Evolutionary Ecology Research — Volume 19 (2019)

APPENDIX

On the rediscovery of Volvox perglobator (Volvocales, Chlorophyceae) and the evolution of outcrossing from self-fertilization

Erik R. Hanschen1,2,*, Dinah R. Davison2, Patrick J. Ferris2, Richard E. Michod2

1 Division of Bioscience, Los Alamos National Laboratory, Los Alamos, New Mexico 87544 2Department of Ecology and Evolutionary Biology, University of Arizona

*Correspondence: [email protected] Morphological tree estimation

We accounted for the substantial effect of lost Volvox section Volvox species (Volvox merrillii, Volvox amboensis, Volvox prolificus) on ancestral state reconstruction (Figure S3) by estimating a tree from morphological traits for the seven species with genetic data. If the morphological tree and genetic tree are congruent, morphology may be used to estimate species relationships. We used previously defined morphological traits (Nozaki and Itoh 1994) and traits which serve to morphologically identify species (Isaka et al. 2012), for a total of 39 traits. After removing invariant traits, seven traits remained (Table S3). Other traits (cell number, colony length, etc.) are not included as they are highly variable within species (Isaka et al. 2012; Nozaki et al. 2015).

It was not possible to use PartitionFinder (Lanfear et al. 2016) to automatically identify the optimal model of evolution due to an insufficient number of traits; therefore, trees were estimated using both BINCAT and BINGAMMA models. Trees were made with RAxML version 8.0.20 (Stamatakis 2014) using 1,000 bootstraps. Both morphological trees had poor bootstrap support (below 32, Figure S4), and both trees were discordant with the chloroplast and ITS trees (normalized Robinson-Foulds distance, 50 to 75% of nodes different; Robinson & Foulds, 1981). Morphological traits cannot be used to accurately estimate the chloroplast and ITS trees (Figure S4), therefore we cannot reliably use morphological traits to infer the phylogenetic placement of lost Volvox section Volvox species. Furthermore this approach is not feasible as mating system, the trait we reconstruct, is included in this matrix.

Chloroplast tree estimation

We utilized a recently estimated volvocine chloroplast phylogeny (Hanschen et al. 2018a). Briefly, this phylogeny uses the coding sequences of five chloroplast genes (ATP synthase beta- subunit, atpB; P700 chlorophyll a-apoprotein A1, psaA; P700 chlorophyll a-apoprotein A2, psaB; photosystem II CP43 apoprotein, psbC; and the large subunit of Rubisco, rbcL; 6,021 base pairs total). The ingroup was defined as the smallest clade containing Chlamydomonas

-1- reinhardtii and Volvox carteri. The data matrix included sequences for 97 volvocine OTUs and seven outgroup taxa (Table S1). The outgroup consisted of non-volvocine algae, including two taxon from the immediate sister group and one taxa from each of five other major groups (Herron and Michod 2008; Hanschen et al. 2018a). The best partitioning scheme and nucleotide substitution models were determined using PartitionFinder version 2.1.1 (Lanfear et al. 2016) using AICc and a greedy search algorithm with branch lengths linked (Hanschen et al. 2018a).

A concatenated phylogeny was generated using Bayesian Markov chain Monte Carlo implemented in MrBayes version 3.2.2 (Ronquist et al. 2012). Four independent Bayesian runs of four chains each (three heated chains and one cold chain) were run for 2.5×107 generations with a burn-in of 5×106 generations. Trees were sampled every 100 generations. We considered the runs to have adequately sampled the solution space when the standard deviation of split frequencies was below 5×10-3. Post burn-in trees were combined and assembled to construct a majority-rule consensus phylogram and calculate posterior probabilities. An ultrametric tree, necessary for ancestral-state reconstruction, was calculated using a penalized likelihood function in the ape R package with a correlated model with no age constraints (Sanderson 2002; Paradis et al. 2004). The chloroplast tree, with 97 volvocine taxa and seven outgroup taxa, was independently constructed using maximum likelihood (ML) methods using RAxML version 8.1.12 (Stamatakis 2014) with the rapid bootstrap analysis and the partition scheme previously identified (Hanschen et al. 2018a) by PartitionFinder (Lanfear et al. 2016), generating 200 ML replicate trees to estimate bootstrap support.

Taxa of the same species were previously identified (Hanschen et al. 2018b) using a single rate Poisson Tree Processes (PTP) method (Fujisawa and Barraclough 2013). A maximum likelihood approach with a default p-value of 0.001 was used (Hanschen et al. 2018b). Multiple genetically-unique individuals of the same species, as well as species with unknown mating system (heterothallic outcrossing or homothallic selfing) were trimmed from the final tree (which contained 69 species) using the R package ape (Paradis et al. 2004).

-2- Ancestral-state reconstructions

Maximum likelihood ancestral states were reconstructed using the R package diversitree version 0.9-9 (FitzJohn 2012). Two models of character evolution were evaluated for the evolution of selfing and outcrossing (Table S2): (1) an equal rates of change for both transitions between states (ER model) and (2) all rates different for both transitions between states (ARD model). Model fit was compared using the AIC (Akaike 1974), corrected for small sample size (Burnham and Anderson 2002), which should reveal the best-fitting model without including unnecessary parameters. The best-fitting model was ARD (ÄAICc = 8.59). Alternative root state models were evaluated by comparing their likelihoods while holding the best-fitting transition model constant. These models included an equal probability for each state, probabilities based on the frequency of each state among species on the tree, or fixed in either selfing/outcrossing state). We found

that the ÄAICc values for alternative root state models were indistinguishable (ÄAICc < 8.2×10- 4 for all reconstructions). Therefore, the root prior was weighted based on the observed frequency of each state among taxa across the tree (FitzJohn 2012) following (Hanschen et al. 2018b). The state with the highest probability was considered the most likely for a given node and considered to be significantly supported at a given node only if it was at least 7.39 times (if the natural logarithm of the ratio of two likelihoods is greater than 2) more likely than the alternative state (Pagel 1999).

Tree topology in phylogenetic simulations

A small proportion (4.46%) of trees reconstructed an alternative evolutionary history with mostly outcrossing ancestors and numerous (5-7) independent origins of selfing in Volvox section Volvox (Figure 3C, upper left black box). In order to better understand these reconstructions, we analyzed 1,000 trees for each method of assigning lost Volvox species to a branch ((1) Equal, (2) Proportional, (3) Inverse Proportional). We extracted all trees with an

-3- outcrossing evolutionary history (Equal, 17; Proportional, 13; Inverse Proportional, 86), and an equal number of trees with a selfing evolutionary history (Figure 3C, lower right black box). There were significantly more trees with this outcrossing evolutionary history in the Inverse Proportional sample than the Equal sample (G test of independence, G = 48.247, p = 3.7×10-12) or the Proportional sample (G test of independence, G = 57.706, p = 3.0×10-14).

