Molecular Genetics

Total Page:16

File Type:pdf, Size:1020Kb

Load more

GENETICS AND PATTERNS OF INHERITANCE Simon Petersen-Jones DVetMed PhD DVOphthal MRCVS DECVO Department of Small Animal Clinical Science Michigan State University Veterinary Medical Center 736 Wilson Road, D-208 East Lansing. MI 48824 [email protected] INTRODUCTION The genome contains a complete set of instructions to make an organism and control its cellular structures and activities. This information, or genome, is contained within tightly coiled threads of deoxyribonucleic acid (DNA) found in the nucleus of every cell. The DNA is divided into chromosomes. The human genome consists of about 3 billion basepairs (Mb) (dog genome consists of 2.4Mb) and disease may result from an alteration of just one of those basepairs. It is estimated that the human genome contains in the region of 20, - 25,000 genes, whereas the dog is estimated to have only ~19,000 genes. Each gene carries the code for making a particular protein. Only a subset of the total number of genes will be functional in a particular cell type. Certain genes, known as house-keeping genes are expressed in all cell types and are needed for cell function. Other genes are tissue or cell-type specific. Although 20 –25,000 may seem a small number of genes to encode for and control the functions of a complex organism, further complexity if provided by a process of alternative spicing of genes. Alternative splicing between different tissues allows the same gene to produce differing proteins dependent on the tissue in which the gene is active. From http://www.exonhit.com/alternativesplicing/index.html - see this web page for more information on alternative splicing. Disease states are all influenced by genetic makeup. Some conditions result primarily from genetically determined factors (e.g. gene mutations). Although the animal’s genes (genotype) may dictate that it develops a disease, the actual characteristics of the disease (disease phenotype) i.e. how the disease is expressed in that individual (such as age of onset, rate of progression) may be influenced by environmental factors. Conversely diseases that at first glance appear totally environmental, such as infections with microorganisms are in fact influenced by genetic factors (e.g. factors that confer disease resistance). The situation may be further complicated when it is appreciated that expression of even simply inherited traits can be modified by “background genetics”. Basically this means that a variation (mutation) of one gene is the cause of the disease, but DNA variations elsewhere (at a modifying locus, or loci) influence the expression of the disease trait. 1 Perhaps the modifying locus encodes a protein that interacts with the disease protein or can render the animal relatively resistant to the effects of the mutation. DNA STRUCTURE DNA strands consist of repeating nucleotide units consisting of a phosphate group, a sugar (deoxyribose for DNA) and a base (adenine, cytosine, guanine or thymine). The DNA molecules consist of 2 strands that wrap around each other as a double helix. The two strands are joined by hydrogen bonds between the bases. Adenine (A) joins to thymine (T) and cytosine (C) to guanine (G) and thus the two strands are complementary to each other. 2 Note the different directionality of each strand – one runs from 5’ to 3’ and the complementary strand runs from 3’ to 5’. 3’ or 5’ refers to the number of the carbon atom of the deoxyribose sugar that forms a phosphodiester bond with the next sugar, as shown below. Folding of DNA to form a chromosome: The double helix of DNA is wrapped around 8 histone proteins in 2 loops. The length of the double loop is 146 nucleotides. This structure is known as a nucleosome. The DNA strand between adjacent 3 nucleosomes is about 60 basepairs long. The nucleosomes in turn wind into a cable 3 times thicker than the individual nucleosome. Each turn of the cable has about 6 nucleosomes. This cable is known as a chromatin fiber and this is resolvable by EM. During the metaphase stage of cell division the chromosomes become condensed. The chromatin fibers are looped around a central scaffold. Each loop is about 75,000 bp (75kb) long. These are then coiled to form the chromatids. NB: The significance of the nucleosome is that when a cell undergoes apoptosis (programmed cell death) the inter nucleosome DNA is cut. This results in cut sections of DNA each of which is a multiple of 180bp. This can be demonstrated on an agarose gel where a series of bands at 180bp, 360bp, 540bp…… can be seen, and indicates that apoptosis has occurred. Apoptosis plays a crucial role in the development of many structures including the retina. For example, developing retinal neurons that do not develop neuronal connections will be disposed of by apoptosis. Apoptosis also plays a role in death of cells