Adaptive Synonymous Mutations in an Experimentally Evolved Pseudomonas ﬂuorescens Population

ARTICLE

Received 7 Apr 2014 | Accepted 8 May 2014 | Published 10 Jun 2014 DOI: 10.1038/ncomms5076 Adaptive synonymous mutations in an experimentally evolved Pseudomonas ﬂuorescens population

Susan F. Bailey1,w, Aaron Hinz1 & Rees Kassen1

Conventional wisdom holds that synonymous mutations, nucleotide changes that do not alter the encoded amino acid, have no detectable effect on phenotype or fitness. However, a growing body of evidence from both comparative and experimental studies suggests otherwise. Synonymous mutations have been shown to impact gene expression, protein folding and fitness, however, direct evidence that they can be positively selected, and so contribute to adaptation, is lacking. Here we report the recovery of two beneficial synonymous single base pair changes that arose spontaneously and independently in an experimentally evolved population of Pseudomonas fluorescens. We show experimentally that these mutations increase fitness by an amount comparable to non-synonymous mutations and that the fitness increases stem from increased gene expression. These results provide unequivocal evidence that synonymous mutations can drive adaptive evolution and suggest that this class of mutation may be underappreciated as a cause of adaptation and evolutionary dynamics.

1 Department of Biology, University of Ottawa, Ottawa, Ontario, Canada K1N 6N5. w Present address: Bioinformatics Research Centre, Aarhus University, C.F. Møllers Alle´ 8, DK-8000 Aarhus C, Denmark. Correspondence and requests for materials should be addressed to S.F.B. (email: [email protected]).

NATURE COMMUNICATIONS | 5:4076 | DOI: 10.1038/ncomms5076 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms5076

ynonymous mutations might be expected to have no being that they have hitch hiked to high frequency alongside a detectable effect on fitness, as this class of mutation does genetically linked beneficial non-synonymous substitution. Snot change the amino-acid sequence of the encoded protein. Further investigation of the fitness effects associated with However, it has been recognized for sometime that this synonymous mutations from these experiments typically reveals assumption may not always be correct. Pervasive variation in that these mutations are indeed neutral18,19. the frequencies of synonymous codons across genes and genomes Taken together, the evidence suggests that the fitness effects of (codon usage bias)1 suggests that selection may favour some synonymous mutations are most often either nearly neutral or synonymous codons over others. Moreover, direct measures of deleterious and, very infrequently, weakly beneficial. Such the impact of synonymous mutations from nucleotide variability in fitness effects suggests that we might be able to replacement studies demonstrate that they can impact gene describe the distribution of fitness effects among synonymous expression2,3, presumably through changes to the rate or accuracy mutations in much the same way as we do for any other kind of of transcription and/or translation4, mRNA stability and folding5, mutation, including non-synonymous ones: the distribution protein secondary structure6,7 and even fitness3,8–11. Taken should be modal, with a mean that is on average negative and a together, these results suggest that the frequency of at least right-hand tail that encompasses at least some beneficial some synonymous mutations is governed by selection. mutations. If this interpretation is correct, then we should The nature of selection on synonymous mutations—its occasionally expect to see strongly beneficial synonymous direction and strength—is less clear. Theory suggests that the mutations that are positively selected and contribute to adapta- strength of selection on synonymous sites resulting in observed tion. To date, however, direct evidence that such mutations exist patterns of codon bias is probably weak, on the order of 1/Ne (Ne: is lacking. Here we report the recovery of two independently effective population size) for genes with intermediate levels of arising beneficial synonymous mutations driving adaptive evolu- B 12 codon bias and up to 2/Ne for genes with extreme codon bias . tion in a laboratory population of the Gram-negative bacterium, Consistent with this expectation, estimates of fitness from Pseudomonas fluorescens. These mutations have strong beneficial comparative genomics suggest that synonymous sites are under fitness effects, comparable to the fitness effects of beneficial weak purifying selection13–15, although a recent study suggests non-synonymous mutations arising in similar experimental that up to 22% of synonymous sites in the Drosophila populations, that are caused by increased gene expression at the melanogaster genome may be under strong purifying level of transcription and can be common in natural populations. selection16. Direct measures of fitness from site-directed Our results suggest that synonymous mutations may play an mutagenesis studies tell a similar story: the fitness effects of underappreciated role in adaptive evolution. synonymous mutations are almost always deleterious or, more rarely, weakly beneficial3,8–11. Deleterious mutations are, by Results definition, subject to purifying selection, while weakly beneficial Substitution dynamics of synonymous mutations. As part mutations are unlikely to be substituted by selection because of a larger experiment20, we propagated an initially isogenic either they cannot escape drift in small populations or, in large population of P. fluorescens strain SBW25 for 1,000 generations populations, are eliminated in competition with the relatively in a minimal medium containing glucose as the sole carbon more abundant class of non-synonymous mutations with larger source. Fitness was assayed every 200 generations and increased beneficial effects. The occasional recovery of synonymous significantly by 14.79% (t-test, df ¼ 2, P ¼ 0.01939) relative to the mutations from microbial evolution experiments could imply ancestor by the end of the experiment (Fig. 1a). Comparing that they are under positive selection, but often little focus is given whole-genome sequences of the generation 1000 population with to these mutations (for example, see ref. 17), the assumption the ancestor revealed two synonymous single base pair changes in

a c 1.20 1.15 1.15 1.10

1.05 (A15A) G38G) (PFLU4435−4466) Δ(PFLU4435−4466) ( Δ Δ(PFLU4435−4466) gtsB 1.10 1.00 gtsB Relative fitness 0.95 0 200 400 600 800 1,000 Generations