We tested two hypotheses for how different tree topology has resulted in radically different reconstructions: (1) when outcrossing V. prolificus is sister to outcrossing V. rousseletii or outcrossing V. perglobator, a selfing evolutionary history is inferred (and when V. prolificus is not sister to V. rousseletii or V. perglobator, an outcrossing history with numerous origins of selfing is preferred over three independent reversions), and (2) a tree topology with more recent speciation events results in an outcrossing evolutionary history. The frequency with which V. prolificus is sister to another outcrossing species is not significantly different in outcrossing and selfing evolutionary histories (G test of independence, G = 2.755, p = 0.097). Therefore, the topology of V. prolificus relative to other outcrossing species does not differentiate these evolutionary histories.

Alternatively, the average branch length of the three lost Volvox species strongly correlates with outcrossing or selfing evolutionary history (one sided Mann-Whitney U test, W = 16300, p = 2.2×10-16, Mann and Whitney 1947). More recent speciation events strongly correlate with an outcrossing ancestor with numerous origins of selfing. This is consistent with the observation of more outcrossing evolutionary histories in the Inverse Proportional sample, which preferentially added lost Volvox species to short branches (which seem to be more recent, Figure 2). If speciation events are extremely recent, then the inferred reverse transition rate must be extremely high, which is discordant with the rest of the volvocine tree (Figure S2), resulting in an alternative reconstruction with numerous (5-7) independent origins of selfing.

A small number of simulations (4.46%) predicted a largely outcrossing ancestry in Volvox section Volvox (Figure 3C, upper left black box). However, these reconstructions are the consequence of extremely recent simulated speciation events within Volvox section Volvox. The

-4- disparate geographical distribution of outcrossing Volvox section Volvox species (V. rousseletii, Africa; V. perglobator, North America; V. prolificus, India; Smith 1944; Coleman 2012; Isaka et al. 2012), may suggest that the simulations with extremely recent speciation events do not reflect true species divergence. If so, multiple reversions to outcrossing in the volvocine algae are even more likely than the simulations suggest. On the other hand, it must be noted that volvocine geographical distributions are uncertain given relatively poor sampling.

Sequencing FUS1, MID, and ITS sequences

In order to better understand the genetic basis underlying evolutionary transitions between outcrossing and selfing, we tested the presence and absence of the MID gene in outcrossing Volvox perglobator (in both male and female isolates) and the presence of both the MID and FUS1 genes in selfing Gonium pectorale Russia. In addition, the nuclear ITS gene of V. perglobator was sequenced to demonstrate phylogenetic consistency of chloroplast data and nuclear data. Volvox perglobator and G. pectorale Russia were grown in SVM at 25°C on a 16:8 hour light:dark cycle at approximately 35 µmol photons/m2/s. Genomic DNA for V. perglobator and G. pectorale Russia was prepared using a CTAB protocol (Miller and Kirk 1999). After initial sequencing, genomic DNA for G. pectorale Russia for secondary sex gene sequencing was prepared using a quick preparation protocol (Hallmann and Kirk 2000). PCR reactions for MID and ITS were performed using 2X Phusion HF Master Mix (Thermo Scientific, Waltham, MA). Cycling conditions were 98°C for 2 minutes, followed by 37 cycles of 98°C for 10 seconds, 59.0-63.0°C annealing temperature for 20 seconds, 72°C for variable extension time (20-60 seconds), then a finishing step of 72°C for 5 minutes (Table S4). PCR amplifications intended for sequencing were performed in a minimum of three separate reactions and then combined before sequencing to reduce the possibility of PCR errors. DNA sequencing was performed by the University of Arizona Genetics Core using Applied Biosystems 3730 DNA Analyzers (Waltham, MA). The sequence of the MID PCR product in V. perglobator was used to design a hybridization primer (Vol5mid, Table S4) for screening a cosmid library. The cosmid library was constructed following Hanschen et al. (2014). A portion of a cosmid containing a full length MID gene was sequenced.

-5- To ensure both MID and FUS1 genes are present in the same genotype in G. pectorale Russia (as opposed to being a mix of two heterothallic strains), G. pectorale Russia was plated onto 1.5% agar SVM plates and six single-cell isolates were picked and grown in liquid SVM. Secondary PCR amplification and sequencing of six single- cell isolates confirmed FUS1 and MID are present in the same genotype (Figs. S1, S2).

We constructed a multiple sequence alignment of ITS-1, 5.8S rDNA, and ITS-2 using Mafft version 7.130b with the accurate L-INS-i option (Katoh et al. 2005). We removed ambiguous regions (Hayama et al. 2010; Isaka et al. 2012; Nozaki et al. 2015), resulting in an alignment of 574 base pairs. An unrooted maximum likelihood phylogeny was constructed using RAxML version 8.1.12 (Stamatakis 2014) with the automatically- selected GTR+Ã model and 300 bootstrap replicates. An independent Bayesian phylogeny was constructed using MrBayes version 3.2.2 (Ronquist et al. 2012) with a GTR+Ã model as above.

We constructed a multiple sequence alignment for MID and FUS1 protein sequences using Mafft version 7.130b with the accurate L-INS-i option (Katoh et al. 2005). An unrooted phylogeny of MID genes was estimated using RAxML version 8.1.12 (Stamatakis 2014) using a rapid bootstrapping analysis with an automatically selected 850 bootstrap replicates and the automatically-selected LG substitution model (Le and Gascuel 2008). An independent Bayesian phylogeny was estimated using MrBayes version 3.2.2 (Ronquist et al. 2012) as above using the LG substitution model. A FUS1 phylogeny was not estimated as only three FUS1 genes have been sequenced (Figure S6).

All single colony isolates of V. perglobator were genotyped using MID (to confirm an isolate as V. perglobator and male) or rbcL (to confirm an isolate as V. perglobator if MID failed, indicating female).

Supplementary References

Akaike, H. 1974. A new look at the statistical model identification. IEEE Trans.

-6- Automat. Contr. 19:716–723.

Burnham, K. P., and D. R. Anderson. 2002. Model selection and multi-model inference: a practical information-theoretic approach. Springer-Verlag, New York.

Coleman, A. W. 2012. A comparative analysis of the Volvocaceae (Chlorophyta). J. Phycol. 48:491–513.

Coleman, A. W., A. Suarez, and L. J. Goff. 1994. Molecular delineation of species and syngens in Volvocacean green algae (Chlorophyta). J. Phycol. 30:80–90.

