Supplemental Figs, Tables, Methods for Complete

Apple us22617

Supplemental Information

An Ensemble of Regulatory Elements Controls Runx3 Spatiotemporal Expression in Subsets of Dorsal Root Ganglia Proprioceptive Neurons

Supplemental _Fig _ S1 is related to Fig. 1 Supplemental _Fig _ S2 is related to Fig. 1 Supplemental _Fig _ S3 is related to Fig. 1 Supplemental _Fig _ S4 is related to Fig. 2 Supplemental _Fig _ S5 is related to Figs. 3, 5 Supplemental _Fig _ S6 is related to Figs. 3, 5 Supplemental _Fig _ S7 is related to Fig. 3 Supplemental _Fig _ S8 is related to Fig. 6 Supplemental _Fig _ S9 is related to Fig. 7

Supplemental _ Table_ S1 is related to Fig. 1 Supplemental _ Table_ S2 is related to Fig. 1 Supplemental _ Table_ S3 is related to Fig. 1 Supplemental _ Table_ S4 is related to Fig. 1 Supplemental _ Table_ S5 is related to Material and methods Supplemental _ Table_ S6 is related to Fig. 7 Supplemental _ Table_ S7 is related to Fig. 7

Supplemental_ Movie_ S1.mp4 is related to Fig. 3 Supplemental_ Methods.pdf

Supplemental Figures

Supplemental Fig. S1. The overlapping BACs –C, -E and -A encompass the genomic region required for the established Runx3 expression Sagittal sections of E14.5 BAC transgenic and Runx3LacZ/LacZ knock-in embryos depicting LacZ expression. BAC-B, -D and -F, completely lacked expression in hematopoietic tissues and in DRG and exhibited faint expression at all other sites (Supplemental Table S1). Despite the fact that BAC-B contains both P1 and P2, and BACs -D and -F contain only P2, the expression pattern of the three BACs was highly similar. BACs -A, -C and -E that extend 5’upstream of Runx3 exhibited a more intense LacZ expression in the same organs as BACs -B, -D and -F (Supplemental Table S1), indicating that the region upstream of P1 contains REs that intensify Runx3 expression in these tissues. These BACs also exhibited LacZ expression in hematopoietic organs, with BAC-A conferring the highest reporter expressing in the liver and thymus. Upper panels show embryos outer side and lower panels show inner side.

AFP GFP Supplemental Fig. S2. Schematic representation of the Runx3 gene with P1 and P2 specific KI alleles 3 Runx3 gene (upper line) was modified to generate the two KI alleles; P1-driven AFP KI allele (P1AFP, middle line) and P2-driven GFP KI allele (P2GFP, lower line).

Supplemental Fig. S3. Strategy for generation of compound heterozygote mutant mice (A) CRISPR-mediated deletion of R1,2,3 REs. Blue arrows underneath the line indicate position of sgRNAs while the shears mark Cas9 cutting sites (see also Supplemental Table S4). (B) Diagnostic PCR for detection of R1,2,3 REs homozygous deletion. PCR primers were designed to detect WT internal R1 and R3 fragments (lanes 1 and 3) and their absence in the mutant (lanes 2 and 4). R3/R1 PCR reaction detecting the deleted allele is seen in mutant (lane 7) but not in WT (lane 6). Lane 5 shows MW markers (see PCR oligos in Supplemental Table S5). (C) Schematic representation of compound heterozygote mice carrying one Runx3 allele bearing CRISPR-deleted REs (CRΔR1,2,3) and a second P2GFP Runx3 null allele.

Supplemental Fig. S4. Differential REs Activity in BAC transgenics at E12.5 (A) GFP expression in TrkC/Runx3 neurons: shown are intact BAC-C and various BAC-C RE-deleted brachial DRG. (B) Histograms showing percentage of TrkC/Runx3 neurons expressing BAC-derived GFP. BAC-C-GFP (Ct) and its indicated deleted versions. *p<0.005, **p<0.0001.

Supplemental Fig. S5. Histograms showing the results of counting TrkC neurons in serial sections of E15.5 DRG (A) Total number of Runx3 expressing TrkC/GFP cells in C5-T1 DRGs of: WT/P2GFP (marked as Ct), ΔR1= (CRΔR1/P2GFP), ΔR2= (CRΔR2/P2GFP), ΔR3= (CRΔR3/P2GFP), R1= (CRΔR2,3/P2GFP), R2= (CRΔR1,3/P2GFP), R3= (CRΔR1,2/P2GFP), Data were obtained by counting the total number of TrkC/GFP neurons in serial sections of an entire ganglion (n=2-4 embryos of either control or each mutant). *p<0.05, **p<0.001, ***p<0.0002. (B) Total number of TrkC/GFP cells in C5-T1 DRGs acquired by counting the same set of embryos as indicated in (A).

Supplemental Fig. S6. Histograms showing the proportion of TrkC neurons in various RE-deleted brachial DRGs (A) Percentage of Runx3 expressing TrkC/GFP cells present in RE-mutant compared to WT/P2GFP embryos. Data was deduced from the cell counting presented in Supplemental Fig. S5A (average mutant cell number/average WT/P2GFPx100). *p<0.05, **p<0.001, ***p<0.0002. (B) Percentage of TrkC/GFP cells present in mutant compared to WT/P2GFP embryos. Data was deduced from the cell counting presented in Supplemental Fig. S5B.

Supplemental Fig. S7. The DRG REs also regulate Runx3 expression in the trigeminal ganglion Expression of endogenous Runx3, TrkC and GFP in trigeminal ganglion at E14.5. Panels (from left to right): CRΔR1,2,3/P2GFP, CRΔR1,3/P2GFP, CRΔR1/P2GFP.

Supplemental Fig. S8. Deletion of R2 evokes GFP expression in TrkB neurons of BAC transgenics (A) Expression of Runx3, TrkB and GFP in BAC-C and (B) in BAC-C-ΔR2. Panels in (A) or (B) from left to right: transgenic embryos at E11, E11.5, E12.5, and E14.5. (C) Histograms showing percentage of Runx3 expressing TrkB neurons in E11-E14.5 WT embryos. (D) Histograms showing percentage of GFP expressing TrkB neurons in E11-E14.5 BAC-C-ΔR2 transgenic embryos. *p< 0.0001 compared to WT (C) at E11.5, E12.5 and E14.5. (E) Expression of endogenous Runx3, TrkB and GFP in CRΔR2/P2GFP E12.5 embryos.

Supplemental Fig. S9. Gene expression analysis discovers TrkC-neuron specific Runx3-responsive genes that were previously presumed to be Brn3a-targets RNA-seq was conducted on TrkC neurons of E11.5 P2GFP/+ and P2GFP/GFP embryos (see Supplemental Materials and methods). This early developmental stage was selected because at this stage the number of TrkC neurons is relatively high. FACS-sorted P2GFP/+ neurons express significantly higher level of Runx3 compared to Runx1 or Runx2 as well as a higher level of Ntrk3 compared to Ntrk1 and Ntrk2 (Supplemental Table S7), thereby providing strong indication for the TrkC identity of the neurons used for RNA-seq analysis. Data analysis revealed pronounced gene expression changes between P2GFP/+ and P2GFP/GFP neurons (Supplemental Table S7), underscoring the central role of Runx3 in TrkC neuron homeostasis. Interestingly, Ingenuity upstream regulator analysis revealed that several previously reported Brn3a (Pou4f1) regulated genes behave as Runx3-responsive genes. Namely, similarly to their response in Brn3a-mutant those genes were either upregulated (marked in pink) or downregulated (marked in green) in P2GFP/GFP neurons (lacking Runx3) compared to P2GFP/+ neurons. These findings are consistent with the observation that in TrkC neurons, Brn3a is an upstream regulator of Runx3.

Supplemental Table S1 Expression pattern of BACs surrounding Runx3 The detailed expression pattern of the six BACs: BAC-A, -B, -C, -D, -E, -F, listed in the Table according to their position in the murine genome starting from the 5’-end, and a Runx3 LacZ knock-in line (Runx3 KI). Original BAC names are indicated in brackets (see UCSC browser; mm9). The intensity of expression was evaluated qualitatively and is marked by + to +++. No expression is marked by a minus (-). The numbers in brackets indicate the number of positively-stained embryos out of the total number of embryos analyzed for each BAC.