Relative fitness 1.05 b

1.00 abundance (A15A) (G38G) Genotype relative gtsB gtsB 0 200 400 600 800 1,000 (A15A) (G38G) (PFLU4435−4466)gtsB Generations Δ Δ(PFLU4435−4466)gtsB Genotype

Figure 1 | Fitness and genotype trajectories of a P. fluorescens population adapting to glucose minimal media over 1,000 generations. (a) Population fitness relative to the ancestor (SBW25), over 1,000 generations (mean±s.e.m.; n ¼ 3); * indicates when genotypes were first detected. (b) Relative abundance of the ancestor (grey), D(PFLU4435–4466) (red), D(PFLU4435–4466) gtsB(A15A) (blue), D(PFLU4435–4466) gtsB(G38G) (yellow) genotypes over 1,000 generations. (c) Fitness of the evolved genotypes (solid bars) and the synonymous mutations in the ancestral genetic background (hashed bars) relative to the ancestor (mean±s.e.m.; n ¼ 8).

2 NATURE COMMUNICATIONS | 5:4076 | DOI: 10.1038/ncomms5076 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms5076 ARTICLE the putatively annotated gtsB (PFLU4845) gene (A15A: GCA- advantage over the ancestor and, moreover, that D(PFLU4435– GCG; G38G: GGC-GGT; see Fig. 2a) and a 35,107 bp deletion, 4466) gtsB(G38G) is fitter than D(PFLU4435–4466) gtsB(A15A) D(PFLU4435–4466). We reconstructed the dynamics of (Fig. 1c), consistent with the substitution dynamics observed substitution by isolating 24 colonies every 200 generations and (Fig. 1a,b). To estimate the fitness effect of the synonymous probing each isolate for the relevant mutation (Fig. 1a,b). The mutations themselves, we used an allelic replacement strategy to D(PFLU4435–4466) genotype appeared first around generation introduce each synonymous mutation into the ancestral genetic 200 and was nearly fixed by generation 400 before being replaced background that lacked the D(PFLU4435–4466) mutation (see by a second genotype with the gtsB(A15A) mutation in the Methods). Competitive fitness assays reveal that gtsB(A15A) D(PFLU4435–4466) background, which rose to high frequency confers a 7.25% (±0.55 s.e.m.) and gtsB(G38G) a 8.73% (±0.79 by generation 800 and was itself nearly replaced by the s.e.m.) fitness advantage relative to the ancestor (Fig. 1c), values D(PFLU4435–4466) gtsB(G38G) genotype by the end of the that are substantially larger than any previous estimate of fitness experiment. This pattern, with each new genotype arising and for a synonymous mutation3,8–11. nearly fixing within 200 generations, is consistent with natural selection acting on strongly beneficial mutations. Confirmation that gtsB is a target of selection. The intensity and breadth of resource use that these mutations confer provides Beneficial fitness effects of synonymous mutations. Assays insight into the ultimate causes of selection. Four lines of evidence of competitive fitness confirm that both evolved genotypes con- suggest that these mutations were selected because of their fitness taining the synonymous substitutions confer a significant fitness advantage on glucose rather than general adaptation to laboratory conditions. First, both synonymous mutations occur in a gene predicted to encode a permease subunit of an ABC transporter, a A10T A15A 1 M S S V A V F S K A S P F D A L Q R W L and homologues of this transport system in P. aeruginosa and ATGAGTTCTGTTGCTGTGTTCAGCAAAGCCTCGCCGTTCGATGCACTGCAGCGCTGGCTA P. putida are glucose inducible and responsible for glucose uptake AG 21–24 G38G (Fig. 2) . Second, the benefits conferred are specific to 21 P K L V L A P S M F I V L V G F Y G Y I glucose: neither mutation significantly affected fitness on CCCAAACTGGTGCTGGCGCCCAGCATGTTCATCGTGTTGGTGGGCTTTTACGGCTACATC T alternate sugars (Fig. 3). Third, from the same experiment, we identified a beneficial non-synonymous mutation (A10T) in gtsB that arose in an independently evolved population in glucose lux fusion (Figs 2a and 3), while populations selected in mannose or xylose gtsA gtsB gtsCgtsD oprB never showed mutations in this gene. Finally, a gtsB knockout

ΔgtsB strain (DgtsB) shows a significant fitness decrease in glucose of 14.23%±1.42 s.e.m. compared with the SBW25 ancestor (t-test, PFLU4846 PFLU4845 PFLU4844 PFLU4843 PFLU4842 df ¼ 7, Po0.0001; Fig. 3), but no significant difference in fitness Periplasmic Permease Permease ATP-binding Porin sugar-binding subunit from the ancestor on alternate sugars (t-test, df ¼ 15, P ¼ 0.9563; protein Fig. 3). Taken together, these results strongly suggest that gtsB is a target of selection, that the synonymous mutations confer an b Glucose adaptive advantage specifically on glucose and that the fitness

