IL-22 Receptor Signaling in Paneth Cells Is Critical for Their Maturation, Microbiota Colonization, Th17-Related Immune Responses, and Anti-Salmonella Immunity

www.nature.com/mi

ARTICLE OPEN IL-22 receptor signaling in Paneth cells is critical for their maturation, microbiota colonization, Th17-related immune responses, and anti-Salmonella immunity

Stephen J. Gaudino1, Michael Beaupre1, Xun Lin1, Preet Joshi1, Sonika Rathi1, Patrick A. McLaughlin1, Cody Kempen1, Neil Mehta1, Onur Eskiocak2, Brian Yueh2, Richard S. Blumberg3, Adrianus W. M. van der Velden1, Kenneth R. Shroyer4, Agnieszka B. Bialkowska5, Semir Beyaz2 and Pawan Kumar 1

Interleukin-22 (IL-22) signaling in the intestines is critical for promoting tissue-protective functions. However, since a diverse array of cell types (absorptive and secretory epithelium as well as stem cells) express IL-22Ra1, a receptor for IL-22, it has been difficult to determine what cell type(s) specifically respond to IL-22 to mediate intestinal mucosal host defense. Here, we report that IL-22 signaling in the small intestine is positively correlated with Paneth cell differentiation programs. Our Il22Ra1fl/fl;Lgr5-EGFP-creERT2- specific knockout mice and, independently, our lineage-tracing findings rule out the involvement of Lgr5+ intestinal stem cell (ISC)- dependent IL-22Ra1 signaling in regulating the lineage commitment of epithelial cells, including Paneth cells. Using novel Paneth cell-specific IL-22Ra1 knockout mice (Il22Ra1fl/fl;Defa6-cre), we show that IL-22 signaling in Paneth cells is required for small intestinal host defense. We show that Paneth cell maturation, antimicrobial effector function, expression of specific WNTs, and organoid morphogenesis are dependent on cell-intrinsic IL-22Ra1 signaling. Furthermore, IL-22 signaling in Paneth cells regulates

1234567890();,: the intestinal commensal bacteria and microbiota-dependent IL-17A immune responses. Finally, we show ISC and, independently, Paneth cell-speciﬁc IL-22Ra1 signaling are critical for providing immunity against Salmonella enterica serovar Typhimurium. Collectively, our ﬁndings illustrate a previously unknown role of IL-22 in Paneth cell-mediated small intestinal host defense.

Mucosal Immunology (2021) 14:389–401; https://doi.org/10.1038/s41385-020-00348-5

INTRODUCTION absorptive enterocytes, secretory cells (goblet and Paneth) and A critical role for IL-22 signaling via IL-22Ra1-STAT3 has been intestinal stem cells (ISCs) express the IL-22Ra1 monomer required established in modulating mucosal immunity, microbiota coloni- for IL-22 effector function, but how IL-22 stimulates these cell types zation, inflammation, and tissue repair.1–6 Currently, recombinant is not well characterized.12 human IL-22 IgG2-Fc (IL-22.Fc) fusion protein is in FDA-approved Paneth cells are critical for small intestinal host defense and phase IIa clinical trials for graft vs host disease (trial ID their dysregulation results in microbiota-dependent inflammatory NCT0246651) and alcoholic hepatitis (NCT 02655510). Despite responses.13–15 In addition, Crohn’s patients have Paneth cell the myriad of gastrointestinal responses to IL-22 stimulation, there abnormalities, reduced α-defensin expression, and elevated IL-22 have been limited findings that elucidate whether these responses levels in inflamed tissues.14,16,17 Recent studies show that IL-22 to injury or infection are consequences of direct stimulation to acts via ISCs or transit-amplifying cells to promote epithelial cell functionally distinct absorptive or secretory epithelial cells or if regeneration.12,18,19 However, a direct role of IL-22 (via Lgr5) in they are stem cell-derived. regulating secretory cell lineage commitment and Paneth cell- The protective and inflammatory roles of IL-22 in the intestinal specific responses is not known. It is possible that IL-22 either acts tissue have been reported.1–10 This has been implicated by directly on Paneth cells or via ISCs or secretory progenitor cells to increased susceptibility of germ-line Il22−/−, or receptor Il22Ra1−/−, regulate their differentiation and effector functions, but how IL-22 knockout mice to murine colitis models including dextran sodium regulates Paneth cell function has not clearly been investigated sulfate- and bacteria-induced colitis.1,2,4–7 Furthermore, cell prolif- due to a lack of lineage-specific tools. Paneth cell-derived EGF, erative and tumorigenic effects of IL-22 have been documented TGFβ, WNT3, WNT6, and WNT9b regulate, in part, ISC main- through the use of Il22bp−/− mice that lack IL-22 binding protein, an tenance.20–22 Thus, it is unknown whether IL-22Ra1 signaling in antagonistic receptor for IL-22.10,11 Although global knockouts Paneth cells reciprocally regulates the small intestinal niche of ISCs provide insight into how IL-22 responses impact gut defense, the and epithelial cell differentiation. precise mechanisms regarding how IL-22 exerts these effects remain It has been shown that IL-22 promotes colonic Salmonella poorly understood. Numerous intestinal epithelial cell types such as enterica serovar Typhimurium (S. Typhimurium) colonization and

1Department of Microbiology and Immunology, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY, USA; 2Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA; 3Department of Gastroenterology, Brigham and Womenʼs Hospital, Boston, MA 02115, USA; 4Department of Pathology, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY, USA and 5Department of Medicine, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY, USA Correspondence: Pawan Kumar ([email protected]) Received: 3 October 2019 Revised: 11 August 2020 Accepted: 10 September 2020 Published online: 15 October 2020

© The Author(s) 2020 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 390 that the microbiota secondarily mediates this effect.23 In the small cells and ISCs express the IL-22 receptor;19 however, it is not intestine, however, IL-22 confers a protective effect against known whether IL-22-dependent regulation of small intestinal Salmonella.11,24,25 The importance of Paneth cells in controlling host defense is dependent on ISCs or a specific epithelial lineage. S. Typhimurium infection is evident by a study in human defensin To examine differences in gene expression among small intestinal 5 (HD5)-transgenic mice.26 While IL-22 may act via α-defensins to enterocytes and secretory cells, single-cell RNA sequencing regulate S. Typhimurium colonization, the Paneth cell-specific role (scRNA-seq) was performed on naive C57BL/6 mouse-derived pri- of IL-22 in regulating S. Typhimurium has not been investigated. mary small intestinal organoids. Our scRNA-seq results demon- Our study helps unravel these gaps in knowledge by providing strated that Paneth cells express the highest level of Il22ra1 when evidence that IL-22Ra1 signaling in Paneth cells, but not ISCs, is compared to ISCs as well as enterocyte, goblet, tuft, and endocrine required for their maturation, antimicrobial functions, microbiota lineages (Fig. 1a). We also found that expression patterns of key colonization, and selective WNT secretion. Our data also suggest Paneth cell-specific genes, particularly Mmp7 and Lyz1, were that both ISC- and, independently, Paneth cell-specific IL- positively correlated with Il22 expression in the terminal ileum of 22Ra1 signaling are required for providing immunity against naive C57BL/6 mice at different days after birth (Fig. 1b). These S. Typhimurium. data suggest that IL-22 may influence Paneth cell differentiation, maintenance, and antimicrobial activities. Using naive Rorc−/− mice which lack IL-22 and several other cytokines including IL-17A, RESULTS we found that Lyz1, Mmp7, and Reg3γ (positive control) expression Paneth cell differentiation and their antimicrobial effector as well as Paneth cell number were substantially reduced in the functions are positively correlated with IL-22 responses in the terminal ileum of these mice (Fig. 1c–e). In line with our Rorc−/− small intestine mice observation, we found a significant reduction of Lyz1 and Paneth cells play an important role in small intestinal host defense Mmp7 expression in the terminal ileum of Il22−/− mice compared by regulating microbiota colonization and providing protection to cohoused WT mice. Interestingly, Paneth cell number was against pathogens.14,26 Likewise, IL-22 is a key player in mucosal modestly reduced, albeit not significant, in Il22−/− mice (Supple- host defense.1–6 All intestinal epithelial lineages including Paneth mentary Fig. 1a, b). Collectively, these data suggest that IL-22

a Cell type UMAP2

UMAP1

b Reg3g Lyz1 Mmp7 Il22 ,

c Reg3g Lyz1 Mmp7 de *

–/– WT Rorc–/– WT Rorc–/– WT Rorc–/– WT Rorc WT Rorc–/– Fig. 1 Paneth cell differentiation and effector functions are positively correlated with IL-22 responses in the small intestine. a Principal component analysis (left panel) and heatmap diagram (right panel) of single-cell primary small intestinal organoid RNA sequencing depicting the expression patterns of Il22Ra1 in epithelial and stem cell lineages. b Terminal ileum RT-PCR analysis displaying alterations in Paneth cell- speciﬁc genes as well as Il22 expression over a period of 42 days post birth in naive C57BL/6 mice. c RT-PCR analysis of Reg3γ, Lyz1 and Mmp7 expression from ileal tissues of naive WT and Rorc−/− mice. d Immunoﬂuorescence staining for MMP7 from ilea tissue of naive WT and Rorc−/− mice. e Number of MMP7+ cells from Fig. 1d. Figure 1c is representative of two independent experiments. Figure 1b is representative of at least 3–6 mice per group and was generated from two independent experiments. *P ≤ 0.05 (Mann–Whitney test, two-tailed).