BAC E BAC A BAC B BAC F BAC D Runx3 BAC C Organ BAC (RP23- (RP24- (RP24- (RP24- (RP23- KI (RP23-394B) 307D6) 118B14) 252E9) 180O8) 57P18) Thymus ++ + (2/9) ++ (1/7) ++ (6/12) - (9/9) - (5/5) - (8/8) Liver ++ +/- (3/9) + (1/7) + (6/12) - (9/9) ++ (1/5) - (8/8) Eyelid mesenchyme + ++ (8/9) ++ (7/7) +++ (12/12) ++ (3/9) + (4/5) + (5/8) Tongue – mesenchymal element ++ ++ (9/9) ++ (7/7) +++ (11/12) + (7/9) + (5/5) + (8/8) of filiform papillae DRG Cervical ++ ++ (8/9) ++ (4/7) + (1/12) - (9/9) - (5/5) +/- (1/8) Brachial ++ ++ (8/9) +/- (5/7) +/- (4/12) - (9/9) - (5/5) +/- (1/8) Thoracic + ++ (8/9) +/- (5/7) +/- (8/12) - (9/9) - (5/5) +/- (2/8) Lumbar ++ ++ (7/9) + (5/7) +/- (6/12) - (9/9) - (5/5) +/- (1/8) Coccygeal (Tail) ++ ++ (9/9) ++ (5/7) + (7/12) - (9/9) - (5/5) +/- (1/8) Hair follicles + ++ (7/9) ++ (7/7) ++ (11/12) + (2/9) + (3/5) +/- (3/8) Whiskers upper ++ + (8/9) ++ (7/7) +++ 10/12) + (2/9) +/- (4/5) - (8/8) Whiskers lower + +++ (9/9) +++ (7/7) +++ 12/12) ++ (6/9) ++ (5/5) ++ (8/8) Inner Epithelium of the ear + + (1/9) - (7/7) + (1/12) + (2/9) +/- (3/5) + (2/8) Teeth mesenchyme + + (4/9) + (6/7) + (9/12) - (9/9) ++ (1/5) +/- (1/8) Nails upper limbs ++ +++ (8/9) +++ (7/7) +++ (11/12) + (3/9) + (4/4) - (8/8) Nails lower limbs ++ +++ (8/9) ++ (7/7) +++ (11/12) + (2/9) + (2/4) - (8/8) Nose mesenchyme ++ +++ (9/9) +++ (7/7) +++ (12/12) ++ (8/9) ++ (5/5) ++ (7/8) Penis ++ +++ (9/9) +++ (7/7) +++ (10/10) + (4/5) ++ (4/5) + (3/5) Upper limb cartilage Scapula ++ +++ (9/9) +++ (7/7) +++ (11/12) + (6/9) ++ (5/5) ++ (8/8) Humerus ++ +++ (9/9) +++ (7/7) +++ (11/12) + (6/9) ++ (5/5) ++ (8/8) Radius ++ +++ (9/9) +++ (7/7) +++ (12/12) + (6/9) ++ (5/5) ++ (8/8) Ulna ++ +++ (9/9) +++ (7/7) +++ (12/12) + (6/9) ++ (5/5) ++ (8/8) Carpus - - (9/9) +/- (1/7) - (12/12) - (9/9) - (5/5) - (8/8) Metacarpus + +++ (7/9) +++ (6/7) +++ (12/12) +/- (4/9) ++ (4/5) ++ (8/8) Digits P1 + +++ (4/9) +++ (5/7) +++ (12/12) +/- (1/9) + (4/5) ++ (8/8) Digits P2 - +++ (3/9) ++ (4/7) +++ (9/12) - (9/9) +/- (3/5) ++ (6/8) Lower limb cartilage Femur ++ +++ (9/9) +++ (7/7) +++ (12/12) + (6/9) ++ (5/5) ++ (8/8) Tibia ++ +++ (9/9) +++ (7/7) +++ (12/12) + (6/9) ++ (5/5) ++ (8/8) Fibula ++ +++ (9/9) +++ (7/7) +++ (12/12) + (6/9) ++ (5/5) ++ (8/8) Tarsus - +/- (2/9) +/- (5/7) + (11/12) - (9/9) + (4/5) + (2/8) Metatarsus + +++ (7/9) +++ (6/7) +++ (12/12) +/- (3/9) ++ (5/5) ++ (8/8) Digits P1 + +++ (3/9) +++ (5/7) +++ (12/12) - (9/9) ++ (4/5) ++ (7/8) Digits P2 - - (9/9) + (2/7) +++ (9/12) - (9/9) - (5/5) +++ (4/8) Ribs ++ +++ (9/9) +++ (7/7) +++ (11/12) + (5/9) ++ (5/5) + (8/8) Vertebra cartilage ++ +++ (9/9) +++ (7/7) +++ (11/12) + (5/9) ++ (5/5) + (8/8)

Supplemental Table S2 A list of candidate cis-regulatory elements in the murine Runx3 locus (chr4:134,953,991- 135,208,237; mm10). Four separate analyses were performed using M-LAGAN (http://genome.lbl.gov/vista/index.shtml): 1) Human-Mouse-Rat; 2) Human-Mouse-Chicken; 3) Human-Mouse-Frog; 4) Human-Mouse-Fugu, in order to identify various degrees of evolutionary conservation. We used the rank Vista option, available through the Vista website, to identify candidate cis -regulatory elements in the mouse Runx3 locus. CNE mm10 RE 6 Species Human-Mouse- Human-Mouse- Human-Mouse- Human-Mouse- Rat Chicken Frog Fugu

CNE1 Chr4:134,968,833- R4 1.70E-12 1.80E-14 1.40E-09 - 7.30E-05 134,969,068 CNE2 Chr4:135,026,078- R3 4.90E-31 7.40E-21 2.10E-17 8.00E-14 0.00011 135,026,308 CNE3 Chr4:135,038,358- R2 1.20E-11 4.50E-10 1.40E-07 1.10E-08 0.075 135,038,569 CNE4 Chr4:135,050,219- R1 (R1C1) 2.30E-33 9.70E-18 4.50E-19 1.80E-14 1.80E-08 135,050,417 CNE5 Chr4:135,051,401- R1 (R1C2) 6.50E-25 9.60E-12 2.10E-16 1.00E-09 0.0035 135,051,628 CNE6 Chr4:135,080,518- 0.4 1.70E-06 - - - 135,080,582 CNE7 Chr4:135,146,991- 9.80E-07 2.20E-10 2.00E-07 - - 135,147,157 CNE8 Chr4:135,152,766- P2 0.0074 - 0.49 6.10E-12 2.90E-09 135,152,787 CNE9 Chr4:135,156,399- 1.10E-07 1.80E-16 9.10E-17 7.50E-09 - 135,156,596 CNE10 Chr4:135,173,098- 1.80E-05 0.00022 0.0028 0.017 - 135,173,197

Supplemental Table S3 Mouse genome coordinates of RE deletions and TF binding site mutations created in BACs Enhancer mm10 Deletion size, bp CNE R1C1 Chr4:135,049,483-135,050,834 1352 CNE5 R1C2 Chr4:135,050,829-135,052,405 1574 CNE6 R1 Chr4:135,049,087-135,052,405 3320 CNE5-6 R2 Chr4:135,036,909- Chr4:135,039,193 2284 CNE4 R3 Chr4:135,025,315- Chr4:135,026,573 1259 CNE3 TF binding site BRNF-R1 Chr4:135,050,255- 135,050,271 16 BRNF-R3 Chr4:135,026,245-135,026,260; Chr4: 135,026,272-135,026,284 15, 12

R1C1+R1C2 termed R1 was deleted in BAC-CdelR1; Only the core sequence of R1C1 was deleted in CRΔR1, because experiments with BAC-CdelR1C1 and BAC-CdelR1C2 revealed that deletion of R1C2 had no effect and all the apparent function is related to R1C1 (data not shown).

Supplemental Table S4 Coordinates and phenotypes of deletions and mutations created using CRISPR/Cas9 technology

Name Coordinates Sequence of sgRNAs Deletion Number Mutants Homozygotes Ataxic in mm10 size of pups born ΔR1,2,3 Chr4: 5’: TCCAGCCTTGTGTACCAGAC 25Kb 84 23 2 2 135050010 - 3’:GATGGGAGGGATATTCGACT 135026424

ΔR1 Chr4: 5’: TCCAGCCTTGTGTACCAGAC 530bp 34 6 0 0 135050010 - 3’: GCCTATGTGTATGCTGGAGT 135050541

ΔR2 Chr4: 5’: CCCAAACGCCATTAACAGGT 1000bp 55 25 2 0 135037768- 3’: CGATGCATGATTGCTTGGGT 135038767

ΔR3 Chr4: 5’: GAGAACCACGGGGTGGTCGA 700bp 55 31 10 0 135025711- 3’: GATGGGAGGGATATTCGACT 135026424

ΔR2,3 Chr4: 5’: CCCAAACGCCATTAACAGGT 13Kb 74 4 0 0 135037768- 135026424 3’: GATGGGAGGGATATTCGACT

ΔR1,2 Chr4: 5’: TCCAGCCTTGTGTACCAGAC 11Kb 86 12 1 0 135050010 – 135038767 3’: CGATGCATGATTGCTTGGGT

Name Coordinates Sequence of DNA oligo for site specific recombination sgRNA in mm10 BrnR1 Chr4:1350502 GTATTGATTTAT ACAGCCATCCCCGACCTGCAATGTATAATGAAAGACATTCGAAA 55-135050274 TCTATCCAAATGGCATgaggcgggcgggcggccggcCGGGGAATGTTGCTC TAATGCCG TAATTGAATTGAGATCCAGGAAGTAAGTTAATGTAGCTGACGAT G

Supplemental Table S5 Oligonucleotides for mouse lines diagnostic PCR

Mice Flanking oligos Internal oligos CRΔR1 F CTGATGCCTAGTACGTGCTCA CTCCAGCCTTGTGTACCAG R CTCCCCTTCTTCTCATTCCT ATACACATAGGCTCTGACCAC

CRΔR2 F TAGGACATCAAAGCCACCGAG TGGCCACTCTTTGTCACGA R GCCCTGAGCAAACTAGCAA TGCCATACACACATTCGCAAG

CRΔR3 F TCCCAACATCTGAATGGACTC TTTACAAGAAACCGGAATTAT R TCCTCAAAAGATCCGCACTCC TCCCTCATTCAGACGTGACC

CR-BRN-R1 F ATGAGGCGGGCGGGCGGCCG CCAAATGGCATGAGTATTGAT R CTCCCCTTCTTCTCATTCCTC TAGGCTCTGACCACATTTTC

P2GFP F AGCCGCCGCCTTCCCGCC R-GFP TGGTGCAGATGAACTTCAGG R AGCACGGAGCAGAGGAAGT

BACs-A, B, C,E-GFP F ATTGGGAACGGATCTACACGC R AGCTTGCCGTAGGTGGCATCG

BAC-C-ΔR1, F CTTACACAGCTACACCAGCCAT BAC-A-ΔR1 R GTGTGGGACATGGCTGCAAAC

BAC-C-ΔR2 F CCAGAAAGCAAACTCAGACCTTG R CTCAGCTGTAAGGATGCCGTCC

BAC-C-ΔR3, BAC- F AACAGGTCCTTTCCATCGTG EΔR3 R GCAACAATAACGGGATTCCT

BAC-C-BRNT F TAGCATCAATCCGGCCTGCG R CCAAAATGCTCTGAGTGTTCTGAGGG ATAGAGCC

BAC-C-BRN-R3 F TTGCAAGCAGCTGCAGGAACC R CACAACCAGCCTACTTGCTCC

BAC-C-BRN-R1 F ATGAGGCGGGCGGGCGGCCG R CTCCCCTTCTTCTCATTCCTC

16 Supplemental Table S6 Highly expressed TFs in TrkC neurons Listed are the top 20 TFs expressed in E11.5 TrkC neurons (1800 read counts per gene was selected as a lowest cutoff value). The two TFs (NeuroD1 and Zfhx3) could be Runx3 target genes since their expression is affected by loss of Runx3 (empty boxes signifies value similar to control). All these TFs possess potential binding sites in the three enhancers (binding sites selected by DiAllign TF (Genomatix) according to: matrix similarity optimized and 0.95, and core similarity 1, 5 of 6 species for R1 and R3 and 4 of 5 species for R2).

