As Inferred from Mitochondrial DNA Sequences

Available online at www.sciencedirect.com

Molecular Phylogenetics and Evolution 46 (2008) 403–414 www.elsevier.com/locate/ympev

Phylogeny, species limits, and biogeography of the Brazilian lizards of the genus Eurolophosaurus (Squamata: Tropiduridae) as inferred from mitochondrial DNA sequences

Jose´ Carlos Passoni a, Maria Lu´cia Benozzati a,*, Miguel Trefaut Rodrigues b

a Departamento de Gene´tica e Biologia Evolutiva, Instituto de Biocieˆncias, Universidade de Saõ Paulo, Rua do Mataõ, 277, Cidade Universita´ria, 05508-900, Saõ Paulo, SP, Brazil b Departamento de Zoologia, Instituto de Biocieˆncias, Universidade de Saõ Paulo, Brazil

Received 21 July 2006; revised 14 October 2007; accepted 23 October 2007 Available online 12 November 2007

Abstract

Phylogenetic relationships and divergence times for 10 populations of the three recognized ‘‘species” of Brazilian lizards of genus Eurolophosaurus were estimated from 1229 bp of cyt b, COI, 12S, and 16S rRNA mitochondrial gene segments. Eurolophosaurus is monophyletic and the basal split within the genus separates E. divaricatus from a clade comprising E. amathites and E. nanuzae. Three populations of E. divaricatus, which occurs along the western bank of Rio Sa˜o Francisco, were consistently grouped together. On the east bank of the river, E. amathites and E. nanuzae from state of Bahia were recovered as the sister group of E. nanuzae populations from state of Minas Gerais. The paraphyly of E. nanuzae and the high divergence levels among populations of E. divaricatus strongly suggest that species limits in Eurolophosaurus should be revised. Even considering an extreme evolutionary rate of 2.8% sequence divergence per million years for the four gene segments analyzed together, E. divaricatus would have separated from the two other species by at least 5.5 my ago, and E. amathites from E. nanuzae populations from Bahia and Minas Gerais, respectively, by 1.5 and 3.5 my. The paleolacustrine hypothesis and changes in the course of the river potentially explain faunal divergence in the area, but divergences are much older than previously admitted. Ó 2007 Elsevier Inc. All rights reserved.

Keywords: Cyt b; COI; 12S; 16S; mtDNA phylogeny; Species limits; Biogeography; Divergence times; Eurolophosaurus; Tropiduridae; Rio Sa˜o Francisco sand dunes; Brazil

1. Introduction Serra do Cipo´ in the southern part of Minas Gerais to Rio de Contas and Caetite´, in Bahia, always at altitudes near or The tropidurid lizard genus Eurolophosaurus (Frost above 900 m. The other two species are psammophilous et al., 2001) is a monophyletic group of three species and occupy opposite banks of Rio Saõ Francisco below formerly called the Tropidurus nanuzae group (Rodrigues, 600 m, close to the northern portion of Serra do Espinhacßo 1986). It occurs along the Serra do Espinhacßo, a large in the state of Bahia. E. amathites is found at Santo Inaćio, mountain ridge extending along eastern Brazil in the states Gameleira do Assurua´, and Lagoa de Itaparica, on the of Minas Gerais and Bahia, and in sandy areas close to the sands of the right bank of the river, and E. divaricatus in banks of the middle Rio Saõ Francisco in Bahia (Fig. 1). Queimadas, Ibiraba, Mocambo do Vento, Manga, and E. nanuzae is predominantly saxicolous and occurs in Alagoado, on the opposite margin, in two dune fields sep- several localities throughout the Serra do Espinhacßo, from arated by an area of rocky soils approximately 150 km long. Additional data on distribution, physiography, and * Corresponding author. Fax: +55 11 3091 7553. ecology of the group have been reported by Rodrigues E-mail address: [email protected] (M.L. Benozzati). (1986, 1996).

Fig. 1. Above, South America inter-tropical region. Below, sand dune region of the middle Rio Saõ Francisco, Brazil. Localities: (1) Caetite´; (2) Rio de Contas; (3) Pedra Menina; (4) Extracßaõ; (5) Serra do Cipo´; (6) Alagoado; (7) Queimadas; (8) Vacaria; (9) Ibiraba; (10) Xique-Xique; (11) Ilha do Gado Bravo; (12) Mocambo do Vento; (13) Lagoa de Itaparica; (14) Barra; (15) Santo Inaćio; (16) Gameleira do Assurua´.