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 391

abIl22Ra1 cLyz1 Mmp7 p=0.0519 ** * – Cre ;Villin-cre fl/fl + Il22ra1 Cre Cre– Cre+ Cre– Cre+ Cre– Cre+ Cre– Cre+ Il22ra1fl/fl;Villin-cre Il22ra1fl/fl;Villin-cre Il22ra1fl/fl;Villin-cre

defSFB Il17a Il22 Saa1/2 ** ***

– + – + – + – + – + Cre Cre Cre Cre Cre– Cre+ Cre Cre Cre Cre Cre Cre Il22ra1fl/fl;Villin-cre Il22ra1fl/fl;Villin-cre Il22ra1fl/fl;Villin-cre Il22ra1fl/fl;Villin-cre

g hiVehicle IL-22.Fc Lyz1 Mmp7

Lgr5-EGFP-creERT2;RosaLSLTdtomato

IL-22.Fc Vehicle Vehicle IL-22.Fc IL-22.Fc Fig. 2 Intestinal epithelium-specific IL-22Ra1 knockout mice display Paneth cell defects. a RT-PCR data depicting Il22Ra1 expression in the terminal ileum of naive Il22Ra1fl/fl;Villin-cre+/− mice. b Representative phloxine-tartrazine staining image (left panel) and average Paneth cell number/crypt (right panel) in the ileum of naive Il22Ra1fl/fl;Villin-cre+/− mice. c RT-PCR analysis of Lyz1 and Mmp7 expression from ileal tissues of naive Il22Ra1fl/fl;Villin-cre+/− mice. d Representative immunofluorescence image of Lyz1 and MMP7 in the ileal tissue of naive Il22Ra1fl/fl; Villin-cre+/− mice. e RT-PCR analysis of SFB levels in the terminal ileum of naive Il22Ra1fl/fl;Villin-cre+/− mice. f RT-PCR analysis of Il17a, Il22 and Saa1/2 expression from the terminal ileum of naive Il22Ra1fl/fl;Villin-cre+/− mice. g Layout of Lgr5-EGFP-creERT2;RosaLSLtdTomato treatment with tamoxifen and either vehicle (PBS) or IL-22.Fc (80 μg/mouse). h Representative immunofluorescence images of TdTomato expression in vehicle or IL-22.Fc treated Lgr5-EGFP-creERT2;RosaLSLtdTomato mice. i RT-PCR analysis of Lyz1 and Mmp7 expression in the terminal ileum of these mice. Figure 2b–f were generated from two independent experiments. Figure 2d is representative of at least four mice in each group Figure 2h, i are generated form 2–3 mice per group. Data are presented as mean ± SEM on all graphs except Fig. 2i (mean ± SD). Scale bars in relevant figures equal 100 μm. *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001 (Mann–Whitney test, two-tailed). influences Paneth cell antimicrobial effector function by regulat- the terminal ileum of Il22Ra1fl/fl;Villin-cre+ mice (Fig. 2f). Our data ing their expression of key antimicrobial peptides. suggest that IL-22Ra1 signaling in the small intestine plays an important role in regulating Paneth cell antimicrobial gene Intestinal IL-22Ra1 deficient mice have Paneth cell defects expression, which could promote increased SFB colonization. To further validate a role for IL-22 in regulating Paneth cell However, it remains unclear whether defects in Paneth cell differentiation and antimicrobial activity, we utilized and validated function are due to a reduced number of Paneth cells (via RT-PCR and flow cytometry) intestinal epithelium-specific IL- (compromised ISC function) or a functional impact of IL-22Ra1 22Ra1 knockout mice (Fig. 2a and Supplementary Fig. 1c). signaling on Paneth cells. To test the effects of IL-22 on ISC- Terminal ilea of naive Il22Ra1fl/fl;Villin-cre+ and littermate cre- mediated lineage commitment, we utilized Lgr5-EGFP-creERT2; control mice were analyzed for Paneth cell numbers and RosaLSLtdTomato lineage tracer mice. We administered IL-22.Fc expression levels of Lyz1 and Mmp7. Our data show that Paneth (half-life 48 h) as depicted in Fig. 2g and harvested small intestinal cell number was modestly decreased in Il22Ra1fl/fl;Villin-cre+ mice tissues 1 day after the last tamoxifen injection. Our data show no (Fig. 2b). Interestingly, Lyz1 and Mmp7 expression (RNA and difference in tdTomato stained cells in the control or treatment protein) were significantly reduced in the terminal ileum of groups suggesting IL-22 may not influence ISC-mediated intestinal Il22Ra1fl/fl;Villin-cre+ mice (Fig. 2c, d). It has been reported that epithelial cell lineage commitment (Fig. 2h). Interestingly, Lyz1 and Il22−/− and Mmp7−/− mice possess a commensal dysbiosis Mmp7 expression was increased in the IL-22.Fc administered indicated by an increased colonization of segmented filamentous group (Fig. 2i). We additionally examined whether IL-22 acts on bacteria (SFB) in the small intestine.3,27 As expected, we detected ISCs and Paneth cells. Using the described gating strategy increased colonization of SFB in terminal ileum luminal contents (Supplementary Fig. 1d), we show that both ISCs and, possibly, of Il22Ra1fl/fl;Villin-cre+ mice (Fig. 2e). SFB colonization regulates Paneth cells respond to IL-22 stimulation as revealed by sustained small intestinal IL-17A and IL-22 responses in a serum amyloid A intracellular pSTAT3 staining (Supplementary Fig. 1e), although (SAA)-dependent manner.28 Despite increased levels of SFB additional work with an acute stimulation of IL-22 may be colonization in Il22Ra1fl/fl;Villin-cre+ mice, we did not find any required. It is possible that IL-22 may act on Paneth cells to difference in Il17a and Il22 transcript levels in the terminal ileum modulate their effector gene expression. The gain of function with (Fig. 2f). This could be related to a reduced expression of Saa1/2 in the administration of IL-22.Fc has an inherent caveat since it does

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 392 not mimic the physiological concentration of IL-22 in a defined expression in Paneth cells is not compromised in tamoxifen- crypt environment. Therefore, exacerbated IL-22 activation on administered Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice. Tamoxifen- non-ISC epithelial cell types may have an impact on stem and administered Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice lost IL-22Ra1 in progenitor cells. To ideally study the effects of IL-22 on stem cells all descendant cells in a time-dependent manner. We found under homeostatic conditions, we have additionally utilized ISC- reduced Il22Ra1 expression (50%) in the terminal ileum of specific IL-22Ra1 knockout mice. Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice on day 10 after the last tamoxifen injection (Fig. 3d). Based on published work, we expect IL-22Ra1 signaling in Lgr5+ ISCs is dispensable for the that longer time periods will result in 100% deletion of IL-22Ra1 in development of secretory cells including Paneth cells and all Lgr5 descendant cells including Paneth cells. These cells would antimicrobial activity then act the same as those from Il22Ra1fl/fl;Villin-cre+ mice To test the effect of IL-22 on ISCs, we generated tamoxifen- (Fig. 2a); therefore, longer post-injection periods may not be inducible Lgr5+ ISC-specific Il22Ra1 mice by crossing Il22Ra1fl/fl useful for our model. However, analysis of other secretory lineages and Lgr5-EGFP-creERT2 mice. IL-22Ra1 deletion in Lgr5+ ISCs was (goblet, endocrine and tuft cells) with fast turn-over rates confirmed by RT-PCR analysis of sorted GFPhigh (Lgr5+) cells as (3–4 days) and transcription factors required for secretory (ATOH1) well as IL-22Ra1 protein staining in tamoxifen-administered mice or absorptive (HES1) epithelial cell lineage commitment in (Fig. 3a, b and Supplementary Fig. 2a). In contrast to our Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice is informative. We found no observation in Il22Ra1fl/fl;Villin-cre+ mice, we found no difference difference in Hes1 and Atoh1 expression in sorted Lgr5+ cells of in Paneth cell number and Lyz1 and Mmp7 expression in naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice (Supplementary Fig. 2d). tamoxifen-administered naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice In addition, expression patterns of goblet cell (Muc2), endocrine compared to the control (corn oil) group (Fig. 3c, and cell (Chga), and tuft cell (Dclk1)-specific genes, as well as Alcian Supplementary Fig. 2b, c). Interestingly, tamoxifen-administered blue+ goblet cell numbers, were similar in tamoxifen- mice displayed decreased expression of Reg3γ (Fig. 3c). Paneth administered naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice when com- cells possess a half-life >30 days; thus, it is possible that IL-22Ra1 pared to their control group (Fig. 3e). Comparable SFB

abchigh Lyz1 Mmp7 Reg3g Il22ra1fl/fl;Lgr5-EGFP-creERT2 Il22Ra1 (GFP ) ns * ns *

– + –––+++ Tamoxifen (Tm) Il22ra1fl/fl;Lgr5-EGFP-creERT2+ Il22ra1fl/fl;Lgr5-EGFP-creERT2+ d e Il22Ra1 (Ileum) Chga Dclk1 Muc2 ** ns ns ns

Tm – + – + – + – + Tm – + Il22ra1fl/fl;Lgr5-EGFP-creERT2+ Il22ra1fl/fl;Lgr5-EGFP-creERT2+ Il22ra1fl/fl;Lgr5-EGFP-creERT2+

f SFB Il17a Il22 ns ns ns

–––+ ++Tm Il22ra1fl/fl;Lgr5-EGFP-creERT2+ Fig. 3 IL-22Ra1 signaling in intestinal stem cells is dispensable for lineage commitment and effector functions of secretory cells including Paneth cells. a Flow cytometry gating strategy utilized for sorting ISCs (GFPhigh) from the small intestine of naive Il22Ra1fl/fl;Lgr5- EGFP-creERT2+ mice. b RT-PCR analysis of Il22Ra1 expression from sorted GFPhigh cells. c RT-PCR analysis of Lyz1, Mmp7 and Reg3γ expression from ileal tissue of naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice treated with or without tamoxifen. d RT-PCR analysis of Il22Ra1 expression in the ileal tissue of naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice treated with or without tamoxifen. e RT-PCR analysis of Chga, Dclk1 and Muc2 expression (left panel) and representative Alcian blue staining (right panel) from ileal tissues of naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice treated with or without tamoxifen. f RT-PCR analysis of SFB levels as well as Il17a and Il22 expression in the terminal ileum of naive Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice treated with or without tamoxifen. Figure 3a is representative of two independent experiments. Figure 3b–f were generated from two independent experiments. Figure 3e right panel figure is representative of at least four mice in each group. Data are presented as mean ± SEM on relevant graphs. *P ≤ 0.05; **P ≤ 0.01 (Mann–Whitney test, two-tailed).