TF WT/P2 GFP P2 GFP/GFP Potential BS in enhancers

Pou4f1 22,449 R1, R2, R3 (POU homeodomain)

Islet 1 (Lim homeobox) 16,578 R1, R3

Sox11 (HMG) 15,130 R1

NeuroD1 11,711 6163 R1 (3/6 0.75, opt)

Ilf3 (dsRNA,NFAT) 8256 R2

Ilf2 (NFAT) 7556 R2

Klf13 (ZF) 4702, 1674 R2 Klf7

Tbpl1 4224 R3

NR2f2 3623 R3

Jarid2 (ARID domain) 2633 R1, R2, R3

Zfhx3 (ZF homeobox) 2205 4974 R3

Creb3 (Leucine zipper) 2189 R1

Shox2 (CART homeobox) 2153 R1, R2, R3

Hbp1 (HMG) 2152 R1, R3

Atf2 (CREB) 2074 R1

Onecut2 (HNF6) 2042 R1, R2

Pbx1 (homeobox C) 2005 R1, R2, R3

Zeb2 (ZFHX) 1959 R2

Zeb1 (ZFHX) 1844 R2

17 Supplemental Table S7 Runx3 target genes in TrkC neurons Lists of differentially expressed genes between E11.5 TrkC neurons of WT/P2GFP and P2GFP/GFP embryos. A total of 466 genes were Runx3 responsive, exhibiting differential expression in the absence of Runx3 (P2GFP/GFP / WT/P2GFP ≥ 2; FDR< 0.05). Of these, 338 genes were upregulated and 128 genes were downregulated in the absence of Runx3. RNA-seq results of differentially expressed genes between WT and Runx3-KO DRG neurons * WT= Runx3GFP/+; KO=Runx3GFP/GFP Gene Description Normalized reads Fold change WT_mean KO_mean KO vs p-value padj = WT* FDR Slco2a1 Mus musculus prostaglandin transporter 54.3230517 0 -17.45 1.24E-12 1.45E-09 PGT mRNA, complete cds. Fam19a4 TAFA4 protein precursor 2594.35858 162.418 -13.6424 1.49E-41 1.93E-37

Runx3 SubName: Full=Core binding factor alpha 1032.6227 112.278 -8.02444 4.65E-25 3.03E-21 3 subunit; Flags: Fragment; Zdhhc22 putative palmitoyltransferase ZDHHC22 118.397596 5.8191 -7.96785 5.97E-08 1.34E-05 Fam189a1 hypothetical protein LOC70638 222.0374 21.9671 -7.26009 1.21E-11 8.22E-09 Calca calcitonin gene-related peptide 1 isoform 177.095439 12.627 -6.48841 7.99E-07 0.0001182 Calca Shisa6 protein shisa-6 homolog precursor 337.33833 37.6335 -6.36007 1.22E-09 4.68E-07 Rgs11 regulator of G-protein signaling 11 571.59812 64.2496 -6.2199 3.65E-09 1.25E-06 Calcb calcitonin gene-related peptide 2 precursor 634.702268 49.724 -6.10334 1.81E-06 0.0002332 Ppp1r3b protein phosphatase 1 regulatory subunit 422.436125 65.1535 -5.13885 3.34E-09 1.18E-06 3B 1700034H15Rik Mus musculus adult male testis cDNA, 38.5215896 3.05868 -4.93383 6.55E-05 0.0040056 RIKEN full-length enriched library, clone:1700034H15 product:unclassifiable, full insert sequence. Gal galanin precursor 825.897147 132.046 -4.90179 2.24E-08 5.71E-06 Eno1 alpha-enolase 219.750421 36.16 -4.88868 6.58E-09 1.99E-06 Pcdh15 SubName: Full=Protocadherin-15-CD3 510.863386 97.9946 -4.84212 2.90E-20 1.26E-16 isoform 3; Avil advillin 1670.4115 313.34 -4.68156 5.60E-12 4.55E-09 Pcp4 Purkinje cell protein 4 37.8705767 3.615 -4.65221 9.73E-05 0.0053943 Cntnap4 contactin-associated protein-like 4 301.177842 39.2176 -4.54199 3.49E-05 0.0025844 precursor Kirrel3 kin of IRRE-like protein 3 isoform C 329.713583 59.2018 -4.42803 1.81E-07 3.03E-05 precursor AK047938 Mus musculus 10 days neonate cerebellum 73.7476824 11.2175 -4.38769 1.56E-05 0.0012995 cDNA, RIKEN full-length enriched library, clone:B930053L08 product:unclassifiable, full insert sequence. AK048013 Mus musculus 16 days embryo head cDNA, 63.0854157 2.96213 -4.36926 0.00041 0.0146825 RIKEN full-length enriched library, clone:C130030D05 product:unclassifiable, full insert sequence. Gm6537 hypothetical protein LOC624918 precursor 353.283276 66.9858 -4.29488 1.11E-07 2.18E-05 Cdh12 cadherin-12 precursor 191.103035 34.35 -4.2177 3.13E-06 0.0003915 Rbfox1 fox-1 homolog A isoform alpha 44.7602402 5.22688 -4.17261 0.00028 0.0113971 Dio3 type III iodothyronine deiodinase 121.740176 18.5236 -4.03552 0.00014 0.007159 Insrr insulin receptor-related protein precursor 327.05796 64.6722 -4.02028 1.76E-06 0.0002292 Cdh18 cadherin 18 90.2844687 5.83809 -3.83154 0.00129 0.0319682 Galnt14 polypeptide N- 181.374605 35.8068 -3.77528 3.74E-05 0.0026785 acetylgalactosaminyltransferase Anxa2 annexin A2 7973.23086 1946.12 -3.71303 7.74E-10 3.36E-07 Glb1l2 beta-galactosidase-1-like protein 2 131.547908 27.4368 -3.60031 7.31E-05 0.0044302 Grik1 glutamate receptor, ionotropic kainate 1 280.800329 72.4655 -3.56299 2.53E-10 1.18E-07 isoform Kcnh6 Mus musculus adult male hypothalamus 211.352187 52.0736 -3.39887 1.17E-05 0.0010586 cDNA, RIKEN full-length enriched library, clone:A230021I18 product:Potassium channel ERG2 (FRAGMENT) homolog [Ratus ratus], full insert sequence. Snora17 Mus musculus RIKEN cDNA 2610002F03 95.8292597 23.913 -3.36566 1.23E-05 0.0010977 gene, mRNA (cDNA clone 18 IMAGE:5324476). Pthlh parathyroid hormone-related protein 54.2262974 9.56475 -3.35472 0.0016 0.0379542 Tns1 SubName: Full=Putative uncharacterized 145.070522 34.0586 -3.28237 0.00022 0.0094337 protein; Syt9 Mus musculus mRNA for synaptotagmin 349.414493 71.8018 -3.25915 0.00119 0.0305878 V, complete cds. Sfrp4 secreted frizzled-related sequence protein 4 358.374991 81.9314 -3.19741 0.0007 0.0214038 Fam38b Mus musculus adult male colon cDNA, 534.857558 136.626 -3.13865 0.00021 0.0093882 RIKEN full-length enriched library, clone:9030411M15 product:RIKEN cDNA 9030411M15 gene, full insert sequence. Rnf112 RING finger protein 112 123.743696 29.7444 -3.08138 0.00099 0.0270825 AK019679 Mus musculus adult male testis cDNA, 744.36352 222.495 -3.07698 1.36E-07 2.51E-05 RIKEN full-length enriched library, clone:4930513E20 product:unclassifiable, full insert sequence. Cbln2 cerebellin-2 425.066189 117.31 -3.03326 0.00012 0.0063374 Sorcs1 VPS10 domain-containing receptor 263.745704 78.5229 -3.02024 3.50E-06 0.0004182 SorCS1 Adcy1 Mus musculus adenylyl cyclase 1 (Adcy1) 615.43667 186.852 -2.99897 1.16E-06 0.0001589 cDNA, partial cds. Dbpht2 DNA binding protein with his-thr domain 2342.34246 723.365 -2.95227 1.56E-06 0.0002054 AK028782 Mus musculus 10 days neonate skin cDNA, 256.929947 71.603 -2.94786 0.00034 0.0129426 RIKEN full-length enriched library, clone:4732456F06 product:unclassifiable, full insert sequence. Prune2 RecName: Full=Protein prune homolog 2; 572.994587 148.218 -2.92326 0.00158 0.0377993 AltName: Full=BNIP2 motif-containing molecule at the C-terminal region 1; Cryba1 beta-crystallin A1 529.815459 171.399 -2.90319 2.18E-08 5.69E-06 Rac3 ras-related C3 botulinum toxin substrate 3 158.523267 43.9214 -2.85157 0.0012 0.0307646 Grm3 metabotropic glutamate receptor 3 326.708843 98.5774 -2.84562 0.00017 0.0080935 precursor Prdm12 PR domain zinc finger protein 12 744.741539 249.887 -2.80204 8.62E-08 1.73E-05 Scn10a sodium channel protein type 10 subunit 943.452996 301.899 -2.79314 3.91E-05 0.0027674 alpha Tmem63c transmembrane protein 63C 262.569533 80.501 -2.79262 0.00029 0.0116578 Susd2 sushi domain-containing protein 2 isoform 208.741808 58.3935 -2.77639 0.00222 0.0480741 2 Cntnap2 contactin-associated protein-like 2 isoform 701.229535 245.175 -2.76843 1.33E-12 1.45E-09 b Mdga1 MAM domain-containing 615.796192 205.894 -2.75021 5.04E-06 0.0005653 Odz2 teneurin-2 240.491317 74.2102 -2.74968 0.00049 0.0165965 Scn7a sodium channel, voltage-gated, type VII, 3644.75409 1239.14 -2.71509 5.25E-06 0.0005797 alpha Pls1 plastin-1 249.089252 76.0947 -2.69636 0.00137 0.0338582 AI593442 hypothetical protein LOC330941 isoform 2 1285.45956 405.352 -2.69189 0.0007 0.0215401 6430704M03Rik SubName: Full=Putative uncharacterized 197.775807 62.7816 -2.68444 0.00062 0.0197962 protein; Flags: Fragment; Accn2 SubName: Full=Sodium channel 2; Flags: 1394.99548 504.43 -2.66674 2.09E-10 1.01E-07 Fragment; Myo1e SubName: Full=Myosin IE; 478.480565 161.792 -2.66601 6.50E-05 0.0039929 Cacna2d2 voltage-dependent calcium channel subunit 353.521176 122.787 -2.66359 7.81E-06 0.0007879 Mgat4c alpha-1,3-mannosyl-glycoprotein 433.614768 143.036 -2.6561 0.00032 0.0122795 P4ha2 Mus musculus 2 days pregnant adult 879.978488 316.142 -2.6464 7.21E-08 1.57E-05 female oviduct cDNA, RIKEN full-length enriched library, clone:E230038K10 product:hypothetical protein, full insert sequence. Slc24a2 solute carrier family 24 148.224834 49.4354 -2.64319 0.00028 0.0113861 Pirt phosphoinositide-interacting protein 3216.20255 1133.95 -2.6378 5.14E-06 0.0005725 Jph4 junctophilin-4 isoform b 387.276405 131.96 -2.62176 0.00017 0.0081412 Klhl5 kelch-like 5 476.748097 161.004 -2.58524 0.0006 0.0194355 Vill villin-like protein isoform 1 139.076875 47.0154 -2.55048 0.00113 0.0296035 Mgst3 microsomal glutathione S-transferase 3 1779.97904 670.292 -2.53526 1.64E-07 2.84E-05 Atp1a2 sodium/potassium-transporting ATPase 279.204144 97.3669 -2.49405 0.00125 0.0316455

