Journal of Plant Pathology R.F., Mavordi, D.V. and Th omashow, L.S. 2007. 90(2), S2.417. Role of 2,4-diacetylphloroglucinol-producing fl uorescent Pseudomonas spp. in the defense of plant roots. Plant Biology (Stuttgart) 9, 4–20.

TheTR Rovira Rhizosphere R Symposium S 30 New insights into roles of arbuscular mycorrhizas in P nutrition of crops reveal the need for conceptual changes

Sally E. Smith1,2, Huiying Li1, Emily J. Grace1,3 and F. Andrew Smith1

Abstract total nutrient uptake are less than in non-mycorrhizal (NM) control treatments. Furthermore, Many soils are phosphorus (P) defi cient. such growth depressions in AM plants cannot Th e cost of P fertiliser is increasing and the be explained simply by carbon (C) drain to the reserves of phosphate rock from which it is fungal symbionts. Future research should be manufactured are diminishing rapidly. Th ere directed to understanding the way in which is accordingly a major need to identify and un- nutrient uptake pathways through roots and derstand traits that maximise the effi ciency of AM fungi are integrated and controlled, so P uptake by plants. Most crops, including cere- that new crops can be developed that capture als, form arbuscular mycorrhizas (AM) in the benefi ts of both direct and AM uptake of P and fi eld; their symbiotic root systems are therefore make maximal use of nutrient resources in soils the normal nutrient absorbing organs. Despite and fertilisers. this, cereals often do not show marked positive responses to AM inoculation in the vegetative stages of pot experiments and this has led to Introduction a reduced emphasis in recent years on applied A very large proportion of land under agriculture is research into the roles of AM in cereal P nu- P defi cient and requires inputs of P fertiliser to be trition. However, new research has provided productive. Such fertiliser is produced from deposits signifi cant insights into the ways that plant of phosphate rock which represent a fi nite resource, roots and AM fungi are integrated, structurally with rapidly increasing price. Some calculations sug- and functionally. Th e most important fi nding gest that reserves will be exhausted in 85–190 years. is that the contribution of AM fungi to plant Th ese factors bring into sharp focus the need for nutrition may be large but remains hidden un- research into mechanisms underpinning effi cient less special techniques are used. We have shown P uptake by plants, including those involving their large contributions of AM fungi to P uptake in AM fungal symbionts. both wheat and barley, even when growth and AM fungi colonise about 80% of terrestrial plants, including herbs, shrubs and trees, and hence

1 Soil and Land Systems, School of Earth and the vast majority of species in natural and agro- Environmental Sciences, Waite Campus,Th e ecosystems. Th ey have recently been reclassifi ed University of Adelaide, Adelaide, South Australia into a separate fungal phylum, the Glomeromycota 5005, Australia (Schüßler et al. 2001). Not all form storage vesicles 2 Email: [email protected] in plant roots, so the long-established descriptor 3 Th e Australian Centre for Plant Functional ‘vesicular-arbuscular’ mycorrhiza (VAM) has been Genomics, Waite Campus, Th e University of replaced by ‘arbuscular’ mycorrhiza (AM). Th e new Adelaide, Adelaide, South Australia 5005, Australia terminology recognises that many members of the

TheTR Rovira Rhizosphere R Symposium S 31 Glomeromycota form AM pathway characteristic, treelike P depletion Arb structures called arbus- zone cules within root cortical CC cells. Th e arbuscules are Fungalfungal high-affinihigh- commonly believed to transporters P affinity P play major roles in nutri- transporters ent transfers between Plantplant high-affinity P the symbionts and have Direct pathway P transporterstransporters been used (rightly or (AM-inducible)(AM-inducible) wrongly, see below) as Plant high-affinity diagnostic of the AM plant high-affinity P symbiosis1. Th e fact that Ptransporters transporters P AM fungi are integral (P-responsive)(P-responsive) components of the large majority of normal root root growth systems has been strongly emphasised in the past, Figure 1. Diagrammatic representation of the integration of the direct and but continues to be AM pathways of uptake of orthophosphate (P) in a root growing through soil. overlooked in both eco- Th e direct pathway involves expression of plant P transporters in root hairs and logical and agricultural epidermis and results in progressive depletion of P close to the root surface. contexts. A considerable Th e AM pathway involves the expression of fungal high-aﬃ nity transporters amount of research led in external hyphae and plant transporters in the interface between fungus and to signifi cant advances plant. Th e intracellular fungus is depicted as an arbuscule (arb) inside a cortical in our understanding of cell (CC), but other structures (see Fig. 3) may also be important. AM symbioses (Koide and Mosse 2004; Smith and Read 2008). Generalisations were made, some of which have overcomes localised nutrient depletion which oc- stood the test of time, whereas others require curs because the rate of uptake by roots exceeds the re-evaluation. It is the purpose of this article to rate of replacement from the bulk soil. Hyphae are highlight recent advances on eff ects of AM sym- able to access pores of considerably smaller diam- bioses in plant P nutrition and show how the new eter than can roots, greatly increasing the volume of knowledge can be used to understand the roles of the soil solution from which P can be absorbed as AM symbioses in plants, particularly in crop spe- orthophosphate (Smith and Read 2008). cies, and to provide new avenues to capture any In many plants establishment of AM symbioses benefi ts. leads to increased P uptake and hence, when P is limiting, to increased growth. Th e ‘conventional’ The conventional story view has been that P uptake by external hyphae AM symbioses have been considered to be typi- (the AM pathway) supplements direct uptake by cally mutualistic, based on reciprocal exchange of the plant root (the direct pathway) (Fig. 1) and that soil-derived mineral nutrients and plant sugars. Th e the extent of ‘benefi t’ in terms of growth is related main nutrients are P and zinc (Zn), both of which to the amount of AM colonisation in roots. are highly immobile in soil. Extensive growth of the It was believed that AM colonisation does not AM fungal hyphae in soil considerably extends the aff ect direct uptake by the root and that activity absorptive surfaces of the symbiotic root system and of this and the AM pathway are strictly additive. Where colonisation is low and or total P uptake un-

changed by the symbiosis, it has been assumed that 1 We will follow common usage and refer to mem- the AM fungi are making a negligible contribution bers of the Glomeromycota as AM fungi, while to nutrition. As an increased number of plant– recognising that arbuscules are not formed in all fungus combinations was investigated a diversity plant-fungus combinations of plant responses was recognised. Th ese ranged

TheTR Rovira Rhizosphere R Symposium S 32 from large increases in growth of AM compared Because of this complexity and because arbuscules to NM plants, to considerable reductions. It was were long considered diagnostic for AM colonisa- again supposed (but now shown to be incorrect, see tion, the presence of AM fungi in roots has almost below) that where responses are neutral or negative certainly been underestimated, particularly in fi eld the fungi are making no contribution to nutrition. samples where AM fungi may have been recorded as Whereas AM fungi colonising plants showing absent because the only structures seen were hyphae positive benefi t have been viewed as mutualistic, and intracellular coils. Nevertheless, most reports those colonising plants that did not respond posi- indicate that cereal crops are colonised by AM tively have been generally believed to be parasitic fungi in the fi eld, with values ranging from zero (Johnson et al. 1997; Smith et al. 2009). It was (questionable, considering the above) to 80% of root also thought that the latter group use plant-derived length (Jensen and Jakobsen 1980; Baon et al. 1992; carbon (C), proportional to the extent of fungal Ryan et al. 1994; Boyetchko and Tewari 1995; development. Aliasgharzadeh et al. 2001; Li 2004). In some soils colonisation is reduced by application of P fertiliser Major cereal crops, such as wheat and barley, fre- (e.g., Baon et al. 1992; Ryan and Angus 2003), quently do not show positive responses to AM drought (Ryan and Ash 1996) and crop rotations colonisation in experiments investigating vegetative involving non-AM hosts such as canola (Arihara growth (Fig. 2a). Th is has led to a belief that AM and Karasawa 2000; Miller 2000; Ryan and Angus colonisation is of little importance in P nutrition 2003; reviewed by Lekberg and Koide 2005), so that and productivity of these crops (e.g., Ryan and the signifi cance of AM in such soils has again been Graham 2002) and to a consequent lack of em- questioned (Ryan and Graham 2002). However, phasis in research on the roles of the symbionts in in other soils (such as the highly P-fi xing soils of nutrition. In our view this situation should now the Eyre Peninsula, South Australia) colonisation be reversed. Crops, including cereals, are normally is very high (up to 80% of root length) and little AM-colonised in the fi eld and an understanding of crop nutrition requires an understanding of how symbiotic root systems function. 10 (a) It is the experimentally-induced NM condition that 8 is abnormal, but is receiving the largest research 6 input with respect to maximising effi ciency of nutrient uptake of normally AM crops. 4

New insights into AM development DW at tillering (g per pot) 0 and function in P uptake 0 50 100 150 10 Complexity of AM structures may have (b) led to underestimation of incidence of AM 8 colonisation in the fi eld 6

Recent work has shown that many of the conven- 4 tional views of the development of AM and their 2 roles in nutrient uptake and plant growth must be revised. Arbuscules are not the only intracellular 0 Grain yield at (g mature Grain pot)per interfaces formed by AM fungi that are functional 00 5050 100100 150 Grain yield at maturity (g per pot) DW at tillering P application levels (mg per kg) in nutrient transfers. In many plant–fungus combi- P application levels ( mg per kg) nations the major intracellular fungal development Figure 2. Growth (dry weight, DW) of wheat in a is by coiled hyphae sometimes bearing short highly calcareous soil with diﬀ erent levels of P ap- arbuscule-like branches (Smith and Smith 1996). plied as CaHPO4, inoculated with the AM fungus Both intracellular coils and arbuscules may be as- Glomus intraradices (dotted lines and triangles) or sociated with intracellular hyphae (Dickson 2004) not inoculated (solid lines and diamonds). a) dry (see Fig. 3). weight (DW) at tillering; b) grain yield at harvest.

TheTR Rovira Rhizosphere R Symposium S 33 benefi t in terms of P uptake or growth. Where this relationship was not apparent the suggestion has been made that AM fungi were not functional in terms of plant nutrition and other benefi ts were adduced to explain the prevalence of the symbiosis (Newsham et al. 1995).

It has become increasingly obvious that there is no strong relationship between percent colonisation and either increased nutrient uptake at the whole-plant level, or indeed in the extent of any changes in growth (Graham and Abbott 2000; Grace et al. 2009a; Li et al. 2008a). Th e apparent para- dox has been partially resolved by quantifi cation of the actual Figure 3. Mycorrhizal colonisation in wheat roots taken from the ﬁ eld. contributions of the AM fungi a) Low-magniﬁ cation image showing the intense mycorrhizal colonisation to P uptake using radioactive (stained blue) in most cortical cells of the root. b) Detail of colonisation P (33/32P). showing coiled intracellular hyphae bearing arbusculate branches (arrowed). c) Detail of colonisation showing intracellular arbuscules (A) and vesicles (V). Th e basic principle of the technique is to grow plants in pots divided into compartments by mesh that allows hyphae aff ected by addition of P (Li et al. 2006, 2008b; of AM fungi, but not roots, to penetrate. An AM H.Y. Li, unpublished2) or drought (H.Y. Li, un- plant is grown in one compartment, where soil is published). In such situations where colonisation explored by both roots and hyphae (root hyphal is high there is clearly a potential for AM to have compartment—RHC). Hyphae grow through the signifi cant eff ects on plant function. As shown in mesh into the second (hyphal) compartment (HC). Figure 2b, inoculation with an AM fungus pro- Soil in the HC is labelled with 32P or 33P, providing a duced signifi cant yield benefi ts in wheat at relatively tracer for uptake and transfer by the AM fungal hy- high P application rates, even though a reduction in phae. Any tracer reaching the plant must have done growth had been observed in the inoculated treat- so via the AM pathway (Fig. 1). Results show that ments at tillering (Fig. 2a). the AM pathway can make strong contributions to P uptake—even when the plant does not respond Lack of direct relationship between extent of positively to colonisation in terms of growth or colonisation and AM eff ects total P uptake—and that there can be considerable variations depending on the fungal symbiont It has also been frequently held that there is a direct (Table 1). A recent advance was made by using an relationship between the extent (percent) of colo- HC that is very small in relation to the size of the nisation and the extent of any AM eff ect, such as main pot, so that its presence had little eff ect on the

total P available to the plants (Smith et al. 2003). In 2 Dr H.Y. Li, Soil and Land Systems, School of Earth the same investigation the contribution of the AM and Environmental Sciences, Waite Campus, Th e pathway was quantifi ed, using specifi c activity of 33P University of Adelaide, Adelaide, South Australia in soil and plants and hyphal lengths of AM fungi 5005, Australia in both RHCs and HCs (Smith et al. 2003, 2004).

TheTR Rovira Rhizosphere R Symposium S 34 Table 1. Percentage of total P taken up via the AM pathway into plants that did not show a positive growth response to colonisation in the same experiments. Quantiﬁ ed results are obtained by extrapolating uptake from hyphal compartments to the whole pot.

Fraction of total P via AM Plant AM fungus pathway Reference (%) Barley G. intraradices ~40–55 Grace (2008); Grace et al. (2009b) G. geosporum ~ 5 Wheat G. caledonium 100 Ravnskov and Jakobsen (1995) G. invermaium ~0 Ravnskov and Jakobsen (1995) G. intraradices 50–60 Li et al. (2006) Cucumber G. caledonium 100 Pearson and Jakobsen (1993) Ravnskov and Jakobsen (1995) G. invermaium 0 or 20 Pearson and Jakobsen (1993) Ravnskov and Jakobsen (1995) S. calospora ~7 Pearson and Jakobsen (1993) G. intraradices Not quantifi ed Ravnskov et al. (1999) Bromus sp. G. etunicatum Not quantifi ed Hetrick et al. (1994) Pea 3 mixed species Not quantifi ed Gavito et al. (2002) Tomato G. caledonium 20–30 Smith et al. (2004) G. intraradices 90–100

Th is work established that Glomus intraradices If 100% of the P enters through the AM pathway, contributed up to 100% of the P reaching the plants then the direct pathway must be non-functional in Medicago truncatula, which showed a marked and, furthermore, if the AM pathway is functional increase in growth and P uptake when mycorrhizal, to any extent in a non-responsive plant (as repeated- as well as in Solanum lycopersicum (tomato), which ly shown), then again the contribution of the direct did not. Other plant–fungus combinations have pathway must be of reduced signifi cance compared shown variable, but still signifi cant, contributions of with NM plants. In other words, uptake of P (and the AM pathway (Table 1). probably other nutrients like Zn and N) via the AM pathway may be ‘hidden’ unless tracers are used to Th e quantitative approach has been extended to reveal its occurrence. barley and wheat, in which the AM fungi contribute strongly to P uptake even when the AM plants Studies of gene expression have also shed light on show reductions in both growth and total P uptake the operation of the AM-P uptake pathway. It is compared with NM plants. In particular, our work clear that the operation of the two pathways de- has shown that the AM pathway involving G. intra- pends on expression of diff erent genes (see Fig. 1). radices contributed ~50% of P absorbed by barley In the direct pathway, P is taken up via high-affi nity (Grace 2008; Grace et al. 2009b) and up to ~60% transporters located in the root hairs and root by wheat (Li et al. 2006). In neither case was there epidermal cells. Th e few studies of these genes in a signifi cant eff ect of P fertilisation on the contribution of the two pathways, which indicates that relation to root development show that expression increasing P availability did not increase the ability appears to be maximal just behind the root apices, of the roots themselves to absorb P via the direct where P in the soil solution would also be expected pathway. to be highest before rapid uptake leads to depletion of P in the rhizosphere (Daram et al. 1998; Gordon- Two key conclusions must be drawn from this work: Weeks et al. 2003). Th e AM pathway depends on • the AM pathway operates to provide P to P transporters in both fungus and plant. High- plants regardless of their responsiveness in affi nity P transporters have been characterised terms of growth or P uptake from several AM fungi. Th ey are all expressed in • the operation of the direct and AM pathways is external hyphae, as would be required for uptake not additive. from the soil solution (Harrison and van Buuren

TheTR Rovira Rhizosphere R Symposium S 35 1995; Maldonado-Mendoza et al. 2001; Benedetto thought to be artefacts of experimental conditions et al. 2005; Balestrini et al. 2007). Uptake of P is and appeared to detract from the positive image followed by rapid translocation within the external of the symbiosis and potential for management to hyphae and delivery to the symbiotic interfaces optimise the benefi ts. Th is blinkered vision meant within the root cortex (arbuscules, coils and/or ar- that a whole range of interactions between AM busculate coils—see Fig. 3) (Ezawa et al. 2002). Th e fungi and plants was excluded from study, with mechanism of loss of P from the hyphae remains a consequent loss of key information that might lead mystery, but uptake by the plant membrane in the to understanding of their causes (see Johnson et al. interface involves expression of AM-specifi c or AM- 1997; Jones and Smith 2004; Janos 2007; Smith et inducible P transporters (reviewed by Bucher 2006; al. 2009). Th is is not the place to discuss the com- Javot et al. 2007). As AM development occurs fi rst plex physiological issues involved. It is important to behind the root apex (Smith et al. 1986), the exter- point out, however, that the most common expla- nal hyphae and fungal structures within the root nation for depressions has been that the plants are are apparently well placed to take over from uptake C-limited and that the fungi exert a C drain on the by the epidermal cells and root hairs near the apex plants that is not off set by increased nutrient uptake as P becomes depleted and the root apex itself grows (Smith 1980; Bethlenfalvay et al. 1982). Hence, into hitherto unexploited soil. Th is theoretical extensive and rapid colonisation was thought to scenario has not been demonstrated by develop- be a key contributor to AM depressions in growth, mental studies, but it seems clear that the potential especially in soils where nutrients were readily for independent regulation of the expression of available and hence AM symbiosis ‘not required for the transporter genes in the two pathways may be uptake’. We now know that the fungi are involved critical in determining the way they are integrated in P uptake and we also point out that growth de- during development of a root system and in diff er- pressions are oft en transitory (compare Figs 2a and ent plant–fungus combinations. 2b) and occur both in plants that are extensively colonised and in those that are not (see Graham and At this stage we have no clear picture of why P Abbott 2000; Grace 2008; Li et al. 2008a; Grace delivery by the direct pathway is frequently re- et al. 2009b; Smith et al. 2009). As with P uptake, duced in AM plants. Some studies indicate that the conventional explanation is not adequate to expression of P transporter genes in the direct explain the range of situations under which growth uptake pathway is reduced in AM plants (Liu depressions occur. Th e issue is important because a et al. 1998; Burleigh et al. 2002; Harrison et al. number of staple crops, including wheat and barley, 2002; Paszkowski et al. 2002; Glassop et al. 2005; are known to show depressions in experimental Christophersen et al. 2009). However, others show conditions. What is required is an understanding no such eff ect, even with the same plant–fungus of how activities of the symbionts are controlled combinations (Karandashov et al. 2004; Nagy et and integrated in the fi eld where AM symbioses are al. 2005; Poulsen et al. 2005; Grace 2008; Grace et normal. al. 2009b). As highlighted frequently in the past, it may be that soil conditions and extension of the P Conceptual changes are required uptake surfaces (roots or hyphae) play a much more signifi cant role in controlling P uptake than the Th e recent work reviewed here indicates that kinetic characteristics of the transporters (Clarkson conceptual changes in our understanding of the 1985; Silberbush and Barber 1983; Raghothama operation of AM symbioses in fi eld situations are 2000; Tinker and Nye 2000). Th is is an important necessary: area for future research. • First and most important, the vast majority of plants (including crops) are AM-colonised in Growth depressions fi eld situations. If we are to understand crop nutrition and growth in the fi eld we must Although negative eff ects of AM colonisation on understand how the activities of AM fungi and plant P uptake and growth have been recognised for plants are integrated over a very diverse range a very long time (Smith 1980), they have received of responses. little attention and may even have been played • A range of diff erent intracellular structures down in published research because they were are formed in root cortical cells by AM

TheTR Rovira Rhizosphere R Symposium S 36 fungi. Identifi cation of a root as ‘arbuscular Under these circumstances there is little point in mycorrhizal’ requires that arbuscules, coils research to maximise activity of the direct pathway and arbusculate coils are all recognised as without taking the eff ects of the symbiosis into functionally important. account. A future research challenge will be to max- • Eff ects of AM symbiosis on both nutrient imise uptake by both pathways in a way that will uptake and plant growth (whether positive enhance the overall effi ciency of the root systems. or negative) are not directly related to the Th e aim should be to maximise the use of pools of P extent of colonisation of the roots. Th us the stored in soil, thus minimising the need for applied ‘importance’ of AM and potential role in fertiliser and off setting the rising costs associated nutrient uptake cannot be gauged from the with its application. percent colonisation. • Th e two pathways of nutrient uptake in an AM Acknowledgements root (direct and AM) do not act additively, but are independently regulated. Th e activity Emily Grace is grateful for a Commonwealth Hill of the direct pathway is frequently reduced in Postgraduate Research Scholarship. We thank AM plants, regardless of the overall outcome the South Australian Grains Industry Trust, the of the symbiosis. It is therefore not possible to Australian Research Council and the Australian determine the contribution of AM symbiosis Centre for Plant Functional Genomics for fi nancial (i.e. the AM pathway) by comparing total P support. uptake in AM and NM plants. • Because the AM nutrient uptake pathway References operates in negatively responsive plants it is not appropriate to regard the fungi in these Aliasgharzadeh, N., Rastin, N.S., Towfi ghi, H. and associations as fully parasitic. Th e associations Alizadeh, A. 2001. Occurrence of arbuscular are mutualistic at the cellular level, with mycorrhizal fungi in saline soils of the Tabriz plain of Iran in relation to some physical and reciprocal transfers of P and C between the chemical properties of soil. Mycorrhiza 11, symbionts. Furthermore, C-drain to the fungal 119–122. symbiont is not always an adequate explanation for growth depressions in AM plants. Arihara, J. and Karasawa, T. 2000. Eff ect of previous crops on arbuscular mycorrhizal formation and growth of succeeding maize. Soil Science Implications for future work on crop and Plant Nutrition 46, 43–51. plants Balestrini, R., Gomez-Ariza, J., Lanfranco, L. and It is undeniable that the vast majority of major Bonfante, P. 2007. Laser microdissection crops, including cereals, are capable of forming reveals that transcripts for fi ve plant and mycorrhizas and will do so in cropping situations in one fungal phosphate transporter genes are the fi eld. Nutrient uptake in the fi eld will therefore contemporaneously present in arbusculated involve symbiotic AM root systems. As we have cells. Molecular Plant–Microbe Interactions emphasised, the new work indicates a major infl u- 20, 1055–1062. ence of AM colonisation both on the pathways of Baon, J.B., Smith, S.E., Alston, A.M. and Wheeler, nutrient uptake, including genes expressed, and on R.D. 1992. Phosphorus effi ciency of three the quantitative contributions of the two pathways cereals as related to indigenous mycorrhizal to P uptake. Th e AM pathway is involved in uptake infection. Australian Journal of Agricultural of P whether or not the plants are responsive to AM Research 43, 479–491. fungi in terms of growth. Optimising the use of nutrients accumulated in soil or applied as fertiliser Benedetto, A., Magurno, F., Bonfante, P. and depends on understanding the symbiotic uptake Lanfranco, L. 2005. Expression profi les of processes and their control. If the AM and direct a phosphate transporter (GmosPT) from the pathways are complementary and the AM pathway endomycorrhizal fungus Glomus mosseae. Mycorrhiza 15, 620–627. makes a major contribution, then P uptake via the direct pathway may be very low or even inoperative.

TheTR Rovira Rhizosphere R Symposium S 37 Bethlenfalvay, G.J., Pacovsky, R.S. and Brown, M.S. Gordon-Weeks, R., Tong, Y.P., Davies, T.G.E. 1982. Parasitic and mutualistic asssocia- and Leggewie, G. 2003. Restricted spatial tions between a mycorrhizal fungus and expression of a high-affi nity phosphate soybean. Development of the endophtye. transporter in potato roots. Journal of Cell Phytopathology 72, 894–897. Science 116, 3135–3144. Boyetchko, S.M. and Tewari, J.P. 1995. Grace, E.J. 2008. Functional characterisation of Susceptibility of barley cultivars to vesicular- phosphorus uptake pathways in a non- arbuscular mycorrhizal fungi. Canadian responsive arbuscular mycorrhizal host. Journal of Plant Science 75, 269–275. PhD thesis, Th e University of Adelaide. Bucher, M. 2006. Functional biology of plant Grace, E.J., Smith, F.A. and Smith, S.E. 2009a. phosphate uptake at root and mycorrhiza Deciphering the arbuscular mycorrhizal interfaces. New Phytologist 173, 11–26. pathway of P uptake in non-responsive hosts. In: Azcón-Aguilar, C., Barea, J.M., Burleigh, S.H., Cavagnaro, T.R. and Jakobsen, I. Gianinazzi, S.and Gianinazzi-Pearson, V. 2002. Functional diversity of arbuscular (eds) Mycorrhizas: Functional Processes and mycorrhizas extends to the expression of Ecological Impact. Springer, pp. 89–106. plant genes involved in P nutrition. Journal of Experimental Botany 53, 1593 –1601. Grace, E.J., Cotsaftis, O., Tester, M., Smith, F.A. and Smith, S.E. 2009b Arbuscular my- Christophersen, H.M., Smith, F.A. and Smith, S.E. corrhizal inhibition of growth in barley 2009. Arbuscular mycorrhizal colonisa- cannot be attributed to extent of colonisation reduces arsenate uptake in barley via tion, fungal P uptake or eff ects on plant down-regulation of transporters in the direct phosphate transporter expression. New epidermal phosphate uptake pathway. New Phytologist 181, 938–949. Phytologist 184, 962–974. Graham, J.H. and Abbott, L.K. 2000. Wheat Clarkson, D.T. 1985. Factors aff ecting mineral nutri- responses to aggressive and non-aggressive ent acquisition by plants. Annual Review of arbuscular mycorrhizal fungi. Plant and Plant Physiology and Plant Molecular Biology Soil 220, 207–218. 36, 77–115. Harrison, M.J. and van Buuren, M.L. 1995. A Daram, P., Brunner, S., Persson, B.L., Amrhein, N. phosphate transporter from the mycor- and Bucher, M. 1998. Functional analysis rhizal fungus Glomus versiforme. Nature and cell-specifi c expression of a phosphate 378, 626–632. transporter from tomato. Planta 206, Harrison, M.J., Dewbre, G.R. and Liu, J.Y. 2002. 225–233. A phosphate transporter from Medicago Dickson, S. 2004. Th e Arum–Paris continuum of truncatula involved in the acquisition mycorrhizal symbioses. New Phytologist 163, of phosphate released by arbuscular 187–200. mycorrhizal fungi. Th e Plant Cell 14, 2413–2429. Ezawa, T., Smith, S.E. and Smith, F.A. 2002. P metabolism and transport in AM fungi. Plant Hetrick, B.A.D., Wilson, G.W.T. and Schwab, and Soil 244, 221–230. A.P. 1994. Mycorrhizal activity in warm- and cool-season grasses: variation Gavito, M., Bruhn, D. and Jakobsen, I. 2002. in nutrient uptake strategies. Canadian Phosphorus uptake by arbuscular mycor- Journal of Botany 72, 1002–1008. rhizal hyphae does not increase when the Janos, D. 2007. Plant responsiveness to mycor- host plant grows under atmospheric CO2 enrichment. New Phytologist 154, 751–760. rhizas diff ers from dependence upon mycorrhizas. Mycorrhiza 17, 75–91. Glassop, D., Smith, S.E. and Smith, F.W. 2005. Cereal phosphate transporters associated Javot, H., Pumplin, N. and Harrison, M.J. 2007. with the mycorrhizal pathway of phosphate Phosphate in the arbuscular mycorrhizal uptake into roots. Planta 222, 688–698. symbiosis: transport properties and regu- latory roles. Plant Cell and Environment 30, 310–322.

TheTR Rovira Rhizosphere R Symposium S 38 Jensen, A. and Jakobsen, I. 1980. Th e occurence of Liu, H., Trieu, A.T., Blaylock, L.A. and Harrison, vesicular-arbuscular mycorrhiza in barley M.J. 1998. Cloning and characterization of and wheat grown in some Danish soils with two phosphate transporters from Medicago diff erent fertilizer treatments. Plant and Soil truncatula roots: regulation in response to 55, 403–414. phosphate and response to colonization by arbuscular mycorrhizal (AM) fungi. Johnson, N.C., Graham, J.H. and Smith, F.A. 1997. Molecular Plant–Microbe Interactions 11, Functioning of mycorrhizal associations 14–22. along the mutualism-parasitism continuum. New Phytologist 135, 575–586. Maldonado-Mendoza, I.E., Dewbre, G.R. and Harrison, M.J. 2001. A phosphate trans- Jones, M.D. and Smith, S.E. 2004. Exploring porter gene from the extraradical mycelium functional defi nitions of mycorrhizas: are of an arbuscular mycorrhizal fungus Glomus mycorrhizas always mutualisms? Canadian intraradices is regulated in response to Journal of Botany 82, 1089–1109. phosphate in the environment. Molecular Plant–Microbe Interactions 14, 1140–1148. Karandashov, V., Nagy, R., Wegmuller, S., Amrhein, N. and Bucher, M. 2004. Evolutionary Miller, M.H. 2000. Arbuscular mycorrhizae and the conservation of a phosphate transporter phosphorus nutrition of maize: a review of in the arbuscular mycorrhizal symbiosis. Guelph studies. Canadian Journal of Plant Proceedings of the National Academy of Science 80, 47–52. Sciences, USA 101, 6285–6290. Nagy, R., Karandashov, V., Chague, V., Kalinkevich, Koide, R.T. and Mosse, B. 2004. A history of re- K., Tamasloukht, M.B., Xu, G., Jakobsen, search on arbuscular mycorrhiza. Mycorrhiza I., Levy, A.A., Amrhein, N. and Bucher, 14, 145–163. M. 2005. Th e characterization of novel mycorrhiza-specifi c phosphate transporters Lekberg, Y. and Koide, R.T. 2005. Is plant perfor- from Lycopersicon esculentum and Solanum mance limited by abundance of arbuscular tuberosum uncovers functional redundancy mycorrhizal fungi? A meta-analysis of stud- in symbiotic phosphate transport in so- ies published between 1988 and 2003. New lanaceous species. Th e Plant Journal 42, Phytologist 168, 189–204. 236–250.

Li, H.Y. 2004. Roles of mycorrhizal symbiosis in Newsham, K.K., Fitter, A.H. and Watkinson, A.R. growth and phosphorus nutrition of wheat 1995. Multi-functionality and biodiversity in a highly calcarous soil. PhD thesis, Th e in arbuscular mycorrhizas. Trends in Ecology University of Adelaide, Adelaide, Australia. and Evolution 10, 407–411.

Li, H.Y, Smith, S.E., Holloway, R.E., Zhu, Y-G. and Paszkowski, U., Kroken, S., Roux, C. and Briggs, Smith, F.A. 2006. Arbuscular mycorrhizal S.P. 2002. Rice phosphate transporters fungi contribute to phosphorus uptake by include an evolutionarily divergent gene wheat grown in a phosphorus-ﬁ xing soil even speciﬁ cally activated in arbuscular mycor- in the absence of positive growth responses. rhizal symbiosis. Proceedings of the National New Phytologist 172, 536–543. Academy of Sciences USA 99, 13324–13329.

Li, H.Y., Smith, F.A., Dickson, S., Holloway, R.E. Pearson, J.N. and Jakobsen, I. 1993. Th e relative and Smith, S.E. 2008a. Plant growth depres- contribution of hyphae and roots to phos- sions in arbuscular mycorrhizal symbioses: phorus uptake by arbuscular mycorrhizal 32 not just caused by carbon drain? New plants measured by dual labelling with P 33 Phytologist 178, 852–862. and P. New Phytologist 124, 489–494.

Li, H.Y., Smith, S.E., Ophel-Keller, K., Holloway, Poulsen, K.H., Nagy, R., Gao, L-L., Smith, S.E., R.E. and Smith, F.A. 2008b. Naturally oc- Bucher, M., Smith, F.A. and Jakobsen, I. curring arbuscular mycorrhizal fungi can 2005. Physiological and molecular evidence replace direct P uptake by wheat when roots for Pi uptake via the symbiotic pathway in a cannot access added P fertiliser. Functional reduced mycorrhizal colonization mutant in Plant Biology 35, 125–134. tomato associated with a compatible fungus. New Phytologist 168, 445–454.

TheTR Rovira Rhizosphere R Symposium S 39 Raghothama, K.G. 2000. Phosphate transport and Smith, S.E. 1980. Mycorrhizas of autotrophic higher signaling. Current Opinion in Plant Biology plants. Biological Reviews 55, 475–510. 3, 182–187. Smith, S.E. and Read, D.J. 2008. Mycorrhizal Ravnskov, S. and Jakobsen, I. 1995. Functional Symbiosis. Edition 3. Academic Press, New compatibility in arbuscular mycorrhizas York, London, Burlington, San Diego. measured as hyphal P transport to the plant. New Phytologist 129, 611–618. Smith, F.A and Smith, S.E. 1996. Mutualism and parasitism: diversity in function and struc- Ravnskov, S., Nybroe, O. and Jakobsen, I. 1999. ture in the ‘arbuscular’ (VA) mycorrhizal Infl uence of an arbuscular mycorrhizal symbiosis. Advances in Botanical Research 22, fungus on Pseudomonas fl uorescens df57 1–43. in rhizosphere and hyphosphere soil. New Phytologist 142, 113–122. Smith, S.E., Tester, M. and Walker, N.A. 1986. Th e development of mycorrhizal root systems in Ryan, M.H. and Angus, J.F. 2003. Arbuscular my- Trifolium subterraneum L.: growth of roots corrhizae in wheat and fi eld pea crops on and the uniformity of spatial distribution of a low P soil: increased Zn-uptake but no mycorrhizal infection units in young plants. increase in P-uptake or yield. Plant and Soil New Phytologist 103, 117–131. 250, 225–239. Smith, S.E, Smith, F.A. and Jakobsen, I. 2003. Ryan, M.H. and Ash, J.E. 1996. Colonisation of Mycorrhizal fungi can dominate phosphate wheat in southern New South Wales by supply to plants irrespective of growth re- vesicular-arbuscular mycorrhizal fungi is sponses. Plant Physiology 133, 16–20. signifi cantly reduced by drought. Australian Journal of Experimental Agriculture 36, Smith, S.E., Smith, F.A. and Jakobsen, I. 2004. 563–569. Functional diversity in arbuscular mycorrhizal (AM) symbioses: the contribution of Ryan, M.H. and Graham, J.H. 2002. Is there a the mycorrhizal P uptake pathway is not role for arbuscular mycorrhizal fungi in correlated with mycorrhizal responses in production agriculture? Plant and Soil 244, growth or total P uptake. New Phytologist 263–271. 162, 511–524.

Ryan, M.H., Chilvers, G.A. and Dumaresq, Smith, F.A., Grace, E.J. and Smith, S.E. 2009. More D.C. 1994. Colonisation of wheat by VA- than a carbon economy: nutrient trade and mycorrhizal fungi was found to be higher on ecological sustainability in facultative arbus- a farm managed in an organic manner than cular mycorrhizal symbioses. New Phytologist on a conventional neighbour. Plant and Soil 182, 347–358. 160, 33–40. Tinker, P.B.H. and Nye, P.H. 2000. Solute Schüßler, A., Schwarzott, D. and Walker, C. 2001. Movement in the Rhizosphere. Oxford A new fungal phylum, the Glomeromycota: University Press, Oxford. phylogeny and evolution. Mycological Research 105, 1413–1421.

Silberbush, M. and Barber, S.A. 1983. Sensitivity of simulated phosphate uptake parameters used by a mechanistic mathematical model. Plant and Soil 74, 93–100.

TheTR Rovira Rhizosphere R Symposium S 40 Two parallel rhizosphere programs

R.J. (Jim) Cook1,2

Abstract Introduction Complementary research programs at Adelaide Congratulations on the symposium — it is a won- and Pullman, led respectively by Albert Rovira derful tribute to Albert Rovira. and the author, have cooperated for 40 years to I am very sorry I can’t be at the event, although address signiﬁ cant problems of disease and yield you have a great representative from the Pacifi c in wheat crops. Northwest in Dick Smiley. I thought that doing a We identiﬁ ed the microorganisms associated DVD or video would be the next best thing, and with take-all decline in wheat, and observed what better place than in my favourite habitat— the complexity of the interaction between right here in the wheat fi elds. the root-damaging organisms and cultivation I remember fi rst meeting Albert Rovira at the and cropping history. We showed that soil Berkley Symposium in 1963. Albert was fresh into sterilisation could enable crops to more fully his new job at CSIRO as a rhizosphere microbiolo- exploit the nutrients available in the soil. We gist aft er coming from a post-doctorate in Sweden. have been able to identify at least some factors During his presentation Albert showed pictures of important to the successful use of low-tillage bacteria on the root surface—little islands of bac- systems for wheat cropping. teria jockeying for space. We were all amazed to see this fi rst presentation of what bacteria looked like Albert Rovira has made a seminal contribution on the surface, and since then Albert has just gone to our understanding of the rhizosphere in on to show so much more in this area. cereal cropping. It was quite surprising that within one year I would be in Australia working with Noel Flentje at the Waite Agricultural Research Institute just across the road from Albert’s lab at CSIRO Division of

1 Presented as a video presentation by DVD from a Soils. I especially remember going along to see one wheat fi eld in eastern Washington of his fi eld trials with wheat inoculated with bacte- 2 Dean and Professor Emeritus, Washington State ria, trying to confi rm some of the Russian work on University. Formerly, Endowed Chair in Wheat growth promotion through N fi xation provided by Research, Departments of Plant Pathology and a bacterium applied to the seeds. At that time, all of Crop and Soil Sciences, and his work was in the realm of basic or fundamental USDA, Agricultural Research Service Root Disease research. Th at’s one of the reasons that I enjoyed and Biological Control Research Unit, Washington looking at the sort of things he was doing. I think it State University, Pullman, Washington 99164- started with Dick Smiley doing his PhD with me, 6430, USA and then getting down to Australia—it may have been in 1972–1973—and doing a post-doctoral

TheTR Rovira Rhizosphere R Symposium S 41 with you, Albert, that you began to change the way rotation. We moved several hundred kilos of each you looked at soil microbiology. Th at was the period of these soils to western Washington, to the WSU when you began to critically seek answers to the Research Center at Puyallup. Dick also did one of question of what limits crop productivity—whether his experiments on the infl uence of form of nitrogen fertility or soil biology—as opposed to but probably on rhizosphere pH right alongside a site where we building on your experiences in the more funda- mixed in those six diff erent soils in four replicate mental chemical and biological processes of the blocks. In the fi rst year, we introduced the pathogen rhizosphere. It was a very major change. It was a real as colonised oat grains at the time of planting and tribute that, aft er working 15 years in one area and the wheat was devastated from one corner of the 15 years in another area, you became a Fellow of the experimental site to the other by take-all. But the American Phytopathological Society for your work second year, when we dug up the plants, we were on rhizosphere pathology. I know you are very amazed, as you will see (Fig. 1), the roots were white proud of that and I’m very proud of that too. exactly and exclusively from the four plots that received soil from that fi eld of 12 years of continuous I will talk about three diff erent projects that I think wheat, QF, but where we did not add any soil, or have tied our programs together. Th ese are: where we added the Quincy Virgin (QV) soil from • the fi rst evidence of the role of uorescentfl just across the fence line, or any of the other four pseudomonads in take-all decline soils, these soils contributed nothing to take-all suppression. I’ll never forget those white roots in • research on soil fumigation that led to the di- those four plastic bags with plants that came from agnosis of the ubiquitous presence of Pythium those four plots — the white roots just like you see root rot here in eastern Washington, adjacent in the picture. Idaho and Oregon • work on the problems encountered with no-till Figure 2 gives a view the profi le of the wheat in the farming and discovery of the role of and means plots aft er heading. Th e plots were 1.5 m wide and 3 to control Rhizoctonia root-rot. m long. We mowed out the front and held up some butchers’ paper behind the standing wheat to get Th ese are all major topics, each one of which would a profi le view of the wheat as it was starting into deserve a full hour of conversation. heading.

