US 2006OO63150A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0063150 A1 Iversen et al. (43) Pub. Date: Mar. 23, 2006

(54) ANTISENSE ANTIVIRAL COMPOUND AND Publication Classification METHOD FOR TREATING SSRNA WRAL INFECTION (51) Int. Cl. CI2O 1/70 (2006.01) G06F I9/00 (2006.01) (76) Inventors: Patrick L. Iversen, Corvallis, OR CI2P 1934 (2006.01) A6IK 4800 (2006.01) (US); David A. Stein, Corvallis, OR (52) U.S. Cl...... 435/5; 435/912; 514/44; 702/20; (US) 514/81

Correspondence Address: (57) ABSTRACT PERKINS COE LLP The invention provides antisense antiviral compounds and P.O. BOX 21.68 methods of their use and production in inhibition of growth MENLO PARK, CA 94026 (US) of viruses of the Flaviviridae, Picornoviridae, Caliciviridae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae and (21) Appl. No.: 11/226,995 Hepeviridae families in the treatment of a viral infection. The antisense antiviral compounds are Substantially (22) Filed: Sep. 14, 2005 uncharged morpholino oligonucleotides having a Sequence of 12-40 Subunits, including at least 12 Subunits having a Related U.S. Application Data targeting Sequence that is complementary to a region asso ciated with Stem-loop Secondary Structure within the 5'-ter (60) Provisional application No. 60/611,063, filed on Sep. minal end 40 bases of the positive-sense RNA strand of the 16, 2004. WUS. Patent Application Publication Mar. 23, 2006 Sheet 1 of 12 US 2006/0063150 A1 ', , R Y- B O - O, 9 p CH2 m so O=P-R C=O m 's- 7B O NH O o O Fig. 1A Fig. 1B Fig. 1C

"loO O loO B m R. S O=s=O CH2 R 1. O B o O- B R. Ó

CH3. O=P-N, CH3 B

N Patent Application Publication Mar. 23, 2006 Sheet 2 of 12 US 2006/0063150 A1

z- 'O =-x ' { P N Fig. 2A Fig. 2B

N N ZP-X ) y Z-P-X Y ''' ": N N Patent Application Publication Mar. 23, 2006 Sheet 3 of 12 US 2006/006.3150 A1

Legend:stigiitigategiztigatzigzag HRV89 polyprotein rt ...t-r-t CBS.S., in - no w Fig. 3A-

rt Trrrrrrrrrrrrrt 7654 EenOnstructural58kd capsid pre-2EEE polyprotein yp Legend: Orf3s cera - CDS cea - gene r"T" -1000-2000. Fig d 3B

1mm - "9755 assessessessessite nonstructural pO E" Legend: mRNA-Subgenomic RNA.ii. cra - CDS m - RNA tra - gene Trrrrtm - 1000-2000, Fig. 3C

6

EE , -- polyprotein Legend:repeat region - repeat region" reca - CDS as - gene arms - other feature TTTTTTTT - 1000-2000. Fig. 3D

SCII 2737 Corries rececareplicase polyprotein areplicase Picas FIRpolyprotein 1ab an

Patent Application Publication Mar. 23, 2006 Sheet 5 of 12 US 2006/0063150 A1

Patent Application Publication Mar. 23, 2006 Sheet 6 of 12 US 2006/0063150 A1

8

-Q &c.

Patent Application Publication Mar. 23, 2006 Sheet 8 of 12 US 2006/0063150 A1 Patent Application Publication Mar. 23, 2006 Sheet 9 of 12 US 2006/0063150 A1 uoneo||des|-Naquo

Z

unjd Olfo

4034434oT.S.G.OWdDHS)QI(?g:ONuo Patent Application Publication Mar. 23, 2006 Sheet 10 of 12 US 2006/0063150 A1

E&::::::::: 34s &xisS& Patent Application Publication Mar. 23, 2006 Sheet 11 of 12 US 2006/0063150 A1

601 Patent Application Publication Mar. 23, 2006 Sheet 12 of 12 US 2006/0063150 A1

3 S S. C O (VS .9 s Y i le). Oulu.OO pejeanun %

Hs ./ O O O e s N

N O p N in O O 2. 2 O d Se a.

-go assessessr asses L?)

CO

Je). Oluod peee Jun / US 2006/OO63150 A1 Mar. 23, 2006

ANTISENSE ANTIVIRAL COMPOUND AND 0014) Moulton, H. M., M. H. Nelson, et al. (2004). METHOD FOR TREATING SSRNA WRAL “Cellular uptake of antisense morpholino oligomers con INFECTION jugated to arginine-rich peptides. Bioconjug Chem 15(2): 0001. This application claims priority to U.S. provisional 290-9. patent application No. 60/611,063 filed on Sep. 16, 2004, 0.015 Murray, R. and e. al. (1998). Medical Microbiol which is incorporated herein in its entirety by reference. ogy. St. Louis, Mo., Mosby Press: 542-543. FIELD OF THE INVENTION 0016) Neuman, B. W., D. A. Stein, et al. (2004). “Anti sense Morpholino-Oligomers Directed against the 5' End 0002 This invention relates to antisense oligonucleotide of the Genome Inhibit Coronavirus Proliferation and compounds for use in treating a Flavivirus, Hepacivirus, Growth dagger.' J. Virol. 78(11): 5891-5899. Enterovirus, Rhinovirus, Hepatovirus, Apthovirus, Hepevi rus, Coronavirus, Arterivirus, Vesivirus, Norovirus, 0017 O'Ryan, M. (1992). Clinical Virology Manual. S. Mamastrovirus, Alphavirus, and Rubivirus infection and Spector and G. Lancz. New York, Elsevier Science: antiviral treatment methods employing the compounds. 361-196. 0.018 Pardigon, N., E. Lenches, et al. (1993). “Multiple REFERENCES binding sites for cellular proteins in the 3' end of Sindbis 0003. The following references are related to the back alphavirus minus-sense RNA.'J Virol 67(8): 5003-11. ground or the invention. 0.019 Pardigon, N. and J. H. Strauss (1992). “Cellular 0004 Banerjee, R. and A. Dasgupta (2001). “Interaction proteins bind to the 3' end of Sindbis virus minus-strand of picornavirus 2C polypeptide with the Viral negative RNA. J Virol 66(2): 1007-15. strand RNA. J Gen Virol 82(Pt. 11): 2621-7. 0020 Paul, A. V. (2002). Possible unifying mechanism of 0005 Banerjee, R. and A. Dasgupta (2001). “Specific picornavirus genome replication. Molecular Biology of interaction of hepatitis C virus protease/helicase NS3 with Picornaviruses. B. L. Semler and E. Wimmer. Washing the 3'-terminal Sequences of Viral positive- and negative ton, D.C., ASM Press: 227-246. strand RNA. J Virol 75(4): 1708-21. 0021) Roehl, H. H., T. B. Parsley, et al. (1997). “Process 0006 Banerjee, R., A. Echeverri, et al. (1997). “Poliovi ing of a cellular polypeptide by 3CD proteinase is rus-encoded 2C polypeptide specifically binds to the required for poliovirus ribonucleoprotein complex forma 3'-terminal sequences of viral negative-strand RNA.J tion.”J Virol 71(1): 578-85. Virol 71(12): 9570-8. 0022 Roehl, H. H. and B. L. Semler (1995). “Poliovirus 0007 Banerjee, R., W. Tsai, et al. (2001). “Interaction of infection enhances the formation of two ribonucleopro poliovirus-encoded 2C/2BC polypeptides with the 3' ter tein complexes at the 3' end of Viral negative-Strand minus negative-Strand cloverleaf requires an intact Stem RNA. J Virol 69(5): 2954-61. loop b.”Virology 280(1): 41-51. 0023 Smith, A. W., D. E. Skilling, et al. (1998). “Cali 0008 Blommers, M. J., U. Pieles, et al. (1994). “An civirus emergence from Ocean reservoirs: Zoonotic and approach to the Structure determination of nucleic acid interspecies movements.” Emerg Infect Dis 4(1): 13-20. analogues hybridized to RNA. NMR studies of a duplex between 2'-OMe RNA and an oligonucleotide containing 0024 Summerton, J. and D. Weller (1997). “Morpholino a single amide backbone modification.'Nucleic Acids Res antisense oligomers: design, preparation, and properties 22(20): 4187-94. .'Antisense Nucleic Acid Drug Dev 7(3): 187-95. 0009 Gait, M. J., A. S. Jones, et al. (1974). “Synthetic 0.025 Xu, W.Y. (1991). “Viral haemorrhagic disease of analogues of polynucleotides XII. Synthesis of thymidine rabbits in the People's Republic of China: epidemiology derivatives containing an oxyacetamido- or an oxyforma and virus characterisation.'Rev Sci Tech 10(2): 393-408. mido-linkage instead of a phosphodiester group.'J Chem 0026. Zuker, M. (2003). “Mfold web server for nucleic Soc Perkin 10(14): 1684-6. acid folding and hybridization prediction.” Nucleic Acids 0010 Holland, J. (1993). Emerging Virus. S. S. Morse. Res 31(13): 3406-15. New York and Oxford, Oxford University Press: 203-218. BACKGROUND OF THE INVENTION 0011 Lesnikowski, Z. J., M. Jaworska, et al. (1990). "Octa(thymidine methanephosphonates) of partially 0027 Single-stranded RNA (ssRNA) viruses cause many defined stereochemistry: synthesis and effect of chirality diseases in wildlife, domestic animals and humans. These at phosphorus on binding to pentadecadeoxyriboadenylic Viruses are genetically and antigenically diverse, exhibiting broad tissue tropisms and a wide pathogenic potential. The acid."Nucleic Acids Res 18(8): 2109-15. incubation periods of Some of the most pathogenic viruses, 0012 Markoff, L. (2003). “5’- and 3'-noncoding regions e.g. the caliciviruses, are very short. Viral replication and in flavivirus RNA.A.d Virus Res 59: 177-228. expression of virulence factors may overwhelm early 0013 Mertes, M. P. and E. A. Coats (1969). “Synthesis of defense mechanisms (Xu 1991) and cause acute and severe carbonate analogs of dinucleosides. 3'-Thymidinyl 5'-thy Symptoms. midinyl carbonate, 3'-thymidinyl 5'-(5-fluoro-2'-deox 0028. There are no specific treatment regimes for many yuridinyl) carbonate, and 3'-(5-fluoro-2'-deoxyuridinyl) Viral infections. The infection may be Serotype specific and 5'-thymidinyl carbonate.”J Med Chem 12(1): 154-7. natural immunity is often brief or absent (Murray and al. US 2006/OO63150 A1 Mar. 23, 2006

1998). Immunization against these virulent viruses is 0038 (i) a nuclease-resistant backbone, impractical because of the diverse Serotypes. RNA virus replicative processes lack effective genetic repair mecha 0039 (ii) capable of uptake by mammalian host cells, nisms, and current estimates of RNA virus replicative error 0040 (iii) containing between 12-40 nucleotide bases, rates are Such that each genomic replication can be expected and to produce one to ten errors, thus generating a high number 0041 (iv) having a targeting Sequence of at least 12 of variants (Holland 1993). Often, the serotypes show no Subunits that is complementary to a region within the croSS protection Such that infection with any one Serotype 5'-terminal 40 bases of the positive-strand viral genome that does not protect against infection with another. For example, is capable of forming internal Stem-loop Secondary Struc vaccines against the vesivirus genus of the caliciviruses ture. The compound is effective, when administered to the would have to provide protection against over 40 different host cells, to form a heteroduplex structure (i) composed of neutralizing serotypes (Smith, Skilling et al. 1998) and the positive Sense Strand of the virus and the oligonucleotide vaccineS for the other genera of the Caliciviridae are compound, and (ii) characterized by a Tm of dissociation of expected to have the same limitations. at least 45 C. and disruption of Such stem-loop Secondary 0029. Thus, there remains a need for an effective antiviral Structure. The compound may be administered to a mam therapy in Several virus families, including Small, Single malian Subject infected with the Virus, or at risk of infection stranded, positive-sense RNA viruses in the Flaviviridae, with the virus. Picornoviridae, Caliciviridae, Togaviridae, Arteriviridae, 0042. The compound may be composed of morpholino Coronaviridae, Astroviridae or Hepeviridae families. Subunits linked by uncharged, phosphorus-containing inter Subunit linkages, joining a morpholino nitrogen of one SUMMARY OF THE INVENTION Subunit to a 5' exocyclic carbon of an adjacent Subunit. In 0030 The invention includes, in one aspect, a method of one embodiment, the interSubunit linkages are phospho producing an anti-Viral compound effective in inhibiting rodiamidate linkages, Such as those having the Structure: replication within a host cell of an RNA virus having a Single-Stranded, positive-Sense genome and Selected from one of the Flaviviridae, Picornoviridae, Caliciviridae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae or ZEP-X Hepeviridae families. The method includes first identifying as a viral target Sequence, a region within the 5'-terminal 40 bases of the positive Strand of the infecting virus whose Sequence is capable of forming internal Stem-loop Secondary Structure. There is then constructed, by Step-wise Solid phase Synthesis, an oligonucleotide analog compound char acterized by: 0031 (i) a nuclease-resistant backbone, 0032 (ii) capable of uptake by mammalian host cells, where Y=O, Z=O, P is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, 0033 (iii) containing between 12-40 nucleotide bases, to a base in a polynucleotide, and X is alkyl, alkoxy, and thioalkoxy, or alkyl amino, e.g., wherein X=NR, where 0034 (iv) having a targeting Sequence of at least 12 each R is independently hydrogen or methyl. Subunits that is complementary to the virus-genome region 0043. The compound may be a covalent conjugate of an capable of forming internal duplex Structure, and oligonucleotide analog moiety capable of forming Such a 0035 (v) an ability to form with the viral target sequence, heteroduplex Structure with the positive Sense Strand of the a heteroduplex structure (i) composed of the positive sense Virus, and an arginine-rich polypeptide effective to enhance Strand of the Virus and the oligonucleotide compound, and the uptake of the compound into host cells. (ii) characterized by a Tm of dissociation of at least 45 C. 0044) In a related aspect, the invention includes a het and disruption of Such stem-loop Structure. eroduplex complex formed between: 0.036 The target sequence may be identified by obtaining 0045 (a) a region within the 5'-terminal 40 bases of the analyzing the 5'-terminal Sequences, e.g., the 5'-terminal 40 positive strand RNA of an RNA virus having a single bases by a computer program capable of performing Sec Stranded, positive-Sense RNA genome and Selected from one ondary Structure predictions based on a Search for the of the Flaviviridae, Picornoviridae, Caliciviridae, Togaviri minimal free energy State of the input RNA sequence. dae, Arteriviridae, Coronaviridae, Astroviridae or Hepeviri 0037. The invention includes, in another aspect, a method dae families, which region is capable of forming internal of inhibiting in a mammalian host cell, replication of an Stem-loop Secondary Structure, and infecting RNA virus having a Single-Stranded, positive-Sense 0046 (b) an oligonucleotide analog compound charac genome and selected from one of the Flaviviridae, Picor noviridae, Caliciviridae, Togaviridae, Arteriviridae, Coro terized by: naviridae, Astroviridae or Hepeviridae families. The method 0047 (i) a nuclease-resistant backbone, includes administering to the infected host cells, a virus inhibitory amount of an oligonucleotide analog compound 0048 (ii) capable of uptake by mammalian host cells, characterized by: 0049 (iii) containing between 12-40 nucleotide bases, US 2006/OO63150 A1 Mar. 23, 2006

0050 (iv) having a targeting sequence of at least 12 duplex comprising the antisense oligonucleotide complexed Subunits that is complementary to a region associated with with a complementary-Sequence 5'-end region of the posi Such stem-loop Secondary Structure within the 5'-terminal tive-strand RNA of the virus. end 40 bases of the positive-sense RNA strand of the virus, 0055. In still another aspect, the invention includes an 0051 where said heteroduplex complex has a Tm of oligonucleotide analog compound for use in inhibiting rep lication in mammalian host cells of an RNA virus having a dissociation of at least 45 C. and disruption of Such Single-Stranded, positive-Sense RNA genome and Selected Stem-loop Secondary Structure. from the Flaviviridae, Picornoviridae, Caliciviridae, 0.052 An exemplary compound is composed of mor Togaviridae, or Coronaviridae families and hepatitis E Virus. pholino Subunits linked by uncharged, phosphorus-contain The compound is characterized by: ing interSubunit linkages, joining a morpholino nitrogen of 0056 (i) a nuclease-resistant backbone, one Subunit to a 5’ exocyclic carbon of an adjacent Subunit. The compound may have phosphorodiamidate linkages, 0057 (ii) capable of uptake by mammalian host cells, Such as in the Structure 0.058 (iii) containing between 12-40 nucleotide bases, 0059 (iv) having a targeting sequence of at least 12 Subunits that is complementary to a region associated with stem-loop secondary structure within the 5'-terminal end 40 bases of the positive-sense RNA strand of the virus, and 0060 (v) capable of forming with the positive-strand Viral SSRNA genome, a heteroduplex Structure having a Tm of dissociation of at least 45 C. and disruption of Such Stem-loop Secondary Structure. 0061 An exemplary compound is composed of mor pholino Subunits linked by uncharged, phosphorus-contain ing interSubunit linkages, joining a morpholino nitrogen of one Subunit to a 5’ exocyclic carbon of an adjacent Subunit. where Y=O, Z=O, P is a purine or pyrimidine base-pairing The compound may have phosphorodiamidate linkages, moiety effective to bind, by base-specific hydrogen bonding, Such as in the Structure to a base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, or alkyl amino. In a preferred compound, X=NR, where each R is independently hydrogen or methyl. The compound may be the oligonucleotide analog alone or a conjugate of the analog and an arginine-rich polypeptide ZEP-X capable of enhancing the uptake of the compound into host l, cells. Pi 0053. The invention is also directed to a method for detecting the presence of a viral infection by an RNA virus having a single-Stranded, positive-Sense RNA genome and N Selected from one of the Flaviviridae, Picornoviridae, Cali civiridae, Togaviridae, Arteriviridae, Coronaviridae, Astro Viridae or Hepeviridae families a in a mammalian Subject, or for confirming the presence of an effective interaction where Y=O, Z=O, P is a purine or pyrimidine base-pairing between Such a virus infecting a mammalian Subject and an moiety effective to bind, by base-specific hydrogen bonding, antisense oligonucleotide analog compound directed against to a base in a polynucleotide, and X is alkyl, alkoxy, the virus. In practicing the method, the Subject is adminis thioalkoxy, or alkyl amino. In a preferred compound, tered an oligonucleotide analog compound having (a) a X=NR, where each R is independently hydrogen or methyl. Sequence of 12-40 Subunits, including a targeting Sequence The compound may be the oligonucleotide analog alone or of at least 12 Subunits that is complementary to a region a conjugate of the analog and an arginine-rich polypeptide asSociated with Stem-loop Secondary Structure within the capable of enhancing the uptake of the compound into host 5'-terminal end 40 bases of the positive-sense RNA strand of cells. the virus, (b) morpholino Subunits linked by uncharged, 0062 For treatment of a Flavivirus or Hepacivirus as phosphorus-containing interSubunit linkages, each linkage given below, the targeting Sequence is complementary to a joining a morpholino nitrogen of one Subunit to a 5' exocy region associated with Stem-loop Secondary Structure within clic carbon of an adjacent Subunit, and (c) capable of one of the following Sequences: forming with the positive-Strand viral SSRNA genome, a heteroduplex Structure characterized by a Tm of dissociation 0063 (i) SEQ ID NO. 1, for St Louis encephalitis virus; of at least 45 C. and disruption of the stem-loop secondary Structure. 0064 (ii) SEQ ID NO. 2, for Japanese encephalitis virus; 0065 (iii) SEQ ID NO. 3, for a Murray Valley encepha 0054. At a selected time after the compound is adminis tered, a Sample of a body fluid is obtained from the Subject, litis virus; and assayed for the presence of a nuclease-resistant hetero 0.066 (iv) SEQ ID NO. 4, for a West Nile fever virus; US 2006/OO63150 A1 Mar. 23, 2006