19 subunit Adamts17 ADAM metallopeptidase with 103.146575 38.0899 -2.47765 0.00013 0.0066526 thrombospondin type 1 Ctdspl CTD small phosphatase-like protein 411.722882 158.99 -2.4708 5.59E-07 8.66E-05 Pcqap Mus musculus PC2-glutamine-rich- 110.558191 38.9027 -2.45731 0.00202 0.0447915 associated protein (Pcqap) mRNA, complete cds. Adap1 centaurin, alpha 1 244.402476 91.0129 -2.44907 0.00021 0.0093882 Cpne6 copine-6 isoform a 244.429162 86.9856 -2.44538 0.00168 0.0396875 6530418L21Rik hypothetical protein LOC109050 isoform 2 881.01223 333.472 -2.44425 7.83E-05 0.0046356 Gfra3 GDNF family receptor alpha-3 2617.33363 1019.67 -2.42628 7.70E-06 0.0007836 preproprotein Armc2 SubName: Full=Putative uncharacterized 64.4780035 23.2845 -2.42584 0.0017 0.0398467 protein; Npr2 atrial natriuretic peptide receptor 2 4338.90392 1735.84 -2.41269 4.37E-08 9.98E-06 precursor Fggy Mus musculus adult male tongue cDNA, 196.657834 73.5963 -2.4049 0.00067 0.0209444 RIKEN full-length enriched library, clone:2310009E04 product:CDNA FLJ10986 FIS, CLONE PLACE1001869, WEAKLY SIMILAR TO L- RIBULOKINASE (EC 2.7.1.16) (HYPOTHETICAL 27.5 KDA PROTEIN) homolog [Homo sapiens], full insert sequence. Abhd14b abhydrolase domain-containing protein 577.953016 218.451 -2.40319 0.00044 0.0157325 14B Ablim3 actin-binding LIM protein 3 1013.64946 391.959 -2.39142 0.00015 0.0075313 Faim2 fas apoptotic inhibitory molecule 2 isoform 173.866987 65.1078 -2.3841 0.00122 0.0311592 2 Atp1b1 sodium/potassium-transporting ATPase 486.690413 183.735 -2.3795 0.00093 0.0262427 subunit 2210012G02Rik Mus musculus adult male stomach cDNA, 429.666776 169.478 -2.37225 5.98E-05 0.0037413 RIKEN full-length enriched library, clone:2210010B22 product:CDNA FLJ32112 FIS, CLONE OCBBF2001586, WEAKLY SIMILAR TO TRANSCRIPTION ELONGATION FACTOR S-II homolog [Homo sapiens], full insert sequence. 4933431E20Rik Mus musculus adult male testis cDNA, 485.351891 195.251 -2.3406 4.04E-05 0.0028002 RIKEN full-length enriched library, clone:4933431E20 product:unclassifiable, full insert sequence. Hrk activator of apoptosis harakiri 581.859031 229.958 -2.33758 0.00027 0.0110818 Pld5 Mus musculus adult male corpora 186.689251 74.0524 -2.33037 0.00025 0.0107621 quadrigemina cDNA, RIKEN full-length enriched library, clone:B230365F16 product:hypothetical Phospholipase D/nuclease structure containing protein, full insert sequence. AK154225 Mus musculus adult male testis cDNA, 146.570192 58.7696 -2.32976 0.00011 0.0060715 RIKEN full-length enriched library, clone:4930451G09 product:hypothetical protein, full insert sequence. Tub tubby protein 1819.02979 772.467 -2.31921 3.24E-14 6.02E-11 Lrfn5 leucine-rich repeat and fibronectin type-III 414.863542 164.843 -2.31399 0.00048 0.0163879 Arhgdig rho GDP-dissociation inhibitor 3 168.747751 67.4243 -2.3018 0.00057 0.0185996 Snhg3 Mus musculus RNA transcript from U17 276.827452 108.197 -2.29409 0.00204 0.0451603 small nucleolar RNA host gene. Fkbp1b peptidyl-prolyl cis-trans isomerase 1473.84432 611.743 -2.29398 1.52E-05 0.0012995 FKBP1B Usp12 ubiquitin carboxyl-terminal hydrolase 12 590.172274 241.652 -2.26324 0.00045 0.0158248 AK040485 Mus musculus 0 day neonate thymus 188.160731 78.3336 -2.25769 0.00016 0.0079736 cDNA, RIKEN full-length enriched library, clone:A430102M01 product:unclassifiable, full insert sequence. Mfap4 microfibril-associated glycoprotein 4 10539.3762 4444.91 -2.24305 8.14E-05 0.004731 precursor AK044422 Mus musculus adult male olfactory brain 1510.21472 628.316 -2.23998 0.00039 0.014336 cDNA, RIKEN full-length enriched library, clone:6430539E13 product:unclassifiable, full insert sequence.

20 Syn2 synapsin-2 isoform IIa 628.871097 268.151 -2.23666 2.55E-05 0.0019419 Sema5a Mus musculus 13 days embryo forelimb 651.41383 268.501 -2.23392 0.00095 0.0264991 cDNA, RIKEN full-length enriched library, clone:5930434A13 product:weakly similar to SEMAPHORIN 5A PRECURSOR (SEMAPHORIN F) (SEMA F) [Mus musculus], full insert sequence. Sobp sine oculis-binding protein homolog 189.189959 78.5942 -2.22261 0.00091 0.0260211 Stra6 stimulated by retinoic acid gene 6 protein 2035.66729 869.747 -2.21761 9.10E-05 0.005148 6720401G13Rik Mus musculus adult male thymus cDNA, 2268.56523 954.599 -2.21285 0.00056 0.018452 RIKEN full-length enriched library, clone:5830467J12 product:unclassifiable, full insert sequence. Frmd3 FERM domain-containing protein 3 776.216291 338.824 -2.21009 3.31E-06 0.0003996 isoform 2 Camk1g calcium/calmodulin-dependent protein 774.553062 327.527 -2.19303 0.00088 0.0253533 kinase type Cyth3 cytohesin-3 isoform 2 741.144425 319.443 -2.15314 0.00124 0.0314462 Rrp8 RecName: Full=Ribosomal RNA- 202.0343 88.4428 -2.15008 0.00051 0.0173074 processing protein 8; EC=2.1.1.-; AltName: Full=Cerebral protein 1 homolog; Ccdc112 coiled-coil domain-containing protein 112 267.133287 114.606 -2.14923 0.00179 0.0415583 9430008C03Rik Mus musculus 10 day old male pancreas 848.903574 391.186 -2.11989 1.57E-07 2.80E-05 cDNA, RIKEN full-length enriched library, clone:1810073H09 product:unclassifiable, full insert sequence. Pam Mus musculus 7 days embryo whole body 765.386151 341.787 -2.11405 0.00051 0.0171738 cDNA, RIKEN full-length enriched library, clone:C430006I19 product:peptidylglycine alpha-amidating monooxygenase, full insert sequence. Fads3 fatty acid desaturase 3 247.414039 113.089 -2.09473 0.00012 0.0063146 Gnal guanine nucleotide-binding protein G(olf) 922.383817 428.155 -2.08796 8.67E-06 0.0008549 Shc4 SHC-transforming protein 4 304.968393 139.99 -2.07783 0.00022 0.0096096 Miat Mus musculus adult male hypothalamus 7269.98434 3378.26 -2.0633 0.00014 0.0071996 cDNA, RIKEN full-length enriched library, clone:A230057G18 product:unclassifiable, full insert sequence. Cwc22 SubName: Full=Putative uncharacterized 4227.66289 1950.24 -2.04884 0.00097 0.026806 protein; Rgs4 regulator of G-protein signaling 4 15693.5598 7332.62 -2.047 0.00026 0.0109142 Cdhr1 cadherin-related family member 1 2145.2533 1028.13 -2.04406 2.08E-07 3.34E-05 precursor Malat1 Mus musculus adult male stomach cDNA, 126032.765 59700.9 -2.03218 0.00011 0.0060715 RIKEN full-length enriched library, clone:2210401K01 product:inferred: Unknown (protein for MGC:7901) [Mus musculus], full insert sequence. Slc16a2 monocarboxylate transporter 8 633.115501 299.192 -2.0275 0.00026 0.0107968 Slco4a1 Mus musculus adult male cecum cDNA, 1366.3928 631.819 -2.0267 0.00232 0.0496768 RIKEN full-length enriched library, clone:9130022F15 product:ORGANIC ANION TRANSPORTER E homolog [Rattus norvegicus], full insert sequence. Tnks tankyrase, TRF1-interacting ankyrin- 4148.99255 1980.42 -2.02558 5.15E-05 0.0032708 related Zfp804a zinc finger protein 804A 584.873003 278.925 -2.01954 0.00013 0.0067141 AK076606 Mus musculus 1 day pregnant adult female 286.185319 134.881 -2.0139 0.00105 0.0279738 mammary gland cDNA, RIKEN full-length enriched library, clone:4222403J09 product:inferred: RIKEN cDNA 1500010G04 gene, full insert sequence. Cpeb2 cytoplasmic polyadenylation element- 800.063887 386.089 -2.0026 8.04E-05 0.0047147 binding Prph peripherin isoform 2 4457.23338 2137.73 -2.00112 0.0003 0.0119432 Wdr89 WD repeat-containing protein 89 2374.31108 4965.43 2.0068 0.00027 0.0112124 Tk1 thymidine kinase, cytosolic 137.071732 292.222 2.01638 0.00122 0.0310716 Irf2 interferon regulatory factor 2 130.404222 276.974 2.0189 0.00076 0.0227159 Suv420h2 histone-lysine N-methyltransferase 354.738852 759.083 2.02515 0.00105 0.0278635 SUV420H2