The role of fl uorescent pseudomonads in take-all decline My interest in take-all decline was really sparked when I met Peter Shipton in 1968 at the First International Congress of Plant Pathology. Peter had just done his PhD on take-all decline following the work of Gerlagh in the Netherlands, and had a soil assay system to identify fi elds in take-all decline. It was only a year or two later that Peter joined my program at Pullman and we took up the whole question of what would happen in response to continuous wheat cropping with respect to take- all. Dick Smiley will remember very well the classic experiment that we did because he helped us to set Figure 1. Wheat roots black with take-all (left and it up, using soils from six diff erent fi elds in eastern centre) and healthy white (right) from a fi eld plot where, two years earlier, soil from a fi eld cropped to Washington. One of these fi elds was later nick- wheat for 12 consecutive years had been mixed to named the Quincy Field (QF) where the farmer had 15 cm deep at about 0.5% by weight. Th e checks had grown wheat for 12 consecutive years and where no foreign soil added (left) or soil was added from take-all was not a problem, although we never knew a site next to the long-term wheat fi eld but never whether it ever was a problem. Th e other fi ve fi elds planted to wheat (centre). had a history either of no wheat or wheat in a crop

TheTR Rovira Rhizosphere R Symposium S 42 Figure 2. Replicate 3 (centre), typical of all four replicates. Th e tall plants are in a plot where soil from a ﬁ eld cropped to wheat for 12 consecutive years had been mixed in two years earlier; in comparison the stunted wheat, severely aﬀ ected by take-all, is in plots where other soils or no soil had been mixed in previously (see Fig. 1).

Th e wheat in plots amended with the QF soil was Figure 3. Pot experiment done in Albert’s lab in clearly taller, and it was because of those white 1973, where soil from Roseworthy College and roots. Take-all suppression took two years to mani- fumigated with methyl bromide (Mb) was used as fest itself in these plots, but in the third year (Lex the common rooting medium amended with the Parker was there to see it), it was non-stop take-all take-all pathogen (Gg) and then also amended at 1% decline from one end of that experiment to the by weight with soil never cropped to wheat (QV), other. Th at was really the start of my interest in cropped continuously to wheat (QF and H), or studying microbial processes through the transfer cropped to wheat as a component in a crop rotation of soil. A year later I was in Australia in Albert’s lab (A and T). Th e control received no soil amendment. ready to go to work on that very question.

Research on soil fumigation I was invited to give a seminar at CSIRO just as I was completing this trial. I had the pots on a bench I recalled Rex Krause from his days at Pullman, so beside the podium with brown paper in front of we went out to Roseworthy Agricultural College them, and I gave my seminar about the transfer of and Rex helped me get some soil that was beautiful soil at Puyallup and then I talked about the pot test. soil to work with—coarse and well drained—to use At the right time, I pulled that brown paper up. You as a fumigated rooting medium. We will never for- could clearly see the suppression of take-all with the get those two 3 lb Maxwell House coff ee cans that two soils that came from the fi elds cropped continu- I shipped in advance of my arrival, one full of QF ously to wheat, but not with soil from fi elds where soil and the other full of QV soil. Albert had them wheat had not been grown regularly or at all. in the cold room when I arrived. I got the soil from Roseworthy and mixed it up with the QF soil and I looked at Albert in front of the audience, and said the QV soil. Meanwhile, Albert and I, with others, ‘I’ve come to work with the world’s best rhizosphere made a trip to Horsham where the Research Centre microbiologist to fi nd out what was in that table- had grown wheat repeatedly in the same fi elds for spoonful of soil’. Th at got us going. Even today with 50 years. We obtained some of that (H) soil. Th is take-all decline, we have never been able to actually resulted in a pot trial—Figure 3. introduce the agent by seed inoculation. With the story about the antibiotic and so forth, ‘take-all decline’ is now the centre-piece for our intensive

TheTR Rovira Rhizosphere R Symposium S 43 Figure 4. Th e plot fumigated with Telone C17 Figure 5. Healthy white wheat roots from fumigated yielded 8 tonnes/ha (upper plots) vs. 6 tonnes/ha in soils (left); Pythium-aﬀ ected roots stripped of ﬁ ne unfumigated soil (foreground). rootlets and root hairs from unfumigated soil (right) direct-seed cropping systems here in the Pacifi c Northwest. Th en superimposed on that are all the other things we have to do to control the other root diseases, so we can grow cereals continuously with good fertility.

Dick Smiley, working with Noel Sutherland at CSIRO, started to experiment with soil fumigation when he joined Albert’s lab. My understanding is that it was from these early experiments that Albert got the idea for his program to look at root diseases including the nematodes. I was amazed at Albert’s fi eld trials done collaboratively with Ted Ridge; Figure 6. Conventional no-till wheat (left) and when I came back in the seventies I started my own wheat undersown with granular metalaxyl (four rows fumigation trials just out of Pullman with the help on the right) of Bill Haglund. In Figure 4, you can see one of the wheat fi elds where we showed a two-metric-tonne yield increase from just fumigating the soil. Th is We used the fumigant Telone C-17, which led to response was in a three-year rotation. beautifully white roots, while the controls produced We got 8 tonnes/ha where we fumigated com- those brown roots. We discovered that Pythium pared to 6 tonnes where the soil was left natural. strips off the fi ne rootlets and root hairs, greatly Six tonnes is very respectable but 8 tonnes was the reducing the ability of the crop to get its nutrients— potential yield with the same fertiliser and water. especially relatively immobile nutrients such as Th ere was some nitrogen left unused in the non-fu- phosphorus. Th is shows why there was nitrogen migated plots, as Albert’s own work had also shown. fertiliser left unused in the soil.

Th ere was something else going on, and that led to Th e real break came with the availability of metal- our discovery of Pythium. You can see a compari- axyl which was then being developed by Novartis, son of the roots in Figure 5—white roots where now known as Syngenta, specifi cally for control of Pythium was eliminated with Telone C17 at Pythium and its close relatives. When I laid down 240 L/ha compared with brown roots in the metalaxyl in a granular layer under the seed in four controls. Th ese results are from of one of our fumi- rows, the crop looked as though we had added extra gation trials set up the next year and across the road fertiliser to those rows (Fig. 6). from the fi eld shown in Figure 4.

TheTR Rovira Rhizosphere R Symposium S 44 Figure 7. Young barley plant showing classical Figure 8. Plots with alternating strips of symptoms of Rhizoctonia root rot conventional tillage (healthy wheat) and no till (wheat stunted with missing plants), with an area fumigated with methyl bromide across all strips Th is and similar studies led us to conclude that that (foreground) Pythium is present everywhere and all plants are damaged more-or-less to the same degree. We had come to think of our 6 tonne/ha wheat as normal in soils here in the Pacifi c Northwest. Th is means healthy wheat when in fact it should have been 8 we have not only the same pathogen, but also the tonnes. Th at was a major break-through for us; I same biotypes or sub-biotypes of Rhizoctonia solani wouldn’t have done that if I hadn’t become excited AG 8. when I saw Albert’s own fumigation trials in the I then did my own experiments comparing the ef- 1970s. fects of tillage and no-till on Rhizoctonia root rot of wheat. In Figure 8 you can see the strips of alter- Problems with no-till farming nating no till, where the wheat is stunted or plants As was known in both Australia and the Pacifi c are missing, and till where the wheat looks good. North-West, no-till farming was starting to take off Th e fumigated plots (in the foreground) showed where one could farm with a planter, a sprayer and a that the poor growth of wheat in no-till was due to combine, leaving all the other equipment out in ‘the disease—not a physical eff ect of the undisturbed back 40’, where it would ‘rust in peace’. Of course soil. Th is study was done at the WSU experimental there were some problems as well. station near Lind, WA, in one of my fi eld sites that had been cropped continuously to wheat for about In 1983 Dick Smiley was on sabbatical in 20 years, and showed what Rhizoctonia could do Melbourne, David Weller from my lab was work- without soil disturbance. ing with Albert and I came down for the Fourth International Congress of Plant Pathology. We were Th at study prompted us to pick up on Albert’s introduced to the work that Albert was doing on sowing points used as openers for soil disturbance soil disturbance for Rhizoctonia control. within the seed row; trying to ‘have our cake and eat it too’—disturbing the soil only in the seed rows Back home, we tried some of these experiments (but otherwise calling it no-till) and planting the ourselves. We found young wheat and barley plants seed and fertiliser all in a single pass. with exactly the same symptoms of Rhizoctonia root rot (Fig. 7) that wheat and barley plants showed in Th e story would not be complete without talk- no-till fi elds in Australia. ing about the ‘green bridge’—what was known in Australia as ‘spray-seed’ and I think became ‘spray Th e Rhizoctonia in Washington is the same anas- wait’. Dick Smiley started experiments at Pendleton tomosis group (AG 8) as the Rhizoctonia in South on that shortly aft er he got back from Australia. I, Australia. Moreover, the SARDI DNA tests for with the weed scientist Alex Ogg, did similar work. Rhizoctonia in Australia detected our Rhizoctonia Results of an experiment that Alex and I did at the WSU experimental station at Lind are shown in

TheTR Rovira Rhizosphere R Symposium S 45 Figure 9. Barley seeded no-till in the spring where Figure 10. Wheat seeded no-till into stubble of the volunteer cereals had been sprayed out the previous previous crop, showing the so-called ‘combine row fall (background) and only three days before eﬀ ect’ owing to the concentration of straw left by the planting in the spring (foreground) harvester and where plants are stunted and slow to mature (green strips). Healthier wheat is maturing more rapidly between the strips where straw and Figure 9. In the background of the photo we had chaﬀ were left most concentrated. sprayed out volunteer Hordeum in the fall, whereas in the foreground it was sprayed in the spring just Th at brings the story to 2008. For the most part, three days before planting. you can now drive in the fall through eastern What an incredible diff erence just getting rid of Washington and you can see the diff erence between that volunteer crop makes! Figure 10 is an earlier the no-till fi elds of those who allow the stubble to photograph, of wheat planted directly into wheat green up and of those where the stubble is brown, stubble of the previous year’s crop, in which you having been sprayed in the fall—at least when there could see every combine row where the straw had was something to spray in the fall or early in the lain aft er combining. Th e explanation at that spring. time was that the straw—or more likely the concentration of chaff left behind the combine—was Conclusion somehow toxic to wheat. Ron Kimber was working on it in Adelaide and Jim Lynch and Lloyd Elliott My presentation has covered some of the history of at Pullman. But all that time the stunting and slow our two complementary programs. We have been maturation of wheat in the combine rows was due to working together for 40 years, and our programs root diseases favoured by the green bridge, and not have run in parallel, almost in lock step, charging to straw and chaff . It was the volunteer crop, most each other’s batteries and staying the course. We concentrated in the combine row, that was giving us have never looked back to the old-fashioned way that eff ect. of working up the ground and kicking up the dust. Let’s get on with no-till. Let’s resolve the problems Soil disturbance in the seed row within an other- so this system really works. wise no-till system is working—we are still getting eff ects from that, although there is still some con- I say to you, Albert, ‘Good luck and all the best’, troversy about low-disturbance drills preferred by remembering the trip we did during your time in some vs high-disturbance drills favoured by others. Pullman in 1987, from sun-up to sundown through I favour high-disturbance drills, at least when fi rst the countryside, ending up in Idaho at sundown. getting into no-till cropping systems. Th ese were the things we enjoyed and we remember.

TheTR Rovira Rhizosphere R Symposium S 46 Root diseases, plant health and farming systems

Richard W. Smiley1

Abstract and root-lesion nematode. Recent progress has included a deeper understanding of pathogen Root diseases continue to hinder the produc- population dynamics and disease resistance, as tion of small-grain cereals and especially the well as development of DNA markers, pathogen transition from cultivated to direct-drill dry- detection and quantifi cation procedures. land farming systems. A deeper understanding of ecosystems and development of improved support systems and farming practices remain Introduction critically important as farmers strive to elevate Cropping systems are an integration of manage- disease management capabilities to a higher pla- ment decisions and practices involving a complex teau. Th e focus of this paper is on root disease matrix of farm-level environmental, fi nancial and management practices and methods that were social parameters (Howden et al. 1998; Pannell et strongly infl uenced by the many contributions al. 2006). Cropping system diversity occurs even of Dr Albert Rovira. His career has been replete among neighboring farms. Small diff erences in with productive collaboration among scientists, practices can directly infl uence interactions among farmers and providers of farm advisory and micro-environments, crops and pathogens that supply services throughout Australia and inter- determine plant vigor and the occurrence and severity of disease. Th e challenge is to develop practical nationally, as most recently delivered through and profi table disease management practices that Th e ATSE Crawford Fund. Examples in this pa- fi t within the fi nancial and social parameters that per are drawn mostly from rainfed wheat-based infl uence decisions made by farmers. Dr Albert cropping systems in a low-rainfall region of Rovira’s contributions to agriculture and to science the Pacifi c Northwest USA where root disease have clearly demonstrated that he is a scientist who management was also improved through the was capable and willing to commit a lifelong passion infl uences of Albert Rovira and his colleagues, to achieve this mission. particularly those at Glen Osmond. Th e emphasis of this paper is on take-all, Rhizoctonia root Th is paper addresses direct and indirect infl uences rot (bare patch) and cereal cyst nematode but of Australian scientists and farmers on disease management programs in the inland Pacifi c Northwest includes Pythium root rot, Fusarium crown rot USA (PNW: Idaho, eastern Oregon and eastern

Washington), where wheat is the primary economic 1 Oregon State University, Columbia Basin enterprise and is produced in farming systems simi- Agricultural Research Center, PO Box 370 lar to the diversity of those in the wheat belts of Pendleton, Oregon, USA 97801 southern and western Australia (Freebairn et al. Email: [email protected] 2006; Schillinger et al. 2006). http://cbarc.aes.oregonstate.edu/plant-pathology

TheTR Rovira Rhizosphere R Symposium S 47 Cropping systems and plant health Th e frequent occurrence of root disease complexes involving multiple diseases and pathogen species Climate, enterprise profi tability and resources such underscores the need for crop management prac- as soil, water, equipment and fi nancial credit are tices that focus on holistic root health rather than major determinants of the complexity of enterprises a disease that is dominant at any particular time. on each farm. While rotation of three or more Th is has been a lifelong objective of programs led crop species in long rotations is a basic tenet for and infl uenced by scientists such as Albert Rovira producing healthy crops globally, profi tability and in South Australia and R. James (Jim) Cook in the resources oft en restrict the use of eff ective rotations PNW (Cook and Veseth 1991). Discussions of in- to areas having adequate precipitation or suffi cient dividual diseases in this paper are limited to PNW water for supplemental irrigation. In dryland farm- research that was strongly infl uenced by studies of ing regions receiving low annual precipitation, Albert and his colleagues at CSIRO, SARDI and combinations of fragile soil, profi tability of limited the University of Adelaide. Th e focus is on take-all, crop species, range in temperature, and or poor Rhizoctonia root rot and cereal cyst nematode but temporal distribution of precipitation oft en limit includes research on Pythium root rot, Fusarium crop diversity. In low-rainfall regions of the PNW crown rot and root-lesion nematode. Reviews by –1 (150–300 mm y ) the two-year monoculture of Smiley et al. (2009) and Smiley and Nicol (2009) wheat and long fallow continues to be most profi t- and additional PNW-oriented references in the text able and to have least variability in season-to-season provide entry points for examining these topics in grain yield and economic risk, albeit at the expense greater detail. of declining soil quality. Th e area of chemical fallow has increased but remains less than cultivated fallow because direct-drill systems are oft en less profi table Root diseases than cultivated systems, even though they reduce Take-all requirements for labor, fuel, machinery and tractor horsepower, and retain greater amounts of water in Most irrigated wheat in the PNW does not experi- the soil profi le (Machadoet al. 2007; Schillinger et ence economically important damage from take-all al. 2007; Bewick et al. 2008). due to the low frequency of wheat in these high- value cropping systems. However, high wheat prices More intensive systems have been introduced cause some farmers to plant wheat frequently or to PNW regions with annual precipitation of repeatedly, occasionally leading to destruction of 300–450 mm but most farming systems continue the crop by take-all. But, as in Australia, take-all is as functional cereal monoculture because other also widespread and causes chronic damage in even crops are signifi cantly less profi table and oft en also the lowest-rainfall regions of the PNW (Paulitz et reduce the yield of the following wheat crop, either al. 2002; Cook 2003). ‘Dryland take-all’, as named by extracting too much stored water or by increas- by C.A. ‘Lex’ Parker in Western Australia, occurs ing the population of pathogens or parasites with where environmental conditions favor infection broad host ranges, such as root-lesion nematodes. of roots that contact soilborne inoculum (primary True rotations using multiple crop species occur infection cycle) but are unfavourable for subsequent only in areas of highest rainfall (450–600 mm y–1), where profi table crops include barley, food legumes root-to-root and up-the-stem spread (secondary and oilseed crops. Summer crops are generally not infection cycle) that occurs in higher-moisture profi table for broadacre PNW farms because night environments. temperatures are too low and in deep soils the sum- Take-all in the PNW has either been unaff ected mer crops deplete stored water otherwise available by tillage intensity or more prevalent in direct-drill for a subsequent wheat crop. Long rotations gener- than cultivated systems (Schroeder and Paulitz ally improve yields of all crops in higher-rainfall 2006). Damage to roots is reduced when starter districts, but cereal crops are generally most prof- itable and dominate the rotational sequence. In fertiliser is banded directly below the seed, regard- all rainfall districts, practices for managing root less of the application procedure or timing for the diseases must be compatible with and complement remainder of the fertiliser requirement. Take-all practices for achieving maximum agronomic yield decline with wheat monoculture occurs in PNW and for managing weeds, insect pests and foliar dis- regions that receive supplemental irrigation or –1 eases (Ogg et al. 1999). more than 550 mm y of precipitation (Weller et

TheTR Rovira Rhizosphere R Symposium S 48 al. 2007), but not in soils that have a combination and R. oryzae (Smiley et al. 2009). Th e dominant of low microbial activity due to low organic matter pathogen is AG 8 in low-rainfall regions where the content (<1.5%), very dry surface horizons during bare patch symptom is commonly expressed, and warm weather, and very low temperatures when AG 2-1 in higher-precipitation regions where chron- the soil is moist. Predictive models developed and ic root debilitation occurs without expression of used in Australia (by David Roget, Herdina, Kathy the bare-patch symptom. Rhizoctonia oryzae causes Ophel-Keller and Alan McKay at CSIRO and a cortical rot similar to AG 8 but seldom severs the SARDI) and in Europe (by Alexandra Schoeny and root axis to cause the ‘spear-tip’ symptom common- Philippe Lucas at INRA, Le Rheu, France) have not ly associated with AG 8. Damping-off is a symptom yet been adapted to the PNW. caused by R. oryzae but generally not by R. solani AG 8. Barley is much more susceptible than wheat, Th e most intensive and sustained take-all re- particularly in direct-drill cropping systems. search in the PNW has focused on antagonists of Gaeumannomyces graminis var. tritici (Cook 2003; An observation fi rst made by Albert Rovira and Weller et al. 2007). Th e role of antagonistic fl uo- David Roget, among others, was transferred to the rescent Pseudomonas species has been revealed in PNW and aft er further study was developed into great depth over the past 40 years, aft er fi rst being what is now the most infl uential and cost-eff ective detected during the 1970s by scientists in Albert strategy for managing Rhizoctonia root rot. In the Rovira’s CSIRO laboratory. Th at work, to which I PNW the principle is known as ‘managing the once contributed (Smiley and Cook 1973; Smiley green bridge’. Rhizoctonia root rot is especially 1978a,b, 1979), set the stage for exhaustive global pronounced when fi elds are planted shortly aft er attempts to manage these antagonists as bio-control a herbicide is applied to kill volunteer cereals and agents. In addition to the CSIRO lab formerly di- or weeds infected by Rhizoctonia. Th is commonly rected by Albert, a focal point for this management occurs when sowing spring cereals during a narrow approach has been the USDA Biological Control window between rain events in early spring, where and Root Disease Research Lab at Pullman, roots of newly emerging seedlings are particularly Washington. Th at lab was developed and formerly vulnerable to infection by the enhanced level of directed by Jim Cook. More than 22 genotypes of Rhizoctonia inoculum that develops when natural 2,4-diacetylphloroglucinol (2,4-DAPG)-producing defense mechanisms become impaired as weeds Pseudomonas fl uorescens are now recognised as and volunteers die from the pre-plant herbicide having an important impact on root health and application. Th e dying plants serve as highly eff ec- particularly in protecting roots against infection by tive bridging hosts to greatly amplify the amount the pathogen. Competitive interactions between of damage to emerging seedlings unless the time the pathogen and specifi c 2,4-DAPG genotypes in between herbicide application and planting is ex- the rhizosphere are well defi ned (Welleret al. 2007) tended to an interval exceeding two weeks. Fields and emphasis has been placed on managing native maintained without living hosts through the entire populations of these antagonistic microbes in soil winter can produce yields of spring cereals twice (Cook 2006, 2007), using tools such as managing those in fi elds where the volunteer and or weed rotations, soil reaction and the dominant molecular hosts were sprayed only a few days before sowing. form of nitrogen absorbed by roots. Th e same principle occurs in winter wheat–fallow rotations planted to ‘Clearfi eld’ wheat cultivars that Rhizoctonia root rot are tolerant to the herbicide imazomox. Th ese cultivars provide important opportunities to eliminate In the PNW the acute stage (bare patch) of winter-annual weed species by over-spraying the Rhizoctonia root rot is observed less commonly winter wheat crop with imazomox. Th ere have been than the chronic stage in which roots are severed notable instances in which Rhizoctonia damage on plants that are individually stunted within the became greater on winter wheat seedlings follow- drill row, without evidence of a clustering of stunted ing application of imazomox to eliminate downy plants characteristic of the bare-patch symptom brome or goatgrass, but it remains unclear as to (Paulitz et al. 2002). Th e most important pathogens whether this was a direct response to a weakened associated with Rhizoctonia diseases of rainfed cere- natural defense in wheat roots or to a greater level of als in the PNW include R. solani AG 8 and AG 2-1, inoculum as the Rhizoctonia transferred from dying

TheTR Rovira Rhizosphere R Symposium S 49 weed grasses to adjacent wheat seedlings. A similar parasitic nematode. H. avenae was discovered in the eff ect is likely if or when glyphosate-resistant wheat PNW only recently. Important crop losses occur in or barley cultivars become registered for release into only a few areas because long fallow is a dominant commercial agriculture. production practice and highly infested soils occur mostly in areas where crop rotations are possible. Eff ects of crop rotation have been variable because Also, the more fertile and deeper soils of the region the most virulent of these Rhizoctonia species promote more robust plants than most soils used for have broad host ranges including wheat, barley, broadacre crops in Australia. Greatest damage oc- fi eld pea, canola, mustard and others (Paulitz et al. curs when farmers in highly infested areas attempt 2002; Schillinger et al. 2007; Smiley et al. 2009). to achieve maximum farm profi tability by main- As fi rst reported in Australia, seedling health in taining a high frequency of wheat in the cropping Rhizoctonia-infested soil in the PNW is improved system. by tilling soil shortly before planting, using drill openers that vigorously stir soil in the seed row, Th e SIRONEM bioassay developed by Albert and banding starter fertiliser below the seed. A Rovira and Andrew Simon became superseded microbial-based disease decline phenomenon by DNA-based assays such as those used by the was demonstrated by David Roget in the Avon C-Qentec/SARDI Root Disease Testing Service. Experiment in South Australia and by our group Comparable diagnostic procedures are being devel- in the PNW. An initiative toward controlling oped in the PNW and these eff orts quickly revealed Rhizoctonia root rot through biological means be- the fi rst-known occurrence of H. fi lipjevi in North came short-lived in response to the untimely death America (Smiley et al. 2008). Th e impact of this ad- of Dr Andrew Simon as he expanded his studies ditional complexity on wheat production practices of antagonistic Trichoderma species at Pullman, has not yet been investigated. Washington. Heterodera avenae populations tested thus far in Th e most promising strategy for managing Oregon are unable to eff ectively multiply in wheat Rhizoctonia root rot in the PNW currently re- lines carrying the Cre1 resistance gene and in barley sides in further development of a wheat selection lines carrying the Rha2 and Rha3 resistance genes. that exhibits resistance to both R. solani AG-8 Th e Cre1 gene was recently transferred from the and R. oryzae. Th is non-GMO resistant wheat Australian cultivar Ouyen into PNW-adapted cul- was selected by Washington State University and tivars. A non-proprietary molecular marker is being USDA-Agricultural Research Service scientists. developed to improve the effi ciency of these breed- Doubled haploid populations were generated to ing objectives. develop a molecular marker for tracking the single co-dominant resistance gene in breeding programs. Th e contributions of Albert Rovira and his many Th is prospective breakthrough was coupled with a colleagues invariably fostered expansion of research public-domain real-time PCR procedure (Okubara eff orts to include diseases that were either less et al. 2008) now being used to improve under- known or of lower priority early in Albert’s career. standings of pathogen diversity and geographic Th ese diseases are now considered to be important distribution, and to promote an accelerated rate of constraints to wheat and barley health in each coun- adoption for molecular technologies in commercial try and are included in this recognition of Albert’s testing services, following services already avail- accomplishments and global infl uence. able through the C-Qentec/SARDI Root Disease Testing Service in Adelaide. Root-lesion nematode Pratylenchus neglectus and P. thornei have been Cereal cyst nematode detected in 90% of PNW fi elds and potentially Farmers and scientists in South Australia and damaging populations occur in 60% of the fi elds. Victoria have a long history with the cereal cyst Procedures and Australian wheat cultivars de- nematode, Heterodera avenae. An extensive knowl- scribed by Sharyn Taylor and Vivien Vanstone at edge base and the resulting deployment of resistance SARDI and the University of Adelaide were used genes and crop rotations have greatly diminished to demonstrate that P. neglectus and P. thornei each the amount of damage once caused by this plant- reduce wheat yields in the PNW without caus-

TheTR Rovira Rhizosphere R Symposium S 50 ing specifi c or diagnostic symptoms (Smiley and ment practice in direct-drill systems is to equip the Machado 2009; Smiley and Nicol 2009; also see the harvest combine with a straw and chaff spreader to author’s website). Winter and spring wheat yields prevent development of rows of Pythium-incited are frequently correlated inversely with numbers depressed growth where chaff rows have been left of root-lesion nematodes in soil. High populations when harvesting the preceding crop. Extensive dam- occur at depths of up to 90 cm in the soil profi le. age occurs without visibly apparent symptoms other Barley and saffl ower suppress the population density than a non-diagnostic lack of vigor and reduced and canola, mustard, chickpea and wheat produce tillering, which are most pronounced in portions of high Pratylenchus populations, as was previously fi elds with the greatest amounts of crop residue. shown throughout Australia. Procedures of John Th ompson (QDPI, Toowoomba) were used to Pythium-infected root segments are oft en lost when defi ne tolerance and resistance characteristics for roots are washed for inspection, making it diffi cult wheat and barley in the PNW (Sheedy et al. and to detect these pathogens. Th e most virulent spe- Th ompson et al. in Plant Disease Management cies in the PNW are P. ultimum and P. irregulare Reports volumes 1–3, at http://www. groups I and IV. A real-time PCR procedure was plantmanagementnetwork.org/pub/trial/pdmr/). A developed to detect and quantify these species wide range of tolerance levels were detected among (Schroeder et al. 2006). Crop rotation is not use- spring wheat and barley cultivars, and tolerance to ful for controlling Pythium diseases but inoculum one Pratylenchus species was not always indicative levels of some but not all species decline during of tolerance to both species (Smiley 2009). Th is spe- the host-free interval of the wheat-fallow rotation. cies-specifi c tolerance for individual wheat cultivars Partially eff ective management strategies include is problematic because most commercial nematode planting when soil temperature and moisture are diagnostic laboratories in the PNW will not dif- optimal for rapid seedling emergence and estab- ferentiate these Pratylenchus species, undermining lishment, treating seed with an oomycete-specifi c the utility of published cultivar recommendations fungicide, using only recently harvested seed to specifi c to the Pratylenchus species occurring in ensure rapid germination, and controlling the green individual fi elds. We therefore developed a robust bridge as discussed for Rhizoctonia root rot. PCR procedure to distinguish these species (Yan et Fusarium crown rot al. 2008) and are currently transforming the procedure into a non-proprietary real-time PCR format. Th is disease is very widespread and in the PNW Also, since no current wheat cultivars adapted to becomes particularly acute on winter wheat planted the PNW exhibit a signifi cant level of genetic re- into cultivated seedbeds before the autumn break, sistance, crosses were made to improve the level of and on spring wheat and barley planted into high- resistance in locally-adapted cultivars. Gene donors residue seedbeds (Paulitz et al. 2002). All of the included Virest for P. neglectus, GS50A and OS55 early work in the PNW was led by Jim Cook, in for P. thornei, and AUS28451R, CPI133872 and collaboration with other scientists and farmers. Persia 20 for both species. Mapping populations Jim Cook initiated his research soon aft er train- are being used to develop molecular markers for the ing with noted Fusarium experts at the University sources of dual-species resistance. All of this work of California at Berkeley and at the University of was based upon pioneering investigations and re- Adelaide, Waite Campus. Th e most important crown rot pathogens in the PNW are Fusarium cul- sources developed in Australia and at CIMMYT. morum and F. pseudograminearum. Because disease Pythium diseases incidence is strongly correlated with the quantity of infested residue, practices that enhance soil con- Pythium damping-off and root rot are caused by a servation have led to increasing levels of economic complex of 13 species in the PNW (Paulitz et al. damage from crown rot. Readily identifi able surface 2002; Schroeder and Paulitz 2006; Smiley et al. residues of previous crops remain for as long as three 2009). Th ese diseases occur most frequently in cool years in PNW environments that are mostly too dry wet soils in areas of higher precipitation but are for decomposition during warm weather and too also important and occasionally severe even in the cold when soil is moist. Th ese features prolong in- driest production areas. Although populations of oculum viability and lead to greater disease severity the pathogens are equal in tilled and direct-drill in direct-drill than cultivated systems. farming systems, a particularly important manage- Th e most eff ective management strategy developed

TheTR Rovira Rhizosphere R Symposium S 51 thus far in the PNW is to delay planting winter Summary wheat until the seed-zone temperature falls below 10°C, which is compatible with direct-drill systems Th is paper is a tribute Albert Rovira’s many contri- but not cultivated fallows that have early sowing butions to agriculture and to science. His research dates as the underlying principal for achieving and his close interaction with practicing farmers optimal agronomic yield potential. Seed-zone tem- and advisors have created many new understand- perature (10-cm depth or greater) can exceed 25°C ings of the dynamics of root diseases that limit when wheat is planted early into cultivated fallow productivity of small-grain cereals, especially in using moisture-seeking drills. conservation farming systems. Albert’s infl uence has been important throughout the world. Th is Nitrogen management also has a strong impact paper summarises selected Pacifi c Northwest USA on crown rot incidence and severity, particularly research on diseases examined by him, including in low-rainfall environments where plants mature take-all, Rhizoctonia root rot (bare patch), cereal without the benefi t of late-season rainfall and where cyst nematode, root-lesion nematode, Pythium the least expensive fertiliser application strategy diseases and Fusarium crown rot. In accordance is to inject the entire seasonal fertiliser require- with his current global eff ort, through the ATSE ment into soil before the crop is planted and before Crawford Fund, connections were made to exem- the amount of seasonal precipitation is known. Reducing the stimulation of seedling growth and plify the cross complementation and validation that consequential acceleration of moisture depletion has occurred for knowledge fi rst gained either in by applying only a portion of the fertiliser before or Australia or in North America. at planting, and the remainder at some later date, References can be used to reduce crown rot severity but this practice may also reduce wheat yield more than the Bewick, L.S., Young, F.L., Alldredge, J.R. and crown rot because it leads to greater late-season Young, D.L. 2008. Agronomics and eco- moisture competition by winter-annual grass weeds. nomics of no-till facultative wheat in the Wheat cultivars produced for high-protein end uses, Paciﬁ c Northwest, USA. Crop Protection 27, such as bread wheat and durum, are particularly 932–942. susceptible to damage by crown rot because they require a greater amount of applied nitrogen than Cook, R.J. 2003. Take-all of wheat. Physiological and cultivars produced for low-protein (<10%) end uses. Molecular Plant Pathology 62, 73–86. Where both market classes are produced, as in the Cook, R.J. 2006. Toward cropping systems that PNW, growers who apply fertiliser to meet the enhance productivity and sustainability. protein requirements for high-protein wheat almost Proceedings of the National Academy of always have greater losses from crown rot. Sciences 103, 18389–18394.

Cultivars span the range from susceptible to mod- Cook, R.J. 2007. Management of resident plant erately tolerant, as was fi rst defi ned by Graham growth-promoting rhizobacteria with the Wildermuth and colleagues at QDPI, Toowoomba. cropping system: a review of experience in Cultivars with varying levels of tolerance perform, the US Paciﬁ c Northwest. European Journal on average, equally against F. pseudograminearum of Plant Pathology 119, 255–264. in the PNW as in Queensland. However, responses of cultivars are variable over seasons and geographic Cook, R.J. and Veseth, R.J. 1991. Wheat Health areas, making it diffi cult to publish consistently Management. APS Press, St Paul, Minnesota, reliable sowing recommendations (Smiley and Yan 152 pp. 2009). Lines from the CIMMYT Root Disease Resistance Nursery coordinated by Julie Nicol Freebairn, D.M., Cornish, P.S., Anderson, W.K., (Ankara, Turkey), are being evaluated in an attempt Walker, S.R., Robinson, J.B. and Beswick, to identify germplasm with improved crown rot A.R. 2006. Management systems in climate regions of the World—Australia. In: resistance. Crosses between the Australian wheats Peterson, G.A., Unger, P.W. and Payne, 2-49 and Sunco and several PNW-adapted cultivars W.A. (eds) Dryland Agriculture. 2nd edn. have been made in an attempt to improve resistance Agronomy Monograph No. 23, American and especially the stability of that trait over seasons Society of Agronomy, Madison, Wisconsin, and geographic regions. pp. 837–878.

TheTR Rovira Rhizosphere R Symposium S 52 Howden, P., Vanclay, F., Lemerle, D. and Kent, from conventional tillage to direct seeding. J. 1998. Working with the grain: farming Plant Disease 90, 1247–1253. styles amongst Australian broadacre crop- pers. Rural Society 8, 109–125. Schroeder, K.L., Okubara, P.A., Tambong, J.T., Lévesque, C.A. and Paulitz, T.C. 2006. Machado, S., Petrie, S., Rhinhart, K. and Qu, A. Identifi cation and quantifi cation of 2007. Long-term continuous cropping in pathogenic Pythium spp. from soils in the Pacifi c Northwest: tillage and fertilizer eastern Washington using real-time PCR. eff ects on winter wheat, spring wheat, and Phytopathology 96, 637–647. spring barley production. Soil and Tillage Research 94, 473–481. Smiley, R.W. 1978a. Antagonists of Gaeumannomyces graminis from the rhizoplane of wheat in Ogg, A.G. Jr., Smiley, R.W., Pike, K.S., McCaff rey, soils fertilized with ammonium- or nitrate- J.P., Th ill, D.C. and Quisenberry, S.S. 1999. nitrogen. Soil Biology and Biochemistry 10, Integrated pest management for conservation 169–174. systems. In: Michalson, E.L., Papendick, R.I. and Carlson, J.E. (eds) Conservation Smiley, R.W. 1978b. Colonization of wheat roots Farming in the United States. CRC Press, by Gaeumannomyces graminis inhibited by Boca Raton, Florida, pp. 97–123. specifi c soils, microorganisms and ammonium-nitrogen. Soil Biology and Biochemistry Okubara, P.A., Schroeder, K.L. and Paulitz, T.C. 10, 175–179. 2008. Identifi cation and quantifi cation of Rhizoctonia solani and R. oryzae us- Smiley, R.W. 1979. Wheat rhizosphere pH and the ing real-time polymerase chain reaction. biological control of take-all. In: Harley, Phytopathology 98, 837–847. J.L. and Scott Russell, R. (eds) Th e Soil- Root Interface. Academic Press, London, pp. Pannell, D.J., Marshall, G.R., Barr, N., Curtis, 329–338. A., Vanclay, F. and Wilkinson, R. 2006. Understanding and promoting adoption of Smiley, R.W. 2009. Root-lesion nematodes re- conservation practices by rural landhold- duce yield of intolerant wheat and barley. ers. Australian Journal of Experimental Agronomy Journal 101, 1322–1335. Agriculture 46, 1407–1424. Smiley, R.W. and Cook, R.J. 1973. Relationship be- Paulitz, T.C., Smiley, R.W. and Cook, R.J. 2002. tween take-all of wheat and rhizosphere pH Insights into the prevalence and manage- in soils fertilized with ammonium vs. ni- ment of soilborne cereal pathogens under trate-nitrogen. Phytopathology 63, 882–890. direct seeding in the Pacifi c Northwest, Smiley, R.W. and Machado, S. 2009. Pratylenchus USA. Canadian Journal of Plant Pathology neglectus reduces yield of winter wheat in 24, 416–428. dryland cropping systems. Plant Disease 93, Schillinger, W.F., Papendick, R.I., Guy, S.O., 263–271. Rasmussen, P.E. and Van Kessel, C. 2006. Smiley, R.W. and Nicol, J.M. 2009. Nematodes Dryland cropping in the western United which challenge global wheat production. In: States. In: Peterson, G.A., Unger, P.W. and Carver, B.F. (ed.) Wheat Science and Trade. Payne, W.A. (eds) Dryland Agriculture. Wiley-Blackwell Publishing, Ames, Iowa, 2nd edn. Agronomy Monograph No. 23, pp. 171–187. American Society of Agronomy, Madison, Wisconsin, pp. 365–393. Smiley, R.W. and Yan, H. 2009. Variability of Fusarium crown rot tolerances among Schillinger, W.F., Kennedy, A.C. and Young, D.L. cultivars of spring and winter wheat. Plant 2007. Eight years of annual no-till cropping Disease 93, 954–961. in Washington’s winter wheat – summer fallow region. Agriculture Ecosystems & Smiley, R.W., Yan, G.P. and Handoo, Z.A. 2008. Environment 120, 345–358. First record of the cyst nematode Heterodera fi l i p j e v i on wheat in Oregon. Plant Disease Schroeder, K.L. and Paulitz, T.C. 2006. Root diseas- 92, 1136. es of wheat and barley during the transition

TheTR Rovira Rhizosphere R Symposium S 53 Smiley, R.W., Backhouse, D., Lucas, P. and Paulitz, Yan, G.P., Smiley, R.W., Okubara, P.A., Skantar, A., T.C. 2009. Diseases which challenge global Easley, S.A., Sheedy, J.G. and Th ompson, wheat production — root, crown and culm A.L. 2008. Detection and discrimination rots. In: Carver, B.F. (ed.) Wheat Science and of Pratylenchus neglectus and P. thornei in Trade. Wiley-Blackwell Publishing, Ames, DNA extracts from soil. Plant Disease 92, Iowa, pp. 125–153. 1480–1487.

Weller, D.M., Landa, B.B., Mavrodi, O.V., Schroeder, K.L., De La Fuente, L., Blouin Bankhead, S., Allende Molar, R., Bonsall, R.F., Mavrodi, D.V. and Th omashow, L.S. 2007. Role of 2,4-diacetylphloroglucinol- producing ﬂ uorescent Pseudomonas spp. in the defense of plant roots. Plant Biology 9, 4–20.

TheTR Rovira Rhizosphere R Symposium S 54 Rhizoctonia on the Upper Eyre Peninsula, South Australia

N.S. Wilhelm1

Abstract 250 mm Th e upper Eyre Peninsula (EP) is a large agri- Ceduna cultural region of South Australia dominated Gawler Ranges 350 mm by fragile, infertile, calcareous and sandy Minnipa Whyalla soils. Th e rainfall is low and falls mostly dur- Eyre Peninsula ing the autumn to spring months, typical of Mediterranean climates. Th e farming systems Eyre Peninsula are dominated by wheat and barley crops rotat- Port Lincoln ed with volunteer pastures consisting of annual Medicago and grass species. Th e pastures are grazed by sheep in low-input management strategies. Rhizoctonia is an endemic problem and appears to fl ourish in the major environments of this region. While some management strategies can reduce its impact, it is still largely an in- tractable problem infl uencing crop productivity, nutrient use effi ciency and economic returns. Th e discovery of biological suppression antagonistic against rhizoctonia disease incidence off ers the prospect of removing rhizoctonia as a major production constraint on the upper EP.

Figure 1. Th e Eyre Peninsula of South Australia and The upper Eyre Peninsula annual rainfall isohyets in the state (adapted from Th is agricultural region of South Australia pro- Anon. 2002) duces about one-third of the state’s wheat crop (1 MT y–1) and is an area dominated by calcareous, infertile, shallow and sandy soils. Th e region has a Mediterranean climate with about 70% of the annual rainfall falling between the months of April and October, or the autumn to spring period. Th is 1 South Australian Research and Development is the growing season for the farming systems in this Institute region, with the summer being hot and dry (Rovira GPO Box 397, Adelaide, South Australia 5001 1992). Annual rainfall is low and highly variable, Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 55 with the agricultural zone in this region being defi ned by the 250 mm and 350 mm average annual rainfall isohyets (see Fig. 1).