0067 (v) SEQ ID NO. 5, for a Yellow fever virus 0097 (i) SEQID NOS. 61 and 62, for a polio virus of the 0068 (vi) SEQ ID NO. 6, for a Dengue Type-2 virus; Mahoney and Sabin strains; 0.098 (ii) SEQID NOS. 63 and 64, for a Human enterovi 0069 (vii) SEQ ID NO. 7, for a Hepatitis C virus; ruS A, 0070 (viii) SEQ ID NO. 8, for a tick-borne encephalitis 0099 (iii) SEQ ID NOS. 65 and 66, for a Human virus, enterovirus B; 0071 (ix) SEQ ID NO. 9, for Omsk hemorrhagic fever 01.00 (iv) SEQ ID NOS. 67 and 68, for a Human virus, and enterovirus C; 0072 (x) SEQ ID NO. 10, for Powassan virus. 0101 (v) SEQID NOS. 69 and 70, for a Human enterovi 0.073 Exemplary targeting sequences for these viruses rus D; include the following Sequences, or portions of these Sequences that overlap with one or more regions of duplex 01.02 (vi) SEQ ID NOS. 71 and 72, for a Human Secondary Structure in the associated target Sequence: enterovirus E.; 0074) (i) SEQ ID NOS. 41 and 42, for St Louis encepha 01.03 (vii) SEQ ID NOS. 73 and 74, for a Bovine litis virus; enterovirus, 0075 (ii) SEQID NOS. 43 and 44, for Japanese encepha 0104 (viii) SEQ ID NOS. 75 and 76, for Human rhinovi litis virus; rus 89; 0076 (iii) SEQID NOS. 45 and 46, for a Murray Valley 01.05 (ix) SEQ ID NOS. 77 and 78, for Human rhinovi encephalitis virus, rus B; 0.077 (iv) SEQ ID NOS. 47 and 48, for a West Nile fever 0106 (x) SEQ ID NOS. 79 and 80, for Foot-and-mouth virus, disease virus, and 0078 (v) SEQ ID NOS. 49 and 50, for a Yellow fever 0107 (xi) SEQ ID NOS. 81 and 82, for a hepatitis A virus Virus. 0079 (vi) SEQ ID NOS. 51, 52, for a Dengue virus; 0108) For treatment of a Calicivirus or Norovirus the targeting Sequence is complementary to a region associated 0080 (vii) SEQ ID NOS. 53 and 54, for a Hepatitis C with Stem-loop Secondary Structure within one of the fol virus, lowing Sequences: 0081 (viii) SEQ ID NOS. 55 and 56, for a tick-borne encephalitis virus, 0109 (i) SEQ ID NO. 22, for a Feline Calicivirus; 0082) (ix) SEQ ID NOS. 57 and 58, for Omsk hemor 0110 (ii) SEQ ID NO. 23, for a Canine Calicivirus; rhagic fever virus, and 0111 (iii) SEQ ID NO. 24, for a Porcine enteric calicivi 0083) (x) SEQ ID NOS. 59 and 60, for Powassan virus. ruS, 0084. For treatment of an Enterovirus, Rhinovirus, Hepa 0112 (iv) SEQID NO. 25, for Calicivirus strain NB; and tovirus or Aphthovirus the targeting Sequence is comple mentary to a region associated with Stem-loop Secondary 0113 (v) SEQ ID NO. 26, for a Norwalk virus. Structure within one of the following Sequences: 0114 Exemplary targeting sequences for these viruses 0085 (i) SEQ ID NO. 11, for a polio virus of the include the following Sequences, or portions of these Mahoney and Sabin strains; Sequences that overlap with one or more regions of duplex Secondary Structure in the associated target Sequence: 0.086 (ii) SEQ ID NO. 12, for a Human enterovirus A; 0115 (i) SEQ ID NOS. 83 and 84, for a Feline Calicivi 0087 (iii) SEQ ID NO. 13, for a Human enterovirus B; ruS, 0088 (iv) SEQ ID NO. 14, for a Human enterovirus C; 0116 (ii) SEQ ID NOS. 85 and 86, for a Canine Cali 0089 (v) SEQ ID NO. 15, for a Human enterovirus D; civirus, 0090 (vi) SEQ ID NO. 16, for a Human enterovirus E; 0117 (iii) SEQ ID NOS. 87 and 88, for a Porcine enteric 0091 (vii) SEQ ID NO. 17, for a Bovine enterovirus; calicivirus, 0092 (viii) SEQ ID NO. 18, for Human rhinovirus 89; 0118 (iv) SEQID NOS. 89 and 90, for Calicivirus strain NB; and 0093 (ix) SEQ ID NO. 19, for Human rhinovirus B; 0119) (v) SEQ ID NOS. 91 and 92, for a Norwalk virus. 0094) (x) SEQ ID NO. 20, for Foot-and-mouth disease virus, and 0120 For treatment of the Hepevirus, Hepatitis E virus, the targeting Sequence is complementary to a region asso 0.095 (xi) SEQ ID NO. 21, for a hepatitis A virus. ciated with Stem-loop Secondary Structure within the 0.096 Exemplary targeting sequences for these viruses sequence identified as SEQ ID NO: 27. Exemplary targeting include the following Sequences, or portions of these sequences include SEQ ID NOS: 93 and 94, or portions Sequences that overlap with one or more regions of duplex thereof that overlap with one or more regions of Secondary Secondary Structure in the associated target Sequence: Structure in the associated target Sequence. US 2006/OO63150 A1 Mar. 23, 2006

0121 For treatment of a Rubivirus or Alphavirus the 0145 (vi) SEQ ID NOS. 107 and 108, for Murine hepa targeting Sequence is complementary to a region associated titis virus, and with Stem-loop Secondary Structure within one of the fol lowing Sequences: 0146 (vii) SEQ ID NOS. 109 and 110, for Porcine reproductive and respiratory Syndrome virus. 0122) (i) SEQ ID NO. 28, for Rubella virus; 0147 For treatment of a Mamastrovirus, Human astro 0123 (ii) SEQID NO. 38, for Eastern equine encephalitis Virus, the targeting Sequence is complementary to a region virus, asSociated with Stem-loop Secondary Structure within the 0124 (iii) SEQID NO. 39, for Western equine encepha sequence identified as SEQ ID NO:37. Exemplary targeting litis virus, and sequences are SEQ ID NOS. 113 and 114, or portions of these Sequences that overlap with one or more regions of 0125 (iv) SEQ ID NO. 40, for Venezuelan equine duplex Secondary Structure in the associated target Sequence. encephalitis virus. 0.148. For treatment of an Equine arteritis virus, the 0.126 Exemplary targeting sequences for each of these targeting Sequence is complementary to a region associated Viruses are identified by the following Sequence ID numbers, with Stem-loop Secondary Structure within the Sequence or portions of these Sequences that overlap with one or more identified as SEQ ID NO: 36. Exemplary targeting regions of duplex Secondary Structure in the associated sequences are SEQ ID NOS. 111, 112, or portions of these target Sequence: Sequences that overlap with one or more regions of duplex O127 (i) SEQ ID NOS. 95 and 96, for Rubella virus; Secondary Structure in the associated target Sequence. 0128 (ii) SEQID NOS. 115 and 116, for Eastern equine 014.9 These and other objects and features of the inven encephalitis virus, tion will be more fully appreciated when the following detailed description of the invention is read in conjunction 0129 (iii) SEQID NOS. 117 and 118, for Western equine with the accompanying figures. encephalitis virus, and 0130 (iv) SEQ ID NOS. 119 and 120, for Venezuelan BRIEF DESCRIPTION OF THE DRAWINGS equine encephalitis virus 0150 FIGS. 1A-1G show the backbone structures of 0131 For treatment of a Coronavirus or Arterivirus the various oligonucleotide analogs with uncharged backbones, targeting Sequence is complementary to a region associated 0151 FIGS. 2A-2D show the repeating subunit segment with Stem-loop Secondary Structure within one of the fol of exemplary morpholino oligonucleotides; lowing Sequences: 0152 FIGS. 3A-3E are schematic diagrams of genomes 0132) (i) SEQ ID NO. 29, for SARS coronavirus TOR2; of exemplary viruses and viral target Sites, 0133) (ii) SEQ ID NO. 30, for Porcine epidemic diarrhea 0153 FIGS. 4A-4E show examples of predicted second virus, ary Structures of 5' end terminal positive-Strand regions for 0134) (iii) SEQ ID NO. 31, for Transmissible gastroen exemplary viruses, and teritis virus, 0154 FIGS. 5A-5D show the inhibition of Dengue virus replication in infected Vero cells in the presence of an 0135 (iv) SEQ ID NO. 32, for Bovine coronavirus; antisense oligomer that targets the 5' positive-Strand terminal 0136 (v) SEQ ID NO. 33, for Human coronavirus 229E; region of Dengue virus types 1-4. 0137 (vi) SEQ ID NO. 34, for Murine hepatitis virus; O155 FIG. 6 shows that PMO can reduce PRRSV rep and lication as measured by viral titer. 0138 (vii) SEQ ID NO. 35, for Porcine reproductive and 0156 FIG. 7 shows in vitro PMO treatment of respiratory Syndrome virus. CRL11171 cells inoculated with PRRSV have reduced cell 0139 Exemplary targeting sequences for each of these pathogenic effects. Viruses are identified by the following Sequence ID numbers, 0157 FIG. 8 shows the reduction of TBEV replication in or portions of these Sequences that overlap with one or more vitro in the presence PMO targeting the 5' terminal region of regions of duplex Secondary Structure in the associated TBEV. target Sequence: 0140) (i) SEQ ID NOS. 97 and 98, for SARS coronavirus DETAILED DESCRIPTION OF THE TOR2; INVENTION 0141 (ii) SEQID NOS. 99 and 100, for Porcine epidemic I. Definitions diarrhea virus, 0158. The terms below, as used herein, have the follow 0142 (iii) SEQID NOS. 101 and 102, for Transmissible ing meanings, unless indicated otherwise: gastroenteritis virus, 0159. The terms “oligonucleotide analog” refers to an oligonucleotide having (i) a modified backbone structure, 0143 (iv) SEQ ID NOS. 103 and 104, for Bovine coro e.g., a backbone other than the Standard phosphodiester navirus, linkage found in natural oligo- and polynucleotides, and (ii) 0144) (v) SEQ ID NOS. 105 and 106, for Human coro optionally, modified Sugar moieties, e.g., morpholino moi navirus 229E; eties rather than ribose or deoxyribose moieties. The analog US 2006/OO63150 A1 Mar. 23, 2006

Supports bases capable of hydrogen bonding by Watson as a PMO. Such oligomers are composed of morpholino Crick base pairing to Standard polynucleotide bases, where subunit structures such as shown in FIG.2B, where X=NH, the analog backbone presents the bases in a manner to permit NHR, or NR (where R is lower alkyl, preferably methyl), Such hydrogen bonding in a Sequence-specific fashion Y=O, and Z=O, and P, and P are purine or pyrimidine between the oligonucleotide analog molecule and bases in a base-pairing moieties effective to bind, by base-specific Standard polynucleotide (e.g., single-stranded RNA or hydrogen bonding, to a base in a polynucleotide. Also Single-stranded DNA). Preferred analogs are those having a preferred are structures having an alternate phosphorodia Substantially uncharged, phosphorus containing backbone. midate linkage, where, in FIG.2B, X=lower alkoxy, such as 0160 A Substantially uncharged, phosphorus containing methoxy or ethoxy, Y=NH or NR, where R is lower alkyl, backbone in an oligonucleotide analog is one in which a and Z=O. majority of the Subunit linkages, e.g., between 60-100%, are 0.165. The term “substituted”, particularly with respect to uncharged at physiological pH, and contain a single phoS an alkyl, alkoxy, thioalkoxy, or alkylamino group, refers to phorous atom. The analog contains between 8 and 40 replacement of a hydrogen atom on carbon with a heteroa subunits, typically about 8-25 subunits, and preferably about tom-containing Substituent, Such as, for example, halogen, 12 to 25 Subunits. The analog may have exact Sequence hydroxy, alkoxy, thiol, alkylthio, amino, alkylamino, imino, complementarity to the target Sequence or near complemen OXO (keto), nitro, cyano, or various acids or esters Such as tarity, as defined below. carboxylic, Sulfonic, or phosphonic. It may also refer to replacement of a hydrogen atom on a heteroatom (Such as an 0.161. A “subunit' of an oligonucleotide analog refers to amine hydrogen) with an alkyl, carbonyl or other carbon one nucleotide (or nucleotide analog) unit of the analog. The containing group. term may refer to the nucleotide unit with or without the attached interSubunit linkage, although, when referring to a 0166 As used herein, the term “target', relative to the “charged Subunit', the charge typically resides within the viral genomic RNA, refers to a viral genomic RNA, and interSubunit linkage (e.g. a phosphate or phosphorothioate Specifically, to a region associated with Stem-loop Secondary linkage). structure within the 5'-terminal end 40 bases of the positive 0162. A “morpholino oligonucleotide analog” is an oli sense RNA strand of a single-stranded RNA (ssRNA) virus gonucleotide analog composed of morpholino Subunit Struc described herein. tures of the form shown in FIGS. 2A-2D, where (i) the 0.167 The term “target sequence” refers to a portion of structures are linked together by phosphorus-containing the target RNA against which the oligonucleotide analog is linkages, one to three atoms long, joining the morpholino directed, that is, the Sequence to which the oligonucleotide nitrogen of one Subunit to the 5' exocyclic carbon of an analog will hybridize by Watson-Crick base pairing of a adjacent subunit, and (ii) P, and P are purine or pyrimidine complementary Sequence. AS will be seen, the target base-pairing moieties effective to bind, by base-specific Sequence may be a contiguous region of the viral positive hydrogen bonding, to a base in a polynucleotide. The purine Strand RNA, or may be composed of complementary frag or pyrimidine base-pairing moiety is typically adenine, ments of both the 5' and 3' sequences involved in secondary cytosine, guanine, uracil or thymine. The Synthesis, Struc Structure. tures, and binding characteristics of morpholino oligomers 0.168. The term “targeting sequence” is the sequence in are detailed in U.S. Pat. Nos. 5,698,685, 5,217.866, 5,142, the oligonucleotide analog that is complementary (meaning, 047, 5,034,506, 5,166,315, 5,521,063, and 5,506,337, all of in addition, Substantially complementary) to the target which are incorporated herein by reference. Sequence in the RNA genome. The entire Sequence, or only 0163 The subunit and linkage shown in FIG.2B are used a portion, of the analog compound may be complementary for six-atom repeating-unit backbones, as shown in FIG. 3B to the target Sequence. For example, in an analog having 20 (where the six atoms include: a morpholino nitrogen, the bases, only 12-14 may be targeting Sequences. Typically, the connected phosphorus atom, the atom (usually oxygen) targeting Sequence is formed of contiguous bases in the linking the phosphorus atom to the 5' exocyclic carbon, the analog, but may alternatively be formed of non-contiguous 5' exocyclic carbon, and two carbon atoms of the next Sequences that when placed together, e.g., from opposite morpholino ring). In these structures, the atom Y linking the ends of the analog, constitute Sequence that spans the target 5' exocyclic morpholino carbon to the phosphorus group Sequence. AS will be seen, the target and targeting Sequences may be Sulfur, nitrogen, carbon or, preferably, oxygen. The are Selected Such that binding of the analog to a region X moiety pendant from the phosphorus is any stable group within the 5'-terminal end 40 bases of the positive-sense which does not interfere with base-specific hydrogen bond RNA Strand of the Virus acts to disrupt Secondary Structure, ing. Preferred X groups include fluoro, alkyl, alkoxy, thio particularly, the most 3' Stem loop Structure, in this region. alkoxy, and alkyl amino, including cyclic amines, all of which can be variously Substituted, as long as base-specific 0169 Target and targeting sequences are described as bonding is not disrupted. Alkyl, alkoxy and thioalkoxy “complementary to one another when hybridization occurs preferably include 1-6 carbon atoms. Alkyl amino preferably in an antiparallel configuration. A targeting Sequence may refers to lower alkyl (C. to C.) Substitution, and cyclic have “near” or “substantial” complementarity to the target amines are preferably 5- to 7-membered nitrogen hetero Sequence and Still function for the purpose of the present cycles optionally containing 1-2 additional heteroatoms invention, that is, still be “complementary.” Preferably, the Selected from Oxygen, nitrogen, and Sulfur. Z is Sulfur or oligonucleotide analog compounds employed in the present oxygen, and is preferably oxygen. invention have at most one mismatch with the target Sequence out of 10 nucleotides, and preferably at most one 0164. A preferred morpholino oligomer is a phospho mismatch out of 20. Alternatively, the antisense oligomers rodiamidate-linked morpholino oligomer, referred to herein employed have at least 90% sequence homology, and pref US 2006/OO63150 A1 Mar. 23, 2006 erably at least 95% sequence homology, with the exemplary not limited to, administration of e.g., a pharmaceutical targeting Sequences as designated herein. composition, and may be performed either prophylactically, 0170 An oligonucleotide analog “specifically hybrid or Subsequent to the initiation of a pathologic event or izes to a target polynucleotide if the oligomer hybridizes to contact with an etiologic agent. The related term “improved the target under physiological conditions, with a T. Sub therapeutic outcome' relative to a patient diagnosed as stantially greater than 45 C., preferably at least 50 C., and infected with a particular virus, refers to a slowing or typically 60° C.-80 C. or higher. Such hybridization pref diminution in the growth of Virus, or viral load, or detectable erably corresponds to Stringent hybridization conditions. At Symptoms associated with infection by that particular virus. a given ionic Strength and pH, the T is the temperature at 0.178 An agent is “actively taken up by mammalian which 50% of a target Sequence hybridizes to a comple cells' when the agent can enter the cell by a mechanism mentary polynucleotide. Again, Such hybridization may other than passive diffusion across the cell membrane. The occur with “near” or “substantial” complementary of the agent may be transported, for example, by “active trans antisense oligomer to the target Sequence, as well as with port', referring to transport of agents acroSS a mammalian exact complementarity. cell membrane by e.g. an ATP-dependent transport mecha nism, or by “facilitated transport', referring to transport of 0171 A“nuclease-resistant” oligomeric molecule (oligo antisense agents across the cell membrane by a transport mer) refers to one whose backbone is Substantially resistant mechanism that requires binding of the agent to a transport to nuclease cleavage, in non-hybridized or hybridized form, protein, which then facilitates passage of the bound agent by common extracellular and intracellular nucleases in the acroSS the membrane. For both active and facilitated trans body; that is, the oligomer shows little or no nuclease port, the oligonucleotide analog preferably has a Substan cleavage under normal nuclease conditions in the body to tially uncharged backbone, as defined below. Alternatively, which the oligomer is exposed. the antisense compound may be formulated in a complexed 0172 A "heteroduplex” refers to a duplex between an form, Such as an agent having an anionic backbone com oligonucleotide analog and the complementary portion of a plexed with cationic lipids or liposomes, which can be taken target RNA. A “nuclease-resistant heteroduplex” refers to a into cells by an endocytotic mechanism. The analog also heteroduplex formed by the binding of an antisense oligo may be conjugated, e.g., at its 5' or 3' end, to an arginine-rich mer to its complementary target, Such that the heteroduplex peptide, e.g., a portion of the HIV TAT protein, or polyargi is Substantially resistant to in Vivo degradation by intracel nine, to facilitate transport into the target host cell as lular and extracellular nucleases, such as RNASeH, which described (Moulton, Nelson et al. 2004). Exemplary argin are capable of cutting double-stranded RNA/RNA or RNA/ ine-rich peptides useful in practicing the present invention as DNA complexes. listed as SEQ ID NOS: 121-126 in the Sequence Listing table. 0173 A“base-specific intracellular binding event involv ing a target RNA refers to the Specific binding of an 0179 A sequence is “capable of forming internal stem oligonucleotide analog to a target RNA sequence inside a loop Secondary Structure' if it can Spontaneously, under cell. The base Specificity of Such binding is Sequence Spe physiological conditions, form one or more regions of cific. For example, a Single-Stranded polynucleotide can double-stranded (duplex) RNA separated by one or more Specifically bind to a Single-Stranded polynucleotide that is regions of Single-Stranded RNA. The Stem and loop in this complementary in Sequence. Structure refers to the duplex RNA region (stem) terminating in a looped Single-Stranded region. The Stem-loop Structure 0.174. An “effective amount” of an antisense oligomer, of the 5'-terminal regions of Several of the viruses encom targeted against an infecting SSRNA virus, is an amount passed by the invention are seen in FIGS. 4A-4E. As seen effective to reduce the rate of replication of the infecting for the West Nile virus (WNV) or HCV, for example (FIG. Virus, and/or viral load, and/or Symptoms associated with the 4A), the stem-loop structure may comprise a single stem, a viral infection. Single loop, and non-duplexed end regions. In other cases, 0175 AS used herein, the term “body fluid” encompasses e.g., Yellow fever virus (YFV) or Dengue-2 virus (FIG. 4A), a variety of Sample types obtained from a Subject including, the Stem-loop Secondary Structure can include two or more urine, Saliva, plasma, blood, Spinal fluid, or other Sample of double-Stranded "stem” regions interspersed by non-du biological origin, Such as skin cells or dermal debris, and plexed regions and including a single loop. may refer to cells or cell fragments Suspended therein, or the 0180. By “disruption of such stem-loop structure” is liquid medium and its Solutes. meant disruption of any portion of the Stem-loop Structure in 0176) The term “relative amount” is used where a com the 5' terminal region of the RNA viral positive-strand parison is made between a test measurement and a control genome, by interfering with duplex RNA formation within measurement. The relative amount of a reagent forming a this region by forming a Stable heteroduplex complex complex in a reaction is the amount reacting with a test between the oligonucleotide analog compound of the inven Specimen, compared with the amount reacting with a control tion and duplex-forming Sequences within the 5' terminal Specimen. The control Specimen may be run Separately in region of the virus genome. Rules for the Selection of the same assay, or it may be part of the same Sample (for targeting Sequences capable of disrupting Secondary Stem example, normal tissue Surrounding a malignant area in a loop Structure in the 5'-terminal region of a viral genome are tissue Section). discussed below. 0177 “Treatment” of an individual or a cell is any type II. Targeted Viruses of intervention provided as a means to alter the natural 0181. The present invention is based on the discovery course of the individual or cell. Treatment includes, but is that effective of Single-Stranded, positive-Sense RNA viruses US 2006/OO63150 A1 Mar. 23, 2006 can be achieved by exposing cells infected with the virus to 0189 C. Caliciviridae. Members of the Caliciviridae antisense oligonucleotide analog compounds (i) targeted infect both humans and animals. The genus Vesivirus pro against the 5' end terminal Sequences of the positive-Strand duces disease manifestations in mammals that include epi Viral RNA Strand, and in particular, against target Sequences thelial blistering and are Suspected of being the cause of that contribute to Stem-loop Secondary Structure in this region, (ii) having physical and pharmacokinetic features animal abortion Storms and Some forms of human hepatitis which allow effective interaction between the antisense (non A through E) (Smith et al., 1998). Other genera of the compound and the virus within host cells. In one aspect, the Caliciviridae include the Norwalk-like and Sapporo-like oligomers can be used in treating a mammalian Subject Viruses, which together comprise the human caliciviruses, infected with the virus. and the Lagoviruses, which include rabbit hemorrhagic 0182. The invention targets RNA viruses having disease virus, a particularly rapid and deadly virus. genomes that are: (i) Single Stranded, (ii) positive polarity, 0190. The human caliciviruses are the most common and (iii) less than 32 kb. The targeted viruses also synthesize cause of Viral diarrhea outbreaks worldwide in adults, as a genomic RNA Strand with negative polarity, the minus well as being significant pathogens of infants (ORyan strand or negative-sense RNA, as the first step in viral RNA replication. In particular, targeted viral families include 1992). There are at least five types of human caliciviruses Flaviviridae, Picornoviridae, Caliciviridae, Togaviridae, that inhabit the gastrointestinal tract. The Norwalk virus is a Arteriviridae, Coronaviridae, Astroviridae and Hepeviridae widespread human agent causing acute epidemic gastroen families. Targeted viruses organized by family, genus and teritis and causes approximately 10% of all outbreaks of Species are listed in Table 1. Various physical, morphologi gastroenteritis in man (Murray and al. 1998). cal, and biological characteristics of each of these eight families, and members therein, can be found, for example, in 0191 Vesiviruses are now emerging from being regarded Textbook of Human Virology, R. Belshe, ed., 2" Edition, as Somewhat obscure and host specific to being recognized Mosby, 1991 and at the Universal Virus Database of the as one of the more versatile groups of Viral pathogens International Committee on Taxonomy of Viruses known. For example, a Single Serotype has been shown to (www.ncbi.nlm.nih.gov/ICTVdb/index.htm). Some of the infect a diverse group of 16 different Species of animals that key biological characteristics of each family are Summarized include a saltwater fish (opal eye), Sea lion, Swine, and man. below. 0183 A. Flaviviridae. Members of this family include 0192 D. Togaviridae. Members of this family include the Several Serious human pathogens, among them mosquito mosquito-borne Viruses which infect both humans and ani borne members of the genus Flavivirus including yellow mals. The family includes the genera Alphavirus and Rubivi fever virus (YFV), West Nile virus (WNV), Japanese rus (rubella). Representative Alphaviruses include Sindbus, encephalitis virus (JEV), St. Louis encephalitis virus Western equine encephalomyelitis virus (WEEV), Eastern (SLEV), Murray Valley encephalitis, Kunjin virus, and the equine encephalitis virus (EEEV) and Venezuelan equine four serotypes of dengue virus (DEN1-4). encephalitis virus (VEEV). 0184 Tick-borne members of the Flavivirus genus include tick-borne encephalitis virus (TBEV) and related 0193 E. Hepatitis E-like Viruses. Hepatitis E virus viruses including Omsk hemorrhagic fever virus (OHFV), (HEV) was initially described in 1987 and first reported in Louping ill virus, Powassan Virus, Kyasanur Forest disease the U.S. in 1991. The virus was initially described as a Virus and Alkhurma virus. member of the Caliciviridae based on the Small, Single stranded RNA character. Some still classify HEV as belong 0185. The Flaviviridae also includes Hepatitis C virus, a ing to the Caliciviridae, but it has also been recently clas member of the genus Hepacivirus. sified as the only member of the Hepeviridae family. 0186 B. Picornaviridae. This medically important fam Infection appears to be much like hepatitis. A viral infection. ily, whose members infect both humans and animals, can The disease is an acute viral hepatitis which is apparent cause Severe paralysis (paralytic poliomyelitis), aspectic about 20 days after initial infection, and the virus may be meningitis, hepatitis, pleurodynia, myocarditis, Skin rashes, observed for about 20 days in the serum. Transmission and colds, unapparent infection is common. Several medi occurs through contaminated water and geographically the cally important genera are members of this family, Enterovi Virus is restricted to leSS developed countries. rus including poliovirus (PV) and human enteroviruses (e.g. coxsackie Viruses); Hepatovirus which includes hepatitis A 0194 F. Coronaviridae, Arteriviridae and Astroviridae. virus (HAV); Rhinoviruses; and Aphthoviruses which Members of the Coronaviridae include the human coronavi include the foot-and mouth disease virus (FMDV). ruses that cause 10 to 30% of common colds and other 0187 Rhinoviruses such as human rhinovirus 89 (HRV respiratory infections, and murine hepatitis virus. More 89) and human rhinovirus B (HRV-B) are recognized as the recently, the viral cause of Severe acute respiratory Syn principle cause of the common cold in humans. Serotypes drome (SARS) has been identified as a coronavirus. The are designated from 1A to 100. Transmission is primarily by Arteriviridae include two important animal viruses, Equine the aerosol route and the virus replicates in the nose. arteritis virus (EAV) and porcine reproductive and respira tory syndrome virus (PRRSV). The Astroviridae includes 0188 Like all positive-sense RNA viruses, the genomic the human astrovirus (HAstV). RNA of Picornaviruses is infectious; that is, the genomic RNA is able to direct the synthesis of viral proteins directly, 0.195 Table 1, below, lists the targeted viruses of the without host transcription events. invention organized by family and genus. US 2006/OO63150 A1 Mar. 23, 2006