According to morphological and distributional data, The chromosomal studies of Kasahara et al. (1987) Rodrigues (1986) suggested that E. nanuzae (at the time detected a nucleolar organizer region (NOR) on the long in genus Tropidurus) was the sister taxon to a clade com- arm of macrochromosome pair 6 in E. amathites and prising E. amathites and E. divaricatus. Based on morphol- E. nanuzae, but on the short arm of the same chromosome ogy, Frost (1992) placed E. nanuzae outside a clade pair in E. divaricatus. As NORs are absent from this chro- comprising the rest of the Tropidurus radiation (E. amath- mosome pair in phylogenetically related tropidurids, this ites and E. divaricatus were not sampled in this study). This character was used to support the monophyly of the group was the reason why, in a later paper on tropidurid phylog- and a pericentric inversion was proposed to explain the eny using both morphological and molecular characters, condition observed in E. divaricatus (Kasahara et al., the genus Eurolophosaurus was created (Frost et al., 2001). 1983, 1985, 1986a,b). Frost et al. (2001) considered loca- J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414 405 tion of NOR on chromosome 6 and the XXAA:XAY/A Table 1 sexual determination type (Kasahara et al., 1987) as syna- Number of Eurolophosaurus populations and outgroup samples success- pomorphies of the genus Eurolophosaurus. In allozymic fully sequenced for different gene regions analyses (Martins, 1995), however, monophyly of the nan- Species Population mtDNA uzae group could not be demonstrated with confidence. Cyt b COI 12S 16S Finally, in the study of Frost et al. (2001) monophyly of Eurolophosaurus Alagoado 4 3 3 1 Eurolophosaurus was corroborated, and E. divaricatus was divaricatus Queimadas/Ibiraba 3 2 2 2 shown as the sister taxon to a clade comprising E. amath- Mocambo do 3121 ites and E. nanuzae. Vento Eurolophosaurus Santo Inaćio 2 2 1 1 Based on geomorphological and paleoclimatic data on amathites Gameleira do 1——1 the Saõ Francisco sand dunes (Ab’Saber, 1969; Tricart, Assurua´ 1974), and assuming the close relationship of E. amathites Eurolophosaurus Caetite´ 2111 and E. divaricatus, Rodrigues (1986) proposed a vicariant nanuzae Rio de Contas 2 1 1 1 model of speciation to explain their origin. He hypothe- Pedra Menina 2 1 1 1 Serra do Cipo´ 2111 sized an ancestral population bisected by the Rio Saõ Fran- Uranoscodon Manaus 1 1 1 1 cisco after the last glacial period, about 12,000 years ago. superciliosus According to the model, in the Pleistocene the river flowed Microlophus Punta Blanca 1 1 1 1 into a paleolake and, at the end of the Wu¨rm–Wisconsin quadrivittatus glaciation it would have flowed to the Atlantic Ocean. Tropidurus hispidus Santo Inaćio 1 1 1 1 Other psammophilous endemic pairs of closely related spe- All localities are in the Brazilian state of Bahia, except for Pedra Menina cies of gymnophthalmid lizards, snakes, and amphisbae- and Serra do Cipo´ (Minas Gerais), and Manaus (Amazonas). Punta Blanca is located in Chile. nians, which occur in the area and show the same vicariant pattern of geographic distribution, lend support to the model (Rodrigues, 1991a–d, 1996, 2003). More according to Frost et al. (2001). Heart, liver, and portions recently it was also argued that, although the paleolacus- of skeletal muscle were stored at 120 or 196 °C. DNA trine hypothesis could account for the speciation in the enriched in the mitochondrial fraction was obtained by area, forsaken meanders of the river may have acted as bar- the methods of Hillis and Davis (1986) and Dowling riers (Rodrigues, 1996). Palaeoclimatic and geomorpholog- et al. (1990), as modified by Passoni et al. (2000). Approx- ical data on this region support the model (Souza-Lima imately 2–4mm3 of these tissues from each specimen were et al., 2005). Nevertheless, allozymic data (Martins, 1995) homogenized in 800 ll STES (0.01 M NaCl, 0.01 M Tris, suggested that the E. amathites/E. divaricatus divergence 0.1 M EDTA, 0.25 M sucrose, pH 7.5) and then centri- should be much older, of the order of millions of years, fuged for 5 min at 1200g at 4 °C to pellet the nuclei. The and not of 12,000 years as originally proposed. supernatant was centrifuged at 23,000g for 20 min at 4 °C To obtain phylogenetic relationships and divergence for mitochondrial precipitation. The pellet was suspended times between and within species of Eurolophosaurus, based in 250 ll STE (0.1 M NaCl, 0.01 M Tris, 0.1 M EDTA, on DNA sequencing data, we analyzed mtDNA sequences pH 7.5), with 1% sodium dodecyl sulfate (SDS) and for populations of these three species. 10 U/ml proteinase K. After incubation for 2 h at 55 °C, the preparation was extracted with one volume of phenol, 2. Materials and methods and then with one volume of 24:1 chloroform:isoamyl alco- hol solution. DNA was precipitated from the supernatant 2.1. Taxonomic sampling and DNA extraction by the addition of 1/10 volume buffer (3 M NaCl, 0.25 M Tris, 0.1 M EDTA) and 2.5 volumes 100% ethanol at Ten populations of the three species of Eurolophosaurus 20 °C overnight. The DNA pelleted after 15 min centrifu- and three outgroup species were sampled and assayed for gation at 23,000g at 4 °C was washed in 70% ethanol, air regions from mitochondrial genes encoding 12S and 16S dried, and dissolved in 20–80 ll TE (0.01 M Tris, ribosomal RNAs (rRNA), cytochrome b (cyt b), and sub- 0.001 M EDTA, pH 8.0), and stored at 20 °C. unit I of cytochrome c oxidase (COI) proteins. A total of 25 specimens were used. Technical problems in DNA amplification and sequencing precluded the inclusion of a 2.2. Amplification and sequencing larger number of individuals (see Section 2.2). Table 1 shows the sample sizes that we had as a result. The geo- DNA amplification and sequencing trials presented graphic distribution of populations studied is shown in many technical problems hindering the analysis of the Fig. 1. Samples of E. divaricatus from Queimadas and Ibir- desirable number of individuals for each of Eurolophosau- aba were considered the same population (Queimadas/Ibir- rus populations. Therefore, we decided to limit the present aba) according to Passoni et al. (2000). One specimen of analysis to phylogenetic issues. Segments of 12S and 16S Uranoscodon superciliosus, one of Microlophus quadrivitta- rRNA genes, and segments of cyt b and COI protein-cod- tus and one of Tropidurus hispidus were used as outgroups, ing genes of the mitochondrial genome were amplified via 406 J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414

Table 2 List of PCR and sequencing primers, and a summary of the PCR conditions for all four gene segments Primer label Sequence (50–30) PCR conditions: denaturation/annealing/extension 35* B1a CCATCCAACATCTCAGCATGATGAAA 95 °C (1:00), 55 °C (1:00), 72 °C (0:30) B2a (Cyt b) GCCCCTCAGAATGATATTTGTCCTCA L7354b TACCAACACCTATTCTGATT 92 °C (0:45–1:00), 47 °C–53 °C (0:45) or 54 °C (1:00), 68 °C (1:00) or 72 °C (0:45) H7794b (COI) ATAATGGCAAATACTGCCCC L1091c AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT 95 °C (1:00), 54 °C (1:00), 72 °C (0:30) H1478c (12S) TGACTGCAGAGGGTGACGGGCGGTGTGT Ar-50d CAAACCCCGCCTGTTTACCAAAAACAT 95 °C (1:00), 54 °C (1:00), 68 °C (1:00) Br-30d (16S) CCGGTCTGAACTCAGATCACGT Incubation times are given in parentheses in minutes:seconds. *At 92 or 95 °C for 5:00 before first cycle, and for 7:00 at 68 or 72 °C after the last cycle. Reference for primers are: aFu et al. (1997); bFrost et al. (1998); cKocher et al. (1989); dPalumbi (1996). polymerase chain reaction (PCR) in 25 or 50 ll reaction and Fox, 1988) and for mammals (Burk et al., 2002) were volumes containing 20–30 ng DNA, 1 PCR buffer, considered. Cyt b and COI protein-coding gene sequences 4 mM MgCl2, 0.2 mM each dNTP, 1 lM each primer, were translated into amino acid sequences to check for unex- and 2.5 U AmpliTaq DNA Polymerase (Perkin- pected occurrences of stop codons, which might indicate that Elmer, Roche). Amplification primers and thermocycler pseudogenes had been amplified (Sorenson and Fleischer, conditions are specified in Table 2. Negative controls were 1996; Zhang and Hewitt, 1996). The degree of saturation made to avoid contamination. Amplification products were in each gene segment was investigated by plotting transitions checked by electrophoresis on 0.8% agarose gel with and transversions against Lake 94 distances employing 0.4 lg/ml ethidium bromide (the target fragment size was DAMBE program (Xia, 2000; Xia and Xie, 2001). In the case estimated from molecular-weight markers). Products were of protein-coding segments, these analyses were accom- cleaned with Exonuclease and Shrimp Alkaline Phospha- plished considering all codon positions, the first and second tase (Amersham Pharmacia Biotech.) per 1 h at 37 °C codon positions together, and each position separately. and, subsequently, per 10 min at 80 °C. The Concert Rapid Maximum parsimony (MP) analyses based on all indi- PCR Purification System (Gibco BRL-Life Technologies) viduals of Table 1 along with molecular (Martins, 1995; was also used with some samples. In cases of non-specific Passoni et al., 2000) and morphological data (Rodrigues, amplifications, the Concert Rapid Gel Extraction System 1986, 1996; Skuk, 1994) have evidenced monophyletic pop- (Gibco BRL-Life Technologies) was used. Purified PCR ulation units in Eurolophosaurus (see Section 3.2). There- products containing about 100 ng DNA were utilized for fore, the four gene segments of one or two individuals of sequencing using the Big Dye Terminator Ready-Reaction each monophyletic population unit could be used for main Kit (Perkin-Elmer Applied Biosystems). A Perkin-Elmer- phylogenetic analyses, as follows. 2400 thermocycler was used with the following parameters: The partition homogeneity test (Farris et al., 1994) using 96 °C (0:10), 50 °C (0:05), 60 °C (4:00) 25 (0:05 at 96 °C PAUP* (1000 replicates) indicated that the four gene regions before first cycle). Both strands of each segment were could be analysed together. Phylogenetic signal was detected sequenced for each specimen. An ABI PRISM 310 Genetic for the combined data set using the g1 statistic (Sokal and Analyzer (Perkin-Elmer Applied Biosystems) was used and Rohlf, 1981; Hillis, 1991; Huelsenbeck, 1991; Hillis and the sequences were edited using Sequence Navigator 1.0.1 Huelsenbeck, 1992), which measured the skewness of the dis- (Perkin-Elmer Applied Biosystems). tribution of 10,000 random cladograms. Phylogenetic analyses were conducted on ribosomal sequences and protein- 2.3. Phylogenetic analyses coding sequences separately, and on combined mitochondrial data for all populations, using maximum parsimony Multiple alignments were accomplished using Clustal X (MP), maximum likelihood (ML), and neighbor joining 1.64b (Thompson et al., 1997). For 12S and 16S segments, (NJ) methods implemented in PAUP* 4.0b10 (Swofford, gap-opening values of 6, 8, 10, and 12, and a gap-extension 2002). Parsimony trees were constructed using a branch- value of 0.05 were used to assess the effects on sequence align- and-bound search, and the confidence tested by 1000 boot- ment according to Gatesy et al. (1993), Wiens and Reeder strap replicates (Felsenstein, 1985). Due to saturation on (1997) and Reeder and Montanucci (2001). Regions of third codon positions, MP analyses were done considering ambiguous alignments were excluded. 12S rRNA secondary two different weightings for those characters, 0 and 1. In structure models for a scincid lizard (Hickson et al., 1996) for the case of the ribosomal segments, gap was treated as a fifth the lizard family Opluridae (Titus and Frost, 1996) and for character state. For ML heuristic searches and NJ tree esti- hyperoliid treefrogs (Richards and Moore, 1996), and the mates, the evolutionary model that best fits each data set 16S rRNA secondary structure models for humans (Gutell was selected employing PAUP* and MODELTEST 3.06 J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414 407