FitzJohn, R. G. 2012. Diversitree: comparative phylogenetic analyses of diversification in R. Methods Ecol. Evol. 3:1084–1092.

Fujisawa, T., and T. G. Barraclough. 2013. Delimiting species using single-locus data and the generalized mixed Yule coalescent approach: A revised method and evaluation on simulated data sets. Syst. Biol. 62:707–724.

Hallmann, A., and D. L. Kirk. 2000. The developmentally regulated ECM glycoprotein ISG plays an essential role in organizing the ECM and orienting the cells of Volvox. J. Cell Sci. 113:4605–4617.

Hanschen, E. R., P. J. Ferris, and R. E. Michod. 2014. Early evolution of the genetic basis for soma in the Volvocaceae. Evolution 68:2014–2025.

Hanschen, E. R., M. D. Herron, J. J. Wiens, H. Nozaki, and R. E. Michod. 2018a. Multicellularity drives the evolution of sexual traits. Am. Nat. 192:E0000.

Hanschen, E. R., M. D. Herron, J. J. Wiens, H. Nozaki, and R. E. Michod. 2018b. Repeated evolution and reversibility of self-fertilization in the volvocine green algae. Evolution

-7- 72:386–398.

Hayama, M., T. Nakada, T. Hamaji, and H. Nozaki. 2010. Morphology, molecular phylogeny and taxonomy of Gonium maiaprilis sp. nov. (Goniaceae, Chlorophyta) from Japan. Phycologia 49:221–234.

Herron, M. D., and R. E. Michod. 2008. Evolution of complexity in the volvocine algae: transitions in individuality through Darwin’s eye. Evolution 62:436–451.

Isaka, N., H. Kawai-Toyooka, R. Matsuzaki, T. Nakada, and H. Nozaki. 2012. Description of two new monoecious species of Volvox sect. Volvox (Volvocaceae, Chlorophyceae), based on comparative morphology and molecular phylogeny of cultured material. J. Phycol. 48:759–767.

Katoh, K., K. Kuma, H. Toh, and T. Miyata. 2005. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 33:511–518.

Lanfear, R., P. B. Frandsen, A. M. Wright, T. Senfeld, and B. Calcott. 2016. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 34:772– 773.

Le, S. Q., and O. Gascuel. 2008. An improved general amino acid replacement matrix. Mol. Biol. Evol. 25:1307–1320.

Mann, H. B., and D. R. Whitney. 1947. On a test of whether one of two random variables is stochastically larger than the other. Ann. Math. Stat. 18:50–60.

Miller, S. M., and D. L. Kirk. 1999. glsA, a Volvox gene required for asymmetric division and germ cell specification, encodes a chaperone-like protein. Development 126:649–658.

-8- Nozaki, H., and M. Itoh. 1994. Phylogenetic relationships within the colonial Volvocales (Chlorophyta) inferred from cladistic analysis based on morphological data. J. Phycol. 30:353–365.

Nozaki, H., N. Ueki, O. Misumi, K. Yamamoto, S. Yamashita, M. D. Herron, and F. Rosenzweig. 2015. Morphology and reproduction of Volvox capensis (Volvocales, Chlorophyceae) from Montana, USA. Phycologia 54:316–320.

Pagel, M. 1999. The maximum likelihood approach to reconstructing ancestral character states of discrete characters on phylogenies. Syst. Biol. 48:612–622.

Paradis, E., J. Claude, and K. Strimmer. 2004. APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20:289–290.

Robinson, D. F., and L. R. Foulds. 1981. Comparison of phylogenetic trees. Math. Biosci. 53:131–147.

Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A. Darling, S. Hohna, B. Larget, L. Liu, M. A. Suchard, and J. P. Huelsenbeck. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61:539–542.

Sanderson, M. J. 2002. Estimating absolute rates of molecular evolution and divergence times: A penalized likelihood approach. Mol. Biol. Evol 19:101–109.

Smith, G. M. 1944. A comparative study of the species of Volvox. Trans. Am. Microsc. Soc. 63:265–310.

Stamatakis, A. 2014. RAxML version 8: a tool for phylogenetic analysis and post- analysis of large phylogenies. Bioinformatics 30:1312–1313.

-9- Table S1. Genbank accession numbers of chloroplast, ITS, and MID genes for ingroup and outgroup taxa.