translation into viral proteins or incorporation into newly formed virions. The ratio of positive to minus-strand RNA in poliovirus-infected cells is approximately 50:1 in Hepatitis Family Genus Virus C-infected cells indicating each minus-Strand RNAServes as Flaviviridae Flavivirus St. Louis encephalitis (SLEV) a template for the synthesis of many positive-strand RNA Japanese encephalitis (JEV) molecules. Murray Valley encephalitis (MVEV) West Nile (WNV) 0198 The present invention is based on the discovery Yellow fever (YFV) Dengue Types 1-4 (DEN1-4) that several classes of positive-strand RNA viruses can be Tick-borne encephalitis (TBEV) effectively inhibited by exposing the viruses to an anti-Sense Omsk hemorrhagic fever (OHFV) compound capable of binding to a Sequence within the '5 Powassan UTR of the virus positive strand, and in particular, to a Hepacivirus Hepatitis C (HCV) Sequence designed to disrupt one or more of the cis-acting Picornaviridae Enterovirus Poliovirus (PV) Human enterovirus A (HEV-A) elements (stem-loop structures) within the 5' UTR. Human enterovirus B (HEV-B) Human enterovirus C (HEV-C) 0199 Therefore, as a first step in identifying an effective Human enterovirus D (HEV-D) target region (the sequence in the positive Strand 5'-UTR to Human enterovirus E (HEV-E) which the antisense compound will bind), one identifies Bovine enterovirus (BEV) Rhinovirus Human Rhinovirus B (HRV-B) those regions within the 5'-UTR which are involved in Human Rhinovirus 89 (HRV-89) Stem-loop Secondary Structure. This may be done, for Apthovirus Foot and mouth disease (FMDV) example, by computer-assisted Secondary Structure predic Hepatovirus Hepatitis A (HAV) tions which are based on a Search for the minimal free Caliciviridae Vesivirus Feline calicivirus (FCV) Canine calicivirus (CaCV) energy state of the input RNA sequence (Zuker 2003). When Porcine enteric calcivirus (PoCV) this analysis is applied to the terminal 40 bases of the Calicivirus strain NB (CVNB) 5'-UTR region of various target Viruses, the Secondary Norovirus Norwalk(NV) structures or stem loops shown in FIG. 4A-4E are obtained. Hepeviridae Hepevirus Hepatitis E (HEV) AS Seen, regions of Secondary structure (forming the cis Togaviridae Rubivirus Rubella (RUBV) Alphavirus Eastern equine encephalitis acting elements) are found typically in the terminal 20-25 (EEEV) bases, but in many cases, in bases up to position 40. Western equine encephalitis Therefore, the preferred target Sequences are the 5' end (WEEV) Venezuelan equine encephalitis terminal regions of the positive-strand RNA that include the (VEEV) end-most 40 nucleotides, typically the 5' terminal 5-35 Coronaviridae Coronavirus Porcine epidemic diarrhea (PEDV) nucleotides. Preferred target regions include those bases Transmissible gastroenteritis involved in Secondary Structure in these regions, as indicated (TGEV) in FIGS. 4A-4D. In particular, the targeting sequence con SARS coronavirus (SARS-CoV) Bovine coronavirus (BCoV) tains a Sequence of at least 12 bases that are complementary Human coronavirus 229E (HCoV to the 5'-end region of the positive-strand RNA, and are 229E) selected such that hybridization of the compound to the Murine hepatitis (MHV) RNA is effective to disrupt stem-loop secondary structure in Arteriviridae Arterivirus Equine arteritis (EAV) Porcine respiratory and this region, preferably the 5'-end most Stem-loop Secondary reproductive syndrome (PRRSV) structure. By way of example, FIG. 4A shows secondary Astroviridae Mamastrovirus Human astrovirus (HAstV) Structure of viral-genome Sequences that are available from well known sources, such as the NCBI Genbank databases. Alternatively, a perSon Skilled in the art can find Sequences III. Viral Target Regions for many of the Subject viruses in the open literature, e.g., by 0196. Single-stranded, positive-sense RNA viruses, like Searching for references that disclose Sequence information all RNA viruses, are unique in their ability to synthesize on designated viruses. Once a complete or partial viral RNA on an RNA template. To achieve this task they encode Sequence is obtained, the 5' end-terminal Sequences of the and induce the synthesis of a unique RNA-dependent RNA virus are identified. polymerases (RdRp) and possibly other proteins which bind 0200. The general genomic organization of each of the Specifically to the 3' and 5' end terminal untranslated regions eight virus families is discussed below, followed by exem (UTRs) of viral RNA. Since viral RNAS are linear mol plary target Sequences obtained for Selected members (gen ecules, RdRps have to employ unique Strategies to initiate de era, Species or Strains) within each family. novo RNA replication while retaining the integrity of the 5' end of their genomes. It is generally accepted that positive 0201 A. Picornaviridae. Typical of the picornaviruses, strand (+strand) viral RNA replication proceeds via the the human rhinovirus 89 genome (FIG. 3A) is a single following pathway: molecule of Single-Stranded, positive-Sense, polyadenylated RNA of approximately 7.2 kb. The genome includes a long +strand RNA-e-strand RNA synthesis-e-RF->+ 618 nucleotide UTR which is located upstream of the first strand RNA synthesis polyprotein, a single ORF, and a VPg (viral genome linked) 0.197 where “-strand RNA is negative-sense or minus protein covalently attached to its 5' end. The ORF is sub strand RNA complementary to the “+Strand RNA and “RF divided into two Segments, each of which encodes a (replicative form) is double-stranded RNA. The minus polyprotein. The first Segment encodes a polyprotein that is Strand RNA is used as a template for replication of multiple cleaved subsequently to form viral proteins VP1 to VP4, and copies of positive-strand RNA which is destined for either the Second Segment encodes a polyprotein which is the US 2006/OO63150 A1 Mar. 23, 2006

precursor of viral proteins including a protease and a poly a 341 nucleotide 5' UTR. The 5' end is capped with an merase. The ORF terminates in a polyA termination m"GppAmp molecule, and the 3' end is not polyadenylated. Sequence. The genome includes only one open reading frame which 0202 B. Caliciviridae. FIG. 3B shows the genome of a encodes a precursor polyprotein Separable into Six Structural calicivirus, in this case the Norwalk virus. The genome is a and functional proteins. Single molecule of infectious, Single Stranded, positive-Sense RNA of approximately 7.6 kb. As shown, the genome 0205 E. Coronaviridae. FIG. 3E shows the genome includes a Small UTR upstream of the first open reading structure of human coronavirus 229E. This coronovirus has frame which is unmodified. The 3' end of the genome is a large genome of approximately 27.4 kb that is typical for polyadenylated. The genome includes three open reading the Coronoviridae and a 292 nucleotide 5' UTR. The 5'-most frames. The first open reading frame encodes a polyprotein, ORF of the viral genome is translated into a large polypro which is Subsequently cleaved to form the Viral non-struc tein that is cleaved by viral-encoded proteases to release tural proteins including a helicase, a protease, an RNA Several nonstructural proteins, including an RdRp and a dependent RNA polymerase, and “VPg", a protein that helicase. These proteins, in turn, are responsible for repli becomes bound to the 5' end of the viral genomic RNA cating the Viral genome as well as generating nested tran (Clarke and Lambden, 2000). The second open reading Scripts that are used in the Synthesis of other viral proteins. frame codes for the Single capsid protein, and the third open 0206 GenBank references for exemplary viral nucleic reading frame codes for what is reported to be a structural acid Sequences representing the 5' end terminal, positive protein that is basic in nature and probably able to associate strand sequences for the first (most 5'-end) 40 bases for with RNA. corresponding viral genomes are listed in Table 2 below. The 0203 C. Togaviridae. FIG.3C shows the structure of the nucleotide Sequence numbers in Table 2 are derived from the genome of a togavirus, in this case, a rubella Virus of the Genbank reference for the positive-strand RNA. It will be Togavirus genus. The genome is a Single linear molecule of appreciated that these Sequences are only illustrative of other Single-Stranded, positive-Sense RNA of approximately 9.8 Sequences in the five virus families, as may be available kb, which is infectious. The 5' end is capped with a 7-me from available gene-Sequence databases of literature or thylG molecule and the 3' end is polyadenylated. Full-length patent resources. The sequences below, identified as SEQ ID and Subgenomic messenger RNAS have been demonstrated, NOS: 1-40, are also listed in Sequence Listing, Table 4, at and post translational cleavage of polyproteins occurs during the end of the Specification. RNA replication. The genome also includes two open read 0207. The target sequences in Table 2 are the first 40 ing frames. The first open reading frame encodes a polypro bases at the 5' terminal ends of the positive-strands tein which is Subsequently cleaved into four functional Sequences of the indicated viral RNAS. The Sequences proteins, nsP1 to nsP4. The Second open reading frame shown are in the 5' to 3' orientation so the 3' terminal encodes the viral capsid protein and three other viral pro nucleotide is at the end of the listed Sequence. The base teins, PE2, 6K and E1. designation “N' indicates the nucleotides at these positions 0204 D. Flaviviridae. FIG. 3D shows the structure of the are presently unknown. The region within each Sequence genome of the hepatitis C virus of the Hepacivirus genus. that is associated with Stem-loop Secondary Structure can be The HCV genome is a Single linear molecule of Single Seen from the predicted Secondary Structures in these stranded, positive-sense RNA of about 9.6 kb and contains sequences, shown in FIGS. 4A-4D.