during disease processes. Examples of this are death by apoptosis of photoreceptors of animals suffering from hereditary retinal dystrophies (e.g. PRA), and of ganglion cells in glaucoma. Several pathways can feed into the end result of apoptosis of the cell. There are currently investigations of experimental treatments to inhibit apoptosis as a way of saving photoreceptors in animals suffering from hereditary retinal dystrophies. CHROMOSOMES The DNA of the genome is divided into portions – the chromosomes. The nuclei of non-gametes have a diploid (2n) number of chromosomes. This means that there are 2 copies of each chromosome. The gametes (ova or sperm) are haploid (n) and have one copy of each chromosome. A normal diploid genome consists of two sex chromosomes and a number of autosomes (non-sex chromosomes). The number of autosomes varies between species. Chromosome number of different species: Species Diploid number Human 46 Dog 78 Cat 38 Horse 64 Donkey 62 Sheep 54 Cow 60 Pig 38 Rabbit 44 Mouse 40 The ends of the chromosomes are known as telomeres. These have repeated DNA elements and act to protect the chromosome from degradation during DNA replications. GENES Genes are lengths of DNA that code for individual proteins. The coding portion of genes only makes up a small percentage of the total DNA of the genome (c. 5%). The coding portions of the genes are split into segments called exons separated by noncoding intervening sequences called introns. The coding of genes is discussed under translation below. NON-CODING DNA The non-coding DNA serves many functions some of which are only relatively recently recognized. In addition to non-coding RNA such as transfer-RNA and ribosomal-RNA, microRNAs and long non-coding RNA has been identified. Micro-RNAs have a role in controlling translational activity of some genes. The functions of long non-coding RNAs (of which there are thousands) are not fully understood but some have been shown to have regulatory roles in gene transcription and mechanisms such as imprinting and X-chromosome inactivation. Having previously been described as “junk DNA” the functions of these non-coding regions and role in disease processes are becoming better understood. 4 TRANSCRIPTION & TRANSLATION The copying of DNA of a gene into RNA is called transcription. The messenger RNA transports the genetic message out of the nucleus to the cytoplasm where proteins are made by the translation of the genetic code. The mRNA codes for a specific order of specific amino acids. From the start site of translation the code is read in three basepairs units (a codon), one per amino acid. This coding can be likened to a series of three letter words. The following shows the effect if one letter (basepair) is missing, this is known as a deletion and results in a reading frame shift (the message is incorrect following the site of the deletion): Wild type: THE ONE RED EYE WAS OUT TOO FAR 1 basepair deletion: THE ONR EDE YEW ASO UTT OOF One amino acid may be coded for by up to 4 different triplets of basepairs (codons). The first two basepairs of the codon coding for any given amino acid are the same, the last basepair is the variable one (e.g. Alanine is coded for by: GCT, GCC, GCA or GCG). Three different triplets code for the end of the amino acid chain (stop codons TGA, TAG or TAA). RNA is in many ways similar to DNA except: • It is single stranded • The backbone sugar is ribose not deoxyribose • RNA uses the pyrimidine base uracil where DNA uses thymine Transcription is a complex process under precise control with a number of proteins controlling the rate of transcription. These proteins interact with DNA sequences of the gene promoter. The entire system ensures that the appropriate protein is produced in the correct cell type and at the correct stage of life. The initiation of translation is when a TATA binding protein binds to a TATA sequence (TATA box) in the promoter. Other factors bind and interact with enhancer and silencer regions of the promoter. Finally RNA polymerase joins and transcription can start. The DNA is unwound and a complementary RNA copy is made of the coding strand of the DNA (the non-coding, complementary strand is not copied). The following shows a complementary strand of RNA: GGTTACCATTAACGAT - DNA sense strand CCAAUGGUAAUUGCUA - mRNA As mRNA is being formed the noncoding interruptions of the message (the introns) are spliced out. Introns start and end with a characteristic pair of bases (GT at the beginning and AG at the end). The intron/exon boundaries are known as the splice sites. A mutation at a splice site could mean that the intron is not removed from the mRNA or that an exon is cut out of the mRNA (either would completely alter the message).
Recommended publications
  • Polymorphisms of the BARX1 and ADAMTS17 Locus Genes in Individuals with Gastroesophageal Reflux Disease