(Posada and Crandall, 1998) programs. The substitution individuals. Appendix I shows the aligned 12S DNA model for all four concatenated segments was found to be sequences used in the main phylogenetic analyses, with the General-Time-Reversible model (GTR + C +I;Rodrı´- the identified stem and loop regions, from which 33 ambig- guez et al., 1990). In ML analyses, tree bisection-reconnec- uously aligned characters were removed. Seven insertion/ tion (TBR) branch swapping, MULTREES, and random deletion events—indels—(characters 123, 124, 128, 129, addition of sequences (100 replicates) were employed. Boot- 189, 194, and 275) could be precisely aligned in 12S strap values (BVs) were estimated by 100 replicates with 10 sequences which, along with others, did not disrupt the replicates of random addition of sequences. In NJ analyses, RNA secondary structure. For 16S ribosomal sequences BVs were calculated by 1000 replicates. The interpretation of (Appendix II), a region of 98 positions was excluded due BVs is still a controversial issue. We followed Shaffer et al. to ambiguous alignment. Indels in 16S DNA sequences, (1997): BVs P 90% were considered as highly significant val- six of which could be unambiguously aligned (characters ues; 70 6 BVs < 90% as marginally significant proportions 16, 17, 317, 331, 355, and 365) were all located in unpaired and 50% 6 BVs < 70% as suggesting limited evidence of regions. Cyt b and COI protein-coding gene sequences con- monophyly. For discussion purposes, we consider only tained no indels. The resulting phylogenetic data matrix highly significant BVs. was composed of 282 characters of 12S rRNA gene, 389 characters of 16S rRNA gene, 209 bp of cyt b and 349 bp 2.4. Divergence time analyses of COI genes. These sequences, used in the main phylogenetic analyses, have been deposited in GenBank under Absence of fossils and geomorphological records pre- Accession Nos.: cyt b (DQ848725–DQ848735); COI cludes independent testing of divergence times for the (DQ848747–DQ848757); 12S (DQ848758–DQ848768); Eurolophosaurus radiation. Previous molecular divergence 16S (DQ848736–DQ848746). The remaining sequences, time estimates were based only on a reduced sample of used in other analyses, have been deposited in GenBank allozymic loci (Martins, 1995). Therefore, in the present under Accession Nos.: cyt b (DQ848713–DQ848724); Eurolophosaurus evolutionary history context, it is worth- COI (DQ848769–DQ848772); 12S (DQ848773– while determining time intervals in order to have at least DQ848776); 16S (DQ848777 and DQ848778). Several rough date estimates and also to test the vicariant hypoth- observations indicate that the sequences analyzed here cor- esis of 12,000 years ago. With this purpose, the corrected respond to functional mitochondrial genes (see Zhang and genetic distances based on the gene sequences of the main Hewitt, 1996). Protein-coding sequences do not have pre- phylogenetic analyses were used. mature stop codons, and ribosomal sequences apparently The hypothesis of rate constancy was tested by the like- code for rRNAs with stable secondary structures. Nucleo- lihood-ratio test (Muse and Weir, 1992) for each gene tide frequencies shown in Table 3 were estimated from all sequence separately, for ribosomal sequences, for protein- sequences referenced in Table 1. The bias against guanine coding sequences, and for all mitochondrial sequences. on light strands of the protein-coding sequences and the This test compares the log likelihood (ln L) of a tree using bias against guanine and thymine on light strands of the an assumption of clock-like evolution with the log likeli- ribosomal sequences support the conclusion that the hood of a tree calculated without this assumption sequences do not represent nuclear-integrated copies of (P = 0.05). PAUP* and MODELTEST were used to select mitochondrial genes (e.g. Zhang and Hewitt, 1996; Macey the most appropriate model of evolution for each data set et al., 1997, 1999; Honda et al., 2000a, b; Tu et al., 2000; and PAUP* was used to calculate each log likelihood value. Ast, 2001; Daniels et al., 2002; Schulte et al., 2002). Evolutionary rate constancy was detected only for cyt b, 16S and the four concatenated gene segments. 3.2. Phylogenetic relationships Since we obtained the first considerable amounts of mtDNA sequence data for Eurolophosaurus populations, Our data diagnose at least six monophyletic population we have an opportunity to obtain secure time limits for the units in Eurolophosaurus. Although our cladograms based evolutionary history of this genus. The highest rates of molecular evolution found in literature, along with lower rates, were applied for the combined data set. To allow com- Table 3 Mean base frequencies, X2 and P values in homogeneity test for base parison with published data, the Kimura Two-Parameter composition among taxa for each DNA segment (K2P) model (Kimura, 1980) was used to correct the cyt b Gene Cyt b COI 12S 16S genetic distances. Bpa 209 348–349 307–313 456–468 %A 27.1 28.7 36.2 32.8 3. Results %C 29.1 22.8 26 27.2 %G 15.7 19.8 19.2 20.1 3.1. Molecular characterization %T 28.1 28.7 18.6 19.9 X2 6.0346 10.9451 3.18 6.0138 About 1360 mtDNA base pairs (bp) were sequenced for P 1.00 0.99 1.00 1.00 22 specimens of Eurolophosaurus and the three outgroup a Number of bases. 408 J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414 on all cyt b and COI sequences taken separately do not characters. In other words, there are characters that diag- present any phylogenetic resolution among populations, nose each of six well differentiated population units that they group with BVs of 97–100% (1000 replicates; show reciprocal monophyly for mtDNA haplotypes (Avise, branch-and-bound search) sequences representing each of 1994). the following population units: (1) E. divaricatus of Alago- The main phylogenetic inferences were conducted with ado, (2) E. divaricatus of Queimadas/Ibiraba/Mocambo do the two rRNA gene sequences (671 characters), with cyt Vento, (3) E. amathites of Santo Inaćio/Gameleira do Ass- b and COI protein-coding sequences (558 bp), and with urua´, (4) E. nanuzae of Caetite´/Rio de Contas, (5) E. nan- the concatenated data including all four genes. The parti- uzae of Serra do Cipo´, and (6) E. nanuzae of Pedra Menina. tion homogeneity test (Farris et al., 1994) detected no sig- These results corroborate inferences from morphological nificant heterogeneity among the four DNA segments, and data (Rodrigues, 1986, 1996; Skuk, 1994), an allozymic the g1 statistic (Hillis and Huelsenbeck, 1992) for the total survey (Martins, 1995) and a mtDNA RFLP study (Pas- data matrix showed a value of 0.728, therefore indicating soni et al., 2000). These data collectively include a compre- the presence of phylogenetic signal. Thus, most of the hensive survey of all known Eurolophosaurus populations mtDNA analyses were based on the combined data, which as diagnosed by morphological and molecular phylogenetic include 1229 unambiguously aligned sites, with 204 of the