Nearly all of the farming systems in this region employ a rotation of cereal crops with annual volunteer pastures.

Th e most frequent combination is two cereal crops (wheat–wheat or wheat–barley) followed by one volunteer pasture of a mix of annual grasses and medic (annual Medicago spp.) (Anon. 2002). Sheep in these extensive and low-input management systems are used to graze the annual pastures and cereal stubbles. Long fallows (more than 4 months) are rarely practised on upper EP due to the susceptibility of the sandy soils to wind erosion over the dry months of summer and early autumn. Most crops are established using no-till because this is the most rapid and fl exible system for seeding large areas of crop and also maximises the protection of the soil surface from wind erosion (Anon. 2002).

Most of these farms consist of 1500 to 3000 ar- Figure 2. Soil profi le of a highly calcareous sandy able hectares that are managed with a low-input, loam soil in the upper Eyre Peninsula low-cost strategy due to the variable climate and generally low productivity on the shallow and in- and sodium are the only essential elements in abun- fertile soils. Long-term average wheat yields for the dant supply in most upper EP soils. Nitrogen can region are about 1.5 t ha–1. Annual stocking rates for occasionally occur at abundant levels but only aft er sheep are oft en only 2–3 dry sheep equivalents per a vigorous medic-based pasture. However, these oc- hectare (Anon. 2002). cur only sporadically and only following average to All soil types under agricultural production on up- wet growing seasons (Anon. 2002). per EP are very old by world standards and hence are Break crops for cereals such as canola (Brassica highly weathered and leached. Th is has resulted in napus) or fi eld peas (Pisum sativum) are considered widespread and severe infertility in the surface lay- to be too unreliable and drought sensitive to be ers of these soils. Many of the essential elements for regularly used in rotations on the upper EP and are normal plant growth are in defi cient supply in most found only on the wetter fringe of the region, and of the upper EP soils, either due to low inherent even then only in limited areas (at most 10% of the levels in the soil matrix, or due to poor availability cropped area). Th e medic-based pastures are the from the high pH present in most of these soils, or only widespread breaks for cereal pests and diseases, a combination of both factors. Defi ciencies of phos- but as these pastures frequently have a substantial phorus, nitrogen and zinc are widespread in crops grass component their value as a cleaning phase for and pastures while defi ciencies of manganese and these problems is diminished. copper can be severe but oft en more localised in extent (Reuter 2007). In some of the highly calcareous sandy loams of the upper EP (see Fig. 2), phosphorus Rhizoctonia (bare patch) defi ciency has been endemic, despite the use of gran- on upper EP ulated high-analysis phosphorus fertilisers. Only fl uid phosphorus fertilisers appear to fully correct In this large and important agricultural region for phosphorus defi ciency in these soils and they are not South Australia, Rhizoctonia solani anastomosis widely used on the upper EP due to their high cost group 8 (AG8) causes widespread and frequent (Holloway et al. 2001). Sulphur, potassium, boron damage in all phases of the rotations (Neate and Warcup 1985; Neate 1987).

TheTR Rovira Rhizosphere R Symposium S 56 (MacNish and Neate 1996). Th ese disease patches oft en re-occur in the same spots but details of the chemical and biological characteristics specifi c to these sites, e.g. pathogen inoculum levels, are not fully understood. Patches will be more severe and frequent in barley than in wheat under the same circumstances (Neate 1989).

Th e disease is generally more severe during the seedling phase of crops and pastures. Th e severity of the characteristic patches frequently fades as the season progresses into spring; it is unclear why Figure 3. Rhizoctonia disease patches in a South Australian the disease appears to be worse early in barley crop plant development. Rhizoctonia is so widespread across the upper EP that patchy and uneven crops are the norm in many districts (see Fig. 4). Th e combination of alkaline, sandy, infertile soil types, relatively dry mild starts to each growing season and grass- dominated rotations appears to be very conducive to the development of the disease because grasses in pastures serve as the source of pathogen inoculum in the following crop. It is estimated that as much as $65 million is lost each year through the eff ect of rhizoctonia in the upper EP (N. Cordon, Primary Industries and Resources of South Figure 4. Severe rhizoctonia disease symptoms in an upper EP Australia (PIRSA), pers. comm. 2007), cereal crop growing on a highly calcareous grey soil although estimates of economic damage across southern Australia vary widely (Brennan and Murray 1998; Jones Rhizoctonia solani is a soil-borne fungus whose 2007). primary niche in soil ecosystems appears to be as a saprophyte. However, conditions in agricultural Th e conditions that appear to be conducive to the systems occasionally occur that appear to be condu- development of the disease in agricultural systems cive to R. solani acting as a pathogen. Under such appear to be very complex and dynamic because conditions, the fungus invades the cortex of roots of many attempts to identify the pre-disposing factors a wide range of host plants, causing localised lesions have been made and, while some factors have been and eventually killing the root. In situations where identifi ed, none have proven to universally explain the disease incidence is severe the root system of the the epidemiology of the disease. host plant can be decimated, leading to poor shoot growth. Cook et al. (2008) undertook a comprehensive survey on the upper EP specifi cally targeting pad- Severe stunting in crop and pasture plants appears docks which farmers rated as either very bad for only in discrete and very clearly defi ned irregular- rhizoctonia or where rhizoctonia was rarely a prob- shaped patches (see Fig. 3). However, the pathogen lem. Detailed analysis of management history and (and the symptoms of the disease it causes—brown practices followed failed to clearly identify any fac- or absent cortices and ‘spear tips’ on root ends) tor, environment or agricultural practice that was can still be found outside these distinct patches consistently associated with disease severity.

TheTR Rovira Rhizosphere R Symposium S 57 No chemical treatments have yet been found that Table 1. Factors that have been identifi ed to are both benefi cial and cost-eff ective against rhizoc- infl uence the incidence of rhizoctonia disease under tonia for upper EP farming systems (Cordon 2008). fi eld conditions. Th is information is based on multi- Where soils are suffi ciently free of limestone rocks, year observations in fi eld experiments and farmer most farmers will use deep working points (about paddocks. 5–10 cm below the seed bed) at seeding to cultivate the soil below the seed row. Th is will reduce Factors that make rhizoctonia worse rhizoctonia but not eliminate it (Gill et al. 2002). • Dry, warm start to the cropping season Originally, it was thought that this practice physi- • Low fertility, particularly for phosphorus, cally disrupted the mycelia of R. solani and thus its nitrogen and zinc infective potential (Roget et al. 1996) but it is now • Barley grown rather than wheat believed that its most important benefi t is to foster • Cereals grown rather than peas or canola rapid root growth in the host plant and allow those • Use of sulfonylurea herbicides either with the roots to ‘escape’ the inoculum-rich upper layers crop or in prior years of the soil profi le as quickly as possible (Gillet al. • Seeding systems that do not cultivate below the seed bed 2001). Factors that reduce the severity of rhizoctonia Many farmers on the upper EP will report that the • Late or wet start to the cropping season factors listed in Table 1 can infl uence the disease. • Adequate or luxury phosphorus and zinc nutrition. High levels of nitrogen fertility or Although the nomination of many of these factors fertiliser applications can help crops ‘grow is supported by individual research fi ndings, they do away’ from the disease. not appear to be universal in their eff ects. • Preceding the cereal crop with either a fallow or canola Despite this long list of do’s and don’ts for managing • Seeding systems that cultivate below the seed rhizoctonia, the severity and extent of the disease bed or cultivating prior to seeding does not seem to be declining except where some • Ensuring any weeds are killed at least three weeks prior to seeding farm managers have implemented a continuous • Continuous cropping (rather than a ley sys- cropping enterprise for at least 5–10 years previ- tem of cereal crop – pasture combinations) ously. Some of these managers report substantial declines in the severity and frequency of rhizoctonia in their crops. Others, however, with apparently similar systems in similar environments do not report such trends. retention and low levels of mineral nitrogen in the soil seemed to be two key factors with this change in However, the discovery of suppression in a similar the soil microfl ora. environment at Avon, in the lower north of South Australia, has introduced a possible solution because One of the early questions which fl owed from this it occurred over a range of management systems and discovery was whether this could be made to work rotations (Wiseman et al. 1996). on the upper EP. Disease suppression active against rhizoctonia has since been identifi ed in a range of Disease suppression against cropping environments across southern Australia, including the upper EP (Roget et al. 1999; Cook et rhizoctonia on the upper EP al. 2008; Gupta et al. 2009). While the general level Roget (1995) demonstrated that incidences of of suppression expressed in upper EP soils appears rhizoctonia disease had disappeared from a long- to be lower than at Avon, there are examples of very term rotation trial on a calcareous sandy loam soil in strong suppression in some situations. a low-rainfall environment. Research by Wiseman We are still not sure how to manipulate systems et al. (1996) and Roget et al. (1999) showed that to improve the level of suppression expressed, es- this suppression was due to a change in the composi- pecially in the low-productivity environments of tion and activity of microbial fl ora and the presence the upper EP. Roget and Gupta (2006) reported of populations antagonistic to the development of that the expression of disease suppression can be rhizoctonia disease (Barnett et al. 2006). Stubble modifi ed by changes in the C and N turnover, par-

TheTR Rovira Rhizosphere R Symposium S 58 ticularly over summer and autumn—for example, a Brennan, J.P. and Murray, G.M. (1998) Economic narrow C:N ratio could switch off the suppression. importance of wheat diseases in Australia. However, other aspects about the management of GRDC report, NSW Agriculture, Wagga suppression are still not clear, except that it appears Wagga, Australia. that the suppressive microfl ora are oft en limited Cook, A., Wilhelm, N.S. and Dyson, C. (2008) by the availability of simple carbon substrates (e.g. Survey of soil-borne disease suppression carbohydrates) in the low-rainfall cropping environ- to Rhizoctonia solani in low rainfall farm- ments in SA. ing systems on upper Eyre Peninsula, South Australia. Proceedings 14th Agronomy Future prospects Conference. 8 September 2008, Adelaide, South Australia. Poster paper. Suppression does not appear to operate strongly on the highly calcareous grey sandy loams of the up- Cordon, N. (2008) EP dividend research: Eyre per EP. Th is is an environment where rhizoctonia Peninsula farming systems 2007. Summary. is widespread, most severe and most frequent. It is PIRSA Publishing Service, Adelaide, pp. also an environment where productivity is very low 127–129. (and hence carbohydrate supply for soil microfl ora is Gill, J.S., Sivasithamparam, K. and Smettem, K.R.J. poor), soils are oft en dry and highly aerated (due to (2001) Infl uence of depth of soil disturbance their very high infi ltration rates and the low rainfall on root growth dynamics of wheat seedlings in the area) and where phosphorus defi ciency is se- associated with Rhizoctonia solani Ag-8 dis- vere, widespread and frequent. Crops grown on this ease severity in sandy and loamy sand soils of soil type are almost always phosphorus defi cient, Western Australia. Soil and Tillage Research regardless of the phosphorus fertiliser regime (un- 62, 73. less it involves fl uid phosphorus) (Holloway et al. 2001). Gill, J.S., Sivasithamparam, K. and Smettem, K.R.J. (2002) Size of bare-patches in wheat caused Phosphorus defi ciency weakens defence pathways in by Rhizoctonia solani AG-8 is determined by plants and reduces productivity. Reduced productiv- the established mycelial network at sowing. ity reduces food supply to soil microfl ora, including Soil Biology and Biochemistry 34, 889–893. suppressive communities. Unfortunately a potential Gupta, V.V.S.R., Roget, D.K., Coppi, J.C. and pathogen with strong saprophytic capabilities can Kroker, S.K. (2009) Soil type and rotation compete particularly well in such an impoverished eff ects on the suppression of rhizoctonia bare environment. patch disease in wheat. In: Fifth Australasian Soilborne Disease Symposium. Extended ab- Could phosphorus nutrition management be the stracts. Th redbo, NSW, pp. 85–87. key to fostering suppression on the upper EP and unlocking the solution to rhizoctonia as an intrac- Holloway, R.E., Bertrand, I., Frischke, A.J., Brace, table problem? D.M., McLaughlin, M.J. and Shepperd, W. (2001) Improving fertiliser effi ciency on calcareous and alkaline soils with fl uid References sources of P, N and Zn. Plant and Soil 236, Anon. (2002). Far West Coast Eyre, Western 209–219. Eyre, Central Eyre and Eastern Eyre Jones, S.M. (2007). Rhizoctonia diseases of Soil Conservation Plans. http://www.ep- Australian wheat and barley: economic nrm.sa.gov.au/PublicationsandResources/ opportunities for commercialization of Reports/tabid/1550/Default.aspx. biological control product. Report submit- Barnett, S.J., Roget, D.K. and Ryder, M.H. (2006) ted to SARDI. Aglign Consulting Pty Ltd, Suppression of Rhizoctonia solani Ag-8 Brooklyn, NSW, Australia. induced disease on wheat by the interac- MacNish, G.C. and Neate, S.M. (1996) Rhizoctonia tion between Pantoea, Exiguobacterium and bare patch of cereals: an Australian perspec- Microbacteria. Australian Journal of Soil tive. Plant Disease 80, 965–971. Research 44, 331-342.

TheTR Rovira Rhizosphere R Symposium S 59 Neate, S.M. (1987) Plant debris in soil as a source Roget, D.K., Neate, S.M. and Rovira A.D. (1996) of inoculum of Rhizoctonia in wheat. Eff ect of sowing point design and tillage Transactions of the British Mycological Society practice on the incidence of Rhizoctonia 88, 157–162. root rot, take-all and cereal cyst nematode in wheat and barley. Australian Journal of Neate, S.M. (1989) A comparison of controlled Experimental Agriculture 36, 683–693. environment and fi eld trials for detection of resistance in cereal cultivars to root rot Roget, D.K., Coppi, J.A., Herdina and Gupta, caused by Rhizoctonia solani. Plant Pathology V.V.S.R. (1999) Assessment of suppres- 38, 494–501. sion to Rhizoctonia solani in a range of soils across SE Australia. In: Magarey, R.C. (ed.) Neate, S.M. and Warcup, J.H. (1985) Anastomosis Proceedings of the First Australasian Soilborne grouping of some isolates of Th anatephorus Disease Symposium. BSES, Brisbane, cucumeris from agricultural soils in South Australia, pp. 129–130. Australia. Transactions of the British Mycological Society 85, 615–620. Rovira, A.D. (1992) Dryland mediterranean farming systems in Australia. Australian Journal of Reuter, D. (2007) Trace elements disorders in South Experimental Agriculture 32, 801–809. Australian agriculture. Primary Industries and Resources of SA, Adelaide, Australia, 17 Wiseman, B.M., Neate, S.M., Keller, K.O. pp. http://www.pir.sa.gov.au/__data/assets/ and Smith, S.E. (1996) Suppression of pdf_fi le/0011/49619/Trace_Element_disor- Rhizoctonia solani anastomosis group 8 ders_in_SA.pdf. in Australia and its biological nature. Soil Biology and Biochemistry 28, 727–732. Roget, D.K. (1995) Decline in root rot (Rhizoctonia solani AG-8) in wheat in a tillage and rotation experiment at Avon, South Australia. Australian Journal of Experimental Agriculture 35, 1009–1013.

Roget, D.K. and Gupta, V.V.S.R. (2006) Rhizoctonia control through management of disease suppressive activity in soils. In: Frontiers of Soil Science: Technology and the Information Age. Abstracts of the 18th World Congress of Soil Science, Philadelphia USA, Soil Science of America and International Union of Soil Science p. 172, http://crops.confex.com/ crops/wc2006/techprogram/P17478.HTM.

TheTR Rovira Rhizosphere R Symposium S 60 Infl uence of carbon input to soil on populations of specifi c organisms linked to biological disease suppression of Rhizoctonia root rot

Rowena S. Davey1,4, Ann M. McNeill2, Stephen J. Barnett2 and Vadakattu V.S.R. Gupta3

Abstract sp.). Th e remaining soils were then used in a pot bioassay to measure disease severity on wheat Labile soil organic carbon has been suggested seedlings after inoculation and incubation with as one of the main drivers of biological dis- Rhizoctonia solani AG-8. Results showed that ease suppression, both in terms of increasing carbon input increased the quantity of DNA of populations of suppressive organisms as well potentially suppressive organisms; young root as providing an energy source for these organ- carbon > stubble carbon > control for Pantoea isms to function. Eyre Peninsula (EP) soils in agglomerans, Exiguobacterium acetylicum and South Australia generally have relatively low Microbacterium, whilst for Trichoderma groups soil organic carbon (<1.5%) which may preclude the increase in amounts of DNA was deter- the development of biological disease suppres- mined by the type of carbon input and the sion. It was hypothesised that increased input Trichoderma group. Overall, input of either of organic carbon to these soils could foster the source of carbon (stubble or young roots) to development of biological disease suppression. this EP soil reduced wheat seedling infection by A controlled environment experiment was un- Rhizoctonia solani AG-8 in a pot bioassay. dertaken to investigate the eﬀ ect of two types of carbon inputs (wheat stubble and young Introduction wheat roots) to an EP soil on the populations of organisms linked to biological disease suppres- Th e adoption of conservation tillage farming sys- sion and on disease severity of root rot caused tems and direct drilling in recent years appears to by Rhizoctonia solani AG-8. After a six-month have increased the severity and extent of incubation period, a sub-sample of soil from Rhizoctonia root rot caused by Rhizoctonia solani each treatment was used for quantiﬁ cation of AG-8 in Australia (Rovira 1986). Th e Eyre soil organisms potentially involved with sup- Peninsula (EP) in South Australia (SA) is a region pression (Pantoea agglomerans, Exiguobacterium which produces about 40% of the SA wheat crop but is particularly vulnerable to Rhizoctonia infesta- acetylicum, Microbacterium sp. and Trichoderma tion due to edaphic and climatic constraints (Coventry et al. 1998). Indeed, it has been estimated 1 Discipline of Soil and Land Systems, School of Earth that Rhizoctonia root rot could reduce the yield in and Environmental Sciences, Th e University of the northern part of this region by up to 60% Adelaide, PMB 1, Urbrrae, SA 5064, Australia (Crouch et al. 2005). 2 Plant and Soil Health, South Australian Research and Development Institute (SARDI), Waite Roget (1995) reported the decline of Rhizoctonia Campus, GPO Box 397, Adelaide, SA 5001, root rot at a long-term trial site at Avon in the mid- Australia north of SA. Further investigations demonstrated 3 CSIRO Entomology, PMB 2, Glen Osmond, SA that this was due to a biological factor within the 5064, Australia soil (Wiseman et al. 1996). More recent work has 4 Email: [email protected] lead to isolation of specifi c soil organisms from the

TheTR Rovira Rhizosphere R Symposium S 61 soil at this site that act in combination to reduce days (Mazzola and Gu 2000; Miche and Balandreau disease severity of Rhizoctonia root rot (Barnett 2001; Barnett et al. 2006). Aft er 28 days plant 2005; Barnett et al. 2006). It has also been reported shoots were cut off just above the soil level and then that disease suppression is a function of the popula- the root-soil mixture in each container was broken tion, activity and composition of a diverse microbial up and mixed well. Th is was repeated three times community and that an increase in labile carbon resulting in a total of four cycles for the growing substrates is one of the main drivers behind bio- wheat plants. Th e stubble carbon input (Treatment logical disease suppression of Rhizoctonia root rot 2) was set up by mixing chopped (about 1 cm long) (Roget et al. 1999; Gupta et al. 2007). wheat stubble into four of the containers of soil (5.8 g stubble kg–1 dry soil) at the same time as the Since soils from the EP generally have low amounts root treatment was initiated. Aft er 28 days (length of labile (biologically available) carbon (Coventry et of a cycle for Treatment 1) the soil and stubble mix al. 1998; McNeill et al. 2001), it was hypothesised was mixed in each container, and this was repeated that addition of an organic carbon source to these for a total of four cycles. No carbon was added to soils could lead to a reduction in Rhizoctonia root the containers in the control treatment but the soil rot via biologically mediated disease suppression. in each container was mixed well every 28 days at Th us a study was undertaken to investigate if: the same time as for treatments 1 and 2. For practi- • the addition of two carbon types of sources cal reasons, aft er four growing cycles, the soil from representative of the two main types of inputs treatments in each container was air-dried before of carbon in agricultural systems (young roots use in the bioassay. which have a narrow C : nutrient ratio or cut stubble with a wide C : nutrient ratio) to a A sub-sample of air-dry soil was removed selected EP soil would result in lower disease from each container and sent to the SARDI severity Diagnostics Group (South Australian Research and Development Institute, South Australia), for quan- • these diff erent carbon sources reduced disease tifi cation of DNA from the pathogen Rhizoctonia severity by diff erent levels solani AG-8 (Whisson et al. 1995) and the ben- • the reduced disease severity was correlated efi cial organisms Exiguobacterium acetylicum, with amounts of DNA for specifi c organisms Pantoea agglomerans, Microbacterium, Trichoderma linked to reducing disease severity in another Group A, (sect. Pachybasium) and Group B (sect. soil in SA. Trichoderma (see Fig. 2) described by Kullnig- Gradinger et al. 2002). Materials and methods Th e bioassay was based on methods described by A soil previously identifi ed as non-suppressive Barnett et al. (2006). Briefl y, in this work 300 g to Rhizoctonia (Cook et al. 2007) was collected dry soil at 75% of fi eld capacity was weighed into in March 2007 from the top 10 cm depth in a three bioassay pots from each container. Each pot 200 m transect across a farmer paddock on the was inoculated at half the pot height (5 cm) with Eyre Peninsula at Mount Damper (33°04.159′S, three, 10-mm full strength potato dextrose agar 135°03.584′E), air dried and sieved through a two- plugs infested with R. solani AG-8. Seven surface- millimetre sieve. Th e soil was non-calcareous (1.34% sterile wheat seeds were planted and thinned to CaCO ) with a pH of 7.6, an organic carbon 3 (CaCl2) fi ve seedlings per pot and aft er 28 days growth of 1.4% and a CEC of 19.14 meq kg–1. in a controlled environment room (15°C and 12 hour day–night regime), plants were sampled, root Twelve plastic containers (31 cm × 13 cm × 12 cm) washed and the disease incidence was measured by each holding 3.5 kg of air dried soil and watered counting the number of seminal roots truncated by weight to 75% of fi eld capacity were prepared. by Rhizoctonia root rot before 10 cm (height of the Th ree experimental treatments were then applied— 300 ml pot) and those infected but not truncated. addition of young root carbon, stubble carbon or no Th ese counts were used to calculate percentage root carbon (control). Th e addition of young root carbon infection: (Treatment 1) was obtained by planting a high den- Percentage root infection = (No. truncated roots + sity (875 seeds m–2) of surface-sterilised wheat seeds (No. infected roots / 2) × 100) / (Total no. seminal (Triticum aestivum, cv. Yitpi) into each of the four roots) containers fi lled with soil and growing plants for 28

TheTR Rovira Rhizosphere R Symposium S 62 Data were analysed as ANOVA, RCBD using Control Young root carbon Stubble carbon GenStat Eighth Edition. Least signifi cant diff erence (lsd) at P = 0.05 was used for comparison of treat- 3.53.5 a 3.03 ment means. a 2.52.5 Results 2.02 b Rhizoctonia solani AG-8 DNA amounts for soil 1.51.5 pg DNA / g soil) / pg DNA 1.01

from the treatments prior to the bioassay were (10) higher (P = 0.05) in the soil with young root carbon 0.50.5 b b c (log –1

Concentration of DNA in soil in soil DNA of Concentration 0.0 treatment (3.12 log(10) pg DNA g soil) than in ei- 0 ther the stubble carbon or control treatments (0.19 Exiguobacterium Pantoea –1 acetylicium agglomerans and 0.52 log(10) pg DNA g soil, respectively). Micro-organism In the bioassay, percentage root infection was lower (P = 0.05) in both the carbon input treatments Figure 2. Amounts of DNA of Exiguobacterium compared to that of the control (Fig. 1). acetylicum (lsd(0.05) = 0.08) and Pantoea agglomerans (lsd = 0.72) extracted from Mount Damper soil Amounts of DNA (P = 0.05) from both root as- (0.05) which had been pre-treated for six months with a sociated bacteria Exiguobacterium acetylicum and carbon addition treatment (young root or stubble) Pantoea agglomerans were higher in the young root or left untreated (control). Diff erent letters show sig- carbon treatment (Fig. 2). Th e amount of Pantoea nifi cant diff erences at P = 0.05 between treatments agglomerans DNA in the stubble carbon treatment within each organism group only. was higher than that in the control treatment (Fig. 2).

Th e amount of DNA for Microbacterium increased in the order control < stubble carbon < young root carbon addition treatment (P = 0.05) (Fig. 3).

Control Young root carbon Stubble carbon

6 c 100 a 5 b 80 a 4 b b 60 3 b b a ab pg DNA / g soil) / pg DNA 2 a 40 (10) a

(log 1 Root infection (%) infection Root

20 in soil DNA of Concentration 0 A 0 A B Control Young root Stubble bacterium carbon carbon Trichoderma Trichodermahoderma B Microbacterium Micro-organismTrichoderma Tric Treatment Micro

Figure 1. Percentage seminal root infection (lsd(0.05) Figure 3. Amount of DNA of Microbacterium

= 11.19) for wheat plants grown in a bioassay of (lsd(0.05) = 0.14), Trichoderma group A (lsd(0.05) =

Mount Damper soil which had either been pre-treat- 0.28) and Trichoderma group B (lsd(0.05) = 0.27) from ed for six months with a carbon addition treatment Mount Damper soil which had been pre-treated for (young root or stubble) or left untreated (control). six months with a carbon addition treatment (young All pots were inoculated with Rhizoctonia solani AG- root or stubble) or left untreated (control). Diff erent 8. Diff erent letters indicate signifi cant diff erences at letters show signifi cant diff erences at P = 0.05 be- P = 0.05. tween treatments within each organism group only.

TheTR Rovira Rhizosphere R Symposium S 63 Addition of stubble carbon resulted in the highest For both of the Trichoderma groups quantifi ed in amount of DNA for Trichoderma group A (P = this work, the unamended control treatment had 0.05) whilst for Trichoderma group B, the young the least amount of DNA for Trichoderma and the root carbon treatment had the higher amount of most root infection. A number of Trichoderma spp. DNA (P = 0.05) (Fig. 3). have been well documented as biocontrol agents (Harman et al. 2004); they may also have contribut- Discussion ed to the decrease in disease in the carbon-amended treatments in this work. In a controlled environment experiment, amendment with two diff erent carbon inputs (young roots Despite an improved ability over the past decade to or stubble) resulted in less disease than the una- quantify some of the organisms linked to specifi c mended control treatment, and the amount of DNA functions such as disease suppression, it is impor- for the organisms quantifi ed tended to be highest in tant to note that many other organisms are likely to the young root carbon treatment and lowest in the have been involved in decreasing disease incidence, unamended control. especially in the fi eld environment. Th is present work has highlighted the importance of consider- In this work, the young root carbon treatment ing multi-organism whole–system interactions had signifi cantly more DNA for Exiguobacterium to understand the infl uence of added carbon sub- acetylicum and Pantoea agglomerans, which are both strates on Rhizoctonia disease incidence. Another root-associated plant growth promoting bacteria consideration is that an amount of DNA does not linked to biological disease suppression at Avon necessarily equate to a measure of organism activity, (Barnett et al. 2006). Since the young root carbon so it is possible that the organisms may be present treatment involved four cycles of growing roots, it but not necessarily functioning and able to cause is not surprising that this treatment had such large suppression, although the reduction in disease inci- amounts of DNA for these organisms. dence in this work suggests otherwise. Nevertheless, it is acknowledged that further work is required to Although these organisms do not act alone in the more fully defi ne the functional ecology underlying expression of biological disease suppression (Barnett the biological suppressive capacity of soils in the et al. 2006), they are likely to have contributed to fi eld environment. the decrease in root infection. Microbacterium spp. are soil-associated organisms (Barnett et al. 2006) that had the greatest amount of DNA in the young Conclusions root carbon treatment, followed by slightly less in Under controlled environment conditions relatively the stubble treatment, whilst the lowest amount was large inputs of carbon in the form of young roots in the unamended control. Th e diff erence between or wheat stubble to a soil from EP, SA, resulted in carbon treatments is perhaps due to the young root a decreased severity of Rhizoctonia root rot as well material being more decomposable, with low-mo- as an increase in populations of specifi c organisms lecular-weight carbon compounds readily available suggested to be linked to soil-borne disease suppres- for soil organisms, than the stubble which tends to sion. Given the widespread adoption of no-till as a have high-molecular-weight carbon compounds and management practice on the EP, where stubbles are is less decomposable with a wide C : nutrient ratio retained and there is minimal soil disturbance, the (e.g., C:N of 100:1, Tiessen et al. 1984). increased C inputs should therefore increase the Th e triplet combination of Microbacterium, potential for development of biological suppression Exiguobacterium acetylicum and Pantoea agglo- to soil-borne diseases. However, mechanisms for merans have been reported to act eff ectively to an increase in the severity of Rhizoctonia root rot decrease disease severity of Rhizoctonia solani un- under no-till and the development of disease sup- der controlled environment (Barnett et al. 2006). pression under some regional climatic and edaphic Our results supports this concept, that is, greater constraints to agricultural production are not com- amounts of DNA from all three of these bacteria in pletely understood and require further the carbon-amended soils than in the control treat- investigation. ment, which had the least amount of DNA from these organisms and the highest root infection.

TheTR Rovira Rhizosphere R Symposium S 64 Acknowledgements Harman, G.E., Howell, C.R., Viterbo, A., Chet, I. and Lorito, M. 2004. Trichoderma species Th ank you to GRDC for funding RSD’s schol- — opportunistic, avirulent plant symbionts. arship and GRDC, SARDI and SAGIT for Nature Reviews Microbiology 2, 43–56. supporting the research. Th ank you to A. Cook for Kullnig-Gradinger, C.M., Szakacs, G. and Kubicek, the use of her data, W. Sheppard for collecting all C.P. 2002. Phylogeny and evolution of the the soil and S. Anstis for the Rhizoctonia. Th ank genus Trichoderma: a multigene approach. you also to N. Wilhelm, K. Clarke and C. Heddles Mycological Research 106, 757–767. for their support, discussions and advice. Lastly thank you to K. Ophel-Keller, A. McKay and all the Mazzola, M. and Gu, Y.-H. 2000. Impact of wheat other staff at SARDI diagnostics centre for DNA cultivation on microbial communities from analysis on these soils and to SAGIT for funding replant soils and apple growth in green house the development of these tests. trials. Phytopathology 90, 114–119. McNeill, A. and Day, P. 2001. Biological activity of References surface soils on Upper Eyre Peninsula. Eyre Barnett, S.J. 2005. Microorganisms and mechanisms Peninsula Farming Systems 2001 Summary. that contribute to rhizoctonia disease sup- A.J. Frischke, PIRSA Publishing Services, pression on wheat. Shandong Science 18(3), pp. 110–111. 16–21. Miche, L. and Balandreau, J. 2001. Eff ects of rice seed surface sterilization with hypochlorite Barnett, S.J., Roget, D.K. and Ryder, M.H. 2006. on inoculated Burkholderia vietnamiensis. Suppression of Rhizoctonia solani AG-8 Applied and Environmental Microbiology 67, induced disease on wheat by the interac- 3046–3052. tion between Pantoea, Exiguobacterium, and Microbacteria. Australian Journal of Soil Roget, D.K. 1995. Decline in root rot (Rhizoctonia Research 44, 331–342. solani AG-8) in wheat in a tillage and rotation experiment at Avon, South Australia. Cook, A., Wilhelm, N. and Shepperd, W. 2007. EP Australian Journal of Experimental disease suppression bioassay and survey. Eyre Agriculture 35, 1009–1013. Peninsula Farming Systems 2007 Summary. A.J. Frischke, PIRSA Publishing Services, Roget, D.K., Coppi, J.A., Herdina and Gupta, pp. 130–131. V.V.S.R. (1999). Assessment of suppression to Rhizoctonia solani in a range of soils across Coventry, D.R., Holloway, R.E. and Cummins, SE Australia. In: Magarey, R.C. (ed.) First J.A. 1998. Farming fragile environments: Australasian Soilborne Disease Symposium. low rainfall and diffi cult soils in South Bureau of Sugar Experiment Stations, Australia. In: Michalk, D.L. and Pratley, Brisbane, pp. 129–130. J.E. (eds) Agronomy, Growing a Greener Future. Proceedings of the Ninth Australian Rovira, A.D. 1986. Infl uence of crop rotation and Agronomy Conference, 20–23 July 1988, tillage on rhizoctonia bare patch of wheat. Wagga Wagga, Australia. Australian Society Phytopathology 76, 669–673. of Agronomy, Wagga Wagga, pp. 107–116. Tiessen, H., Stewart, J. and Hunt, H. 1984. Concepts of soil organic matter transforma- Crouch, J., Purdie, B. and Daniel, C. 2005. Seed tions in relation to organo-mineral particle treatments for Rhizoctonia control. Eyre size fractions. Plant and Soil 76, 287–295. Peninsula Farming Systems 2005 Summary. A.J. Frischke, PIRSA Publishing Services, Whisson, D.L., Herdina and Francis, L. 1995. pp. 81–82. Detection of Rhizoctonia solani AG-8 in soil using a specifi c DNA probe. Mycological Gupta, V.V.S.R., Neate, S.M. and Roget, D.K. 2007. Research 99, 1299–1302. Catabolic diversity of microbial communities in soiborne-disease suppressive soils. Wiseman, B.M., Neate, S.M., Ophel-Keller, K. and In: Fermenting New Ideas. Abstracts of the Smith. S.E. 1996. Suppression of Rhizoctonia Australian Society of Microbiology annual solani anastomosis group 8 in Australia scientifi c meetings 2007, Adelaide, Australia, and its biological nature. Soil Biology and p. 119. Biochemistry 28, 727–732.

TheTR Rovira Rhizosphere R Symposium S 65 Minimum tillage and residue retention enhance suppression of Pratylenchus and other plant-parasitic nematodes in both grain and sugarcane farming systems

Graham R. Stirling1

Abstract surface and C levels were relatively high. Th us in both sugarcane and cereal-growing soils, Observations in sugarcane cropping soils in minimum tillage and residue retention appear Australia showed that conserving soil organic to play a role in improving the suppressiveness matter through practices such as residue of soils to plant-parasitic nematodes. retention and minimum tillage improved a range of soil physical and chemical parameters Introduction including total C, labile C, aggregate stability, water infi ltration rate and cation exchange In the subtropical and tropical regions of north- capacity, and reduced bulk density and surface eastern Australia, grain crops (predominantly wheat, sorghum and chickpea) and sugarcane are crusting: all parameters that are positively the main cropping industries. Th e grain-growing associated with soil and plant health. Results region occupies about 4 million hectares and of fi eld and microplot experiments indicated extends from just south of Tamworth in New South that biological mechanisms that suppressed Wales (~32°S) to near Emerald in Queensland plant-parasitic nematodes were also enhanced. (~23°S). Sugarcane is grown on about 440 000 Pratylenchus zeae and Meloidogyne javanica ha of land along the east coast, from Graft on in did not multiply as readily when soils received northern New South Wales to just north of Cairns continual C inputs from a mulch layer of plant in Queensland. residue, were not disturbed by tillage, or were amended with high C/N residues. Numerous Grain crops and sugarcane have been grown in this suppressive mechanisms are probably involved, area for more than 100 years, and for most of that but predatory fungi that obtain N from time land was cultivated with conventional tillage nematodes in N-limited environments appear to implements before crops were planted. However, the be contributing. In cereal-growing soils under grain industry began to change to reduced tillage in the 1980s, with zero tillage and residue retention minimum tillage, populations of Pratylenchus now standard practice throughout the industry. thornei were relatively low in the upper 25 cm Following research demonstrating the benefi ts of of the soil profi le and remained low when a farming system based on a legume rotation crop, surface soils were potted and planted to wheat, controlled traffi c with GPS guidance, minimum indicating that the nematode did not multiply tillage and residue retention (Garside et al. 2005), readily when stubble was retained on the soil a similar change is now taking place in the sugar industry.

1 Biological Crop Protection Pty Ltd, 3601 Moggill Plant-parasitic nematodes are important pests of Road, Moggill, Queensland 4070, Australia both grain crops and sugarcane, and this paper uses Email: [email protected] experimental data that has been published else-

TheTR Rovira Rhizosphere R Symposium S 66 where (Stirling 2007, 2008) to examine Table 1. Eﬀ ect of rotation and tillage treatments on population the impact of these recent changes in densities of Pratylenchus zeae at the time sugarcane was planted farming systems on nematode popula- (Pi), and 13 months after planting (Pf). Modiﬁ ed from Bell et tions. Tillage and residue management al. 2006. aff ect the rate of accumulation of soil organic matter (Franzluebbers 2004) Number of P. zeae and since organic matter plays a key role Treatment Tillage /200 ml soil in inducing suppressiveness to a wide Pi Pf range of soilborne pathogens, including 30 month bare fallow + 1 a 1103 a nematodes (Stirling 1991; Akhtar and 12 month bare fallow + 43 b 1224 a Malik 2000; Stone et al. 2004), it was 6 month bare fallow + 81 b 729 ab considered that suppressive mechanisms Continuous sugarcane + 285 c 777 ab against plant-parasitic nematodes were 30 month grass pasture + 81 b 478 ab likely to be enhanced by a move towards 30 month grass pasture – 125 b 315 b minimum tillage and residue retention. 30 month legume crop + 1 a 958 ab 30 month legume crop – 1 a 378 ab

Experiments with sugarcane Means within a column followed by the same letter are not soils signiﬁ cantly diﬀ erent (P = 0.05) Field experiment Pot experiment Th e fi rst observations on the eff ect of tillage on Th e above result suggests that lesion nematode mul- nematode population dynamics were made in tiplication rates are infl uenced by the background a fi eld experiment established at Bundaberg in soil biology and that disturbance caused by the con- 2003. Treatments included various lengths of bare ventional tillage practices used during the planting fallow, grass and legume breaks, and some organic operation may be one of the reasons that nematodes amendments (Bell et al. 2006), but those of interest rapidly re-infest sugarcane aft er it is replanted. Th is from a nematological perspective are listed in hypothesis was tested by comparing nematode mul- Table 1. Th e various breaks had expected eff ects on tiplication in pipes 20 cm long and 10 cm diameter populations of P. zeae: the nematode population fi lled with soil from two sugarcane fields, one with density at the time of planting sugarcane (Pi) sandy loam soil and the other with sandy clay loam declined as the length of the bare fallow increased, soil. Pipes were hammered into the soil surface and the legume break reduced nematode populations the soil cores were then left undisturbed, or the soil to very low levels relative to continuous sugarcane was sterilised by autoclaving or disturbed by peri- and the grass pasture maintained moderate odically mixing it by hand. Sugarcane was planted populations of nematodes (Table 1). Th ere were in ten replicate pipes of each treatment and then P. marked diff erences, however, in the way lesion zeae was added to half the pipes so that the initial nematode populations responded when sugarcane inoculum density in those pipes was similar in all was replanted. Nematode multiplication rates treatments (about 250 nematodes/200 mL soil). in the fi rst 13 months aft er planting were much In another experiment with root-knot nematode higher in fallowed soil than in soil that had been (Meloidogyne javanica), all inoculated pipes received cropped, probably because biological activity had the same number of nematodes (about 130 second- declined markedly in the fallow (Bell et al. 2006). stage juveniles/200 mL soil). Th e results of the fi rst Although diff erences in fi nal population densities experiment (Table 2) showed that P. zeae multiplied (Pf) were not always signifi cant, the nematode did best in autoclaved soil and least in undisturbed soil. not multiply as readily in non-tilled soils and the In pipes that were not inoculated, the fi nal nema- fi nal nematode population in the non-tilled legume tode population was much higher in disturbed than treatment was one-third as high as the 30-month undisturbed soil, despite the fact that the initial bare fallow treatment, despite the fact that Pi in nematode density was reduced by 30% and 70% in both treatments was similar at planting. the disturbed soils because of nematode mortality during the mixing process. In inoculated pipes, populations of P. zeae increased about 11-fold in autoclaved soil, whereas there were only 5-fold and

TheTR Rovira Rhizosphere R Symposium S 67 Table 2. Final nematode population densities in two experiments where sugarcane was grown in pipes ﬁ lled with autoclaved, disturbed or undisturbed soil that was either inoculated with 250 Pratylenchus zeae/200 mL soil (experiment 1) or 130 Meloidogyne javanica/200 mL soil (experiment 2). (G.R. Stirling, unpublished data).