    Polymorphisms of the BARX1 and ADAMTS17 Locus Genes in Individuals with Gastroesophageal Reflux Disease

    J Neurogastroenterol Motil, Vol. 25 No. 3 July, 2019 pISSN: 2093-0879 eISSN: 2093-0887 https://doi.org/10.5056/jnm18183 JNM Journal of Neurogastroenterology and Motility Original Article Polymorphisms of the BARX1 and ADAMTS17 Locus Genes in Individuals With Gastroesophageal Reflux Disease Alexandra Argyrou,1 Evangelia Legaki,1 Christos Koutserimpas,2 Maria Gazouli,1* Ioannis Papaconstantinou,3 George Gkiokas,3 and George Karamanolis4 1Department of Basic Medical Sciences, Laboratory of Biology, School of Medicine, National and Kapodistrian University of Athens, Athens, Greece; 22nd Department of General Surgery, “Sismanoglio General Hospital of Athens, Athens, Greece; 32nd Department of Surgery, School of Medicine, National and Kapodistrian University of Athens, Athens, Greece; and 4Gastroenterology Unit, 2nd Department of Surgery, School of Medicine, National and Kapodistrian University of Athens, Athens, Greece Background/Aims Gastroesophageal reflux disease (GERD) represents a common condition having a substantial impact on the patients’ quality of life, as well as the health system. According to many studies, the BARX1 and ADAMTS17 genes have been suggested as genetic risk loci for the development of GERD and its complications. The purpose of this study is to investigate the potential association between GERD and BARX1 and ADAMTS17 polymorphisms. Methods The present is a prospective cohort study of 160 GERD patients and 180 healthy control subjects of Greek origin, examined for BARX1 and ADAMTS17 polymorphisms (rs11789015 and rs4965272) and a potential correlation to GERD. Results The rs11789015 AG and GG genotypes were found to be significantly associated with GERD (P = 0.032; OR, 1.65; 95% CI, 1.06- 2.57 and P = 0.033; OR, 3.00; 95% CI, 1.15-7.82, respectively), as well as the G allele (P = 0.007; OR, 1.60; 95% CI, 1.14- 2.24).
  • Gene Linkage and Genetic Mapping 4TH PAGES © Jones & Bartlett Learning, LLC

    Gene Linkage and Genetic Mapping 4TH PAGES © Jones & Bartlett Learning, LLC

    © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION Gene Linkage and © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 4NOTGenetic FOR SALE OR DISTRIBUTIONMapping NOT FOR SALE OR DISTRIBUTION CHAPTER ORGANIZATION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR4.1 SALELinked OR alleles DISTRIBUTION tend to stay 4.4NOT Polymorphic FOR SALE DNA ORsequences DISTRIBUTION are together in meiosis. 112 used in human genetic mapping. 128 The degree of linkage is measured by the Single-nucleotide polymorphisms (SNPs) frequency of recombination. 113 are abundant in the human genome. 129 The frequency of recombination is the same SNPs in restriction sites yield restriction for coupling and repulsion heterozygotes. 114 fragment length polymorphisms (RFLPs). 130 © Jones & Bartlett Learning,The frequency LLC of recombination differs © Jones & BartlettSimple-sequence Learning, repeats LLC (SSRs) often NOT FOR SALE OR DISTRIBUTIONfrom one gene pair to the next. NOT114 FOR SALEdiffer OR in copyDISTRIBUTION number. 131 Recombination does not occur in Gene dosage can differ owing to copy- Drosophila males. 115 number variation (CNV). 133 4.2 Recombination results from Copy-number variation has helped human populations adapt to a high-starch diet. 134 crossing-over between linked© Jones alleles. & Bartlett Learning,116 LLC 4.5 Tetrads contain© Jonesall & Bartlett Learning, LLC four products of meiosis.
  • Resistance to HIV (Exercise)