TABLE 2 Exemplary 3' End Terminal Viral Nucleic Acid Target Sequences SEQ Gen-Bank ID Wirus No. Target Sequence (5' to 3') NO

St. Louis M18929 GNNGATGTTCGCGTCGGTGAGCGGAGAGGAA encephalitis ACAGATTTC (SLEV) Japanese NC OO1437 AGAAGTTTATCTGTGTGAACTTCTTGGCTTAG 2 encephalitis (JEV) TATCGTTG

Murray Valley NC OOO943 AGACGTTCATCTGCGTGAGCTTCCGATCTCA 3 encephalitis GTATTGTTT (MVEV)

West Nile NC OO1563 AGTAGTTCGCCTGTGTGAGCTGACAAACTTA 4 (WNV) GTAGGTTT

Yellow Fever NC OO2O31 AGTAAATCCTGTGTGCTAATTGAGGTGCATT 5 GGTCTGCAA

Dengue - Type 2 M2O558 AGTTGTTAGTCTACGTGGACCGACAAAGACA 6 (DEN2) GATTCTTTG US 2006/OO63150 A1 Mar. 23, 2006 11

TABLE 2-continued Exemplary 3' End Terminal Viral Nucleic Acid Target Sequences SEQ Gen-Bank ID Wirus No. Target Sequence (5' to 3') NO Hepatitis C NC OO 4102 GCCAGCCCCCTGATGGGGGCGACACTCCACC 7 (HCV) ATGAATCAC Tick-borne enceph NC OO1672 AGATTTTCTTGCACGTGCAGCGTTGCTTCG 8 alitis virus (TBEV) GACAGCAT

Omsk hemorrhagic NC OO5 O62 AGATTTTCTTGCACGTGCGTGCGCTGCTTCA 9 fever (OHFV) GACAGCAA

Powassan NC OO3687 AGATTTTCTTGCACGTGTGTGCGGGTGCTTTA GTCAGTGT

Poliovirus NC OO2O58 TTAAAACAGCTCTGGGGTTGTACCCACCCCA Mahoney strain GAGGCCCAC (PV)

Human enterovirus NC OO 1612 TTAAAACAGCCTGTGGGTTGTACCCACCCAC A. AGGGCCCAC (HEV-A)

Human enterovirus NC OO 1472 TTAAAACAGCCTGTGGGTTGTTCCCACCCAC AGGCCCATT (HEV-B)

Human enterovirus NC OO 1428 TTAAAACAGCTCTGGGGTTGCTCCCACCCCA GAGGCCCAC (HEV-C)

Human enterovirus NC OO 1430 TTAAAACAGCTCTGGGGTTGTTCCCACCCCA GAGGCCCAC (HEV-D)

Human enterovirus NC OO3988 GAGTGTTCCCACCCAACAGGCCCACTGGGTG TTGTACTCT (HEV-E)

Bovine enterovirus NC OO 1859 TTAAAACAGCCTGGGGGTTGTACCCACCCCT (BEV) GGGGCCCAC

Human rhinovirus NC OO1617 TTAAAACTGGGAGTGGGTTGTTCCCACTCAC 89 TCCACCCAT (HRV-89)

Human rhinovirus NC OO 1490 TTAAAACAGCGGATGGGTATCCCACCATTCG B ACCCATTGG (HRV-B)

Foot-and-mouth AY593,768 TTGAAAGGGGGCGCTAGGGTTTCACCCCTAG disease virus CATGCCAAC (FMDV)

Hepatitis A NC OO 1489 TTCAAGAGGGGTCTCCGGGAATTTCCGGAGT 21 (HAV) CCCTCTTGG

Feline calicivirus NC OO 1481 GTAAAAGAAATTTGAGACAATGTCCAAACT 22 (FCV) CTGAGCTTC

Canine calicivirus NC OO 4542 GTTAATGAGAAATGGCTTCTGCCATCGCTCT 23 (CaCV) CTCGAGCC

Porcine enteric NC OOO 940 GTGATCGTGATGGCTAATTGCCGTCCGTTGC 24 calicivirus CTATTGGGC (PoCV)

Calicivirus strain NC OO 4064. GTGATTTAATTATAGAGAGATAGTGACTTTC 25 NB CWNB ACTTTTCTT

Norwalk (NV) NC OO 1959 GTGAATGATGATGGCGTCAAAAGACGTCGTT 26 CCTACTGCT US 2006/OO63150 A1 Mar. 23, 2006 12

TABLE 2-continued Exemplary 3' End Terminal Viral Nucleic Acid Target Sequences SEQ Gen-Bank ID Wirus No. Target Sequence (5' to 3') NO Hepatitis E NC OO1434 GCCATGGAGGCCCATCAGTTTATTAAGGCTC 27 (HEV) CTGGCATCA

Rubella (RUBV) NC OO1545 ATGGAAGCTATCGGACCTCGCTTAGGACTCC 28 CATCCCAT

SARS coronavirus NC OO 418 ATATTAGGTTTTTACCTACCCAGGAAAAGCC 29 (SARS-CoV) AACCAACCT

Porcine epidemic NC OO3436 ACTTAAAAAGATTTTCTATCTACGGATAGTTA 30 diarrhea (PEDV) GCTCTTTT

Transmissible NC OO2306 ACTTTTAAAGTAAAGTGAGTGTAGCGTGGCT 31 gastroenteritis ATATCTCTT (TGEV) Bovine coronavirus NC 003045 GATTGCGAGCGATTTGCGTGCGTGCATCCCG 32 (BCoV) CTTCACGA

Human corona- NC 0026.45 ACTTAAGTACCTTATCTATCTACAGATAGAAA 33 virus 229E AGTTGCT (HCoV-229E) Murine Hepatitis NC OO1846 TATAAGAGTGATTGGCGTCCGTACGTACCCT 34 (MHV) CTCAACTCT

Porcine repro AF 176348 ATGACGTATAGGTGTTGGCTCTATGCCTTGG 35 ductive and CATTTGTAT respiratory syn drome (PRRSV) Equine arteritis NC OO2532 GCTCGAAGTGTGTATGGTGCCATATACGGCT 36 (EAV) CACCACCAT

Human astro-virus NC OO1943 CCAAGAGGGGGGTGGTGATTGGCCTTTGGCT 37 (HAstV) TATCAGTGT

Eastern equine NC OO3899 ATAGGGTACGGTGTAGAGGCAACCACCCTAT 38 encephalitis TTCCACCTA (EEEV) Western equine NC OO3908 ACCCTACAAACTAATCGATCCAATATGGAAA 39 encephalomyelits GAATTCACG (WEEV) Venezuelan equine NC OO1449 ATGGGCGGCGCAAGAGAGAAGCCCAAACCAA 40 enceph-alitis TTACCACC (VEEV)

0208 To Select a targeting sequence, one looks for a 0210 (2) a sequence such as 5'-GTCAGCTCACAC-3' Sequence that, when hybridized to a complementary that targets the complementary bases of the Stem and Sur Sequence in the 5'-end region of the positive-Strand RNA rounding bases (13-24); (SEQ ID NOS: 1-40), will be effective to disrupt stem-loop Secondary Structure in this region, and preferably, the initial 0211 (3) a sequence such as 5'-GCTCACACAGGCGA Stem structure in the region. By way of example, a Suitable 3"), that targets a portion of one or both “sides” of a stem targeting sequence for the West Nile Virus (WNV in FIG. loop and Surrounding bases (7-20); typically, the Sequence 4A) is a sequence that will disrupt the stem loop structure should disrupt all but at least 2-4 of the paired bases forming shown in the figure. Three general classes of Sequences the Stem Structure; would be Suitable (exemplary 12-14 base targeting 0212. It will be appreciated how this selection procedure Sequences are shown for illustrative purposes): can be applied to the other Sequences shown in Table 2, For 0209 (1) a sequence such as 5'-ACAGGCGAACTACT example, for the yellow fever virus (YFV) shown in FIG. 3' that targets the most 5' bases (1-14) of the stem and 4A, exemplary 14-18 base Sequences patterned after the Surrounding bases, three general classes above, might include: US 2006/OO63150 A1 Mar. 23, 2006

0213 (1) a sequence such as 5'-GCACACAGGATT. the end regions of the hybrid duplex than in the middle. The TACT-3' that targets the most 5' bases (1-16) of the intial number of mismatches allowed will depend on the length of Stem and Surrounding bases, the oligomer, the percentage of G:C base pairs in the duplex, and the position of the mismatch(es) in the duplex, accord 0214) (2) a sequence such as 5'-GTCCAATGCACCTC-3' ing to well understood principles of duplex Stability. that targets the complementary bases of the initial Stem and Although Such an antisense oligomer is not necessarily Surrounding bases (22-35); 100% complementary to the viral nucleic acid target 0215 (3) a sequence such as 5'-CAATGCACCTCAATT Sequence, it is effective to stably and Specifically bind to the AGC-3' that targets a portion of both sides of a stem and target Sequence, Such that a biological activity of the nucleic Surrounding bases (15-32); acid target, e.g., expression of viral protein(s), is modulated. 0216. It will be understood that targeting sequences so 0220. The stability of the duplex formed between the Selected can be made shorter, e.g., 12 bases, or longer, e.g., oligomer and the target Sequence is a function of the binding 20 bases, and include a Small number of mismatches, as long T, and the Susceptibility of the duplex to cellular enzymatic as the Sequence is Sufficiently complementary to disrupt the cleavage. The T of an antisense compound with respect to Stem structure(s) upon hybridization with the target, and complementary-Sequence RNA may be measured by con forms with the Virus positive-Strand, a heterodupleX having ventional methods, Such as those described by Hames et al., a Tm of 45 C. or greater. Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108 or as described in Miyada C. G. and Wallace R. B., 1987, 0217 More generally, the degree of complementarity Oligonucleotide hybridization techniques, Methods Enzy between the target and targeting Sequence is Sufficient to mol. Vol. 154 pp. 94-107. Each antisense oligomer should form a stable duplex. The region of complementarity of the have a binding T, with respect to a complementary antisense oligomers with the target RNA sequence may be as Sequence RNA, of greater than body temperature and pref short as 8-11 bases, but is preferably 12-15 bases or more, erably greater than 50 C. T.'s in the range 60-80 C. or e.g. 12-20 bases, or 12-25 bases. An antisense oligomer of greater are preferred. According to well known principles, about 14-15 bases is generally long enough to have a unique the T of an oligomer compound, with respect to a comple complementary Sequence in the Viral genome. In addition, a mentary-based RNA hybrid, can be increased by increasing minimum length of complementary bases may be required to the ratio of C:G paired bases in the duplex, and/or by achieve the requisite binding T, as discussed below. increasing the length (in base pairs) of the heteroduplex. At 0218. Oligomers as long as 40 bases may be Suitable, the Same time, for purposes of optimizing cellular uptake, it where at least the minimum number of bases, e.g., 8-11, may be advantageous to limit the Size of the oligomer. For preferably 12-15 bases, are complementary to the target this reason, compounds that show high T. (50° C. or Sequence. In general, however, facilitated or active uptake in greater) at a length of 20 bases or less are generally preferred cells is optimized at oligomer lengths less than about 30, over those requiring greater than 20 bases for high T, preferably less than 25, and more preferably 20 or fewer values. bases. For PMO oligomers, described further below, an 0221 Table 3 below shows exemplary targeting optimum balance of binding Stability and uptake generally Sequences, in a 5'-to-3' orientation, that are complementary occurs at lengths of 14-22 bases. to upstream and downstream portions of the 5' terminal 40 0219. The oligomer may be 100% complementary to the base regions of the positive Strand of the viruses indicated. Viral nucleic acid target Sequence, or it may include mis The Sequences here provide a collection of targeting matches, e.g., to accommodate Variants, as long as a het Sequence or Sequences from which targeting Sequences may eroduplex formed between the oligomer and viral nucleic be selected, according to the general class rules discussed acid target Sequence is Sufficiently Stable to withstand the above. Thus, for example, in Selecting a target against St. action of cellular nucleases and other modes of degradation Louis encephalitis virus, one might select either SEQ ID which may occur in Vivo. Oligomer backbones which are NOS: 40 or 41, or a portion of either sequence effective to leSS Susceptible to cleavage by nucleases are discussed block secondary structure formation in the virus 5' terminal below. Mismatches, if present, are less destabilizing toward UTR.

TABLE 3 Exemplary Antisense Sequences Targeting the 5' End Terminal Positive-Strand Regions SEQ GenBank ID Wirus Acc. No. Ncts. Sequences (5' to 3') NO St. Louis encephalitis M16614 1-18 ACCGACGCGAACATCNNC 41 11-30 TCCTCTCCGCTCACCGACGC 42

Japanese encephalitis NC 001437 1-18 TCACACAGATAAACTTCT 43 11-30 AAGCCAAGAAGTTCACACAG 44

Murray Valley NC OOO 943 1-18 TCACGCAGATGAACGTCT 45 encephalitis 11-30 GAGATCGGAAGCTCACGCAG 46 US 2006/OO63150 A1 Mar. 23, 2006 14

TABLE 3-continued Exemplary Antisense Sequences Targeting the 5' End Terminal Positive-Strand Regions SEQ GenBank ID Wirus Acc. No. Ncts. Sequences (5' to 3') NO

West Nile NC OO1563 -20 GCTCACACAGGCGAACTACT 47 11-31 TAAGTTTGTCAGCTCACACAG 48

Yellow Fever -22 CAATTAGCACACAGGATTTACT 49 21- 40 TTGCAGACCAATGCACCTCA 50

Dengue -Type 2 M2O558 -20 GTCCACGTAGACTAACAACT 51 11-30 GTCTTTGTCGGTCCACGTAG 52

Hepatitis C NC OO 4102 - 17 CCCATCAGGGGGCTGGC 53 10-29 TGGAGTGTCGCCCCCATCAG 54

Tick-borne NC OO1672 -20 ATGCACGTGCAAGAAAATCT 55 encephalitis 21- 40 ATGCTGTCCGAAGCAAACGC 56

Omsk hemorrhagic NC OO5062 -21 CACGCACGTGCAAGAAAATCT 57 fever 13-32 TGAAGCAAGCGCACGCACGT 58

Powassan NC OO3687 -20 ACACACGTGCAAGAAAATCT 59 21- 40 ACACTGACTAAAGCACCCGC 60

Poliovirus-Mahoney -24 GGTACAACCCCAGAGCTGTTTTAA 61 strain 21- 40 GTGGGCCTCTGGGGTGGGTA 62

Human enterovirus A NC OO1612 -20 CAACCCACAGGCTGTTTTAA 63 21- 40 GTGGGCCCTGTGGGTGGGTA 64

Human enterovirus B NC OO 1472 -20 CAACCCACAGGCTGTTTTAA 65 21- 40 AATGGGCCTGTGGGTGGGAA 66

Human enterovirus C NC OO 1428 -20 CAACCCCAGAGCTGTTTTAA 67 21- 40 GTGGGCCTCTGGGGTGGGAG 68

Human enterovirus D NC OO 1430 -20 CAACCCCAGAGCTGTTTTAA 69 21- 40 GTGGGCCTCTGGGGTGGGAA 70

Human enterovirus E NC OO3988 -20 CCTGTTGGGTGGGAACACTC 71. 21- 40 AGAGTACAACACCCAGTGGG 72

Bovine enterovirus NC OO 1859 -20 CAACCCCCAGGCTGTTTTAA 73 21- 40 GTGGGCCCCAGGGGTGGGTA 74

Human rhinovirus 89 NC OO1617 -20 CAACCCACTCCCAGTTTTAA 75 21- 40 ATGGGTGGAGTGAGTGGGAA 76

Human rhinovirus B NC OO 1490 -20 ATACCCATCCGCTGTTTTAA 77 21- 40 CCAATGGGTCGAATGGTGGG 78

Foot-and-mouth AY593768 -21 AACCCTAGCGCCCCCTTTCAA 79 disease 21- 40 GTTGGCATGCTAGGGGTGAA 8O

Hepatitis A NC OO 1489 -20 TCCCGGAGACCCCTCTTGAA 81 21- 40 CCAAGAGGGACTCCGGAAAT 82

Feline calicivirus NC OO 1481 -20 TTGTCTCAAATTTCTTTTAC 83 21- 40 GAAGCTCAGAGTTTGAGACA 84

Canine calicivirus NC OO 4542 -20 AGAAGCCATTTCTCATTAAC 85 21- 40 GAGCTCGAGAGAGCGATGGC 86

Porcine enteric NC OOO940 -20 CAATTAGCCATCACGATCAC 87 calicivirus 13-32 GGCAACGGACGGCAATTAGC 88

Calicivirus strain NB NC OO 4064 -20 TCTCTCTATAATAAATCAC 89 11-30 AAAGTCACTATCTCTCTATA 90

Norwalk NC OO 1959 -20 TTGACGCCATCATCATTCAC 91 21- 40 AGCAGTAGGAACGACGTCTT 92 US 2006/OO63150 A1 Mar. 23, 2006 15

TABLE 3-continued Exemplary Antisense Sequences Targeting the 5' End Terminal Positive-Strand Regions SEQ GenBank ID Wirus Acc. No. Ncts. Sequences (5' to 3') NO Hepatitis E NC OO 1434 - 20 AACTGATGGGCCTCCATGGC 93 21 - 40 TGATGCCAGGAGCCTTAATA 94

Rubella NC OO1545 -20 CGAGGTCCGATAGCTTCCAT 95 21 - 4 O ATGGGAATGGGAGCCTAAG 96

SARS coronavirus NC OO 418 -20 GGTAGGTAAAAACCTAATAT 97 TOR2 21-4. O AGGGGTTGGCTTTCCTG 98

Porcine epidemic NC OO34.36 2O GATAGAAAATCTTTTTAAGT 99 diarrhea 21 - 40 AAAAGAGCTAACTATCCGTA OO

Transmissible NC OO 2306 - 20 ACTCACTTTACTTTAAAAGT O1 gastroenteritis 11-30 GCCACGCTACACTCACTTTA O2

Bovine coronavirus NC OO3O45 -20 CACGCAAATCGCTOGCAATC O3 21 - 40 TCAGTGAAGCGGGATGCACG O4

Human coronavirus NC OO2645 -2O GATAGATAAGGTACTTAAGT O5 229E 21 - 40 AAGCAACTTTTCTATCTGTA O6

Murine Hepatitis NC OO 1846 -21 CGGACGCCAATCACTCTTATA O7 18-39 GAGTTGAGAGGGTACGTACGGA O8 Porcine reproductive & AF176348 5-25 CATAGAGCCAACACCTATACG O9 respiratory syndrome 21 - 4 O ATACAAATGCCAAGGCATAG 10

Equine arteritis NC OO 2532 -20 GCACCATACACACTCGAGC 11 21 - 4 O ATGGTGGTGAGCCGTATATG 12

Human astrovirus NC OO 1943 - 20 AATCACCACCCCCCTCTTGG 13 11-30 GCCAAAGGCCAATCACCACC 14

Eastern equine NC OO3899 - 20 GCCTCTACACCGTACCCTAT 15 encephalitis 21 - 4 O TAGGTGGAAATAGGGTGGTT 16

Western equine NC OO 3908 2O GATCGATTAGTTTGTAGGGT 17 encephalomyelitis 21-40 CGTGAATTCTTTCCATATTG 18

Venezuelan equine NC OO 1449 2O TTCTCTCTTGCGCCGCCCAT 19 encephalitis 21 - 4 O GGTAGGTAATTGGTTTGGGC 20