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 393 colonization levels as well as Il17a and Il22 responses were (Fig. 4d). Reduced Lyz1 and Mmp7 expression was confirmed at observed in tamoxifen administered to naive Il22Ra1fl/fl;Lgr5-EGFP- the protein level using specific antibodies (Fig. 4e). Our data creERT2+ mice when compared to their control group (Fig. 3f). suggest that IL-22Ra1 signaling in Paneth cells is dispensable for These results collectively indicate that IL-22 responses in Lgr5+ their development and differentiation but required for their ISCs are dispensable for intestinal secretory cell lineage commit- maturation and expression of antimicrobial effector genes. ment under homeostatic conditions. Furthermore, these results are consistent with the possibility that IL-22 has an impact on IL-22Ra1 signaling in Paneth cells is required for the expression of Paneth cells to mediate small intestinal mucosal host defense. select WNTs and organoid growth but is dispensable for the maintenance of ISCs niche Intrinsic IL-22Ra1 signaling of Paneth cells is required for their Expression patterns of many Paneth cell proteins including α- effector functions defensins are considered constitutive and depend on cellular Our findings in Il22Ra1fl/fl;Villin-cre and Il22Ra1fl/fl;Lgr5-EGFP-creERT2 differentiation programs within the Paneth cells.27 Having found mice suggest an impact of IL-22Ra1 signaling on Paneth cell for reduced Paneth cell effector proteins but not Paneth cell number regulating their maintenance and antimicrobial activity. To test in naive Il22Ra1fl/fl;Defa6-cre mice, we predicted altered Paneth cell this, we generated Paneth cell-specific IL-22Ra1 knockout mice morphology in our knockout mice. We performed TEM analysis in (Il22Ra1fl/fl;Defa6-cre) by crossing Il22Ra1fl/fl and Defa6-cre+ mice. the terminal ileum of naive Il22Ra1fl/fl;Defa6-cre+ and their Knockdown of IL-22Ra1 on target cells was confirmed via PCR by littermate cre- mice. Our data revealed no difference in Paneth using recombination-specific primers and via flow cytometry by cell morphology and secretory vesicle number in Paneth cell- using an IL-22Ra1-specific antibody (Fig. 4a and Supplementary specific IL-22Ra1 knockout mice (Fig. 5a). Interestingly, we found a Fig. 3). Interestingly, phloxine-tartrazine staining revealed no dif- modest increase in the number of granule-filled vesicles of ference in the number of Paneth cells in the terminal ileum Il22Ra1fl/fl;Defa6-cre+ mice (Fig. 5a and Supplementary Fig. 4). of naive Il22Ra1fl/fl;Defa6-cre+ mice (Fig. 4b). Next, we perfor- Canonical WNT signaling is required for Paneth cell maturation med RNA sequencing (RNA-seq) of the terminal ileum of naive and maintenance of ISCs niche. Paneth cells secrete several WNTs Il22Ra1fl/fl;Defa6-cre+ and littermate cre- mice. Sequencing data (WNT3, WNT6, and WNT9b) and other growth factors (EGF and revealed reduced expression of Paneth cell-specific Lyz1, Mmp7, TGFβ) which have been shown to regulate, at least in part, ISC and select α-defensin antimicrobial peptides but increased maintenance in vitro.20–22 We have found increased expression of expression of IL-22 inducible Reg3γ and serum amyloid Wnt6 and Wnt9b in the ileum of naive Il22Ra1fl/fl;Defa6-cre+ mice, genes (Saa1 and Saa3) in the terminal ileum of naive Il22Ra1fl/fl; suggesting IL-22 negatively regulates WNT secretion (Fig. 5b). Of Defa6-cre+ mice (Fig. 4c). We confirmed RNA-seq results for the note, Wnt3a expression was below the detection limit, and reduced expression for Lyz1, Mmp7, and PanCryptdin by RT-PCR expression patterns of Tgfb1 and Egf remained unchanged (data

Fig. 4 Paneth-specific IL-22Ra1 knockout mice display defects in Paneth cells. a Agarose gel PCR showing genotype and recombination of IL-22Ra1 allele in the target tissue of naive Il22Ra1fl/fl;Defa6-cre+/− mice. b Representative phloxine-tartrazine staining image (left panel) and average Paneth cell number/crypt (right panel) in the ileum of naive Il22Ra1fl/fl;Defa6-cre+/− mice. c RNA sequencing heat-map data showing the expression of selective genes in the terminal ileum of naive Il22Ra1fl/fl;Defa6-cre+/− mice. d RT-PCR analysis of Lyz1, Mmp7, Pancryptdin and Reg3γ expression from terminal ileal tissues of naive Il22Ra1fl/fl;Defa6-cre+/− mice. e Immunofluorescence analysis of Lyz1 and MMP7 from ileal tissue of naive Il22Ra1fl/fl;Defa6-cre+/− mice. Figure 4a is representative of two independent experiments. Figure 4b, d, e are generated from three independent experiments. Figure 4c is representative of 3 mice in each group. Figure 4e is representative of at least four mice in each group. Data are presented as mean ± SEM on relevant graphs. Scale bars in relevant figures equal 100 μm. *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001 (Mann–Whitney test, two-tailed).

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 394

a ns ns ns

Cre– Cre+ Cre– Cre+ Cre– Cre+ Cre– Cre+ Il22ra1fl/fl;Defa6-cre Il22ra1fl/fl;Defa6-cre

b Wnt6 Wnt9b c Lgr5 Olfm4 Ascl2 ** * ns

Cre– Cre+ Cre– Cre+ Cre– Cre+ Cre– Cre+ Cre– Cre+ Il22ra1fl/fl;Defa6-cre Il22ra1fl/fl;Defa6-cre

d Ki67 ns Ki67, DAPI Ki67, DAPI

Cre– Cre+ Cre– Cre+ Il22ra1fl/fl;Defa6-cre Il22ra1fl/fl;Defa6-cre Fig. 5 Dysregulated expression of WNTs are present in Paneth cell-specific IL-22Ra1 knockout mice. a Representative TEM images of Paneth cells (left panel) and number of secretory vesicles (right panel) in the terminal ileum of naive Il22Ra1fl/fl;Defa6-cre+/− mice. b RT-PCR analysis of Wnt6 and Wnt9b expression from terminal ileal tissues of naive Il22Ra1fl/fl;Defa6-cre+/− mice. c RT-PCR analysis of Lgr5, Olfm4 and Ascl2 expression from terminal ileal tissues of naive Il22Ra1fl/fl;Defa6-cre+/− mice. d RT-PCR and immunofluorescence analysis of Ki67 expression (left panel) and number of proliferative cells (right panel) from terminal ileal tissues of naive Il22Ra1fl/fl;Defa6-cre+/− mice. Figure 5b, c, d are generated from two independent experiments. Figure 5a is representative of at least 4–5 mice in each group. Data are presented as mean ± SEM on relevant graphs. Scale bars in relevant figures equal 100 μm. *P ≤ 0.05; **P ≤ 0.01 (Mann–Whitney test, two-tailed).

not shown and Supplementary Fig. 5a). To further confirm the on Paneth cells to modulate the expression of selective WNTs as importance of IL-22 in WNT inhibition, we administered recombi- well as promote organoid growth in vitro. nant IL-22.Fc to naive C57BL/6 mice and collected tissues after 24 h. Our data indicate reduced Wnt6 expression in response to IL- Paneth cell-intrinsic IL-22Ra1 signaling is required for microbiota 22 stimulation (Supplementary Fig. 5b). Despite increased WNT (including SFB) colonization, small intestinal IL-17A and IL-22 levels, expression patterns of ISC-specific Lgr5 and stemness responses, and anti-Salmonella immunity markers (Olfm4 and Ascl2) remained unchanged (Fig. 5c). Con- Given the reduced Paneth cell effector protein expression in the sistent with this observation, Ki67 expression and the number of small intestine of naive Il22Ra1fl/fl;Defa6-cre+ mice, we next Ki67+ proliferative cells were comparable in both groups (Fig. 5d). examined microbiota colonization levels in the terminal ileum In addition, Paneth cells via ISCs are important for promoting lumen of these mice. High throughput 16S rRNA microbial organoid growth in vitro.22 We cultured primary small intestinal community analysis of terminal ileum luminal contents of organoids from naive Il22Ra1fl/fl;Defa6-cre- and cre+ mice and littermate co-housed mice was utilized to study the influence of stimulated them with recombinant IL-22.Fc in the presence or Paneth cell-intrinsic IL-22Ra1 signaling on the overall microbial absence of Wnt3a or NOTCH ligand DLL1. Consistent with community. Analysis demonstrated that microbial communities previously published work,12 we show that IL-22 stimulates remained largely unchanged in Il22Ra1fl/fl;Defa6-cre+ mice, organoid growth. We specifically observed that organoids of suggesting a more subtle and specific control mechanism of control cre- mice but not in Il22Ra1fl/fl;Defa6-cre+ mice (Fig. 6a–c) Paneth cell-specific IL-22Ra1 signaling on the commensal micro- grew in response to IL-22. The difference in organoid size in bial community (Fig. 7a left panel). The family level analysis response to IL-22 stimulation started to appear on day 4 onwards revealed increased colonization of Alphaproteobacteria and (Fig. 6c). Based on our confocal microscopy results, Paneth cell Peptostreptococcaceae in the terminal ileum lumens of naive numbers were comparable in both groups at days 2, 4, and 6 post Il22Ra1fl/fl;Defa6-cre+ mice (Fig. 7a right panel). SFB colonization is culture (Fig. 6d). Interestingly, WNT3a or DLL1 alone or in critical for generating homeostatic IL-17A and IL-22 responses in combination with IL-22 does not influence organoid growth the small intestine and its colonization is regulated by both IL-17A (Fig. 6a, b). Collectively, our data suggest that IL-22 acts specifically and IL-22.3,29 It remains unclear whether IL-22 signaling in Paneth