Experiment 1 Experiment 2 Soil treatment No. P. zeae/200 mL soilA No. M. javanica/200 mL soilA Inoculated Not inoculated Inoculated Not inoculated Autoclaved 2817 a 0 d 285 a 0 c Disturbed 1276b 1663ab 157a 0 c Undisturbed 514 c 464 c 20 b 0 c

A Nematode numbers are means for two soils, and are back-transformed means of transformed data [log10 (no. nematodes+1)]. Within each experiment, numbers followed by the same letter are not signiﬁ cantly diﬀ erent (P = 0.05)

2-fold increases in disturbed and undisturbed soil, 2003: 2 soils (with a history of either cropping or respectively. In the second experiment, M. javanica pasture) × 2 soil depths (0–5 and 5–15 cm) × ± heat was detected only in inoculated soils, with fi nal × ± P. thornei × 5 replicates. nematode numbers signifi cantly higher in autoclaved and disturbed soil than in undisturbed soil 2004: 2 soils (with a history of either cropping (Table 2). or pasture) × 16 treatments (including untreated, heat, gamma irradiation, metham sodium, freezing, Experiments with grain-growing mancozeb and organic amendments) × 4 replicates. soils 2005: 21 soils with diff erent histories × untreated soil or gamma-irradiated soil × ± P. thornei × In four successive years (2003–2006), soil from 3 replicates. a depth of 0–25 cm was collected in April from farms in the Goodiwindi–North Star region 2006: 3 cropped soils from diff erent farms × of Queensland/northern NSW and from the 3 treatments (gamma irradiated soil, gamma Darling Downs (Jimbour–Macalister) region of irradiated soil + 10% untreated fi eld soil and Queensland. Soil was obtained from fi elds that untreated fi eld soil) × ± P. thornei × 5 replicates. were managed under the standard zero-till cropping system and also from areas under permanent Results of these experiments indicated that when a pasture or native vegetation dominated by brigalow single wheat crop was grown in untreated fi eld soil, (Acacia harpophylla). Treatments imposed on populations of P. thornei generally increased 2–4 soils included gamma irradiation (25 kGy), heat times. However, when the soils were sterilised by (65°C for 12 hours) and a range of physical and heat, gamma irradiation or fumigation, there was chemical treatments that were likely to aff ect the a 5–21 fold increase in nematode populations. In soil biology. Broadly similar methods were used for sterilised soil to which P. thornei had been added, each experiment, with 1.5 L pots being fi lled with fi nal nematode population densities were 20–40 treated or untreated soil and planted with a cultivar P. thornei/g soil, whereas they were generally only of wheat (Sunvale) that is susceptible to but tolerant 3–10 P. thornei/g in soil from crop, pasture or native of Pratylenchus thornei. In cases where treatments vegetation sites, despite the fact that similar num- involved the addition of P. thornei, the population bers of nematodes were present at planting. Results density was adjusted to about 1.5 nematodes/g soil from the 2005 experiment provide an indication of by adding the appropriate number of nematodes so the data obtained (Table 3). that initial inoculum densities were similar in all treatments. Exceptions included some cropped soils Discussion where the nematode population density was already > 5 P. thornei/g soil. Final nematode population A new farming system based on legume rotation densities were determined by extracting nematodes crops, controlled traffi c using GPS guidance, mini- from a mixture of soil and roots aft er plants had mum tillage and residue retention has recently been grown to maturity (about 110 days). Brief details of introduced into the Australian sugar industry. Th e the design of each experiment are: soil health improvements obtained from this system

TheTR Rovira Rhizosphere R Symposium S 68 Table 3. Final population densities of Pratylenchus thornei on wheat in ﬁ eld soil, and in ﬁ eld soil or gamma- irradiated soil, after P. thornei was added to achieve an initial inoculum density of 1.5 nematodes / g soil. Data from an experiment with soils collected in 2005.

No. P. thornei / g soil Location of soil samples Land use Field soil Field soil Gamma irradiated soil (no P. thornei added) + P. thornei + P thornei Billa Billa Cropping 0.3 5.8 36.9 Jandowae Cropping 0.1 3.3 24.3 Jimbour Cropping 0.5 0.7 22.9 North Star Cropping 0.2 13.3 28.0 Yelarbon Cropping 2.2 8.8 30.0 North Star Brigalow 0.8 5.9 30.7 Jandowae Pasture 0.1 4.6 13.7 Jimbour Pasture 0.2 7.8 23.4

LSD (P = 0.05) 10.4

(higher soil C, better aggregate stability, higher Although the reasons for relatively low nematode rainfall infi ltration rates, increased cation exchange multiplication rates in the soils used in this study capacity, greater amounts of potentially miner- have not been fully explored, diff erences in the alisable N and reduced bulk density and surface amount of root biomass available to nematodes may crusting) have been discussed in detail elsewhere explain some of the eff ects observed. In the field, (Stirling 2008). An additional soil health benefi t, sugarcane shoots emerge more slowly in minimum- however, is a reduction in problems caused by plant- tilled plots than following cultivation, and since parasitic nematodes. Stirling et al. (2001, 2007) this probably infl uences root biomass, nematode clearly showed that including a legume rotation multiplication in non-tilled plots in the fi eld experi- crop in the farming system reduced the population ment may have been limited by the amount of food density of key nematode pests, while other studies available to the nematode. However, in the pot (Stirling et al. 2005; Stirling 2008) have shown experiment, diff erences in nematode multiplication that organic inputs from mulches and amendments between disturbed and non-disturbed soils were play a key role in enhancing suppressiveness to these not due to diff erences in plant growth. In the pot pests. Th e three experiments presented in this paper experiments with wheat, plants generally grew bet- provide evidence that benefi ts are also obtained ter when soil was sterilised but this was not the sole from minimum tillage and residue retention. Root- reason for increased nematode multiplication rates knot and lesion nematodes, the most important in heat-treated, gamma-irradiated and fumigated nematode pests of sugarcane, did not multiply as soils. Final nematode population densities and plant readily when crop residues were retained on the soil biomass were not strongly correlated in any experi- surface and the soil was not cultivated or disturbed ment, nematode multiplication rates remained before planting. relatively high when shoots of plants growing in Th e fi nding that P. thornei did not multiply read- sterilised soil were cut back to limit biomass pro- ily in potted soils from the northern grains belt duction, and the nematode population densities was unexpected, given that the nematode is widely achieved in untreated soil were well below the carry- distributed in this region and is oft en found at ing capacity of the potted root systems. very high population densities in grain-growing soils (Th ompson et al. 2008). Th e result was not A likely explanation for most of the observed eff ects so surprising, however, when sampling depth is is that biological control mechanisms are operat- considered. All soils were collected from a depth of ing in sugarcane and grain-growing soils and they 0–25 cm and previous work has shown that popula- play a role in regulating nematode populations and tions of P. thornei in the fi eld are generally lower aff ecting nematode multiplication rates. Th ese sup- near the surface than at depth. pressive forces appear to be particularly active in situations where residues are retained on the soil

TheTR Rovira Rhizosphere R Symposium S 69 surface and minimum tillage is a component of the Acknowledgements farming system. Since soil near the surface is more suppressive than soil at depth and most sugarcane Th e sugarcane work was funded by SRDC through and cereal roots are found in the upper 25 cm of the the Sugar Yield Decline Joint Venture, while the soil profi le, these biological buff ering mechanisms grains work was funded by GRDC through its Soil are likely to be important from a practical perspec- Biology Initiative. tive. Plant-parasitic nematodes cost the sugarcane References and wheat industries $82 million and $69 million, respectively, in northern Australia (Blair and Akhtar, M. and Malik, A. 2000. Roles of organic soil Stirling 2007; Th ompson et al. 2008) and so any amendments and soil organisms in the bio- reduction in nematode populations in the zone logical control of plant-parasitic nematodes: where most root biomass is located is likely to result a review. Bioresource Technology 74, 35–47. in major economic benefi ts. Bell, M.J., Garside, A.L., Stirling, G.R., Magarey, To date, no attempt has been made to determine R.C., Moody, P.W., Halpin, N.V., which components of the soil food web are con- Berthelsen, J.E. and Bull, J.I. 2006. Impact tributing to these suppressive eff ects. Numerous of fallow length, organic amendments, break crops and tillage on soil biota and sugarcane parasitic and predatory organisms are probably growth. Proceedings of the Australian Society involved, but fungi that prey on nematodes in of Sugarcane Technologists 28, 273–290. high-C, low-N environments may be important in sugarcane soils (Stirling et al. 2005). Other Blair, B.L. and Stirling, G.R. 2007. Th e role of parasites and predators of nematodes that have plant-parasitic nematodes in reducing been found in sugarcane soils include two fungal yield of sugarcane in fi ne-textured soils in parasites of nematode eggs (Pochonia chlamydospo- Queensland, Australia. Australian Journal of ria and Paecilomyces lilacinus), a bacterial parasite Experimental Agriculture 47, 620–634. (Pasteuria) that has host-specifi c strains capable of Franzluebbers, A.J. 2004. Tillage and residue attacking Pratylenchus and Meloidogyne, and a wide management eff ects on soil organic matter. range of dorylaimid and mononchid predators of In: Magdoff , F. and Weil, R.R. (eds) Soil nematodes. Little is known about mechanisms of Organic Matter in Sustainable Agriculture. suppression in grain-growing soils, but the fact that CRC Press, Boca Raton, USA, pp. 227–268. high multiplication rates in sterilised soil were largely reversed by adding 10% fi eld soil (Stirling 2007) Garside, A.L., Bell, M.J., Robotham, B.G., Magarey, suggests that microbial antagonists are involved R.C. and Stirling, G.R. 2005. Managing rather than larger predatory organisms. yield decline in sugarcane cropping systems. International Sugar Journal 107, Issue 1273, One clear message that emerges from these studies is 16–26. that soil C plays a key role in biological suppression of nematodes. Since some of the organisms likely Stirling, G.R. 1991. Biological Control of Plant- to be involved have a saprophytic phase and many parasitic Nematodes. CAB International, parasites and predators use bacterial and fungal- Wallingford, UK, 282 pp. feeding nematodes as a food source, the amount Stirling, G.R. 2007. Biological suppression of of biological control that occurs in a soil will be Pratylenchus in northern grain-growing dependent on the quality and quantity of resources soils. Proceedings of the Sixteenth Australasian that sustain the soil food web. It is therefore reas- Plant Pathology Society Conference, Adelaide, suring that practices which increase C inputs (e.g., 24–27 September 2007, p. 72. retention of residues, introduction of pasture leys Stirling, G.R. 2008. Th e impact of farming systems or high-residue rotation crops and the use of waste on soil biology and soil-borne diseases: products such as mill mud as amendments) or limit examples from the Australian sugar and losses of soil organic matter (e.g., reduced tillage) are vegetable industries, the case for better becoming an increasingly important component of integration of sugarcane and vegetable both sugarcane and grain farming systems. production and implications for future research. Australasian Plant Pathology 37, 1–18.

TheTR Rovira Rhizosphere R Symposium S 70 Stirling, G.R., Blair, B.L., Pattemore, J.A., Garside, Stone, A.G., Scheuerell, S.J. and Darby, H.M. A.L. and Bell, M.J. 2001. Changes in 2004. Suppression of soilborne diseases in nematode populations on sugarcane fi eld agricultural systems: organic matter following fallow, fumigation and crop management, cover cropping and other rotation, and implications for the role of cultural practices. In: Magdoff , F. and Weil, nematodes in yield decline. Australasian R.R. (eds) Soil Organic Matter in Sustainable Plant Pathology 30, 232–235. Agriculture. CRC Press, Boca Raton, USA, pp. 131–177. Stirling, G.R., Wilson, E.J., Stirling, A.M., Pankhurst, C.E., Moody, P.W., Bell, M.J. Th ompson, J.P., Owen, K.J., Stirling, G.R. and and Halpin, N. 2005. Amendments of Bell, M.J. 2008. Root-lesion nematodes sugarcane trash induce suppressiveness to (Pratylenchus thornei and P. neglectus): a plant-parasitic nematodes in sugarcane soils. review of recent progress in managing a Australasian Plant Pathology 34, 203–211. signifi cant pest of grain crops in northern Australia. Australasian Plant Pathology 37, Stirling, G.R., Moody, P. and Stirling, A.M. 2007. 235–242. Th e potential of nematodes as an indicator of the biological status of sugarcane soils. Proceedings of the Australian Society of Sugarcane Technologists 29, 339–351.

TheTR Rovira Rhizosphere R Symposium S 71 Variability among the isolates of Sclerotium rolfsii (Sacc.) causing stem rot of peanut (Arachis hypogaea L.)

S. Durgaprasad1, N.P. Eswara Reddy1,2, C. Kishore1, B.V. Bhaskara Reddy3, P. Sud-hakar 3 and S.V.R.K. Rao1

N.P.E. Reddy

Abstract about 650–700 base pairs (bp) which confi rms the genus Sclerotium. RAPD profi les with ran- Peanut is an important oilseed crop in India, dom primers, viz. OPA-01, OPA-12, OPA-17, covering half of the area under oil seed pro- OPA-18 and OPA-20 refl ected the genetic di- duction. Th e crop is aff ected by a soil-borne versity among the isolates with the formation of pathogen Sclerotium rolfsii causing stem rot. two clusters. Cluster I consisted of four isolates, Roving survey results revealed an average 20% viz. CSr 9, KSr 17, CSr 1 and KSr 19 of which incidence of the disease in the Rayalaseema re- the fi rst two and last two form two separate gion of Andhra Pradesh, India. Twenty isolates sub-groups Ia and Ib. Cluster II contained four of S. rolfsii were collected and subjected to vari- isolates, viz. CSr 2, CSr 10, KSr 15 and KSr ability studies. Variability has been observed in 20. Th e primer OPA-01 amplifi ed two unique growth on PDA medium, sclerotial size, colour, bands of about 100 bp and 250 bp in the case pathogenicity on peanut, and RAPD profi les. of the highly virulent isolate KSr 19, which can Among all the isolates CSr 2, 3 and 4, and KSr be used for the development of species-specifi c 12, 14, 15, 16, 17 and 18 have shown maximum SCAR (sequence characterised amplifi ed region) growth (90 mm) and least growth was observed markers, whereas the primer OPA-12 ampli- in case of KSr 19 isolate (62.7 mm) on PDA fi ed specifi c bands of 1400 bp and 1500 bp medium. Th e isolate KSr 18 produced the most for the less virulent KSr 15 isolate. However, sclerotia (571/plate) and isolate CSr 6 the least the ITS-RFLP results with AluI, Hinf I and (30/plate). Th e sclerotia were largest (2.2 mm) MseI enzymes did not show any polymorphism in the case of isolate KSr 16 and smallest (0.90 among the isolates under study. Th is work im- mm) for isolate CSr 4. Th e colour of sclerotia proves our understanding of the epidemiology varied from light brown to reddish-brown to of the pathogen S. rolfsii and complements our dark brown. Isolates CSr 4, KSr 19 and KSr eff ort to develop control options that reduce 20 were highly virulent, with 100% disease disease incidence and yield losses in the eco- incidence on peanut variety TCGS-888 in red nomically important peanut crop in southern loamy soil in pot culture studies. Th e ITS am- India. plifi ed region of rDNA produced a fragment of

Introduction 1 Dept of Plant Pathology, S.V. Agricultural College, ANGR Agricultural University, Tirupati, AP, Groundnut or peanut (Arachis hypogaea L.) is a ma- India jor legume and important oil seed crop in southern 2 Email: [email protected] India. In India it is grown over an area of 6.74 mil- 3 Regional Agricultural Research Station, ANGR lion ha with an annual production and productivity Agricultural University, Tirupati, AP, India TheTR Rovira Rhizosphere R Symposium S 72 of 7.99 million t and 1185 kg ha–1, respectively. In in the centre of a plate and incubated at 28 ± 2°C. Andhra Pradesh it is grown on up to 1.87 million Radial growth was measured at 24 h intervals until ha with 1.64 million t of production and a produc- the entire plate was covered with the fungus, mea- tivity of 728 kg ha–1 (Directorate of Economics and suring along the diameters at right angles and then Statistics, Hyderabad 2005–2006). averaging the data. Th ere were three replications for each isolate. Morphological characteristics of scle- In peanut, many diseases occur at diff erent growth rotia, viz. time taken for sclerotial production, size, stages. Among these, stem rot caused by Sclerotium colour and number of sclerotia produced were re- rolfsii Sacc. (teleomorph Athelia rolfsii (Curzi) Tu corded for each isolate. Sclerotial size was measured and Kimbrough) is one of the important diseases. using an image analysis soft ware program with a It causes severe damage to the crop, and yield losses Motic Camera (USA). Th e size of 30 sclerotia was to an extent of 25% have been reported (Mayee and measured in each replication and the results were Datur 1988). Analysis of variability within patho- then averaged. gen populations helps to understand host-pathogen co-evolution and epidemiology, and for developing Pathogenic variability strategies for resistance management (Castro et al. 2000; Morris et al. 2000). Th e pathogenic potential of each isolate of S. rolfsii was tested on TCGS-888 peanut variety in a pot Th e internal transcribed spacer (ITS) analysis of culture experiment. For artifi cial inoculation, dried rDNA is a reliable method for taxonomic species sclerotia were germinated for 36–48 h on PDA at identifi cation and random amplifi ed polymorphic 28°C and a 1-cm disc of germinated sclerotia along DNA (RAPD) for determining sub-population di- with actively growing mycelium was transferred to versity within the species (Freeman et al. 2000). Th e the stem base and covered with coarse sand up to a aim of this study was to determine the variability height of 1.5 cm and maintained in a moist condi- in cultural and morphological properties, patho- tion (Shokes et al. 1996). Seedling mortality was genicity and genetic diversity among the isolates of recorded 15 days aft er inoculation (DAI). Th ere S. rolfsii from peanut-growing regions of Andhra were three replications for each treatment. Pradesh, India. Percent disease incidence (PDI) was calculated us- Materials and methods ing the following formula: Survey, isolation and identifi cation of Number of diseased plants PDI = 100 pathogen Total number of plants A roving survey was conducted in Chittoor and Kadapa districts of the Rayalaseema region, Andhra Pradesh, to estimate disease incidence and to col- Genetic diversity among S. rolfsii isolates lect peanut plants infected with Sclerotium rolfsii. During the survey, twenty plant samples were Extraction of fungal genomic DNA randomly collected and the pathogen was isolated Eight isolates of S. rolfsii, viz. CSr 1, CSr 2, CSr 9, from infected peanut plants using the tissue seg- CSr 10, KSr 15, KSr 17, KSr 19 and KSr 20, diff er- ment method (Rangaswami and Mahadevan 1999). ing in degrees of pathogenicity, were selected for Isolates were maintained on potato dextrose agar molecular characterisation using RAPD, ITS-PCR (PDA) by periodical transfer (Dhingra and Sinclair and ITS-RFLP methods. Th e total genomic DNA 1995) and identifi ed using standard mycological of S. rolfsii isolates was extracted from vegetative keys (Barnett and Hunter 1972). mycelium using the procedure described by Murray and Th ompson (1980) with minor modifi cations. Cultural and morphological variability Cultural and morphological variability was evaluated on potato dextrose agar (PDA) medium. A mycelial disc 5 mm in diameter was taken from the edges of actively growing culture and inoculated

TheTR Rovira Rhizosphere R Symposium S 73 PCR amplifi cation for RAPD analysis through standard mycological keys. Isolates col- Five diff erent random primers belonging to the lected from Chittoor and Kadapa districts were Operon ‘A’ series, viz. OPA-01, 12, 17, 18 and 20 designated as CSr 1 to CSr 10 and KSr 11 to KSr (Operon Technologies Inc.), were used to detect 20, respectively (Table 1). polymorphism among the isolates. PCR amplifi cations were carried out in 0.2 ml Eppendorf tubes Cultural and morphological with 25 μl reaction mixture (2.5 μl of 10x Taq variability buff er, 2.5 μl of 25 mM MgCl2, 2.5 μl of primer (1 picomole μl–1), 0.5 μl of 100 mM dNTP mix, Th e isolates of S. rolfsii varied in all of the test 0.2 μl of Taq polymerase enzyme (conc. 1 U μl–1) parameters, viz. colony morphology, total growth, and 16.8 μl of sterile PCR water (Genei, Bangalore)) growth rate, time taken for sclerotial production, and 2 μl (40–50 ng) of DNA sample. Amplifi cation size, colour and number of sclerotia produced per was carried out by 5 min of initial denaturation at plate (Table 1). Out of 20 isolates, colonies of 11 94°C followed by 40 cycles of denaturation of 94°C isolates showed fl uff y growth, whereas 9 isolates for 1 min; annealing at 37°C for 1 min; extension were compact. However, all the isolates produced at 72°C for 2 min with a fi nal extension at 72°C for white cottony mycelial growth. Maximum radial 5 min. growth was recorded for the isolates CSr 2, CSr 3, CSr 4, KSr 12, KSr 14, KSr 15, KSr 16, KSr 17 and KSr 18 (90 mm) and the least growth was ob- PCR amplifi cation and RFLP analysis of ITS served for KSr 19 (62.7 mm). Maximum growth region of rDNA rate was observed for isolate KSr 15 (34.5 mm d–1) Amplifi cations were performed using universal and the least growth rate was observed for the KSr primers ITS-1 and ITS-4 (White et al. 1990) in 19 isolate (15.6 mm d–1). Isolates CSr 5, CSr 8 and 0.2 ml Eppendorf tubes with 25 μl reaction mix- KSr 11 took a maximum time of 18 days to pro- ture containing 2.5 μl of 10x Taq buff er, 2.5 μl of duce sclerotia, whereas isolate CSr 4 took only 9

25 mm MgCl2, 2.0 μl of each primer (0.6 picomol days. Th e largest sclerotia were produced by isolate μl–1), 0.5 μl of 100 mM dNTP mix, 0.125 μl of Taq KSr 16 (2.2 mm) and the smallest by isolate CSr 4 polymerase (0.5 U μl–1) and 14.37 μl of sterile PCR (0.90 mm). A maximum radial growth of 90 mm water (Genei, Bangalore) and 3 μl (40–50 ng) of by an isolate S. rolfsii was also reported by Akram DNA sample. Amplifi cation was carried out by 35 et al. (2007) for an isolate from chickpea and by cycles, including denaturation at 94°C for 1 min, Kulkarni et al. (2008) for an isolate from potato. annealing at 56°C for 1 min and extension at 72°C Sarma et al. (2002) reported that the growth rate for 1.5 min with initial denaturation at 94°C for of diff erent isolates of S. rolfsii varied from 23 to 31 4 min before cycling and fi nal extension at 72°C for mm d–1. Okereke and Wokocha (2007) recorded a 6 min. Amplifi ed PCR products were digested with minimum sclerotial size of 0.8 mm and a maximum AluI, Hinf I and MseI restriction enzymes as per the of 1.4 mm in a tomato isolate of S. rolfsii. manufacturers’ instructions, and banding patterns were documented through a gel documentation Th e results of the present study reveal wide varia- system (Alpha Innotech). tion among the S. rolfsii isolates in phenotypic characteristics, which could be due to diff erences in nutritional requirements and genetic characteristics. Results and discussion For example, osmotic and matric potential in the Survey, isolation and identifi cation of growth medium can infl uence the formation of re- pathogen productive structures by soilborne fungi (Cook and Duniway 1980). Other environmental factors that Maximum disease incidence (85%) was observed in can infl uence sclerotial production include tempera- Kattuluru village of Vempalli mandal in the Kadapa ture, type and amount of nutrients and C:N ratio. district, whereas the lowest disease incidence (1%) In this study, variability studies were conducted by was observed in the Nallacheruvupalli village of inoculating equal quanta of inoculum (5 mm colony Molakacheruvu mandal in the Chittoor district. discs) on a defi ned medium, so diff erences in genetic Th e isolated pathogen was identifi ed as S. rolfsii characteristics would have contributed to the diff er- based on its mycelial and sclerotial characteristics ences observed.

TheTR Rovira Rhizosphere R Symposium S 74 Table 1. Percent disease incidence (PDI) of stem rot in the ﬁ eld and the cultural, morphological and in vitro pathogenic variability among the isolates of Sclerotium rolfsii. DAI = days after inoculation, RB = reddish brown, DB = dark brown and LB = light brown.

Time Time taken taken for for scler- No. of Size PDI disease Growth otia Colour scler- of in express- PDI in Total rate prod- of otia scler- fi eld ion glasshouse growth (mm/ Colony uction scler- (per otia Isolate Site (%) (DAI) (%)1 (mm) day) type (days) otia plate) (mm) CSr1 Kottapalli 11.1 15 40 (39.2) 73 23 Fluff y16RB811.42 CSr2 Kalikiri 6.7 853 (46.9)90 30 Compact 13 RB 138 1.80 CSr3 Teegalakona 15.0 10 40 (39.2) 90 31 Compact 15 KB 347 0.92 CSr4 Taragonda 20.0 11 53 (46.9) 90 31 Compact 9 DB 385 0.90 CSr5 Yellampalli 2.0 10 47 (43.1) 68 18 Fluff y18LB531.50 CSr6 Kothapalli 5.0 7 60 (50.8) 66 26 Fluff y15LB301.50 CSr7 K. Kuruvapalli 30.0 16 40 (39.2) 73 23 Fluff y15DB1301.31 CSr8 Mudivedu 10.0 12 53 (45.9) 69 24 Fluff y18RB582.00 CSr9 Nallacheruvu- 1.0 8 100 (90.0) 83 21 Fluff y13RB1851.63 palli CSr10 Peddapalem 3.0 8 27 (31.0) 83 23 Compact 11 DB 281 1.13 KSr11 Battalapalli 5.6 12 93 (31.1) 72 23 Fluff y18RB640.95 KSr12 Gollapalli 5.8 10 87 (72.3) 90 33 Compact 16 RB 242 1.12 KSr13 Nagalagutta- 8.3 16 20 (26.6) 82 24 Fluff y17LB2571.48 varipalli KSr14 Kattuluru 85.0 8 60 (50.8) 90 33 Compact 15 LB 168 2.00 KSr15 Gangammapeta 5.7 12 20 (26.6) 90 34 Fluff y13RB562.00 KSr16 Animela 30.0 15 27 (31.0) 90 29 Fluff y14RB812.20 KSr17 V.N. Palli 13.3 15 53 (45.9) 90 30 Compact 14 DB 151 1.50 KSr18 Vuruturu 10.0 780 (63.4)90 30 Compact 16 LB 571 2.00 KSr19 Sunkesula 10.0 10 100 (90.0) 62 15 Compact 12 LB 190 1.00 KSr20 Telagandlapalli 5.0 6 100 (90.0) 67 24 Fluff y17LB1221.62 Critical diff erence (P = 0.05) (9.9) 0.7 Standard error of mean (±3.5) ±0.25 1Th e fi gures in brackets are angular transformed values

Pathogenic variability the pathogenic variability of ten S. rolfsii isolates recovered from diseased parts of Parthenium. Table 1 shows that isolates CSr 9, KSr 19 and KSr Further they reported that isolate Par#02 showed 20 exhibited maximum disease incidence (100%) the greatest disease incidence (80%) whereas isolate following inoculation on peanut, followed by KSr Par#10 showed least (30%). Th e spread of isolates in 11 with 93%. Th e lowest disease incidence was a particular geographic regions followed by changes recorded for isolates KSr 13 and KSr 15 (20%). in the genetic background through selection, ad- Dela-Cueva and Natural (1994) studied the patho- aptation or mutation could result in isolates with logical variation among the isolates of S. rolfsii from diff ering genetic composition and suggest that there diff erent crops. Th e cowpea isolate was considered might be several strains within this species. Such the most aggressive and most virulent. Ansari and information on variability within the populations Agnihotri (2000) reported a positive correlation in a geographic region contributes to the growing between oxalic acid production and the virulence of knowledge of the biology and epidemiology of this the S. rolfsii isolates. In this study we have not mea- economically important pathogen and assists the sured oxalic acid or other enzyme production by the development of eff ective control strategies. selected isolates. Shukla and Pandey (2008) showed

TheTR Rovira Rhizosphere R Symposium S 75 Genetic diversity among S. rolfsii isolates terns of isolates belonging to the same MCG with RAPD analysis primer 335. RAPD profi les in this study clearly show distinct polymorphism among the isolates. Random primers, viz. OPA-01, OPA-12, OPA-17, Th e two unique fragments of about 100 bp and 250 OPA-18 and OPA-20 generated a total of 221 re- bp in case of KSr 19 isolate with primer OPA-01 producible and scorable polymorphic bands ranging and 650 and 700 bp amplicons in case of KSr 20 approximately from as low as 100 bp to as high as were amplifi ed with OPA-17 primer. Th e cloning 2500 bp among eight isolates (Fig. 1A-E). Figure 1F and sequencing of these unique fragments from shows a dendrogram generated using the UPGMA virulent isolates KSr 19 and KSr 20 could allow package based on Ward’s Squared Euclidean the design of specifi c oligonucleotides in order to Distance method. develop SCAR markers for the detection of highly Based on the results obtained, all eight isolates were virulent isolates. Schilling et al. (1996) reported the grouped into two main clusters. Cluster I contains development of SCAR markers based on RAPD four isolates, viz. CSr 9, KSr 17, CSr 1 and KSr 19 profi les for Fusarium spp. Literature evidence for of which the fi rst two and last two form two sepa- molecular genetic and virulence characteristics is rate sub-clusters. Cluster II contains four isolates, variable and detailed characterisation of genetic dif- viz. CSr 2, CSr 10, KSr 15 and KSr 20. Th e RAPD ferences (e.g. presence of a specifi c band or sequence) profi les show a distinct banding pattern indicating may be needed to identify links to virulence charac- the presence of polymorphism among the isolates teristics (Ramsay et al. 1996; Back et al. 1999). of S. rolfsii. Primer OPA-01 amplifi ed two unique For example, screening of isolates using a diverse fragments of about 100 bp and 250 bp in case of set of RAPD primers belonging to diff erent operon isolate KSr 19. Primer OPA-12 amplifi ed specifi c series or analysis using ‘inter-simple sequence repeat bands of 1400 bp and 1500 bp in the case of isolate – PCR’ (ISSR-PCR) may help to fi nd relationships, KSr 15. Moreover, a 600 bp fragment was absent in if any, between pathogenicity and taxonomic ge- the case of isolate CSr 1 compared to other isolates. netic characteristics. OPA-17 primer yielded a specifi c fragment of about 200 bp in isolates CSr 9 and KSr 17 and was absent in all other isolates. Bands of 650 and 700 bp were ITS-PCR and ITS-RFLP analysis specifi cally amplifi ed in the case of isolate KSr 20, Amplifi cation of the ITS region of rDNA produced showing the polymorphism among the isolates. an approximately 650–700 bp fragment which is Primer OPA-18 amplifi ed a unique band of about specifi c to S. rolfsii (Fig. 2 A). Our results are in 500 bp in CSr 1, 575 bp in CSr 9 and 750 bp in case agreement with those of Adandonon et al. (2005) of KSr 20. Primer OPA-20 amplifi ed a fragment of who studied genetic variation among S. rolfsii 1000 bp and 1050 bp in both KSr 15 and KSr 17 isolates of cowpea from Benin and South Africa isolates. Results on RAPD profi les showed that the by using mycelial compatibility and ITS rDNA two highly virulent isolates grouped in one cluster sequence data and obtained an amplifi cation frag- (cluster I), suggesting similarities in genetic and/or ment of about 700 bp which is specifi c for S. rolfsii. virulence characteristics between isolates. However, In the present study, all isolates gave the same size additional and more detailed studies are required of the fragment, that is 650–700 bp, which suggests to confi rm the relationship and its overall signifi - that these isolates are the same species. cance. Punja and Sun (2001) used RAPD analysis to study genetic diversity within and among mycelial Harlton et al. (1995) screened a world-wide col- compatibility groups of S. rolfsii and Sclerotium lection of S. rolfsii, using universal primer pairs delphinii. Th e extent of genetic diversity among ITS1-ITS4, ITS1-ITS2 and ITS3-ITS4, and re- isolates of S. delphinii was lower than that observed vealed variation in ITS regions with 12 sub-groups. in S. rolfsii. Almeida et al. (2001) studied variability Sclerotium rolfsii and S. delphinii yielded a common among 30 isolates of S. rolfsii from diff erent hosts unique band of about 720 bp. in Brazil using RAPD profi les and identifi ed 11 haplotypes. Saude et al. (2004) reported genetic ITS-RFLP results in this study showed similar variability among 17 isolates of S. rolfsii using myce- restriction banding patterns among all the isolates lial compatibility groups (MCGs) and RAPD-PCR. for the restriction enzymes AluI, Hinf I and MseI RAPD analysis revealed similarities in banding pat- (Fig. 2B–D). Th is shows that the restriction sites

TheTR Rovira Rhizosphere R Symposium S 76 Figure 1. Genetic diversity of S. rolfsii isolates based on random ampliﬁ ed polymorphic DNA (RAPD) patterns generated using primers OPA-01 (A), OPA-12 (B), OPA-17 (C ), OPA-18 (D) and OPA-20 (E). Lanes 1–8 represent S. rolfsii isolates CSr 1, CSr 2, CSr 9, CSr 10, KSr 15, KSr 17, KSr 19 and KSr 20, respectively. Lane M = 1kb DNA ladder. Figure 1F: Dendrogram generated using UPGMA analysis showing polymorphism among isolates of S. rolfsii.

TheTR Rovira Rhizosphere R Symposium S 77 Figure 2. A: Ampliﬁ cation product of internal transcribed spacer (ITS). B–D: Restriction enzyme digestion of ITS-rDNA from diﬀ erent isolates of S. rolfsii: B: Alu I; C: Hinf I; D: Mse I. Lane M = 100 bp DNA ladder; lanes 1–8 are S. rolfsii isolates CSr 1, CSr 2, CSr 9, CSr 10, KSr 15, KSr 17, KSr19 and KSr 20 respectively.

for these enzymes were the same among all the showed two main clusters, Cluster І and Cluster ІІ. isolates in the study, whereas Okabe et al. (1998) Cluster I contained the isolates CSr 1 CSr 2, CSr 9, divided 67 isolates of the southern blight fungus CSr 10, KSr 15, KSr 17 and Cluster II containing (Sclerotium spp.) from Japan into fi ve groups based the isolates KSr 19 and KSr 20. Th e authors are of on ITS-RFLP analysis of nuclear rDNA. Th ree the opinion that generating more information us- groups were re-identifi ed as S. rolfsii and two re- ing RAPD profi les with diff erent primers and the sembled S. delphinii in RFLP patterns. Almeida nucleotide sequences of ITS regions will lead to et al. (2000) classifi ed 30 isolates of S. rolfsii from the further development of molecular diagnostics Brazil into two groups based on restriction analysis with respect to pathogenic variability and genetic of PCR fragments. In the present study, the den- diversity among S. rolfsii isolates. Molecular charac- drogram developed using ITS sequences of S. rolfsii terisation of fungal pathogens using RAPD marker

TheTR Rovira Rhizosphere R Symposium S 78 profi les and ISSR-PCR analysis has been eff ectively dela-Cueva, F.M. and Natural, M.P. 1994. Cultural, used previously for soilborne fungal pathogens, morphological and pathological variation both to determine their geographic genetic varia- of Sclerotium rolfsii isolated from diﬀ erent tion and identify its relationship to pathogenicity hosts. Philippine Journal of Crop Science 19, (e.g. Back et al. 1999; Stodart et al. 2007). 26. Dhingra, O.D. and Sinclair, J.B. 1995. Basic Plant References Pathology Methods. CRC Press, London, 61 pp. Adandonon, A., Aveling, T.A.S., Merwe, N.A. and Sanders, G. 2005. Genetic variation Freeman, S., Minz, D., Jurkevitch, E., Maymon, among Sclerotium isolates from Benin and M. and Shabi, E. 2000. Molecular analysis South Africa, determined using mycelial of Colletotrichum species from almond and compatibility and ITS rDNA sequence data. other fruits. Phytopathology 90, 608–614. Australian Plant Pathology 34, 19–25. Harlton, C.E., Levesque, C.A. and Punja, Z.K. Akram, A., Iqbal, S.M., Qureshi, R.A. and Rauf, 1995. Genetic diversity in Sclerotium C.A. 2007. Variability among the isolates (Athelia) rolfsii and related species. of Sclerotium rolfsii associated with col- Phytopathology 85, 1269–1281. lar rot disease of chickpea in Pakistan. Mycopathology 5, 23–28. Kulkarni, S., Kulkarni, V.R., Gorawar, M.M. and Hedge, Y.R. 2008. Impact Assessment of Almeida, A.M.R., Abdelnoor, R.V., Calvo, E.S., IDM-Technology Developed for Sclerotium Tessnman, D. and Yorinori, J.T. 2001. Wilt of Potato in Northern Karnataka. Genotypic diversity among Brazilian isolates Technological Bulletin 6. Department of of Sclerotium rolfsii. Journal of Phytopathology Plant Pathology, College of Agriculture, 149, 493–502. University of Agricultural Sciences, Dharward, Karnataka, India. Ansari, M.M. and Agnihotri, S.K. 2001. Morphological, physiological and patho- Mayee, C.D. and Datur, V.V. 1998. Diseases of logical variations among Sclerotium rolfsii groundnut in the tropics. Review of Tropical isolates of soyabean. Indian Phytopathology Plant Pathology 5, 85–118. 53, 65–67. Morris, P.F., Connolly, M.S. and Clair, D.A. 2000. Barnett, H.L. and Hunter, B.B. 1972. Illustrated Genetic diversity of Alternaria alternata Genera of Imperfect Fungi. Burgess isolated from tomato in California using Publishing Company, Minnesota, 225 pp. RAPD. Mycological Research 104, 286–292.

Back, P.A., Landschoot, P.J. and Huﬀ , D.R. 1999. Murray, M. and Th ompson, W.F. 1980. Rapid isola- Variation in pathogenicity, morphology, and tion of high molecular weight plant DNA. RAPD marker proﬁ les in Colletotrichum Nucleic Acids Research 8, 4321–4325. graminicola from turfgrasses. Crop Science 39, 1129–1135. Okabe, I., Morikawa, C., Matsumoto, N. and Yokoyama, K. 1998. Variation in Sclerotium Castro, M.E.A., Zambolim, L., Chaves, G.M., Cruz, rolfsii isolates in Japan. Mycoscience 39, C.D. and Matsuoka, K. 2000. Pathogenic 399–407. variability of Alternaria solani, the causal agent of tomato early blight. Summa Okereke, V.S. and Wokocha, R.C. 2007. In vitro Phytopathologica 26, 24–28. growth of four isolates of Sclerotium rolfsii Sacc. in the humid tropics. African Journal of Cook, R.J. and Duniway, J.M. 1980. Water rela- Biotechnology 6, 1879–1881. tions in the life cycles of soil-borne plant pathogens. In: Parr, J.F., Gardner, W.R. and Punja, Z.K. and Sun, L.J. 2001. Genetic diversity Elliott, L.F. (eds) Water Potential Relations among mycelial compatibility groups of in Soil Microbiology. Soil Science Society of Sclerotium rolfsii (teleomorph Athelia rolfsii) America. Madison, WI. 9, 119–139. and Sclerotium delphini. Mycological Research 105, 537–546.

TheTR Rovira Rhizosphere R Symposium S 79 Ramsay, J.R., Multani, D.S. and Lyon, B.R. 1996. Shukla, R. and Pandey, A.K. 2008. Pathogenic RAPD-PCR identifi cation of Verticillium diversity of Sclerotium rolfsii isolates, dahliae isolates with diff erential patho- a potential biocontrol agent against genicity on cotton. Australian Journal of Parthenium hysterophorus L. African Journal Agricultural Research 47, 681–693. of Environmental Science and Technology 2, 124–126. Rangaswami, G. and Mahadevan, A. 1999. Diseases of Crop Plants in India. Prentice Hall of Stodart, B.J., Harvey, P.R., Neate, S.M., Melanson, India Pvt Ltd, New Delhi, pp. 61–62. D.L. and Scott, E.S. 2007. Genetic variation and pathogenicity of anastomosis group 2 Sarma, B.K., Singh, U.P. and Singh, K.P. 2002. isolates of Rhizoctonia solani in Australia. Variability in Indian isolates of Sclerotium Mycological Research 111, 891–900. rolfsii. Mycologia 94, 1051–1058. White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Saude, C., Melouk, H.A. and Chenault, K.D. 2004. Amplifi cation and direct sequencing of fun- Genetic variability and mycelial compatibili- gal ribosomal RNA genes for phylogenetics: ty groups of Sclerotium rolfsii. Phytopathology In: Inns, M.A., Gelfard, D.H., Sinisky, J.J. 94, S 92. and White, T.J. (eds) PCR Protocols: A Guide Schilling, A.G., Moller, E.M. and Geiger, H.H. to Methods and Applications. Academic Press, 1996. Polymerase chain reaction-based assays London, pp. 315–322. for species-specifi c detection of Fusarium culmorum, F. graminearum and F. avenaceum. Phytopathology 86, 515–522.