    Resistance to HIV (Exercise)

    1 Evolution in fast motion – Resistance to HIV (Exercise) Resistance to HIV In the early 1990s, a number of studies revealed that some people – although they had repeatedly contact with HIV – did not become carriers of HIV or, in the case of a confirmed HIV-infection, showed a delayed onset of the disease (AIDS) (a delay of several years was reported). First attempts to explain these phenomena were observed a few years later, when scientists identified important co-receptor molecules on the surface of the host cells, which are essential for HIV to infect the host cell. Scientists assumed that resistant persons may carry an aberrant version of the co-receptor molecule, which makes it impossible for the virus to enter the host cell. Such a co-receptor is the chemokine co-receptor CCR5, which is normally involved in the host’s immune answer (Dean & O’Brien, 1998). In order to test their hypothesis, the scientists sequenced the genes which code for the co- receptor CCR5. They investigated more than 700 samples from HIV-infected patients and compared them with the CCR5-sequences from more than 700 healthy persons. The results of the DNA-sequencing revealed mutations in the CCR5-gene in HIV-infected persons with a delayed onset of AIDS, as well as in some samples of healthy persons (but not in HIV- patients with typical onset of AIDS) (Samson et al., 1996). Exercises 1. In material 1, you can find two CCR5-gene-sequences selected from the data set of the scientists. Compare the sequences and a. find out where the mutation is (identify the position and label it in both! sequences).
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2

    Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2

    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
  • Sequence Analysis of Familial Neurodevelopmental Disorders

    Sequence Analysis of Familial Neurodevelopmental Disorders

    SEQUENCE ANALYSIS OF FAMILIAL NEURODEVELOPMENTAL DISORDERS by Joseph Mark Tilghman A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland December 2020 © 2020 Joseph Tilghman All Rights Reserved Abstract: In the practice of human genetics, there is a gulf between the study of Mendelian and complex inheritance. When diagnosis of families affected by presumed monogenic syndromes is undertaken by genomic sequencing, these families are typically considered to have been solved only when a single gene or variant showing apparently Mendelian inheritance is discovered. However, about half of such families remain unexplained through this approach. On the other hand, common regulatory variants conferring low risk of disease still predominate our understanding of individual disease risk in complex disorders, despite rapidly increasing access to rare variant genotypes through sequencing. This dissertation utilizes primarily exome sequencing across several developmental disorders (having different levels of genetic complexity) to investigate how to best use an individual’s combination of rare and common variants to explain genetic risk, phenotypic heterogeneity, and the molecular bases of disorders ranging from those presumed to be monogenic to those known to be highly complex. The study described in Chapter 2 addresses putatively monogenic syndromes, where we used exome sequencing of four probands having syndromic neurodevelopmental disorders from an Israeli-Arab founder population to diagnose recessive and dominant disorders, highlighting the need to consider diverse modes of inheritance and phenotypic heterogeneity. In the study described in Chapter 3, we address the case of a relatively tractable multifactorial disorder, Hirschsprung disease.
  • Systematic Data-Querying of Large Pediatric Biorepository Identifies Novel Ehlers-Danlos Syndrome Variant Akshatha Desai1, John J

    Systematic Data-Querying of Large Pediatric Biorepository Identifies Novel Ehlers-Danlos Syndrome Variant Akshatha Desai1, John J