Fig. 2. Tree estimated for combined gene sequences (cyt b, COI, 12S and 16S), with bootstrap values for equal weighting of all characters (above) in MP (bold), ML (italics), and NJ (underlined) analyses, and without 3rd codon positions in MP (below). Localities: Al, Alagoado; Qu, Queimadas/Ibiraba; MV, Mocambo do Vento; SI, Santo Ina´cio; Ca, Caetite´; RC, Rio de Contas; PM, Pedra Menina; SC, Serra do Cipo´. J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414 409

318 variable sites being informative under parsimony. ribosomal data under MP and ML methods, respectively, Graphical analyses of transition/transversion substitutions with 91% and 92% of bootstraps. at third codon positions plotted against Lake 94 distances Two major clades were recovered in all phylogenetic for all cyt b and COI mitochondrial sequences indicate analyses. One is composed of the populations of E. divaric- some saturation in both segments. No other evidence for atus, the species found on the left margin of Rio Saõ Fran- saturation was detected at protein-coding gene sequences. cisco in the state of Bahia, with highly significant BVs (see At 12S and 16S ribosomal gene sequences no saturation Fig. 2). The other monophyletic group is composed of the was detected in nucleotide transitions or transversions. two species on the right margin, E. amathites and E. nan- A single most parsimonious tree was obtained with the uzae,with92–100% BVs. In this group, two other clades four concatenated gene segments, taking U. superciliosus, are evidenced. In one of them, E. amathites is shown as M. quadrivittatus and T. hispidus as outgroups, and two the sister taxon to E. nanuzae populations from Caetite´ different weightings (1 and 0) for third codon positions. and Rio de Contas, in the state of Bahia. This clade is con- Fig. 2 shows the resulting cladogram with bootstrap sup- sistently supported by BVs of 90–100%, except for ribo- ports. In Table 4, the step numbers, CI and RI values are somal sequence analyses (76–89%). The other clade is presented for both different weightings. High bootstrap composed of E. nanuzae populations from the state of Min- supports were obtained for all ingroup clades, except for as Gerais (Pedra Menina and Serra do Cipo´) with BVs of the clade of E. divaricatus haplotypes from Queimadas/ 100%. Therefore, E. nanuzae is consistently shown as a Ibiraba and Mocambo do Vento when third codon posi- paraphyletic species. E. divaricatus, on the left margin of tions were eliminated (BV = 61%). The General-Time- the Rio Saõ Francisco, also shows two well differentiated Reversible (GTR + C + I) model (Rodrı´guez et al., 1990) clades, the population of Alagoado, in the northern dune was identified by MODELTEST as the best nucleotide- field, and the populations of Queimadas/Ibiraba and substitution model for mtDNA combined data, consider- Mocambo do Vento, on the south dunes, with high boot- ing Eurolophosaurus and outgroup taxa. The estimated strap supports, except for MP analyses with the four con- gamma distribution shape parameter was 0.7270 and the catenated sequences excluding third codon positions, and proportion of invariable sites was 0.5297. ML and NJ anal- for ribosomal analyses (see Fig. 2). yses produced the same phylogenetic relationships, also supported by high bootstrap values (Fig. 2). When ribo- 3.3. Divergence times somal and protein-coding sequences were analyzed separately the same topology was also obtained, although The hypothesis of evolutionary rate constancy was with different bootstrap supports for some nodes. Mono- tested (Muse and Weir, 1992) for each gene sequence sepa- phyly of Eurolophosaurus was significantly supported by rately, for ribosomal sequences, for protein-coding sequences, and for the concatenated four gene sequences, Table 4 with the best molecular evolution model selected in each Tree measures with different character weightings under the maximum case. Evolutionary rate constancy was statistically accepted parsimony (MP) criterion (P = 0.05) only for cyt b, 16S and the four concatenated Character weighting Length CI RI gene sequences. Table 5 shows pairwise distances among All characters = 1 574 0.644 0.654 Eurolophosaurus populations and outgroup taxa estimated Third codon position = 0 232 0.709 0.74 for the concatenated gene sequences with the GTR + C +I CI (consistency index) values considering only informative characters. RI substitutional model, and also for cyt b sequences with the (retention index). K2P model, to allow comparisons with the literature.

Table 5 Percent genetic distances (GTR + C + I) for the combined data (below diagonal) and percent genetic distances (K2P) for cyt b data (above diagonal) among ingroup and outgroup taxa U M Th dAl dQu dMV aSI nCa nRC nPM nSC U — 20.4 24.3 18.4 17.8 17.8 19.7 19.1 20.4 20.4 20.3 M 29.3 — 22.9 20.2 19.6 19.0 19.0 21.5 21.5 24.1 25.5 Th 27.6 21.9 — 21.1 19.1 20.4 19.8 21.1 22.5 21.6 20.9 dAl 25.4 21.4 18.3 — 8.7 8.8 17.3 14.3 14.3 16.7 19.7 dQu 24.2 20.8 16.9 6.0 — 1.9 18.5 15.5 16.7 18.5 19.1 dMV 24.7 19.9 17.1 5.5 1.4 — 17.9 15.5 16.8 19.1 20.4 aSI 29.1 22.9 19.7 15.5 16.3 15.8 — 7.6 8.7 16.8 16.7 nCa 26.7 22.9 20.1 15.2 15.3 15.1 4.2 — 1.0 15.0 13.2 nRC 27.0 22.6 20.3 15.0 15.5 15.3 4.3 0.2 — 15.0 13.2 nPM 29.0 28.1 21.2 16.6 15.7 16.7 9.8 9.8 9.6 — 7.1 nSC 29.6 28.9 22.1 18.9 16.0 17.3 10.4 10.3 10.2 3.3 — U, Uranoscodon superciliosus;M,Microlophus quadrivittatus; Th, Tropidurus hispidus;d,Eurolophosaurus divaricatus;a,E. amathites;n,E. nanuzae; Al, Alagoado; Qu, Queimadas/Ibiraba; MV, Mocambo do Vento; SI, Santo Ina´cio; Ca, Caetite´; RC, Rio de Contas; PM, Pedra Menina; SC, Serra do Cipo´. 410 J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414