Shokes, F.M., Rhogalski, K., Gorbet, D.W., Brenneman, T.B. and Berger, D.A. 1996. Techniques for inoculation of peanut with Sclerotium rolfsii in the greenhouse and ﬁ eld. Peanut Science 23, 124–128.

TheTR Rovira Rhizosphere R Symposium S 80 Development of a microbial indicator database for validating measures of sustainable forest soils

Richard S. Winder1,2, Phyllis L. Dale1, Charles W. Greer3 and David J. Levy-Booth1

Abstract nine varied with season, four varied with site productivity, and three (a Paenibacillus sp., an EdIRT (Edaphic Indicator Research Tool) unidentifi ed member of the Intrasporangiaceae, is a database of microbial indicators of soil and an unidentifi ed diazotrophic bacte- status, designed to assist in the validation of rial species) were indicators of clear-cutting. forest soil conservation eff orts. Th e database Taxonomic analysis of sequences in EdIRT re- prototype was developed using Microsoft Inc. vealed some clustering of diazotrophic bacteria (MS) Access, with regular migration to an sequences related to the level of tree removal open-source version using a structured query and season. Further expansion of EdIRT will language (MySQL). To enable future web allow for increased utility of the dataset in vali- access, a browser-accessible interface was devel- dating forest soil conservation eff orts. oped for the MySQL version of the database, using a mixture of personal home page language Introduction (PHP), cascading style sheet language (CSS), Soil fertility is a prerequisite for sustainable forest and hyper-text markup language (HTML). ecosystems. One way to measure soil fertility is to To enable queries for genetic sequences, a measure the amount of available nutrients (N, P, K, ‘Pattern Recognition Algorithm for Microbes’ etc.). Th is approach takes a ‘snapshot’ of soil status; (PRAM) was developed by modifying the it is a reasonable method for assessing general soil Boyer-Moore algorithm. Th e database catalogs conditions at a point in time. Other indicators such source information, genetic features, biochemi- as soil moisture and bulk density measurements cal and physiological attributes, and functional can be helpful in determining the extent of distur- signifi cance of microbial indicators. EdIRT bance impacts and some underlying mechanisms of currently comprises a relatively modest dataset disturbance. Th ese approaches are inexpensive and of 105 genetic sequences for microbial indica- provide immediate answers concerning soil condi- tors of site productivity and tree loss in coastal tions. However, they do not necessarily demonstrate Douglas-fi r forests of British Columbia (BC). sustainability, because they do not reveal underlying When 46 indicator sequences from EdIRT were mechanisms controlling the dynamics of nutrient used to re-evaluate source soils using molecu- cycles, nor do they necessarily predict soil status in lar microarrays, 28 were actually ubiquitous, the long term. For example, forest sites with low available soil N might or might not have a problem with soil fertility, depending on the long-term rate 1 Natural Resources Canada, Canadian Forest Service, of N-fi xation and net N-loss due to denitrifi cation. 506 West Burnside Rd, Victoria, BC. V8Z 1M5 Likewise, sites with good nutrient availability at 2 E-mail: [email protected] early stages of forest succession might not remain 3 NRC-Biotechnology Research Institute, 6100 that way; if the diversity of key microbe commu- Royalmount Avenue, Montréal, Québec H4P 2R2

TheTR Rovira Rhizosphere R Symposium S 81 nities is reduced; their function at later stages of the comparison of indicator suites or profi les in a succession may be impaired or degraded. Th us, ques- complex, diverse environment where the occurrence tions remain concerning the long-term impact of of individual indicators may be highly variable. All various types of forest disturbance, including forest of these things would benefi t researchers and for- management practices such as variable tree reten- est managers seeking to understand the behavior tion and clear-cutting. of these indicators in edaphic environments. We developed and tested a database to expedite the use Soil microbes (bacteria, fungi and protista) are of microbial indicators in validation of soil health much more prevalent than other potential indica- measurements for sustainable forest management. tors, in some cases approaching 10 000 diff erent species per gram in forest soil (Chatzinotas 1998; In British Columbia, Canada (BC), forest soil Quince et al. 2008). Microbes are a very attractive conservation guidelines are detailed in the Forest measure of soil health because they are the drivers of Resource Protection Act (FRPA). Th e long-term ob- about 80–90% of all soil nutrient processes (Quince jective of the database development outlined in this et al. 2008). Soil microorganisms are challenging to paper is to support these FRPA guidelines by pro- monitor; only 5–10% of soil bacteria are culturable viding a means to evaluate their eff ectiveness, using according to some estimates (Janssen et al. 2002). microbial indicators of common soil disturbances However, molecular profi ling methods can be used and key nutrient-cycling functions. Th e specifi c to catalogue and understand the taxonomic and short-term objectives of this project were to: functional diversity of soil microorganisms, which can help elucidate the functional behavior of these • develop a microbial indicator database called communities. Th ere is currently a lack of data re- EdIRT (the Edaphic Indicator Research Tool) garding links between microbiological diversity and using Microsoft © (MS) AccessTM (Microsoft ecosystem function. Changes to microbiological Corp., Redmond, WA, USA) diversity can be linked to alterations in ecosystem • develop a personal home-page language (PHP)- process rate changes (Allison and Martiny 2008), based interface for an open-source version but the high levels of microbial diversity and abun- of EdIRT permitting sequence queries and dance in soil ecosystems can buff er the impacts of Internet browser access disturbance on functional attributes of communities. On the other hand, ecological succession or • test the power of indicators in EdIRT using disturbance in soil ecosystems may open or close taxonomic analyses and a DNA microarray microbial niches, allowing specifi c groups of mi- assay. croorganisms to increase or decrease in abundance. Th e ability to detect and catalogue the changes Materials and methods to microbial community structure may aid in the Database development identifi cation of specifi c DNA sequences linked to dynamic microbial populations. Large-scale EdIRT was developed as a relational database to fl uctuations in these dynamic microbes potentially catalog source information, genetic sequences, have important impacts on soil fertility, but they biochemical attributes, physiological attributes and cannot be fully understood until the key species are functional information associated with microbial detected and catalogued for further evaluation in indicator signals (Fig. 1). EdIRT was initially de- quantitative studies. Databases are tools that can be veloped using commercial soft ware (MS AccessTM). used to gather indicator information to one com- Th is soft ware allowed the development of custom mon point of reference, to increase the power of data entry forms and simple custom queries that analyses and to improve the long-term prospects for could be associated with the data tables. It was practical extension of results (e.g., validation of soil necessary, however, to develop an alternate ver- indicator methodologies). Th rough amassing micro- sion to facilitate eventual Internet access and more bial DNA sequence data and associated information advanced queries relating to DNA sequences. concerning environmental conditions, research- Commercial soft ware (DBManager 3.1.0, DBTools ers can potentially fi lter these data, using selected Inc., Brazil) was used to migrate data from Access environmental criteria to uncover trends of func- tables to a MySQL 5.0 library of tables accessible tional signifi cance. Moreover, databases facilitate through an Apache 2.0 hyper-text markup language

TheTR Rovira Rhizosphere R Symposium S 82 Collection, extraction and Sample micro- Sample determination of indicator sequences site data inventory data Molecular sequences included in EdIRT were Sub-sample sampled at fi eld sites located on Vancouver Island, Sample site inventory data data BC, Canada. Soil samples were collected in the Experimental Shawnigan Lake (lower productivity) and Sayward conditions Forest (higher productivity) Level of Growth Stock and results data (LOGS) installations with 63- and 61-year-old Primer Sequence Publications Contacts second-growth Douglas-fi r plantations, respectively. data data data data Sampling took place in 0.5-ha second-growth forest plots including organic and mineral soils from External Institutions control, highly (90%) thinned (35-year impact), database data data and recently (< 3 year) clear-cut plots. Because tree roots and mycorrhizae oft en occupy the totality of bulk samples, these were all eff ectively considered Figure 1. An overview of the principal relationships to include rhizospheric species. Ten samples from in the EdIRT relational database each plot were pooled. Th e MoBio UltraCleanTM Microbial DNA Isolation Kit (MoBio© Laboratories Inc., Carlsbad, CA, USA) was used to extract DNA (HTML) server through a PHP-based interface. from the soil samples, modifying the manufac- Th e web-based interface was written using a com- turer’s protocol to remove humic substances. 260 bination of HTML, PHP and cascading style sheet μl of 1x Tris-EDTA (TE) (pH 8) buff er was added (CSS) languages. Th e HTML provides the basic to the post-extracted DNA with 40 μl ammonium structure of each page, while CSS provides a com- acetate buff er and 6 μl of linear polyacrylamide mon design that is easily updated independently of co-precipitant to aid alcohol precipitation of DNA each separate page. Th e PHP language allows server- (Bioline Ltd, London, UK). Th e mixture was incu- side functions by interacting with the MySQL bated at 20°C for 15 min and centrifuged at 12 500 database program. Th is scripting language allows rpm. Th e DNA pellet was isolated and washed with the dynamic queries of a web-user to interact with 70% EtOH, followed by a second centrifuge step. data in a separate database. Th e primary web-based Th e pellet was air-dried and suspended in 50 μl TE. interface fi le, edirt.php, is able to call all other PHP DNA was stored at –20°C prior to PCR. Polymerase interface fi les. Th e edirt.php fi le also coordinates an chain reaction (PCR) amplifi cation and denaturing EdIRT function called the overall pattern recogni- gradient gel electrophoresis (DGGE) analysis were tion algorithm for microbes (PRAM). When the performed using oligonucleotide primer sets de- PRAM is activated, edirt.php calls sequencesearch. scribed in Tables 1 and 2. php, which in turn calls the fi le functions.php and DGGE was performed using the BioRad© (Hercules, its pattern recognition algorithms. With some CA, USA) Universal Mutation Detection SystemTM modifi cations, PRAM functions are based on the with at 6% (w/v) acrylamide / bisacrylaminde stack- Boyer-Moore algorithm that is also used by the US ing gel with no denaturant and a separating gel of 8% National Center for Biotechnology Information polyacrylamide with a denaturing gradient (urea and discontinuous megaBLAST program1. PRAM com- formamide) of 35–65%. Gels were stained for 20 min pares base pairs of known and unknown sequences, in 1x TAE with SYBR Gold and documented using starting with the 5’ end and skipping non-matching a transillumination system (Syngene, Cambridge, base-pairs. Th e process is repeated with other se- UK). Dominant and unique bands were excised from quences, and a score based on sequence similarity is the acrylamide gel. Excised bands were deposited into obtained. Sequences are displayed in order of their 160 μL sterile dH O and a freeze-thaw cycle was used ranked scores; queries linked to other data tables 2 to physically disrupt the gel as described in Bäckman become available for each specifi ed sequence. et al. (2004). DNA was re-extracted from the dis-

rupted gel and sequenced by Macrogen Inc. (Seoul, 1 Available online at: http://www.ncbi.nlm.nih.gov/ Korea). Post-DGGE DNA extracts were sequenced blast/megablast.shtml and added to the EdIRT database. Currently, thirty

TheTR Rovira Rhizosphere R Symposium S 83 Table 1. Primer sets and functional targets used for PCR-DGGE analysis of soil microbial communities

Primers Functional target(s) Reference 16S – Actinomycete specifi c Multiple functions (e.g. N-fi xation) Heurer et al. 1997 16S – Paenibacillus-specifi c Multiple functions (e.g. N-fi xation) da Silva et al. 2003 16S – N oxidiser specifi cNitrifi cation 16S – CTO β-subgroup Ammonia oxidisers amoA Autotroph. ammonia-oxidisers Stephen et al. 1999 nifH – nitrogenase (universal, Azotobacter) Nitrogen fi xation Bürgmann et al. 2004 nirK – nitrite reductase Denitrifi cation Chénier et al. 2004 18S – fungal specifi c Multiple functions, e.g. mycorrhizae ITS1F Ectomycorrhizal basidiomycetes Gardes and Bruns 1993 NLB4 Ectomycorrhizal basidiomycetes Smit et al. 2003 nifH DNA sequences are also deposited in a public 46 sequences (35-mer) making it to the fi nal stage database (GenBank accession numbers EU730607 (e.g., Table 2) were synthesised by Integrated DNA – EU730636). Technologies (Coralville, IA, U.S.A.), and spotted on microarray slides at the National Research Taxonomic analyses Council Biotechnology Research Institute in Montréal. Cy-5 labeled DNA extracted from posi- Taxonomic analysis was performed with nifH tive controls (Bacillus sp., Frankia sp.), negative sequences obtained from DGGE following their controls (Alcinovorax sp.), and new soil samples deposition into the EdIRT database. Th e sequenced was placed on the slides, hybridised over-night, and nifH gene fragments were aligned with published removed by washing. Th e soil samples corresponded nifH sequences in the GenBank database (http:// to the original isolation sites for the indicators. www.ncbi.nlm.nih.gov/) using the CLUSTAL W Fluorescent spots indicating matching oligomers 2.0.6 program (Th ompson et al. 1994). Phylogenetic were detected with a laser microarray scanner. analysis was performed using the neighbour-joining method on a 323 bp nifH fragment that excluded Results and discussion both primer sites to allow phylogenetic analysis with a maximum number of published nifH refer- EdIRT now contains 105 DGGE-detected DNA ence sequences using BioEdit Sequence Alignment sequences corresponding to microbial indicators Editor 7.0 (Hall 1999) and the TreeView 1.6.6 plug- of forest disturbance in coastal Douglas-fi r forests in using 100 bootstrap replicates. of the Pacifi c Northwest. It currently comprises 29 main data tables (Table 3), six sub-tables, one DNA microarray analysis linking table and one large soil sub-group table ap- plicable to Canadian soil classes. A DNA (35-mer) microarray was constructed from sequences in EdIRT (Table 2). From excised Taxonomic analysis of sequences in EdIRT revealed DGGE bands, 19 Eubacterial, 19 Paenibacillus sp., that some sequences corresponding to diazotrophic 15 Acintomyces and 28 nifH bands were chosen as bacteria clustered according to the level of tree re- candidates for use in the microarray. Sequences were moval and season (Fig. 2). compared for areas of divergence from homologous In the DNA microarray assays, no negative controls sequences. Contiguous 35-nucleotide sequences fl uoresced and all positive controls successfully were located in divergent areas to obtain sequence- hybridised with their intended targets, although specifi c oligomers. Th e oligomers were checked for cross-reactivity between a labeled Frankia spp. cross-reactivity, hairpin formation and melting nifH-oligomers and 16S DNA from an uncultured temperature. Any potential oligomers that formed Acinetobacterium spp. clone was noted. In the as- secondary structures or were not within acceptable say, 28 sequences were ubiquitous, nine varied with thermodynamic parameters were not used. Th e

TheTR Rovira Rhizosphere R Symposium S 84

) ƍ -3 ƍ equence suggested by the NCBI CGGCCGCGGCTGCTGGCACGTA and CGGTGTGTACAAGGCCCGGGAAC G GCGTGTGTACAAGACCC GCRTAIABNGCCATCATYTC and

) Reverse primer(s) (5 ƍ -3 ƍ et al. (2004) Bürgmann 4 Forward primer(s) (5 CCTACGGGAGGCAGCAG CTACCAGGGTATCTAATCC GGATGAGCCCGCGGCCTA and AACGCGAAGAACCTTAC GCTCGGAGAGTGACGGTACCTGAGA AACGCGAAGAACCTTAC GCIWTITAYGGNAARGGNG and GGITGTGAYCCNAAVGCNGA et al. (2003);

3 da Silva 3

2 et al. (1997);

1 Heuer 2 Fa/R and Fb/R Fa/R and Fb/R Fa/R and Fb/R Fa/R and Fb/R Fa/R and Fb/R 515F/R1401 and F968-GC/R1401 515F/R1401 and F968-GC/R1401

341F/907R 341F/907R 3 3 et al. (1993); 16S 341F/907R 16S 16S 16S F234/R1378 and F234/R513 16S 515F/R1401 and F968-GC/R1401 16S nifH 16S 341F/907R 16S 341F/758R 16S 341F/907R 16S 16S 341F/907R nifH

nifH DSM576 strain KNP414 Some of the bacterial indicators from EdIRT included in microarray assay. Sequence identities correspond to most like s et al. (2004) and Muyzer

sp. Fortin Table 2. discontinuous MegaBLAST program. 1 Organism PCR primer set Azotobacter vinelandii Bacillus chitinolyticus B. mucilaginosus Frankia Rhodococcus polyvorum R. rhodocorus Stenotrophomonas sp. FL-2 Luedmannella helvata Paenibacillus hodogayensis P. mendelii P. polymyxa (2 strains) Azorhizobium caulinodans Azospirillum brasilense Bradyrhizobium japonicum nifH Fa/R and Fb/R Burkolderia cepacia Methylocystis sp. LW2 nifH Methylobacterium nodulans nifH

TheTR Rovira Rhizosphere R Symposium S 85 Table 3. Data included in the EdIRT database

Name of data table Description Fields CONTACTS Data contributors 7 INSTITUTIONS Contributing institutions, group or lab 10 PUBLICATIONS Publications associated with the entered data 6 AUTHOR Authors of published articles above 3 CULTURE Culture method and composition 6 PRIMER Primers used for microbial identiﬁ cation methods 8 SEQUENCES DNA sequences 9 TAXONOMY Proposed taxonomy of indicator 13 results_BIOLOG BioLog assay and carbon source results 15 results_ENZYME Enzyme assay results 14 results_MCRARRAY Microarray assay results 13 results_MCRB_BIOMASS Microbial biomass results (carbon measurement) 14 results_PCR Results of PCR-based assays (qPCR, DGGE, T-RFLP, etc.) 20 results_PLFA Results of Phospholipid Fatty-acid Analysis 14 results_SIR Results of Substrate Induced Respiration assays or catabolic 17 proﬁ ling plate assays results_GENERIC Generic results for assays not included above 12 SAMP_INVENTORY Sample description, collection, transport, storage 16 SUBSAMP_INVENTORY Sub-sample description 12 SAMP_SITE Physical, chemical, ecological and climatic attributes of the sample 10 location SAMPSITE_DESCRIP Detailed description of a sample site 14 LRG_TREE_COMP Ten most frequent tree species at the sample site 8 UNDERFSTOREY_COMP Understory bushes, shrubs, herbs, etc. 8 SITE_ORIGIN Origin of vegetation on the sample site 6 SITE_TREAT Treatments applied to the sample site 6 SITE_DISTURB Disturbances experienced at the sample site 6 SAMP_MICROSITE Micro-sites sampled within the larger sample site 19 CONTAMINANTS Description of contaminants at sample site 5 FUNGI_COMP Details of associated fungal species at sample site 7 BACT_COMP Details of associated bacterial species at sample site 7 season, four varied with site productivity, and three est ecosystems, ecological niches and disturbance (a Paenibacillus sp., an unidentifi ed member of types to be addressed in microbial indicator studies, the Intrasporangiaceae, and an unidentifi ed diaz- databases like EdIRT may become increasingly nec- otrophic bacterial species) were consistent indicators essary as gains in the quantity, scope and complexity of clear-cutting at specifi c sites. Th e EdIRT database of the data are realised. Implementation of a public was used to assemble sequence profi les according to (online) version of EdIRT is pending several refi ne- associated edaphic factors, supporting the developments, including French translation modules and ment of molecular tools designed to detect potential adjustment of the input–output architecture of the indicators of environmental disturbance, for ex- PHP interface. Further expansion of EdIRT will al- ample clear-cut logging. While the use of a database low for increased utility of the dataset in evaluating may not be required for selecting a small number of forest soil conservation eff orts in BC, Canada, and sequences to use in a small microarray, EdIRT has throughout the world’s forests. the potential to facilitate the analysis and validation of edaphic microbial indicators in much larger datasets and arrays. Given the vast number of for-

TheTR Rovira Rhizosphere R Symposium S 86 Frankia sp. X73983 Frankia sp. X76399 Clostridium pasteurianum X07472 Clostridium pasteurianum X07475 Trichodesmium sp. L00688 Trichodesmium thiebautii M29709 Klebsiella pneumoniae V00631 Alcaligenes faecalis X96609 Azotobacter chroococcum MCD 1 X03916 Azotobacter vinelandii M20568 Burkholderia cepacia S7 2 AM110713 Herbaspirillum seropedicae Z54207 Bradyrhizobium japonicum USDA 110 K01620 Thiobacillus ferrooxidans M15238 Azorhizobium caulinodans str. ORS571 M16710 Rhodobacter capsulatus str. SB1003 X07866 Rhodospirillum rubrum M33774 Sinorhizobium fredii str. QB1130 L16503 Rhizobium sp. str. ANU240 M26961 Rhizobium etli bv. phaseoli M10587 Rhizobium leguminosarum bv. trifolii K00490 Azospirillum brasilense ATCC 29145 M64344 Azospirillum brasilense str. Sp7 X51500 Su04-Sy-CCm [Band 7] EU730635 Su04-Sy-CTm [Band 3] EU730631 Su04-Sy-CTm [Band 2] EU730630 Su04-Sy-CTm [Band 4] EU730632 Su04-SL-CTm [Band 5] EU730633 Sp05-SL-CTm [Band 20] EU730636 Su04-Sy-CTm [Band 1] EU730629 Su04-Sy-CCm [Band 6] EU730634 Fall04-SL-CTm [Band 9] EU730627 Fall04-SL-CTm [Band 8] EU730628 Sp05-Sy-CTm [Band 12] EU730609 Sp05-SL-CTm [Band 17] EU730614 Sp05-Sy-CTm [Band 13] EU730610 Sp05-Sy-CTm [Band 11] EU730608 Sp05-SL-CTm [Band 18] EU730615 Sp05-Sy-CCm [Band 1] EU730617 Sp05-SL-CTm [Band 19] EU730616 Sp05-Sy-CTm [Band 15] EU730612 Sp05-Sy-CTm [Band 14] EU730611 Distance Sp05-SL-CTm [Band 16] EU730613 Sp05-Sy-CTm [Band 10] EU730607 0.1 Fall04-Sy-CTm [Band 10] EU730626 Sp05-Sy-CCm [Band 4] Sp05-Sy-CCm [Band 2] EU730618 Sp05-SL-CCm [Band 5] EU730621 Sp05-SL-CCm [Band 6] EU730622 Sp05-SL-CCm [Band 9] EU730625 Sp05-Sy-CCm [Band 3] EU730619 Sp05-SL-CCm [Band 7] EU730623 Sp05-SL-CCm [Band 8] EU730624

Figure 2. Cluster analysis of of sequenced nitrogenase reductase (nifH) from diazotrophic bacteria currently in EdIRT. Th e nifH gene fragments (position: 131-334 bp from start of Azotobacter vinelandii (M20568) nifH sequence) from Douglas-ﬁ r forest plots compared to known nifH sequences obtained from GenBank. Sequences were obtained following direct ampliﬁ cation from isolated DGGE bands from mineral layer soil DNA extractions from summer 2004(Su04), fall 2004 (Fall04) and spring 2005 (Sp05) sampling dates at Shawningan Lake (SL) or Sayward Forest (Sy) sites in clearcut (CC; underlined) or unthinned control (CT; grey italics) plots. GenBank accession numbers are listed beside their respective nifH sequence. Frankia sp. (X73983, X76399) were used for the out-group.

TheTR Rovira Rhizosphere R Symposium S 87 Acknowledgments Fortin, N., Beaumier, D., Lee, K. and Greer, C.W. 2004. Soil washing improves the recovery of Funding for EdIRT development came from total community DNA from polluted and the CFS Enhanced Pest Management Methods high organic content sediments. Journal of Program and the British Columbia Forest Science Microbiological Methods 56, 181–191. Program. Portions of EdIRT were developed with the aid of CLPP profi les provided by Dr Sue Gardes, M. and Bruns, T. 1993. ITS primers with Grayston (UBC). We thank Sandra Eades, Ryan enhanced specifi city for basidiomycetes-ap- Miller, Alex Gauld, Eric Bol and Shannon Berch for plication to the identifi cation of mycorrhizae and rusts. Molecular Ecology 2, 113–118. technical assistance. Hall, T.A. 1999. BioEdit: a user-friendly biological References sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Allison, S.D. and Martiny, J.B.H. 2008. Resistance, Symposium Ser. 41, 95–98. resilience, and redundancy in microbial communities. Proceedings of the National Heurer, H., Krsek, M., Baker, P., Smalla, K. and Academy of Science 1051 (Suppl. 1), 11512– Wellington, E. 1997. Analysis of actinomy- 11519. cete communities by specifi c amplifi cation of genes encoding 16S rRNA and gel-electro- Bäckman, J.S.K., Klemedtsson, A.K., Klemedtsson, phoretic separation in denaturing gradients. L. and Lindgren, P-E. 2004. Clear-cutting Applied and Environmental Microbiology 63, aff ects the ammonia-oxidizing community 3233–3241. diff erently in limed and non-limed conifer- ous forest soils. Biology and Fertility of Soils Janssen, P.H., Yates, P.S., Grinton, B.E., Taylor, 40, 260–267. P.M. and Sait, M. 2002. Improved cul- turability of soil bacteria and isolation Bürgmann, H., Widmer, F., Von Sigler, W. and in pure culture of novel members of the Zeyer, J. 2004. New molecular screening divisions Acidobacteria, Actinobacteria, tools for analysis of free-living diazotrophs in Proteobacteria, and Verrucomicrobia. soil. Applied and Environmental Microbiology Applied and Environmental Microbiology 68, 70, 240–247. 2391–2396.

Chatzinotas, A., Sandaa, R., Schönhuber, W., Muyzer, G., De Waal, E.C. and Uitterlinden, Amann, R., Daae, F., Torsvik, J., Zeyer, J. A.G. 1993. Profi ling of complex micro- and Hahn, D. 1998. Analysis of broad-scale bial populations by denaturing gradient diff erences in microbial community compo- gel electrophoresis analysis of polymerase sition of two pristine forest soils. Systematic chain reaction-amplifi ed genes coding for and Applied Microbiology 21, 579–587. 16S rRNA. Applied and Environmental Microbiology 59, 695–700. Chénier, M., Baumier, D., Roy, R., Driscoll, B., Lawrence, J. and Greer, C. 2004. Impact of Quince, C., Curtis, T.P. and Sloan, W.T. 2008. Th e seasonal variations and nutrient inputs on rational exploration of microbial diversity. nitrogen cycling and degradation of hexade- Th e ISME Journal 2, 997–1006. cane by replicated river biofi lms. Applied and Environmental Microbiology 69, 5170–5177. Smit, E., Veenman, C. and Baar, J. 2003. Molecular analysis of ectomycorrhizal basidiomycete da Silva, K., Salles, J., Seldon, L. and van Elsas, J. communities in a Pinus sylvestris L. stand 2003. Application of a novel Paenibacillus- reveals long-term increased diversity after re- specifi c PCR-DGGE method and moval of litter and humus layers. Federation sequence analysis to assess the diversity of of European Microbiological Societies (FEMS) Paenibacillus spp. in the maize rhizosphere. Microbiology Ecology 45, 49-57. Journal of Microbiological Methods 54, 213–231.

TheTR Rovira Rhizosphere R Symposium S 88 Stephen, J., Chang, Y., Mcnaughton, S., Kowalchuk, Th ompson, J.D., Higgins, D.G., and Gibson, T.J. G., Leung, K., Flemming, C. and White, D. 1994. CLUSTALW: improving the sen- 1999. Eﬀ ect of toxic metals on indigenous sitivity of progressive multiple sequence soil beta-subgroup Proteobacterium ammonia alignment through sequence weighting, oxidizer community structure and protection position-speciﬁ c gap penalties and weight against toxicity by inoculated metal-resis- matrix choice. Nucleic Acids Research 22, tant bacteria. Applied and Environmental 4673–4680. Microbiology 65, 95–101.

TheTR Rovira Rhizosphere R Symposium S 89 Long-term international research cooperation between China and Australia on soil biology in agriculture

Maarten H. Ryder1 and Tang Wenhua2

Abstract Subsequent bilateral R&D has been supported by grants from AusIndustry and the Ministry Research cooperation between CSIRO Division of Science and Technology (MOST) in China of Soils and China Agricultural University (2002–2004), followed by a grant from (CAU, formerly Beijing Agricultural University) the Department for Education Science and began following a visit by Dr Albert Rovira Training (DEST) Australia – MOST China to China in 1993. Having identifi ed a com- (2005–2007) and a grant from the Grains mon interest in soil-borne constraints to crop R&D Corporation (GRDC). Collaboration production and the potential benefi ts to crop continues through a current Department of production of exploiting plant-associated mi- Innovation, Industry, Science and Research crobes as inoculants, collaborative research projects have focused on ‘yield-increasing bac- (DIISR) (Australia) – MOST (China) grant teria’ (YIB), and biological control agents for to CSIRO and three institutes in China to soil-borne diseases of crops. Initially a one-year work on molecular mechanisms in biocontrol pilot project (1994–1995) was supported by the (2008–2010). Australian Centre for International Agricultural Th e research cooperation has led to the pub- Research (ACIAR). Following the success of lication of scientifi c papers and has featured this project, ACIAR supported a larger, longer cooperative research program (1997–2001) on numerous exchange visits, conferences and biological control of soil-borne root diseases. training workshops, supported by ACIAR, Th e research topics of the expanded coopera- the Crawford Fund and Chinese Government tion included (i) the isolation and fi eld testing support for training. In 2005, members of the of biocontrol agents on wheat, cotton and collaboration team played a critical role in the vegetables, (ii) investigation of mechanisms in organisation and delivery of a Crawford Fund growth and yield promotion, (iii) the microbial Master Class on soil-borne diseases of wheat in ecology of biocontrol agents and (iv) the ecology China. Subsequently there has been a broaden- of soil-borne plant pathogens. Some commercial ing of the Australia–China collaboration to development of microbial treatments in China include the impact and control of cereal cyst came from the collaborative research eff ort. nematode in China. Th e long-term collaboration has been benefi cial to both China and Australia and has the potential to make signifi -

1 Ryder Research, PGB Box 1152, Aldinga Beach, cant further contributions to improving crop South Australia 5473, Australia health and yield in both countries. Email: [email protected] 2 Department of Plant Pathology, China Agricultural University, Beijing, PR China Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 90 Introduction ability of these microbial treatments to control economically important crop root diseases such as Australia and China share a strong interest in im- take-all (China and Australia) and sharp eyespot of proving the effi ciency of crop production to improve wheat (China only). the eff ectiveness of land and resource use. One aspect of improved effi ciency is increasing water-use At fi rst, isolates of Trichoderma, Bacillus and effi ciency by crops. Many factors determine water- Pseudomonas were tested in glasshouse experiments use effi ciency by a crop, including root growth and and then some of these ‘biocontrol microbes’ were root health. In situations where there is severe root formulated for seed application and tested in fi eld disease or where there are other soil-borne con- trials in China. Th e results of these early tests were straints to root growth, water-use effi ciency can be quite promising, with good levels of disease control dramatically reduced. and plant growth promotion (see papers in Tang et al. 1996). Optimum root health and root growth, to support good yields, can be best achieved by a combination Th e Chinese YIB strains proved to be very eff ective of good soil structure (soil physics), good nutrition at promoting plant growth in glasshouse experi- (soil chemistry) and an active soil food web and lack ments in Australia (Ryder et al. 1999), but fi eld tests of pathogens (soil biology). were not so successful. Th is is likely to be due to the very diff erent conditions encountered in the fi eld in Since the 1980s, Chinese scientists had been re- Australia (mainly dryland or rain-fed cereal produc- searching and using ‘Yield-increasing bacteria’ or tion) compared to those in China, where there is ‘YIB’ (Mei et al. 1990; Mei 1991). Th ese YIB were much irrigated cereal production. plant-associated isolates of Bacillus, mainly B. cere- us. Th e YIB were applied to many crops in the fi eld On the basis of success in the pilot project, a larger and millions of hectares of crop were treated: for cooperative project (Phase 2) was proposed by the example there are reports of 40 million ha treated project leaders, Professor Tang and Dr Ryder. by 1994 (see papers in Tang et al. 1996). Average yield responses reported for the use of YIB ranged Research cooperation Phase 2 from 11% with wheat to 25% with vegetables (Mei et al. 1990; Mei 1991). Between 1997 and 2001 a larger ACIAR- funded project was established (ACIAR During a lecture tour of China by Dr Albert project LWR2/1996/080). In this cooperative Rovira in 1993, a common interest in plant growth- project, the scope and number of partner organi- promoting soil microbes was identifi ed. Dr Rovira sations was broadened. Th e partners were China (at that time the director of the Cooperative Agricultural University (CAU), Chinese Academy Research Centre for Soil and Land Management) of Agricultural Sciences (CAAS) and Zhejiang and Professor Tang Wenhua of Beijing Agricultural Agricultural University (ZAU, now Zhejiang University mooted the concept of establishing a University) in China and CSIRO Division of Soils joint research project. A cooperative research proj- (later CSIRO Land and Water) and the Australian ect was established the following year, with funding Cotton Research Institute (ACRI) in Australia. Th e from the Australian Centre for International teams were led by Professor Tang Wenhua (CAU), Agricultural Research. Dr Peng Yufa (CAAS), Professor Zhang Bingxin (ZAU), Dr Subbu Putcha (ACRI) and Dr Maarten Research and development Ryder (CSIRO). cooperation Th e research aims of the larger ACIAR project were to: Research cooperation Phase 1 • test the eff ectiveness and reliability of Th e aims of the initial research project were to promising biological control agents for take-all exchange benefi cial soil bacteria and fungi be- and Rhizoctonia diseases of wheat under fi eld tween the CSIRO Division of Soils in Australia conditions and Beijing Agricultural University (now China Agricultural University) in China and to test the

TheTR Rovira Rhizosphere R Symposium S 91 • evaluate biological agents for reliable Trichoderma spp. produced progeny that had im- control of damping-off on solanaceous and proved biocontrol ability. Th is research was done by cucurbitaceous vegetables Dr Yang Hetong, SDAS, while visiting CSIRO. • evaluate the potential for biological control of damping-off and Verticillium wilt of cotton Biocontrol of damping-off diseases of solanaceous and cucurbitaceous vegetables • investigate the biological basis for biocontrol of soil-borne diseases and plant growth A number of new bacterial isolates were identifi ed promotion. that had good ability to control damping-off dis- Th e overall aim was to reduce the need for chemical eases of vegetables. Microbial ecology techniques fungicides or for cultivation treatments that could were taught by CSIRO scientists and were used lead to soil erosion by developing eff ective and reli- extensively in this part of the research program able microbial treatments that farmers could use to at ZAU, led by Professor Zhang Bingxin. Th is in- control soil-borne root diseases of the target crops. cluded tracking of biocontrol agents in the soil and on plant roots using marker genes and an investigation of the ecology of the damping-off pathogen Outputs and some of the main fi ndings Pythium. Biocontrol of take-all and rhizoctonia on wheat Work towards commercialising biocontrol in China Biocontrol of damping-off and verticillium wilt culminated in the pre-registration of a formulated of cotton product of CSIRO’s Trichoderma koningii (Tk 7a) Excellent control of cotton seedling disease by binu- by the CAU team. A licence agreement between cleate (non-pathogenic) Rhizoctonia was discovered. CAU and CSIRO was signed at one of the sessions of the fi nal review meeting in Beijing in 1999. One Biological basis for disease control and or of the benefi ts of the bilateral cooperation was the growth promotion input of Chinese expertise in the formulation of biocontrol micro-organisms into products that Both the CAU and CSIRO groups demonstrated could be used by farmers. A commercial product a role for antibiotics produced by selected CAU based on the benefi cial fungus Trichoderma Tk 7a strains of Bacillus subtilis in their capacity to control was produced and sold in China by the MinFeng root disease, and that this mechanism is indepen- company (Shandong province) in 1999 and 2000. dent of their plant growth promoting ability (this In addition, the Tk7a organism that had been was only the second demonstration of this concept formulated by the Chinese methods was used in for Bacillus, worldwide). experimental trials in Australia between 1999 and 2002. Identifi cation of common root rot problem in Scientists at CAU developed a new bacterial biocon- dryland wheat production trol treatment that came from a disease-suppressive Cooperation between CAU and CSIRO scientists soil in Shandong province. Th e particular strain in 1998 led to the identifi cation of a widespread of Pseudomonas, CPF 10, was patented and regis- and serious problem with common root rot (a fun- tered in China for the control of bacterial wilt of gal disease) in Shanxi province in central western ginger. Another soil bacterium, Pseudomonas Pf China. Th is soilborne disease constraint had not P303, which was isolated by CAAS scientists, gave previously been identifi ed. good yield responses (11–23%) in large-scale fi eld trials (2100 ha) in China, when used individually A report on this Phase 2 project, covering the ap- and in combination with the chemical fungicide plication of the research as well as training and ® Bayleton . exchange visits, was included in an ACIAR Project A new selective medium was developed for Adoption Study (Ryder 2005). Th e research carried Trichoderma spp. to allow isolation of the fungus out under the fi rst two cooperation projects from from soils where it exists in low levels. New poten- 1994 to 2001 generated 39 scientifi c papers, which tial biocontrol agents (Trichoderma and Bacillus) are listed at http://www.clw.csiro.au/publications/ were isolated from a disease-suppressive soil in consultancy/2003/ACIAR_report_App1only.pdf. South Australia. Finally, protoplast fusion of

TheTR Rovira Rhizosphere R Symposium S 92 Research cooperation Phase 3 initial set of tests gave promising results, which have since been followed up with testing of Chinese soils Following the research projects funded by ACIAR, for nematodes that attack the roots of cereal crops. several of the collaborating institutes sought and found funding to continue the collaboration. Th e fi rst of these was a bilateral project funded Research cooperation Phase 4 by AusIndustry and the Ministry of Science and Aft er 2002, research cooperation on soil biology in Technology (MOST) in China (AusIndustry agriculture expanded to include more scientists and project CH020003). Th is two-year cooperation institutes in both China and Australia. (2002–2004) was aimed at connecting research and industry in both countries, to facilitate the commer- From 2003 to 2006, the Grains R&D Corporation cial development of biological control agents. in Australia supported a collaborative project involving SARDI (Dr Steve Barnett) and the SDAS Th e title of the project was ‘Commercial application (Dr Yang Hetong) on the topic ‘TRINOC: Tri- of disease control biotechnology to increase crop inoculation for enhanced growth of wheat under productivity’ and the main partner institutes were disease-limiting conditions’. Under this project, CAU and CSIRO, with industry collaborators the a visiting scientist from SDAS (Guo Yong) spent Qinhuangdao Leading Science and Technology a year at SARDI working on the formulation of a Company in China and Bio-Care Technology Pty mixture of organisms for the control of rhizoctonia Ltd in Australia (later Becker Underwood Australia bare patch disease. Pty Ltd). Currently (2008–2010), the international col- Th e partner companies received, from the research laboration continues through a project entitled institutes, microbial cultures for formulation devel- ‘Molecular mechanisms involved in biological opment and testing, as well as extensive sets of data control of root diseases by novel microbial in- on performance of microbial cultures in control- oculants’. Th is is a joint project involving CSIRO ling disease. Th rough this process, some biocontrol Entomology (Dr Paul Harvey) and Hebei Academy agents such as Trichoderma Tk7a were found to of Agricultural and Forest Sciences (Dr Ma Ping) as have a broader spectrum of disease control activity well as the SDAS (Dr Yang Hetong) and CAU (Dr than was previously recognised. Th e project fostered Zhang Liqun). Th e project is fi nancially supported active links between science and industry, but it was by the Department of Innovation, Industry, Science recognised that the decision to develop a microbial and Research (DIISR, Australia) and MOST in treatment into a saleable product ultimately lies China under the Australia–China Special Fund with the commercial organisation. for Scientifi c and Technological Cooperation. Th e A second bilateral project (2005–2007), entitled project involves workshops, exchange of technical ‘New microbial inoculants and monitoring tools information and active research cooperation at the for agriculture via the formal establishment of laboratory and fi eld level. joint research and development facilities’, was Aft er the Crawford Master Class on soil-borne jointly funded by the Department for Education diseases of wheat (China 2005), collaboration Science and Training (DEST project CH040109) between SARDI (Dr Ian Riley, Dr Kathy Ophel- in Australia and MOST in China. Under this Keller and others) and Chinese institutes (CAAS, project, a formal cooperation agreement between CAU and others) was established on evaluating CSIRO and SDAS was signed in September 2005. the signifi cance of and ways to control cereal cyst Th is coincided with an article about our long-term nematode in China. Th is collaboration also includes cooperation in a booklet that celebrated 30 years of the International Maize and Wheat Improvement CSIRO’s involvement in China (CSIRO 2005). Center (CIMMYT) (Dr Julie Nicol). Also under the auspices of this project, Chinese soil samples were analysed in Australia for plant Workshops and symposia pathogens using the South Australian Research and Development Institute (SARDI)–CSIRO During the course of the various collaborative proj- DNA-based Root Disease Testing Service (avail- ects since 1994, members of the cooperating teams able commercially in Australia as ‘Predicta-B’). Th is have organised a number of conferences, symposia