21 Bola1 bolA-like protein 1 241.801693 525.23 2.03123 0.00233 0.0496768 Cbx1 chromobox protein homolog 1 311.307777 666.737 2.03246 0.00071 0.0217786 Zfhx3 zinc finger homeobox protein 3 2205.67792 4718.2 2.04456 0.00029 0.0116578 Snx14 sorting nexin-14 206.651543 440.44 2.04791 0.00011 0.0056739 Rad51 Mus musculus 10 days embryo whole body 169.959767 370.015 2.05396 0.00093 0.0262427 cDNA, RIKEN full-length enriched library, clone:2600017H22 product:RAD51 homolog (S. cerevisiae), full insert sequence. Cst3 cystatin-C precursor 2293.58263 4940.27 2.05593 0.00029 0.0116578 Rplp2 60S acidic ribosomal protein P2 489.211974 1066.93 2.05693 0.00098 0.0269513 Ddx11 probable ATP-dependent RNA helicase 100.444801 215.112 2.0597 0.00011 0.0056739 DDX11 N4bp2 Nedd4 binding protein 2 131.662844 285.069 2.06881 0.00018 0.0084322 Yaf2 YY1-associated factor 2 341.80996 734.196 2.06948 4.95E-05 0.003208 Pebp1 phosphatidylethanolamine-binding protein 394.203933 873.971 2.086 0.00086 0.0250459 1 Eif2ak2 interferon-induced, double-stranded 66.8792057 149.943 2.08678 0.00178 0.0414208 Ict1 peptidyl-tRNA hydrolase ICT1, 548.200399 1206.4 2.08829 0.00037 0.0137419 mitochondrial Atad5 SubName: Full=Atad5 protein; 157.858306 344.025 2.08872 0.00011 0.0056739 Hmga2 SubName: Full=Hmga2 protein; 303.156287 678.63 2.11713 0.00037 0.0138392 Mrpl2 SubName: Full=Mitochondrial ribosomal 448.47108 1016.52 2.12014 0.00095 0.026496 protein L2; SubName: Full=Mitochondrial ribosomal protein L2, isoform CRA_c; Anln actin-binding protein anillin 267.024009 606.006 2.12032 0.00105 0.0278635 Fh1 fumarate hydratase, mitochondrial 919.838208 2095.26 2.12777 0.00098 0.0270183 precursor Elf1 ETS-related transcription factor Elf-1 189.531042 430.962 2.13094 0.00077 0.0229353 Bop1 ribosome biogenesis protein BOP1 484.589152 1131.42 2.1454 0.00216 0.0471426 Ccdc86 coiled-coil domain-containing protein 86 190.751743 441.29 2.15104 0.00101 0.0274424 Tsc22d1 TSC22 domain family protein 1 isoform 2 3780.78591 8501.63 2.15355 4.14E-05 0.0028398 Dnm2 dynamin-2 315.913012 727.612 2.15572 0.00062 0.0197961 Mpped2 metallophosphoesterase MPPED2 166.297094 383.372 2.16013 0.00059 0.0192029 Upf1 regulator of nonsense transcripts 1 isoform 258.050272 575.052 2.16441 4.96E-07 7.78E-05 b Hmmr SubName: Full=Putative uncharacterized 119.729454 272.441 2.1679 8.13E-05 0.004731 protein; Flags: Fragment; Praf2 PRA1 family protein 2 328.514921 771.439 2.1698 0.00128 0.0319682 Hnrnpm SubName: Full=Heterogeneous nuclear 3288.65803 7646.27 2.17262 0.00061 0.0194947 ribonucleoprotein M; Lyrm7 LYR motif-containing protein 7 61.1736849 141.161 2.17372 0.00033 0.012523 Rad50 DNA repair protein RAD50 242.48222 569.98 2.17436 0.00114 0.0296428 Dusp6 dual specificity protein phosphatase 6 634.379803 1443.29 2.17475 4.05E-05 0.0028002 Phb prohibitin 305.393137 713.611 2.18698 0.00044 0.0157362 Pctp SubName: Full=Phosphatidylcholine 117.360259 275.244 2.19441 0.00041 0.0146825 transfer protein; Rab1b ras-related protein Rab-1B 315.124791 744.704 2.20553 0.00046 0.0161944 2810001G20Rik Mus musculus adult male cerebellum 90.4758818 219.611 2.21047 0.00176 0.040991 cDNA, RIKEN full-length enriched library, clone:1500002G14 product:unclassifiable, full insert sequence. Epb4.1l2 band 4.1-like protein 2 230.182958 547.574 2.21259 0.00055 0.0183633 Stk32b serine/threonine-protein kinase 32B 194.131174 456.72 2.21581 0.00019 0.0086469 Heatr5a RecName: Full=HEAT repeat-containing 138.271363 321.283 2.2328 5.95E-06 0.0006405 protein 5A; Pgrmc1 membrane-associated progesterone 761.598086 1854.55 2.23826 0.00094 0.0264887 receptor Twf2 twinfilin-2 434.511517 1018.84 2.24442 9.92E-06 0.0009363 Bak1 Mus musculus N-BAK1 (Bak1) mRNA, 34.2901385 85.9789 2.25518 0.00215 0.0469526 complete cds, alternatively spliced. Vps72 vacuolar protein sorting-associated protein 544.096977 1287.5 2.25621 1.77E-05 0.0014303 72

22 Tmem108 transmembrane protein 108 precursor 111.507776 274.127 2.26184 0.00068 0.0209946 AK043844 Mus musculus 10 days neonate cortex 113.551948 276.024 2.26461 0.0003 0.0118966 cDNA, RIKEN full-length enriched library, clone:A830039H05 product:unclassifiable, full insert sequence. Pts 6-pyruvoyl tetrahydrobiopterin synthase 272.474816 667.934 2.2672 0.00047 0.0162274 Cartpt cocaine- and amphetamine-regulated 181.37613 460.144 2.28663 0.0016 0.0379542 transcript Mrps22 Mus musculus 13 days embryo head cDNA, 106.906794 267.125 2.34866 4.06E-05 0.0028002 RIKEN full-length enriched library, clone:3100002P07 product:mitochondrial ribosomal protein S22, full insert sequence. Ajap1 adherens junction-associated protein 1 52.615651 138.641 2.35924 0.00115 0.0298834 Aldh16a1 aldehyde dehydrogenase family 16 member 134.708314 346.793 2.36197 0.00031 0.0121069 A1 Cthrc1 SubName: Full=Cthrc1 protein; 107.645422 289.397 2.36609 0.00194 0.0437389 Mrpl52 Mus musculus 18-day embryo whole body 498.997669 1281.38 2.38564 9.59E-05 0.0053399 cDNA, RIKEN full-length enriched library, clone:1110047B07 product:mitochondrial ribosomal protein L52, full insert sequence. Rrm2 ribonucleoside-diphosphate reductase 1257.4592 3320.58 2.3872 0.00061 0.0194947 subunit M2 3110047P20Rik hypothetical protein LOC319807 173.999052 478.54 2.41425 0.00159 0.0379204 Ppp1r15a protein phosphatase 1 regulatory subunit 115.844647 305.647 2.41662 0.00021 0.0093882 15A Spcs2 signal peptidase complex subunit 2 795.487852 2068.51 2.41841 6.08E-05 0.0037623 Olfm2 noelin-2 precursor 543.077741 1365.91 2.42118 8.66E-08 1.73E-05 Agtrap type-1 angiotensin II receptor-associated 43.7803488 119.552 2.4245 0.00102 0.0274759 Brip1 Fanconi anemia group J protein homolog 54.0012355 149.822 2.44622 0.00102 0.0274759 Gltscr2 glioma tumor suppressor candidate region 88.2382388 238.301 2.4536 0.00025 0.0105662 gene 2 Zfp36l2 zinc finger protein 36, C3H1 type-like 2 27.0380059 77.453 2.45775 0.00201 0.0447915 Gfra2 GDNF family receptor alpha-2 657.327106 1736.83 2.45953 3.57E-05 0.0026125 Cnn2 calponin-2 343.692 920.897 2.47289 6.84E-05 0.004165 Tfpt TCF3 fusion partner homolog 56.8646086 156.972 2.49784 0.00021 0.0092035 Mbnl3 muscleblind-like protein 3 104.419222 278.64 2.49823 1.16E-05 0.0010585 Gusb SubName: Full=Gusb protein; 389.688566 1127.38 2.50237 0.0013 0.0323002 AK152437 Mus musculus 9 days embryo whole body 61.8492273 172.524 2.50408 0.00032 0.0122795 cDNA, RIKEN full-length enriched library, clone:D030050E20 product:unclassifiable, full insert sequence. S100a13 protein S100-A13 72.3500312 203.911 2.5088 0.00045 0.0158248 Cdk2 cell division protein kinase 2 isoform 2 126.758582 369.669 2.50885 0.00143 0.0348896 Peg10 Mus musculus Peg10 mRNA for paternally 62.9715697 176.784 2.5182 0.00032 0.0122795 expressed 10, complete cds. Dmap1 DNA methyltransferase 1-associated 109.726924 312.965 2.52244 0.00051 0.0172805 protein 1 Akap8l A-kinase anchor protein 8-like 148.948229 408.212 2.53591 2.39E-05 0.0018617 Lgr5 SubName: Full=Putative uncharacterized 49.1706802 136.179 2.53642 5.88E-05 0.0036978 protein; Suclg2 Mus musculus 7 days neonate cerebellum 48.2692258 141.921 2.53759 0.00101 0.0274627 cDNA, RIKEN full-length enriched library, clone:A730045H10 product:GTP- SPECIFIC SUCCINYL-COA SYNTHETASE BETA SUBUNIT (FRAGMENT) homolog [Mus musculus], full insert sequence. Mtr Mus musculus 16 days neonate thymus 183.034629 504.291 2.5386 3.81E-05 0.0027089 cDNA, RIKEN full-length enriched library, clone:A130029B16 product:5- methyltetrahydrofolate-homocysteine methyltransferase, full insert sequence. Trappc6a Mus musculus 10 day old male pancreas 117.238599 321.198 2.54912 1.06E-05 0.000993 cDNA, RIKEN full-length enriched library, clone:1810073E21 product:similar to HSPC289 (FRAGMENT) [Homo sapiens], full insert sequence. Arpc1b actin-related protein 2/3 complex subunit 273.37188 809.313 2.565 0.00081 0.0239296 1B