Species Strain atpB psaA psaB psbC rbcL ITS MID FUS1 Astrephomene gubernaculifera NIES-418 AB014022-3 AB044233S AB044458 AB044513-4 D63428 – – – Astrephomene gubernaculifera UTEX 1394 AB044181 AB044235 AB044459 AB044515-7 AB044169S – – – Astrephomene perforata NIES-564 AB014024 AB044236S AB044460 AB044518-9 D63429 – – – Basichlamys sacculifera NIES-566 AB014015 AB044416 AB044467-8 AB044526 D63430 – – – Carteria crucifera NIES-421 AB084320 – AB084358 – D63431 – – – Chlamydomonas cribrum UTEX 1341 – – – – AF517070 – – – Chlamydomonas debaryana UTEX 1344 AB014034 AB0444170-8 AB044469 AB044527 D86838 – – – Chlamydomonas globosa CC1870 – – – – – AF002710 – Chlamydomonas moewusii UTEX 0097 EF587443 EF587460 EF587461 EF587466 EF587479 – – – Chlamydomonas reinhardtii CC-503 – – – – – – – XM_001696588 Chlamydomonas reinhardtii CC-621 – – – – – – U92071 – Chlamydomonas reinhardtii Nc5353 NC005353 NC005353 NC005353 NC005353 NC005353 – – – Chlorella variabilis C-27 NC001865 NC001865 NC001865 NC001865 NC001865 – – – Chlorogonium elongatum NIES-751 AB084327 – AB084368 – AJ001881 – – – Colemanosphaera angeleri NIES-3382 AB905590 AB905594 AB905596 AB905598 AB905592 – – – Colemanosphaera charkowiensis NIES-3388 AB905589 AB905593 AB905595 AB905597 AB905591 – – – Eudorina cylindrica UTEX 1197 AB014033 AB044210 AB044441 AB044493 D86833 – – – Eudorina elegans NIES-456 AB014009 AB044199 AB044435 AB044485 D63432 – – – Eudorina elegans NIES-458 – – – – D88807 – – – Eudorina elegans NIES-568 AB014011 – – – D88808 – – – Eudorina elegans UTEX 1195 AB047072 – – – D88810 – – – Eudorina elegans UTEX 1199 AB047073 – – – D88804 – – – Eudorina elegans UTEX 1205 AB014010 AB044200S AB044437 AB044486 D88805 – – – Eudorina elegans UTEX 1212 AB014012 AB044202S AB044438 AB044487-8 D88806 – – – Eudorina elegans UTEX 1193 AB047071 – – – D88803 – – – Eudorina illinoisensis NIES-460 AB014013 AB044198 AB044434 AB044484 D63433 – – – Eudorina illinoisensis UTEX 808 AB047069 – – – D88809 – – – Eudorina minodii NIES-856 AB047068 – – – AB047074-6 – – – Eudorina peripheralis UTEX 1215 AB014007 AB044207S AB044440 AB044491-2 D63434 – – – Eudorina peripheralis UTEX 1218 AB047070 – – – D86830 – – – Eudorina unicocca UTEX 737 AB014008 AB044204S AB044439 AB044489-90 D86829 – – – Gonium maiaprilis NIES-2457 – – – – AB520745 – – – Gonium multicoccum NIES-1038 – – – – AB246187 – – – Gonium multicoccum NIES-1708 – – – – – – AB774226 – Gonium multicoccum UTEX 2580 AB014020 AB044239S AB044461 AB044481 D63435 – – – Gonium multicoccum UTEX 783 AB076115 AB076138 AB076153S AB076168S AB076102S – – – Gonium octonarium NIES-851 AB014018 AB044241 AB044462 AB044520 D63436 – – – Gonium pectorale K4-F3-4 – – – – – – – LC062719 Gonium pectorale Kaneko3 – – – – – – AB353340 – Gonium pectorale NIES-1711 – – – – AB246190 – – – Gonium pectorale NIES-1713 – – – – AB246189 – – – Gonium pectorale NIES-569 AB014016-7 AB044242 AB044464 AB044521 D63437 – – – Gonium pectorale Russia KY489647 KY489652 KY489655 KY489658 KY489661 – KY489651 KY489650 Gonium quadratum NIES-653 AB014019 AB044243 AB044464 AB044522-3 D63438 – – – Gonium viridistellatum NIES-1122 AB076117 AB076139 AB076155 AB076172 AB076092 – – – Gonium viridistellatum NIES-289 AB076118S AB076140S AB076156 AB076173 AB076091 – – – Gonium viridistellatum UTEX 2519 AB014021 AB044244 AB044465 AB044524 D86831 – – – Lobomonas monstruosa NIES-474 AB044533 AB044421 AB044472 AB044530 AB044171 – – – Pandorina colemaniae NIES-572 AB014027 AB044232 AB044457 AB044512 D63441 – – – Pandorina morum NIES-574 AB014025-6 AB044226 AB044452 AB044505 D63442 – – – Pandorina morum UTEX 1727 AB044178 AB044228 AB044454 AB044508 AB044165 – – – Pandorina morum UTEX 2326 AB044177 AB044227 AB044453 AB044506-7 AB044164 – – – Pandorina morum UTEX 854 AB044180 AB044231 AB044456 AB044510-1 AB044167 – – – Pandorina morum UTEX 880 AB044179 AB044229S AB044455 AB044509 AB044166 – – – Paulschulzia pseudovolvox UTEX 0167 AB014040 AB044422-3 AB044473 AB044531-2 D86837 – – – Platydorina caudata UTEX 1658 AB014032 AB044211S AB044442 AB044494 D86828 – – – Platydorina caudata UTEX 1661 – – – AB044495 D86827 – – – Pleodorina californica UTEX 809 AB014004 AB044190S AB044430 AB044496 D63439 – – – Pleodorina indica UTEX 1990 AB014006 AB044195S AB044432-3 AB044497 D86834 – – – Pleodorina japonica UTEX 2523 AB014005 AB044193S AB044431 AB044498 D63440 – – – Pleodorina starrii NIES-1362 AB214424 AB214430 AB214432 AB044499 AB214427 – AB272612 – Pleodorina thompsonii UTEX 2804 AB214407 AB214410-1 AB214412 AB044500 AB214408 – – – Pseudocarteria mucosa NIES-522 AB084324 – AB084364 AB044501 AB084335 – – – Tetrabaena socialis NIES-571 AB014014 AB044415 AB044466 AB044502 D63443 – – – Vitreochlamys aulata NIES-1140 AB076121 AB076143 AB076158 AB044503 AB050486S – – – Vitreochlamys aulata NIES-876 – – – AB044504 AB050489 – – – Vitreochlamys aulata NIES-877 AB076122 AB076144 AB076159 AB044505 AB050492 – – – Vitreochlamys aulata NIES-878 – – – AB044506 AB050493 – – – Vitreochlamys gloeocystiformis NIES-880 – – – AB044507 AB050485 – – – Vitreochlamys ordinata NIES-882 AB014036 AB044420 AB044471 AB044508 AB014041 – – – Vitreochlamys pinguis NIES-1148 AB076120 AB076142 AB076157 AB044509 AB050490S – – – Volvox africanus NIES-3780 LC090150 LC090151 LC090152 AB044510 LC090149 – – – Volvox aureus NIES-1156 AB076104 AB076123 AB076145 AB044512 AB076096 – – – Volvox aureus NIES-1157 AB076105 AB076124 AB076146 AB044513 AB076086 – – – Volvox aureus NIES-541 AB013998 AB044182 AB044424 AB044514 D63445 – – – Volvox barberi UTEX 804 AB014001 AB044186 AB044427 AB044515 D86835 AB663341 – – Volvox capensis M1-2 – – – AB044516 LC033870 LC034074 – – Volvox carteri f. kawasakiensis NIES-732 AB013999 AB044184-5 AB044425 AB044517 D63446 – – – Volvox carteri f. nagariensis UTEX 1885 AB076108S AB076127S AB076148 AB044518 AB076099 – GU784916 – Volvox carteri f. weismannia UTEX 1875 AB076110S AB076129S AB076149 AB044519 AB076100 – – – Volvox dissipatrix Marb. 2RS 29 AB214419 AB214421 AB214422 AB044520 AB214420 – – – Volvox dissipatrix UTEX 2184 AB014000 AB044183 AB044426 AB044521 D63447 – – – Volvox ferrisii NIES-2738 – – – AB044522 AB663331 AB663333 – – Volvox ferrisii NIES-3986 – – – – – – LC274877 – Volvox gigas UTEX 1895 AB076112 AB076131S AB076150 AB044523 AB076084 – – – Volvox globator UTEX 955 AB014002 AB044187 AB044428 AB044524 D86836 AB663340 – – Volvox kirkiorum NIES-543 – – – AB044525 AB663322 AB663327 – – Volvox obversus UTEX 1865 AB076113 AB076133-6 AB076151 AB044526 AB076085 – – – Volvox ovalis NIES-2569 AB592341 AB592339 AB592340 AB044527 AB592342 – – – Volvox powersii UTEX 1863 AB214414 AB214416 AB214417 AB044528 AB214415 – – – Volvox reticuliferus NIES-3782 LC090155 LC090156 LC090157 AB044529 LC090154 – – – Volvox reticuliferus UTEX 1891 AB076114 AB076137 AB076152 AB044511 AB076101 – – – Volvox rousseletii UTEX 1862 AB014003 AB044188 AB044429 AB044530 D63448 AB663342 – – Volvox perglobator Tucson KY489648 KY489653 KY489656 KY489659 KY489662 MG429137 MG429691 – Volvox tertius NIES-544 AB086173 AB086175-6 AB086177 AB044531 AB086174 – – – Volvox tertius UTEX 132 AB076106S AB076125S AB076147 AB044532 AB076098 – – – Volvulina boldii UTEX 2185 AB044176 AB044225 AB044451 AB044533 AB044162S – – – Volvulina compacta NIES-582 AB014029 AB044217S AB044446 AB044534 D86832 – – – Volvulina compacta TN-0205-2-Pn-1 AB593420 AB593421 AB593422 AB593423 AB593419 – – – Volvulina pringsheimii UTEX 1020 AB014028 AB044220 AB044447 AB044535 D63444 – – – Volvulina steinii NIES-545 AB044173 AB044221S AB044448 AB044536 AB044159 – – – Volvulina steinii UTEX 1525 AB044174 AB044223 AB044449 AB044537 AB044160 – – – Volvulina steinii UTEX 1531 AB044175 AB044224 AB044450 AB044538 AB044161 – – – Yamagishiella unicocca NIES-578 – – – AB044539 AB000811 – – – Yamagishiella unicocca NIES-762 – – – AB044540 AB000810 – – – Yamagishiella unicocca NIES-872 AB044172 AB044216 AB044445 AB044541 AB044168 – – – Yamagishiella unicocca NIES-1859 – – – – – – LC274882 – Yamagishiella unicocca UTEX 2031 – – – AB044542 D86822 – – – Yamagishiella unicocca UTEX 2127 – – – AB044543 D86824 – – – Yamagishiella unicocca UTEX 2428 AB014130 AB044213 AB044443 AB044544 D86823 – – – Yamagishiella unicocca UTEX 2430 AB014131 AB044214S AB044444 AB044545 D86825 – – – Yamagishiella unicocca UTEX 840 – – – AB044546 D86826 – – – Table S2. Heterothallic/outcrossing and homothallic/selfing character data and associated references for volvocine green algae. For heterothallic/outcrossing species, only one strain of a mating pair has been given.