Studies on mtDNA evolution among vertebrates indi- and 12S rRNA genes in Tarentola genus (Gekkonidae), cate a rate of approximately 2% sequence divergence per based on similar rate estimated for Gallotia galloti of the million years (Upholt and Dawid, 1977; Brown et al., Canary Islands (Thorpe et al., 1994; Gonza´lez et al., 1979). Deviations from this ‘‘conventional” rate have been 1996). Those lizards are all similar in body size to Eurolo- reported, and have been correlated with generation length, phosaurus. Benozzati and Rodrigues (2003), based on metabolic rate and body size of the organisms (Martin and RFLP analyses of gymnophthalmid lizards, endemic from Palumbi, 1993; Li, 1997). Avise et al. (1992), based on the dune fields of the Rio Saõ Francisco, also considered a restriction assays of Testudines, noted up to 2- to 14-fold sequence divergence of 2%/my rate in their evolutionary slowdown deviations from the universal mtDNA molecu- studies. Based on those references, a sequence divergence lar clock of 2%/my. On the other hand, rates from 1.7% of 2%/my and the maximum rate of 2.8%/my (Paulo to 2.85% were considered for the Iberian lizard Lacerta et al., 2001) were considered for divergence-time estima- schreiberi (Paulo et al., 2001). Carranza et al. (2000) used tions in Eurolophosaurus. As those rates were the highest a rate of 1.96%/my for concatenated sequences of cyt b we found in literature, they were used to determine minimal ages for vicariant events in the group. Table 6 shows Table 6 time estimations for Eurolophosaurus divergence events Divergence times (my) based on combined data set (cyt b, COI, 12S, and 16S) considering two different molecular clocks with both molecular clocks. According to those data, E. divaricatus would have diverged from the two other spe- 2%/my 2.8%/my cies by 5.4–9.5 my, and E. amathites from E. nanuzae by dAl–aSI 7.7 5.5 1.5–5.2 my. E. amathites was shown to be closer in time dAl–nCa/RC 7.5 5.4 dAl–nPM 8.3 5.9 to E. nanuzae populations from Bahia (1.5–2.1 my) than dAl–nSC 9.5 6.8 to those from Minas Gerais (3.5–5.2 my). Divergence times dQu/MV–aSI 8.0 5.7 of 2.1–2.9 my have been estimated for E. divaricatus popu- dQu/MV–nCa/RC 7.7 5.5 lations living in different dune fields, on the left margin of dQu/MV–nPM 8.1 5.8 the river. E. nanuzae populations of Bahia would have dQu/MV–nSC 8.3 5.9 aSI–nCa/RC 2.1 1.5 diverged from those of Minas Gerais by 3.5–5.1 my. Diver- aSI–nPM 4.9 3.5 gence between Pedra Menina and Serra do Cipo´ popula- aSI–nSC 5.2 3.7 tions (Minas Gerais) was estimated at 1.2–1.7 my. The dAl–dQu/MV 2.9 2.1 Tropidurinae ancestor would date from approximately nCa/RC–nPM 4.9 3.5 9.8–13.7 my. Separation of Eurolophosaurus and M. quad- nCa/RC–nSC 5.1 3.7 nPM–nSC 1.7 1.2 rivittatus would date from 8.4 to 11.7 my, and the separation between T. hispidus and Eurolophosaurus, from 7 to Slower molecular clocks must also be considered (see text). d, Eurolophosaurus divaricatus;a,E. amathites;n,E. nanuzae; Al, Alagoado; 9.8 my. The maximum likelihood tree of Fig. 3 illustrates Qu, Queimadas/Ibiraba; MV, Mocambo do Vento; SI, Santo Inaćio; Ca, minimal divergence times, estimated with an evolutionary Caetite´; RC, Rio de Contas; PM, Pedra Menina; SC, Serra do Cipo´. rate of 2.8%/my.

Fig. 3. Maximum likelihood tree of combined gene sequences (cyt b, COI, 12S and 16S) with minimal dates for splitting events estimated with a sequence divergence of 2.8%/my. Slower molecular clocks must also be considered (see text). Localities: Al, Alagoado; Qu, Queimadas/Ibiraba; MV, Mocambo do Vento; SI, Santo Ina´cio; Ca, Caetite´; RC, Rio de Contas; PM, Pedra Menina; SC, Serra do Cipo´. J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414 411

4. Discussion areas at high altitudes. The same is true for those of E. divaricatus, which occupy two isolated dune fields separated 4.1. Phylogenetic relationships and taxonomic changes by 150 km of unfavorable habitats (Rodrigues, 1996). Tax- onomic changes in Eurolophosaurus are, therefore, urgent. Our study supports monophyly of Eurolophosaurus and The populations of E. nanuzae from Bahia should be con- places E. divaricatus as the sister taxon to a clade compris- sidered a new undescribed species, and the name nanuzae ing E. amathites and E. nanuzae, as previously proposed by should be restricted to those of Minas Gerais (Extracßaõ, Frost et al. (2001). The phylogenetic relationships recov- Pedra Menina and Serra do Cipo´). Similarly, the popula- ered for 10 populations of Eurolophosaurus including repre- tion of E. divaricatus from the isolated sand dunes of Alag- sentatives of the three recognized ‘‘species” were strongly oado should be described as a new species. supported. The three populations of E. divaricatus, the species restricted to the left bank of the river, were consistently 4.2. Genetic distances and biogeography grouped together. This grouping was reinforced by the dis- covery of a precisely aligned gap in Helix 42 of 12S ribo- Sequences of cyt b and 16S rRNA genes, analyzed sep- somal RNA secondary structure (position 189 in arately, and the four mitochondrial gene segments, collec- Appendix I), present only in those three populations. Pop- tively, were shown to be evolving according to the ulations of E. amathites/E. nanuzae, all restricted to the ‘‘molecular clock” hypothesis. Considering the evolution- right bank of the river, were also strongly supported as a ary rates of 2%/my–2.8%/my for the four combined gene monophyletic group and recovered as the sister group to sequences, E. divaricatus would have diverged from the E. divaricatus. Our analyses demonstrate that E. amathites amathites/nanuzae complex approximately 5.4–9.5 my and the populations of E. nanuzae from Bahia (Caetite´ and ago. These evolutionary times are compatible with those Rio de Contas) form a monophyletic group, which is recov- previously estimated for the group from allozymic data ered as the sister group of that formed by the populations (Martins, 1995). Since no intrinsic calibration point is of E. nanuzae from Minas Gerais (Pedra Menina and Serra available for Eurolophosaurus evolutionary history, the do Cipo´). Paraphyly of E. nanuzae and high divergences high rates proposed here must be considered tentative. found among populations of E. divaricatus strongly suggest Although ectothermy of lizards favors low metabolic rates, that species limits in Eurolophosaurus should be revised, Eurolophosaurus organisms are small and live in drastic cli- because present taxonomy of the group is inconsistent with matic conditions (average annual temperature between recovered relationships. Contrary to Rodrigues (1986), E. 24 °C and 26 °C), suggesting high metabolic rates and high amathites and E. divaricatus are not sister species, nor does rates of molecular evolution (Martin and Palumbi, 1993; their separation correspond to the opening of the Rio Saõ Li, 1997). With lower evolutionary rates, the basal Eurolo- Francisco to the sea at 12,000 years ago. Indeed, divergence phosaurus split would be older than 7.5–9.5 my ago. Thus, data support a much older origin and differentiation of this the hypothesis of a few thousand years ago for this split, as group of species than previously proposed. initially proposed (Rodrigues, 1986), was not Considering mean genetic distances in Eurolophosaurus corroborated. and all outgroup taxa, molecular evolutionary rates for Cyt b K2P genetic distances in Eurolophosaurus (see ribosomal sequences were shown to be three to four times Table 5) are compatible with intrageneric comparisons slower than those for the protein-coding sequences. Their reported by Johns and Avise (1998) in a comprehensive more conservative nature therefore provided better resolu- survey in vertebrates. They detected lower genetic distances tion for deeper nodes of phylogeny. This was probably the for birds than for fish, amphibians, reptiles, and mammals, reason why the monophyly of Eurolophosaurus could be considering congeneric species and confamilial genera. The consistently demonstrated only by ribosomal sequence average genetic distance of 16% that we found among the data. On the other hand, more recent nodes could be con- three recognized Eurolophosaurus species is close to the sistently supported mainly by protein-coding sequences. maximum value identified by Johns and Avise for reptilian Our sequence data indicate considerable evolutionary congeneric species, and twofold higher than the average divergence between the populations of E. divaricatus from genetic distance estimated for bird congeneric species. Alagoado and Queimadas/Ibiraba; these populations also The 21% mean value obtained among the tropidurid genera differ morphologically in color pattern and in size and con- Uranoscodon, Microlophus, Tropidurus, and Eurolophosau- spicuousness of the dorsal crest of scales (Skuk, 1994). rus is within the interval reported by those authors for con- Likewise, we know that the populations of Eurolophosau- familial genera of reptiles (9% to >25%). The mean rus from Caetite´ and Rio de Contas, although similar to divergence times of 5.7 my (with sequence divergence of E. nanuzae in external appearance, have an almost black 2.8%/my) and 8 my (with sequence divergence of 2%/my) ventral color. These differences can be attributed to long- estimated for the mtDNA lineages in Eurolophosaurus spe- term isolation of these populations indicated by the molec- cies, based on cyt b K2P genetic distances, are also in ular data and justify a rediagnosis of this species complex. accordance with the mean time estimated by Johns and The populations of E. ‘‘nanuzae” from the states of Minas Avise for reptiles (6 my, with a sequence divergence of Gerais and Bahia are actually allopatric, living in isolated 2%/my). 412 J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414