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 395

Fig. 6 IL-22-mediated organoid growth is regulated by Paneth cell-specific IL-22Ra1 signaling. a Representative day 6 images of naive small intestinal Il22Ra1fl/fl;Defa6-cre+/− organoids stimulated with either 0 or 4 ng/mL IL-22.Fc in the presence or absence of 100 ng/mL Wnt3a or 1 μg/mL Dll1 over a 6-day period. b Normalized fold change of the area of organoids after 6 days of stimulation with either 0 ng/mL or 4 ng/ mL IL-22.Fc in the presence or absence of 100 ng/mL Wnt3a or 1 μg/mL Dll1. c Normalized fold change of the area of Il22Ra1fl/fl;Defa6-cre+/− organoids after 2, 4 and 6 days of stimulation with either 0 or 4 ng/mL IL-22.Fc. d Representative confocal images of Lyz stained Il22Ra1fl/fl; Defa6-cre+/− organoids after 2, 4 and 6 days of growth. Organoid area was measured in ImageJ. The average area size of respective treated organoids was used to calculate the fold changes over the control group. Figure 6a–c are generated from two independent experiments. Figure 6a is representative of 4–5 mice in each group. Figure 6b is representative of 3–5 mice. Representative images in Fig. 6d are based on two mice in each group. Data are presented as mean ± SEM on relevant graphs. Scale bars in relevant figures equal 100 μm. ***P ≤ 0.001; ****P ≤ 0.0001 (two-way ANOVA). cells is required for regulating colonization of SFB and homeo- difference in weight loss in Il22Ra1fl/fl;Defa6-cre- and cre+ mice static IL-17A and IL-22 responses. Our data show increased SFB (Fig. 7d left panel). However, mortality and pathological findings in colonization and elevated Saa1/2 expression levels in the terminal the ileum were modestly elevated in Il22Ra1fl/fl;Defa6-cre+ mice ileum of naive Il22Ra1fl/fl;Defa6-cre+ mice (Fig. 7b, c). In line with (Fig. 7d right panel and Supplementary Fig. 5c). Paneth cell these observations, we found increased Il17a and Il22 expression number was modestly reduced in the small intestine of Il22Ra1fl/fl; in the small intestine of naive Il22Ra1fl/fl;Defa6-cre mice (Fig. 7c). Defa6-cre+ mice after infection (Fig. 7e). While we found no Collectively, our data suggest that SFB and selective Proteobac- difference in S. Typhimurium burden in the MLN and caecum of teria spp. are regulated by IL-22Ra1 signaling in Paneth cells, but Il22Ra1fl/fl;Defa6-cre+ and their littermate cre- mice, we observed SFB-dependent IL-17A responses are regulated by non-Paneth cell increased S. Typhimurium dissemination in the liver of Il22Ra1fl/fl; epithelial lineages. Defa6-cre+ mice on day 4 post infection (Fig. 7f). Consistent with We next evaluated the role of Paneth cell-specific IL- our unchallenged mice data, Mmp7 expression remained reduced 22Ra1 signaling in a S. Typhimurium infection model where in the terminal ileum of S. Typhimurium-infected Il22Ra1fl/fl;Defa6- inflammation is evident in the colon and ileum. The mechanisms cre+ mice; however, differences in Lyz1 expression were no longer that regulate S. Typhimurium colonization are incompletely observed (Fig. 4d and Supplementary Fig. 5d). We found no understood, especially since it is increasingly clear that IL-22 can difference in the expression of selected inflammatory cytokines act to promote30 or control (small intestine) its pathogenesis.23–26 (Il1β and Tnfα)ofS. Typhimurium-infected Il22Ra1fl/fl;Defa6-cre+ It is possible that IL-22 acts via Paneth cells to mediate mice (Supplementary Fig. 5d). It is possible that IL-22 signaling in S. Typhimurium colonization. Also, IL-22-dependent protective non-Paneth cell types is required for protective responses. Indeed, and/or inflammatory responses may be mediated by Paneth cells. global Il22−/− mice have increased expression of inflammatory Il22Ra1fl/fl;Defa6-cre+ and their littermate cre- mice were fasted for cytokines Il1β and Tnfα in the terminal ileum on day 4 post 4 h and infected with 5 × 108 CFU of S. Typhimurium. We found no S. Typhimurium infection (Supplementary Fig. 5e). Upon infection,

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 396

Fig. 7 Paneth-specific IL-22Ra1 signaling prevents commensal dysbiosis (indicated by increased colonization by SFB) and is required for providing immunity against Salmonella.aTerminal ileum luminal contents of cohoused littermate Il22Ra1fl/fl;Defa6-cre+/− mice were analyzed for commensal diversity at the phyla (left panel) and selected family (right panel) levels by 16 S microbial sequencing. b, c RT-PCR analysis of SFB levels as well as Saa1/2, Il17a and Il22 expression from ileal tissues of Il22Ra1fl/fl;Defa6-cre+/− mice. d Weight changes (left panel) and mortality curve (right panel) of S. Typhimurium infected Il22Ra1fl/fl;Defa6-cre+/− mice are shown.ePhloxine-tartrazine staining and quantification of Paneth cells in Il22Ra1fl/fl;Defa6-cre+/− mice on day 5 post S. Typhimurium infection. f S. Typhimurium burden in the caecum, MLN, and liver of Il22Ra1fl/fl;Defa6-cre+/− mice on day 5 post infection. Data are presented as mean ± SEM on relevant graphs. Figure 7b–f are generated from three independent experiments. Figure 7d is generated from 4–5 mice in each group. Figure 7e is a representative image of at least 5–6 mice in each group. Individual mouse data are shown in Fig. 7a. Data are presented as mean ± SEM on relevant graphs. *P ≤ 0.05 (Mann–Whitney test, two-tailed).

Salmonella selectively induces certain WNTs (WNT3a, WNT6 and indicating that IL-22Ra1 signaling in Paneth cells is required for WNT9a) to promote ISC survival.31 Next, we infected tamoxifen- small intestinal mucosal host defense and provides immunity administered Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ and littermate cre- mice against the bacterial pathogen, S. Typhimurium. with Salmonella. We found Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ were We observed that Paneth cell differentiation, development, and highly susceptible to infection with 100% mortality 5 days post maturation positively correlate with IL-22 responses in the small infection as well as elevated, albeit not significant, bacterial intestine. Paneth cells and other epithelial cell lineages develop dissemination to the liver (Supplementary Fig. 5f, g). Collectively, from Lgr5+ ISCs.32 Paneth cell differentiation starts postnatally on our data suggest IL-22Ra1 signaling in Paneth cells and ISCs may day 7; by day 42, they are fully differentiated and matured at the regulate systemic S. Typhimurium infection. base of intestinal crypts, appropriately matched with microbiota establishment post weaning.33 A fully matured Paneth cell contains large secretory granules packed with antimicrobial DISCUSSION peptides. Interestingly, IL-22 expression exactly follows the Paneth Paneth cells and their antimicrobial products (α-defensins, cell differentiation program in the small intestine suggesting IL-22 lysozyme, etc.) play a critical role in small intestinal host defense may regulate Paneth cell differentiation, maturation, or main- to injury or infection, and their dysregulation constitutes a tenance. Indeed, studies have shown that type 3 innate immune pathogenic factor for Crohn’s Disease.13–15 Crohn’s patients have cell (ILC3)-derived IL-22 plays an important role in microbiota Paneth cell abnormalities and elevated levels of IL-22 in inflamed colonization immediately after weaning.34 This is evidenced by the tissue.14,16,17 However, how IL-22 regulates Paneth cell function phosphorylation of STAT3 (downstream of IL-22) in the entire remains poorly understood. In this study, we present evidence crypt and villus epithelial cells and ILC3s. However, it was not clear