23 Ddx54 ATP-dependent RNA helicase DDX54 196.9064 591.029 2.56644 0.00115 0.0298555 Kit SubName: Full=KIT oncogene; 493.360673 1415.05 2.58172 0.00014 0.0071612 Mab21l2 protein mab-21-like 2 1096.92554 3053.91 2.58622 9.86E-06 0.0009363 Lama1 laminin subunit alpha-1 precursor 129.227122 351.494 2.60085 2.31E-08 5.78E-06 Mcm3 DNA replication licensing factor MCM3 682.512732 1928.68 2.60159 2.15E-05 0.0017201 Uqcrc1 cytochrome b-c1 complex subunit 1, 1180.70272 3445.09 2.60522 0.00018 0.0084322 mitochondrial Pea15a astrocytic phosphoprotein PEA-15 isoform 939.843765 2652.06 2.6053 1.55E-05 0.0012995 2 Ndufa6 NADH dehydrogenase [ubiquinone] 1 510.731422 1514.35 2.61748 0.00028 0.0113855 alpha Pdzrn4 PDZ domain containing RING finger 4 127.477388 393.135 2.63351 0.00077 0.0229353 isoform 2 Gpx1 glutathione peroxidase 1 2130.31301 6326.4 2.63987 0.00017 0.0080935 Snrpa U1 small nuclear ribonucleoprotein A 111.866526 350.682 2.67458 0.0006 0.0194355 Dll1 delta-like protein 1 precursor 155.808754 448.521 2.67548 2.86E-06 0.0003618 Hist3h2ba histone H2B type 3-A 63.0247246 209.026 2.69678 0.00152 0.0366168 Rassf7 ras association domain-containing protein 186.725868 581.147 2.70045 0.00029 0.0116578 7 Rhog rho-related GTP-binding protein RhoG 149.441932 461.564 2.71075 0.00017 0.0081542 precursor Tox RecName: Full=Thymocyte selection- 477.372644 1374.87 2.71377 2.10E-07 3.34E-05 associated high mobility group box protein TOX; AltName: Full=Thymus high mobility group box protein TOX; Cdca8 borealin 256.168076 774.79 2.72643 3.38E-05 0.002526 Gadd45g growth arrest and DNA damage-inducible 263.170301 835.072 2.72705 0.00034 0.0128347 protein Stk17b serine/threonine-protein kinase 17B 90.0614843 297.337 2.73109 0.00092 0.0261534 AA465934 Mus musculus mammary gland RCB-0527 25.1076593 85.3646 2.73525 0.00155 0.0372504 Jyg-MC(B) cDNA, RIKEN full-length enriched library, clone:G930023N16 product:unclassifiable, full insert sequence. Dcc Mus musculus 12 days embryo spinal cord 236.515181 821.807 2.7481 0.00182 0.0419696 cDNA, RIKEN full-length enriched library, clone:C530046D04 product:deleted in colorectal carcinoma, full insert sequence. Colec12 collectin-12 39.3844294 138.41 2.75536 0.00193 0.0437077 Gli3 zinc finger protein GLI3 167.802756 524.595 2.75975 9.02E-05 0.0051299 Il4ra interleukin-4 receptor subunit alpha 135.109594 461.554 2.7714 0.00107 0.0284282 precursor Stxbp2 syntaxin-binding protein 2 216.255799 677.403 2.78451 5.00E-05 0.0032169 Nptx1 neuronal pentraxin-1 precursor 68.815329 234.584 2.79041 0.0008 0.0237029 Gpm6a neuronal membrane glycoprotein M6-a 469.259814 1543.69 2.80409 0.00027 0.0111294 Ada adenosine deaminase 52.5376297 178.901 2.80688 0.00064 0.0200768 Mrpl34 39S ribosomal protein L34, mitochondrial 542.764549 1778.66 2.85738 7.58E-05 0.0045488 2810428I15Rik hypothetical protein LOC66462 206.396175 702.674 2.9161 0.0001 0.005617 Jam2 junctional adhesion molecule B precursor 21.6285651 84.782 2.92564 0.00152 0.0366168 Iqgap2 ras GTPase-activating-like protein 52.2170596 180.729 2.94277 0.00011 0.0057468 IQGAP2 Snx29 sorting nexin-29 18.644856 70.3617 2.94683 0.0008 0.0237279 Sox6 transcription factor SOX-6 isoform 2 89.5465349 374.014 2.95004 0.0023 0.0492348 Sgk1 serine/threonine-protein kinase Sgk1 218.58632 727.886 2.95024 1.49E-05 0.0012995 isoform e Arhgef6 Mus musculus Rac/Cdc42 guanine 75.6448147 264.102 2.95585 0.00012 0.0061272 nucleotide exchange factor 6 (Arhgef6) mRNA, complete cds. Syngr2 synaptogyrin-2 102.183775 383.546 2.9595 0.00064 0.0201387 Tnfaip6 tumor necrosis factor-inducible gene 6 15.563107 64.4037 2.9803 0.00168 0.0397493 protein Pros1 vitamin K-dependent protein S precursor 33.3828877 130.912 3.02188 0.00066 0.0204706 Nt5c 5'(3')-deoxyribonucleotidase, cytosolic type 160.046832 555.238 3.03379 1.60E-05 0.0013268 Rgs2 regulator of G-protein signaling 2 231.990476 886.094 3.03394 0.00039 0.014173 2310039H08Rik hypothetical protein LOC67101 11.9266452 52.7705 3.05269 0.00171 0.0400986