Evolutionary history of Eurolophosaurus would have Avise, J.C., 1994. Molecular Markers, Natural History and Evolution. featured an original separation between lineages on the east Chapman & Hall, New York, London. and west banks of Rio Sao Francisco, followed by the iso- Avise, J.C., Bowden, B.W., Lamp, T., Meylan, A.B., Bermingham, E., ˜ 1992. Mitochondrial DNA evolution at a turtles pace-evidence for low lation between Bahia and Minas Gerais populations, at the genetic variability and reduced microevolutionary rate in the testu- right margin, and between populations of the two dune dines. Mol. Biol. Evol. 9, 457–472. fields, at the left margin. Considering a range of rates Barreto, A.M.F., Suguio, K., Oliveira, P.E., Tatumi, S.H., 1999. O campo between 1% and 2.8%/my, most vicariant events in this de dunas inativas do me´dio Rio Saõ Francisco, Bahia. In: Schobben- genus would have occurred in the Pliocene and Miocene. haus, C., Campos, D.A., Queiroz, E.T., Winge, M., Berbert-Born, M.L.C. (Eds.), Sı´tios Geolo´gicos e Paleontolo´gicos do Brasil. Pub- Only two splits, E. amathites–E. nanuzae of Caetite´/Rio lished in http://www.unb.br/ig/sigep/sitio056/sitio056.htm. de Contas and E. nanuzae of Pedra Menina–E. nanuzae Benozzati, M.L., Rodrigues, M.T., 2003. Mitochondrial restriction-site of Serra do Cipo´, could be situated in the Pleistocene characterization of a Brazilian group of eyed-less gymnophthalmidae (Table 6). The Tropidurinae ancestor could date from Mio- lizards. J. Herpetol. 37 (1), 161–168. cene or Paleocene, and separation of Eurolophosaurus and Brown, W.M., George Jr., M., Wilson, A.C., 1979. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 76, M. quadrivittatus date from Miocene or from the Miocene/ 1967–1971. Paleocene border. On the other hand, the separation Burk, A., Douzery, E.J.P., Springer, M.S., 2002. The secondary structure between T. hispidus and Eurolophosaurus would be of mammalian mitochondrial 16S rRNA molecules: refinements based restricted to Miocene even with this broader range of rates. on a comparative phylogenetic approach. J. Mam. Evol. 9 (3), Although data do not support either the divergence time 225–252. Carranza, S., Arnold, E.N., Mateo, J.A., Lo´pez-Jurado, L.F., 2000. Long- or the species originally proposed in the first vicariance distance colonization and radiation in gekkonidae lizards, Tarentola model, both the paleolacustrine hypothesis and changes in (Reptilia: Gekkonidae), revealed by mitochondrial DNA sequences. the course of the river remain valid as putative vicariant bar- Proc. R. Soc. Lond. B 267, 637–649. riers to explain faunal divergence in the area (Rodrigues, Cartelle, C., Hartwig, W.C., 1996. Macacos sul-americanos: ossos que saõ 1986a–d, 1996). Paleoclimate and historical geomorphology um verdadeiro tesouro. Cieˆncia Hoje 21 (125), 31–36. Daniels, S.R., Heideman, N., Hendricks, M., Willson, B., 2002. A of this region are poorly understood. All available studies molecular phylogeny for the South African limbless lizard taxa of the encompass timescales of thousands and not millions of years subfamily Acontinae (Sauria: Scincidae) with special emphasis on ago (see Cartelle and Hartwig, 1996; Barreto et al., 1999; De relationships within Acontias. Mol. Phylogenet. Evol. 24, 315–323. Oliveira et al., 1999). Otherwise, the herpetofauna of these De Oliveira, P.E., Barreto, A.M.F., Suguio, K., 1999. Late Pleistoceno/ Quaternary sand dunes is a very rich one and shows a high Holocene climatic and vegetational history of the Brazilian Caatinga: the fossil dunes of the middle Saõ Francisco River. Paleogeogr. degree of endemism (Rodrigues, 1996), providing a great Palaeoclimatol. Palaecol. 152 (3–4), 319–337. opportunity to compare evolutionary patterns in many Dowling, T.E., Moritz, C., Palmer, J.D., 1990. Nucleic acids II: restriction taxa. Additional phylogenetic studies in progress with other site analyses. In: Hillis, D.M., Moritz, C. (Eds.), Molecular System- reptilian groups of the continental sand dunes of the middle atics. Sunderland, Sinauer, pp. 250–317. Rio Sao Francisco will determine whether the basal east–- Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1994. Testing signifi- ˜ cance of incongruence. Cladistics 10, 315–319. west split observed in the Eurolophosaurus radiation is a gen- Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using eral pattern for fauna of the region. the bootstrap. Evolution 39, 783–791. Frost, D.R., 1992. Phylogenetic analysis and taxonomy of the Tropidurus Acknowledgments group of lizards (Iguania: Tropiduridae). Am. Mus. Novit. 3033, 1–68. Frost, D.R., Crafts, H.M., Fitzgerald, L.A., Titus, T.A., 1998. Geographic variation, species recognition, and molecular evolution of cytochrome The authors thank the Brazilian agencies Fundacßaõde oxidase I in the Tropidurus spinulosus complex (Iguania: Tropiduri- Amparo a` Pesquisa do Estado de Saõ Paulo (FAPESP) dae). Copeia 4, 839–851. and Coordenacßaõ de Aperfeicßoamento de Pessoal de Nı´vel Frost, D.R., Rodrigues, M.T., Grant, T., Titus, T.A., 2001. Phylogenetics Superior (CAPES) for financial support. We also thank of the lizard genus Tropidurus (Squamata: Tropiduridae: Tropiduri- Jose´ Manoel Martins, Pedro Luis Bernardo da Rocha, nae), direct optimization, and sensitivity analysis of congruence between molecular data and morphology. Mol. Phylogenet. Evol. 21, and Gabriel Skuk for aid in field. 352–371. Fu, J., Murphy, R.W., Darevsky, I.S., 1997. Toward the phylogeny of Caucasian rock lizards: implications from mitochondrial DNA gene Appendix A. Supplementary data sequences (Reptilia: Lacertidae). Zool. J. Linn. Soc. 121, 463–477. Gatesy, J., Desalle, R., Wheeler, W., 1993. Alignment-ambiguous nucle- Supplementary data associated with this article can be otide sites and the exclusion of systematic data. Mol. Phylogenet. Evol. found, in the online version, at doi:10.1016/ 2, 152–157. j.ympev.2007.10.022. Gonza´lez, P., Pinto, F., Nogales, M., Jimeńez-Asensio, J.J., Hernańdez, M., Cabrera, V.M., 1996. Phylogenetic relationships of the Canary Islands endemic lizard genus Gallotia (Sauria: Lacertidae), inferred References from mitochondrial DNA sequences. Mol. Phylogenet. Evol. 6, 63–71. Gutell, R.R., Fox, G.E., 1988. A compilation of large subunit RNA Ab’Saber, A.N., 1969. Participacßaõ das superfıćies aplainadas nas sequences presented in a structural format. Nucleic Acids Res. 16 paisagens do nordeste brasileiro. Geomorfologia (Saõ Paulo) 19, 1–39. (Suppl.), r175–r269. Ast, J.C., 2001. Mitochondrial DNA evidence and evolution in Varanoi- Hickson, R.E., Simon, C., Cooper, A., Spicer, G.S., Sullivan, J., Penny, dea (Squamata). Cladistics 17, 211–226. D., 1996. Conserved sequence motifs, alignment, and secondary J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414 413