OprB gains do not stem from a loss of gene function. OM Distribution of ﬁtness effects. In contrast to all previous work A Periplasm reporting ﬁtness effects of synonymous mutations, the two we

IM B C Glucose Succinate Mannitol

1.10 Cytosol ADP + Pi D D ADP + Pi

ATP ATP 1.05

1.00 Figure 2 | Genomic and functional context of the synonymous (A15A and G38G) and non-synonymous (A10T) substitutions. (a) The substitutions 0.95 occurred in the 50 region of PFLU4845, which encodes a permease subunit of an ATP-binding cassette (ABC) transporter. The DNA and amino-acid Relative fitness 0.90 sequence of the ﬁrst 40 codons are shown, with the nucleotide substitutions indicated below the highlighted codons. Neighbouring genes 0.85 encode three additional ABC transporter subunits and an outer membrane porin. The transporter gene names (gts, glucose transporter subunit) are based on those of the P. putida KT2440 homologues23. The open reading gtsB gtsB gtsB Δ Δ Δ (A10T) (A10T) (A10T) (A15A) (A15A) frame lengths, position of the luciferase (lux) transcriptional fusion junction (A15A) (G38G) (G38G) (G38G) and DgtsB-deleted region are drawn to scale. Bent arrows indicate gtsB gtsB gtsB gtsB gtsB gtsB gtsB gtsB promoters predicted by the Softberry BPROM program (http:// gtsB linux1.softberry.com/berry.phtml). (b) The schematic depicts the probable Figure 3 | Fitness effects of gtsB mutations are speciﬁc to glucose. subunit organization of the gene products during glucose uptake40. Glucose Fitness relative to the ancestor (SBW25) of genotypes containing the two crosses the outer membrane by facilitated diffusion through the OprB porin, synonymous mutations, gtsB(A15A) and gtsB(G38G), the non-synonymous interacts with the periplasmic glucose-binding protein (GtsA) and is mutation, gtsB(A10T), and the gtsB knockout, DgtsB, in glucose and two transported across the inner membrane channel (GtsBCD2) in a process alternate carbon sources—succinate and mannitol. The mean±s.e.m. for energized by ATP hydrolysis. IM, inner membrane; OM, outer membrane. each treatment is shown (n ¼ 8).

NATURE COMMUNICATIONS | 5:4076 | DOI: 10.1038/ncomms5076 | www.nature.com/naturecommunications 3 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms5076 have uncovered arose spontaneously in an initially isogenic responsible for the increased fitness caused by these synonymous population and quickly went to near-fixation, a hallmark of mutations. strong positive selection. Indeed, our experimental results con- Synonymous mutations are often thought to impact both gene firm that the fitness advantages of these mutations are large, and expression and fitness through modifications to codon usage bias, of similar magnitude to those reported for the first few non- mRNA stability or protein folding, but these mechanisms seem synonymous mutations fixing in other microbial selection unlikely explanations for our results. Both the A15A and the experiments (for example, see ref. 18). To provide further insight G38G mutations result in slightly less-preferred codons (see into the magnitude of the fitness effects associated with these Methods and Supplementary Table 1), indicating that the increase mutations, we have examined the distribution of fitness effects in gene expression (and increase in fitness) cannot be due to fixed in other populations from the larger experiment20. Notably, aligning codon bias within the gene to that of highly expressed the fitness effects of the synonymous mutations are well genes. Furthermore, previous studies suggest that codon bias within the range of fitness effects for all other non-synonymous must change by a substantial amount to have a measurable effect mutations evolving in these populations and are indistinguishable on gene expression2, much less fitness, and so the magnitude of from the fitness effect of an independently isolated non- the fitness effects seen here suggests a priori that codon bias is not synonymous mutation in the same gene (Fig. 4). The fitness a potential mechanism. effects of these synonymous mutations thus resemble those of any Synonymous mutations can affect the stability of mRNA other non-synonymous mutation that has been selected. secondary structure through altered base pair interactions. Less stable secondary structures near a ribosomal binding site can lead Fitness advantage is caused by increased gene expression. What to increases in mRNA and protein levels, presumably via more efficient translation initiation, while more stable structures can is the mechanism by which the synonymous substitutions confer 2,4 high fitness? As the amino-acid sequence is not changed, the reduce expression levels . Although the G38G mutation does mechanism presumably involves changes to gene expression at decrease the predicted mRNA stability relative to the ancestor, the the level of transcription or translation, or perhaps even changes A15A mutation has no effect on predicted mRNA stability to protein secondary structure resulting from altered translation (Supplementary Table 1), suggesting that changes in mRNA rates4,6,7. We obtained measures of gtsB gene expression by folding energy do not fully explain the effects of the substitutions. Changes to translational efficiencies caused by the synonymous assaying transcript abundance using a luciferase reporter assay 6 (see Methods and Supplementary Fig. 1). We found that the mutations can result in altered protein folding and could synonymous mutations and the independently evolved non- conceivably lead to increased fitness. This explanation seems synonymous mutation in the same gene increased gene unlikely given that increasing transcription of the wild-type allele expression by approximately twofold in glucose (Fig. 5a; t-test, increased fitness (Fig. 5b), however, further examination of this df ¼ 19, Po0.0001). Both the wild-type and mutant alleles were hypothesis must await a complete characterization of the GtsB specifically expressed on glucose, indicating that there was no protein. shift from inducible to constitutive expression. Although our It is conceivable that the fitness benefit of these mutations assay cannot distinguish between an increase in gene expression comes via their interaction with regulatory factors that modulate due to increased rates of transcription or decreased rates of transcription or translation. Two mechanisms seem plausible. transcript degradation, we can confirm a link between increased First, the catabolite repression control (Crc) protein regulates glucose metabolism in Pseudomonads by binding to target gene expression and fitness. While transcriptional induction of 25 the wild-type gtsB gene alone did not increase fitness, induction of mRNA and inhibiting translation . If Crc binding to gtsB mRNA the entire operon containing the gene was beneficial (Fig. 5b and is inhibited by the synonymous mutations, this could result in increased GtsB expression. Although the gts operon is a predicted Supplementary Fig. 1). Taken together, these results indicate that 26 increased expression of the ABC transporter operon is likely target of Crc , deleting crc did not increase gene expression and fitness in the wild-type background and both remained elevated in the presence of the synonymous mutations (Supplementary Fig. 2). Second, the synonymous mutations could prevent binding of a small RNA (sRNA) targeting the gtsB transcript for 1.20 degradation27. However, we found that deleting hfq, a protein required for the activity of many sRNAs28, did not decrease the 1.15 elevated levels of gene expression associated with the synonymous mutations (Supplementary Fig. 3). That we find no empirical 1.10 support for either of these models suggests that the molecular