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 397 whether IL-22Ra1 signaling in Paneth cells is required for regulating Paneth cell maturation and antimicrobial effector microbiota colonization. functions. We did not observe as great of a difference in Paneth While we found a modest reduction in Paneth cell number in cell number in Il22Ra1fl/fl;Defa6-cre+ mice as in Il22Ra1fl/fl;Villin-cre+ entire gut-epithelium-specific IL-22Ra1 knockout mice, Paneth mice. We and Juan-Min Zha et al. ruled out involvement of ISCs.35 It cell-specific antimicrobial peptide expression was significantly is possible that IL-22Ra1 signaling in stromal cells or secretory reduced in Il22Ra1fl/fl;Villin-cre+ and germ-line Il22−/− mice. progenitors regulates Paneth cell differentiation. Stromal cell- Therefore, it is possible that Paneth cell differentiation and derived growth factors may regulate TA cell proliferation. Indeed, antimicrobial activity are regulated by distinct pathways. It is PDGFRα+ stromal cells act via WNTs and R-spondin to regulate ISC predicted that IL-22 regulates Paneth cell differentiation and function in the intestine.36 Investigation of the stromal cell-specific maintenance which may account for the reduced Lyz1 and Mmp7 role of IL-22 in modulating ISC/TA cell niche and function will be expression. Published literature suggests that the expression of useful for Paneth cell lineage commitment studies. Our study key antimicrobial peptides is independent of transcriptional suggests that IL-22Ra1 signaling is required for Paneth cell regulation rather than dependent on Paneth cell differentiation maturation and effector function. More studies are required to pathways.27 Consistent with a recent study,35 our data suggest dissect how IL-22 transcriptionally regulates Paneth cell antimicro- that Lyz1 and Mmp7 expression are regulated at the transcriptional bial effector genes. One possibility is that STAT3 binds to the level. While our data suggest that Paneth cell number is not promoter of Lyz1, Mmp7,andPancryptdin. Indeed, MMP7 activity is significantly affected by IL-22Ra1 signaling, IL-22 has been shown regulated by STAT3 binding to its promoter in non-intestinal to promote Lgr5+ ISC-mediated epithelial cell proliferation and fibroblast cell lines.37 regeneration.12,18 Thus, it is possible that within a shorter duration Interestingly, we also observed that IL-22 negatively regulates of IL-22 stimulation (24 h), Lgr5+ ISCs are re-programmed to the gene expression of Paneth cell-specific selective WNTs. It has promote the differentiation of Paneth and other secretory cells. In been previously shown that IL-22 inhibits WNT signaling in active addition, the majority of published work investigating the effects ISCs.35 Here, we present similar results in Paneth cells. The exact of IL-22 on intestinal ISC function was done in organoid-based mechanism of IL-22/WNT crosstalk is not very well understood. assays, confounding ISC-related interpretation of data. Only a However, IL-22 can potentially increase the levels of WNT pathway single study used ISC-specific IL-22Ra1 knockout mice.18 inhibitor DKK1 which in turn negatively impacts the expression of However, this study was not focused on ISC-mediated intestinal WNT ligands. In addition, recent publications show tissue- secretory lineage commitment or their functions in Il22Ra1fl/fl; dependent outcomes of the crosstalk between STAT3 and WNT Lgr5-EGFP-creERT2 mice. signaling which suggests alternative modes of regulating the Paneth cell-related results from Il22Ra1fl/fl;Villin-cre+ mice may expression of WNT ligands.38–40 WNT proteins have been shown to be driven by IL-22Ra1 signaling in ISCs. However, we did not see a regulate Paneth cell maturation and support the ISC maintenance difference in Paneth cell number or expression patterns of selected ex vivo.20–22 However, in vivo functions of ISCs remain unaltered in antimicrobial genes in Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice. A longer the absence of Paneth cells.41 We also found no difference in ISC- duration of tamoxifen may result in Paneth cell-related changes in specific gene expression, stemness factors, and Ki67+ proliferative Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice, but this approach has an inherent cell number in Il22Ra1fl/fl;Defa6-cre+ mice despite elevated levels caveat whereby all ISC descendent cells including Paneth cells of WNTs. It is possible that stromal cell-derived WNTs may become IL-22Ra1 negative. Goblet, tuft, and enteroendocrine cell- compensate for elevated Paneth cell-specific WNTs. related results in Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice suggest that IL-22 inhibits the expression of WNTs in Paneth cells. R-spondin IL-22 does not regulate secretory cell lineage commitment. A is a WNT agonist and is a necessary factor for organoid growth. Of lineage-tracing experiment may be useful to determine the impact note, in vitro organoid culture can be achieved without the of IL-22 on ISCs to regulate Paneth cell differentiation. ATOH1 is addition of WNTs. Our data suggest that Paneth cell-dependent required for intestinal secretory cell lineage commitment, and it organoid growth is independent of WNT regulation by IL-22 may be possible that IL-22 acts on ATOH1+ transit-amplifying cells (Fig. 6a, b). We show that IL-22 is required for optimum Paneth cell (TA) to mediate a role in Paneth cell differentiation. A recent study maturation and their antimicrobial activities. It is possible that the shows that IL-22 depletes ISCs but enhances TA cell proliferation crypts of Il22Ra1fl/fl;Defa6-cre+ mice that we used for organoid and Paneth cell differentiation.35 It remains unclear whether effects assays possess immature and/or dysregulated Paneth cells. mediated by secretory ATOH1+ progenitor TA cell-specific IL-22 are Therefore, this would not support an initial structure for proper required for Paneth cell differentiation. Our Il22Ra1fl/fl;Lgr5-EGFP- IL-22-dependent organoid growth. It is also possible that an IL-22- creERT2 mice data coincide with this study indicating that IL-22 does mediated claudin flux occurs in Paneth cells (as reported in a not influence ISC function under homeostatic conditions. We also recent study) and is required for organoid growth.35 Indeed, Cldn1 observed increased expression of Olfm4 in tamoxifen-administered is highly expressed in Paneth cells.42 Additional work is required to Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice, suggesting IL-22 reduces ISC investigate the mechanisms of IL-22-mediated regulation of stemness (data not shown). Interestingly, TA cells express low organoid growth. levels of Lgr5, and Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice display IL-22 has been shown to regulate epithelial Reg3γ responses.43 compromised IL-22Ra1 signaling in ATOH1+ TA cells. This raises Our data suggest that IL-22Ra1 signaling in Paneth cells either the question regarding the role of TA cells in promoting Paneth cell does not modulate Reg3γ expression or modulates its expression differentiation. at very low levels. However, it is also possible that enhanced IL-22 One report showed that IL-22Ra1 is expressed on Lgr5+ stem responses in enterocytes of Il22Ra1fl/fl;Defa6-cre+ mice induce cells rather than Paneth cells.12 It is possible that IL-22Ra1 Reg3γ expression, thereby causing Paneth cell responses to be expression is transient or dependent on local environments masked. Reg3γ protein levels in knockout mice may be required to (ileum, jejunum, or duodenum). We used terminal ileum tissue further confirm our assumption. from our conditional knockout mice to validate that expression We and others have shown that IL-22 is critical for SFB of Il22ra1 was reduced in the Paneth cells of our Paneth cell- colonization and Th17 immune responses in the small intestine.3,29 specific IL-22Ra1 knockout mice (Fig. 4a and Supplementary We found increased SFB colonization in Il22Ra1fl/fl;Villin-cre+ mice, Fig. 3). Our Paneth cell Il22ra1 expression data are also supported but expression of Il17a and Il22 was unchanged. SAA1 has been by a recent study which shows that 72.7% of Paneth cells express shown to regulate SFB-dependent Th17 immune responses.28 Il22ra1.19 Reduced Saa1/2 levels in Il22Ra1fl/fl;Villin-cre+ mice may explain Our results obtained using Paneth cell-specific IL-22Ra1 knock- Il17a and Il22 expression results. Reg3γ has been shown to regulate out mice suggest that IL-22 has a specific and unique role in SFB colonization.43 However, SFB colonization was not altered