TheTR Rovira Rhizosphere R Symposium S 93 and workshops. Th ese gatherings have been signifi - one of the reasons why the cooperation has contin- cant in bringing people together, allowing exchange ued successfully for such a long period. of information and fostering progress in the joint scientifi c research. For example, during phase 2 (the larger ACIAR- funded project), three Chinese scientists (Yang In 1996, an important international conference Hetong, Tu Haidy and Lou Binggan) each spent on biological control of plant disease was held in 9 –12 months working at CSIRO in Adelaide. Beijing. Th e conference was instigated by Professor Albert Rovira and Maarten Ryder each spent three Tang Wenhua and the committee also included months in China (in 1997 and 1998 respectively), Dr Albert Rovira and Dr R. James Cook (USDA, where they worked closely in the laboratory with USA) as leaders. About half of the conference the Chinese research teams and gave lecture series. delegates were from China and half from other Th ey worked mainly at ZAU in Hangzhou, but also countries. Th e proceedings of this conference were in Beijing and Shandong Province. At Hangzhou, published by CAU press (Tang et al. 1996). one of the main tasks was to assist with re-starting a biocontrol research program. Stephen Neate and Th e fi nal review meeting for project Paul Harvey each spent several weeks in China in LWR2/1996/080 in Beijing in November 1999 1998 and 1999 respectively, to visit fi eld sites and to consisted of two days of research presentations of give lectures. a very high standard. Th e project was evaluated by two independent reviewers at this workshop and Another example is the more recent collaboration teams were given a substantial amount of positive between SARDI and SDAS in which a Chinese feedback for their achievements. scientist spent over nine months working at SARDI in Adelaide. Th ese longer-term visits have enabled In November 2002, under the AusIndustry–MOST strong relationships to be built, and have led to a project, a two-day workshop was held in Inner great deal of training and exchange of information, Mongolia on the biological control of root dis- expertise and technology. eases. Scientists from CAU, CSIRO and other partner institutes in China were the presenters Th e Crawford Fund for International Agricultural and over 50 local provincial scientists and govern- Research supported two medium-term visits in ment staff attended. As part of the same bilateral the earlier stages of the collaboration: Professor project, a symposium on ‘R & D on new micro- Peng Yufa visited CSIRO in 1996 (three months) bial inoculants for improved crop productivity to work on microbial ecology of biocontrol agents in China and Australia’ was held at CSIRO in and Professor Li Honglian visited the Australian Adelaide in May 2004. Th e speakers at this sym- Cotton Research Institute in Narrabri in 1998 (four posium were from CSIRO, SARDI, Shanghai months) to carry out research on biocontrol of cot- Academy of Agricultural Sciences, Hebei Academy ton damping-off diseases. of Agricultural and Forest Sciences and Henan Agricultural University. Th ere have been many short-term visits in both directions and these exchange visits continue to To celebrate ten years of research cooperation, a this day, usually at least once a year in each direc- special symposium was held in November 2004 at tion. Th ese trips are essential for maintaining the Biology Research Institute, Jinan, Shandong collaboration: they enable planning, exchange of province. Th ere were six speakers from Australia information, reporting and social interaction. and eight from China. Th e collected papers from this symposium were published in a special issue of A signifi cant event in the long-term collaboration Shandong Science in 2005 (see Ryder et al. 2005). was the Crawford Master Class on ‘Soil-borne pathogens of wheat’ that was held in Zhengzhou, Henan province, in 2005. Th is two-week Master Exchange visits and the training of Class was taught by both Australian and Chinese scientists and students scientists, and was attended by 21 research and extension staff from all of the major wheat-growing One of the achievements of the long-term collabo- provinces of China. A training manual was de- ration is the large amount of time that has been veloped (Nicol and Ryder 2005). A description of devoted to training and exchange visits. Th is is also the Master Class concept and the classes that have

TheTR Rovira Rhizosphere R Symposium S 94 been held in China and other countries is found in and their staff , for their commitment to advanc- the chapter by Nicol et al. (2010, pp. 97–104 this ing research and its application to improve crop volume). growth and yield. We would like to acknowledge the contribution made by Dr Albert Rovira to the As a result of the 2005 Master Class, international cooperation, through his initial visit to China in collaborative research on cereal cyst nematode 1993, his stay at ZAU in 1997, his participation in (CCN) in China has increased. For example, since the Crawford Master Class in Zhengzhou in 2005 2005, further workshops and classes that focused and his continuing support through his role with on this potentially serious pest of wheat have been the Crawford Fund. held in China (Riley et al. 2009), and these events have been supported particularly by CIMMYT, SARDI and the Crawford Fund. Several scientists References from SARDI and the University of Adelaide have CSIRO 2005. Celebrating 30 Years in China. CSIRO visited China to assist with the assessment of CCN Publishing (in English and in Chinese). At: damage to cereal crops across northern China, and http://www.csiro.au/ﬁ les/ﬁ les/p4mo.pdf . with training and planning for the future. Since the 2005 Master Class, Professor Lester Burgess Mei, R.H. (ed.) 1991. Yield-increasing Bacteria. (University of Sydney) has been actively cooperating Chinese Agricultural Publisher, Beijing (in with several institutes in China in the identifi ca- Chinese). tion and control of Fusarium disease of cereals. Th e Mei, R.H., Chen, B., Lu, S. and Chen, Y.X. 1990. Crawford Fund has supported a number of training Field application of yield-increasing bacteria. visits and workshops in the last three years, which Chinese Journal of Microecology 3, 30–34. has further strengthened and broadened the cooperation. Nicol, J.M. and Ryder, M.H. (eds) 2005. Soil-borne Pathogens of Wheat: Training Manual. Th e Conclusions ATSE Crawford Fund, Melbourne.

Considerable progress has been made in scientifi c Nicol, J.M., Burgess, L.W., Riley, I.T. and research and in capacity-building in soil biology Wallwork, H. 2010. ATSE Crawford and crop disease assessment and control, particu- Fund International Master Class series on larly in northern and western China, through the soil-borne pathogens of wheat. In: Gupta, long-term collaborative eff orts of many scientists V.V.S.R., Ryder, M. and Radcliﬀ e, J. and their support staff . Bilateral collaborations be- (eds) Th e Rovira Rhizosphere Symposium. tween China and Australia are continuing strongly. Proceedings, 15 August 2008, SARDI Plant Progress has been made in the application of re- Research Centre, Adelaide. Th e Crawford search to disease control treatments. A particular Fund, Canberra, pp. 97–108. strength of the joint R&D teams is the breadth Riley, I.T., Li Honglian and Tang Wenhua 2009. of the collaboration (i.e., number of institutes in- Impact of international training on soil- volved) and the strong continuing focus on training borne pathogens of wheat in China, with and the sharing of ideas, knowledge and technology. special consideration of cereal cyst nematode (Heterodera avenae). A report to Th e ATSE We can ask ‘Why has this cooperation been success- Crawford Fund, Deakin ACT. ful and so long-lived?’ We think that there are two parts to the answer: fi rstly we have common goals Ryder, M. 2005. Increasing crop productivity (improving crop growth and yield through har- through biological control of soil-borne root nessing benefi cial soil biota), and secondly we have diseases (LWR2/9680). In: McWaters, V., developed trust and an ability to work together. Hearn, S. and Taylor, R. (eds) Adoption of ACIAR Project Outputs: Studies of Projects Acknowledgements Completed in 2000–2001. ACIAR Canberra, pp. 55–62. At: http://aciar.gov.au/publica- Th e authors wish to acknowledge the contribution/AS_00-01. tions made to the long-term collaboration by many scientists and administrative staff in both China and Australia, and thank the research team leaders,

TheTR Rovira Rhizosphere R Symposium S 95 Ryder, M.H., Yan, Z., Terrace, T.E., Rovira, A.D., Tang, W., Cook, R.J. and Rovira, A.D. (eds) 1996. Tang, W.H. and Correll, R.L. 1999. Use Advances in Biological Control of Plant of strains of Bacillus isolated in China to Diseases. China Agricultural University suppress take-all and rhizoctonia root rot, Press, Beijing. and promote seedling growth of glasshouse- grown wheat in Australian soils. Soil Biology and Biochemistry 31, 19–29.

Ryder, M., Warren, R., Harvey, P., Tang Wenhua, Yang Hetong, Zhang Xia and Zhang Bingxin 2005. Recent advances in biological control of soil-borne root diseases of wheat, vegetables and cotton in China and Australia. Shandong Science 18, 3–8.

TheTR Rovira Rhizosphere R Symposium S 96 ATSE Crawford Fund International Master Class series on soil-borne pathogens of wheat

Julie M. Nicol1,2, Lester W. Burgess3, Ian T. Riley4,5 and Hugh Wallwork5

Abstract Introduction Th ree International Master Classes on Soil- Root, crown and stem diseases caused by soil-borne Borne Pathogens of Wheat have been sponsored fungi and plant parasitic nematodes, known collec- through the ATSE Crawford Fund’s Master tively in this paper as soil-borne pathogens (SBPs), Class Program. Th ese were held in Turkey in are one of the most economically important groups 2003, China in 2005 and Tunisia in 2008. of plant diseases in many crops. Th ey are insidious A total of 63 plant pathologists from over 13 diseases as they cause non-specifi c symptoms of the foliar plant parts, such as stunting, yellowing, countries through the regions of West Asia, premature ripening and reduced yield (Wallwork North Africa, India and China, and Australia, 2000; Coyne et al. 2007; Burgess et al. 2008). Th ese have participated in the program. In addition to foliar symptoms are commonly attributed to other the direct impact of the training on the knowl- causes such as drought stress, waterlogging, nutrient edge and skills of individual trainees, a wide defi ciencies and poor soil structure. Furthermore, range of follow-up activities have ensured con- root, crown and stem symptoms may not be obvi- tinuing beneﬁ ts. Members of the teaching team ous in a cursory examination. Consequently most have continued to mentor and support early- are quite diffi cult for inexperienced pathologists, career trainees through a variety of measures, agronomists, advisors and farmers to diagnose in some of which have also been supported by the the fi eld. Crawford Fund. SBPs are also one of the most diffi cult groups of plant diseases to control. Th e pathogens can persist

in root and stem residues in soil or in specialised 1 CIMMYT (International Maize and Wheat structures in the soil matrix for one to many years. Improvement Centre), ICARDA–CIMMYT Many have a wide host range and some are able to Wheat Improvement Program, CIMMYT Global persist by infecting symptomless crop or weed hosts. Wheat Program, PK 39 Emek 06511 Ankara, Eff ective control of many SBPs depends on the use Turkey of a range of measures. Crop rotation is usually a 2 Email: [email protected] key element of most integrated disease management 3 Faculty of Agriculture, Food and Natural Resources, (IDM) strategies. Although resistant cultivars are Th e University of Sydney, Sydney, NSW 2006, available and eff ective for the control of some spe- Australia cies or formae speciales of SBPs, resistant cultivars 4 School of Agriculture, Food and Wine, Th e have generally proven diffi cult to develop for such University of Adelaide, Adelaide, SA 5005, pathogens. Other IDM measures include modifi ca- Australia tion of agronomic practices such as planting rates 5 South Australian Research and Development and fertilisers to reduce moisture stress and increase Institute, GPO Box 397, Adelaide, SA 5001, plant vigour, and the adoption of no-tillage and Australia stubble-retention practices to improve soil health and increase disease suppressiveness in soils.

TheTR Rovira Rhizosphere R Symposium S 97 Unfortunately, no-tillage and stubble retention Background to the Crawford Fund practices can also lead to signifi cant increases in Master Class program Rhizoctonia and stubble-borne pathogens, such as Fusarium pseudograminearum responsible for Th e ‘master class’ training concept was conceived by crown rot of wheat (Burgess et al. 2001). Chemical Prof. Bruce Holloway, then of Monash University, control measures are used successfully to minimise as the key training initiative on microbial and mo- some diseases caused by SBPs in high-value hor- lecular genetics embedded in Australian Centre for ticultural crops but are generally not available for International Agricultural Research (ACIAR) proj- pathogens of fi eld crops such as wheat, for both eco- ects on bacterial wilt (PN9015 and PN9452). Th ree nomic and practical reasons. Th e success of an IDM classes on microbial and molecular genetics were strategy for these pathogens depends on a thorough held between 1992 and 1994. Th ese classes were knowledge of crop agronomy as well as the biology designed as intensive three-week teaching programs of the pathogen. with an emphasis on interactive teaching techniques, a variety of teaching aids and alternating SBPs aff ect plants in cropping regions around the tutorial room and laboratory sessions. In 1994, the world. Th ey are however oft en neglected in regions President of the Academy of Technological Sciences with limited diagnostic and research resources, and Engineering (ATSE) invited Fellows to suggest regions where the focus is commonly on conspicu- new activities for the Academy. Prof. Holloway pro- ous foliar pathogens such as the rusts, smuts and posed that the Academy set up a program of master leaf spots that can be more readily diagnosed by classes to train scientists and technologists in the foliar symptoms. Furthermore, university and col- South-East Asian region in areas of technology rel- lege courses tend to focus almost entirely on foliar evant to the Academy’s objectives. diseases with root, crown and stem diseases caused by SBPs being considered only on a very superfi cial Following discussions at committee level, Prof. level, if at all. Holloway decided that the focus should be on agricultural biotechnology and the president suggested A number of economically important SBPs of wheat that the Crawford Fund, a part of the Academy, was are collectively of concern world-wide, causing an appropriate administrative organisation for the signifi cant losses in both developing and developed master classes. Prof. Holloway subsequently became countries, particularly under drought stress. Th ey the Coordinator for the Master Class Program, a include the cereal cyst nematodes (Heterodera spp. position he held until 2004. During his tenure he (CCN)), root lesion nematodes (Pratylenchus thor- was responsible for coordinating 24 classes covering nei and P. neglectus (RLN)), the take-all fungus a wide range of scientifi c topics, as well as research (Gaeumannomyces graminis var. tritici (Ggt)), the management in agriculture (Metcalfe et al. 2005). crown rot fungus (F. pseudograminearum), the root Prof. Holloway raised over A$2M from external and foot rot fungus (F. culmorum), the bare-patch agencies to support this training. Dr Paul Ferrar fungus (Rhizoctonia sp.) and the common root rot was the coordinator from 2005 to 2008, during fungus (Bipolaris sorokiniana). Th e diseases caused which time a further seven classes were held. Dr by these pathogens are important in Australia Eric Craswell succeeded Dr Ferrar as coordinator in where they have been studied over a long period. In 2008. A total of 630 trainees were enrolled in the 31 contrast, there has been limited recognition of their classes presented through the program. potential importance in many developing countries, and in many other countries their occurrence and International Master Classes on soil- distribution have yet to be assessed. It is important borne pathogens of wheat to note that many of these SBPs are of economic importance in rainfed or limited-irrigation wheat In 2001, the CIMMYT International Pathology cropping systems where moisture or drought stress Program on soil-borne pathogens was moved from is commonplace, including the dominant wheat- CIMMYT headquarters in Mexico to the regional growing regions of West Asia, North Africa and offi ce in Turkey where Dr Julie Nicol was appointed northern India (Nicol and Rivoal 2008). as the Senior Plant Pathologist. Th e goal was to work collaboratively with the Turkish Ministry of Agricultural and Rural Aff airs (TAGEM), with re- sponsibility for fostering an awareness of the nature,

TheTR Rovira Rhizosphere R Symposium S 98 and potential economic importance and control, Class objectives of SBPs in the rainfed wheat production systems of Th e class was designed, through a series of modules, West Asia and North Africa (WANA). One of the to enhance the ability of trainees to: key responsibilities of the CGIAR (Consultative Group of International Agricultural Research) cen- • understand the biology, pathology and tres such as CIMMYT is to provide opportunities population dynamics of important SBPs, viz., for scientists in national programs to develop their parasitic nematodes and root, crown and stem research skills. rotting fungi of cereals As in Australia, Dr Nicol realised that SBPs were • isolate, extract and identify these SBPs a major constraint to wheat productivity in the • understand the methodologies to scientifi cally rainfed wheat production systems of the WANA establish losses caused by one or several of these region. It was also realised that the small number of SBPs experienced researchers was one of the major limitations to the diagnosis and control of these diseases. • understand the control options for the diff er- Consequently, an urgent need for intensive train- ent SBPs, with an emphasis on the use of host ing in the diagnosis, biology and control of these resistance and other environmentally friendly diseases as well as survey and crop loss assessment control methods techniques was identifi ed. It was clear that Australia • understand the principles of incorporating re- had particular expertise and experience in research sistance to SBPs into a cereal-breeding program on SBPs of wheat and the Crawford Fund’s Master • understand the application of molecular biol- Class Program was an appropriate and proven plat- ogy both in the identifi cation of the pathogens form for the effi cient training of wheat pathologists and the breeding of disease-resistant germ- from the predominantly rainfed wheat cropping plasm against the identifi ed SBPs regions of WANA. • contribute to increased research capacity build- Dr Albert Rovira, formerly Chief Research Scientist ing in their home organisation in Soil Biology at CSIRO, Adelaide, a member of • further develop their research management the South Australia Crawford Fund Committee, and personal skills was approached for support. Following discussions with the Committee and its chair, Dr John • establish a regional network of pathologists Radcliff e, and the coordinator of the Crawford with key pathologists in the region who may Fund’s Master Class Program, Prof. Holloway, it work on these SBPs. was agreed that Th e Fund would be the key spon- Th e class included tutorials, discussions, extensive sor of the fi rst master class on SBPs of wheat to practical laboratory sessions and fi eld excursions. be held in Turkey in 2003. In collaboration with Th e emphasis was to provide practical solutions to Dr Rovira, additional support was obtained from real problems encountered in the trainees’ home TAGEM,ACIAR, the International Centre for countries. Agricultural Research in the Dry Areas (ICARDA), the Grains Research and Development Corporation Classes in Turkey, China and Tunisia of Australia (GRDC) and the Kirkhouse Trust Th ree International Master Classes on SBPs of in the United Kingdom. Dr Rovira also helped to wheat have been held. Th e fi rst was in Turkey recruit the Australian teaching team for the class, in June 2003 (Fig. 1) coordinated by Julie Nicol including Fusarium specialist and pathologist (CIMMYT) and hosted by TAGEM under the Prof. Lester Burgess (Th e University of Sydney), then Director General Dr Hasan Ekiz. Th e 23 train- wheat pathologist and geneticist Dr Hugh ees of the class came from the WANA region, with Wallwork (SARDI)) and nematologist Dr Ian Riley representatives from Afghanistan, Iran, Morocco, (University of Adelaide and SARDI). In addition, Syria, Tunisia and Turkey, with the addition of Dr Rovira provided valuable support and advice trainees from Australia, India, Kazakhstan and during the development of the class program and Uzbekistan. Besides the Australian teaching team, training manual. contributions were made to the master class by researchers from TAGEM and Cukurova University,

TheTR Rovira Rhizosphere R Symposium S 99 Figure 1. First Master Class on Soil Borne Pathogens of Wheat, Eskisehir, Turkey, 14–29 June 2003

Figure 2. Second Master Class on Soil Borne Pathogens of Wheat, Zhengzhou, China, 9–20 May 2005

CIMMYT, ICARDA and INRA, France. Since the Tunali et al. 2008; Elekçioğlu et al. 2009). A key class, national projects have been implemented in aspect of this work has been the identifi cation and Turkey, in collaboration with CIMMYT, on cereal distribution of promising sources of resistant germ- nematodes and dryland root rots. Th ese projects plasm to a number of regional collaborators where have clearly demonstrated the importance of SBPs SBPs are known to be economically important in the rainfed wheat systems in Turkey (Hekimhan (Nicol et al. 2007, 2008). et al. 2004; Toktay et al. 2006; Sahin et al. 2008;

TheTR Rovira Rhizosphere R Symposium S 100 Figure 3. Th ird Master Class on Soil Borne Pathogens of Wheat, Tunis, Tunisia, 28 April – 9 May 2008

Figure 4. Dr Albert Rovira with Drs Julie Nicol and Li Honglian (left and right of Albert) and a group of trainees involved with ﬁ eldwork at the Second Master Class on Soil Borne Pathogens of Wheat, Zhengzhou, China, 9–20 May 2005

TheTR Rovira Rhizosphere R Symposium S 101 Th e success of the fi rst class provided the impetus Class program for two further classes, the second in China in 2005 Th e training program for each class included 20–40 (Fig. 2) and the third in Tunisia in 2008 (Fig. 3). minute tutorials on specifi c topics using a variety of Th e design of these classes was based on the format teaching and learning techniques, alternating with devised for the Turkey Master Class but with some laboratory sessions and including two days of fi eld modifi cation of content to suit local circumstances. studies. Th e tutorials were designed to be highly in- Th e China class was jointly coordinated by Drs teractive and draw on the experiences of the trainers Maarten Ryder (CSIRO) and Julie Nicol, and held and the trainees. Th e varied program was essential at Henan Agricultural University in Zhengzhou. to maintain the enthusiasm of both trainers and trainees. It also enhanced the understanding of Dr Albert Rovira (Fig. 4) and Dr Ryder, having had important concepts through a process of consolida- much experience in China in their research careers, tion and reiteration of key ideas and techniques in played a pivotal role in identifying and coordinating diff erent contexts. local teaching staff in collaboration with eminent plant pathologist Prof. Tang Wenhua, from China An introductory session considered the key fea- Agricultural University in Beijing. As before, the tures of SBPs and was designed to emphasise the major donor was the Crawford Fund, with ad- interactive and inclusive nature of the teaching and ditional support from two international and seven learning process and ensure that each trainee was local donors. Th e local logistics were organised by contributing. Th is was a critical session as many Prof. Li Honglian of Henan Agricultural University trainees come from cultures where teaching focuses in close collaboration with Dr Ma Ping from the more on imparting information and involves little Institute for Plant Protection, Hebei Academy of or no discussion, problem-solving or critical analy- Agriculture and Forest Sciences. As China is a large sis. An introduction to the biology and control of and diverse wheat-producing country, the class was the key diseases followed to provide a background limited to 21 trainees from 13 Chinese provinces. for the fi rst field trip on either day two or three. Th e Australian teaching team led the class with Th e fi rst field trip provided an opportunity for important contributions from leading Chinese trainees to identify symptoms in the fi eld (Fig. 5), researchers. Th e class was rated highly by the train- collect samples for laboratory diagnosis (Fig. 6) ees. One of the key outcomes was the unexpected and discuss fi eld survey procedures. Th e second trip fi nding of high levels of the cereal cyst nematode involved inspection of fi eld trials designed for crop (CCN) in Henan and three adjacent provinces loss assessment purposes or the evaluation of host (Anhui, Hebei and Shandong). resistance.

Th e third class in Tunisia in 2008 was hosted by Th e isolation or extraction of pathogens, their the Institut National de la Recherche Agronomique purifi cation, identifi cation and enumeration were de Tunisie (INRAT) under the Director General key aspects of the laboratory sessions (Figs 7 and 8), Dr Amor Chermiti and coordinated by Julie and complemented discussions on the biology and Nicol in collaboration with three INRAT staff , control of the individual pathogens. Th e impor- Drs Gargouri, Saleh and Kachouri. Again, the tance of accurate identifi cation and diagnosis was Crawford Fund was the main sponsor together with emphasised. two CGIAR centres, CIMMYT and ICARDA, Th e development of IDM strategies with an em- and the Kirkhouse Trust. Th e 20 trainees came phasis on rotation and resistant cultivars was a from Algeria, Australia, Iran, Kazakhstan, Libya, recurrent topic throughout the class. In the class in Morocco, Syria, Tunisia and Turkey. Th e format was Tunisia, the impact of no-tillage on diseases such as similar to the earlier classes and the core Australian crown rot was considered extensively together with teaching team remained unchanged. Th e INRAT a presentation on no-tillage and the critical role of researchers mentioned above and others from rotation in no-tillage farming systems the ICARDA-CIMMYT Wheat Improvement Program and INRA also contributed. Th e use of resistant cultivars is a key component of IDM strategies for control of several key pathogens, especially CCN, RLN and crown rot fungi. Several sessions on the principles underlying the

TheTR Rovira Rhizosphere R Symposium S 102 Figure 5. Dr Julie Nicol discussing symptoms of cereal cyst nematode during a ﬁ eld trip in the Master Class in Tunisia, 2008 incorporation of resistance into adapted cultivars Two early-career Australian researchers were also in- were included. Screening methods and the use cluded as trainees in the classes held in Turkey and of molecular markers were discussed in detail in Tunisia. Th ey provided peer support to other young combination with laboratory, greenhouse and fi eld trainees as well as assisting the teaching team (Fig. studies. Th e crucial role of international centres in 8), thereby enhancing the eff ectiveness of the learn- providing germplasm in initiatives between cooper- ing experience. Th e four trainees and the Australian ating countries and the CGIAR (as demonstrated grains industry will benefi t from the international in the CIMMYT-led SBP network’s multi-location exposure and networking opportunities, as well as screening of germplasm for resistance to SBPs, Nicol a broader understanding of SBPs. Furthermore, in et al. 2007) was emphasised. collaboration with local colleagues, one of these trainees completed a survey of Fusarium species Professional development of trainees was considered associated with wheat in Turkey as part of her PhD and the establishment of research networks en- (Bentley et al. 2006). couraged. Th e classes concluded with small groups undertaking case studies. Th eir reports included formal Power-Point presentations. Class outcomes Th e types of extended outcomes of the classes can Evaluation and feedback provided by trainees be illustrated by reference to the second class held in through formal surveys has been highly positive. China in 2005. Moreover, the outcomes and benefi ts of these classes extend well beyond the direct impacts of the class Following identifi cation of high levels of CCN dur- on the understanding of these diseases and the tech- ing the fi rst field trip, a survey of CCN in wheat nical skills learnt by the trainees. Examples of these fi elds was conducted over the following weekend by are discussed below. the teaching team and trainees. Th e survey conducted in Henan and three adjacent provinces revealed

TheTR Rovira Rhizosphere R Symposium S 103 that CCN occurred in 90% of the fi elds at population densities greater than anticipated and likely to cause signifi cant yield losses. Th is led to eff orts by Master Class trainees, their supervisors and national experts to survey the distribution of CCN more widely in wheat-producing provinces, determine population densities, characterise pathotype and genetic diversity, assess yield loss and test the suitability of available resistance genes. Provincial-level support has since been se- cured and CCN is likely to be recognised as a pest of national importance in China (Li et al. 2007; Peng et al. 2007; Riley et al. 2007).

Figure 6. (L to R) Dr Gargouri, Noel Knight, Dr Saleh and A further training workshop, specifi cally Phillip Davies collecting take-all samples during a ﬁ eld trip in the on CCN, was held in Baoding, Hebei, Master Class in Tunisia, 2008 in 2006 with two of the Master Class team (Julie Nicol and Ian Riley) working together with Dr Sharyn Taylor (formerly of SARDI) as facilitators. Th e South Australia Crawford Fund Committee provided the direct fi nancial support to make this workshop possible. In 2007 and 2008, CCN review and planning workshops held in Beijing and Xining, Qinghai, were coordinated by Prof. Peng Deliang (CAAS, Beijing) representing the CCN Network in China that grew from the Master Class and CCN workshop. Figure 7. Prof. Lester Burgess and trainees in the laboratory CIMMYT and Australian researchers during the Master Class in Tunisia, 2008 provided an international perspective on CCN at these meetings. Th rough these initiatives the CCN research program has been expanded signifi cantly in China. Most recently two large national projects with CIMMYT collaboration have been funded in China to address CNN (Nicol, pers.)

Most of the post Master Class outcomes occurred through the CCN network in irrigated winter-wheat producing provinces (Riley et al. 2007). As it is well recognised that damage by CCN is increased under rainfed or stressed wheat production systems, it was decided that some support and research would Figure 8. Phillip Davies, an Australian trainee, assisting other be directed to the more marginal spring trainees with fungal isolation procedures during the Master Class wheat growing areas in northern China. in Tunisia Th e South Australia Crawford Fund

TheTR Rovira Rhizosphere R Symposium S 104 Committee enabled Dr Riley to provide individual impacts at both country and personal level, of the follow-up support to three Master Class trainees in Master Class program. Gansu and Qinghai in 2007. With funding from a Cheung Kong Endeavour Australian Fellowship, Dr A recent study by the Centre for International Riley also spent the second half of 2008 in China Economics (CIE 2009) shows that with an invest- undertaking fi eld studies on CCN in spring wheat ment of about $200 000 the 2005 Master Class on in high-altitude villages of Qinghai, in collabora- cereal cyst nematode in China potentially yielded tion with a former Master Class trainee. Th e goal benefi ts of $20 million by bringing forward by one was to examine the impact of rotational crops on year the benefi ts of CCN control. CCN and spatial patterns in CCN populations with a view to developing recommendations on Conclusions control and future research options. Findings from these studies indicated that natural biocontrol is the Th e success of these Master Classes and the continu- strongest determinant of CCN densities and, where ing research and training activities are a testament biocontrol is not operating eff ectively, damaging to the foresight and support of key Australian sci- populations still occur, irrespective of the rotation. entists such as Drs Rovira and Radcliff e. Th ey were Time was also devoted to reinforcing training pro- aware of the importance and diffi culty of working vided by the Crawford Fund programs. with SBPs of wheat and strongly supported the establishment of these Master Classes. Following each Master Class, selected trainees were recommended for further specialised training. Th e Another key to success of the three classes has been New South Wales Crawford Fund Committee the leadership provided by the directors of the sponsored a three-month visit for two trainees Crawford Fund Master Class program (Prof. Bruce of the China Class to the Fusarium Research Holloway and Dr Paul Ferrar) and the in-kind time Laboratory at Th e University of Sydney in 2006 support of SARDI, Th e University of Sydney and to study with Prof. Lester Burgess. Th is involved Th e University of Adelaide in allowing their staff to detailed work on Fusarium taxonomy and identi- continue as the teaching team, providing consisten- fi cation, and the biology and control of Fusarium cy across classes. An important part of this support diseases of cereals and other crops in wheat farming has been the development of a teaching manual, systems. Th is led to changes to the PhD programs which will be published shortly and will serve as a of the visiting students and Prof. Burgess becom- basic resource for future training programs. ing a co-supervisor for each student. In 2007, Prof. It is important to note that the long-term impact Burgess visited China for two months and attended of any one class is dependent on the follow-up their fi nal seminars and defence of thesis. He also research, networking and training activities. Th e undertook a survey of Fusarium species in Gansu. Crawford Fund has played a pivotal role in support- In addition, he presented a two-week workshop ing further training activities and workshops for on soil-borne fungal plant pathogens at Gansu key researchers identifi ed from the Master Classes. Agricultural University (GAU) for six trainees rep- Th e cooperation between CIMMYT, ICARDA resenting three universities and the Plant Protection and partners in the host countries has also played a Research Institute in Beijing. Th is workshop, based critical role for these on-going activities, and in the on the master class concept, was sponsored by the establishment of new research programs. New South Wales Crawford Fund Committee. Th e tutorials were also attended by 20 undergraduate Master Classes funded by the ATSE Crawford and postgraduate students from GAU. One of the Fund have also been a catalyst to enable important original trainees who came to Sydney in 2006 at- forums to occur, such as the First International tended advanced English training in Beijing and Cereal Cyst Nematode Iniative meeting recently was awarded a Chinese Government Fellowship in held in Turkey with more than 60 participants rep- 2008 for research at the CSIRO in Adelaide. Her resenting 20 countries. With a dedicated editoral research is being supported in part by the South team a published proceedings has been produced Australia Crawford Fund Committee. (Riley et al. 2009) with more than 10 papers representing former attendees to the various Master Th e follow-up activities outlined above provide Classes. examples of the long-term benefi ts and positive

TheTR Rovira Rhizosphere R Symposium S 105 Recent publications by former trainees (e.g. Bentley Station, Henan Society for Plant Pathology, et al. 2006; Toktay et al. 2006; Sahin et al. 2008; National Engineering Research Centre for Wheat, Tunali et al. 2008) illustrate the strength of the Syngenta China Investment Co. Ltd, Bayer research projects fostered through the classes and CropScience (China) and Xinjiang Kangzheng follow-up activities. Key fi ndings have been pub- Agri-science and Technology Co. Ltd; Tunisia — lished from Turkey, Iran, Tunisia, China, India and Institut National Research Agronomique. Australia. Th e leadership and support of senior wheat manage- Food security and sustainable crop production are ment staff of CIMMYT and ICARDA, specifi cally the two most urgent issues to be resolved in rainfed Drs S. Rajaram, Hans J. Braun, Amor Yahyaoui and marginal wheat production systems in semi-arid Richard Brettell, is gratefully acknowledged. Th e regions. Th ese Master Classes clearly address these continuing fi nancial and staff support provided by issues. Th e development of diagnostic and research these organisations has enabled the senior author capacity in these regions is leading to wider recogni- to devote time to the initiation, coordination and tion of the economic importance of SBPs of wheat, follow-on activities of the classes. and appropriate control measures for them. As these pathogens commonly cause losses of 20–40%, sig- References nifi cant gains in yield can be achieved through the use of resistant cultivars, crop rotation and other Bentley, A.R., Tunali, B., Nicol, J.M., Burgess, L.W. measures. Th us eff ective control has a major impact and Summerell, B.A. 2006. A survey of on food security in these regions, irrespective of Fusarium species associated with wheat and other inputs. Furthermore, the classes address the grass stem bases in northern Turkey. Sydowia problems of poor soil structure, low organic matter 58, 163–177. and fertility, and susceptibility to wind and water Burgess, L.W., Backhouse, D., Summerell, B.A. erosion. No-tillage, soil health and crop rotation are and Swan, L. 2001. Crown rot of wheat. In: discussed in detail together with a consideration of Summerell, B.A., Leslie, J.F., Backhouse, the biology and control of stubble-borne diseases. D., Bryden, W.L. and Burgess, L.W. Th is is an area where Australian researchers have (eds) Fusarium: Paul E. Nelson Memorial long experience. Symposium. APS Press, St Paul, Minnesota, pp. 271–294. Continuation of these classes and their complementary activities will provide signifi cant future Burgess, L.W., Knight, T.E., Tesoriero, L. and Phan, benefi ts to developing countries as well as Australia. H.T. 2008. Diagnostic Manual for Plant Th e authors are indebted to the Crawford Fund for Diseases in Vietnam. ACIAR (Australian its continuing commitment to this vision. Centre for International Agricultural Research) Monograph No. 129, Canberra, Australia, 210 pp. Acknowledgements CIE (Centre for International Economics) 2009. Th e fi nancial and in-kind support of the follow- Potential Economic Impact of a Crawford ing international and Australian organisations is Master Class: Soil Borne Pathogens and Cereal gratefully acknowledged: ACIAR, ATSE Crawford Cyst Nematodes. Centre for International Fund, Chueng Kong Endeavour Australia Awards, Economics, Canberra, 22 pp. CIMMYT, CSIRO Adelaide, GRDC, ICARDA, SARDI, Th e Kirkhouse Trust (UK), Th e Coyne, D.L., Nicol, J.M. and Claudius-Cole, B. University of Adelaide, Th e University of Southern 2007. Practical Plant Nematology: A Field Queensland and Th e University of Sydney. and Laboratory Guide. SP-IPM Secretariat. System-wide Program Integrated Pest Th e fi nancial and in-kind support for the classes Management, International Institute of from local donors in each of the three host countries Tropical Agriculture (IITA), Cotonou, is also gratefully acknowledged: Turkey — Ministry Benin, 92 pp. of Agricultural and Rural Aff airs; China — China Agricultural University, Henan Agricultural University, Henan Plant Protection and Quarantine

TheTR Rovira Rhizosphere R Symposium S 106 Elekçioğlu, İ.H., Nicol, J.M., Bolat, N., Şahin, E., root rot and cyst and lesion nematodes) Yorgancılar, A., Braun, H.J., Yorgancılar, Ö., using conventional and molecular tools. Yıldırım, A.F., Kılınç, A.T., Toktay, H. and In: Buck, H.T. (ed.) Wheat Production in Çalışkan, M. (2009) Longterm studies on Stressed Environments. Springer Publishers, the cereal cyst nematode Heterodera fi lipjevi Dordrecht, Th e Netherlands, pp. 125–137. in Turkey: international collaboration with regional implications. In: Riley, I.T., Nicol, Nicol, J.M., Sahin, E., Wallwork, H., Chakraborty, J.M. and Dababat, A.A. (eds) Cereal Cyst S., Meiqin, L., O’Brien, L., Sutherland, Nematodes: Status, Research and Outlook. M., Horne, M., Simpfendorfer, S., Herde, CIMMYT, Ankara, Turkey, pp. 11–16. D., Ogbonnaya, F., Duvellier, E., Bolat, N., Yahyaoui, A., Buerstmayr, H., Lewis, Hekimhan, H., Bagci, S.A., Nicol, J., Arisoy R.Z. J., Crossa, J., Singh, A.K., Bishnoi, S.P., and Taner, S. 2004. Dryland root rot: a ma- Kanwar, R. and Gargouri, S. 2008. jor threat to winter cereal production under Identifi cation of multiple root disease re- sub-optimal growing conditions. In: Fischer, sistant wheat germplasm against cereal T. et al. (eds) New Directions for a Diverse nematodes and dryland root rot and their Planet. Proceedings for the 4th International validation in regions of economic im- Crop Science Congress, Brisbane, Australia, portance. In: Appels, R., Eastwood, R., 26 September – 1 October 2004, (www. Lagudah, E., Langridge, P., Mackay, M., cropscience.org.au/icsc2004/post- McIntyre, L. and Sharp, P. (eds) Proceedings er/3/7/2/1322_nicol.htm). of the Eleventh International Wheat Genetics Symposium. Brisbane, Australia, 24–29 Li Honglian, Yuan Hongxia, Wu Xujin, Yang August 2008. Sydney University Press, Weixing and Nicol, J.M. 2007. Cereal cyst Sydney, Australia. nematode (Heterodera avenae) is causing damage on wheat in Henan, the bread basket Peng, D., Zhang, D., Nicol, J.M., Chen, S., of China. In: Proceedings of the Sixteenth Waeyenberge, L., Moens, M., Li, H., Tang, International Plant Protection Conference. W. and Riley, I.T. 2007. Occurrence, dis- Glasgow, Scotland, 15–18 October 2007. tribution and research situation of cereal Th e British Crop Production Council, cyst nematode in China. In: Proceedings of Farnham, UK, pp. 674–675. the Sixteenth International Plant Protection Conference. Glasgow, Scotland, 15–18 Metcalfe, I., Holloway, B., McWilliam, J. and October 2007. Th e British Crop Production Innall, N. 2005. Research Management in Council, Farnham, UK, pp. 350–351. Agriculture—A Manual for the Twenty-First Century. Th e University of New England, Riley, I.T., Peng D., Li, H., Chen, S., Yang H., Wu Armidale, Australia, 127 pp. H. and Nicol, J.M. 2007. Cereal cyst nematode in China — emerging as a potentially Nicol, J.M. and Rivoal, R. 2008. Global knowl- serious constraint to wheat production. In: edge and its application for the integrated Proceedings of the Th ird Asian Conference control and management of nematodes on on Plant Pathology. Jogyakarta, Indonesia, wheat. In: Ciancio, A. and Mukerji, K.G. 20–23 August 2007. Faculty of Agriculture, (eds) Integrated Management and Biocontrol Gudjah Mada University, Yogyakarta, of Vegetable and Grain Crops Nematodes. Indonesia, pp. 185–186. Springer, Dordrecht, Th e Netherlands, pp. 243–287. Riley, I.T., Nicol, J.M. and Dababat, A.A. (eds) (2009) Cereal Cyst Nematodes: Status, Nicol, J.M., Bolat, N., Bagci, A., Trethowan, R.T., Research and Outlook. CIMMYT, Ankara, William, M., Hekimhan, H., Yildirim, Turkey, 244 pp. A.F., Sahin, E., Elekcioglu, H., Toktay, H., Tunali, B., Hede, A., Taner, S., Braun, Şahin, E., Nicol, J.M., Yorgancılar, A., Elekçioğlu, H.J., van Ginkel, M., Keser, M., Arisoy, İ.H., Tülek, A., Yıldırım, A.F. and Bolat, Z., Yorgancilar, A., Tulek, A., Erdurmus, N. (2008) Seasonal variation of fi eld popu- D., Buyuk, O. and Aydogdu, M. 2007. lations of Heterodera fi lipjevi, Pratylenchus Th e international breeding strategy for the thornei and P. neglectus on winter wheat incorporation of resistance in bread wheat in Turkey. Nematologia Mediterránea 36, against the soil borne pathogens (dryland 51–56.