IV. AntiSense Oligonucleotide Analog Compounds form a stable duplex with the target RNA will also depend on the oligomer backbone, as well as factors noted above, 0222 A. Properties the length and degree of complementarity of the antisense 0223) As detailed above, the antisense oligonucleotide oligomer with respect to the target, the ratio of G:C to A.T analog compound (the term “antisense' indicates that the base matches, and the positions of any mismatched bases. compound is targeted against the virus Sense or positive The ability of the antisense oligomer to resist cellular Sense Strand RNA) has a base sequence targeting a region of nucleaseS promotes Survival and ultimate delivery of the the 5' end 40 bases that are associated with secondary agent to the cell cytoplasm. structure in the negative-strand RNA. In addition, the oli 0225 Below are disclosed methods for testing any given, gomer is able to effectively target infecting viruses, when Substantially uncharged backbone for its ability to meet administered to a host cell, e.g. in an infected mammalian these requirements. Subject. This requirement is met when the oligomer com pound (a) has the ability to be actively taken up by mam 0226 A1. Active or Facilitated Uptake by Cells malian cells, and (b) once taken up, form a duplex with the 0227. The antisense compound may be taken up by host target ssRNA with a T. greater than about 45 C. cells by facilitated or active transport across the host cell 0224. As will be described below, the ability to be taken membrane if administered in free (non-complexed) form, or up by cells requires that the oligomer backbone be Substan by an endocytotic mechanism if administered in complexed tially uncharged, and, preferably, that the oligomer Structure form. is recognized as a Substrate for active or facilitated transport 0228. In the case where the agent is administered in free across the cell membrane. The ability of the oligomer to form, the antisense compound should be Substantially US 2006/OO63150 A1 Mar. 23, 2006 uncharged, meaning that a majority of its interSubunit link complexes, including bilayer complexes, between anionic ages are uncharged at physiological pH. Experiments carried oligonucleotides and cationic lipid or other polymer com out in Support of the invention indicate that a Small number ponents, are well known. For example, the liposomal com of net charges, e.g., 1-2 for a 15- to 20-mer oligomer, can in position Lipofectin(E) (Felgner et al., 1987), containing the fact enhance cellular uptake of certain oligomers with Sub cationic lipid DOTMA (N-1-(2,3-dioleyloxy)propyl-N,N, Stantially uncharged backbones. The charges may be carried N-trimethylammonium chloride) and the neutral phospho on the oligomer itself, e.g., in the backbone linkages, or may lipid DOPE (dioleyl phosphatidyl ethanolamine), is widely be terminal charged-group appendages. Preferably, the num used. After administration, the complex is taken up by cells ber of charged linkages is no more than one charged linkage through an endocytotic mechanism, typically involving par per four uncharged linkages. More preferably, the number is ticle encapsulation in endoSomal bodies. no more than one charged linkage per ten, or no more than one per twenty, uncharged linkages. In one embodiment, the 0234. The antisense compound may also be administered oligomer is fully uncharged. in conjugated form with an arginine-rich peptide linked covalently to the 5' or 3' end of the antisense oligomer. The 0229. An oligomer may also contain both negatively and peptide is typically 8-16 amino acids and consists of a positively charged backbone linkages, as long as opposing mixture of arginine, and other amino acids including phen charges are present in approximately equal number. Prefer yalanine and cysteine. The use of arginine-rich peptide ably, the oligomer does not include runs of more than 3-5 PMO conjugates can be used to enhance cellular uptake of consecutive Subunits of either charge. For example, the the antisense oligomer (See, e.g. (Moulton, Nelson et al. oligomer may have a given number of anionic linkages, e.g. 2004). phosphorothioate or N3'->P5' phosphoramidate linkages, and a comparable number of cationic linkages, Such as 0235. In some instances, liposomes may be employed to N,N-diethylenediamine phosphoramidates (Dagle, 2000). facilitate uptake of the antisense oligonucleotide into cells. The net charge is preferably neutral or at most 1-2 net (See, e.g., Williams, S. A., Leukemia 10(12): 1980-1989, charges per oligomer. 1996; Lappalainen et al., Antiviral Res. 23:119, 1994; Uhl mann et al., ANTISENSE OLIGONUCLEOTIDES: A NEW 0230. In addition to being substantially or fully THERAPEUTIC PRINCIPLE, Chemical Reviews, Volume uncharged, the antisense agent is preferably a Substrate for 90, No. 4, pages 544-584, 1990; Gregoriadis, G., Chapter a membrane transporter System (i.e. a membrane protein or 14, Liposomes, Drug Carriers in Biology and Medicine, pp. proteins) capable of facilitating transport or actively trans 287-341, Academic Press, 1979). Hydrogels may also be porting the oligomer acroSS the cell membrane. This feature used as vehicles for antisense oligomer administration, for may be determined by one of a number of tests for oligomer example, as described in WO 93/01286. Alternatively, the interaction or cell uptake, as follows. oligonucleotides may be administered in microSpheres or 0231. A first test assesses binding at cell surface recep microparticles. (See, e.g., Wu, G.Y. and Wu, C. H., J. Biol. tors, by examining the ability of an oligomer compound to Chem. 262:4429-4432, 1987). Alternatively, the use of gas displace or be displaced by a Selected charged oligomer, e.g., filled microbubbles complexed with the antisense oligomers a phosphorothioate oligomer, on a cell Surface. The cells are can enhance delivery to target tissues, as described in U.S. incubated with a given quantity of test oligomer, which is Pat. No. 6,245,747. typically fluorescently labeled, at a final oligomer concen 0236 Alternatively, and according to another aspect of tration of between about 10-300 nM. Shortly thereafter, e.g., the invention, the requisite properties of oligomers with any 10-30 minutes (before significant internalization of the test given backbone can be confirmed by a simple in Vivo test, oligomer can occur), the displacing compound is added, in in which a labeled compound is administered to an animal, incrementally increasing concentrations. If the test com and a body fluid Sample, taken from the animal Several hours pound is able to bind to a cell Surface receptor, the displacing after the oligomer is administered, assayed for the presence compound will be observed to displace the test compound. of heteroduplex with target RNA. This method is detailed in If the displacing compound is shown to produce 50% Subsection D below. displacement at a concentration of 10x the test compound concentration or less, the test compound is considered to 0237 A2. Substantial Resistance to RNaseH bind at the same recognition Site for the cell transport System 0238. Two general mechanisms have been proposed to as the displacing compound. account for inhibition of expression by antisense oligonucle 0232 A Second test measures cell transport, by examin otides. (See e.g., Agrawal et al., 1990; Bonham et al., 1995; ing the ability of the test compound to transport a labeled and Boudvillain et al., 1997). In the first, a heteroduplex reporter, e.g., a fluorescence reporter, into cells. The cells are formed between the oligonucleotide and the viral RNA acts incubated in the presence of labeled test compound, added as a Substrate for RNaseH, leading to cleavage of the viral at a final concentration between about 10-300 nM. After RNA. Oligonucleotides belonging, or proposed to belong, to incubation for 30-120 minutes, the cells are examined, e.g., this class include phosphorothioates, phosphotriesters, and by microscopy, for intracellular label. The presence of phosphodiesters (unmodified “natural oligonucleotides). Significant intracellular label is evidence that the test com Such compounds expose the viral RNA in an oligomer:RNA pound is transported by facilitated or active transport. duplex structure to hydrolysis by RNaseH, and therefore 0233. The antisense compound may also be administered loSS of function. in complexed form, where the complexing agent is typically 0239 A second class of oligonucleotide analogs, termed a polymer, e.g., a cationic lipid, polypeptide, or non-bio “steric blockers” or, alternatively, “RNaseH inactive” or logical cationic polymer, having an opposite charge to any “RNaseH resistant”, have not been observed to act as a net charge on the antisense compound. Methods of forming substrate for RNaseH, and are believed to act by sterically US 2006/OO63150 A1 Mar. 23, 2006 blocking target RNA nucleocytoplasmic transport, Splicing pairing moiety effective to bind, by base-specific hydrogen or translation. This class includes methylphosphonates bonding, to a base in a polynucleotide, preferably Selected (Toulme et al., 1996), morpholino oligonucleotides, peptide from adenine, cytosine, guanine and uracil. Suitable back nucleic acids (PNA's), certain 2'-O-allyl or 2'-O-alkyl modi bone structures include carbonate (FIG. 1A, R=O) and fied oligonucleotides (Bonham, 1995), and N3'->P5' phos carbamate (FIG. 1A, R=NH) linkages (Mertes and Coats phoramidates (Gee, 1998; Ding, 1996). 1969; Gait, Jones et al. 1974); alkyl phosphonate and phosphotriester linkages (FIG. 1B, R=alkyl or -O-alkyl) 0240 A test oligomer can be assayed for its RNaseH (Lesnikowski, Jaworska et al. 1990); amide linkages (FIG. resistance by forming an RNA:oligomer duplex with the test 1C) (Blommers, Pieles et al. 1994); sulfone and sulfonamide compound, then incubating the duplex with RNaseH under linkages (FIG. 1D, R, R=CH-) (Roughten, 1995; McEl a Standard assay conditions, as described in Stein et al. After roy, 1994); and a thioformacetyl linkage (FIG. 1E) (Mat exposure to RNaseH, the presence or absence of intact teucci, 1990; Cross, 1997). The latter is reported to have duplex can be monitored by gel electrophoresis or mass enhanced dupleX and triplex Stability with respect to phos Spectrometry. phorothioate antisense compounds (Cross, 1997). Also reported are the 3'-methylene-N-methylhydroxyamino com 0241 A3. In Vivo Uptake pounds of the structure in FIG. 1F (Mohan, 1995). 0242. In accordance with another aspect of the invention, there is provided a simple, rapid test for confirming that a 0248 Peptide nucleic acids (PNAS) (FIG. 1G) are ana given antisense oligomer type provides the required char logs of DNA in which the backbone is structurally homo acteristics noted above, namely, high T, ability to be morphous with a deoxyribose backbone, consisting of N-(2- actively taken up by the host cells, and Substantial resistance aminoethyl)glycine units to which pyrimidine or purine to RNaseH. This method is based on the discovery that a bases are attached. PNAS containing natural pyrimidine and properly designed antisense compound will form a stable purine bases hybridize to complementary oligonucleotides heteroduplex with the complementary portion of the viral obeying Watson-Crick base-pairing rules, and mimic DNA RNA target when administered to a mammalian Subject, and in terms of base pair recognition (Egholm et al., 1993). The the heteroduplex Subsequently appears in the urine (or other backbone of PNAS are formed by peptide bonds rather than body fluid). Details of this method are also given in co phosphodiester bonds, making them well-Suited for anti owned U.S. patent application Ser. No. 09/736,920, entitled Sense applications. The backbone is uncharged, resulting in “Non-Invasive Method for Detecting Target RNA” (Non PNA/DNA or PNA/RNA duplexes which exhibit greater Invasive Method), the disclosure of which is incorporated than normal thermal stability. PNAS are not recognized by herein by reference. nucleases or proteases. 0243 Briefly, a test oligomer containing a backbone to be 0249. A preferred oligomer structure employs mor evaluated, having a base Sequence targeted against a known pholino-based Subunits bearing base-pairing moieties, RNA, is injected into a mammalian Subject. The antisense joined by uncharged linkages, as described above. Espe oligomer may be directed against any intracellular RNA, cially preferred is a Substantially uncharged phosphorodia including a host RNA or the RNA of an infecting virus. midate-linked morpholino oligomer, Such as illustrated in Several hours (typically 8-72) after administration, the urine FIGS. 2A-2D. Morpholino oligonucleotides, including anti is assayed for the presence of the antisense-RNA heterodu Sense oligomers, are detailed, for example, in co-owned U.S. plex. If heteroduplex is detected, the backbone is suitable for Pat. Nos. 5,698,685, 5,217.866, 5,142,047, 5,034,506, use in the antisense oligomers of the present invention. 5,166,315, 5,185,444, 5,521,063, and 5,506,337, all of which are expressly incorporated by reference herein. 0244. The test oligomer may be labeled, e.g. by a fluo rescent or a radioactive tag, to facilitate Subsequent analyses, 0250 Important properties of the morpholino-based sub if it is appropriate for the mammalian Subject. The assay can units include: the ability to be linked in a oligomeric form by be in any Suitable Solid-phase or fluid format. Generally, a Stable, uncharged backbone linkages, the ability to Support Solid-phase assay involves first binding the heteroduplex a nucleotide base (e.g. adenine, cytosine, guanine or uracil) analyte to a Solid-phase Support, e.g., particles or a polymer Such that the polymer formed can hybridize with a comple or test-Strip Substrate, and detecting the presence/amount of mentary-base target nucleic acid, including target RNA, heterodupleX bound. In a fluid-phase assay, the analyte with high T, even with oligomers as short as 10-14 bases, Sample is typically pretreated to remove interfering Sample the ability of the oligomer to be actively transported into components. If the oligomer is labeled, the presence of the mammalian cells; and the ability of the oligomer:RNA heterodupleX is confirmed by detecting the label tags. For heteroduplex to resist RNASe degradation. non-labeled compounds, the heteroduplex may be detected by immunoassay if in Solid phase format or by mass spec 0251 Exemplary backbone structures for antisense oli troScopy or other known methods if in Solution or Suspen gonucleotides of the invention include the B-morpholino Sion format. subunit types shown in FIGS. 2A-2D, each linked by an 0245 When the antisense oligomer is complementary to uncharged, phosphorus-containing Subunit linkage. FIG. 2A a virus-specific region of the viral genome (such as 5' end shows a phosphorus-containing linkage which forms the five terminal region of the viral RNA, as described above, the atom repeating-unit backbone, where the morpholino rings method can be used to detect the presence of a given SSRNA are linked by a 1-atom phosphoamide linkage. FIG. 2B Virus, or reduction in the amount of Virus during a treatment shows a linkage which produces a 6-atom repeating-unit method. backbone. In this structure, the atom Y linking the 5' morpholino carbon to the phosphorus group may be Sulfur, 0246 B. Exemplary Oligomer Backbones nitrogen, carbon or, preferably, oxygen. The X moiety 0247 Examples of nonionic linkages that may be used in pendant from the phosphorus may be fluorine, an alkyl or oligonucleotide analogs are shown in FIGS. 1A-1G. In Substituted alkyl, an alkoxy or Substituted alkoxy, a thio these figures, B represents a purine or pyrimidine base alkoxy or Substituted thioalkoxy, or unsubstituted, mono US 2006/OO63150 A1 Mar. 23, 2006