Species Strain Heterothallic Ref. Astrephomene gubernaculifera NIES-418 1 4 Astrephomene gubernaculifera UTEX 1394 1 15 Astrephomene perforata NIES-564 1 4 Basichlamys sacculifera NIES-566 1 25 Chlamydomonas cribrum UTEX 1341 NA 5 Chlamydomonas debaryana UTEX 1344 1 31 Chlamydomonas reinhardtii Nc5353 1 11 Colemanosphaera angeleri NIES-3382 NA 16 Colemanosphaera charkowiensis NIES-3388 1 16 Eudorina cylindrica UTEX 1197 1 2,12 Eudorina elegans NIES-456 1 2 Eudorina elegans NIES-458 0 4 Eudorina elegans NIES-568 0 2 Eudorina elegans UTEX 1195 1 2 Eudorina elegans UTEX 1199 1 2 Eudorina elegans UTEX 1205 1 2 Eudorina elegans UTEX 1212 0 2 Eudorina elegans UTEX 1193 1 2 Eudorina illinoisensis NIES-460 1 14 Eudorina illinoisensis UTEX 808 1 2 Eudorina minodii NIES-856 0 2,4 Eudorina peripheralis UTEX 1215 1 2 Eudorina peripheralis UTEX 1218 1 2 Eudorina unicocca UTEX 737 1 2 Gonium maiaprilis NIES-2457 1 21 Gonium multicoccum NIES-1038 1 30 Gonium multicoccum UTEX 2580 0 3 Gonium multicoccum UTEX 783 1 6 Gonium octonarium NIES-851 1 4 Gonium pectorale NIES-1711 1 4 Gonium pectorale NIES-1713 1 4 Gonium pectorale NIES-569 1 4 Gonium pectorale Russia 0 27,28 Gonium quadratum NIES-653 1 4 Gonium viridistellatum NIES-1122 1 19 Gonium viridistellatum NIES-289 1 4 Gonium viridistellatum UTEX 2519 1 4 Pandorina colemaniae NIES-572 1 8 Pandorina morum NIES-574 1 4 Pandorina morum UTEX 1727 1 4 Pandorina morum UTEX 2326 1 4 Pandorina morum UTEX 854 1 3 Pandorina morum UTEX 880 1 3 Platydorina caudata UTEX 1658 1 13 Platydorina caudata UTEX 1661 1 13 Pleodorina californica UTEX 809 0 2 Pleodorina indica UTEX 1990 1 2 Pleodorina japonica UTEX 2523 0 2 Pleodorina starrii NIES-1362 1 17 Pleodorina thompsonii UTEX 2804 NA 17 Tetrabaena socialis NIES-571 0 26 Vitreochlamys aulata NIES-1140 NA 5,9 Vitreochlamys aulata NIES-876 NA 5,9 Vitreochlamys aulata NIES-877 NA 5,9 Vitreochlamys aulata NIES-878 NA 5,9 Vitreochlamys gloeocystiformis NIES-880 NA 5,9 Vitreochlamys ordinata NIES-882 NA 5,9 Vitreochlamys pinguis NIES-1148 NA 5,9 Volvox africanus NIES-3780 0 24 Volvox aureus NIES-1156 0 2 Volvox aureus NIES-1157 0 2,4 Volvox aureus NIES-541 0 2 Volvox barberi UTEX 804 0 1 Volvox capensis NIES-3874 0 22 Volvox carteri f. kawasakiensis NIES-732 1 2,4 Volvox carteri f. nagariensis UTEX 1885 1 4 Volvox carteri f. weismannia UTEX 1875 1 4 Volvox dissipatrix Marburg 0 2 Volvox dissipatrix UTEX 2184 1 25,32 Volvox ferrisii NIES-2738 0 20 Volvox gigas UTEX 1895 1 4 Volvox globator UTEX 955 0 20 Volvox kirkiorum NIES-543 0 20 Volvox obversus UTEX 1865 1 4 Volvox ovalis NIES-2569 NA 23 Volvox powersii UTEX 1863 0 7 Volvox reticuliferus NIES-3782 1 24 Volvox reticuliferus UTEX 1891 1 4 Volvox rousseletii UTEX 1862 1 1 Volvox perglobator Tucson 1 27 Volvox tertius NIES-544 0 4 Volvox tertius UTEX 132 0 25 Volvulina boldii UTEX 2185 1 4 Volvulina compacta NIES-582 1 10 Volvulina compacta TN-0205-2-Pn-1 NA 29 Volvulina pringsheimii UTEX 1020 1 4 Volvulina steinii NIES-545 1 4 Volvulina steinii UTEX 1525 1 4 Volvulina steinii UTEX 1531 1 4 Yamagishiella unicocca NIES-578 1 3,4 Yamagishiella unicocca NIES-762 1 3,4 Yamagishiella unicocca NIES-872 1 4 Yamagishiella unicocca UTEX 2031 1 3,4 Yamagishiella unicocca UTEX 2127 1 3,4 Yamagishiella unicocca UTEX 2428 1 4 Yamagishiella unicocca UTEX 2430 1 3,4 Yamagishiella unicocca UTEX 840 1 18