24 Ifngr1 interferon gamma receptor 1 precursor 208.46648 723.677 3.05477 9.42E-06 0.000909 Parvg gamma-parvin isoform 1 109.979325 493.139 3.09729 0.0015 0.0363571 1810043H04Rik hypothetical protein LOC208501 26.0402513 104.8 3.09845 0.00045 0.0158248 Pdzrn3 E3 ubiquitin-protein ligase PDZRN3 105.92803 387.837 3.10878 3.99E-05 0.0028002 Tapbp tapasin isoform 1 115.281962 448.973 3.11569 0.00021 0.0093882 Frrs1 ferric-chelate reductase 1 45.1240146 192.934 3.1575 0.00062 0.0197962 Man2b1 lysosomal alpha-mannosidase precursor 510.461905 1938.54 3.16686 5.10E-05 0.0032584 Fuca1 tissue alpha-L-fucosidase precursor 234.245152 917.694 3.18338 9.92E-05 0.0054736 Pou2f2 POU domain, class 2, transcription factor 2 37.7986888 160.37 3.1922 0.00042 0.0149649 Gria3 glutamate receptor 3 precursor 37.6663253 153.307 3.20232 0.00019 0.0085799 Dtx3l E3 ubiquitin-protein ligase DTX3L 14.1318455 67.1267 3.21272 0.00109 0.0286973 Fam46a hypothetical protein LOC212943 isoform 2 44.4907672 173.092 3.21368 5.01E-05 0.0032169 B2m beta-2-microglobulin precursor 513.168942 1987.8 3.2382 2.93E-05 0.0022031 Ccdc80 coiled-coil domain-containing protein 80 8.85987099 41.7172 3.26368 0.00068 0.0211261 H6pd GDH/6PGL endoplasmic bifunctional 22.3107344 121.144 3.27409 0.00168 0.0396875 protein Ap2s1 AP-2 complex subunit sigma 275.81579 1082.16 3.33312 7.42E-06 0.0007619 Arap3 arf-GAP with Rho-GAP domain, ANK 29.1693195 115.687 3.3355 1.22E-05 0.0010951 repeat and PH Itgb8 Mus musculus 0 day neonate head cDNA, 19.8610259 107.851 3.392 0.00092 0.0261922 RIKEN full-length enriched library, clone:4832412O06 product:SIMILAR TO INTEGRIN, BETA 8 homolog [Homo sapiens], full insert sequence. Cfb complement factor B isoform 1 26.1345133 147.778 3.40525 0.00108 0.0285011 Ncf2 neutrophil cytosol factor 2 24.9777104 174.639 3.41473 0.00199 0.0445076 Alox5ap arachidonate 5-lipoxygenase-activating 78.8767903 369.415 3.41983 0.00022 0.0096014 protein Fyb Mus musculus FYN binding protein 67.1872351 394.235 3.43364 0.00112 0.029421 mRNA, complete cds. Cd69 early activation antigen CD69 9.90205635 72.4261 3.44312 0.00194 0.0437389 Lmo3 LIM domain only protein 3 17.5822757 117.222 3.44814 0.00158 0.0378715 Prtg protogenin precursor 31.2578248 135.596 3.44896 4.03E-05 0.0028002 Car14 SubName: Full=Carbonic anhydrase 14, 13.3649689 93.4715 3.45748 0.00169 0.0397912 isoform CRA_b; SubName: Full=Putative uncharacterized protein; Chodl chondrolectin precursor 28.8163853 137.085 3.45853 0.0002 0.0088377 Tnfrsf1b tumor necrosis factor receptor superfamily 17.1513203 133.812 3.45911 0.00206 0.0454756 Prtn3 myeloblastin precursor 11.5417234 90.7922 3.48244 0.00193 0.0437077 Pou6f2 POU domain, class 6, transcription factor 2 82.6137654 346.886 3.487 6.86E-06 0.0007202 Lect1 chondromodulin-1 precursor 105.075318 435.116 3.49401 3.25E-06 0.0003988 Irx5 iroquois-class homeodomain protein IRX-5 2.5735052 24.1005 3.49456 0.00217 0.0472053 Fgd2 RecName: Full=FYVE, RhoGEF and PH 89.396387 484.182 3.49571 0.00053 0.0177334 domain-containing protein 2; Zic3 zinc finger protein ZIC 3 10.5231976 86.7561 3.49676 0.00197 0.044237 Spc24 kinetochore protein Spc24 109.551733 463.856 3.49752 8.02E-06 0.0008034 Cd300a CMRF35-like molecule 8 41.8844438 322.118 3.50324 0.00176 0.040991 Mndal myeloid cell nuclear differentiation 14.5320988 130.255 3.50558 0.00211 0.0463161 Stat6 signal transducer and transcription 83.4281375 454.079 3.50715 0.00052 0.0174462 activator 6 Hexb beta-hexosaminidase subunit beta 69.6752411 361.692 3.51061 0.00035 0.0130756 precursor Lgmn legumain precursor 1010.19983 5436.03 3.53719 0.0004 0.0145941 Gcet2 germinal center B-cell-expressed transcript 2.81391819 43.3862 3.55407 0.00233 0.0496768 2 AK139611 Mus musculus 2 cells egg cDNA, RIKEN 13.6971319 137.676 3.5579 0.002 0.0446334 full-length enriched library, clone:B020006F14 product:unclassifiable, full insert sequence. Fam198b protein ENED 35.0043152 189.132 3.59225 0.00029 0.0116578 H2-T23 H-2 class I histocompatibility antigen, D-37 15.6311777 101.127 3.59246 0.00082 0.024065 25 Fes tyrosine-protein kinase Fes/Fps 100.421953 475.2 3.60139 4.66E-05 0.0030773 Ifitm1 interferon-induced transmembrane protein 68.8392862 833.009 3.60915 0.00194 0.0437389 1 Cd14 monocyte differentiation antigen CD14 9.24768119 119.373 3.61867 0.00193 0.0437077 precursor Itih5 inter-alpha-trypsin inhibitor heavy chain 19.1244358 113.465 3.62205 0.00047 0.0162904 H5 BC072662 Mus musculus 12 days embryo embryonic 7.13132274 62.9531 3.64054 0.00137 0.0338582 body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430057O05 product:unclassifiable, full insert sequence. Tyrobp TYRO protein tyrosine kinase-binding 72.3703088 1396.89 3.67107 0.00183 0.0421164 protein Pmaip1 phorbol-12-myristate-13-acetate-induced 28.401118 169.161 3.67368 0.00038 0.0140015 protein Gpr65 psychosine receptor 6.74642058 66.3597 3.70751 0.00128 0.0319386 B4galnt1 beta-1,4 N-acetylgalactosaminyltransferase 43.6113105 238.669 3.71416 0.00015 0.0074339 1 Mocs1 molybdenum cofactor biosynthesis protein 6.28219187 74.1955 3.72227 0.00143 0.0348896 1 Tbxas1 thromboxane-A synthase 4.31740454 58.997 3.7313 0.00148 0.0359819 Slfn2 schlafen family member 12-like 12.5909907 133.098 3.74253 0.00126 0.0316532 E3 ubiquitin-protein ligase MARCH1 31.4206124 148.545 3.74547 7.43E-06 0.0007619 מרץ01- isoform 2 Pecam1 platelet endothelial cell adhesion molecule 20.3235337 168.193 3.81264 0.00073 0.022149 Apbb1ip amyloid beta A4 precursor protein-binding 6.06130389 66.2319 3.81988 0.00104 0.0278635 family Nr5a2 nuclear receptor subfamily 5 group A 15.3156317 77.6779 3.82733 1.76E-05 0.0014303 member 2 Cd109 CD109 antigen precursor 0.66559169 29.5106 3.83588 0.00127 0.031764 Pilra paired immunoglobulin-like type 2 20.3139987 143.005 3.83718 0.00041 0.0146611 receptor alpha Plac8 placenta-specific gene 8 protein 32.8954151 736.919 3.83762 0.00127 0.031764 Cd97 CD97 antigen isoform 2 29.2377861 184.48 3.83862 0.00023 0.0099374 Itgb5 integrin beta-5 isoform 1 42.7452061 260.001 3.89175 0.00013 0.0067141 Lcp1 plastin-2 110.375405 1965.76 3.89842 0.00108 0.0285011 V00821 Mouse mRNA fragment for 6.15722771 92.5604 3.93224 0.00094 0.0264887 immunoglobulin mu encoding the C- terminus of the membrane-bound form. Tnfaip8 tumor necrosis factor alpha-induced 96.7580737 501.453 3.93403 9.06E-06 0.0008868 protein 8 Lst1 leukocyte-specific transcript 1 protein 2.61378173 46.2305 3.93597 0.00097 0.0269338 Cpa3 mast cell carboxypeptidase A 81.7702933 1400.62 3.93683 0.00098 0.0269708 preproprotein Dhrs3 SubName: Full=Dehydrogenase/reductase 427.411728 2225.41 3.96405 7.40E-06 0.0007619 (SDR family) member 3; SubName: Full=Dehydrogenase/reductase (SDR family) member 3, isoform CRA_c; AK002860 Mus musculus adult male kidney cDNA, 69.5115639 392.222 3.96453 3.45E-05 0.0025666 RIKEN full-length enriched library, clone:0610040B09 product:unclassifiable, full insert sequence. Cyp4f18 leukotriene-B(4) omega-hydroxylase 2 3.75729136 48.4255 3.96967 0.00079 0.0233714 Gata2 endothelial transcription factor GATA-2 33.0814073 230.105 3.97018 0.00022 0.0094487 Rab44 ras-related protein Rab-44 8.129097 158.087 3.99452 0.00088 0.025242 Lpxn leupaxin 9.42829265 122.671 3.99901 0.00074 0.0224743 Gmfg glia maturation factor gamma isoform 1 2.05655692 39.5838 4.00461 0.00084 0.0246148 Mertk SubName: Full=Putative uncharacterized 4.41332837 78.5667 4.01947 0.00081 0.023836 protein; Flags: Fragment; Sfmbt2 scm-like with four MBT domains protein 2 11.9681876 87.9555 4.03063 0.00021 0.0093882 isoform E230029C05Rik Mus musculus adult male corpora 2.85004049 51.1376 4.04935 0.00075 0.02259 quadrigemina cDNA, RIKEN full-length enriched library, clone:B230337J15 product:unclassifiable, full insert sequence. Dnajc30 dnaJ homolog subfamily C member 30 43.8783108 254.05 4.05034 2.46E-05 0.0018935 Il16 pro-interleukin-16 29.9939012 219.077 4.06102 0.00018 0.0084917 Pik3cg phosphatidylinositol-4,5-bisphosphate 3- 11.5126831 146.126 4.07255 0.0006 0.0194947 26 kinase Cd7 T-cell antigen CD7 precursor 2.18860304 52.9122 4.10145 0.0007 0.0215401 Pycard apoptosis-associated speck-like protein 38.0549079 290.057 4.1019 0.00019 0.0086469 Cd68 macrosialin 44.0755392 307.45 4.15063 9.17E-05 0.005148 Ctsc dipeptidyl peptidase 1 preproprotein 157.646025 1596.49 4.15809 0.00036 0.013551 Ikzf1 SubName: Full=Zinc finger protein 21.5189324 492.768 4.16141 0.00062 0.0197961 subfamily 1A, 1 isoform 11; Amz1 archaemetzincin-1 5.9890593 91.3215 4.16381 0.00054 0.0178987 Icam1 intercellular adhesion molecule 1 precursor 10.5107545 136.16 4.16703 0.00048 0.0164164 D330045A20Rik Mus musculus 13 days embryo heart 4.37720608 90.5309 4.22885 0.00052 0.0174462 cDNA, RIKEN full-length enriched library, clone:D330045A20 product:hypothetical protein, full insert sequence. Nfam1 NFAT activation molecule 1 19.9793237 232.934 4.25674 0.00034 0.0127886 Apobec3 DNA dC->dU-editing enzyme APOBEC-3 19.7360224 144.789 4.25835 7.37E-05 0.0044424 isoform 2 Icosl ICOS ligand precursor 4.10067079 81.2669 4.26113 0.00047 0.0163793 A830007P12Rik torsin family protein C9orf167 homolog 2.53738291 52.8277 4.2614 0.00048 0.0163879 Mrc2 C-type mannose receptor 2 precursor 3.09169967 35.0522 4.27122 0.00029 0.0116578 Cyba RecName: Full=Cytochrome b-245 light 131.018263 887.552 4.27174 3.74E-05 0.0026785 chain; AltName: Full=Cytochrome b(558) alpha chain; AltName: Full=Cytochrome b558 subunit alpha; AltName: Full=Neutrophil cytochrome b 22 kDa polypeptide; AltName: Full=Superoxide- generating NADPH oxidase light chain subunit; AltName: Full=p22 phagocyte B- cytochrome; AltName: Full=p22-phox; Short=p22phox; Irgm1 immunity-related GTPase family M 12.607588 129.69 4.27334 0.00026 0.0108095 protein 1 P2ry10 putative P2Y purinoceptor 10 5.5804779 99.9088 4.30273 0.00042 0.0149185 AK052812 Mus musculus 10 days lactation, adult 7.33685963 57.1568 4.30869 7.96E-05 0.0046912 female mammary gland cDNA, RIKEN full-length enriched library, clone:D730024H21 product:unclassifiable, full insert sequence. Gpr171 probable G-protein coupled receptor 171 14.8891871 136.427 4.32212 0.00016 0.0079119 Ripk3 receptor-interacting serine/threonine- 22.5001094 276.998 4.3341 0.00029 0.0116578 protein Tmem119 transmembrane protein 119 precursor 34.0290134 276.699 4.34735 9.14E-05 0.005148 Vamp8 vesicle-associated membrane protein 8 75.7144882 464.655 4.36546 4.78E-06 0.0005505 Rnase6 ribonuclease K6 precursor 3.75189093 105.858 4.36802 0.0004 0.0145547 Ntrk2 BDNF/NT-3 growth factors receptor 305.194705 1550.59 4.38867 4.90E-10 2.20E-07 isoform b P2ry6 P2Y purinoceptor 6 30.4506913 261.494 4.39866 9.60E-05 0.0053399 Gpr97 SubName: Full=Putative uncharacterized 8.15109472 76.2294 4.40321 0.00013 0.0065204 protein; Slc35d3 solute carrier family 35 member D3 0.97824926 32.3342 4.47531 0.00032 0.0122795 abParts Parts of antibodies, mostly variable 64.151578 444.781 4.49983 1.15E-05 0.0010585 regions. Mybpc1 myosin binding protein C, slow type 6.90750703 102.611 4.52574 0.00021 0.0093882 Casp8 caspase-8 precursor 15.6880908 144.926 4.59135 6.10E-05 0.0037623 Dock2 dedicator of cytokinesis protein 2 11.6820583 197.102 4.67287 0.00017 0.00799 Lpl lipoprotein lipase precursor 38.9816837 377.687 4.77911 3.73E-05 0.0026785 Gata1 Mus musculus 13 days embryo liver cDNA, 4.0645485 151.943 4.78225 0.00017 0.0080935 RIKEN full-length enriched library, clone:I920074C13 product:GATA binding protein 1, full insert sequence. Kmo kynurenine 3-monooxygenase 1.63968671 43.234 4.7903 0.00015 0.0075492 A930038C07Rik fibronectin type-III domain-containing 3.72821168 58.0558 4.80835 0.0001 0.0056739 protein