Substituted, or disubstituted nitrogen, including cyclic struc 0258 Serological identification employs a viral sample tures, Such as morpholines or piperidines. Alkyl, alkoxy and or culture isolated from a biological Specimen, e.g., Stool, thioalkoxy preferably include 1-6 carbon atoms. The Z urine, cerebroSpinal fluid, blood, etc., of the Subject. Immu moieties are Sulfur or oxygen, and are preferably oxygen. noassay for the detection of Virus is generally carried out by methods routinely employed by those of skill in the art, e.g., 0252) The linkages shown in FIGS. 2C and 2D are ELISA or Western blot. In addition, monoclonal antibodies designed for 7-atom unit-length backbones. In Structure 3C, Specific to particular viral Strains or Species are often com the X moiety is as in Structure 3B, and the moiety Y may be mercially available. methylene, Sulfur, or, preferably, oxygen. In Structure 2D, the X and Y moieties are as in Structure 2B. Particularly 0259 Culture methods may be used to isolate and iden preferred morpholino oligonucleotides include those com tify particular types of virus, by employing techniques posed of morpholino subunit structures of the form shown in including, but not limited to, comparing characteristics Such FIG. 2B, where X=NH or N(CH), Y=O, and Z=O. as rates of growth and morphology under various culture 0253) As noted above, the substantially uncharged oligo conditions. mer may advantageously include a limited number of 0260 Another method for identifying the viral infective charged linkages, e.g. up to about 1 per every 5 uncharged agent in an infected Subject employs one or more antisense linkages, more preferably up to about 1 per every 10 oligomers targeting broad families and/or genera of Viruses, uncharged linkages. Therefore a Small number of charged e.g., Picornaviridae, Caliciviridae, Togaviridae and Fla linkages, e.g. charged phosphoramidate or phosphorothio Viviridae. Sequences targeting any characteristic viral RNA ate, may also be incorporated into the oligomers. can be used. The desired target Sequences are preferably (i) 0254 The antisense compounds can be prepared by step common to broad virus families/genera, and (ii) not found in wise Solid-phase Synthesis, employing methods detailed in humans. Characteristic nucleic acid Sequences for a large the references cited above. In Some cases, it may be desir number of infectious viruses are available in public data able to add additional chemical moieties to the antisense bases, and may serve as the basis for the design of Specific compound, e.g. to enhance pharmacokinetics or to facilitate oligomers. capture or detection of the compound. Such a moiety may be 0261) For each plurality of oligomers, the following steps covalently attached, typically to a terminus of the oligomer, are carried out: (a) the oligomer(s) are administered to the according to Standard Synthetic methods. For example, addi Subject; (b) at a selected time after said administering, a tion of a polyethyleneglycol moiety or other hydrophilic body fluid sample is obtained from the subject; and (c) the polymer, e.g., one having 10-100 monomeric Subunits, may Sample is assayed for the presence of a nuclease-resistant be useful in enhancing Solubility. One or more charged heteroduplex comprising the antisense oligomer and a groups, e.g., anionic charged groupS. Such as an organic acid, complementary portion of the viral genome. Steps (a)-(c) are may enhance cell uptake. A reporter moiety, Such as fluo carried for at least one Such oligomer, or as many as is rescein or a radiolabeled group, may be attached for pur necessary to identify the virus or family of viruses. Oligo poses of detection. Alternatively, the reporter label attached mers can be administered and assayed Sequentially or, more to the oligomer may be a ligand, Such as an antigen or biotin, conveniently, concurrently. The Virus is identified based on capable of binding a labeled antibody or Streptavidin. In the presence (or absence) of a heteroduplex comprising the Selecting a moiety for attachment or modification of an antisense oligomer and a complementary portion of the viral antisense oligomer, it is generally of course desirable to genome of the given known virus or family of viruses. Select chemical compounds of groups that are biocompatible and likely to be tolerated by a subject without undesirable 0262 Preferably, a first group of oligomers, targeting side effects. broad families, is utilized first, followed by selected oligo mers complementary to specific genera and/or Species and/ V. Inhibition of Viral Replication or strains within the broad family/genus thereby identified. 0255 The antisense compounds detailed above are useful This Second group of oligomers includes targeting in inhibiting replication of ssRNA viruses of the Flaviviri Sequences directed to specific genera and/or Species and/or dae, Picornoviridae, Caliciviridae, Togaviridae, Arteriviri Strains within a broad family/genus. Several different Second dae, Coronaviridae, Astroviridae and Hepeviridae Virus oligomer collections, i.e. one for each broad virus family/ families. In one embodiment, Such inhibition is effective in genus tested in the first stage, are generally provided. treating infection of a host animal by these viruses. Accord Sequences are selected which are (i) specific for the indi ingly, the method comprises, in one embodiment, contacting vidual genus/species/strains being tested and (ii) not found a cell infected with the virus with an antisense agent in humans. effective to inhibit the replication of the specific virus. In this embodiment, the antisense agent is administered to a mam 0263 B. Administration of the Antisense Oligomer malian Subject, e.g., human or domestic animal, infected 0264. Effective delivery of the antisense oligomer to the with a given virus, in a Suitable pharmaceutical carrier. It is target nucleic acid is an important aspect of treatment. In contemplated that the antisense oligonucleotide arrests the accordance with the invention, routes of antisense oligomer growth of the RNA virus in the host. The RNA virus may be delivery include, but are not limited to, Various Systemic decreased in number or eliminated with little or no detri routes, including oral and parenteral routes, e.g., intrave mental effect on the normal growth or development of the nous, Subcutaneous, intraperitoneal, and intramuscular, as host. well as inhalation, transdermal and topical delivery. The appropriate route may be determined by one of skill in the 0256 A. Identification of the Infective Agent art, as appropriate to the condition of the Subject under 0257 The specific virus causing the infection can be treatment. For example, an appropriate route for delivery of determined by methods known in the art, e.g. Serological or an antisense oligomer in the treatment of a viral infection of cultural methods, or by methods employing the antisense the skin is topical delivery, while delivery of an antisense oligomers of the present invention. oligomer for the treatment of a viral respiratory infection is US 2006/OO63150 A1 Mar. 23, 2006 by inhalation. The oligomer may also be delivered directly tration are from about 1-100 mg oligomer per 70 kg. In Some to the site of viral infection, or to the bloodstream. cases, doses of greater than 100 mg oligomer/patient may be necessary. For i.v. administration, preferred doses are from 0265. The antisense oligomer may be administered in any about 0.5 mg to 100 mg oligomer per 70 kg. The antisense convenient vehicle which is physiologically acceptable. oligomer may be administered at regular intervals for a short Such a composition may include any of a variety of Standard time period, e.g., daily for two weeks or less. However, in pharmaceutically accepted carriers employed by those of Some cases the oligomer is administered intermittently over ordinary skill in the art. Examples include, but are not a longer period of time. Administration may be followed by, limited to, saline, phosphate buffered saline (PBS), water, or concurrent with, administration of an antibiotic or other aqueous ethanol, emulsions, Such as oil/water emulsions or therapeutic treatment. The treatment regimen may be triglyceride emulsions, tablets and capsules. The choice of adjusted (dose, frequency, route, etc.) as indicated, based on Suitable physiologically acceptable carrier will vary depen the results of immunoassays, other biochemical tests and dent upon the chosen mode of administration. physiological examination of the Subject under treatment. 0266. In Some instances, liposomes may be employed to 0271 C. Monitoring of Treatment facilitate uptake of the antisense oligonucleotide into cells. (See, e.g., Williams, S. A., Leukemia 10(12): 1980-1989, 0272 An effective in vivo treatment regimen using the 1996; Lappalainen et al., Antiviral Res. 23:119, 1994; Uhl antisense oligonucleotides of the invention may vary accord mann et al., ANTISENSE OLIGONUCLEOTIDES: A NEW ing to the duration, dose, frequency and route of adminis THERAPEUTIC PRINCIPLE, Chemical Reviews, Volume tration, as well as the condition of the Subject under treat 90, No. 4, pages 544-584, 1990; Gregoriadis, G., Chapter ment (i.e., prophylactic administration versus administration 14, Liposomes, Drug Carriers in Biology and Medicine, pp. in response to localized or Systemic infection). Accordingly, 287-341, Academic Press, 1979). Hydrogels may also be Such in Vivo therapy will often require monitoring by tests used as vehicles for antisense oligomer administration, for appropriate to the particular type of Viral infection under example, as described in WO 93/01286. Alternatively, the treatment, and corresponding adjustments in the dose or oligonucleotides may be administered in microSpheres or treatment regimen, in order to achieve an optimal therapeu microparticles. (See, e.g., Wu, G.Y. and Wu, C. H., J. Biol. tic outcome. Treatment may be monitored, e.g., by general Chem. 262:4429-4432, 1987). Alternatively, the use of gas indicators of infection, Such as complete blood count (CBC), filled microbubbles complexed with the antisense oligomers nucleic acid detection methods, immunodiagnostic tests, can enhance delivery to target tissues, as described in U.S. Viral culture, or detection of heteroduplex. Pat. No. 6,245,747. 0273 The efficacy of an in Vivo administered antisense 0267 Sustained release compositions may also be used. oligomer of the invention in inhibiting or eliminating the These may include Semipermeable polymeric matrices in the growth of one or more types of RNA virus may be deter form of Shaped articles Such as films or microcapsules. mined from biological Samples (tissue, blood, urine etc.) taken from a Subject prior to, during and Subsequent to 0268. In one aspect of the method, the subject is a human administration of the antisense oligomer. ASSays of Such Subject, e.g., a patient diagnosed as having a localized or Samples include (1) monitoring the presence or absence of Systemic viral infection. The condition of a patient may also heteroduplex formation with target and non-target dictate prophylactic administration of an antisense oligomer Sequences, using procedures known to those skilled in the of the invention, e.g. in the case of a patient who (1) is art, e.g., an electrophoretic gel mobility assay; (2) monitor immunocompromised; (2) is a burn victim; (3) has an ing the amount of Viral protein production, as determined by indwelling catheter; or (4) is about to undergo or has standard techniques such as ELISA or Western blotting, or recently undergone Surgery. In one preferred embodiment, (3) measuring the effect on viral titer, e.g. by the method of the oligomer is a phosphorodiamidate morpholino oligomer, Spearman-Karber. (See, for example, Pari, G. S. et al., contained in a pharmaceutically acceptable carrier, and is Antimicrob. Agents and Chemotherapy 39(5): 1157-1161, delivered orally. In another preferred embodiment, the oli 1995; Anderson, K. P. et al., Antimicrob. Agents and Che gomer is a phosphorodiamidate morpholino oligomer, con motherapy 40(9):2004-2011, 1996, Cottral, G. E. (ed) in: tained in a pharmaceutically acceptable carrier, and is deliv Manual of Standard Methods for Veterinary Microbiology, ered intravenously (i.v.). pp. 60-93, 1978). 0269. In another application of the method, the subject is 0274) A preferred method of monitoring the efficacy of a livestock animal, e.g., a chicken, turkey, pig, cow or goat, the antisense oligomer treatment is by detection of the etc., and the treatment is either prophylactic or therapeutic. antisense-RNA heteroduplex. At Selected time(s) after anti The invention also includes a livestock and poultry food Sense oligomer administration, a body fluid is collected for composition containing a food grain Supplemented with a detecting the presence and/or measuring the level of hetero Subtherapeutic amount of an antiviral antisense compound dupleX Species in the Sample. Typically, the body fluid of the type described above. Also contemplated is, in a Sample is collected 3-24 hours after administration, prefer method of feeding livestock and poultry with a food grain ably about 6-24 hours after administering. AS indicated Supplemented with Subtherapeutic levels of an antiviral, an above, the body fluid Sample may be urine, Saliva, plasma, improvement in which the food grain is Supplemented with blood, Spinal fluid, or other liquid Sample of biological a Subtherapeutic amount of an antiviral oligonucleotide origin, and may include cells or cell fragments Suspended composition as described above. therein, or the liquid medium and its Solutes. The amount of Sample collected is typically in the 0.1 to 10 ml range, 0270. The antisense compound is generally administered preferably about 1 ml or less. in an amount and manner effective to result in a peak blood concentration of at least 200-400 nM antisense oligomer. 0275. The sample may be treated to remove unwanted Typically, one or more doses of antisense oligomer are components and/or to treat the heterodupleX Species in the administered, generally at regular intervals, for a period of Sample to remove unwanted SSRNA overhang regions, e.g. about one to two weeks. Preferred doses for oral adminis by treatment with RNase. It is, of course, particularly US 2006/OO63150 A1 Mar. 23, 2006 important to remove overhang where heteroduplex detection a conjugate of the analog and an arginine-rich polypeptide relies on size Separation, e.g., electrophoresis of mass Spec capable of enhancing the uptake of the compound into host troScopy. cells. 0276 A variety of methods are available for removing 0286. In one embodiment, the compound is effective, unwanted components from the Sample. For example, Since when administered to the host cells, to form a heteroduplex the heterodupleX has a net negative charge, electrophoretic Structure (i) composed of the positive Sense Strand of the or ion exchange techniques can be used to Separate the heteroduplex from neutral or positively charged material. virus and the oligonucleotide compound, and (ii) character The Sample may also be contacted with a Solid Support ized by a Tm of dissociation of at least 45 C. and disruption having a Surface-bound antibody or other agent Specifically of Such Stem-loop Secondary Structure. able to bind the heteroduplex. After washing the Support to remove unbound material, the heteroduplex can be released EXAMPLES in Substantially purified form for further analysis, e.g., by 0287. The following examples illustrate but are not electrophoresis, mass spectroScopy or immunoassay. intended in any way to limit the invention. VI. Heteroduplex Complex Materials and Methods 0277. In another aspect, the invention includes a hetero 0288 Standard recombinant DNA techniques were duplex complex formed between: employed in all constructions, as described in Ausubel, FM 0278 (a) a region within the 5'-terminal 40 bases of the et al., in CURRENT PROTOCOLS IN MOLECULAR positive strand RNA of an RNA virus having a single BIOLOGY, John Wiley and Sons, Inc., Media, Pa., 1992 and Stranded, positive-Sense RNA genome and Selected from one Sambrook, J. et al., in MOLECULAR CLONING: A LABO of the Flaviviridae, Picornoviridae, Caliciviridae, Togaviri RATORY MANUAL, Cold Spring Harbor Laboratory Press, dae, Arteriviridae, Coronaviridae, Astroviridae or Hepeviri Cold Spring Harbor, N.Y., Vol. 2, 1989). dae families, which region is capable of forming internal Stem-loop Secondary Structure, and 0289 All peptides were custom synthesized by Global Peptide Services (Ft. Collins, Colo.) or at AVI BioPharma 0279 (b) an oligonucleotide analog compound charac (Corvallis, Oreg.) and purified to >90% purity (see Example terized by: 2 below). PMOs were synthesized at AVI BioPharma in 0280 (i) a nuclease-resistant backbone, accordance with known methods, as described, for example, in (Summerton and Weller 1997) and U.S. Pat. No. 5,185, 0281 (ii) capable of uptake by mammalian host cells, 444. 0282 (iii) containing between 12-40 nucleotide bases, 0290 PMO oligomers were conjugated at the 5' end with 0283 (iv) having a targeting Sequence of at least 12 an arginine-rich peptide (RFC-5'-PMO) to enhance cellu Subunits that is complementary to a region associated with lar uptake as described (U.S. Patent Application 60/466,703 Such stem-loop Secondary Structure within the 5'-terminal and (Moulton, Nelson et al. 2004). end 40 bases of the positive-sense RNA strand of the virus, 0284 where said heteroduplex complex has a Tm of Example 1 dissociation of at least 45 C. and disruption of Such Stem-loop Secondary Structure. Antisense Inhibition of Flaviviridae (Yellow Fever 0285) An exemplary compound is composed of mor Virus) In Vitro pholino Subunits linked by uncharged, phosphorus-contain ing interSubunit linkages, joining a morpholino nitrogen of 0291 Although an effective vaccine for yellow fever one Subunit to a 5’ exocyclic carbon of an adjacent Subunit. virus (YFV) has been available for many years, this virus The compound may have phosphorodiamidate linkages, continues to be a leading cause of hemorrhagic fever with mortality rates as high as 50%. Worldwide, there are 200,000 Such as in the Structure estimated cases of yellow fever (with 30,000 deaths) annu ally. Small numbers of imported cases also occur in coun tries free of yellow fever (WHO, Fact Sheet 100, 2001). 0292 A PMO antisense oligomer targeted to the 5' posi tive strand terminus of YFV (SEQ ID NO:49) was evaluated in a 4-concentration test. The standard CPE test used an 18 h monolayer (80-100% confluent) of Vero cells, medium was drained and each of the concentrations of PMO or Scramble control Sequence was added, followed within 15 min by virus or virus diluent. Two wells are used for each concentration of compound for both antiviral and cytotox icity testing. The plate was Sealed and incubated the Standard time period required to induce near-maximal viral CPE. The where Y=O, Z=O, P is a purine or pyrimidine base-pairing plate was then stained with neutral red by the method moiety effective to bind, by base-specific hydrogen bonding, described below and the percentage of uptake indicating to a base in a polynucleotide, and X is alkyl, alkoxy, viable cells read on a microplate autoreader at dual wave thioalkoxy, or alkyl amino. In a preferred compound, lengths of 405 and 540 nm, with the difference taken to X=NR, where each R is independently hydrogen or methyl. eliminate background. An approximated virus-inhibitory The compound may be the oligonucleotide analog alone or concentration, 50% endpoint (EC50) and cell-inhibitory US 2006/OO63150 A1 Mar. 23, 2006 concentration, 50% endpoint (IC50) was determined from reproductive failure in SOWS and respiratory disease in young which a general Selectivity index (S.I.) was calculated: pigs. The causative agent, PRRSV, is a single-stranded RNA S.I.=(IC50)/(EC50). An SI of 3 or greater indicates signifi Virus with genome organization Similar to that of other cant antiviral activity. The PMO targeting the 5' positive members of the Coronaviridae. PRRS causes heavy eco strand terminal region (SEQ ID NO:49) produced an SI of nomic losses to the Swine industry though a vaccine has been 21 in this assay. widely used for years. Specific anti-PRRSV drugs are urgently needed as one of the integrated Strategies to prevent Example 2 and control PRRSV infection. A PMO (PRRSV-1a, SEQ ID NO: 109) that targets the 5' positive strand terminal region Antisense Inhibition of Flaviviridae (Dengue virus of PRRSV was tested for its ability to inhibit viral replica Serotypes 1-4) In Vitro tion as described below. 0293 Dengue Fever/Dengue Hemorrhagic Fever (DF/ DHF) has become a major global health problem over the 0296. The first test was designed to determine whether past 20 years. Geographic distribution of the dengue virus the PRRSV-1a PMO could inhibit the development of virus (DEN), its mosquito Vectors and the disease burden it causes induced, cell pathogenic effect (CPE). ATCC CRL11171 continue to increase. The World Health Organization esti cells were used for this experiment as previously reported. mates that there are 50-100 million new infections yearly. The CRL11171 monolayer cells were treated with the DF/DHF is now a leading cause of hospitalization and death PRRSV-1 a PMO (SEQID NO:109) in DMEM for 4 hat 37° among children in Southern Asia, and its incidence is sharply C. The PMOS were removed from the cells and inoculated rising in the Americas. There is currently no vaccine or with PRRSV strain VR2385 at a multiplicity of infection effective therapeutic. One requirement of a Successful vac (MOI) of one. The cells were cultured and observed daily for cine or therapeutic is that it be effective against all 4 human CPE development. A blank control and the control PMO serotypes of DEN. The purpose of this study was to evaluate (DSscr, a scramble sequence PMO) were included as nega the efficacy and specificity of PMO that target the 5' posi tive controls. The cell culture medium was also collected tive-Strand terminal Stem loop at inhibiting the replication of and titrated in CRL11171 cells to determine PRRSV titer. four serotypes of DEN in Vero cells in culture. The PMO 0297. The PRRSV-1a PMO targeting the 5' positive was designed to target the Sequence element in the positive Strand end-terminus of the untranslated region (UTR), was strand DEN2 RNA that may be important in viral transcrip found to be effective in inhibiting PRRSV replication (FIG. tion and/or translation (Markoff 2003). The PMO in this 6). The cells treated with PRRSV-1a PMO at 16 uM had Study were conjugated to an arginine-rich peptide in order to much less cell pathogenic effect (CPE) development than facilitate entry into Vero E6 cells (Moulton, Nelson et al. controls (FIG. 7). CPE is clearly visible after PRRSV 2004; Neuman, Stein et al. 2004). infection (positive), while uninfected control cells remain an 0294) A PMO, 5'SL, (SEQ ID NO:51) designed to intact monolayer (blank). PMO PRRSV-1 a reduced CPE hybridize to the 5' positive Strand terminal region of Dengue development, while other PMOs including control PMO did 2 virus (DEN2), were evaluated for their ability to inhibit not have much effect in blocking CPE. The cells and Dengue virus replication in mammalian cell culture. The medium were harvested for titration of PRRSV yield. Tissue PMOS were conjugated to a short arginine-rich peptide culture infectious dose (TCID50) was calculated based on (RFC-5'-PMO) to facilitate their entry into cells in culture. CPE development of different dilutions. PRRSV-1a reduced Vero E6 cells were incubated with the PMO agents, inocu virus yield by more than 90% (not shown). lated with DEN serotypes 1-4 (DEN1, DEN2, DEN3, 0298. The inhibition of PRRSV replication by the DEN4, respectively), and viral titer determined by plaque PRRSV-1a PMO was also shown to be dose-dependent. assay 5-8 days later. The compound targeting the 5' positive Using the PMO-treatment and virus culture conditions strand terminus (5'SL) reduced the titer of DEN2 by over 4 described above, three different concentrations of PRRSV orders of magnitude, compared to controls, in a dose 1a and DSscr control PMO (4, 8 and 16 mM) were tested on dependent and Sequence-specific manner over a 4 day period PRRSV-infected CRRL11171 cells for the ability to inhibit as shown in FIG. 5A. Ten uM solutions of the 5'SL PMO viral replication as measured by viral titer. As shown in FIG. reduced the titer of all four Dengue serotypes by over two to 6, the PRRSV-1a PMO inhibits PRRSV replication in a four orders of magnitude, in Some cases below detectable dose-dependent manner. limits as shown in FIGS. 5A-5B. The 5'SL PMO was less effective against DEN4 (two log reduction) than it was Example 4 against DEN1, DEN2 and DEN3 (four log reductions) due to a two base pair mismatch between the 5'SL PMO and its Antisense Inhibition of Tick Borne Encephalitis target sequence in DEN4. The effective anti-DEN com Virus pounds did not alter the titer of West Nile Virus (WNV) grown in Vero E6 cells. This data indicates that the 5'SL 0299. This example describes a study that was devised to PMO compound is a potential DEN 1-4 therapeutic. test the antiviral activity of antisense PMO compounds of the present invention against two flaviviruses, Tick Borne Example 3 Encephalitis virus (TBE) and West Nile virus (WNV). Two PMO oligomers were evaluated for antiviral activity; TBE Antisense Inhibition of Coronaviridae (Porcine 5'SL, SEQ ID NO:57 and; a scramble control sequence Reproductive and Respiratory Syndrome Virus DSscr (5'-AGTCTCGACTTGCTACCTCA-3' SEQ ID PRRSV) In Vitro NO:133). Both PMO oligomers were conjugated at the 5' 0295 Porcine reproductive and respiratory syndrome end with an arginine-rich peptide (RFC-5'-PMO) to (PRRS) is a contagious viral disease that is characterized by enhance cellular uptake as described (U.S. Patent Applica US 2006/OO63150 A1 Mar. 23, 2006 22 tion 60/466,703 and (Moulton, Nelson et al. 2004). The with 270 microliters serum-free medium. The remainder of WNV infection provided a negative control infection as the sample was placed in cryotube and stored at -70° C. The there is no homology between WNV and the TBE 5'SL medium was removed from the 24-well plates and 250 ul of targeting PMO. This control indicates the level of non the titration dilutions were transferred from the 96-well specific viral suppression of each of the PMOS. The PMO plates to the 24 well plates which were incubated at 37 C. compounds were prepared to provide a 2 mM Stock Solution, for one hour. One ml agarose overlay medium was added to each well and after allowing the agarose to Set at room which were then titrated against a Standard dose of virus on temperature the plates were incubated at 37 C. for 5 days. tissue culture cells. Cells were infected with a multiplicity of After 5 days the plates were removed from the incubator, 1 infection (MOI) of 1 and the virus yield was assessed in ml 10%. Formol saline was added to each well and the plates Samples of Supernatant medium taken at 18 hours post were left at room temperature for 3 hours. The plates were infection. washed under running water to remove the agarose medium 0300. The two virus strains used in this example: and left to drain inverted while the remaining plates were washed. Each well then received 1 ml of 0.1% Naphthalene 0301) 1) TC 401 West Nile 99-34940-31A (New York black stain and the plates were left for 30 minutes before the Strain) Passage 2 Stain was removed and the plates washed under running 0302) 2) TC 339 Tick Borne Encephalitis virus (Hypr water. They were then left to dry (inverted) for 3 hours. Viral strain) Passage 49 plaques were counted to determine the titer. 0307 FIG. 8 shows the viral titer obtained from the 0303) Four T175 tissue culture flasks (NUNC) of SW 13 PMO-treated infections as a percentage of untreated control, cells (human caucasian adrenal cortex adenocarcinoma cell with virus-infected cells infected with either TBEV or WNV line ECAAC 87031801 grown in RPMI 1640 medium plus and treated with either the TBEV antisense compound where 5% FBS) at passage 130 were washed twice with trypsin the PMO compound is either 5'SL (SEQ ID NO:57) or EDTA (1x) and incubated for 2-3 minutes at 37° C. The cells control PMO (DSscr, a scrambled base sequence). As seen were resuspended in 11.5 ml growth medium per flask and from a comparison of the viral titers in FIG. 8, significant pooled. A cell count was performed on the pooled cell there is a reduction in viral titre in all cells (treated and suspension and the result was 1.74x10° cells/ml with 99% control) with increasing concentrations of compound, viability. Six mls of the cell Suspension was used to seed four thought to be due to a cell-toxicity effect of the attached T175 flasks and 40 ml of the cell suspension was diluted to arginine-rich peptide present in both antisense and control 270 ml. This was dispensed in 3 ml aliquots per well in 15 compounds. However, at compound concentrations of 5 uM Six-well plates. The plates were incubated overnight to form and above, there is seen a Sequence-specific increase in confluent cell monolayers. TBEV inhibition, both relative to WNV (FIG. 8), and 0304 Each of the PMO compounds was diluted to 25, 20, relative to the DSScr Scrambled control Sequence. 15, 10 and 5 uM in 4 ml serum-free RPMI 1640 medium. The medium was removed from the wells of two six-well Example 5 plates. 2 ml of the appropriate compound dilution was dispensed in all wells of a plate and this was repeated on Effect of PMO on West Nile Virus (WNV) separate plates for both PMO compounds. The plates were Infection in Mice incubated at 37 C. for 5 hours. The two viruses were 0308 PMOs are uncharged, water-soluble, nuclease-re removed from the -70° C. freezer and thawed rapidly. Each Sistant antisense agents that are typically Synthesized to a virus was diluted to 2x10 pfu/ml to produce 42 ml serum length of about 20 Subunits and contain purine and pyrimi free medium. The six-well plates were removed from the dine bases attached to a backbone composed of morpholine incubator and the pre-treatment medium aspirated from all rings joined by phosphorodiamidate interSubunit linkages. the wells. 1 ml of medium was added to each well of the In experiments in Support of the invention, it was shown that control plate (no compound). Each set of plates received 1 conjugation of an Arg-rich peptide (designated as P007; ml/well of either TBE or WN diluted to 2x10 pfu/ml. The SEQ ID NO:122) to the 5'-end of the PMOs greatly facili plates were incubated at room temperature for 1 hour and the tates the delivery of the PMO into cultured cells. P007 medium was then removed and replaced with 2 ml RPMI PMOS targeting different regions of the viral genome have 1640 plus 1% FBS plus the same concentration of test inhibited WNV virus infection to various degrees. Among compound as used to pre-treat the cells. The plates were them, PMOS targeting the 5'-terminal 20 nucleotides (5'End; incubated at 37° C. for 18 hours. SEQ ID NO:47) showed potent antiviral activity. 0305) To prepare 24 well plates for determining virus 0309 Experiments were conducted in mice to extend the titers, eight T175 tissue culture flasks (NUNC) of SW 13 observations to in vivo conditions. Female BALB/c mice cells at passage 131 were washed twice with trypsin-EDTA were used. The mice were obtained from Simonsen Labo (1x) and incubated for 2-3 minutes at 37 C. The cells were ratories (Gilroy, Calif.). At the time that the experiment was resuspended in 11.5 ml growth medium per flask and pooled. Started, the animals had been in the animal facility for one A cell count was performed on the pooled cell Suspension week and they were greater than 6 weeks of age. The mice and the result was 1.7x10 cells/ml with 99% viability. 80 ml weighed 12.3 to 19.8g with an average of 16.1 g. Experi of the cell suspension was diluted to 680 ml. These cells ments were conducted in the BSL-3 animal Suite at Utah were dispensed as 1 ml per well aliquots in eight 24-well State University Laboratory Animal Research Center plates. The plates were incubated overnight to form conflu (LARC). Two PMO compounds were used: 1) a PMO ent monolayers. targeting the 5' terminus (NGO40006; SEQ ID NO:47) and; 0306. At 18 hours post-infection the Supernatant media 2) the same PMO conjugated at its 5' end with the P007 from the PMO-treated, virus-infected six-well plates were arginine-rich peptide (SEQ ID NO: 122) and named harvested from each individual wells. Thirty microliters of NG040005. NGO40007 is an unconjugated, scramble con each harvest was placed in a Single cup of a 96-well plate trol PMO. AmpligenTM was used as a positive control, US 2006/OO63150 A1 Mar. 23, 2006 23 antiviral compound and was obtained from William M. Mitchell (School of Medical Pathology, Vanderbilt Univer TABLE 5-continued sity, Nashville, Tenn. 37240). Since ampligen is an RNA like molecule, care was used to prevent contamination with Sequence Listing Table RNase by using RNase-free materials and DEPC-treated SEQ Water. ID 0310 Ten animals were randomly assigned to each treat NO Sequence, 5' to 3' ment group, except for the placebo group 11, which had 20 animals. Intraperitoneal treatments were initiated 24 hours AGTAAATCCTGTGTGCTAATTGAGGTGCATTGGTCTGCAA before subcutaneous WNV challenge. PMO treatments con AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTG tinued qd, -4 hours before viral challenge, 1, 2, 3, 4, 5 and 5 days post-viral injection (dpi). Ampligen was treated i.p., GCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATCAC qd, -1, 1, 3, and 5 dpi. Dosages and treatment groups are indicated in the table below along with Survival and mean AGATTTTCGCACGTGCATGCGTTTGCTTCGGACAGCAT day to death (MDD). NG040005 and ampligen increased the AGATTTTCTTGCACGTGCGTGCGCTTGCTTCAGACAGCAA MDD of WNV-infected mice as compared to the placebo control (Table 4). AGATTTTCGCACGTGTGTGCGGGTGCTTAGTCAGTGT TTAAAACAGCTCTGGGGTTGTACCCACCCCAGAGGCCCAC TABLE 4 TTAAAACAGCCTGTGGGTTGTACCCACCCACAGGGCCCAC Effect of PMOS on West Nile virus infection in mice TTAAAACAGCCTGTGGGTTGTTCCCACCCACAGGCCCATT Animals: Female BALBfic mice, >6 wk old Virus: West Nile virus, NY crow brain homogenate, TTAAAACAGCTCTGGGGTTGCTCCCACCCCAGAGGCCCAC 10 infectious units, s.c. injection Drug diluent: saline TTAAAACAGCTCTGGGGTTGTTCCCACCCCAGAGGCCCAC Treatment schedule: qd, -1 d, -4 h, 1, 2, 3, 4, 5, 6 d Treatment Route: i.p. GAGTGTTCCCACCCAACAGGCCCACTGGGTGTTGTACTCT Duration of experiment: 21 days TTAAAACAGCCTGGGGGTTGTACCCACCCCTGGGGCCCAC % survival TTAAAACTGGGAGTGGGTTGTTCCCACTCACTCCACCCAT (alive? MDD + Survival Drug Dose Schedule total) SD analysis TTAAAACAGCGGATGGGTATCCCACCATTCGACCCATTGG