TheTR Rovira Rhizosphere R Symposium S 107 Toktay, H., McIntyre, L., Nicol, J.M., Ozkan, H. Wallwork, H. 2000. Cereal Root and Crown Diseases. and Elekcioglu, H.I. 2006. Identiﬁ cation of International edition. Grains Research common root lesion nematode (Pratylenchus and Development Corporation, Canberra, thornei Sher et Allen) loci in bread wheat. Australia, 62 pp. Genome 49, 1–5.

Tunali, B., Nicol, J.M., Hodson, D., Uçkun, Z., Büyük, O., Erdurmuş, D., Hekimhan, H., Aktaş, H., Akbudak, M.A. and Bağcı, S.A. 2008. Root and crown rot fungi associated with spring, facultative, and winter wheat in Turkey. Plant Disease 92, 1299–1306.

TheTR Rovira Rhizosphere R Symposium S 108 Plant and soil health and farming systems—a farmer’s perspective

Neil Smith1

Abstract Technical improvement has continued since then. Th e outcome on Australian grain farms in the A series of technical innovations, commencing period 1977–1978 to 2001–2002 has been that in 1900, has enabled Australian farmers— multifactor productivity growth (growth in out- typically operating on inherently infertile put relative to the combined contribution of key soils—to raise grain yields threefold. In the last inputs, usually labour and capital) has increased, round of innovation, in the last two decades of on average, by around 3.3% per year (Angus 2001). the 20th century and in which Albert Rovira Explanations for the superior performance of the had a prominent role, the management of cropping industries include signifi cant changes in root disease and minimisation of tillage were cropping technology encompassing crop varieties key elements. Th e diminishing availability of with improved resistance to disease, more eff ec- external inputs poses a serious challenge for the tive use of as well as improvements to fertilisers future. Pasture legumes will have an expanded and pesticides, and greater labour productivity role in providing nitrogen, but unfortunately (Productivity Commission 2005). there is no corresponding source of phosphorus. The Rovira legacy Introduction Th e adaptation of results from the long-term trial Australian soils are inherently infertile. Since work started by Rovira and continued by Roget European settlement, the meagre fertility status at the low-rainfall site at Avon, north-west of of the country’s soils and adapted fl ora has been vigorously exploited and or discarded. Nitrogen fertiliser in southern Australia 2.0 Break crop (canola) in southern Australia Th e ingenuity of farmers Break crop (lupin) in WA with adaptive and advanc- 1.5 ing science and technology Legume nitrogen has enabled the soils, which Better rotations Semidwarf Superphosphate are naturally rain-fed, to 1.0 Mechanisation cultivars New cultivars Selective grass yield at increasing levels. Wheat yield (t/ha) Fallowing Nutrient herbicide Th ese trends were shown exhaustion 0.5 up until the end of the 1950s by the classic diagram Donald 1965 New of Donald (1964, 1965) 0 (Fig. 1). 1860 1880 1900 1920 1940 1960 1980 2000 2020 Figure 1. Average grain yields (for each decade) of Australian wheat crops. Th is graph was generated by Angus (2001) using data from Donald (1965) 1 Maitland, South Australia and ABARE. Th e dotted line represents yields projected from the increase during the 1990s.

TheTR Rovira Rhizosphere R Symposium S 109 Adelaide, has been responsible for the major positive In my view, a key feature of a failed cropping op- changes in farming systems in the critical 1980s and eration in the future will be poor management of 1990s. Th ere were signifi cant technological develop- the pasture phase. Unfortunately, it is rare to see ments in tillage design, herbicides and fertiliser use. well-managed pasture in areas below the 375-mm Rotations were developed to exploit these technolo- rainfall isohyet. By inference, these areas have no fu- gies. Th is, combined with knowledge emanating ture without radical change in commercial systems from the Avon work, generated yield increases as development and adjustment. Th ere will be little root diseases were contained. Essentially, the Rovira alternative to improved livestock production sys- legacy has consisted of recognising that rhizoctonia tems in these regions, based on managed or native could be somewhat controlled by deep cultivation, pasture systems with only ‘opportunistic cropping’. desirably three weeks before sowing to minimise the impact of the fungus. Th eir research also showed With the virtual doubling of the price of applied ni- that long-term retention of trash resulted in the trogen (now $2/unit for urea-derived nitrogen), no development of ‘suppressive soils’ allowing no-till longer can all cereal nitrogen needs be applied ‘from or direct drill yields to ‘catch up’ with those from the bag’ because of the increasing risk associated conventional soil preparation, but with the added with variable climate. At the current cost of nitro- advantage of minimal disturbance of Australia’s gen, farmers will quickly accept that a well-managed fragile soils. Hence the retention of trash—so criti- pasture (legume dominant—grasses removed) will cal to the fertility status of southern Australian be the norm. Sowing of the crops on 20–40% of the soils—became accepted by farmers as essential. area of a farm would allow carrying a legume pasture simply as a source of nitrogen. Grazing of that Th e research undertaken by Rovira and Roget was phase will become complementary to nitrogen pro- among the most important scientifi c work that has duction, not an essential revenue source in its own been adopted by farmers since the selection and right as it has been in the past. All types of possibili- introduction of medics for the pasture phase of the ties surround the need to plan for plant-nitrogen ley-farming system developed in the 1950s. as the principal source of nitrogen for non-legume grain production. Pastures just happen to be the But where do we go in the future? most practical approach.

Pastures (legume dominant) in Work by Ed Hunt, an agricultural consultant from Eyre Peninsula, indicated that even before the rapid farming systems increase in the price of nitrogen fertilisers, continu- Th e climate is predicted to become increasingly ous cropping, even in highly favoured 450-mm drier and hotter in the southern latitudes. Fossil- zones, may not be as eff ective as having 15% or more fuel-derived inputs have become much more of the farm’s area sown to a well-managed pasture. expensive through increasing scarcity of oil that will On our farm, the total cost of growing wheat is now continue to worsen in the future. Agriculturists will $540 per hectare on brown manure (residue from fi nd that unless they can employ all that science can grazing pasture legumes) or $481 on good pulse provide them, together with an accurate knowledge stubble with 35 units of nitrogen from industrial of the real cost of each unit of production (tonnes sulphate of ammonia. With a wheat crop average per hectare), they will face a very hard time even yield that has dropped from 4.3 tonnes per hectare in more favoured areas. We, as farmers, have been during 1995–2001 to 3.0 tonnes per hectare on able to profi tably overcome the natural poverty of brown manure and 2.7 tonnes per hectare on pulse Australia’s soils in recent years only because oil- stubble in the drier seasons of 2002–2007, to break based products were so cheap. even at current averages a price of $180 per tonne In South Australia, not since the run of dry years at the farm gate has to be achieved. Th at price may from the late 1800s or the great depression of the have been achievable as at the date of this sympo- 1930s, have we as farmers had to face a challenge sium, but what about next year? Th e expected price such as that ahead. of a unit of nitrogen from industrial-grade sulphate of ammonia has been assessed at $1.50. If urea is to Th e rapid changes in the operating environment have be used ($925 per tonne delivered and spread), then just shift ed to a higher gear! the return for wheat on pulse stubble would need to be $497 per tonne.

TheTR Rovira Rhizosphere R Symposium S 110 Th e advantages of growing nitrogen by legumes are: We have probably passed through the halcyon days from the late 1980s to 2001 when fertiliser and fuel • Th e cost is ‘internalised’ (equivalent to 80 were cheap. (In 2001, the average diesel price was units of nitrogen at $1.50 per unit, valued at 41c per litre, but at the time of this symposium it is $120 per hectare). $1.25 per litre.) Th ose days were a time when recent • Sheep are grazed on brown manure for prime technology and science outcomes had combined lamb production. to provide the grain farmer with massive oppor- • Th ere is much less fi nancial risk due to less up- tunities. Th ere will still be new technologies and front outlay. scientifi c discoveries, but it is my observation that • Th e area of pulses, a high-risk crop, is kept to a over the past forty years the excellent work from the minimum. public scientifi c sector has started to decline. Some of the ‘bells and whistles’ from the private sector Th e other nutrient to rapidly increase in price is on new technologies may be obscuring clear think- phosphorus. Th e on-farm cost of applied phospho- ing by farmers about the underlying principles of rus is now about $6.40 per unit, with 3–4 tonne agriculture. per hectare wheat crops needing 9–12 units per hectare as a minimum—about $75 per hectare. Albert Rovira undertook his work at the right time Most Australian soils are very defi cient in phospho- for agriculturists to reap the benefi ts. Th ere is still a rus. Our farm soils contain roughly 40–50 units of challenge in the future for rhizosphere scientists. Colwell P that is available to plants. We will be able to survive for a few years on less than optimal dress- References ings. Not so many other areas of South Australia, particularly western Eyre peninsula where phos- Angus, J.F. 2001. Nitrogen supply and demand in Australian agriculture. Australian Journal of phorus is rapidly locked up on the highly calcareous Experimental Agriculture 41, 277–288. soils. Donald, C.M. 1964. Phosphorus in Australian ag- Conclusion riculture. Journal of Australian Institute of Agricultural Science 30, 75–105. Stresses are appearing in Australia’s grain industries, but farmers on the better lands will continue Donald, C.M. 1965. Th e progress of Australian to fl ourish. Th e world population is approaching agriculture and the role of pastures in en- seven billion. Grain prices will be volatile, making vironmental change. Australian Journal of Science 27, 187–198. it harder for the exporting agriculturist to manage a successful business. Good farm accounting and Productivity Commission 2005. Trends in Australian marketing knowledge will be essential. Agriculture. Research Paper. Productivity Commission, Canberra.

TheTR Rovira Rhizosphere R Symposium S 111 Abstracts

TheTR Rovira Rhizosphere R Symposium S 112 New technologies for more in-depth understanding of the soil and rhizosphere communities

James M. Tiedje1,2, WooJun Sul1, Stephan Ganter1, Mary Beth Leigh1, Deborah Yoder-Himes1 and James R. Cole1

Much of Earth’s terrestrial productivity depends on New molecular technologies, especially the ‘omics’, the ability of plants to convert the energy from sun- provide the opportunity to understand microbial light into useful organic compounds for food and communities and their interactions in much great now for liquid fuels. Plants do not live in isolation detail. Th is is illustrated by the insight into soil and but in concert with microbes around their roots, on rhizosphere communities provided by new high- their leaves and internally (endophytes). As we are capacity sequencers. Th e ecology and dynamics of driven to lower-cost, more productive and sustain- particular populations, and which genes and their able primary production systems, we need these regulators are expressed in contrasting niches, can communities to live in harmony and at maximum be better understood. Th e patterns and diversity effi ciency. of Burkholderia and Pseudomonas populations in rhizospheres provide good examples of this. Can we ‘manage’ the plant–microbe associations, especially those in the rhizosphere, to enhance sustainability of productivity? Th is will be especially important in any new cellulose-to-biofuel economy where energy crops would most likely be grown on marginal lands, and to maximise energy gain and ensure carbon neutrality.

1 Center for Microbial Ecology, Plant and Soil Science Building, Michigan State University, East Lansing, Michigan 48824, USA 2 Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 113 Trophic cascade and decreased survival and growth of Pinus strobus seedlings in microcosms caused by fungivory on mycorrhizae

Sina M. Adl1,2 and Melanie L. Wilson1

Can fungivory post-germination during composition. Fauna were grouped into functional mycorrhization aff ect seedling growth and survival? categories. Seedlings without ectomycorrhizae Most studies on mycorrhizae have been carried out did not survive to four months. Fungivory by on older seedlings with established mycorrhizae. nematodes or microarthropods (treatments c We have focused on early seedling growth. We and e) reduced mean (%) mycorrhizae on roots. selected eastern white pine (Pinus strobus) which Enrichment with both fungivorous nematodes and was germinated in soil microcosms, reconstructed microarthropods (treatment d) decreased fungivory using a protocol similar to one used in the Setälä and permitted mean (%) ectomycorhhizae levels laboratory. A full factorial design with fi ve similar to treatment with no fungivory (treatment treatments, each randomly replicated in ten trays b). (n=10), was established in a controlled-environment greenhouse. Treatments were: Canonical scores plot in discriminant analysis clearly separated treatments by mean (%) root tip a) no ectomycorrhizae colonisation. Some functional groups correlated b) three species of ectomycorrhizae (EM) with treatment response. In addition we observed: c) EM and enriched with fungivorous nematode • a trophic cascade, confi rming an earlier culture (Nf) microcosm study by the Setälä laboratory, and d) EM, Nf and enriched with microarthropods expanding the results to germinating seedlings (MA) during mycorrhization e) EM and MA. • that fungivory in the rhizosphere can decrease mean mycorrhization levels, and aff ects both Seedlings were destructively sampled at four seedling survival and growth. months or at seedling death (< 4 months). Data were analysed with ANOVA and multivariate Comparison of animal abundances and procedures and results were compared across mycorrhization levels confi rms that seedlings less treatments for seedling survival rate, age at death, than one year old aff ect their rhizosphere. Th us growth, mycorrhization and animal abundance and rhizosphere food web structure has consequences for seedling growth and survival through mycorrhization level.

1 Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada 2 Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 114 Co-opting the endorhizosphere

Christopher M. Franco1,2

Th e endorhizosphere of cereal crops contains Colonisation of plants by actinobacterial a diverse microbial population as revealed by endophytes, studied using confocal microscopy and microscopy, culture-independent techniques and T-RFLP, revealed an early colonisation of external isolation of pure cultures. Our study focussed on surfaces and within plant tissue, especially below endophytic actinobacteria—the rationale being that the epidermal layer of roots and at lateral root actinobacteria are recognised as prolifi c producers junctions. Th e inoculant, added initially as a seed of bioactive compounds such as plant growth coating, does not radically disrupt the endemic regulators and antifungal agents; their mycelial endophytic diversity and was found to colonise growth promotes colonisation and, as endophytic wheat plants for up to 12 weeks aft er germination. partners, they work from within the plant where During this early growth period the actinobacterial they are protected from environmental stresses and partner increased plant emergence and root and competition from soil microfl ora. Actinobacteria shoot length. isolated from surface-sterilised roots of young healthy cereal plants were identifi ed and tested Th ese benefi cial interactions result from an intimate for their ability to suppress root diseases in planta relationship between endophytic actinobacteria in greenhouse and fi eld trials. Selected strains and host plants. Th is partnership is a new facet of improved grain yields by 5–60%, compared with microbial ecology that enables a biological means untreated controls, in multi-location fi eld trials to signifi cantly increase grain yields and reduce the across Australia over the past fi ve years. Isolates reliance on chemical fungicides and petrochemical- eff ective in controlling root diseases belonged to derived fertilisers. Th is technology is sustainable Streptomyces, Microbispora and Nocardioides genera. and has widespread application for broad-acre Most isolates were capable of suppressing multiple agriculture, pasture production, horticulture and fungal pathogens including Rhizoctonia solani, fl oriculture. Gaeumannomyces graminis var. tritici and Pythium spp. through induction of systemic resistance and antibiotic production. Th ese actinobacterial inoculants are compatible with farm management practices such as the application of fertilisers, herbicides and pickling agents, and can withstand on-farm environmental conditions.

1 Flinders University, Bedford Park, SA 5042, Australia 2 Email: Chris.Franco@fl inders.edu.au

TheTR Rovira Rhizosphere R Symposium S 115 Varietal diff erences in cotton— belowground

Oliver G.G. Knox1,2,3, Vadakattu V.S.R. Gupta3,4,5, Kellie Gordon2, Richard Lardner4, Paul Harvey4 and Marcus Hicks4

Rhizosphere microbial diversity is known to signifi cant. Th e fl uctuations in microbial biomass diff er between various crop species. Th ere is values observed throughout the season were taken also reported evidence of varietal diff erences in as an indication of the infl uence of changes in rhizosphere bacterial diversity within crops such exudation, as plants redirected resources according as wheat. During work conducted between 2002 to physiological requirements. and 2006 on the potential for genetically modifi ed cotton to aff ect microbiota in Australian soils it Bacterial population analysis based on 16SrDNA- became apparent that crop variety can infl uence DGGE indicated a strong association between microbiology associated with the rhizosphere. varieties and families of varieties based on specifi c rhizosphere bacterial populations early in the season A project was commenced in 2006 to determine the (63 days aft er sowing), which disappeared later infl uence of current commercial cotton varieties on in the season (176 days aft er sowing). MicroResp® their associated rhizosphere microbial populations results over the two years showed clear varietal and functions. Rhizosphere samples for 15 cotton infl uences on the capability of the rhizosphere varieties were collected from fi eld experiments communities to utilise specifi c compounds. conducted at the NSW DPI Myall Vale Research Canonical analysis of catabolic profi les indicated a Station, Narrabri, during the 2006–2007 and varietal-based response of rhizosphere microbiota to 2007–2008 seasons and analysed for microbial specifi c hexose sugars and amino acids. biomass and activity, catabolic diversity of microorganisms (MicroResp®), bacterial diversity Data on ammonia oxidising populations and and populations and activities of nitrifying and nitrifi cation rates indicated signifi cant diff erences free-living N-fi xing microorganisms using culture- between varieties but trends varied between the two based and DNA techniques. seasons. We also observed varietal diff erences in the capability of rhizosphere soils to carry out non- Analysis of microbial biomass and activity symbiotic N fi x a t i o n . indicated large seasonal fl uctuations and showed 2 that diff erences between varieties were non- Overall, our results show that cotton varieties are altering the soil microbiology in their rhizospheres

and, in turn, the levels of functions that these 1 Scottish Agricultural College, Edinburgh, EH9 3JG, microbes carry out. Th rough developing a better Scotland understanding of what drives these changes and 2 CSIRO Entomology, Narrabri, NSW 2390, how wide spread they are, it should be possible Australia in the future to develop lower input and more 3 Cotton Catchment Communities CRC, Narrabri, effi cient input systems that capitalise on varietal NSW 2390, Australia selection. Further research is required before fi eld 4 CSIRO Entomology, Adelaide, SA 5064, Australia recommendations can be made. 5Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 116 Root damage constrains autumn–winter pasture yield and farm productivity

Richard Simpson1,3, Alan Richardson1, Ian Riley2 and Alan McKay2

Root damage on subterranean clover as a result of limit gains in farm income that would normally be root-rot pathogens has been variously described expected when stocking rates are lift ed. as a substantial problem for clover yield or as an intermittent problem that can be severe in certain DNA assays for root pathogens and some years. It is likely, however, that the true cost of benefi cial organisms were employed to quantify the root damage is not fully appreciated because sub- microorganisms associated with damaged roots. lethal damage to pasture roots is hidden to casual Increasing levels of Phytopthora clandestina and observation and the costs to production tend to go Pythium clade F associated with increasing clover unrecognised. root damage at three sites but lacking association at the fourth, and with grass root damage, indicated Bioassays using subterranean clover (cv. a need to also develop DNA assays for other root Woogenellup) or annual ryegrass (cv. Safeguard) pathogens. were used to investigate the potential for root damage at four fi eld sites in NSW and to estimate the cost of damaged roots for plant growth in autumn–winter. Substantial seedling losses and damage to roots of clover and ryegrass were observed. Autumn–winter plant growth was negatively related to the extent to which roots were damaged. Root damage limited clover growth by 21–36% and ryegrass by 10–45%, depending on the site.

Simulation modelling was used to estimate the cost to a sheep enterprise of such a constraint to autumn–winter pasture productivity. It was estimated that a well-managed enterprise would forego between 25% and 58% of potential net farm income given the levels of root damage measured in this study. Root damage was also predicted to

1 CSIRO Plant Industry, Canberra, ACT 2600, Australia 2 SARDI Plant and Soil Health, Adelaide, SA 5001, Australia 3 Email: [email protected]

TheTR Rovira Rhizosphere R Symposium S 117 Biology of the rhizosphere: progress and prospects for the future

Albert D. Rovira1,2

Abstract As this symposium is sponsored by the ATSE Crawford Fund dedicated to increasing food As the fi nal speaker of the day and as a person production in lesser developed countries, I will who became interested in the rhizosphere back fi nish my talk with a few suggestions on how in 1951 before many of the today’s speakers some of the results of rhizosphere research may were born, and following speakers who are ac- be used to further the work of the Crawford tively involved in rhizosphere research, I had a Fund. challenge in preparing this talk. I believe that, despite all the modern techniques Introduction that are available and the reliance of scientists Th is symposium in my honour came as a great sur- on computer searches for past information, prise and I am deeply honoured to be part of it—to knowledge of the history of a subject enables have reached 80 years of age is largely genetic, life scientists to avoid the repetition of past research style and luck, but to have worked on the rhizo- and leads to faster progress. sphere was a matter of fate. It resulted from coming Th e big breakthroughs in rhizosphere research across three reviews on the topic shortly aft er I have often followed the application of tech- graduated from the University of Melbourne in niques developed in other areas of science. 1948. Th ese were reviews by three pioneers in this Examples of this are the application of paper fi eld: Starkey (1931), Katznelson et al. (1948) and Clark (1949). I was interested in soil microbiology chromatography to determine the composition and fi gured that if I was to work on this for my doc- of root exudates, the application of transmis- torate at the University of Sydney starting in 1951 sion and scanning electron microscopy and the and possibly later in my postdoctorate career, then use of DNA techniques to detect and quantify rhizosphere microbiology was preferable to general cereal root pathogens in Australian soils. In this soil microbiology because improved knowledge of paper I will discuss the outcomes of the basic the rhizosphere would be a more direct route to research to understand the biology of the rhizo- improved plant performance.Th is is not a review of sphere and how this knowledge was extended to the subject, but rather a personal journey through soil-borne root diseases, and fi nally the applica- the rhizosphere written in the fi rst person, based on tion of this knowledge to develop sustainable my experiences and interests over the past 50 years rain-fed farming systems. and with an emphasis on Australian research, much of which is published in Australian journals oft en overlooked overseas. Over the years I have worked

in many laboratories around the world, but spent 1 Rovira and Associates Hawthorndene, South Australia most of my time in the CSIRO Division of Soils, 2 Email: [email protected] Adelaide. Visiting scientists, post-doctoral fellows

TheTR Rovira Rhizosphere R Symposium S 118 and post-graduate students have all made signifi cant Light microscopy of root surface contributions to my research. I have also had strong Rovira (1956a), using direct microscopy with ap- support from Ted Ridge, the late Andrew Simon, propriate staining of lightly washed roots, provided Greig Whitehead, Neil Venn and David Roget. I some of the fi rst information on the variety of also want to thank Mr Robin Manley for allow- organisms and their distribution on the surfaces ing us to conduct fi eld trials on his farm at Avon of diff erent parts of the roots. Louw and Webley in South Australia for some 30 years. Professor (1959) reported that plate count estimates of rhizo- Jim Cook from the USDA and Washington sphere bacteria were 30% of the direct microscope State University and I have talked and worked counts, indicating that many bacteria living on together over many years and it is interesting to roots would not grow on the media used. Later note that although we started with very diff erent studies by Rovira et al. (1974) using direct micros- backgrounds—Jim from plant pathology and me copy of lightly washed roots of eight pasture species from soil microbiology—we both ended up working showed that bacteria covered some 7.7% of the root on soil health, cereal root diseases and conserva- surface, and that for these plants plate counts were tion farming. Over a period of 25 years, Dr Glynn only 10% of the total (direct) counts. Bowen and I worked in parallel fi elds in CSIRO Division of Soils, which brought us together gen- Nutritional groupings of rhizosphere and soil erating new ideas and experiments that resulted bacteria in many joint publications and culminated in a Lochhead and his co-workers in Canada clearly wide-ranging review of the topic (Bowen and Rovira demonstrated that those organisms stimulated by 1999). Th is has been a relationship that I very much plant roots were generally faster growing and had appreciate and one that contributed greatly to my diff erent nutritional requirements from the bacteria research. Subsequent reviews by Garbeva et al. in the soil away from the roots (Katznelson et al. (2004), Bais et al. (2006) and Watt et al. (2006) 1948). have diff erent emphases from our review. Selective techniques for diff erent groups of Aft er some years of fundamental research I decided bacteria to make the research more applied and extended the defi nition of the rhizosphere to include studies on Work by Sands and Rovira (1971) and Simon et al. plant growth promoting bacteria, soil-borne root (1973), using selective media, found that fl uores- pathogens, biological control of root diseases, the cent pseudomonads were associated with roots and development of suppression to root pathogens in the freshly added particulate organic matter in soil. fi eld and the impact of rotations and tillage on root Subsequent research has found that many of these diseases, plant yields, water use effi ciency and ulti- pseudomonads antagonise root pathogens and have mately profi tability when put into farming practice. the ability to promote plant growth. Bacillus species can be isolated by heat treating soil suspensions and Th ere is an enormous amount of published informa- many such isolates have been found to be active an- tion on the rhizosphere (Lynch 1990) and with the tagonists against root diseases, capable of promoting concentration on recent information in computer plant growth, increasing phosphate uptake and in literature searches, much of what I discuss will not inducing disease resistance in plants. be known to current scientists. However, I trust that this personal journey will interest you and Paper chromatography inspire you to continue your research on the rhizo- Th e fi rst identifi cation of amino acids and sugars sphere. in root exudates came in the 1950s by growing peas and oats in nutrient solutions and using paper Techniques and stepping stones chromatography developed by Swedish scientists for biochemical studies. For the fi rst time we had Progress in science depends upon the developments information on the wide range of soluble organic of new techniques, oft en in unrelated fi elds, and the compounds coming from healthy roots and pro- rhizosphere is no exception. I see these techniques viding sustenance for the rhizosphere microfl ora as stepping stones towards greater knowledge of the (Rovira 1956b). subject and will now list some of these.

TheTR Rovira Rhizosphere R Symposium S 119 14Carbon labelling of plants McDougall (1965), working in CSIRO, was one of the fi rst to use C-14 labelling to study root exudation. Later, McDougall and Rovira (1970) used C-14 labelling of plants to investigate the sites of exudation from roots, while Rovira and Ridge (1973) used this technique to study the infl uence of plant nutrition on exudation. Whipps (1990) demonstrated that sloughed-off root cells from healthy plants contributed more carbon to the rhizosphere than did soluble exudates—he coined the term ‘rhizodeposition’ to describe the non-soluble carbon coming from healthy roots. 32Phosphorus labelling of plants Bowen and Rovira (1966) used this technique with solution-grown tomato and subterranean clover to demonstrate that non-sterile roots took up twice as much phosphate as sterile roots and during the course of the experiment translocated two to four Figure 1. Rhizosphere of clover from the surface of times more phosphate to the tops than did sterile an epidermal cell out to 10 microns from the root plants. Further studies showed that although mi- surface; B = bacteria, Q = quartz grain, CL = clay, crobial populations were very low in the root-tip EP = epidermal cells region with heavy colonisation in the older part of the root, the apical region of non-sterile roots had a higher phosphate uptake compared with sterile roots, indicating that the micro-organisms on the older part of the root aff ected the metabolism of the root tip (Bowen and Rovira 1969). Transmission electron microscopy of roots Th e application of electron microscopy to roots grown in soil has provided us with an insight into the complexity of the rhizosphere (Foster et al. 1983) and of the many diff erent types of bacteria living side by side within 10–20 microns of the root surface (Fig. 1). Scanning electron microscopy (SEM) of the rhizosphere Th is technique has the advantage that it gives a ‘birds eye’ view of the inner rhizosphere and the root surface. SEM examination of roots infected Figure 2. Surface of a wheat root infected by with the take-all fungus (Gaeumannomyces gramin- Gaeumannomyces graminis var. tritici showing is) showed that the infection sites become heavily hyphae of the pathogen (F) and a biocontrol bacteria colonised by bacteria, and if these are eff ective (B) colonising both the root surface and the hyphae. biocontrol agents the technique showed that these Courtesy of R. Campbell, University of Bristol, Foster et al. (1983). bacteria lyse the hyphae of the pathogen (Fig. 2).

TheTR Rovira Rhizosphere R Symposium S 120 DNA detection of plant root pathogens in DAPG from the rhizosphere of wheat growing in soil suppressive soils at levels high enough to inhibit the take-all fungus. Rotenberg et al. (2007) found Th e development of DNA assays for a number of that rotation and tillage aff ected the levels of cereal and pasture root pathogens by McKay and 2,4-DAPG-producing pseudomonads in the rhizo- Ophel-Keller in SARDI (Th e South Australian sphere, but the presence of pseudomonads was not Research and Development Institute) has led to always linked with disease suppression. the development of a Rood Disease Testing Service for farmers in southern Australia. Over the last ten My opinion is that although Weller and associates years thousands of soil samples have been tested have shown the links between these pseudomonads for root pathogens including Rhizoctonia solani, and take-all suppression, there will be other organ- Gaeumannomyces graminis (take-all disease of cere- isms and other antibiotics involved in suppression in als) and Heterodora avenae (cereal cyst nematode). other situations. Th e results are delivered to farmers via advisers who are trained to interpret the results. Each year Simon et al. (1988), working in Western Australia, McKay and associates have drawn maps showing the found that take-all suppression associated with distribution and levels of pathogens in cereal-grow- prolonged use of nitrogenous fertilisers and con- ing soils across southern Australia (Ophel-Keller tinuous wheat cropping was due to the build-up of et al. 2007). More recently this technique has been Trichoderma koningii. Subsequently Simon (1989) extended to root diseases of pasture legumes in reported that the introduction of T. koningii (Strain southern Australia (I. Riley, SARDI, 2007, pers. Tk7a) into soil controlled take-all of wheat in con- comm.) and studying root distribution of crops and trolled-environment conditions. Th is work has since pastures (McKay et al. 2008). been extended to the fi eld in China and Australia with considerable success. In reviews by Vinale et Th is work of McKay, Ophel-Keller and associates al. (2006, 2008) many diff erent mechanisms by is an outstanding example of how a new technique which trichoderma inhibits root pathogens are de- developed in unrelated fi elds can be applied to soil scribed. biology. Another example of a diff erent antifungal metabo- lite from a biocontrol fl uorescent pseudomonad Root disease decline, suppression and (Ps. str. AN5) is provided by Nayudu et al. (2010), biological control who found that the active antifungal compound is gluconic acid, a simple hydrophilic sugar acid that is Th is topic has interested plant pathologists for very eff ective against the take-all fungus. many years. Th e book by Cook and Baker (1983) is still the best treatise on the subject even though Long-term rotation and tillage trials in South it was published 25 years ago. Take-all decline, Australia have demonstrated that suppression can where cropping continuously with wheat fi rst leads be built up against rhizoctonia root rot (Fig. 3) to high levels of take-all disease and then leads and take-all (Fig. 4) aft er the diseases peaked. Th is to a decline, has been reported from the USA, suppression developed in all rotations and in both UK, Th e Netherlands, Yugoslavia and Australia direct drilled crops and crops sown aft er cultiva- (Hornby 1979; Cook 2007a). Cook and Rovira tion provided the crop residues were retained. Th is (1976) demonstrated that it was possible to transfer suppression was aff ected by the carbon-to-nitrogen the suppressive property by adding 1% of suppres- ratio of the residues being returned to the soil. sive soil from a continuously-cropped wheat fi eld Suppression was maintained as long as the residues to fumigated soil. Addition of soil from an adja- had a high C:N ratio (Roget and Gupta 2006). Th e cent uncropped area did not confer suppression incidence of rhizoctonia root rot has been diffi cult to fumigated soil. Studies by Weller et al. (2002, to predict and did not appear to be aff ected by rain- 2007) and de Souza et al. (2003) have shown that fall. By contrast, in southern Australia take-all was fl uorescent pseudomonads producing the antibiotic aff ected by the rainfall in the previous spring and 2,4-diacetylfl uoroglucinol (2,4-DAPG) occur in until suppression occurred it was possible to predict large numbers in the rhizosphere of wheat grow- the potential level of take-all based on the previous ing in take-all decline soils in the USA and in the year’s rainfall, as shown in Figure 4 in those rota- Netherlands. Th ese workers have extracted 2,4- tions that hosted the take-all fungus.

TheTR Rovira Rhizosphere R Symposium S 121 100 4 100 Take all incidence Take all predicted Cultivated pasture/wheat Take-all incidence (%) Direct drill pasture/wheat 8080 Take-all predicted 3 Direct drill wheat/wheat lesions 6060 take-all

2 4040 with

1 plants 2020 Wheat Root damage rating (0-5 scale) 0 00 79 81 83 85 87 89 91 93 95 7878 79 80 80 81 82 82 83 84 84 85 86 87 88 88 89 90 90 91 92 92 93 94 94 95 96 97 Year Wheat plants with take-all lesions (%) YearYear Figure 3. Suppression of rhizoctonia root rot with Figure 4. Development of suppression of take-all at diﬀ erent rotations and tillage systems at Avon, South Avon, South Australia. Th is graph shows the actual Australia (Roget 1995) levels of take-all and the predicted levels based on rainfall (Roget 2003)

Table 1. Numbers of bacteriaa in soil and on wheat straw from burnt and unburnt areas of stubble at Turretﬁ eld, South Australia Treatment Viable count / g on wheat stubble Straw retained Straw burnt FPb TBc FP TB Soil 25 1.8 14 4 Straw Slight decomposition 10 300 60 240 21 Advanced decomposition 316 319 420 252 a Numbers are means of duplicate or triplicate samples b Fluorescent pseudomonads (×103/g) c Total bacterial count on YPS agar (×106/g)

Th is eff ect of crop residues may be explained in part 375 sites but did not fi nd N. gynophila, but they did by the fi nding of Rovira and Sands (1971) some 35 fi nd small populations of the other parasite, V. chla- years earlier that under stubble there were almost mydosporium. Kerry et al. (1984) then explored the 50 times more fl uorescent pseudomonads in the soil potential for V. chlamydoporium to control CCN than were found where the stubble had been burned by introducing the fungus grown on oat grain into (Table 1). soil containing CCN and then growing wheat in these soils. In these greenhouse experiments they Another example of root disease decline came found that CCN numbers were reduced by between from Kerry and Crump (1977), who found that 26 and 80% when the fungus was introduced. Th is cereal cyst nematode (Heterodera avenae) (CCN) study was not extended to the fi eld because chemi- built up and then declined with continuous cereal cal control of CCN and rotation were being used to cropping. Th is decline was attributed to biological eff ectively control CCN. Soon aft er this work plant control by two fungi, Nematophthora gynophyla breeders bred resistant cereals, making both biologi- and Verticillium chlamydosporium. Following this cal and chemical control obsolete. It is unlikely, report, CSIRO invited Brian Kerry to visit Adelaide however, that biological control was signifi cant to investigate the potential for biological control in Australian soils because CCN never showed of CCN as it was a major problem throughout any signs of declining unless non-host plants were south-eastern Australia. Stirling and Kerry (1983) grown in rotation with cereals. examined more than 23 000 CCN females from

TheTR Rovira Rhizosphere R Symposium S 122 Biological control of root diseases by seed or In Australia there are some examples of root disease soil treatment control and yield increases from seed or soil treatment with biological control agents. Nayudu et al. Since the discovery that many soil micro-organisms (2010) has obtained yield increases ranging from 10 produce antifungal and antibacterial compounds to 32% from planting seed treated with a fl uorescent there have been many attempts to control root pseudomonas into fi elds infested with the take-all diseases by introducing such organisms either by fungus in southern New South Wales, which has a seed or soil treatment. Although many hundreds higher rainfall than other wheat-growing areas of of potential biocontrol organisms have been tested and found to be eff ective in pot and fi eld trials, only Australia. Ryder et al. (2005) has obtained similar 14 bacteria and 12 fungi were registered by the US though variable responses from seed treated with a EPA for use in agriculture and horticulture (Fravel fl uorescent pseudomonad and with in-furrow treat- 2005). One reason for this may be the high cost of ment with Trichoderma koningii (strain Tk7a from fi eld testing and marketing of potential biocontrol Western Australia). Wakelin et al. (2006) found agents, while another may be that biocontrol agents that a combination of Penicillium radicum and the may be more aff ected by adverse soil conditions fungicide fl uquinconazole gave better control of than are chemical agents. take-all than either the biological treatment or the fungicide alone. Th is indicates the diffi culty of controlling root diseases by seed or soil treatment, so much so that Coombs et al. (2004), using several endophytic ac- Cook (2007b) and Mazzola (2007) postulated that tinobacteria, found that some of the isolates greatly cropping systems that increase the populations of reduced damage from the take-all fungus and from antagonists in soil and in the rhizosphere off er a rhizoctonia in the fi eld. Th ese endophytic acti- preferable route. nobacteria have an advantage over other biocontrol agents in that they invade the wheat roots soon aft er Despite this view, however, I still believe that as our germination and thus do not have to compete with knowledge of rhizosphere dynamics increases we the general rhizosphere population. will be able to use the inoculation approach. Aft er all, the symbiosis of the nitrogen-fi xing Rhizobium In a large-scale fi eld study, Putcha and Allen (1997) with legumes following seed treatment with rhizo- applied the liquid suspensions of 600 isolates with bium makes an enormous contribution to food cotton seed in the drill rows and reported that production world wide (Crews and Peoples 2004). several of the isolates were equal to or superior to In Australia this symbiosis is estimated to be worth chemicals in controlling cotton seedling diseases. AUD$3 billion each year to agricultural production, based on the cost of its replacement with fertiliser nitrogen (Howieson and Herridge 2005). Impact of root diseases, rotation and tillage on root disease and yield Two major factors mitigate against the success of seed or soil treatment to control root diseases. Th e Th e eff ect of cropping systems on rhizosphere or- fi rst is to achieve colonisation along the root, and ganisms that aff ect plant health is illustrated in the this was shown to be diffi cult with a biocontrol review by Rovira et al. (1990). In my research pro- pseudomonad without having water movement gram on root health and yield I used soil fumigation down the profi le (Parkeet al. 1986). Th e second and rotations to demonstrate the impact of root is the complexity of the rhizosphere, as shown by diseases on grain yield and water-use effi ciency. One electron microscopy of roots (Fig. 1) that indicates of these trials conducted in Victoria, using a nem- the environment into which we are introducing aticide to control cereal cyst nematode, fumigation benefi cial organisms. However, the fact that there to control all root pathogens and nitrogen fertiliser, have been successes in several countries as described showed spectacular yield increases from controlling below is cause for optimism. root diseases (Fig. 5; Meagher et al. 1978).

In China, the use of Bacillus spp. in the commercial Fumigation of highly calcareous soils in South YIBS (Yield-Increasing Bacteria) product and the Australia gave similar increases in grain yield, which use of Trichoderma spp. and other organisms dem- was attributed to the control of a root disease com- onstrates the potential of seed and soil treatment plex (Rovira and Simon 1985). with benefi cial organisms (Tang and Rovira 2005).

TheTR Rovira Rhizosphere R Symposium S 123 Th ese soil fumigation trials led to a long-term tillage × rotation trial at Avon, South Australia, where 4.5 take-all and rhizoctonia root rot were problems. 4 3.5 ) Th is was the site where suppression to rhizoctonia -1 3 appeared aft er four years and suppression to take-all 2.5 appeared aft er seven years (see Figs 3 and 4). Figure 6 shows that control of root diseases by rotation and 2 1.5

tillage before suppression occurred was necessary to Grain (t yield ha maximise yield and maximise water-use effi ciency 1 (WUE). 0.5 0 Figure 7 demonstrates that unless take-all is controlled by rotation, yields from direct-drilled wheat do not reach the yields of wheat planted with culti- UntreatedNematicideFumigation nematicide vation. LSD (P<0.01) Nitrogen fertiliser ogen + fumigation Soil treatment Nitrogen +Nitr Subsequent research at this site led to the development of narrow sowing points for direct drilling Figure 5. Th e eﬀ ects of soil fumigation with methyl — these points disturbed the soil below the seed, bromide-chloropicrin, nematicide (aldicarb) and controlling rhizoctonia suffi ciently for the seedling nitrogen fertiliser on grain yield (Meagher et al. roots to escape the disease (Roget et al. 1996). 1978) Pythium spp. is a root pathogen with a wide host range and oft en associated with cold, wet conditions Th ey found that the most profi table system was con- at sowing, causing yield losses of 5–10% (Ingram tinuous cropping, with wheat alternating with peas et al. 1990). In South Australia, Pankhurst and both sown directly into stubble with no nitrogen McDonald (1988) reported higher levels of Pythium fertiliser (Fig. 8). following the annual pasture phase of a rotation than aft er the cereal phase. Clive Pankhurst Th is rotation kept the level of take-all down and (CSIRO, pers. comm.) demonstrated that infection benefi ted from the nitrogen fi xed by the peas. eTh of wheat seed embryos occurred within 48 hours of rotation which gave the second-best fi nancial return planting, which means that there is a good oppor- was wheat alternating with oats (not a host for the tunity to control this disease with seed dressings of take-all fungus) planted with cultivation. chemicals or biological control agents.