Fitness mechanism likely stems from effects of the synonymous mutations on binding an as-yet unidentified factor regulating 1.05 transcript abundance through its effects on transcription rate or mRNA stability. 1.00 Discussion Figure 4 | Fitness effects of mutations fixing in SBW25 populations Our results demonstrate unequivocally that synonymous evolved under similar conditions20. Box and whiskers show the mutations can increase fitness by amounts similar to that of distribution of fitness effects of non-synonymous mutations. The box non-synonymous mutations, and can play an important role in indicates the median, and the lower and upper quartiles (25 and 75%) of adaptive evolution. One potential criticism of our results is that the data, while the whiskers indicate the minimum and maximum values they are not general or applicable to more natural, and (n ¼ 8). Red points show the fitness effects of the two synonymous presumably more complex, situations. Two observations argue mutations (A15A and G38G), and the blue point shows the fitness effect of against this view. First, as we noted above, we have confirmed that a non-synonymous mutation (A10T) in the same gene (mean±s.e.m., gtsB is a target of selection on glucose and that the synonymous n ¼ 8). mutations do not confer general fitness advantages to life in a

4 NATURE COMMUNICATIONS | 5:4076 | DOI: 10.1038/ncomms5076 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms5076 ARTICLE

ab50 Glucose Succinate 1.06 40 1.04 30

20 1.02 Relative Relative fitness luminescence/CFU 10 1

0 0.98 (WT) (WT) None gtsB gtsABCD (A10T) (A10T) (A15A) (A15A) (G38G) (G38G) −oprB gtsB gtsB gtsB gtsB gtsB gtsB gtsB gtsB Inducible region

Figure 5 | The effects of the gtsB mutations on gene expression, and the effects of increased expression on fitness. (a) Reporter gene expression measured in luminescence/colony-forming units (CFU), relative to the minimum expression (mean±s.e.m., n ¼ 5). Transcriptional reporter strains with the wild type (WT), synonymous (A15A and G38G) and non-synonymous (A10T) alleles of gtsB-driving luciferase expression were tested in the selection environment (glucose) and with an alternate carbon source (succinate). (b) Mean fitness (±s.e.m., n ¼ 11) of constructs containing inducible inserts. Light grey shows fitness in the absence of the inducer (IPTG) and dark grey shows fitness in the presence of the inducer.

A15A G38G P protegens Pf-5 GCAGGC P protegens CHA0 GCA GGC Pseudomonas sp. UW4 GCG GGT P fulva 12-X GCG GGC P syringae pv. syringae B728a GCG GGC P syringae pv. phaseolicala 1448A GCG GGC P syringae pv. tomato str. DC3000 GCG GGC P putida H8234 GCG GGC P putida NBRC 14164 GCG GGC P putida GB-1 GCG GGC P putida S16 GCG GGC P putida F1 GCG GGC P putida ND6 GCG GGC P putida DOT–T1E GCG GGC P putida KT2440 GCG GGC P putida BIRD-1 GCG GGC P putida W619 GCG GGC P entomophila str.L48 GCG GGC P brassicacearum NFM421 GCA GGC P fluorescens F113 GCA GGC P fluorescens Pf0-1 GCA GGC P poae RE*1-1-14 GCT GGC P fluorescens A506 G T G GGC P fluorescens SBW25 G C A (G)CGG (T)