Key: 0 = Homothallic 1 = Heterothallic NA = Unknown # Reference 1 Smith, G. M. 1944. Transactions of the American Microscopal Society 63:265-310 2 Nozaki, H., and L. Krienitz. 2001. European Journal of Phycology 36:23-28 3 University of Texas Austin, Culture Collection of Algae 4 National Institute for Environmental Studies, Microbial Culture Collection 5 Ettl, H. 1983. Pp. 1-807 in Süsswasserflora von Mitteleuropa. Gustav Fischer, Stuttgart. 6 Nozaki, H., and T. Kuroiwa. 1991. Phycologia 30:381-393. 7 Van de Berg, W. J., and R. C. Starr. 1971. Archiv fur Protistenkunde 113:195-219. 8 Nozaki, H., and T. Kuroiwa. 1991. Phycologia 30:449-457. 9 Nakazawa, A., L. Krienitz, and H. Nozaki. 2001. European Journal of Phycology 36:113-128. 10 Nozaki, H., and T. Kuroiwa. 1990. Phycologia 29:410-417. 11 Harris, E. H. 1989. The Chlamydomonas Sourcebook. Academic Press, Inc., San Diego. 12 Goldstein, M. 1964. Journal of Protozoology 11:317-344. 13 Harris, D. O., and R. C. Starr. 1969. Archiv für Protistenkunde 111:S138-S155. 14 Nozaki, H. 1986. Japanese Journal of Phycology 34:143. 15 Brooks, A. E. 1966. Journal of Protozoology 13:367-375. 16 Nozaki, H., et al. 2014. BMC Evol. Biol. 14:37. BMC Evolutionary Biology. 17 Nozaki, H., et al. 2006. J. Phycol. 42:1072–1080. 18 Coleman, A. W. 2012. J. Phycol. 48:491–513. 19 Nozaki, H., et al. Mol. Phylogenet. Evol. 23:326–338. 20 Isaka, N., et al. J. Phycol. 48:759–767. 21 Hayama, M., et al. 2010. Phycologia 49:221–234. 22 Nozaki, H., et al. 2015. Phycologia 54:316–320. 23 Nozaki, H., and A. W. Coleman. 2011. J. Phycol. 47:673–679. 24 Nozaki, H., et al. 2015. PLoS One 10:e0142632. 25 Starr RC, Zeikus JA (1993). Journal of Phycology 29: 1–106. 26 Nozaki, H. 1986. Phycologia 25: 29-35. 27 Hanschen, E. R. et al. (2018) American Naturalist. In press. 28 Fabry, S., et al. 1999. J. Mol. Evol. 48:94–101. 29 Nakada, T., Tomita, M. & Nozaki, H. (2010). Journal of Japanese Botany 85, 364–369. 30 Hamaji, T., et al. PLoS One 8, e64385 (2013). 31 Ferris PJ, et al. (1997). PNAS 94: 8634-8639. 32 Starr, R.C. (1972). British Phycological Journal 7:2, 279-285. Table S3. Morphological traits after 32 invariant traits have been removed, the remaining seven traits define species identification in Volvox section Volvox (Isaka et al. 2012).

Mating system Number of eggs Zygote spine shape Zygote spine length Zygote point shape Shape of somatic cells (1) Shape of somatic cells (2) V. globator 0 0 0 1 1 0 1 V. capensis 0 1 0 0 1 1 1 V. barberi 0 1 0 0 0 1 0 V. perglobator 1 0 0 0 1 1 1 V. ferrisii 0 1 0 1 0 1 1 V. rousseletii 1 1 1 1 0 1 1 V. kirkiorum 0 0 0 1 0 1 1

Key 0=Monoecious 0=Less than 100 eggs 0=Straight 0=Shorter than 6µm 0=Acute 0=Flat 0=Elongate 1=Dioecious 1=More than 100 eggs 1=Curved 1=longer than 6µm 1=Blunt 1=Ovoid 1=Ovoid

References Isaka, N., et al. J. Phycol. 48, 759–767 (2012). Nozaki, H. & Itoh, M. J. Phycol. 30, 353–365 (1994). Nozaki, H. et al. Phycologia 54, 316–320 (2015). Pocock, M. A. Proc. Linn. Soc. London (1937). Pocock, M. A. Ann. South African Museum 16, 473–522 (1933). Pocock, M. A. Volvox in South Africa. Ann. South African Museum 16, 523–658 (1933). Powers, J. Trans. Am. Microsc. Soc. 28, 141–175 (1908). Powers, J. H. Trans. Am. Microsc. Soc. 27, 123–150 (1907). Rich, F. & Pocock, M. A. Ann. South African Museum 16, 427–471 (1933). Shaw, W. R. Philipp. J. Sci. 20, (1922). Smith, G. M. Trans. Am. Microsc. Soc. 63, 265–310 (1944). Starr, R. C., et al. Proc. Natl. Acad. Sci. U. S. A. 77, 1025–1028 (1980). Table S4. PCR primers used in this study. *indicates a reverse primer. Internal transcribed spacer, ITS; Minus dominance gene, MID; and gamete fusion gene, FUS1.