    Desai et al. BMC Musculoskeletal Disorders (2016) 17:80 DOI 10.1186/s12891-016-0936-8 RESEARCH ARTICLE Open Access Systematic data-querying of large pediatric biorepository identifies novel Ehlers-Danlos Syndrome variant Akshatha Desai1, John J. Connolly1, Michael March1, Cuiping Hou1, Rosetta Chiavacci1, Cecilia Kim1, Gholson Lyon1, Dexter Hadley1 and Hakon Hakonarson1,2* Abstract Background: Ehlers Danlos Syndrome is a rare form of inherited connective tissue disorder, which primarily affects skin, joints, muscle, and blood cells. The current study aimed at finding the mutation that causing EDS type VII C also known as “Dermatosparaxis” in this family. Methods: Through systematic data querying of the electronic medical records (EMRs) of over 80,000 individuals, we recently identified an EDS family that indicate an autosomal dominant inheritance. The family was consented for genomic analysis of their de-identified data. After a negative screen for known mutations, we performed whole genome sequencing on the male proband, his affected father, and unaffected mother. We filtered the list of non- synonymous variants that are common between the affected individuals. Results: The analysis of non-synonymous variants lead to identifying a novel mutation in the ADAMTSL2 (p. Gly421Ser) gene in the affected individuals. Sanger sequencing confirmed the mutation. Conclusion: Our work is significant not only because it sheds new light on the pathophysiology of EDS for the affected family and the field at large, but also because it demonstrates the utility of unbiased large-scale clinical recruitment in deciphering the genetic etiology of rare mendelian diseases. With unbiased large-scale clinical recruitment we strive to sequence as many rare mendelian diseases as possible, and this work in EDS serves as a successful proof of concept to that effect.
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com

    Análise Integrativa De Perfis Transcricionais De Pacientes Com

    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
  • Integrating Genetic Linkage Maps with Pachytene Chromosome Structure in Maize

    Integrating Genetic Linkage Maps with Pachytene Chromosome Structure in Maize

    Copyright 2004 by the Genetics Society of America Integrating Genetic Linkage Maps With Pachytene Chromosome Structure in Maize Lorinda K. Anderson,*,1 Naser Salameh,† Hank W. Bass,‡ Lisa C. Harper,§ W. Z. Cande,§ Gerd Weber† and Stephen M. Stack* *Department of Biology, Colorado State University, Fort Collins, Colorado 80523, †Department of Plant Breeding and Biotechnology, University of Hohenheim, D-70593 Stuttgart, Germany, ‡Department of Biological Science, Florida State University, Tallahassee, Florida 32306 and §Department of Molecular and Cell Biology, University of California, Berkeley, California 94720 Manuscript received November 4, 2003 Accepted for publication January 9, 2004 ABSTRACT Genetic linkage maps reveal the order of markers based on the frequency of recombination between markers during meiosis. Because the rate of recombination varies along chromosomes, it has been difficult to relate linkage maps to chromosome structure. Here we use cytological maps of crossing over based on recombination nodules (RNs) to predict the physical position of genetic markers on each of the 10 chromosomes of maize. This is possible because (1) all 10 maize chromosomes can be individually identified from spreads of synaptonemal complexes, (2) each RN corresponds to one crossover, and (3) the frequency of RNs on defined chromosomal segments can be converted to centimorgan values. We tested our predic- tions for chromosome 9 using seven genetically mapped, single-copy markers that were independently mapped on pachytene chromosomes using in situ hybridization. The correlation between predicted and observed locations was very strong (r2 ϭ 0.996), indicating a virtual 1:1 correspondence. Thus, this new, high-resolution, cytogenetic map enables one to predict the chromosomal location of any genetically mapped marker in maize with a high degree of accuracy.
  • An ADAMTS17 Splice Donor Site Mutation in Dogs with Primary Lens Luxation

