DOCSLIB.ORG

Dissertation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Dissertation DISSERTATION submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Science Presented by Dipl. biol. Jessica Fuhrmeister Born in Wiesbaden, Germany Heidelberg, March 2015 The role of hepatic Growth Arrest and DNA Damage-inducible 45 beta (GADD45β) in adaptive metabolic control Referees: Prof. Dr. Ursula Klingmüller Prof. Dr. Stephan Herzig ACKNOWLEDGEMENT This work would not have been possible without the help and contribution of several people to whom I would like to express my sincere gratitude. • Thank you Stephan Herzig for giving me the opportunity to work in this wonderful and unique division. • Thank you Adam Rose for giving me a chance to perform my PhD studies, for your guidance, your advice, and for sharing your immense knowledge and experience with me. Thank you for your support and understanding also in times of personal issues. In short: I wish that every PhD student had such great boss. • Thank you Annika, Oksana and Katharina S. for teaching me techniques and for your constant help. You were invaluable during animal and virus work. Special thanks go to our Hiwis for making uncountable SDS gels. • Thank you Tjeerd for your help with the TSE system and the isolation of primary hepatocytes. • Thank you Mauricio, Anja, Allan, Katharina N., Astrid and Dan for sharing samples. • Thank you Ashley and Bilgen, the god of Western Blotting, and Adriano for all your ideas and advice, and for sharing your knowledge with me – without you I would have been lost in the insulin signaling pathway! Thank you Ashley and Adriano for proofreading. • Thank you Claus Kremoser and Ursula Klingmüller for being part of my DKFZ Thesis Advisory Committee, for your guidance and helpful criticism and suggestions. • Thank you Stephan Frings and Thomas Hofmann for being part of my examining board. • Thank you Jürgen Okun, Kathrin Schmidt, Emil Karaulanov, and Matthias Blüher for your collaboration and analyses. • Thank you Jess, Thomas and Jonas for the good atmosphere in our small group, for the sweets and chocolate and not to forget the delicious cupcakes and macarones to chase away the Monday blues! Thank you Nicola for being such an enthusiastic and talented intern/Bachelor student, for all your work and the cool survival kit. Thank you A170s for the awesome time; it’s been great working with you. • Thank you Aish, Asrar, Irem, Ivo, Julia, Nico, Sushma and Martin for all the fun we had together in social activities, PhD parties and board game nights. You brightened up my time as PhD student. • Thank you Daniel for your indestructible positive attitude and patience, for encouraging me, for listening to me, for enduring my moods, for laughing with me, for holding me when I’m down – in other words: thank you for everything you give me. • A special gratefulness goes to you, Mom and Dad! Thank you for everything you have done for me in the last 30 years! Without you I would not be typing these words. You were always there for me, never gave up on me and supported me with all that you could give. i ii ABSTRACT In mammals, the balance of energy storage and breakdown is essential for the maintenance of whole body energy homeostasis. An imbalance between energy intake and expenditure as well as an impaired adaption of the central metabolic organs to changes in nutrient availability (so- called metabolic inflexibility) is tightly associated with the onset and progression of obesity and type II diabetes (T2D) and represents a hallmark of the metabolic syndrome. The metabolic syndrome is associated with a spectrum of liver abnormalities described as non-alcoholic fatty liver disease (NAFLD). Thereby, intracellular fat accumulation leads to hepatic lipotoxicity, cellular stress and dysfunction. While the liver is recognized as a key organ contributing to systemic metabolic control, the molecular mechanisms of liver metabolism in coordinating metabolic flexibility remain still puzzling. In order to determine the molecular mechanisms involved in metabolic flexibility and to find genes which display certain ‘inflexibility’ in conditions of metabolic dysfunction, a liver transcriptome analysis was performed on obese-diabetic