NGO4OOOS 250 qd, -1 d, 50%. 14.0 P = 0.2O 20 TTGAAAGGGGGCGCTAGGGTTTCACCCCTAGCATGCCAAC pig?inj -4 h, 1, 2, (5/10) 3.8* * * 3, 4, 5, 6 d 21 TTCAAGAGGGGTCTCCGGGAATTTCCGGAGTCCCTCTTGG NGO4OOO6 7SO qd, -1 d, 40% 8.2 P = 0.95 pig?inj -4 h, 1, 2, (4/10) 1.0 22 GTAAAAGAAATTTGAGACAATGTCTCAAACTCTGAGCTTC 3, 4, 5, 6 d ampligen 14 qd, -1 d, 80%. 13.5 P is 0.01* * 23 GTTAATGAGAAATGGCTTCTGCCATCGCTCTCTCGAGCTC mg/kg 1, 3, 5 d (8/10) 4.9 placebo qd, -1 d, 35% 8.6 24 GTGATCGTGATGGCTAATTGCCGTCCGTTGCCTATTGGGC -4 h, 1, 2, (7/20) 1.3 3, 4, 5, 6 d 25 GTGATTTAATTATAGAGAGATAGTGACTTTCACTTTTCTT

Mean day to death of mice dying prior to day 21. Student's t-test was 26 GTGAATGATGATGGCGTCAAAAGACGTCGTTCCTACTGCT used for analysis. Log-rank survival analysis. 27 GCCATGGAGGCCCATCAGTTTATTAAGGCTCCTGGCATCA Toxicity controls were not run in this first experiment because of limited amounts of compounds. 28 ATGGAAGCTATCGGACCTCGCTTAGGACTCCCATTCCCAT *P is 0.05, **P is 0.01, ***P is 0.001 compared to placebo. 29 ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCT 30 ACTTAAAAAGATTTTCTATCACGGATAGTTAGCTCTTTT

0311) 31 ACTTTTAAAGTAAAGTGAGTGTAGCGTGGCTATATCTCTT

TABLE 5 32 GATTGCGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGA Sequence Listing Table 33 ACTTAAGTACCTTATCTATCTACAGATAGAAAAGTTGCTT

SEQ 34 TATAAGAGTGATTGGCGTCCGTACGTACCCTCTCAACTCT ID NO Sequence, 5' to 3' 35 ATGACGTATAGGGTTGGCTCTAGCCTTGGCATTTGTAT

1 GNNGATGTTCGCGTCGGTGAGCGGAGAGGAAACAGATTTC 36 GCTCGAAGTGTGTATGGTGCCATATACGGCTCACCACCAT

2 AGAAGTTTACTGTGTGAACTTCTTGGCTTAGTATCGTTG 37 CCAAGAGGGGGGTGGTGATTGGCCTTTGGCTTATCAGTGT

3 AGACGTTCATCTGCGTGAGCTTCCGATCTCAGTATTGTTT 38 ATAGGGTACGGTGTAGAGGCAACCACCCTATTTCCACCTA

4 AGTAGTTCGCCTGTGTGAGCTGACAAACTTAGTAGTGTTT 39 ACCCTACAAACTAATCGATCCAATATGGAAAGAATTCACG US 2006/OO63150 A1 Mar. 23, 2006 24

TABLE 5-continued TABLE 5-continued Sequence Listing Table Sequence Listing Table

SEQ SEQ ID ID NO Sequence, 5' to 3' NO Sequence, 5' to 3'

40 ATGGGCGGCGCAAGAGAGAAGCCCAAACCAATTACCTACC 75 CAACCCACTCCCAGTTTTAA

41 ACCGACGCGAACATCNNC 76 ATGGGTGGAGTGAGTGGGAA

42 TCCTCTCCGCCACCGACGC 77 ATACCCATCCGCTGTTTTAA

43 TCACACAGATAAACTTCT 78 CCAATGGGTCGAATGGTGGG

44 AAGCCAAGAAGTTCACACAG 79 AACCCTAGCGCCCCCTTTCAA

45 TCACGCAGATGAACGTCT GTTGGCATGCTAGGGGTGAA

46 GAGATCGGAAGCTCACGCAG 81 TCCCGGAGACCCCTCTTGAA

47 GCTCACACAGGCGAACTACT 82 CCAAGAGGGACTCCGGAAAT

48 TAAGTTTGTCAGCTCACACAG 83 TTGTCTCAAATTTCTTTTAC

49 CAATTAGCACACAGGATTTACT 84 GAAGCTCAGAGTTTGAGACA

5 O TTGCAGACCAATGCACCTCA 85 AGAAGCCATTTCTCATTAAC

51 GTCCACGTAGACTAACAACT 86 GAGCTCGAGAGAGCGATGGC

52 GTCTTTGTCGGTCCACGTAG 87 CAATTAGCCATCACGATCAC

53 CCCATCAGGGGGCTGGC 88 GGCAACGGACGGCAATTAGC

54 TGGAGTGTCGCCCCCATCAG 89 TCTCTCTATAATAAATCAC

55 ATGCACGTGCAAGAAAATCT 9 O AAAGTCACTATCTCTCTATA

56 ATGCTGTCCGAAGCAAACGC 91 TTGACGCCATCATCATTCAC

57 CACGCACGTGCAAGAAAATCT 92 AGCAGTAGGAACGACGTCTT

58 TGAAGCAAGCGCACGCACGT 93 AACTGATGGGCCTCCATGGC

59 ACACACGTGCAAGAAAATCT 94 TGATGCCAGGAGCCTTAATA

60 ACACTGACTAAAGCACCCGC 95 CGAGGTCCGATAGCTTCCAT

61 GGTACAACCCCAGAGCTGTTTTAA 96 ATGGGAATGGGAGTCCTAAG

62 GTGGGCCTCTGGGGTGGGTA 97 GGTAGGTAAAAACCTAATAT

63 CAACCCACAGGCTGTTTTAA 98 AGGTTGGTTGGCTTTTCCTG

64 GTGGGCCCTGTGGGTGGGTA 99 GATAGAAAATCTTTTTAAGT

65 CAACCCACAGGCTGTTTTAA OO AAAAGAGCTAACTATCCGTA

66 AATGGGCCTGTGGGTGGGAA ACT CACTTTACTTTAAAAGT

67 CAACCCCAGAGCTGTTTTAA O2 GCCACGCTACACTCACTTTA

68 GTGGGCCTCTGGGGTGGGAG CACGCAAATCGCTCGCAATC

69 CAACCCCAGAGCTGTTTTAA TCAGTGAAGCGGGATGCACG

70 GTGGGCCTCTGGGGTGGGAA GATAGATAAGGTACTTAAGT

71. CCTGTTGGGTGGGAACACTC AAGCAACTTTTCACGTA

72 AGAGTACAACACCCAGTGGG CGGACGCCAATCACTCTTATA

73 CAACCCCCAGGCTGTTTTAA GAGTTGAGAGGGTACGTACGGA

74 GTGGGCCCCAGGGGTGGGTA CATAGAGCCAACACCTATACG US 2006/OO63150 A1 Mar. 23, 2006 25

TABLE 5-continued TABLE 5-continued Sequence Listing Table Sequence Listing Table

SEQ SEQ ID ID NO Sequence, 5' to 3' NO Sequence, 5' to 3'

O ATACAAATGCCAAGGCATAG P008 (RAhx) BAla 123 1 GCACCATACACACTTCGAGC RX4 (RAhx) Ala 124 2 ATGGTGGTGAGCCGTATATG 125 3 AATCACCACCCCCCTCTTGG RXR3 (RAhxR) Ahxf3Ala 126 4 GCCAAAGGCCAATCACCACC SEQ 5 GCCTCTACACCGTACCCTAT ID NO Sequence, 5' to 3' 6 TAGGTGGAAATAGGGTGGTT 127 ACAGGCGAACTACT GATCGATTAGTTTGTAGGGT 128 GTCAGCTCACAC 8 CGTGAACTTTCCAATTG 129 GCTCACACAGGCGA 9 TTCTCTCTTGCGCCGCCCAT 130 GCACACAGGATTTACT 2O GGTAGGTAATTGGTTTGGGC 131 GTCCAATGCACCTC. Peptide SEQ Sequences ID 132 CAATGCACCTCAATTAGC Name (NH2 to COOH) NO 133 AGTCTCGACTTGCTACCTCA POO3 RRRRRRRRRFFC 121

P007 (RAhxR) Ahxf3Ala 122 0312)

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS : 133 <210> SEQ ID NO 1 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: St. Louis encephalitis virus &22O > FEATURE <221> NAME/KEY: misc feature <222> LOCATION: (2) ... (3) <223> OTHER INFORMATION: n is a c, g, or t <400 SEQUENCE: 1

gningatgttc gcgtoggtga goggagagga aacagatttic 40

<210> SEQ ID NO 2 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Japanese encephalitis virus

<400 SEQUENCE: 2

agaagttitat citgttgttgaac ttcttggctt agtatcgttg 40

<210> SEQ ID NO 3 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Murray Valley encephalitis virus

US 2006/OO63150 A1 Mar. 23, 2006 27

-continued <210> SEQ ID NO 11 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Poliovirus - Mahoney strain <400 SEQUENCE: 11 ttaaaa.cago totggggttg tacccacccc agaggcc cac 40

<210> SEQ ID NO 12 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human enterovirus A

<400 SEQUENCE: 12 ttaaaa.cago citgtgg gttg tacccaccca cagggcc cac 40

<210> SEQ ID NO 13 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human enterovirus B

<400 SEQUENCE: 13 ttaaaa.cago citgtgg gttg titc.ccaccca caggcc.catt 40

<210> SEQ ID NO 14 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human enterovirus C

<400 SEQUENCE: 14 ttaaaa.cago totggggttg citc.ccacccc agaggcc cac 40

<210 SEQ ID NO 15 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human enterovirus D

<400 SEQUENCE: 15 ttaaaa.cago totggggttg titc.ccacccc agaggcc cac 40

<210> SEQ ID NO 16 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human enterovirus E

<400 SEQUENCE: 16 gagtgttc.cc accoaacagg cccactgggt gttgtactict 40

<210 SEQ ID NO 17 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Bovine enterovirus

<400 SEQUENCE: 17 ttaaaa.cago citgggggttg tacccacccc togggg.cccac 40

<210> SEQ ID NO 18 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human rhinovirus 89

<400 SEQUENCE: 18

US 2006/OO63150 A1 Mar. 23, 2006 29

-continued

&212> TYPE DNA <213> ORGANISM: Norwalk virus

<400 SEQUENCE: 26 gtgaatgatg atggcgtcaa aagacgtogt toc tact gct 40

<210 SEQ ID NO 27 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Hepatitis E virus <400 SEQUENCE: 27 gccatggagg cccatcagtt tatta aggct cotgg catca 40

<21 Oc EQ ID NO 28 <211 ENGTH 40 YPE DNA RGANISM: Rubella virus

<400 SEQUENCE: 28 atggaagcta togg acct cq cittaggactic ccattcc cat 40

EQ ID NO 29 ENGTH 40 YPE DNA RGANISM: SARS coronavirus

<400 SEQUENCE: 29 atattaggitt tttacctacc caggaaaagc caaccalacct 40

<210 SEQ ID NO 30 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Porcine epidemic diarrhea virus <400 SEQUENCE: 30 acttaaaaag attittctato tacggatagt tagctcittitt 40

<210> SEQ ID NO 31 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Transmissible gastroenteritis virus <400 SEQUENCE: 31 acttittaaag taaagtgagt gtagcgtggc tatat citctt 40

<210> SEQ ID NO 32 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Bovine coronavirus

<400 SEQUENCE: 32 gattgc gagc gatttgcgtg cqtgcatc.cc gottcactga 40

<210 SEQ ID NO 33 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human coronavirus 229E

<400 SEQUENCE: 33 acttaagtac cittatctato tacagataga aaagttgctt 40 US 2006/OO63150 A1 Mar. 23, 2006 30

-continued

<210> SEQ ID NO 34 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Murine Hepatitis virus <400 SEQUENCE: 34 tataag agtg attggcgtcc gtacgtaccc totcaactct 40

<210 SEQ ID NO 35 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Porcine reproductive and respiratory syndrome virus <400 SEQUENCE: 35 atgacgtata ggtgttggct citatgccttg gcatttgtat 40

<210 SEQ ID NO 36 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Equine arteritis virus <400 SEQUENCE: 36 gctogaagtg totato.gtgc catatacggc ticaccaccat 40

<210> SEQ ID NO 37 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Human astrovirus

<400 SEQUENCE: 37 ccaagagggg g g togtgatt goc ctittggc titatcagtgt 40

<21 Oc EQ ID NO 38 <211 ENGTH 40 YPE DNA RGANISM: Eastern equine encephalitis virus <400 SEQUENCE: 38 atagggitacg gtgtag aggc aaccacccita titt.ccaccita 40

EQ ID NO 39 ENGTH 40 YPE DNA : RGANISM: Western equine encephalomyelits virus <400 SEQUENCE: 39 accotacaaa citaatc gatc caatatggaa agaattcacg 40

<210> SEQ ID NO 40 <211& LENGTH: 40 &212> TYPE DNA <213> ORGANISM: Venezuelan equine encephalitis virus <400 SEQUENCE: 40 atggg.cgg.cg caa.gagagaa goccaaacca attacct acc 40

<210> SEQ ID NO 41 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial sequence US 2006/OO63150 A1 Mar. 23, 2006 31

-continued

&220s FEATURE <223> OTHER INFORMATION: synthetic antisense oligomer &220s FEATURE <221 NAME/KEY: misc feature <222> LOCATION: (16) . . (17) <223> OTHER INFORMATION: n is a c, g, or t <400 SEQUENCE: 41 accgacgcga acatcnn.c 18

<210> SEQ ID NO 42 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 42 toctotcc.gc ticaccgacgc 20

<210> SEQ ID NO 43 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 43 tdacacagat aaacttct 18

<210> SEQ ID NO 44 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 44 aa.gc.caagaa gttcacacag 20

<210> SEQ ID NO 45 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 45 to acgcagat gaacgt.ct 18

<210> SEQ ID NO 46 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 46 gagatcggala gct cacgcag 20

<210> SEQ ID NO 47 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence US 2006/OO63150 A1 Mar. 23, 2006 32

-continued

&220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 47 gctoacacag gogalactact 20

<210> SEQ ID NO 48 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 48 taagtttgtc agotcacaca g 21

<210 SEQ ID NO 49 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 49 caattagcac acaggattta ct 22

<210> SEQ ID NO 50 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 50 ttgcagacca atgcaccitca 20

<210 SEQ ID NO 51 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 51 gtocacgtag actaacaact 20

<210> SEQ ID NO 52 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 52 gtotttgtcg gtccacgtag 20

<210 SEQ ID NO 53 &2 11s LENGTH 17 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 53 US 2006/OO63150 A1 Mar. 23, 2006 33

-continued

CCCatCaggg ggctggc 17

SEQ ID NO 54 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 54 tggagtgtcg ccc.ccatcag 20

SEQ ID NO 55 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 55 atgcacgtgc aagaaaatct 20

SEQ ID NO 56 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 56 atgctgtc.cg aag caaacgc 20

SEQ ID NO 57 LENGTH 21 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 57 cacgcacgtg caagaaaatc t 21

SEQ ID NO 58 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 58 tgaa.gcaa.gc gcacgcacgt. 20

SEQ ID NO 59 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 59 acacacgtgc aagaaaatct 20 US 2006/OO63150 A1 Mar. 23, 2006 34

-continued <210 SEQ ID NO 60 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 60 acactgacta aag caccc.gc 20

<210> SEQ ID NO 61 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 61 ggtaca acco cagagctgtt ttaa 24

<210> SEQ ID NO 62 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 62 gtgggCCtct ggggtgggta 20

<210 SEQ ID NO 63 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 63 caa.cccacag gotgttittaa 20

<210> SEQ ID NO 64 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 64 gtgggCCCtg togggtgggta 20