Primer name Target locus Sequence (5' -> 3') Source ITS-for Internal transcribed spacer, ITS GGGATCCGTTTCCGTAGGTGAACCTGC Coleman et al 1994 J Phycol 30:80 ITS-rev* Internal transcribed spacer, ITS GGGATCCATATGCTTAAGTTCAGCGGGT Coleman et al 1994 J Phycol 30:80 VferMid1 Minus dominance gene, MID GATGCGATCAGTGTGCGGTNTAYAA This study VferMid2* Minus dominance gene, MID TCAAATCCCAGGCTAGCNACCT This study Vol5mid Minus dominance gene, MID ACTGAATGGCTCAAGGAGTGCAT This study RussMid2* Minus dominance gene, MID AGAGAGGTCCAAGCTGGCNACCT This study RussMid3 Minus dominance gene, MID ACCTGCAATGGTTGCTCAGTNTAYAA This study RussFus1 gamete fusion gene, FUS1 CTGCAAGGCTTCCAGACGAATACTT This study RussFus2* gamete fusion gene, FUS1 GATCCACCAGTTTTGCCACCA This study RussFus5* gamete fusion gene, FUS1 GCCCGAAAGATATTGACGGARTANAC This study RussFus6* gamete fusion gene, FUS1 GCCTGGACTGATGGTTGTATT This study RussFus7 gamete fusion gene, FUS1 CCAGTTGTAGCGGGTTACTT This study Figure S1. Diversity of mating systems in the facultatively sexual volvocine green algae. Species capable of self-fertilization are highlighted in gray. A. In obligately outcrossing (heterothallic) species such as Volvox perglobator, distinct genotypes (male on left and female on right) sexually differentiate producing either eggs or sperm. A diploid zygospore (red) is produced after fertilization. After meiosis, colonies hatch and enter the haploid, asexual phase of the life cycle. B. In monoecious selfing (homothallic) species, a single genotype is capable of producing both gamete types within a single colony. Upon sexual differentiation, each sexual colony produces both sperm and eggs. C. In dioecious selfing (homothallic) species, a single genotype sexually differentiates, producing either eggs or sperm, but not both within the same colony. Black arrow indicates the transition from selfing to obligate outcrossing observed in the volvocine algae (Hanschen et al. 2018b). All panels show anisogamous, Volvox-like morphology for illustrative purposes only.

Figure S2. Maximum likelihood ancestral-state reconstruction for outcrossing (black) and self- fertilization (gray) in the volvocine green algae. Modified from Hanschen et al. (Hanschen et al. 2018b). Pie charts at nodes represent scaled marginal likelihoods from ML reconstruction. Gonium pectorale Russia and Volvox perglobator Tucson, the foci of the genetics studied here, are in bold.

Figure S3. A non-random sample of ancestral-state phylogenetic simulations demonstrating the effect of phylogenetic place on evolutionary history of selfing in Volvox section Volvox. A. Two reversions to outcrossing, similar to the inference without including lost Volvox species. B. Three reversions to outcrossing are observed. C. Three reversions to outcrossing are observed. Placement of V. prolificus as sister to the rest of Volvox section Volvox does not automatically change the inference of presence of reversions to outcrossing. D. No reversions to outcrossing are observed; instead, selfing has seven independent origins in Volvox section Volvox.

Figure S4. An unrooted maximum likelihood tree of seven morphological traits previously used to inform phylogenetic relationships and species identification (Nozaki and Itoh 1994; Isaka et al. 2012). Numbers indicate ML bootstrap values. Figure S5. Flowchart of the phylogenetic simulation. Each simulation run was repeated three times, (1) choosing edges with equal probability, (2) choosing edges with probability proportional to edge length, and (3) choosing edges inversely proportional to edge length.

Figure S6. Alignment of all published gamete fusion genes (FUS1) from C. reinhardtii CC-503, G. pectorale K4-F3-4, and G. pectorale Russia, demonstrating the presence of the FUS1 gene in G. pectorale Russia. Positions are colored according to similarity using the BLOSUM62 scoring matrix; black, 100% similar; gray, 66.67% similar; white, 0% similar. Evolutionary Ecology Research — Volume 19 (2019)

Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4

Supplementary Figure 5 Supplementary Figure 6 DATA SET for Hanschen et al. (2018)