db/db and wild type mice under fasting and fed conditions. Array results have uncovered one ‘inflexibility’ gene in the liver: GADD45β, a member of the “growth arrest and DNA damage-inducible 45” (GADD45) gene family. In particular, we have observed a strong upregulation of liver Gadd45b expression upon food deprivation in healthy animals, which was markedly less pronounced in db/db mice. While GADD45β is reported to be involved in hyperplasia of hepatocytes and in liver regeneration, there are no studies examining the role of GADD45β in metabolic function. In this work, we have characterised GADD45β as a nutrient starvation-induced gene, which is differentially expressed in disease and ageing. Congruently, liver Gadd45b mRNA levels were lower in fasted men with T2D than in healthy individuals. Gadd45b induction was liver specific and not compensated by an induction of the other GADD45 family members. Furthermore, we could show that the Gadd45b induction is reversible after re-feeding and intrinsic to hepatocytes. In the present work we describe for the first time a novel role for hepatic GADD45β in adaptive metabolism under the stress of food deprivation and nutrient overload. A whole-body deletion of the gene caused an accumulation of triglycerides and cholesterol in the liver under fasting conditions and in a mouse model for steatosis. Also, GADD45β KO mice were more insulin resistant after 4 months on high fat diet. Inversely, a liver-restricted GADD45β overexpression in systemic GADD45β KO mice could partially reverse their dysregulated fasting lipid metabolism, and GADD45β overexpression in db/db mice could partially reverse their diabetic phenotype. While the exact mechanism(s) by which GADD45β mediates its effects remain unclear we conclude that GADD45β may be a missing link between lipid and glucose homeostasis under conditions of nutrient stress, thereby protecting from metabolic dysfunction. iii iv ZUSAMMENFASSUNG Für Mensch und Tier ist die Ausgewogenheit zwischen Energiespeicherung und –verwertung essentiell für die Aufrechterhaltung der Körperhomöostase. Ein Ungleichgewicht hierbei sowie eine beeinträchtigte Anpassungsfähigkeit der zentralen Stoffwechselorgane an wechselnde Nähr- stoffbedingungen (sogenannte metabolische Inflexibilität) sind eng verknüpft mit der Entstehung und dem Verlauf von Fettleibigkeit und Diabetes Mellitus Typ 2 (DM2) und sind ein Kennzeichen für das Metabolische Syndrom. Dieses ist mit einer Reihe von Störungen der Leber assoziiert, bei denen intrazelluläre Fettanreicherung zu Lipotoxizität, zellulärem Stress und zur Dysfunktion führen (Nicht-alkoholische Fettlebererkrankungen). Während es allgemein anerkannt ist, dass die Leber eine Schlüsselfunktion in der systemischen Stoffwechselkontrolle einnimmt, sind die mole- kularen Mechanismen zur Koordination der metabolischen Flexibilität nicht vollständig aufgeklärt. Um die molekularen Mechanismen zu entschlüsseln, die der metabolischen Flexibilität zugrunde liegen, und dabei Gene zu bestimmen, die bei Stoffwechselstörungen ‚inflexibel‘ reguliert sind, haben wir eine Transkriptom-Analyse an Lebern von adipös-diabetischen db/db und gesunden Wildtyp-Mäusen unter verschieden Nahrungsbedingungen durchgeführt. Dabei haben wir einen Kandidaten gefunden: GADD45β, ein Mitglied der „growth arrest und DNA damage-inducible 45“ (GADD45) Familie. Wir konnten in Wildtyp-Mäusen eine starke Hepatozyten-spezifische Hoch- regulation von Gadd45b bei Nahrungsentzug beobachten, welche in db/db Mäusen deutlich weniger ausgeprägt war. Es ist bekannt, dass GADD45β in der Hyperplasie von Hepatozyten und in der Leberregeneration involviert ist, jedoch gibt es noch keine Studie, in welcher die Rolle von GADD45β in der Stoffwechselkontrolle untersucht wurde. In der vorliegenden Arbeit haben wir GADD45β als ein durch Nährstoffmangel induziertes Gen charakterisiert, dessen Expression in metabolischen Krankheiten und im Alter dysreguliert ist. Übereinstimmend damit waren die Leber-Gadd45b mRNA-Spiegel in nüchternen Männern mit DM2 geringer als in gesunden Individuen. Die Induktion von Gadd45b war dabei nicht durch die Induktion der anderen GADD45 Familienmitglieder kompensiert. Des Weiteren beschreiben wir zum ersten Mal eine