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 398 despite a 50% reduction in Il22Ra1 and Reg3γ expression in primer-probes for Il17a (Mm00439618_m1), Il22 (Mm00444241_m1), Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice. This suggests that IL-22Ra1 Hprt (Mm00446968_m1), Reg3γ (Mm.PT.58.1275735), Saa1/2 signaling in Paneth cells may be required for SFB colonization (Mm04208126), Il22ra1 (Mm.PT.58.42129001), Atoh1 (Mm00476035), and Th17 immune responses in the ileum. Indeed, Paneth cell- and Mmp7 (Mm00487724_m1), Chga (Mm0051431_m1), Dclk1 specific IL-22Ra1 signaling is required for SFB and selected (Mm00444950_m1), Wnt6 (Mm00437351_m1), Wnt9b commensal microbiota colonization, but non-Paneth cell-specific (Mm00457102_m1), Ki67 (Mm_Mki67_1_SG), Tgfb1 (Mm01178820_m1), IL-22 responses drive IL-17A and IL-22 responses in the small Egf (Mm00438696_m1), and Integrated DNA Technologies33 intestine. Additional work is required to reveal whether IL-22Ra1 primer-probes for Muc2 (Mm.PT.58.53535475.g), Tnfa (Mm. signaling in enterocytes or non-Paneth secretory cells is required PT.58.12575861), Hes1 FP- 5′-TGCCTTTCTCATCCCCAACG-3′, Hes1 for IL-17A and IL-22 responses. We predict that IL-22-dependent RP – 5′-AGGTGACACTGCGTTAGGAC-3′, Ascl2 FP 5′-CTACTCGTCG regulation of PanCryptidin and Mmp7 is responsible for SFB GAGGAAAG-3′, Ascl2 RP 5′-ACTAGACAGCATGGGTAAG-3′, Lyz1 colonization. The importance of Paneth cells in controlling SFB (Mm.PT.58.7374112) were used. RT-PCR analysis for mammalian has been evident by studies in HD5-transgenic mice and genes was calculated relative to Hprt. Quantitate relative recombinant defcr25 administered mice.13,29 abundance of SFB and total bacteria (Eubacteria) were deter- Our S. Typhimurium infection data show increased systemic mined using group-specific rDNA primers SFB736F—GACGCT bacteria dissemination in Il22Ra1fl/fl;Defa6-cre+ and tamoxifen- GAGGCATGAGAGCAT, SFB844R—GACGGCACGGATTGTTATTCA, administered Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice. We believe dysre- Eubact Uni340FP—ACTCCTACGGGAGGCAGCAGT, Eubact gulation of Paneth cell-specific antimicrobial peptides, as well as Uni514RP—ATTACCGCGGCTGCTGGC as described before.13,46 impairment of the gut barrier, may have predisposed Il22Ra1fl/fl; RT-PCR analysis for bacterial genes was analyzed relative to Defa6-cre+ or Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ mice to systemic Eubacteria. S. Typhimurium dissemination. Salmonella manipulates WNT/β- catenin signaling pathways to increase ISC-dependent infectiv- Phloxine-tartrazine staining ity.31 In addition, a lineage trace study indicated that Paneth cells Five micrometer thick paraffin-embedded tissue sections were can acquire multipotency and regulate epithelial cell regeneration deparaffinized and rehydrated using Xylene and a descending 44 in the absence of ISCs. Additional work is required to investigate ethanol gradient (100%, 95%, 70%, pure dH2O). Mayer’s Haema- the mechanisms of systemic S. Typhimurium dissemination. toxylin solution was used to stain nuclei to a medium density (~1 Interestingly, we did not see any difference in the expression min). Slides were thoroughly rinsed in running tap water for 5 min patterns of inflammatory cytokines in Il22Ra1fl/fl;Defa6-cre+ mice and stained with phloxine solution for 20 min. Slides were rinsed as we observed in global Il22−/− mice in the terminal ileum of with tap water, blotted dry, and rinsed with tartrazine solution to Salmonella infected mice. It is possible that IL-22 signaling in remove remaining water. Slides were kept in tartrazine solution enterocytes, other secretory cells, or ISCs regulate inflammation. In and visualized under a microscope until granules were red and all addition, neutralizing or enhancing IL-22 function in Il22Ra1fl/fl; other tissue was yellow. Slides were dehydrated in 70, 95, and Defa6-cre+ mice may be useful to further dissect the cell lineage- 100% ethanol and then placed in two washes of 100% xylene specific functions of IL-22 in regulating S. Typhimurium infection. before being mounted. For analysis of average Paneth cell number Overall, our study highlights the importance of IL-22Ra1 per crypt, at least 10 crypts were counted per mouse. Images were signaling in Paneth cell lineages and its impact on the microbiome, acquired using a Zeiss Observer D1 Inverted Phase Contrast immune responses, and pathogen colonization. These findings Fluorescence Microscope, Axiocam 105 color camera, and Zeiss may have a great impact on our understanding of IL-22-dependent Zen pro microscope software (Stony Brook University). protective and/or inflammatory pathways. Likewise, results from this study may be beneficial in identifying a therapeutic target for Alcian blue staining multiple intestinal and extra-intestinal diseases. Five micrometer thick paraffin-embedded tissue sections were deparaffinized and rehydrated using Xylene and a descending ethanol gradient (100%, 95%, 70%, pure dH2O). Three percent MATERIALS AND METHODS acetic acid was applied to the slides for 3 min. Alcian blue solution Mice (pH 2.5) was added to slides for 30 min to stain the goblet cells. C57BL/6 (WT) and Villin-Cre (C57BL/6 background) were purchased Three percent acetic acid was applied to the slides for ~30 s to from The Jackson Laboratory. Defa6-Cre mice were obtained from remove excess Alcian blue staining. Slides were rinsed in running Dr. Richard Blumberg, Brigham and Women’s Hospital, Harvard. tap water for 5 min followed by two changes of distilled water. Generation and characterization of IL-22-Floxed (Il22Ra1fl/fl)mice Nuclear Fast Red solution was applied for 5 min to stain nuclei. was performed as described.45 Rorc−/− and Il22−/− (both C57BL/6 Slides were rinsed with running tap water for 2 min, transferred to background) mice were received from Dr. Jay K. Kolls. Il22Ra1fl/fl two changes of distilled water, and then dehydrated with an mice were bred with Villin-cre, Lgr5-EGFP-creERT2,orDefa6-cre mice ascending ethanol gradient (70, 95, and 100%). Slides were to generate entire gut epithelium ISC-specific and Paneth cell- mounted. Images were acquired using a Zeiss Observer D1 specific IL-22Ra1 knockout mice. Lgr5-EGFP-creERT2;RosaLSLtdTo- Inverted Phase Contrast Fluorescence Microscope, Axiocam 105 mato mice were obtained from Dr. Vincent Yang, Stony Brook color camera, and Zeiss Zen pro microscope software (Stony Brook University. We used 6–8 week aged mice (both genders) for all University). experiments unless indicated in the figure. All mice were housed in specific pathogen-free conditions at Stony Brook University, Stony Tamoxifen treatment Brook, NY. All animal studies were conducted with the approval of Tamoxifen (1 mg/mouse) or corn oil was administered intraper- Stony Brook University Institutional Animal Care and Use itoneally for 5 consecutive days. On day 9 post last tamoxifen Committee. injection, Il22Ra1fl/fl;Lgr5-EGFP-creERT2 mice tissue was harvested for RT-PCR. On day 5 (last tamoxifen injection), Il22Ra1fl/fl;Lgr5- RT-PCR EGFP-creERT2+/− mice were infected with Salmonella. On day 6 To isolate RNA from terminal ileum tissues, Trizol or Qiagen RNeasy (1 day after last tamoxifen injection), Il22Ra1fl/fl;Lgr5-EGFP-creERT2+ kit was used following the manufacturer’s instructions. Biorad IScript mice tissues were used for IL-22Ra1 staining by flow cytometry. kit was used to reverse transcribe RNA into cDNA. RT-PCR was Tamoxifen (1 mg/mouse) was administered intraperitoneally for 5 performed using Biorad Sso advanced supermix. Applied Biosystem consecutive to Lgr5-EGFP-creERT2;RosaLSLtdTomato mice.

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 399 IL-22 treatment RNA sequencing (RNA-seq) Recombinant human IL-22.Fc (generously provided by Evive Organoid: Primary organoids from C57BL/6 mice were cultured as Biotech. China) was administered intraperitoneally (80 μg/mouse) described above. Cells were dissociated using TrypLE Express and in C57BL/6 mice or Lgr5-EGFP-creERT2;RosaLSLtdTomato mice. A single cells were directly sorted into a 96-well plate. Total RNA was dose response curve was generated to determine the optimal used as starting material for deep sequencing. dose of IL-22 in inducing Reg3γ (data not shown). Mouse small intestine-derived organoids were continuously (starting on day 1 Tissue. RNA from the terminal ileum of 6-week-old Il22Ra1fl/fl; till day 8) treated with IL-22.Fc (4 ng/ml). Further details regarding Defa6-cre+ and their littermate cre- mice were isolated using organoid culture are discussed in a subsequent section. TRIZOL extraction method as per manufacture instruction (Life Technologies). S. Typhimurium infection Il22Ra1fl/fl;Defa6-cre+, tamoxifen-administered Il22Ra1fl/fl; Single-cell RNA sequencing (scRNA-seq) Lgr5-EGFP-creERT2 and their littermate cre- mice were fasted for Primary organoids from C57BL/6 mice were generated as 4 h then gavaged with streptomycin (0.1 ml of a 200 mg/ml described above. Four replicates of organoids were pooled solution in sterile water administered orally) 24 h prior to oral together from 1 mouse for scRNA-seq. Cells were dissociated gavage with 5 × 108 CFU Salmonella enterica serovar Typhimurium using TrypLE Express, washed with 1× PBS with 0.4% BSA and strain IR715. After injection, mice were provided with food and stored on ice until proceeding to single-cell capture for RNA water ad libitum. Mice were monitored for weight loss and sequencing. Single cells were processed through the Chromium mortality, and on day 4 or 5 mice were euthanized. Liver, caecum, Single Cell Platform using the Chromium Single Cell 3′ Library, Gel and mesenteric lymph nodes were removed, homogenized in LB Bead and Chip Kits (10X Genomics, Pleasanton, CA), following the media, and plated on LB agar plates supplemented with nalidixic manufacturer’s protocol. In brief, an input of 10,000 cells was acid to evaluate systemic bacterial dissemination. added to each channel of a chip with a recovery rate of 3000 cells. The cells were then partitioned into Gel Beads in Emulsion in the 16S rRNA microbial community analysis Chromium instrument, where cell lysis and barcoded reverse Terminal ileum luminal contents DNA from littermate cohoused transcription of RNA occurred, followed by amplification, tagmen- Il22Ra1fl/fl;Defa6-cre+ mice and cre− mice (6 weeks age) were tation and 5′ adaptor attachment. Libraries were sequenced on an isolated using QiAMP stool DNA extraction kit. Microbial commu- Illumina NextSeq 500. Alignment to the mm10 mouse genome nity analysis utilized PCR amplification of the V4 region of 16S and unique molecular identifier (UMI) collapsing was performing rRNA followed by sequencing on an Illumina MiSeq was using the Cellranger toolkit (version 1.3.1, 10X Genomics). For each performed and analyzed by MR DNA (Shallowater, Tx, USA). cell, we quantified the number of genes for which at least one UMI Sequences were analyzed using QIIME 1.8 as described.47 was mapped and then excluded all cells with fewer than 1000 Differentially abundant OTUs were determined utilizing the group detected genes. significance script within QIIME. Total RNA sequencing Organoid culture Illumina TruSeq stranded total RNA library prep with ribo-zero gold Roughly 10 cm of mouse small intestinal tissue (starting from the ribosomal depletion. Prior to Illumina TruSeq Total RNA library terminal ileum) was flushed with ice-cold 1× PBS, sectioned, and construction, Total RNA was quantitated using the Qubit RNA BR rinsed an additional four times with cold 1× PBS. The tissues were assay kit (Thermo Fisher Scientific: Guide MAN0001987 MP10210, then cut into 0.5 cm pieces and transferred into 7.5 mM EDTA in Kit #Q10210). RNA quality was determined on an Agilent 4150 1× PBS. Tissues were incubated for 30 min on an orbital shaker (60 Tapestation (G2992AA) using Agilent RNA ScreenTape Analysis rpm) at 4 °C. After incubation, the tissues were washed to remove (Agilent: Publication Part Number: G2991-90021, Kit #5067-5576). excess EDTA and were placed into cold 1× PBS. Tissues were 2.5 μg Total RNA was treated with 1MBU Baseline-Zero DNase gently shaken for 1 min and the supernatant was filtered through (Epicentre Cat. No DB0711K) following the General Baseline –Zero a70µmfilter (BD biosciences) into a new conical tube. This was DNase protocol (www.epicentre.com, Lit # 263). RNA was purified performed two additional times to achieve a total of three and concentrated using 1.8 × vol Agencourt RNAClean XP Beads fractions. Each fraction was spot-checked and any fraction with a (Beckman Coulter A63987) following the standard protocol high amount of debris or low crypt yield was discarded. Filtered (Protocol 001298v001). Concentrations of samples were again crypts were pelleted via centrifugation (2000 rpm for 5 min) and measured with Qubit BR RNA assay kit for input into the TruSeq re-suspend in Matrigel hESC-qualified Matrix (Corning) at a Stranded Total RNA library protocol. concentration of 80 crypts per 20 µL Matrigel. Twenty microliters Illumina compatible Total RNA cDNA libraries with RiboZero of this suspension were dispensed per well in 24-well plates. After Gold depletion were generated following the TruSeq Stranded polymerization of Matrigel for 30 min at 37 °C and 5% CO2, the Total RNA Reference Guide (Illumina Document solid matrix was overlaid with 500 µL medium containing growth #1000000040499v00, TruSeq Stranded Total RNA Gold Illumina factor R-Spondin (100 ng/ml) and Noggin (50 ng/ml) in advanced Kit #20020598). Final cDNA libraries were quantitated using Dulbecco’s modified Eagle medium (DMEM)/F12, supplemented Qubit dsDNA BR assay kit (Thermo Fisher Scientific: Guide with 1× penicillin/streptomycin, 1× GlutaMAX, 1× N2, 1× B27 (all MAN0002325 MP 32850, Kit #Q32850). The quality of the form Invitrogen). libraries was determined by running each on an Agilent 4150 The following growth factors were added to the medium media Tapestation using the DNA 1000 Screentape kit (Agilent: prior to plating: human EGF 40 ng/mL (Peprotech), 1µM N- Publication Part Number: G2991-90031, Kit # 5067-5583). Region acetylcysteine (Sigma), 20 µM Y-27632 (Tocris) and 5.6 µM CHIR analysis was performed on the electropherogram of each library 99021 (Tocris). Media was changed every 2 days. using Agilent 4150 Tapestation Analysis Software (Version 3.1) For C57BL/6 organoids, a single-cell suspension was prepared with a range of 200–600 bp to determine average size of each on day 7 and was sorted. Defa6-Cre organoids were stimulated library. Average size and concentration were then used to with 4 ng/mL IL-22.Fc, 100 ng/mL recombinant mouse Wnt3a calculate the molarity of each library. All libraries were pooled (R&D) or 1 μg/mL recombinant mouse DLL1.Fc (R&D) wherever and denatured following the standard normalization method in indicated. Images were taken 2, 4, and 6 days after plating using the Illumina Denature and Dilute Libraries Guide for the NextSeq an Olympus CKX41 microscope and GRYPHAX imaging camera System (Illumina Part #15048776). Finally, denatured libraries and software. were loaded onto an Illumina NextSeq 550 v2.5 Mid 150 output