Supplemental Materials and methods

Mouse Strains Transgenic and knockout mice were kept on CB6 background. Timed pregnancy commenced with embryonic day 0.5 (E0.5) at the morning when a mucous plug was observed. For maintenance of transgenic or CRISPR-mutated lines, tail diagnostic PCR was conducted with the primers listed in Supplemental Table S5. Tails were digested using lysis reagent DirectPCR (VIAGEN, cat #102-T) with Proteinase K (Sigma cat# P2308) at 100 µg/ml.

BAC Reporter Constructs and CNEs Identification BAC DNA was purified using NucleoBond BAC 100 kit (Macherey-Nagel REF 740579), linearized with PI-SceI and its integrity analyzed by pulse field electrophoresis. Linearized BAC DNA (7.5ng/µl) was microinjected into murine zygotes. Deletions and mutations in BAC-reporter CNEs were generated using the Counter Selection BAC Modification Kit (GeneBridges, Germany) and verified by PCR and sequencing (Supplemental Table S3). For CNE identifications four separate analyses were performed: 1) Human-Mouse-Rat 2) Human-Mouse-Chicken 3) Human- Mouse-Frog and 4) Human-Mouse-Fugu in order to identify various degrees of evolutionary conservation. We used the rank Vista option (Mayor et al. 2000), available through the Vista website, to identify candidate conserved cis- elements in mouse Runx3 locus.

Immunofluorescence (IF) Analyses After antigen retrieval in boiling 10mM citric acid (pH6.0), slides were allowed to cool down slowly for 1-2 hours at RT and incubated with 2N HCl/PBS solution for 10 min at 420C followed by neutralization in 0.1M Borate buffer (pH 8.5). M.O.M mouse Ig Blocking Reagent was applied for 1h at RT. Primary and secondary antibodies were used in a dilution solution of the M.O.M kit (Vector Laboratories, BMK-2202). Slides were washed with PBS and 0.2% TritonX-100, covered with ProLong@Gold antifade reagent with Dapi (Molecular Probes, P36935). Images were collected on a Nikon E80i fluorescent microscope. The following primary antibodies were used: Rabbit anti-Runx3 1:1000 (produced in our lab), rabbit anti-TrkA 1:300 (Abcam; ab8871), goat anti-TrkA 1:200 (R&D; AF1056), goat anti-TrkB 1:200 (R&D; AF1494), goat anti-TrkC 1:200 (R&D; AF1404), chicken anti-GFP 1:200 (Abcam; ab13970). Pvalb staining was conducted on E17.5 paraffin sections (10µm) using rabbit anti- Pvalb 1:1000 (Swant; PV-28). The following secondary antibodies were used at dilution 1:200: biotinylated Donkey anti-Goat IgG (Jackson; 711-065-152), Streptavidin Alexa-Fluor-488 (Jackson; 016-540-084), Donkey anti-Rabbit-Cy3 IgG (Jackson; 711- 165-152) and Donkey anti-Chicken Alexa-Fluor-647 IgG (Jackson; 703-605-155).

CRISPR/Cas9-mediated in-vivo Deletions Plasmid DNA was linearized with DraI, treated with proteinase K (200µg/ml) and 0.5% SDS for 30 min at 50ºC followed by phenol:chloroform extraction and precipitation. In-vitro transcription was conducted with MEGAshortscript kit (Life Technologies, AM1354). Cas9 plasmid was linearized with XbaI, treated as above, and in vitro transcribed using mMESSAGE mMACHINE T7 Ultra kit (Life Technologies AM1345). For generation of CRΔR1,R3 mice, Cas9 RNA and sgRNAs designed to delete R3 were co-injected into CRΔR1/CRΔR1 or CRΔR1/WT fertilized mouse eggs. BrnR1 mutations were generated using sgRNA (Supplemental Table S4) co-injected with single stranded DNA of 140 nucleotides long composed of a core mutated Brn3a region (see Fig.8D) flanked by homologous arms of 60 nucleotides 5’and 3’ to the mutated region.

Quantification of Runx3 Expression Intensity Runx3 pixel intensity was measured using ImageJ analysis software on sagittal 4µm sections. At least 50 nuclei were scored from 3-4 different slides. The background pixel intensity was measured in 10 selected neighboring regions lacking neurons. Runx3 intensity was expressed as internal density/area unit. The average background calculated for area unit was subtracted from the measurements of nuclear intensity.

Behavioral Assays Home cage locomotion was assessed as previously described (Sztainberg et al. 2010). Males of (3-4 month old) were housed individually for 72 h, of which the first 24 h were considered habituation to the individual housing conditions. Measurements of general locomotion consisted of two light and two dark cycles in the last 48 h, collected at 30 min intervals. Beam Walk: Males were trained to walk on a plank (50 cm long, 35 mm wide) suspended 30 cm above the working surface in order to get back to their home cage. Following a short training session of three to four repeats, the mice coordination and balance was assessed while they were forced to walk on a narrow beam (6 mm wide) to get back to their home cages (3-5 full length walks with no stops or turns). Test sessions were video recorded using an overhead camera and manually scored. Two sessions were conducted for each group of animals. The CRΔR1/P2GFP (four month old), CRΔR3/P2GFP (three month old) and CRΔR1,2/P2GFP (three month old) groups were compared to one another and to the control group that consisted of age matched heterozygous WT/P2GFP males.

Transcriptome Data Acquisition and Analysis E11.5 embryos were removed from pregnant mice of a cross of males and females P2GFP/+ heterozygotes and genotyped by PCR. P2GFP/+ and P2GFP/GFP cervical ganglia were isolated and prepared for FACS analysis as described by Lee et al., (Lee et al. 2012). 28 Ganglia in Hank's Balanced Salt Solution (HBSS) +10% serum were treated with Trypsin and Collagenase for 10 minutes at 37°C, washed in HBSS+10% serum, resuspended in 0.5 ml HBSS, dispersed via trituration with a narrowed Pasteur pipette and passed through a 45µ mesh. GFP+ TrkC neurons of P2GFP/+ or P2GFP/GFP DRG were FACS sorted and collected into lysis buffer of Qiagen RNeasy mini kit (Qiagen 74104). Total RNA was prepared from 4 samples of each P2GFP/+ and P2GFP/GFP cervical ganglia according to kit procedure and analyzed by bioanalyzer (~1000 cells/embryo yielded ~1ng RNA). Only samples with RNA integrity # >8 were further analyzed and 1ng RNA of each sample was amplified separately using Smarter Ultra low RNA kit (Clontech cat. 634935). After the amplification step, the amplicons were fragmented to fragment sizes of ~100-400bp using Covaris S220 ultrasonicator (Covaris,Inc.,Woburn, MA, USA). The amplified fragments were processed to libraries according to the Chip-seq protocol previously described by Blecher-Gonen et al. (Blecher-Gonen et al. 2013). Libraries were evaluated by Qubit and TapeStation. Sequencing libraries were constructed with barcodes to allow multiplexing of 8 samples in one lane. Between 20 and 24 million single-end 50-bp reads were sequenced per sample on Illumina HiSeq 2500 instrument. Reads were aligned to the mouse mm9 UCSC genome assembly using TopHat2 (Langmead et al. 2009). Between 91% and 95% of reads were successfully mapped. Quantification of the reads per gene was performed using HTSeq (Anders et al. 2015). The genes were annotated according to RefSeq. Analysis of differentially expressed genes was performed using DESeq2 (Love et al. 2014). Ingenuity Pathways Analysis (http://www.ingenuity.com/) was used for functional analysis. RNA-seq data were deposited into GEO repository (GSE81140).

Statistical Analysis Statistical analysis was conducted throughout, unless indicated differently, using Anova unpaired non-parametric Kolmogorov- Smirnov test

Supplemental Movie S1

Three weeks old ataxic CRΔR1,3/P2GFP mouse

Supplemental References

Anders S, Pyl PT, Huber W. 2015. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 31: 166-169. Blecher-Gonen R, Barnett-Itzhaki Z, Jaitin D, Amann-Zalcenstein D, Lara-Astiaso D, Amit I. 2013. High- throughput chromatin immunoprecipitation for genome-wide mapping of in vivo protein-DNA interactions and epigenomic states. Nat Protoc 8: 539-554. Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10: R25. Lee J, Friese A, Mielich M, Sigrist M, Arber S. 2012. Scaling proprioceptor gene transcription by retrograde NT3 signaling. PLoS One 7: e45551. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15: 550. Mayor C, Brudno M, Schwartz JR, Poliakov A, Rubin EM, Frazer KA, Pachter LS, Dubchak I. 2000. VISTA : visualizing global DNA sequence alignments of arbitrary length. Bioinformatics 16: 1046-1047. Sztainberg Y, Kuperman Y, Tsoory M, Lebow M, Chen A. 2010. The anxiolytic effect of environmental enrichment is mediated via amygdalar CRF receptor type 1. Mol Psychiatry 15: 905-917.