structure for the third domain of animal 12S rRNA. Mol. Biol. Evol. second ed. Sinauer Associates, Sunderland, Massachusetts, USA, pp. 13 (1), 150–169. 205–247. Hillis, D.M., 1991. Discriminating between phylogenetic signal and Passoni, J.C., Benozzati, M.L., Rodrigues, M.T., 2000. Mitochondrial random noise in DNA sequences. In: Miyamoto, M.M., Cracraft, J. DNA polymorphism and heteroplasmy in populations of the three (Eds.), Phylogenetic Analysis of DNA Sequences. Oxford University species of Tropidurus of the nanuzae group (Squamata, Tropiduridae). Press, New York, pp. 278–294. Genet. Mol. Biol. 23 (2), 351–356. Hillis, D.M., Davis, S.K., 1986. Evolution of ribosomal DNA: fifty million Paulo, O.S., Dias, C., Bruford, M.W., Jordan, W.C., Nichols, R.A., 2001. years of recorded history in the frog genus Rana. Evolution 40, The persistence of Pliocene populations through the Pleistocene 1275–1288. climatic cycles: evidence from the phylogeography of an Iberian Hillis, D.M., Huelsenbeck, J.P., 1992. Signal, noise, and reliability in lizard. Proc. R. Soc. Lond. B 268, 1625–1630. molecular phylogenetic analyses. J. Hered. 83, 189–195. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA Honda, M., Ota, H., Kobayashi, M., Nabhitabhata, J., Yong, H.-S., substitution. Bioinformatics 14 (9), 817–818. Hikida, T., 2000a. Phylogenetic relationships, character evolution, and Reeder, T.W., Montanucci, R.R., 2001. Phylogenetic analysis of the biogeography of the subfamily Lygosominae (Reptilia: Scincidae) horned lizards (Phrynosomatidae: Phrynosoma): evidence from mito- inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. chondrial DNA and morphology. Copeia 2001, 309–323. 15 (3), 452–461. Richards, C.M., Moore, W.S., 1996. A phylogeny for the African treefrog Honda, M., Ota, H., Kobayashi, M., Nabhitabhata, J., Yong, H.-S., family Hyperoliidae based on mitochondrial rDNA. Mol. Phylogenet. Sengoku, S., Hikida, T., 2000b. Phylogenetic relationships of the Evol. 5 (3), 522–532. family Agamidae (Reptilia: Iguania) inferred from mitochondrial Rodrigues, M.T., 1986. Um novo Tropidurus com crista dorsal do Brasil DNA sequences. Zool. Sci. 17, 527–537. com comenta´rios sobre suas relacßo˜es, distribuicßaõ e origem (Sauria, Huelsenbeck, J.P., 1991. Tree-length distribution skewness: an indicator of Iguanidae). Pap. Avulsos Zool. (Saõ Paulo) 36 (17), 171–179. phylogenetic information. Syst. Zool. 40, 257–270. Rodrigues, M.T., 1991a. Herpetofauna das dunas interiores do Rio Saõ Johns, G.C., Avise, J.C., 1998. A comparative summary of genetic Francisco: Bahia: Brasil. I. Introducßaõa` a´rea e descricßaõ de um novo distances in the vertebrates from the mitochondrial cytochrome b gene. geˆnero de microteiı´deo (Calyptommatus) com notas sobre sua ecologia, Mol. Biol. Evol. 15 (11), 1481–1490. distribuicßaõ e especiacßaõ (Sauria, Teiidae). Pap. Avulsos Zool. (Saõ Kasahara, S., Yonenaga-Yassuda, Y., Rodrigues, M.T., 1985. Variabil- Paulo) 37, 285–320. idade cromossoˆmica nos lagartos do geˆnero Tropidurus grupo torqu- Rodrigues, M.T., 1991b. Herpetofauna das dunas interiores do Rio Saõ atus (Sauria, Iguanidae). VII Congresso Latino Americano de Francisco: Bahia: Brasil. II. Psilophthalmus: um novo geˆnero de Gene´tica, Colombia. Biome´dica 1, 36 (Proceedings). microteiideo sem pa´lpebra (Sauria, Teiidae). Pap. Avulsos Zool. (Saõ Kasahara, S., Yonenaga-Yassuda, Y., Rodrigues, M.T., 1986a. Variabil- Paulo) 37, 321–327. idade cromossoˆmica em lagartos do geˆnero Tropidurus (Sauria, Rodrigues, M.T., 1991c. Herpetofauna das dunas interiores do Rio Saõ Iguanidae). Cieˆnc. Cult. 38, 944 (Proceedings). Francisco: Bahia: Brasil. III. Procellosaurinus: um novo geˆnero de Kasahara, S., Yonenaga-Yassuda, Y., Rodrigues, M.T., 1986b. Caracter- microteiideos sem pa´lpebra, com a redefinicßaõdogeˆnero Gymnoph- izacßaõ cromossoˆmica das espećies Tapinurus semitaeniatus, Plica plica thalmus (Sauria, Teiidae). Pap. Avulsos Zool. (Saõ Paulo) 37, 329–342. e Plica umbra (Sauria, Iguanidae). Cieˆnc. Cult. 38, 944 (Proceedings). Rodrigues, M.T., 1991d. Herpetofauna das dunas interiores do Rio Saõ Kasahara, S., Yonenaga-Yassuda, Y., Rodrigues, M.T., 1987. Karyotype Francisco: Bahia: Brasil. IV. Uma nova espećie de Typhlops (Ophidia, and evolution of the Tropidurus nanuzae species group (Sauria, Typhlopidae). Pap. Avulsos Zool. (Saõ Paulo) 37, 343–346. Iguanidae). Rev. Bras. Genet. 10 (2), 185–197. Rodrigues, M.T., 1996. Lizards, snakes, and amphisbaenians from the Kasahara, S., Yonenaga-Yassuda, Y., Schincariol, R.A., L’Abbate, M., Quaternary sand dunes of the middle rio Saõ Francisco, Bahia, Brazil. 1983. Chromosome mechanisms of sex determination, G- and C-band J. Herpetol. 30, 513–523. patterns and nucleolus organizer regions in Tropidurus torquatus Rodrigues, M.T., 2003. Herpetofauna da Caatinga. In: Leal, I., Tabarelli, (Sauria, Iguanidae). Genetica 60, 151–156. M., Silva, J.M.C. (Eds.), Biodiversidade, Ecologia e Conservacßaõda Kimura, M., 1980. A simple method for estimating evolutionary rate of Caatinga. Universidade Federal de Pernambuco, pp. 181–236. base substitutions through comparative studies of nucleotide Rodrı´guez, F., Oliver, J.L., Marıń, A., Medina, J.R., 1990. The general sequences. J. Mol. Evol. 16, 111–120. stochastic model of nucleotide substitution. J. Theor. Biol. 142, Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paä¨bo, S., 485–501. Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial Schulte II, J.A., Macey, J.R., Pethiyagoda, R., Larson, A., 2002. Rostral DNA evolution in animals: amplification and sequencing with horn evolution among agamid lizards of the genus Ceratophora conserved primers. Proc. Natl. Acad. Sci. USA 86, 6196–6200. endemic to Sri Lanka. Mol. Phylogenet. Evol. 22 (1), 111–117. Li, W.-H., 1997. Molecular Evolution. Sinauer Associates, Sunderland, MA. Shaffer, H.B., Meylan, P., Mcknight, M.L., 1997. Tests of turtle Macey, J.R., Larson, A., Ananjeva, N.B., Papenfuss, T.J., 1997. Evolu- phylogeny: molecular, morphological, and palentological approaches. tionary shifts in three major structural features of the mitochondrial Syst. Biol. 46, 235–268. genome among iguanian lizards. J. Mol. Evol. 44, 660–674. Skuk, G.O., 1994. Variacßaõ Geogra´fica, Ecologia e Relacßo˜es Filogene´ticas Macey, J.R., Wang, Y., Ananjeva, N.B., Larson, A., Papenfuss, T.J., das Espećies de Tropidurus do Grupo nanuzae. M.S. Thesis, Univer- 1999. Vicariant patterns of fragmentation among gekkonid lizards of sidade de Saõ Paulo, Saõ Paulo. the genus Teratoscincus produced by the Indian collision: a molecular Sokal, R.R., Rohlf, F.J., 1981. Biometry. W.H. Freeman, San Francisco. phylogenetic perspective and an area cladogram for central Asia. Mol. Sorenson, M.D., Fleischer, R.C., 1996. Multiple independent transposi- Phylogenet. Evol. 12 (3), 320–332. tions of mitochondrial DNA control region sequences to the nucleus. Martin, A.P., Palumbi, S.R., 1993. Body size, metabolic rate, generation Proc. Natl. Acad. Sci. USA 93, 15239–15243. time, and the molecular clock. Proc. Natl. Acad. Sci. USA 90, Souza-Lima, W., Salgado de Carvalho, M.S., Lacerda Grillo, J. de, and 4087–4091. Milhomem, P. da S., 2005. Bacia do Almada: In: Paleo 2005, Reuniao Martins, J.M., 1995. Allozyme variation and expression in lizards of the Anual Regional da Sociedade Brasileira de Paleontologia, resumos, Tropidurus nanuzae species group (Iguania: Tropiduridae). Copeia 3, pp. 20–27. 665–675. Swofford, D.L., 2002. PAUP* 4.0b10. Phylogenetic Analysis Using Muse, S.V., Weir, B., 1992. Testing for equality of evolutionary rates. Parsimony (* and Other Methods). Sinauer Associates, Sunderland, Genetics 132, 269–276. MA. Palumbi, S.R., 1996. Nucleic acids II: the polymerase chain reaction. In: Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, Hillis, D.M., Moritz, C., Mable, B.K. (Eds.), Molecular Systematics, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies 414 J.C. Passoni et al. / Molecular Phylogenetics and Evolution 46 (2008) 403–414