    An ADAMTS17 Splice Donor Site Mutation in Dogs with Primary Lens Luxation

    Lens An ADAMTS17 Splice Donor Site Mutation in Dogs with Primary Lens Luxation Fabiana H. G. Farias,1 Gary S. Johnson,1 Jeremy F. Taylor,2 Elizabeth Giuliano,3 Martin L. Katz,1,4 Douglas N. Sanders,4 Robert D. Schnabel,2 Stephanie D. McKay,2 Shahnawaz Khan,1 Puya Gharahkhani,5 Caroline A. O’Leary,5 Louise Pettitt,6 Oliver P. Forman,6 Mike Boursnell,6 Bryan McLaughlin,6 Saija Ahonen,7,8 Hannes Lohi,7,8 Elena Hernandez-Merino,9 David J. Gould,10 David R. Sargan,9 and Cathryn Mellersh6 PURPOSE. To identify the genetic cause of isolated canine ADAMTS17 mutation was significantly associated with clin- ectopia lentis, a well-characterized veterinary disease com- ical PLL in three different dog breeds. monly referred to as primary lens luxation (PLL) and to CONCLUSIONS. A truncating mutation in canine ADAMTS17 compare the canine disease with a newly described human causes PLL, a well-characterized veterinary disease, which can Weill-Marchesani syndrome (WMS)–like disease of similar now be compared to a recently described rare WMS-like dis- genetic etiology. ease caused by truncating mutations of the human ADAMTS17 METHODS. Genomewide association analysis and fine mapping ortholog. (Invest Ophthalmol Vis Sci. 2010;51:4716–4721) by homozygosity were used to identify the chromosomal seg- DOI:10.1167/iovs.09-5142 ment harboring the PLL locus. The resequencing of a regional candidate gene was used to discover a mutation in a splice donor site predicted to cause exon skipping. Exon skipping cular lenses are held in place behind the pupil by zonular was confirmed by reverse transcription-polymerase chain reac- Ofibers that link the capsule of the lens near its equator to 1 tion amplification of RNA isolated from PLL-affected eyes and the surrounding ciliary muscle.
  • Lecture 1 1. to Understand the Flow of Biochemical Information from DNA to RNA to Proteins and Ultimately to Biochemical And

    Lecture 1 1. to Understand the Flow of Biochemical Information from DNA to RNA to Proteins and Ultimately to Biochemical And

    Lecture 1 1. To understand the flow of biochemical information from DNA to RNA to proteins and ultimately to biochemical and cellular function and dysfunction (disease) Central Dogma: DNARNAProteinPhenotype NucleotidegeneDNAchromosomegenome - In reality it is much more complex DNA sequence RNA sequence Protein sequence Protein structure Protein function RNA structure RNA function Know: - Structure of DNA/RNA and proteins - Intermolecular interactions: o Hydrogen bonds o Disulfur bonds o Ion bonds o Polar bonds - Main aspects of the central dogma o Translation (at the ribosome) o Transcription o Genetic code DNA structure: - Sugar-phosphate backbone - 4 bases o A/G = purines o T/C = pyrimidines o A-T and G-C - 5’-3’ antiparallel (always read 5’3’) o Addition occurs at the 3’ end o 5’ position to commence reading depends on promotor o Reading frame depends on promotor - Coding and template strand: o Depends on the position of the promotor RNA structure: - U replaces T - Self-complementarity = annealing of strand to itself - tRNA/mRNA/pre-RNA - Spliced (exons remain) to form mature RNA Therefore 6: - 3 from the codon from the top 5’ end, 3 from the codon from the bottom 5’ end. Protein Structure: Chemical Properties Depends on N or C-terminus, peptide bonds and side chains - Non-polar aliphatic - Polar but uncharged - Aromatic - Positively charged - Negatively charged pKa = pH at which the protein has a charge of zero. Alpha-helices: side chains point sideways Beta-helices: - Parallel and anti-parallel to produce alternate the direction the side chains point - In reality, there is a combination of parallel and anti-parallel side chains - Different bonds between NH and CO groups in each direction of side chain Sample Question 1.
  • IGA 8/E Chapter 8

    IGA 8/E Chapter 8

    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.