#Size_of_asexual_spheroid_[microns] #Length Width 466.0 449.6 514.8 509.7 522.2 502.7 593.3 561.8 598.4 567.5 600.6 602.1 601.3 575.6 604.2 579.6 615.0 565.0 648.3 624.0 648.8 508.8 687.4 643.9 687.4 666.8 #Diameter_of_asexual_spheroid_at_liberation_[microns] 78.2 136.3 130.1 115.3 159.2 144.9 128.7 162.8 145.4 154.7 136.5 165.7 167.5 93.7 96.1 130.0 127.6 141.0 106.4 109.4 161.4 135.7 110.0 139.3 163.4 108.2 127.6 88.6 102.0 126.9 143.0 126.6 131.2 135.5 146.0 115.3 108.2 134.4 102.1 133.1 111.1 138.1 141.9 115.3 138.1 148.8 133.9 141.8 103.5 135.3 124.7 103.3 108.3 126.8 124.4 111.5 122.0 152.4 146.2 146.5 152.6 110.2 148.2 117.7 104.2 63.2 120.3 130.4 130.9 110.0 112.2 152.2 137.5 156.8 95.8 138.1 126.0 113.7 135.4 129.3 128.8 143.0 128.4 141.8 121.0 161.9 161.5 135.5 114.0 152.2 127.4 184.7 143.2 148.0 144.4 154.7 131.0 124.5 159.7 #Number_of_cells_in_asexual_spheroid 3213 5426 7569 3282 3530 3352 4327 3602 3899 2532 5426 3077 3213 2846 4570 4529 3145 3458 3179 3179 #Number_of_daughter_colonies_and_embryos_ceasing_development #Treatment Daughters Embryos_ceasing_development Fresh 10 0 Fresh 7 0 Fresh 10 0 Fresh 8 0 Fresh 5 0 Fresh 8 0 Fresh 7 0 Fresh 10 0 Fresh 9 0 Fresh 8 0 Fresh 9 0 Fresh 7 1 Fresh 9 0 Fresh 9 1 Fresh 5 0 Fresh 10 0 Fresh 9 0 Fresh 11 0 Fresh 12 0 Fresh 13 0 Fresh 5 0 Fresh 9 0 Fresh 11 0 Fresh 9 0 Fresh 10 0 Fresh 5 0 Fresh 9 0 Fresh 10 2 Fresh 8 0 Fresh 7 0 Fresh 8 0 Fresh 9 0 Fresh 10 0 Fresh 11 1 Fresh 9 0 Fresh 10 1 Fresh 7 0 Fresh 6 0 Fresh 9 0 Fresh 7 0 Fresh 6 0 Fresh 10 1 Fresh 8 0 Fresh 6 0 Fresh 5 1 Fresh 10 1 Fresh 8 1 Fresh 7 3 Fresh 8 0 Fresh 8 0 Fresh 8 1 Fresh 8 0 Fresh 8 1 Fresh 7 0 Fresh 8 2 Fresh 7 0 Fresh 8 1 Fresh 8 0 Fresh 11 0 Fresh 11 0 Fresh 10 0 Fresh 7 0 Fresh 10 0 Fresh 11 1 Fresh 10 0 Fresh 6 2 Fresh 6 1 Fresh 8 0 Fresh 8 0 Fresh 9 0 Fresh 7 1 Fresh 7 1 Fresh 8 0 Fresh 8 1 Fresh 7 1 Fresh 8 0 Fresh 8 0 Fresh 7 1 Fresh 7 0 Fresh 9 1 Fresh 9 0 Fresh 8 0 Fresh 8 0 Fresh 7 0 Fresh 9 0 Fresh 4 0 Fresh 5 0 Fresh 8 0 Fresh 10 0 Fresh 8 0 Fresh 5 0 Fresh 11 0 Fresh 6 0 Fresh 6 2 Fresh 11 2 Fresh 8 0 Fresh 11 0 Fresh 8 1 Fresh 8 0 Fresh 12 0 Older 3 1 Older 2 0 Older 3 1 Older 3 1 Older 3 1 Older 2 2 Older 2 2 Older 3 1 Older 1 3 Older 3 2 Older 3 0 Older 2 0 Older 2 0 Older 2 2 Older 2 0 Older 3 0 Older 1 2 Older 2 2 Older 2 0 Older 3 1 Older 2 1 Older 3 1 Older 2 2 Older 1 0 Older 2 1 Older 2 0 Older 2 2 Older 2 1 Older 2 2 Older 2 4 Older 2 2 Older 3 2 Older 2 2 Older 2 1 Older 1 1 Older 1 0 Older 2 0 Older 2 0 Older 3 0 Older 1 3 Older 2 0 Older 2 1 Older 1 0 Older 1 1 Older 2 0 Older 2 0 Older 2 0 Older 3 2 Older 2 3 Older 2 2 Older 2 2 Older 1 3 Older 2 1 Older 1 1 Older 1 1 Older 2 1 Older 1 3 Older 2 0 Older 2 0 Older 2 0 Older 1 0 Older 2 1 Older 2 0 Older 2 0 Older 2 3 Older 2 1 Older 2 1 Older 2 2 Older 2 3 Older 3 2 Older 2 0 Older 1 1 Older 1 0 Older 3 2 Older 4 1 Older 3 3 Older 2 1 Older 2 3 Older 1 3 Older 4 0 Older 3 1 Older 2 0 Older 2 2 Older 3 2 Older 3 0 Older 1 2 Older 2 2 Older 1 1 Older 2 0 Older 2 1 Older 1 0 Older 2 3 Older 1 3 Older 1 1 Older 3 1 Older 3 1 Older 2 0 Older 2 1 Older 1 3 Older 1 0 #Size_of_single_cell_gonidia_[microns] 10.2 11.0 #Size_of_somatic_cells_[microns] #Width Length 7.9 8.2 7.3 8.3 6.2 8.0 7.0 7.6 6.0 9.0 7.0 9.2 7.2 7.4 7.3 8.4 7.3 6.8 6.9 7.6 #Size_of_female_spheroid_[microns] #Length Width 433 432 580 579 845 807 886 747 616 566 519 477 727 638 787 606 588 491 631 554 702 586 571 493 752 676 738 691 804 737 721 643 713 606 648 664 694 631 799 712 717 630 747 630 721 667 783 731 598 612 512 460 618 583 654 575 724 613 762 707 705 632 714 606 #Number_of_soma_in_female 4938 3312 6107 5462 6888 6395 5919 6298 4046 8148 6202 6689 6888 6492 6492 5919 6492 3312 6492 6013 6788 6395 7193 7193 3312 2176 3174 6689 6989 7823 6590 6202 #Number_of_eggs_in_female 53 53 38 18 51 39 56 32 58 69 50 45 48 65 46 48 46 51 68 40 50 39 43 71 51 48 44 45 45 44 30 43 55 44 69 68 75 47 71 32 48 45 50 47 35 62 53 55 86 67 74 58 44 71 55 57 59 49 61 61 46 83 59 42 65 42 45 68 65 46 43 68 81 39 36 79 59 49 53 64 66 63 57 40 34 35 32 33 45 56 53 47 56 46 53 43 49 50 27 41 63 75 47 33 45 38 35 58 39 69 72 77 32 75 36 63 78 38 66 73 68 79 46 #Diameter_of_eggs_[microns] 21.534 25.955 27.557 28.421 27.167 26.283 27.16 24.883 23.505 26.514 29.247 27.948 26.722 27.805 28.721 24.883 25.376 23.464 25.187 22.058 24.575 26.543 25.607 24.967 24.967 27.335 25.674 24.76 24.883 26.189 21.427 26.108 26.043 23.456 25.496 23.529 22.638 #Diameter_of_parthenospores_[microns] 28.7 26.4 26.5 21.9 26.4 26.1 26.3 22.2 25.3 23.1 27.3 25.6 20.1 #Size_of_male_colonies_[microns] #Length Width 739.8 618.4 490.3 403.6 475.9 372.4 379.8 330.3 #Number_of_somatic_cells_in_male_spheroids 5552.3 4603.6 6107.2 6107.2 8931.3 #Number_of_sperm_packets_in_male_spheroid 73 67 67 48 #Size_of_sperm_packets_[microns] #Length Width 34.2 21.4 42.6 35.9 41.7 25.1 44.4 27.6 46.3 37.3 44.6 25.5 #Diameter_of_zygotes_[microns] 31.1 29.6 29.4 27.9 22.2 28.4 25.5 21.4 24.9 27.8 29.0 28.2 29.2 #Length_of_zygote_spines_[microns] 2.9 2.8 3.1 2.8 4.6 5.4 4.1 3.9 5.3 3.5 4.4 4.8 5.4 2.5 3.3 2.8 2.9 4.3 4.7 4.6 4.6 4.3 5.1 4.9 #Orthogonal_diameter_of_embryos_ceasing_development_[microns] 18.2 38.1 31.5 18.9 22.9 24.5 30.0 18.8 21.1 38.8 29.3 34.6 23.1 24.3 29.7 26.9 23.3 29.1 18.5 19.0 25.5 19.4 31.8 24.2 #Number_of_daughter_colonies_when_grown_in_acetate 35 30 19 20 17 15 22 17 11 21