Figure 6 | Comparison of substitutions in gtsB at the locations of synonymous mutations A15A and G38G in 23 closely related species/strains of Pseudomonads. This comparison includes the BLAST (blastn) hits to P. fluorescens SBW25 gtsB for which the retrieved gtsB gene sequence did not differ in length from the query gtsB sequence. The phylogeny was constructed from full DNA sequences of gtsB. Black letters indicate the same nucleotide as SBW25, red letters indicate the same nucleotide as an SBW25 synonymous mutant and grey letters indicate an alternate nucleotide. laboratory environment. Any environment where selection fitness benefits typical of other non-synonymous mutations favours the ability to grow on limiting glucose is thus likely to involved in adaptation to resource-limited environments, increase target mutations in gtsB, at least some of which could be fitness via increased gene expression and are found in closely synonymous. Second, comparative genomic evidence indicates related species in nature. Moreover, it is notable that an that the synonymous mutations we have uncovered are the most independently isolated non-synonymous mutation in the same common substitutions at those sites in closely related Pseudo- gene increases fitness by a comparable amount, displays the same monads (Fig. 6). Taken together, these results suggest that these resource specificity and shows a similar increase in gene mutations may also be beneficial in more natural environments expression as the synonymous mutations, suggesting that both and are not just an artefact of life in a laboratory environment. types of mutations impact fitness by the same underlying We have shown that the synonymous mutations identified in mechanism. Synonymous mutations can thus contribute to this study occur in a gene that is a target of selection, confer large adaptation and be positively selected. Synonymous mutations