<210 SEQ ID NO 65 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 65 caa.cccacag gotgttittaa 20

<210 SEQ ID NO 66 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence US 2006/OO63150 A1 Mar. 23, 2006 35

-continued

&220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 66 aatggg cct togggtgggaa 20

<210 SEQ ID NO 67 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 67 caa.ccc.ca.ga gctgttittaa 20

<210 SEQ ID NO 68 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 68 gtgggCCtct ggggtgggag 20

<210> SEQ ID NO 69 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 69 caa.ccc.ca.ga gctgttittaa 20

<210 SEQ ID NO 70 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 70 gtgggCCtct ggggtgggaa 20

<210 SEQ ID NO 71 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 71 cctgttgggt gggaac acto 20

<210 SEQ ID NO 72 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 72 US 2006/OO63150 A1 Mar. 23, 2006 36

-continued agagtacaac accoagtggg 20

SEQ ID NO 73 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 73 caa.ccc.ccag gotgttittaa 20

SEQ ID NO 74 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 74 gtgggCCC ca ggggtgggta 20

SEQ ID NO 75 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 75 caacco acto coagttittaa 20

SEQ ID NO 76 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 76 atgggtggag togagtgggaa 20

SEQ ID NO 77 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 77 atacco atcc gctgttittaa 20

SEQ ID NO 78 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 78 cCaatgggtc. gaatggtggg 20 US 2006/OO63150 A1 Mar. 23, 2006 37

-continued <210 SEQ ID NO 79 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 79 aaccotag cq coccctttca a 21

<210 SEQ ID NO 80 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 80 gttggCatgc taggggtgaa 20

<210> SEQ ID NO 81 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 81 toccggagac cccitcttgaa 20

<210> SEQ ID NO 82 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 82 ccaagaggga citc.cggaaat 20

<210 SEQ ID NO 83 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 83 ttgttctgaaa tittcttttac 20

<210> SEQ ID NO 84 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 84 gaagcticaga gtttgaga.ca 20

<210 SEQ ID NO 85 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence US 2006/OO63150 A1 Mar. 23, 2006 38

-continued

&220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 85 agaag.ccatt totcattaac 20

<210 SEQ ID NO 86 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 86 gagctc.gaga gag.cgatggC 20

<210 SEQ ID NO 87 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 87 caattagcca toacgatcac 20

<210> SEQ ID NO 88 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 88 ggcaa.cggac ggcaattagc 20

<210 SEQ ID NO 89 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 89 totctictata attaaatcac 20

<210 SEQ ID NO 90 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 90 aaagttcacta totctotata 20

<210 SEQ ID NO 91 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 91 US 2006/OO63150 A1 Mar. 23, 2006 39

-continued ttgacgc.cat catcattcac 20

SEQ ID NO 92 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 92 agcagtagga acgacgtc.tt 20

SEQ ID NO 93 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 93 aact gatggg cctocatggc 20

SEQ ID NO 94 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 94 tgatgc.cagg agc cittaata 20

SEQ ID NO 95 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 95 c gaggtocga tagctitcc at 20

SEQ ID NO 96 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 96 atgggaatgg gagtcCtaag 20

SEQ ID NO 97 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 97 gg taggtaaa aacctaatat 20 US 2006/OO63150 A1 Mar. 23, 2006 40

-continued <210 SEQ ID NO 98 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 98 aggttggttg gcttitt.cctg 20

<210 SEQ ID NO 99 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 99 gatagaaaat citttittaagt 20

<210> SEQ ID NO 100 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 100 aaaagagcta act atc.cgta 20

<210> SEQ ID NO 101 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 101 actcactitta ctittaaaagt 20

<210> SEQ ID NO 102 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 102 gccacgctac acticactitta 20

<210> SEQ ID NO 103 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: synthetic antisense oligomer <400 SEQUENCE: 103 cacgcaaatc gctcgcaatc 20

<210> SEQ ID NO 104 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence US 2006/OO63150 A1 Mar. 23, 2006 41

-continued

&220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 104 toagtgaagc gggatgcacg 20

<210 SEQ ID NO 105 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 105 gatagataag gtacttaagt 20

<210> SEQ ID NO 106 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 106 aag caactitt totatotgta 20

<210> SEQ ID NO 107 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 107 cggacgc.caa toactcittat a 21

<210 SEQ ID NO 108 <211& LENGTH 22 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 108 gagttgagag ggtacgitacg ga. 22

<210 SEQ ID NO 109 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 109 catagagcca acaccitatac g 21

<210> SEQ ID NO 110 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 110 US 2006/OO63150 A1 Mar. 23, 2006 42

-continued atacaaatgc caaggcatag 20

SEQ ID NO 111 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 111 gcaccataca cacttic gagc 20

SEQ ID NO 112 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 112 atggtggtga gcc.gtatatg 20

SEQ ID NO 113 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 113 aatcaccacc cccctdttgg 20

SEQ ID NO 114 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 114 gccaaaggcc aatcaccacc 20

SEQ ID NO 115 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 115 gcctctacac cqtacccitat 20

SEQ ID NO 116 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 116 taggtgaaa tagggtggitt 20 US 2006/OO63150 A1 Mar. 23, 2006 43

-continued <210> SEQ ID NO 117 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 117 gatcgattag tttgtagggit 20

<210> SEQ ID NO 118 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 118 cgtgaattct titccatattg 20

<210 SEQ ID NO 119 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 119 ttctdtcttg cgcc.gc.ccat 20

<210> SEQ ID NO 120 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 120 gg taggtaat tdgtttgggc 20

<210> SEQ ID NO 121 <211& LENGTH: 12 &212> TYPE PRT <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic arginine-rich peptide <400 SEQUENCE: 121 Arg Arg Arg Arg Arg Arg Arg Arg Arg Phe Phe Cys 1 5 10

<210> SEQ ID NO 122 <211& LENGTH: 14 &212> TYPE PRT <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic arginine-rich peptide &220s FEATURE <221 NAME/KEY: misc feature <222> LOCATION: (2) ... (2) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (5) . . (5) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE US 2006/OO63150 A1 Mar. 23, 2006 44

-continued <221 NAME/KEY: MISC FEATURE <222> LOCATION: (8) ... (8) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (11) . . (11) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (13) . . (13) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (14) . . (14) <223> OTHER INFORMATION: Xaa = beta-Alanine

<400 SEQUENCE: 122 Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa Xala 1 5 10

<210> SEQ ID NO 123 &2 11s LENGTH 17 &212> TYPE PRT <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic arginine-rich peptide &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (2) ... (2) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (4) ... (4) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (6) . . (6) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (8) ... (8) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (10) . . (10) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (12) . . (12) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (14) . . (14) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (16) . . (16) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (17) . . (17) <223> OTHER INFORMATION: Xaa = beta-Alanine

<400 SEQUENCE: 123 Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa 1 5 10 15

Xaa

<210> SEQ ID NO 124 &2 11s LENGTH 9 &212> TYPE PRT US 2006/OO63150 A1 Mar. 23, 2006 45

-continued <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic arginine-rich peptide &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (2) ... (2) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (4) ... (4) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (6) . . (6) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (8) ... (8) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (9) ... (9) <223> OTHER INFORMATION: Xaa = beta-Alanine

<400 SEQUENCE: 124 Arg Xaa Arg Xaa Arg Xaa Arg Xaa Xala 1 5

<210> SEQ ID NO 125 &2 11s LENGTH 8 &212> TYPE PRT <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic arginine-rich peptide &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (2) ... (2) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (5) . . (5) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (7) . . (7) <223> OTHER INFORMATION: Xaa = 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (8) ... (8) <223> OTHER INFORMATION: Xaa = beta-Alanine

<400 SEQUENCE: 125 Arg Xaa Arg Arg Xaa Arg Xaa Xala 1 5

<210> SEQ ID NO 126 <211& LENGTH: 11 &212> TYPE PRT <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic arginine-rich peptide &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (2) ... (2) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (5) . . (5) &223> OTHER INFORMATION Xaa 6-aminohexanoic acid &220s FEATURE <221 NAME/KEY: MISC FEATURE <222> LOCATION: (8) ... (8) US 2006/OO63150 A1 Mar. 23, 2006 46

-continued

OTHER INFORMATION Xaa 6-aminohexanoic acid FEATURE: NAME/KEY: MISC FEATURE LOCATION: (10) . . (10) OTHER INFORMATION Xaa 6-aminohexanoic acid FEATURE: NAME/KEY: MISC FEATURE LOCATION: (11) . . (11) OTHER INFORMATION Xaa beta-Alanine

<400 SEQUENCE: 126 Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xala Xaa 1 5 10

SEQ ID NO 127 LENGTH 14 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 127 acaggc gaac tact 14

SEQ ID NO 128 LENGTH 12 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 128 gtoagctoac ac 12

SEQ ID NO 129 LENGTH 14 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: synthetic antisense oligomer <400 SEQUENCE: 129 gctoacacag goga 14

SEQ ID NO 130 LENGTH 16 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 130 gcacacagga tttact 16

SEQ ID NO 131 LENGTH 14 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 131 gtocaatgca ccto 14 US 2006/OO63150 A1 Mar. 23, 2006 47

-continued <210> SEQ ID NO 132 &2 11s LENGTH 18 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic antisense oligomer <400 SEQUENCE: 132 caatgcacct caattagc 18

<210> SEQ ID NO 133 &2 11s LENGTH 2.0 &212> TYPE DNA <213> ORGANISM: Artificial sequence &220s FEATURE <223> OTHER INFORMATION: Synthetic scramble control <400 SEQUENCE: 133 agtctogact tdctacctca 20

It is claimed: 4. The method of claim 3, wherein said intersubunit 1. A method of producing an anti-Viral compound capable linkages are phosphorodiamidate linkages. of inhibiting the replication of an RNA virus having a 5. The method of claim 4, wherein said morpholino Single-Stranded, positive-Sense genome and Selected from Subunits are joined by phosphorodiamidate linkages, in one of the Flaviviridae, Picornoviridae, Caliciviridae, accordance with the Structure: Togaviridae, Arteriviridae, Coronaviridae, Astroviridae and Hepeviridae virus families, said method comprising (a) identifying as a viral target Sequence, in the 5'-terminal 40 bases of the positive strand of the selected virus, a ZEP-X region whose Sequence is capable of forming internal Stem-loop Secondary Structure, Y1 (b) constructing, by step-wise Solid-phase synthesis, an oligonucleotide analog compound characterized by: r Pi (i) a nuclease-resistant backbone, N (ii) capable of uptake by mammalian host cells, (iii) containing between 12-40 nucleotide bases, and where Y=O, Z=O, P is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, (iv) having a targeting sequence of at least 12 Subunits to a base in a polynucleotide, and X is alkyl, alkoxy, that is complementary to the virus-genome region thioalkoxy, or alkyl amino. capable of forming internal duplex Structure, and 6. The method of claim 1, wherein the compound to which (v) an ability to form with the viral target Sequence, a the cells are exposed is conjugated to an arginine-rich heteroduplex structure (i) composed of the positive polypeptide effective to promote uptake of the compound Sense Strand of the virus and the oligonucleotide com into infected host cells. pound, and (ii) characterized by a Tm of dissociation of 7. The method of claim 6, wherein the arginine rich at least 45 C. and disruption of Such stem-loop struc peptide has one of the sequences identified as SEQ ID NOS: ture. 121-126. 2. The method of claim 1, wherein Said identifying Step 8. A method of inhibiting in a mammalian host cell, includes (i) analyzing the 5'-terminal 40 bases of the positive replication of an infecting RNA virus having a single Strand of the Selected virus by a computer program capable Stranded, positive-Sense genome and Selected from one of of performing Secondary Structure predictions based on a the Flaviviridae, Picornoviridae, Caliciviridae, Togaviridae, search for the minimal free energy state of the input RNA Arteriviridae, Coronaviridae, Astroviridae or Hepeviridae Sequence, and (ii) identifying as at least a portion of the viral families, comprising target Sequence, a Sequence capable of forming internal duplex RNA structure. administering to the infected host cells, a virus-inhibitory 3. The method of claim 1, wherein said oligonucleotide is amount of an oligonucleotide analog compound char composed of morpholino Subunits linked by uncharged, acterized by: phosphorus-containing interSubunit linkages, joining a mor pholino nitrogen of one Subunit to a 5’ exocyclic carbon of (i) a nuclease-resistant backbone, an adjacent Subunit. (ii) capable of uptake by mammalian host cells, US 2006/OO63150 A1 Mar. 23, 2006 48

(iii) containing between 12-40 nucleotide bases, and 18. A heteroduplex complex formed between: (iv) having a targeting sequence of at least 12 Subunits (a) a region within the 5'-terminal 40 bases of the positive that is complementary to a region within the 5'-terminal strand RNA of an RNA virus having a single-stranded, 40 bases of the positive-Strand Viral genome that is positive-Sense RNA genome and Selected from one of capable of forming internal Stem-loop Secondary Struc the Flaviviridae, Picornoviridae, Caliciviridae, ture, and Togaviridae, Arteriviridae, Coronaviridae, Astroviridae by Said administering, forming within the host cell, a or Hepeviridae families, which region is capable of heteroduplex structure (i) composed of the positive forming internal Stem-loop Secondary Structure, and Sense Strand of the virus and the oligonucleotide com (b) an oligonucleotide analog compound characterized pound, and (ii) characterized by a Tm of dissociation of by: at least 45 C. and disruption of Such stem-loop Sec ondary Structure. (i) a nuclease-resistant backbone, 9. The method of claim 8, wherein said oligonucleotide is (ii) capable of uptake by mammalian host cells, composed of morpholino Subunits linked by uncharged, phosphorus-containing interSubunit linkages, joining a mor (iii) containing between 12-40 nucleotide bases, pholino nitrogen of one Subunit to a 5’ exocyclic carbon of (iv) having a targeting sequence of at least 12 Subunits an adjacent Subunit. that is complementary to a region associated with Such 10. The method of claim 9, wherein said interSubunit Stem-loop Secondary Structure within the 5'-terminal linkages are phosphorodiamidate linkages. end 40 bases of the positive-sense RNA strand of the 11. The method of claim 10, wherein said morpholino Virus, Subunits are joined by phosphorodiamidate linkages, in where Said heteroduplex complex has a Tm of dissocia accordance with the Structure: tion of at least 45 C. and disruption of such stem-loop Secondary Structure. 19. The complex of claim 18, wherein said oligonucle otide is composed of morpholino Subunits linked by uncharged, phosphorus-containing interSubunit linkages, joining a morpholino nitrogen of one Subunit to a 5' exocy clic carbon of an adjacent Subunit. 20. The complex of claim 19, wherein said intersubunit linkages are phosphorodiamidate linkages. 21. The complex of claim 20, wherein said morpholino Subunits are joined by phosphorodiamidate linkages, in accordance with the Structure: where Y=O, Z=O, P is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X is alkyl, alkoxy, ZEP-X thioalkoxy, or alkyl amino. 12. The method of claim 11, wherein X=NR, where each l, R is independently hydrogen or methyl. 13. The method of claim 8, wherein said compound is a r Pi covalent conjugate of an oligonucleotide analog moiety N capable of forming Such a heteroduplex Structure with the positive Sense Strand of the virus, and an arginine-rich polypeptide effective to enhance the uptake of the compound into host cells. where Y=O, Z=O, P is a purine or pyrimidine base-pairing 14. The method of claim 8, wherein the compound to moiety effective to bind, by base-specific hydrogen bonding, which the cells are exposed is conjugated to an arginine-rich to a base in a polynucleotide, and X is alkyl, alkoxy, polypeptide effective to promote uptake of the compound thioalkoxy, or alkyl amino. into infected host cells. 22. The complex of claim 21, wherein X=NR, where 15. The method of claim 14, wherein the arginine rich each R is independently hydrogen or methyl. peptide has one of the sequences identified as SEQ ID NOS: 23. A method of detecting the presence of a viral infection 121-126. by an RNA virus having a single-Stranded, positive-Sense RNA genome and selected from one of the Flaviviridae, 16. The method of claim 8, for use in treating a mamma Picornoviridae, Caliciviridae, Togaviridae, Arteriviridae, lian subject infected with the virus, or at risk of infection Coronaviridae, Astroviridae or Hepeviridae families a in a with the virus, wherein Said compound is administered to the mammalian Subject, or for confirming the presence of an host, in a therapeutically effective amount, by intravenous or effective interaction between Such a virus infecting a mam oral administration. malian Subject and an antisense oligonucleotide analog 17. The method of claim 8, wherein the compound compound directed against the virus, comprising administered is a cocktail of Such compounds directed against two or more of Said positive-Strand Single-Strand (a) administering to the Subject, an uncharged morpholino RNA viruses. oligonucleotide analog compound having (a) a US 2006/OO63150 A1 Mar. 23, 2006 49

Sequence of 12-40 Subunits, including a targeting of dissociation of at least 45 C. and disruption of said Sequence of at least 12 Subunits that is complementary Stem-loop Secondary Structure. to a region associated with Stem-loop Secondary Struc 26. The compound of claim 25, composed of morpholino ture within the 5'-terminal end 40 bases of the positive Subunits linked by uncharged, phosphorus-containing inter sense RNA strand of the virus, (b) morpholino subunits Subunit linkages, joining a morpholino nitrogen of one linked by uncharged, phosphorus-containing interSub Subunit to a 5' exocyclic carbon of an adjacent Subunit. unit linkages, each linkage joining a morpholino nitro 27. The compound of claim 26, wherein said intersubunit gen of one Subunit to a 5' exocyclic carbon of an linkages are phosphorodiamidate linkages. adjacent Subunit, and (c) is capable of forming with the 28. The compound of claim 27, wherein said morpholino positive-Strand viral SSRNA genome, a heteroduplex Subunits are joined by phosphorodiamidate linkages, in Structure characterized by a Tm of dissociation of at accordance with the Structure: least 45 C. and disruption of Said stem-loop Secondary Structure, (b) at a selected time after said administering, obtaining a sample of a body fluid from the Subject; and ZEP-X (c) assaying the Sample for the presence of a nuclease resistant heteroduplex comprising the antisense oligo l, nucleotide complexed with a complementary-Sequence 5'-end region of the positive-strand RNA of the virus. r Pi 24. The method of claim 23, for use in determining the N effectiveness of treating a Flaviviridae, Picornoviridae, Cali civiridae, Togaviridae, Arteriviridae, Coronaviridae, Astro Viridae or Hepeviridae infection by administering Said com pound, wherein Said administering, obtaining, and assaying where Y=O, Z=O, P is a purine or pyrimidine base-pairing is conducted at periodic intervals throughout a treatment moiety effective to bind, by base-specific hydrogen bonding, period. to a base in a polynucleotide, and X is alkyl, alkoxy, 25. An oligonucleotide analog compound for use in inhib thioalkoxy, or alkyl amino. iting replication in mammalian host cells of an RNA virus 29. The compound of claim 28, wherein X=NR, where having a single-Stranded, positive-Sense RNA genome and each R is independently hydrogen or methyl. Selected from the Flaviviridae, Picornoviridae, Caliciviri 30. The compound of claim 25, wherein said oligomer has dae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae a T, with respect to binding to said viral target sequence, or Hepeviridae, and characterized by: of greater than about 50 C., and said compound is actively (i) a nuclease-resistant backbone, taken up by mammalian cells. 31. The compound of claim 25, which is a covalent (ii) capable of uptake by mammalian host cells, conjugate of an oligonucleotide analog moiety capable of (iii) containing between 12-40 nucleotide bases, forming Such a heteroduplex Structure with the positive Sense Strand of the virus, and an arginine-rich polypeptide (iv) having a targeting sequence of at least 12 Subunits effective to enhance the uptake of the compound into host that is complementary to a region associated with cells. Stem-loop Secondary Structure within the 5'-terminal 32. The method of claim 31, wherein the arginine rich end 40 bases of the positive-sense RNA strand of the peptide has one of the sequences identified as SEQ ID NOS: Virus, and 121-126. (v) capable of forming with the positive-strand viral SSRNA genome, a heteroduplex Structure having a Tm