for multiple sequence alignment aided by quality analysis tools. pitvipers of the genus Trimeresurus (Reptilia: Viperidae: Crotalinae): a Nucleic Acids Res. 25, 4876–4882. molecular perspective. Zool. Sci. 17, 1147–1157. Thorpe, R.S., Mcgregor, D., Cumming, A.M., Jordan, W.C., 1994. DNA Upholt, W.B., Dawid, I.B., 1977. Mapping of mitochondrial DNA of evolution and colonization sequence of island lizards in relation to individual sheep and goats: rapid evolution in the D loop region. Cell geological history: mtDNA RFLP, cytochrome b, cytochrome oxidase, 11, 571–583. 12S rRNA sequence, and nuclear RAPD analysis. Evolution 48, Wiens, J.J., Reeder, T.W., 1997. Phylogeny of the spiny lizards (Scelop- 230–240. orus) based on molecular and morphological evidence. Herpetol. Titus, T.A., Frost, D.A., 1996. Molecular homology assessment and Monogr. 11, 1–101. phylogeny in the lizard family Opluridae (Squamata: Iguania). Mol. Xia, X., 2000. Data analysis in molecular biology and evolution. Kluwer Phylogenet. Evol. 6 (1), 49–62. Academic publishers, Boston. Tricart, L., 1974. Existence de pe´riodes seches au quaternaire en Amazonie Xia, X., Xie, Z., 2001. DAMBE: Data analysis in molecular biology and et dans les re´gions voisines. Rev. Geomorph. Dynamique 4, 145–158. evolution. J. Hered. 92, 371–373. Tu, M.-C., Wang, H.-Y., Tsai, M.-P., Toda, M., Lee, W.-J., Zhang, F.-J., Zhang, D.-X., Hewitt, G.M., 1996. Nuclear integrations: challenges for Ota, H., 2000. Phylogeny, taxonomy, and biogeography of the oriental mitochondrial DNA markers. Trends Ecol. Evol. 11, 247–251.