NATURE COMMUNICATIONS | 5:4076 | DOI: 10.1038/ncomms5076 | www.nature.com/naturecommunications 5 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms5076 can therefore not always be assumed to be neutral in models that derivative in which the lacZY genes were replaced by the sacB counterselectable infer the strength of selection from comparative gene sequence marker. This vector was generated by excising the lacZY genes from pUIC3 by EcoRI digestion, followed by self-ligation, transformation into DH5alpir and data based on the relative rates of non-synonymous to screening for white colonies on LB with Ap and X-gal. A 2-kb fragment containing 4 synonymous mutations . Rather, it seems more appropriate to the sacB gene was amplified from pEX18Tc34 using primers SacB-EcoRI and treat the fitness effects of synonymous mutations in the same way SacB-MfeI and inserted at the EcoRI site of the lacZY-excised pUIC3. The resulting r r as we do to other kinds of mutations, as draws from an plasmid (pAH79) confers sucrose sensitivity, Ap and Tc . Transcription of the sacB gene is oriented towards the multiple cloning site, which carries an additional underlying probability distribution of fitness effects that includes unique EcoRI site suitable for cloning. both deleterious and beneficial mutations. More generally, that we The pAH79 derivative containing the gtsB(A10T) mutation was generated by have uncovered an example of adaptive evolution driven by the amplifying the 2-kb gtsB locus using primers 22F-5324097 and 22R-5324097 from substitution of two synonymous mutations in an experimental DNA isolated from an evolved clone carrying the mutation. The fragment was digested with BglII and XbaI and cloned into the BglII and SpeI sites of pAH79 to system evolving over a few hundred generations suggests that this generate pAH79-A10T. The gtsB deletion plasmid was constructed by amplifying class of mutation may be an underappreciated cause of adaptation 1-kb fragments upstream and downstream of the gtsB gene with primer pairs and evolutionary dynamics in nature. 4845-del-F1/R1 and 4845-del-F2/R2. The two products were digested and ligated together using engineered SacI sites, and the 2-kb hybrid product was amplified with primers 4845-del-F1/R2. The resulting fragment contains a gtsB allele with an Methods in-frame deletion of codons 7 through 274 (of 302 total codons). The fragment Bacterial strains, plasmids and media. The strains, plasmids and primers used in was digested with BamHI and XbaI and inserted in the compatible BglII and SpeI this study are listed in Supplementary Tables 2 and 3. Plasmids were propagated in sites of pAH79 to generate pAH79-DgtsB.Thecrc and hfq deletion plasmids Escherichia coli DH5a or DH5alpir (for pUIC3 derivatives). Transformation of (pAH79-Dcrc and pAH79-Dhfq) were generated similarly with primer pairs DNA into E. coli and P. fluorescens was accomplished by chemical transformation, specific to crc (crc-del-F1/R1 and crc-del-F3/R3) and hfq (hfq-del-F1/R1 and 29,30 electroporation or conjugation according to standard protocols . E. coli was hfq-del-F2/R2). The crc allele contains a deletion of codons 31 to 216 (of 259 total), grown on Luria broth (LB) media at 37 °CandP. fluorescens on LB or minimal with a stop codon introduced after codon 31. The hfq allele carries a deletion of (M9) media at 28 °C. The minimal media contained 48 mM Na2HPO4,22mM codons 8 to 82 (of 86 total). KH2PO4, 9 mM NaCl, 19 mM NH4Cl, 2 mM MgSO4 and 0.1 mM CaCl2 with either Chromosomal integration of the pAH79 derivatives in P. fluorescens was glucose (53 mM), succinate (80 mM) or mannitol (53 mM) as sole carbon source. achieved by triparental mating as described for the pUIC3 constructs. sacB À 1 Antibiotics were used at the following concentrations: 100 mgml ampicillin counterselection enabled selection for the second recombination event by streaking À 1 À 1 (Ap), 25 mgml kanamycin (Km) and 25 mgml gentamicin (Gm) for E. coli; Tcr exconjugates on LB agar containing 5% sucrose. Sucrose-resistant colonies were À 1 À 1 À 1 100 mgml nitrofurantoin (Nf), 10 mgml tetracycline (Tc) and 10 mgml tested for Tc sensitivity and screened for the presence of the desired mutations by Gm for P. fluorescens. Media were supplemented with 5-bromo-4-chloro-3- sequencing (SNPs) or a PCR test (deletions). indolyl-b-D-galactopyranoside (X-gal) at 20 mgmlÀ 1 or isopropyl b-D-1- thiogalactopyranoside (IPTG) at 1 mM when appropriate. Transcriptional luciferase fusions. Gene expression of the gtsB alleles was examined using transcriptional luciferase fusions delivered by a site-specific mini- Selection experiment and competitive fitness assays As part of a larger . Tn7 transposon35. A 2.1-kb PCR fragment including the 350-bp gtsA promoter experiment, we propagated an initially isogenic population of P. fluorescens region, gtsA open reading frame and 115 codons (out of 302) of the gtsB open SBW25-lacZ for 1,000 generations in a minimal medium containing glucose as a reading frame was amplified with primers 4845-lacZ-F1 and 4845-lacZ-R1. The sole carbon source20. We estimated relative fitness of the population every 200 fragment was digested with XmaI and XhoI and ligated at the corresponding sites generations using 48 h head-to-head competitions against the SBW25 ancestor. of the vector pUC18-mini-Tn7T-Gm-lux. The truncated gtsB0 open reading frame Fitness was calculated as o ¼ (f /f )^(1/doublings), where f and f are