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 400 reagent cartridge (Illumina # 20024904) at a final concentration EM UC7 ultramicrotome and placed on formvar coated slot copper of 1.5pM in HT1 buffer. Illumina Denatured PhiX control library grids. Sections were then counter-stained with uranyl acetate and v3 (Illumina #FC-110-3001) was also included at 1% concentra- lead citrate and viewed with a FEI Tecnai12 BioTwinG2 transmis- tion. Paired end 75 bp single index sequencing was performed sion electron microscope. Digital images were acquired with an yielding ~7.5 M PE reads per sample. AMT XR-60 CCD Digital Camera system. Sequencing analysis was done using RNA-seq for Eukaryotes Analysis v3 by Banana Slug Genomics Center at University of Flow cytometry California Santa Cruz. Raw sequencing reads (paired-end reads) fl/fl that were produced by Illumina sequencer were quality checked The small intestines from Il22Ra1 ;Villin-Cre,tamoxifen-treated Il22Ra1fl/fl;Lgr5-EGFP-creERT2+,Il22Ra1fl/fl;Defa6-Cre or Lgr5-EGFP- for potential sequencing issues and contaminants using ERT2 FastQC.1 Adapter sequences and primers were trimmed from cre ;RosaLSLtdTomato mice were harvested. The ileum or the sequencing reads using Trimmomatic,2 then followed by entire small intestine were separated from the mesentery and ’ fl removing polyA tail, polyN, and read portions with quality score Peyer s patches were carefully excised. Tissues were ushed with below 28 using PRINSEQ. Reads with a remaining length of ice-cold 1× PBS and opened longitudinally. Tissues were washed fewer than 20 bp after trimming were discarded. A second four additional times with ice-cold PBS and were cut into ~0.5 round of quality check with FastQC was made to compare cm pieces Epithelial cells were separated from the lamina read quality before and after trimming. Trimmed reads were propria by incubating the tissue pieces in 7.5 mM EDTA in 1× mapped to the reference genome (GRCm38/mm10) using PBS on an orbital shaker (60 rpm) for 30 min at 4 °C. Crypts were (TopHat2) with NCBI RefSeq annotated genes as transcriptome released by shaking tissue pieces in 1× PBS and repeating this fi μ index data. Read alignment coverage and summary statistics for step three. Crypts were ltered using a 70- mcellstrainerand visualization were computed using SAMtools, BEDtools, and pelleted by centrifugation at 2000 rpm for 5 min at 4 °C. The UCSC Genome Browser utilities. Cufflinks 2.2.0 workflow and crypts were incubated for 15 min at 4 °C in fetal bovine serum read-counting methodology with DESeq and edgeR were (10%) containing DMEM/F12 medium. Cells were dissociated μ adopted for abundance estimation and differential expression using TrypLE Express (Invitrogen) supplemented with 10 M μ analysis. In brief, using Cufflinks workflow, the sequencing Rock inhibitor (Y-27632) and 2.5 g/ml DNAse 1 (Sigma-Aldrich) fi μ reads aligned to RefSeq annotated genes were quantified using for5minat37°C.Cellswere ltered using a 70- mcellstrainer Cuffquant. Cuffnorm was then used to normalize the gene to remove clumps and mucus. The cells were washed twice with expression levels across the studied samples with FPKM PBS and pelleted by centrifugation at 4 °C at 2000 rpm for 3 min. computed for sample correlation assessment. Differential Cell suspensions were stained with IL-22Ra1 (R&D), UEA-1 expression analysis between samples was performed using (Vector), CD24 (eBioscience), and EpCAM (eBioscience) anti- fi bodies for acquisition at BD-LSR-Fortessa. Cell pellets from Cuf dff with the computed results from Cuffquant. Using read- fl/fl ERT2+ counting methodology, HTSeq was adopted to compute raw tamoxifen-treated Il22Ra1 ;Lgr5-EGFP-cre mice were re- read counts for annotated RefSeq genes. Raw read counts were suspended in 600ul PBS for sorting. normalized across all samples andthenusedfordifferential expression analysis using edgeR. DATA AVAILABILITY fl Immuno uorescence All RNA-seq data have been deposited in the GEO database (GSE159423) and all 16s For staining, terminal ileum tissue was fixed in 10% formalin and files have been deposited in the SRA database (SAMN16424612). embedded in paraffin blocks. Paraffin-embedded tissue sections (5 μm) were deparaffinized using Xylene and rehydrated using a descending ethanol gradient. Antigen retrieval was conducted by heating slides in a microwave. Tissue sections were blocked in 5% ACKNOWLEDGEMENTS bovine serum albumin in 1× PBS for 1 h at 37 °C. Tissue sections We thank Dr. Vincent Yang and Dr. Agnieszka Bialkowska, Stony Brook University, were incubated at 4 °C overnight in primary antibodies against NY for critical reagents. We thank Susan Van Horn, Central Microscopy Imaging LYZ1-FITC (Dako, 1:200), MMP7 (Cell Signaling Technology, 1:200). Center, Stony Brook for acquiring TEM images. We would like to acknowledge the Flow Cytometry Core at Stony Brook University. We would like to acknowledge the Slides were washed three times for 5 min, and sections were ® Research Histology Core Laboratory at Stony Brook University. We would like to incubated with anti-rabbit IgG Fab2 Alexa Fluor 647 (Cell acknowledge the RNA sequencing Core at Tulane University. We thank Shannon Signaling Technology, 1:300). Slides were mounted using a DAPI Kanidinc, Artan Berisha, Makheni Jean-Pierre, Hoi Tong Wong, Suzanne Tawch, and hard stain (Vector® Laboratories, H-1500) to visualize cell nuclei. Ankita Singh for their help. This work was supported by the Crohn’s and Colitis Images were acquired using a Zeiss 510 Meta NLO confocal Foundation (476637), NIH R01 DK121798-01, NIH R21 AI149257 and the SUNY microscope (Stony Brook University). Research Foundation to P.K., the National Science Foundation Graduate Research For lineage-tracing experiments, Rabbit anti-RFP (Rockland, Fellowship and the NRSA T32 training grant (5T32AI007539-22) to S.G., NIH R21 1:300) was used as a primary antibody, Mouse anti-rabbit (Jackson AI128372 and NIH R01 AI101221 to A.V.V., and NIDDK R01 DK088199 to R.B. P.K. Laboratories, 1:300) was used as a secondary antibody and also supported by NIH R21 AI146696. Donkey anti-mouse-Cy5 (Jackson Laboratories, 1:300) was used as a tertiary antibody. The primary antibody was applied overnight at 4 °C, and the secondary and tertiary antibodies were applied for AUTHOR CONTRIBUTIONS 30 min at 37 °C. Slides were washed three times for 5 min after P.K. designed the experiments and wrote the manuscript. S.G. helped design the each antibody was applied. experiments and wrote the manuscript. P.K., S.G., M.B., P.J., and X.L. performed key experiments and data analyses. S.B. and O.E. performed single cells RNA Transmission electron microscopy sequencing and analyzed the data. P.M. and S.G. performed S.Typhimurium Il22Ra1fl/fl;Defa6-cre+ and cre- mice terminal ileum samples were experiments K.S. performed histologic evaluation of S. Typhimurium-infected used for transmission electron microscopy and were processed intestinal tissues. N.M., C.K., A.B., O.E., B.Y., and S.G. performed organoid cultures, using standard techniques. In brief, samples were fixed overnight stimulation, and analysis. 16S microbial sequencing data collection and analysis ’ was done at Mr. DNA, Shallowwater, TX. M.B., P.J., S.R., and S.G. performed all in Karnovsky s Fixative (Electron Microscopy Sciences). Samples immunofluorescence staining. S.R. and S.G. performed Alcian blue and phloxine- were then placed in 1% osmium tetroxide in 0.1 M PBS pH 7.4, tartrazine staining and data analyses. X.L. and S.G. performed all flow cytometry. dehydrated in a graded series of ethyl alcohol and embedded in M.B., X.L., and S.G. performed all RT-PCR experiments. A.V.V. and R.B. provided EMbed 812 resin. Ultrathin sections of 80 nm were cut with a Leica critical experimental samples.