Economic value of 5 farming systems CC = Conventional cultivation Root disease DD = Direct drilling Available research Take- Rhiz- nitrogen 4 all octonia If we wish to make our rhizo- Medic CC ------Low Low High sphere studies more relevant Peas CC ------Low Low High to real farming, an economic 3 Peas DD ------Low Mod. High analysis must take into ac- Medic DD ----- Mod. Mod. High Pasture CC ---- Mod. Low Med. count all inputs for each 2 Wheat CC ----- Low Low Low treatment (seed, fertiliser, (t/ha) Yield chemicals, fuel) with the Pasture DD --- High High Med. 1 Wheat DD ---- High High Low diff erent farming systems. Maximum yield per mm of rainfall 282 mm David Roget, together with 0 Mike Krause (an agricultural 0 100 200 300 400 economist), applied a rigor- April-October rainfall (mm) ous economic analysis to the Avon trial. Figure 6. Impact of root disease and soil nitrogen on grain yield and water use eﬃ ciency

TheTR Rovira Rhizosphere R Symposium S 124 250 Tillage WP/DD/0 WVP/CC/0 CC DD WO/CC/0 Grass-medic pasture 200 WW/DD/0 Sown medic pasture Danger mark Peas 150 Wheat Oats 100 Equity (%)

50 3 N 0 1979 1981 1983 1985 1987 1989 1991 1993 1995 -50

2 Take-all Figure 8. Th e proﬁ tability of the diﬀ erent rotations and tillage treatments expressed as change in equity CC in a long-term farming system trial at Avon, South

1979 wheat yield (t/ha) Australia. WP = wheat/peas; WVP = wheat/volun- 1 teer pasture; WO = wheat/oats; WW = wheat/wheat; DD = direct drill; CC = conventional cultivation; DD 0 = zero fertiliser. ‘Danger mark’ refers to an equity point where the business is reaching a non-viable 0 0 10 20 40 60 80 10 condition (David Roget and Mike Krause, 2000, Incidence of take-all (%) pers. comm.)

Figure 7. Eﬀ ect of rotation and tillage on the inci- Th is property means that these cultivars may have a dence of take-all disease and grain yield of wheat greater ‘resistance’ to the take-all fungus and the use during 1979 at Avon, South Australia. Values are of such cultivars in wheat breeding programs may averages of four replicate plots (Rovira, unpub- provide an indirect control of the disease in succes- lished). DD = direct drilling, no cultivation before sive wheat crops. seeding; CC = conventional cultivation before seed- 2 ing. Regression values (r ) for CC and DD were 0.79 Th ese reports by Gupta et al. (2004) and Mazzola and 0.91 respectively. et al. (2004) present a challenge to plant breeders to gain a better understanding of the importance Since these trials were completed and analysed of the rhizosphere microfl ora to reduce the impact there has been widespread acceptance in southern of one variety upon another and in the resistance to Australia of growing successive wheat crops with root diseases. direct drilling and stubble retention.

Plant growth – promoting rhizobacteria Importance of the rhizosphere microfl ora on (PGPR) successive crops Research conducted some 20 years later by Following the wider adoption of continuous crop- Dobereiner et al. (1976) reported that Azospirillum ping with wheat in Australia it has been found that fi xed nitrogen in the rhizosphere of paspalum (a yields of wheat in crops following certain other tropical grass) in Brazil. Th ese reports caused con- varieties of wheat were 5–20% lower than expected. siderable excitement in the USA where Azospirillum Gupta et al. (2004) demonstrated that this reduced treatment of crops such as corn was seen as an yield was due to the rhizosphere microfl ora on the alternative to the use of nitrogenous fertiliser. roots of the wheat variety causing lower yields in the Unfortunately, there was no recognition of the re- following wheat crop. search conducted in Russia, England and Australia Mazzola et al. (2004) demonstrated that certain with Azotobacter that showed that plant growth wheat cultivars selectively stimulated fl uorescent responses were not due to nitrogen fi xation, and it pseudomonads that produced the antibiotic 2,4-di- was not until a great deal of research was conducted acetylphloroglucinol from resident soil populations. across the USA with variable results that it was con-

TheTR Rovira Rhizosphere R Symposium S 125 cluded that inoculation with Azospirillum did not Mycorrhizas and crop yields provide a substitute for fertiliser nitrogen (Bashan In the Darling Downs of southern Queensland a and Holguin 1997). I think that the researchers condition known as ‘long fallow disorder’ caused failed to appreciate the very diff erent soil environ- poor growth of wheat following a period of bare ment under a paspalum pasture (see Figs 50–53 in fallow. Th is was attributed to a nutrient disorder as Foster et al. 1983) compared with the rhizosphere it could be partly overcome with applications of zinc of an annual cereal such as corn (maize). Under pas- and phosphorus. However, Th ompson (1994) dem- palum and around the paspalum roots there is a very onstrated that during the fallow period the levels high level of available substrate for the Azospirillum of mycorrhizal fungi declined to the point that the that is conducive to nitrogen fi xation. The higher following wheat plants were not mycorrhizal, and in soil temperature and high rainfall of tropical Brazil the high-clay soils the roots alone could not access would also be conducive to microbial activity, in- the soil phosphorus. Th ompson showed that if the cluding non-symbiotic nitrogen fi xation. fallow period was shortened, or crops which became Studies by later researchers showed that many mycorrhizal were grown before the wheat, the prob- bacteria promoted plant growth, and some of these lem was overcome. It is more diffi cult to show the results have been reported in the series of PGPR importance of mycorrhizas in crops in other soils, (plant growth-promoting rhizobacteria) workshops but Smith and co-workers (Sally Smith, University held over the past 20 years. Th e proceedings of each of Adelaide, 2008, pers. comm.) have shown that in- of these PGPR workshops provide an excellent troduction of mycorrhizal fungi at sowing of wheat source of information on the eff ects of rhizosphere in highly calcareous, phosphate-fi xing soil increased microbes on plant growth. the uptake of phosphorus.

Induced resistance to root and foliar diseases Plant nutrition and root health Kloepper et al. (2004, 2006) have shown that many Early studies reported by Rovira and Ridge (1973) PGPR pseudomonads and Bacillus spp. can induce that plant nutrition aff ected the exudation of solu- resistance to a wide range of foliar diseases of plants, ble compounds from plant roots has relevance to the and in some cases increase resistance to insect pests. fi ndings of Wilhelm et al. (1988) and Graham and Most of these PGPR organisms colonise the rhizo- Rovira (1984) that the application of manganese sphere, but some are endophytes which could give fertiliser to manganese-defi cient soils reduced the them an advantage through avoiding competition. colonisation and invasion of roots by the take-all fungus (Gaeumannomyces graminis var. tritici) and increased grain yields because of less disease. Impact of cruciferous plants on root disease Another example of the eff ect of nutrition on root For many years in India mustard has been planted disease was reported by Th ongbai et al. (1993) who between rows of other crops to control fusarium found that application of zinc to zinc-defi cient wilt in the crop plants, an eff ect attributed to vola- sandy soils greatly reduced the severity of rhizocto- tile compounds being released from the mustard nia root rot. roots. Studies by Kirkegaard and Sarwar (1998) reported less take-all in wheat crops following cano- Future prospects for rhizosphere la and mustard, and attributed this to the release of isothiocyanates from roots or residues and their research conversion to glucosinolates resulting in ‘biofumiga- I believe that the development of new and recently tion’ of the soil. However, the relative importance of developed techniques applied to rhizosphere studies the biofumigation eff ects of canola compared with will enable us to ultimately modify the rhizosphere its value purely as a non-host crop for the take-all and improve plant production. It is my opinion that fungus is questioned in a later paper by Smith et al. we need to include root pathogens in our defi nition (2004). of the rhizosphere as they can have a devastating impact on food production. Research needs to progress at two levels—fi rstly, fundamental studies that improve our understanding of the dynamics

TheTR Rovira Rhizosphere R Symposium S 126 of the rhizosphere and secondly the application of Develop mycorrhizal associations to increase these results to fi eld problems. Below are some areas nutrient uptake of research which I believe will be important in the future. In many soils phosphorus levels may be high but relatively unavailable to plants, so the use of mycorrhizas could be an advantage. DNA quantifi cation of pathogens, introduced organisms and roots Develop methods of introducing benefi cial Over the past ten years, this technique has yielded a organism and broaden target crops great deal of information on the levels and distribution of cereal root pathogens in southern Australia. It is now clearly established that there are many Th is technique could be extended to follow the bacteria, actinomycetes and fungi that can improve colonisation of roots by pathogens and introduced plant production by controlling root disease, induc- microbes. Possibly, it could be used as a technique to ing resistance to pathogens and pests and increasing screen cereal varieties for the colonisation of roots nutrient uptake. Th is is a diffi cult area to research, by pathogens such as take-all, fusarium and rhizoc- but nevertheless methods of producing and apply- tonia. ing these bioinoculants should be developed so that food production world wide can be increased and the use of chemical controls reduced. So far, most New techniques for culturing bacteria from research has been conducted on rain-fed broad-acre the rhizosphere crops, but I believe that there is a huge potential to Th e development of media to culture slow-growing increase the production of irrigated vegetable crops soil bacteria (Janssen et al. 2002) has led to the by introducing organisms that will promote plant discovery of many new species. Th is technique growth and control root diseases. Organisms could could be applied to the rhizosphere to improve our be introduced to the roots through trickle irrigation knowledge of the bacteria growing on roots. Th e use systems used for many vegetable crops. of culture-independent techniques such as genomics and microarrays will increase understanding of Breeding crop varieties with resistance to the nature of rhizosphere populations (Kent and soil-borne root diseases Triplett 2002) Th e breeding of varieties of wheat, barley and oats with resistance to cereal cyst nematode (CCN) is an Use rhizosphere colonisation of roots to example how this particular root disease can be con- introduce benefi cial organisms into soil trolled to the point that yield losses in Australia are Microbial degradation of pollutants in soil is one now negligible compared with 25 years ago, when method of decontaminating soils and it should be the disease was causing yield losses of $40–$80 mil- possible to use roots of plants such as grasses to dis- lion each year (Rovira and Simon 1982). tribute benefi cial organisms through soil. Despite the fi ndings that rhizoctonia root rot can be managed in many situations through suppression Improve rhizobium–legume associations to and sowing point design, it still causes heavy losses increase productivity in calcareous sandy soils (Wilhelm 2010, pp. 55–60 this volume), so we need to consider breeding for Th is symbiotic association has brought enormous resistance to this and other cereal root diseases. benefi ts to agriculture world wide, but more knowledge is required to introduce rhizobia into hostile A number of papers have reported tolerance and soils. Th e work of Dilworth et al. (2001) demon- or resistance in wheat to crown rot (Dodman et al. strating how to select acid tolerance in legume root 1985; Klein et al. 1985), take-all (Simon and Rovira nodule bacteria, and the research by Howieson 1985) and rhizoctonia root rot (McDonald and and Ewing (1986) using acid-tolerant selections of Rovira 1985), which should encourage cereal breed- Medicago spp., has extended the range of soils in ers to pursue breeding as a strategy to reduce yield Western Australia in which Medicago spp. can be losses from these diseases. grown for annual pasture.

TheTR Rovira Rhizosphere R Symposium S 127 Th e discovery at Washington State University, References Pullman, USA, of a wheat genotype with tolerance to rhizoctonia root rot (Okubara et al. 2008) should Bais, H.P., Weir, T.L., Perry, L.G., Gilroy, S. and encourage cereal breeders in Australia to develop Vivanco, J.M. 2006. Th e role of root exudates in rhizosphere interactions with other a screening program for tolerance or resistance to organisms. Annual Review of Plant Biology rhizoctonia root rot within the Australian cereal 57, 233–266. varieties. Bashan, Y. and Holguin, G. 1997. Short and You et al. (2005) have reported new sources of medium-term avenues for Azospirillum in- resistance in subterranean clover to Fusarium oculation. In: Ogoshi, A., Kobayashi, K., avenaceum and Pythium irregulare that should be Homma, Y., Kodama, F., Kondo, N. and valuable in increasing annual pasture production in Akino, S. (eds) Plant Growth Promoting southern Australia. Rhizobacteria—Present Status and Future Prospects. Proceedings of the fourth interna- Conclusions tional workshop on plant growth-promoting rhizobacteria. Sapporo, Japan, 5–10 October I hope that this personal journey has given you an 1997, pp. 130–149. insight on how my interests in rhizosphere biology Bowen, G.D. and Rovira, A.D. 1966. Microbial fac- developed from a chance reading of some reviews tor in short-term phosphate uptake studies over 50 years ago to the point where, over the years, with plant roots. Nature 211, 665–666. my interests have expanded from the basic aspects of the rhizosphere to the application of the knowl- Bowen, G.D. and Rovira, A.D. 1969. Th e infl uence edge to agriculture to develop more productive of micro-organisms on growth and metabo- and sustainable farming systems. My defi nition of lism of plant roots. In: Whittington, W.J. the rhizosphere is much broader than that used by (ed.) Root Growth. Butterworth, London. most soil microbiologists and includes root pathology and plant breeding, but if we wish to use our Bowen, G.D. and Rovira, A.D. 1999. Th e rhizosphere and its management to improve plant understanding of the rhizosphere to increase food growth. Advances in Agronomy 66, 1–102. production I believe that we are obliged to use this broader defi nition. Brown, M.E., Burlingham, S.K. and Jackson, R.M. 1964. Studies on Azotobacter species in soil. Th e ATSE Crawford Fund which sponsored this III. Eff ects of artifi cial inoculation on crop symposium has the goal of reducing poverty in yields. Plant and Soil 20, 194–214. lesser-developed countries through increased food production. Th ere is no doubt in my mind that a Clark, F.E. 1949. Soil micro-organisms and plant better understanding of the biology of the rhizo- growth. Advances in Agronomy 1, 214–288. sphere and application of that knowledge to fi eld Cook, R.J. 2007a. Management of resident growth problems will help achieve that goal. promoting rhizobacteria with the cropping I thank the ATSE Crawford Fund and the organis- system: a review of the experience in the ers of this symposium for giving me the opportunity Pacifi c Northwest. European Journal of Plant to prepare this personal journey through the rhizo- Pathology 19, 255–264. sphere. Cook, R.J. 2007b. Take-all decline: model system in the science of biological control and clue Finally I wish to acknowledge the help given to me to the success of intensive cropping. In: by Dr Gupta Vadakattu in coping with the vagaries Vincent, C., Goettel, M.S. and Lazorovits, of diff erent computer programs while this manu- G. (eds) Biological Control: A Global script was being prepared. Perspective. CAB International, London, England, pp. 399–414.

Cook, R.J. and Baker, K.F. 1983. Th e Nature and Practice of Biological Control of Plant Pathogens. American Phytopathological Society, St Paul, Minnesota, 539 pp.

TheTR Rovira Rhizosphere R Symposium S 128 Cook, R.J. and Rovira, A.D. 1976. Th e role of bacte- Graham, R. and Rovira, A.D. 1984. A role of man- ria in biological control of Gaeumannomyces ganese in the resistance of wheat to take-all. graminis by suppressive soils. Soil Biology and Plant and Soil 78, 441–444. Biochemistry 8, 269–273. Gupta, V.V.S.R., Roget, D.K. and Coppi, J.A. 2004. Coombs, T.T, Michelmore, P.P. and Franco, C.M.M. Identifi cation of a previously unrecognized 2004. Evaluation of symbiotic actinobacteria constraint to yield in sequential wheat crops. as antagonists of Gaeumannomyces graminis In: Ophel-Keller, K. and Hall, B. (eds) var. tritici in wheat. Biological Control 29, Proceedings of 3rd Australasian Soilborne 359–366. Disease Symposium. SARDI, Adelaide, pp. 13–14. Crews, T.E. and Peoples, M.B. 2004. Legume versus fertilizer sources of nitrogen: ecological Hornby, D. 1979. Take-all decline: a theorist’s para- trade-off s and human needs. Agriculture dise. In: Schippers, B. and Gams, W. (eds) Ecosystems and Environment 102, 279–297. Soil-Borne Plant Pathogens. Academic Press, London, pp. 133–156. De Souza, J.T., Weller, D. and Raaijmakers, J.M. 2003. Frequency, diversity, and activity of Howieson, J.G. and Ewing, M.A. 1986. Acid toler- 2,4-diacetylphloroglucinol-producing fl uo- ance in the Rhizobium meliloti – Medicago rescent Pseudomonas spp. in Dutch take-all symbiosis. Australian Journal of Agricultural decline soils. Phytopathology 93, 54–63. Research 37, 55–64.

Dilworth, M.J., Howieson, J.G., Reeve, J.G., Tiwari, Howieson, J. and Herridge, D. 2005. Foreword to R.P. and Glenn, A.P. 2001. Acid tolerance ‘Application of Inoculants to Australian in legume root nodule bacteria and select- Agriculture.’ In: Herridge, D.F., Howieson, ing for it. Australian Journal of Experimental J.G., Anderson, C.A. and Muir, L.L. Agriculture 41, 435–446. (eds) Australian Journal of Experimental Agriculture 45, 127–199. Dobereiner, J., Marriel, I.E. and Nery, M. 1976. Ecological distribution of Spirillum lipoferum Ingram, D.S., Cook, R.J. and Chamswarng, C. Beijerinck. Canadian Journal of Microbiology 1990. Pathogenicity of four Pythium spe- 22, 1464–1473. cies to wheat, barley, lentils and peas. Plant Pathology 39, 110–117. Dodman, R.L., Wildermuth, G.B., Klein, T.A. and Ellison, F.W. 1985. Field resistance of Janssen, P.H., Yates, P.S., Grinton, B.E., Taylor, wheat cultivars to crown rot. In: Parker, P.M. and Sait, M. 2002. Improved cultur- C.A. et al. (eds) Ecology and Management ability of soil bacteria and isolation in pure of Soilborne Plant Pathogens. Th e American culture of novel members of the divisions Phytopathological Society, St Paul, Acidobacteria, Actinobacteria, Proteobacteria Minnesota, USA, pp. 167–168. and Verrucomicrobia. Applied and Environmental Microbiology 68, 2391–2396. Foster, R., Rovira, A.D. and Cock, T.W. 1983. Ultrastructure of the Root-Soil Interface. Katznelson, H., Lochhead, A.G. and Timonin, M.I. American Phytopathological Society, St 1948. Soil micro-organisms in the rhizo- Paul, Minnesota, 157 pp. sphere. Th e Botanical Review 201, 543–586.

Fravel, D. 2005. Commercialization and implemen- Kent, A.D. and Triplett, E.W. 2002. Microbial com- tation of biological control. Annual Review of munities and their interactions in soil and Plant Pathology 43, 337–359. rhizosphere ecosystems. Annual Review of Microbiology 56, 211–236. Garbeva, P., van Veen, J.A. and van Elsas, J.D. 2004. Microbial diversity in soil: selection Kerry, B.R. and Crump, D.H. 1977. Observations of microbial populations by plant and soil on fungal parasites of females and eggs of type and implications for disease suppres- cereal cyst-nematode, Heterodera avenae, siveness. Annual Review of Plant Pathology and other cyst nematodes. Nematologica 23, 42, 243–270. 193–198.

TheTR Rovira Rhizosphere R Symposium S 129 Kerry, B.R., Simon, A. and Rovira, A.D. 1984. of Soilborne Plant Pathogens. Th e American Observations on the introduction of Phytopathological Society, St Paul, Verticillium chlamydosporium and other Minnesota, USA, pp. 174–176. parasitic fungi into soil for the control of the cereal cyst nematode Heterodera avenae. McDougall, B.M. 1965. Carbon-14 labelled photo- Annals of Applied Biology 105, 509. synthate in wheat root exudates. Nature 207, 1104–1105. Kirkegaard, J.A. and Sarwar, M. 1998. Biofumigation potential of brassicas. I. McDougall, B.M. and Rovira, A.D. 1970. Sites Variations in glucosinolate profi les of diver- of exudation of 14-carbon labelled com- sifi ed fi eld-grown brassicas. Plant and Soil pounds from wheat roots. New Phytology 69, 201, 71–89. 999–1003.

Klein, T.A., Liddell, C.M. and Burgess, L.W. 1985. McKay, A., Riley, I.T., Hartley, D., Wiebkin, S., Glasshouse test for tolerance of wheat to Herdina, Li Guangdi, Coventry, S., Hall, S. crown rot caused by Fusarium gramineare- and Huang, C. 2008. Studying root develop- um Group 1. In: Parker, C.A. et al. (eds) ment in soil using DNA technology: idea to Ecology and Management of Soilborne Plant impact. In: Unkovich, M. (ed.) Global Issues: th Pathogens. Th e American Phytopathological Paddock Action. Proceedings 14 Australian Society, St Paul, Minnesota, USA, pp. Society of Agronomy. Th e Regional Institute 172–173. Ltd, Gosford, NSW, Australia. http://www. regional.org.au/au/asa/2008/plenary/bio- Kloepper, J. and Ryu, C.-M. 2006. Bacterial endo- technology/5945_mckay.htm#TopOfPage. phytes as elicitors of induced resistance. In: Schultz, B., Boyle, C. and Sieber, T.N. (eds) Meagher, J.W., Brown, R.H. and Rovira, A.D. Microbial Root Endophytes in Soil Biology 9, 1978. Th e eff ects of cereal cyst nematode 31–52. (Heterodora avenae) and Rhizoctonia solani on the growth and yield of wheat. Australian Kloepper, J., Ryu, C.-M. and Zhang, S. 2004. Journal of Agricultural Research 29, 1127– Induced systemic resistance and promo- 1137. tion of plant growth. Phytopatology 94, 1259–1266. Nayudu, M., Kaur, R., Samundsett, C., Macleod, J., Franklin, A., Groom, K., Zhang, Y., Louw, H.A. and Webley, D.M. 1959. Th e bacteriol- Murphy, T., Koeck M. and Millar, H. ogy of the root region of the oat plant grown 2010. Nature of biocontrol of take-all by under controlled plot culture conditions. the Australian bacterial isolate Pseudomonas Journal of Applied Bacteriology 22, 216–226. strain AN5: a true symbiosis between plant and microbe. In: Gupta, V.V.S.R., Ryder, M. Lynch, J.M. (ed.) 1990. Th e Rhizosphere. John Wiley and Radcliff e, J. (eds) Th e Rovira Rhizosphere & Sons Ltd., Chichester, England, 458 pp. Symposium. Proceedings, 15 August 2008, SARDI Plant Research Centre, Adelaide. Mazzola, M. 2007. Manipulation of rhizosphere Th e Crawford Fund, Canberra, pp. 26–31. bacterial communities to induce suppressive soils. Journal of Nematology 39, 213–220. Okubara, P.A., Steber, C.M., Paulitz, T.C. and Kidwell, K.K. 2008. Ems-generated rhizoc- Mazzola, M., Funnell, D.L. and Raaijmakers, J.M. tonia resistance in an adapted wheat. Journal 2004. Wheat-cultivar specifi c selection of of Plant Pathology. S.350.(2). 2,4-diacetylphloroglucinol-producing fl uorescent Pseudomonas species from resident Ophel-Keller, K., McKay, A., Hartley, D., Herdina soil populations. Microbial Ecology 48, and Curran, J. 2007. Development of a rou- 338–348. tine DNA-based testing service for soilborne diseases in Australia. Australasian Plant McDonald, H.J. and Rovira, A.D. 1985. Pathology 37, 243–253. Development of inoculation technique for Rhizoctonia solani and its application to Pankhurst, C.E. and McDonald, H.J. 1988. cereal cultivars for resistance. In: Parker, Infl uence of tillage and crop rotation on the C.A. et al. (eds) Ecology and Management ecology of Pythium in a South Australian

TheTR Rovira Rhizosphere R Symposium S 130 wheat growing soil. Proceedings Fifth Rovira, A.D. 1956b. Plant root excretions in relation International Conference on Plant Pathology. to the rhizosphere eff ect. I. Nature of root Kyoto, Japan. Abstracts V1–6, p. 163. exudate from oats and peas. Plant and Soil 7, 178–194. Parke, J.L., Moen, R., Rovira, A.D. and Bowen, G.D. 1986. Soil water fl ow aff ects the rhizo- Rovira, A.D. 1963. Microbial inoculation of plants. sphere distribution of a seed-borne biological I. Establishment of free-living nitrogen- control agent. Soil Biology and Biochemistry fi xing bacteria in the rhizosphere and their 18, 583–588. eff ects on plant growth. Plant and Soil 19, 304–314. Putcha, V.S. and Allen, S.J. 1997. A technique for sowing bacterial inoculants in the fi eld. Rovira, A.D. and Ridge, E.H. 1973. Evaluation of In: Ogoshi, A., Konayashi, K., Homma, C-14 labelled compounds from plant roots: Y., Kodama, F., Kondo, N. and Akino, S. infl uence of nutrients, micro-organisms and (eds) Proceedings of the Fourth International added organic compounds. New Phytology Workshop on Plant Growth-Promoting 72, 1081–1087. Rhizobacteria. OECD Joint Workshop, Rovira, A.D. and Sands, D.C. 1971. Fluorescent Sapporo, Japan, pp. 221-222. pseudomonads—a residual component Roget, D.K. 1995. Decline in root rot (Rhizoctonia of the soil microfl ora. Journal of Applied solani AG-8) in wheat in a tillage and rota- Bacteriology 14, 253–259. tion experiment at Avon, South Australia. Rovira, A.D. and Simon, A. 1982. Integrated control Australian Journal of Experimental of Heterodora avenae. Bulletin OEPP 12, Agriculture 35, 1009–1013. 517–523.

Roget, D.K. 2003. Occurrence and control of Rovira, A.D. and Simon, A. 1985. Growth, nutrition take-all in Australia. In: Proceedings of the and yield of wheat in calcareous sandy loams International Take-all Management Seminar. of South Australia: eff ects of soil fumiga- INIA, Carillanca, Temuco, Chile. tion, fungicide, nematicide and nitrogen fertilizers. Soil Biology and Biochemistry 17, Roget, D.K. and Gupta, V.V.S.R. 2006. Rhizoctonia 279–284. control through management of disease suppressive activity in soils. In: Proceedings Rovira, A.D., Newman, E.I., Bowen, H.J. and of the 18th World Congress of Soil Science. Campbell, R. 1974. Quantitative assess- Philadelphia, USA. ment of the rhizosphere microfl ora by direct microscopy. Soil Biology and Biochemistry 6, Roget, D.K., Neate, S.M. and Rovira, A.D. 1996. 211–216. Eff ect of sowing point design and tillage on the incidence of rhizoctonia root rot, take- Rovira, A.D., Elliott, L.F. and Cook, R.J. 1990. all and cereal cyst nematode in wheat and Th e impact of cropping systems on rhizo- barley. Australian Journal of Experimental sphere organisms aff ecting root health. In: Agriculture 36, 683–693. Lynch, J.M. (ed.) Th e Rhizosphere. John Wiley & Sons Ltd., Chichester, England, pp. Rotenberg, D., Joshi, R., Benitez, M., Chapin, L., 398–436. Camp, A., Zumpetta, C., Osborne, A., Dick, W.A. and McSpadden Gardener, B.B. 2007. Ryder, M., Warren, R., Harvey, P., Tang Wenhua, Farm management eff ects on rhizosphere Yang Hetong, Zhang Xia and Zhang colonization by native populations of 2,4-di- Bingxin 2005. Recent advances in bio- acetylphloroglucinol-producing Pseudomonas logical control of soil-borne root diseases of spp. and their contribution to plant health. wheat, vegetables and cotton in China and Phytopathology 97, 756–766. Australia. Shandong Science 18, 3–8.

Rovira, A.D. 1956a. Study of the development of Sands, D.C. and Rovira, A.D. 1971. Pseudomonas the root surface microfl ora during the initial fl u o r e s c e n s biotype G — the dominant fl uo- stages of plant growth. Journal of Applied rescent pseudomonad in South Australian Bacteriology 19, 72–79. soils and the rhizosphere. Journal of Applied Bacteriology 34, 261–275.

TheTR Rovira Rhizosphere R Symposium S 131 Simon, A. 1989. Biological control of take-all Vinale, F., Marra, R., Scala, F., Ghisalberti, E.J., of wheat by Trichoderma koningii under Lorito, M. and Sivasithamparam, K. 2006. controlled environmental conditions. Soil Major secondary metabolites produced by Biology and Biochemistry 11, 323–326. two commercial Trichoderma strains active against diff erent pathogens. Letters in Applied Simon, A. and Rovira, A.D. 1985. New inoculation Microbiology 43, 143–148. technique for Gaeumannomyces graminis var. tritici to measure dose response and Vinale, F., Sivasithamparam, K., Ghisalberti, E.L., resistance in wheat in fi eld experiments. Marra, R., Woo, S.L. and Lorito, M. 2008. In: Parker, C.A. et al. (eds) Ecology and Trichoderma–plant pathogen interactions. Management of Soilborne Plant Pathogens. Soil Biology and Biochemistry 40, 1–10. Th e American Phytopathological Society, St Paul, Minnesota, USA, 183–184. Wakelin, S., Anstis, S.T., Warren, R.A. and Ryder, M.H. 2006.Th e role of pathogen suppres- Simon, A., Rovira, A.D. and Sands, D.C. 1973. An sion on the growth promotion of wheat improved selective medium for isolating by Penicillium radicum. Australasian Plant fl uorescent pseudomonads. Journal of Applied Pathology 35, 253–258. Bacteriology 36, 141–145. Watt, M., Kirkegaard, J.A. and Passioura, J.B. 2006. Simon, A., Sivasithamparam, K. and MacNish, Rhizosphere biology and crop productiv- G.C. 1988. Eff ect of application to soil of ity. Australian Journal of Soil Research 44, nitrogenous fertilizers and lime on biological 299–317. suppression of Gaeumannomyces graminis var. tritici. Transactions of the British Mycological Weller, D.M, Raaijmakers, J.M., McSpadden Society 91, 287–294. Gardener, B.B. and Th omashow, L.S. 2002. Microbial populations responsible for Smith, B.J., Kirkegaard, J.A. and Howe, G.N. 2004. specifi c soil suppressiveness to plant patho- Impacts of Brassica break crops on soil bi- gens. Annual Review of Plant Pathology 40, ology and yield of following wheat crops. 309–348. Australian Journal of Agricultural Science 55, 1–11. Weller, D., Landa, B.B., Mavrodi, O.V., Schroeder, K.L., De La Fuente, L., Bankhead, S.B., Starkey, R.L. 1931. Some infl uences on the develop- Molar, R.A., Bonsall, R.F., Mavrodi, D.V. ment of higher plants on micro-organisms in and Th omashow, L.S. 2007. Role of 2,4-di- the soil. Soil Science 45, 207–249. acetylphloroglucinol-producing Pseudomonas Stirling, G.R. and Kerry, B.R. 1983. Antagonists of spp. in the defence of plant roots. Plant the cereal cyst nematode (Heterodera avenae) Biology 9, 4–20. Woll. in Australian soils. Australian Journal of Experimental Agriculture and Animal Whipps, J.M. 1990. Carbon economy. In: Lynch, Husbandry 23, 318–324. J.M. (ed.) Th e Rhizosphere. John Wiley & Sons Ltd., Chichester, England, pp. 59–98. Tang, W. and Rovira, A.D. 2005. Preface: Shandong Science 18, 1–123. English with Chinese Wilhelm, N.S. 2010. Rhizoctonia on the Upper abstracts. Eyre Peninsula, South Australia. In: Gupta, V.V.S.R., Ryder, M. and Radcliff e, Th ompson, J.P. 1994. Inoculation with vesicular- J. (eds) Th e Rovira Rhizosphere Symposium. arbuscular mycorrhizal fungi from cropped Proceedings, 15 August 2008, SARDI Plant soil overcomes long-fl ow disorder of linseed Research Centre, Adelaide. Th e Crawford (Linum-usitatissimum L.) by improving P Fund, Canberra, pp. 55–60. and Zn uptake. Soil Biology and Biochemistry 26, 1133–1143. Wilhelm, N.S., Graham, R.D. and Rovira, A.D. 1988. Application of diff erent sources of Th ongbai, P., Hannam, R.J., Graham, R.D. and manganese sulphate decreases take-all Webb, M.J. 1993. Interaction between zinc (Gaeumannomyces graminis var. tritici) of nutritional status of cereals and rhizocto- wheat grown in manganese defi cient soil. nia root rot severity. Plant and Soil 153, Australian Journal of Agricultural Research 207–214. 39, 1–10.

TheTR Rovira Rhizosphere R Symposium S 132 You, N.P., Barbetti, M.J. and Nichols, P.G.H. 2005. New sources of resistance identiﬁ ed in Trifolium subterraneum breeding lines and cultivars to root rot caused by Fusarium avenaceum and Pythium irregulare and their relationship to seedling survival. Australasian Plant Pathology 34, 237–244.

TheTR Rovira Rhizosphere R Symposium S 133 f plant growth? strain AN5 and other plant-parasitic and other plant-parasitic stems stems eals re wiser? Pseudomonas Pratylenchus New insights into roles of arbuscular mycorrhizas in crops and natural ecosy ATSE Crawford International Masterclasses on soilborne pathogens of cer Masterclasses ATSE Crawford International Minimum tillage and residue retention enhance suppression of Minimum tillage and residue retention enhance suppression nematodes in both grain and sugarcane farming systems Nature of biocontol of take-all by the Australian bacterial isolate Nature of biocontol take-all The biology future ofpast, present, the rhizosphere: Albert Rovira and half a century of rhizosphereAlbert Rovira and research: are we any the New technologies for more in-depth understanding of the soil and rhizosphere communities How best can we design rhizosphere plant–microbe interactions for the benefit o Opening remarks Trophic cascades in pine seedling rhizosphere caused mycorrhizae by fungivory on establishing Title Root diseases, plant health and farming systems Soilborne diseasesAustralian agriculture in southern Co-opting the endorhizosphere Co-opting the endorhizosphere A farmer’s agricultu perspective of the Rovira contribution to Australian Michigan State University Oregon State University Australian National University University Australian National University of Queensland University of Queensland Queensland Farmer, York Peninsula, SA Farmer, York Peninsula, University of Adelaide SARDI Dalhousie University CSIRO Entomology CSIRO Entomology Adelaide ATSE Crawford Fund Flinders University Organisation Program for the Rovira Rhizosphere Symposium on 15 August 2008 1400 1420 1420 1435 Neil Smith Nigel Wilhelm 1435 1450 Graham Stirling 1215 1230 Sally Smith 0945 1015 1015 1030 Richard Burns Gupta V.V.S.R. 1600 1630 Albert Rovira Start Finish 0900 0930 REGISTRATION Speaker Radcliffe Sesson 1—John 0935 0940 Neil Andrew 1045 1115 COFFEE BREAK Session 2 —Paul Harvey 1115 1145 Jim Tiedje 1230 1330 LUNCH Session 3—Kathy Ophel-Keller 1330 1400 Dick Smiley 1450 1510 TEA BREAK Session 4—John Radcliffe 1510 1530 1530 1600 Maarten Ryder, Tang Wenhua University Adelaide/China Agricultural Hugh Wallwork, JulieNicol Long-term international research cooperation between China and Australia on soil biology in agriculture 1630 CLOSE SARDI /CIMMYT 1145 1200 Murali Nayudu 1200 1215 Franco Chris 1030 1045 Sina Adl

TheTR Rovira Rhizosphere R Symposium S 134 Rhizoctonia root rot L.) Arachis hypogaea measures of sustainable forest soils (Sacc.) causing stem rot of peanut ( Poster presentations Sclerotium rolfsii Influence of different carbon sources in soil on populations of specific organisms linked to soil-borne disease suppression of Variability among the isolates of Presenter Organisation Title Presenter Organisation Rowena Davey Oliver Knox SARDI N.E. Reddy Scotland India Varietal differences in cotton belowground Richard Simpson Richard Winder CSIRO Canada pasture yield and farm productivity autumn-winter Root damage constrains Development of a rnicrobial indicator database for validating

TheTR Rovira Rhizosphere R Symposium S 135 Crawford Fund Publications since 2006 Most of these publications are available on the fund’s website, http://www.crawfordfund.org

Brown, A.G. (ed.) 2006. Forests, Wood and Duncan, R., Tait, R. and Keating, B. 2009. Livelihoods: Finding a Future for All. Record of Independent Review of the Crawford Fund. Th e a conference conducted by the ATSE Crawford Crawford Fund, Deakin. 70 pp. Fund, Parliament House, Canberra, 16 August 2005. Th e ATSE Crawford Fund, Parkville, Vic. Brown, A.G. (ed.) 2010. World Food Security: vi + 91 pp. ISBN 1 875618 86 4 Can Private Sector R&D Feed the Poor? Th e Crawford Fund Fifteenth Annual Development Anon. 2006. Th e ATSE Crawford Fund Report 1 July Conference, Parliament House, Canberra, 27–28 2005 – 30 June 2006. Th e Fund, Parkville, Vic. October 2009. Th e Crawford Fund, Deakin, 28 pp. http://www.crawfordfund.org/publica- ACT. viii + 116 pp. ISBN 978 1 921388 08 8 tions/pdf/annualreport2006.pdf.

Brown, A.G. (ed.) 2007. Water for Irrigated Agriculture and the Environment: Finding a Flow for All. Record of a conference conducted by the ATSE Crawford Fund, Parliament House, Canberra, 16 August 2006. Th e ATSE Crawford Th e Crawford Fund newsletter, Highlights, is avail- Fund, Parkville, Vic. vi + 72 pp. ISBN 1 875618 92 9 able from the Fund’s website or in printed form. Th e most recent issue was published in April 2010. Anon. 2007. Th e ATSE Crawford Fund Report 1 July 2006 – 30 June 2007. Th e Fund, Parkville, Vic. Th e three publications below discuss the global 28 pp. http://www.crawfordfund.org/publica- setting for international agricultural research. Th e tions/pdf/annualreport2007.pdf website of the Cooperative Group for International Agricultural Research (CGIAR) (http://www.cgiar. Brown, A.G. (ed.) 2008. Biofuels, Energy and org/) provides other information. Agriculture: Powering Towards or Away From Food Security? Record of a conference conducted Alston, J.M., Pardey, P.G. and Taylor, M.J. (eds) by the ATSE Crawford Fund, Parliament House, 2001. Agricultural Science Policy: Changing Canberra, 15 August 2007. Th e ATSE Crawford Global Agendas. John Hopkins University Press, Fund, Parkville, Vic. vi + 54 pp. Baltimore, 285 pp. ISBN 0 8018 6603 0 ISBN 1 875618 95 3 Pardey, P.G., Alston, J.M. and Piggott, R.R. (eds) Persley, G.J. and Blight, D.G. (eds) 2008. A Food Secure World: How Australia can Help. Report 2006. Agricultural R&D in the Developing World: of the Crawford Fund World Food Crisis Task Too Little, Too Late? International Food Policy Force, Australian Academy of Technological Research Institute, Washington DC. Available Sciences and Engineering (ATSE), Melbourne, for download from http://www.ifpri.org/pubs/ 60 pp. ISBN 978-1-921388-00-2 books/oc51.asp

Anon. 2008. Th e Crawford Fund: An Initiative of World Bank 2007. World Development Report 2008: the Australian Academy of Technological Sciences Agriculture for Development. World Bank, and Engineering. Annual Report 1 July 2007 to Washington, D.C. xviii + 365 pp. http://econ. 30 June 2008. Th e Fund, Deakin, ACT, 36 pp. worldbank.org ISBN: 9780821368077 http://www.crawfordfund.org/publications/pdf/ annualreport2008.pdf Th e Crawford Fund facilitated an award-winning Brown, A.G. (ed.) 2009. Agriculture in a Changing one-hour TV documentary, Seed Hunter (1988), Climate: Th e New International Research Frontier. that follows Australian scientist Dr Ken Street on Th e ATSE Crawford Fund Fourteenth Annual a quest through Central Asia to fi nd rare genes Development Conference, Parliament House, Canberra, 3 Septermber 2008. Th e ATSE that may save our food from the looming threat of Crawford Fund, Deakin, ACT. vi + 72 pp. climate change. More details are at http://www. ISBN 978-1-921388-01-9 seedhunter.com/.

TheTR Rovira Rhizosphere R Symposium S 136