final initial initial final encounters a vector-encoded stop codon 36 nucleotides downstream of the XhoI the ratios of the frequency of the evolved population to the frequency of ancestral site, and the start codon of the initial lux gene is located 432 nucleotides further. population before and after competition, respectively, and doublings refer to the Reporter constructs containing four gtsB alleles (wild type, A15A, G38G and number of doublings or generations that occur between the initial and final A10T) were introduced into P. fluorescens by co-electroporation with the pTNS2 measurements. Fitness of the SBW25 allelic replacement constructs was estimated helper plasmid by a previously described method36, with selection on LB Gm relative to SBW25-lacZ in glucose, succinate and mannitol environments to 10 (for SBW25) or LB Gm (for SBW25 Dcrc). The Dhfq reporter constructs were determine whether the detected fitness improvements were glucose specific. 1 generated by deleting the hfq gene from the SBW25 reporter constructs. Insertion at the attTn7 locus was verified as recommended35 by PCR amplification with Whole-genome sequencing and genotyping. Chromosomal DNA was extracted mini-Tn7- and SBW25-specific primer sets (PTn7R/PglmS-up-SBW25 and from the generation 1,000 population using a Promega Wizard Genomic DNA PTn7L/PglmS-down-SBW25). Purification kit and Illumina sequencing was performed by the Michael Smith Activity of the transcriptional fusions was determined in exponential phase Genome Sciences Centre. The sequence data were aligned to the P. fluorescens liquid cultures. Overnight cultures grown in M9-glucose or M9-succinate media SBW25 reference genome NC_012660.1, and mutations were called and annotated were diluted (1:100) in 1.5 ml fresh media and incubated 7 h with shaking in using a custom computational pipeline31 and BRESEQ18. The time dynamics of the 24-well plates. Luminescence at 520 nm was measured using a microplate reader detected mutations was characterized by isolating 24 colonies every 200 generations (Tecan Infinite 200 Pro). The luminescence values were standardized by cell over the course of the experiment and amplifying a B700-bp PCR product density, determined by dilution plating. containing the putative single nucleotide polymorphism (SNP) from each isolate. PCR products were directly sequenced by the McGill University and Genome Quebec Innovation Centre. We probed for the large 35,107 bp deletion in each Inducible gene expression constructs. Regulated expression of gtsB and isolate by characterizing them as motile (ancestral state) versus non-motile gtsABCD-oprB by the Ptac promoter was achieved using mini-Tn7T-LAC 35 (evolved state) on semi-solid agar plates, a trait associated with this deletion. constructs . A 1-kb fragment containing the gtsB open reading frame and 53-bp of upstream sequence was amplified with primers SacI-F2-Tac and XhoI-R1-Tac, digested with SacI and XhoI and cloned into the corresponding sites of pUC18- Allelic replacement constructs. The gtsB synonymous mutations (A15A and mini-Tn7T-LAC to generate pAH308. The 5.8-kb gtsABCD-oprB fragment was G38G) were individually introduced into SBW25 using a previously described amplified with primers SacI-F1-Tac and NheI-R3-Tac and included sequences allelic exchange method involving the pUIC3 vector32,33. PCR fragments from 31-bp upstream of the gtsA start codon to 32-bp downstream of the oprB stop containing the mutations and 1-kb of flanking sequence on each side were codon. The product was digested with SacI and NheI and cloned into the amplified using primers 4845-BglII-F and 4845-AvrII-R from chromosomal DNA compatible SacI and SpeI sites of pUC18-mini-Tn7T-LAC to generate pAH305. isolated from the evolved bacteria. The DNA was digested with BglII and AvrII and Transposition of the expression constructs to the SBW25 attTn7 site was cloned into the compatible BglII and SpeI sites of pUIC3 to generate pUIC3-A15A performed as described for the luciferase fusions. The fitness effects of inducing and pUIC3-G38G. The plasmids were mobilized into SBW25 by triparental mating the gtsB and gtsABCD-oprB genes were measured via 48 h head-to-head with the help of pRK2013. Exconjugates carrying the plasmid integrated by a single competitions against SBW25-lacZ mini-Tn7T-LAC under inducing (1 mM IPTG) homologous recombination were selected on LB agar with Nf and Tc. To allow for and non-inducing (no IPTG) conditions. plasmid excision by a second homologous recombination, bacteria were grown for two 24 h subcultures in LB broth, and plated on LB agar containing X-gal32. The rare white colonies do not express pUIC3-encoded lacZ and were screened for Codon bias estimates and mRNA structure comparisons. To look for tetracycline sensitivity to verify loss of the plasmid backbone. The gtsB locus of potentially important changes in codon bias as a result of the two synonymous independent white colonies was sequenced to identify clones with the desired mutations, we compared the codon usage of highly expressed genes in SBW25 SNPs. to codon usage within the gtsB gene using the codon adaptation index37. We used Additional gtsB mutations (A10T and DgtsB) and the crc (PFLU5989) and the SBW25 ribosomal protein genes as our sample of highly expressed genes. hfq (PFLU0520) deletions were recombined into P. fluorescens using a pUIC3 To calculate change in codon adaptation index caused by each mutation, we used