Mucosal Immunology (2021) 14:389 – 401 IL-22 receptor signaling in Paneth cells is critical for their. . . SJ Gaudino et al. 401 ADDITIONAL INFORMATION 27. Salzman, N. H. Paneth cell defensins and the regulation of the microbiome: The online version of this article (https://doi.org/10.1038/s41385-020-00348-5) Détente at mucosal surfaces. Gut Microbes 1, 401–406 (2010). contains supplementary material, which is available to authorized users. 28. Sano, T. et al. An IL-23R/IL-22 circuit regulates epithelial serum amyloid A to promote local effector Th17 responses. Cell 164, 324 (2016). Competing interests: The authors declare no competing interests. 29. Kumar, P. et al. Intestinal interleukin-17 receptor signaling mediates reciprocal control of the gut microbiota and autoimmune inflammation. Immunity 44, Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims 659–671 (2016). in published maps and institutional affiliations. 30. Lee, J. S. et al. AHR drives the development of gut ILC22 cells and postnatal lymphoid tissues via pathways dependent on and independent of Notch. Nat. Immunol. 13, 144–151 (2011). REFERENCES 31. Liu, X., Lu, R., Wu, S. & Sun, J. Salmonella regulation of intestinal stem cells through the Wnt/beta-catenin pathway. FEBS Lett. 584, 911–916 (2010). 1. Zheng, Y. et al. Interleukin-22 mediates early host defense against attaching and 32. Durand, A. et al. Functional intestinal stem cells after Paneth cell ablation induced effacing bacterial pathogens. Nat. Med. 14, 282–289 (2008). by the loss of transcription factor Math1 (Atoh1). Proc. Natl Acad. Sci. USA 109, 2. Zenewicz, L. A. et al. Innate and adaptive interleukin-22 protects mice from 8965–8970 (2012). inflammatory bowel disease. Immunity 29, 947–957 (2008). 33. Bry, L. et al. Paneth cell differentiation in the developing intestine of normal and 3. Shih, V. F. S. et al. Homeostatic IL-23 receptor signaling limits Th17 response transgenic mice. Proc. Natl Acad. Sci. USA 91, 10335–10339 (1994). through IL-22-mediated containment of commensal microbiota. Proc. Natl Acad. 34. Mao, K. et al. Innate and adaptive lymphocytes sequentially shape the gut Sci. USA 111, 13942–13947 (2014). microbiota and lipid metabolism. Nature 554, 255–259 (2018). 4. Sugimoto, K. et al. IL-22 ameliorates intestinal inflammation in a mouse model of 35. Zha, J.-M. et al. Interleukin 22 expands transit-amplifying cells while depleting ulcerative colitis. J. Clin. Invest. 118, 534–544 (2008). Lgr5+ stem cells via inhibition of Wnt and notch signaling. Cell. Mol. Gastro- 5. Zindl, C. L. et al. IL-22-producing neutrophils contribute to antimicrobial defense enterol. Hepatol. 7, 255–274 (2019). and restitution of colonic epithelial integrity during colitis. Proc. Natl Acad. Sci. 36. Greicius, G. et al. PDGFRalpha(+) pericryptal stromal cells are the critical source of USA 110, 12768–12773 (2013). Wnts and RSPO3 for murine intestinal stem cells in vivo. Proc. Natl Acad. Sci. USA 6. Monteleone, I. et al. Aryl hydrocarbon receptor-induced signals up-regulate IL-22 115, E3173–E3181 (2018). production and inhibit inflammation in the gastrointestinal tract. Gastro- 37. Fukui, H. et al. IL-22 produced by cancer-associated fibroblasts promotes gastric enterology 141, 237–248 (2011). 248.e231. cancer cell invasion via STAT3 and ERK signaling. Br. J. Cancer 111, 763–771 7. Pham, T. A. et al. Epithelial IL-22RA1-mediated fucosylation promotes intestinal (2014). colonization resistance to an opportunistic pathogen. Cell Host Microbe 16, 38. Cantwell, M. T. et al. STAT3 suppresses Wnt/beta-catenin signaling during the 504–516 (2014). induction phase of primary Myf5+ brown adipogenesis. Cytokine 111, 434–444 8. Kryczek, I. et al. IL-22(+)CD4(+) T cells promote colorectal cancer stemness via (2018). STAT3 transcription factor activation and induction of the methyltransferase 39. Chen, M. W. et al. The STAT3-miRNA-92-Wnt signaling pathway regulates DOT1L. Immunity 40, 772–784 (2014). spheroid formation and malignant progression in ovarian cancer. Cancer Res. 77, 9. Ji, Y. et al. IL-22 promotes the migration and invasion of gastric cancer cells via IL- 1955–1967 (2017). 22R1/AKT/MMP-9 signaling. Int J. Clin. Exp. Pathol. 7, 3694–3703 (2014). 40. Fragoso, M. A. et al. The Wnt/beta-catenin pathway cross-talks with 10. Huber, S. et al. IL-22BP is regulated by the inflammasome and modulates STAT3 signaling to regulate survival of retinal pigment epithelium cells. PLoS ONE tumorigenesis in the intestine. Nature 491, 259–263 (2012). 7, e46892 (2012). 11. Jinnohara, T. et al. IL-22BP dictates characteristics of Peyer’s patch follicle- 41. Kim, T. H., Escudero, S. & Shivdasani, R. A. Intact function of Lgr5 receptor- associated epithelium for antigen uptake. J. Exp. Med. 214, 1607–1618 (2017). expressing intestinal stem cells in the absence of Paneth cells. Proc. Natl Acad. Sci. 12. Lindemans, C. A. et al. Interleukin-22 promotes intestinal-stem-cell-mediated USA 109, 3932–3937 (2012). epithelial regeneration. Nature 528, 560–564 (2015). 42. Pearce, S. C. et al. Marked differences in tight junction composition and macro- 13. Salzman, N. H. et al. Enteric defensins are essential regulators of intestinal molecular permeability among different intestinal cell types. BMC Biol. 16, 19 (2018). microbial ecology. Nat. Immunol. 11,76–82 (2010). 43. Vaishnava, S. et al. The antibacterial lectin RegIIIgamma promotes the 14. Liu, T. C. et al. Paneth cell defects in Crohn’s disease patients promote dysbiosis. spatial segregation of microbiota and host in the intestine. Science 334, 255–258 JCI Insight 1, e86907 (2016). (2011). 15. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L. & Hooper, L. V. Paneth cells 44. Yu, S. et al. Paneth cell multipotency induced by notch activation following injury. directly sense gut commensals and maintain homeostasis at the intestinal host- Cell Stem Cell 23,46–59.e45 (2018). microbial interface. Proc. Natl Acad. Sci. USA 105, 20858–20863 (2008). 45. Zheng, M. et al. Therapeutic role of interleukin 22 in experimental intra-abdominal 16. Fujino, S. et al. Increased expression of interleukin 17 in inflammatory bowel klebsiella pneumoniae infection in mice. Infect. Immun. 84,782–789 (2016). disease. Gut 52,65–70 (2003). 46. Croswell, A., Amir, E., Teggatz, P., Barman, M. & Salzman, N. H. Prolonged impact 17. Fellermann, K., Wehkamp, J., Herrlinger, K. R. & Stange, E. F. Crohn’s disease: a of antibiotics on intestinal microbial ecology and susceptibility to enteric sal- defensin deficiency syndrome? Eur. J. Gastroenterol. Hepatol. 15, 627–634 (2003). monella infection. Infect. Immun. 77, 2741–2753 (2009). 18. Gronke, K. et al. Interleukin-22 protects intestinal stem cells against genotoxic 47. Shah, R. et al. Composition and function of the pediatric colonic mucosal stress. Nature 566, 249–253 (2019). microbiome in untreated patients with ulcerative colitis. Gut Microbes 7, 384–396 19. Zwarycz, B. et al. IL22 inhibits epithelial stem cell expansion in an ileal organoid (2016). model. Cell Mol. Gastroenterol. Hepatol. 7,1–17 (2019). 20. Fevr, T., Robine, S., Louvard, D. & Huelsken, J. Wnt/beta-catenin is essential for intestinal homeostasis and maintenance of intestinal stem cells. Mol. Cell Biol. 27, Open Access This article is licensed under a Creative Commons 7551–7559 (2007). Attribution 4.0 International License, which permits use, sharing, 21. van Es, J. H. et al. A critical role for the Wnt effector Tcf4 in adult intestinal adaptation, distribution and reproduction in any medium or format, as long as you give homeostatic self-renewal. Mol. Cell Biol. 32, 1918–1927 (2012). appropriate credit to the original author(s) and the source, provide a link to the Creative 22. Sato, T. et al. Paneth cells constitute the niche for Lgr5 stem cells in intestinal Commons license, and indicate if changes were made. The images or other third party crypts. Nature 469, 415–418 (2011). material in this article are included in the article’s Creative Commons license, unless 23. Behnsen, J. et al. The cytokine IL-22 promotes pathogen colonization by sup- indicated otherwise in a credit line to the material. If material is not included in the pressing related commensal bacteria. Immunity 40, 262–273 (2014). article’s Creative Commons license and your intended use is not permitted by statutory 24. Goto, Y. et al. Innate lymphoid cells regulate intestinal epithelial cell glycosyla- regulation or exceeds the permitted use, you will need to obtain permission directly tion. Science 345, 1254009 (2014). from the copyright holder. To view a copy of this license, visit http://creativecommons. 25. Bel, S. et al. Paneth cells secrete lysozyme via secretory autophagy during bac- org/licenses/by/4.0/. terial infection of the intestine. Science 357, 1047–1051 (2017). 26. Salzman, N. H., Ghosh, D., Huttner, K. M., Paterson, Y. & Bevins, C. L. Protection against enteric salmonellosis in transgenic mice expressing a human intestinal © The Author(s) 2020 defensin. Nature 422, 522–526 (2003).

Mucosal Immunology (2021) 14:389 – 401