6 NATURE COMMUNICATIONS | 5:4076 | DOI: 10.1038/ncomms5076 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms5076 ARTICLE

38 39 the ‘cai’ function in the ‘seqinr’ package in R. We used ‘mfold’ to predict and 25. Rojo, F. Carbon catabolite repression in Pseudomonas: optimizing metabolic compare mRNA structure and stability of the ancestral gtsB gene and the three versatility and interactions with the environment. FEMS Microbiol. Rev. 34, mutated versions. 658–684 (2010). 26. Browne, P., Barret, M., O’Gara, F. & Morrissey, J. P. Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of References catabolite repression control in Pseudomonas bacteria. BMC Microbiol. 10, 300 (2010). 1. Sharp, P. M., Bailes, E., Grocock, R. J., Peden, J. F. & Sockett, R. E. Variation in 27. Gottesman, S. & Storz, G. Bacterial small RNA regulators: versatile roles and the strength of selected codon usage bias among bacteria. Nucleic Acids Res. 33, rapidly evolving variations. Cold Spring Harb. Perspect. Biol. 3, a003798 (2011). 1141–1153 (2005). 28. De Lay, N., Schu, D. J. & Gottesman, S. Bacterial small RNA-based negative 2. Kudla, G., Murray, A. W., Tollervey, D. & Plotkin, J. B. Coding-sequence regulation: Hfq and its accomplices. J. Biol. Chem. 288, 7996–8003 (2013). determinants of gene expression in Escherichia coli. Science 324, 255–258 29. Choi, K. H., Kumar, A. & Schweizer, H. P. A 10-min method for preparation of (2009). highly electrocompetent Pseudomonas aeruginosa cells: application for DNA 3. Agashe, D., Martinez-Gomez, N. C., Drummond, D. A. & Marx, C. J. Good fragment transfer between chromosomes and plasmid transformation. codons, bad transcript: large reductions in gene expression and fitness arising J. Microbiol. Methods 64, 391–397 (2006). from synonymous mutations in a key enzyme. Mol. Biol. Evol. 30, 549–560 30. Sambrook, J. & Russell, D. W. Molecular Cloning: a Laboratory Manual 3rd edn (2013). (Cold Spring Harbor Laboratory Press, 2001). 4. Plotkin, J. B. & Kudla, G. Synonymous but not the same: the causes and 31. Dettman, J. R. et al. Evolutionary insight from whole-genome sequencing of consequences of codon bias. Nat. Rev. Genet. 12, 32–42 (2011). experimentally evolved microbes. Mol. Ecol. 21, 2058–2077 (2012). 5. Shabalina, S. A., Spiridonov, N. A. & Kashina, A. Sounds of silence: 32. Goymer, P. et al. Adaptive divergence in experimental populations of synonymous nucleotides as a key to biological regulation and complexity. Pseudomonas fluorescens. II. Role of the GGDEF regulator WspR in evolution Nucleic Acids Res. 41, 2073–2094 (2013). and development of the wrinkly spreader phenotype. Genetics 173, 515–526 6. Kimchi-Sarfaty, C. et al. A ‘silent’ polymorphism in the MDR1 gene changes (2006). substrate specificity. Science 315, 525–528 (2007). 33. Rainey, P. B. Adaptation of Pseudomonas fluorescens to the plant rhizosphere. 7. Zhang, G., Hubalewska, M. & Ignatova, Z. Transient ribosomal attenuation Environ. Microbiol. 1, 243–257 (1999). coordinates protein synthesis and co-translational folding. Nat. Struct. Mol. 34. Hoang, T. T., Karkhoff-Schweizer, R. R., Kutchma, A. J. & Schweizer, H. P. A Biol. 16, 274–280 (2009). broad-host-range Flp-FRT recombination system for site-specific excision of 8. Carlini, D. B. Experimental reduction of codon bias in the Drosophila alcohol chromosomally-located DNA sequences: application for isolation of unmarked dehydrogenase gene results in decreased ethanol tolerance of adult flies. J. Evol. Pseudomonas aeruginosa mutants. Gene 212, 77–86 (1998). Biol. 17, 779–785 (2004). 35. Choi, K. H. et al. A Tn7-based broad-range bacterial cloning and expression 9. Lind, P. A., Berg, O. G. & Andersson, D. I. Mutational robustness of ribosomal system. Nat. Methods 2, 443–448 (2005). protein genes. Science 330, 825–827 (2010). 36. Choi, K. H. & Schweizer, H. P. mini-Tn7 insertion in bacteria with single 10. Cuevas, J. M., Domingo-Calap, P. & Sanjuan, R. The fitness effects of attTn7 sites: example Pseudomonas aeruginosa. Nat. Protoc. 1, 153–161 (2006). synonymous mutations in DNA and RNA viruses. Mol. Biol. Evol. 29, 17–20 37. Sharp, P. M. & Li, W. H. The codon Adaptation Index--a measure of (2012). directional synonymous codon usage bias, and its potential applications. 11. Schenk, M. F., Szendro, I. G., Krug, J. & de Visser, J. A. Quantifying the Nucleic Acids Res. 15, 1281–1295 (1987). adaptive potential of an antibiotic resistance enzyme. PLoS Genet. 8, e1002783 38. Charif, D. & Lobry, J. R. in Structural Approaches to Sequence Evolution: (2012). Molecules, Networks, Populations (eds Bastolla, U., Porto, M., Roman, H. E. & 12. Hershberg, R. & Petrov, D. A. Selection on codon bias. Annu. Rev. Genet. 42, Vendruscolo, M.) 207–232 (Springer Verlag, 2007). 287–299 (2008). 39. Zuker, M. Mfold web server for nucleic acid folding and hybridization 13. Akashi, H. Molecular evolution between Drosophila melanogaster and D. prediction. Nucleic Acids Res. 31, 3406–3415 (2003). simulans: reduced codon bias, faster rates of amino acid substitution, and larger 40. Schneider, E. ABC transporters catalyzing carbohydrate uptake. Res. Microbiol. proteins in D. melanogaster. Genetics 144, 1297–1307 (1996). 152, 303–310 (2001). 14. McVean, G. A. & Vieira, J. Inferring parameters of mutation, selection and demography from patterns of synonymous site evolution in Drosophila. Genetics 157, 245–257 (2001). Acknowledgements 15. Haddrill, P. R., Zeng, K. & Charlesworth, B. Determinants of synonymous and This work was supported by grants from the Natural Sciences and Engineering Research nonsynonymous variability in three species of Drosophila. Mol. Biol. Evol. 28, Council (Canada) to S.F.B. and R.K., an Ontario Graduate Scholarship to S.F.B. and a 1731–1743 (2011). grant from the Canadian Institutes of Health Research to R.K. Thanks also to Alex 16. Lawrie, D. S., Messer, P. W., Hershberg, R. & Petrov, D. A. Strong purifying Poulain for technical assistance and discussions, to the Rainey Lab for providing a selection at synonymous sites in D. melanogaster. PLoS Genet. 9, e1003527 plasmid and methods for the allelic replacement experiments and to Nicolas Rodrigue for (2013). bioinformatics. 17. Conrad, T. M. et al. Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutations. Genome Biol. 10, R118 (2009). Author contributions 18. Barrick, J. E. et al. Genome evolution and adaptation in a long-term experiment S.F.B. and A.H. performed the experiments, and design, analysis and writing was with Escherichia coli. Nature 461, 1243–1247 (2009). done jointly with R.K. 19. Lang, G. I. et al. Pervasive genetic hitchhiking and clonal interference in forty evolving yeast populations. Nature 500, 571–574 (2013). Additional information 20. Bailey, S. F. & Kassen, R. Spatial structure of ecological opportunity drives Accession codes: The gtsB gene (PFLU4845) sequences reported in this paper have been adaptation in a bacterium. Am. Nat. 180, 270–283 (2012). deposited in the GenBank nucleotide database under the accession codes KJ787789 to 21. Hancock, R. E. & Carey, A. M. Protein D1 - a glucose-inducible, pore-forming KJ787791. protein from the outer membrane of Pseudomonas aeruginosa. FEMS Microbiol. Lett. 8, 105–109 (1980). Supplementary Information accompanies this paper at http://www.nature.com/ 22. Wylie, J. L. & Worobec, E. A. Substrate specificity of the high-affinity glucose naturecommunications transport system of Pseudomonas aeruginosa. Can. J. Microbiol. 39, 722–725 (1993). Competing financial interests: The authors declare no competing financial interests. 23. del Castillo, T. et al. Convergent peripheral pathways catalyze initial glucose Reprints and permission information is available online at http://npg.nature.com/ catabolism in Pseudomonas putida: genomic and flux analysis. J. Bacteriol. 189, reprintsandpermissions/ 5142–5152 (2007). 24. del Castillo, T., Duque, E. & Ramos, J. L. A set of activators and repressors How to cite this article: Bailey, S. F. et al. Adaptive synonymous mutations in an control peripheral glucose pathways in Pseudomonas putida to yield a common experimentally evolved Pseudomonas fluorescens population. Nat. Commun. 5:4076 central intermediate. J. Bacteriol. 190, 2331–2339 (2008). doi: 10.1038/ncomms5076 (2014).