neuartige regulatorische Funktion für GADD45β im adaptiven Metabolismus unter Nahrungsentzug und -überschuss. Ein „knockout“ (KO) dieses Gens führte zu einer stärkeren Akkumulation von Triglyzeriden und Cholesterin in der Leber von nüchternen Mäusen sowie bei einem Mausmodel für Steatose. Zudem waren KO-Mäuse nach 4 Monaten auf einer Hochfett-Diät insulinresistenter als Wildtyp-Mäuse. Umgekehrt konnten wir mit einer Leber- spezifischen GADD45β-Überexpression in gefasteten KO-Mäusen deren dysregulierten Fettstoff- wechsel sowie in db/db Mäusen deren diabetisches Erscheinungsbild teilweise verbessern. Obwohl noch nicht geklärt ist auf welche Weise GADD45β seine Effekte vermittelt, so können wir trotzdem aus unseren Beobachtungen schließen, dass GADD45β unter Stresssituationen wie Nährstoffmangel und –überschuss eine Verbindung zwischen Fett- und Glukose-Homöostase darstellen könnte, wobei es eine schützende Rolle vor Stoffwechselschäden einnimmt. v vi INDEX INDEX ACKNOWLEDGEMENT…………………………………………………………………………. ............... I ABSTRACT…………………………………………………………………
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Pitx3 KNOCKOUT MICE ENTRAIN to SCHEDULED FEEDING DESPITE
    Pitx3 KNOCKOUT MICE ENTRAIN TO SCHEDULED FEEDING DESPITE FREE-RUNNING LIGHT ENTRAINED RHYTHMS A Thesis Presented to the Faculty of California State Polytechnic University, Pomona In Partial Fulfillment Of the Requirements for the Degree Master of Science In Biological Sciences By Lori L. Scarpa 2019 SIGNATURE PAGE THESIS: Pitx3 KNOCKOUT MICE ENTRAIN TO SCHEDULED FEEINDING DESPITE FREE-RUNNING LIGHT ENTRAINED RHYTHMS AUTHOR: Lori L. Scarpa DATE SUBMITTED: Fall 2019 Department of Biological Sciences Dr. Andrew D. Steele Thesis Committee Chair Biological Sciences Dr. Juanita Jellyman Biological Sciences Dr. Robert Talmadge Biological Sciences ii ACKNOWLEDGEMENTS Funding for this project was provided by the Whitehall Foundation and California State Polytechnic University of Pomona, California. I would like to thank the many people who assisted in the daily labors required to complete this project: Raymundo Miranda, Michael Sidikpramana, Jeffrey Falkenstein, Michael Williams, Jaskaran Dhanoa, and many other members of the Steele lab. I would like to specially recognize fellow graduate students in the Steele lab, Damien Wolfe and Andrew Villa, for their unconditional encouragement and support. I would like to thank Dr. Juanita Jellyman for her kindness and nurturing spirit. Dr. Jellyman never wavered her belief in me and it was this that kept me working harder towards my goals. Lastly, I would like thank Dr. Andrew Steele for accepting me into his lab, for being my personal mentor, and for pushing me towards success. Through him, I have grown to become a better scientist and found greater inspiration in my pursuit to further study neuroscience. Thank you, Dr. Steele, for your support and patience, and for playing a leading role in my success as a graduate student in your lab.
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Noninvasive Sleep Monitoring in Large-Scale Screening of Knock-Out Mice
    bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Noninvasive sleep monitoring in large-scale screening of knock-out mice reveals novel sleep-related genes Shreyas S. Joshi1*, Mansi Sethi1*, Martin Striz1, Neil Cole2, James M. Denegre2, Jennifer Ryan2, Michael E. Lhamon3, Anuj Agarwal3, Steve Murray2, Robert E. Braun2, David W. Fardo4, Vivek Kumar2, Kevin D. Donohue3,5, Sridhar Sunderam6, Elissa J. Chesler2, Karen L. Svenson2, Bruce F. O'Hara1,3 1Dept. of Biology, University of Kentucky, Lexington, KY 40506, USA, 2The Jackson Laboratory, Bar Harbor, ME 04609, USA, 3Signal solutions, LLC, Lexington, KY 40503, USA, 4Dept. of Biostatistics, University of Kentucky, Lexington, KY 40536, USA, 5Dept. of Electrical and Computer Engineering, University of Kentucky, Lexington, KY 40506, USA. 6Dept. of Biomedical Engineering, University of Kentucky, Lexington, KY 40506, USA. *These authors contributed equally Address for correspondence and proofs: Shreyas S. Joshi, Ph.D. Dept. of Biology University of Kentucky 675 Rose Street 101 Morgan Building Lexington, KY 40506 U.S.A. Phone: (859) 257-2805 FAX: (859) 257-1717 Email: [email protected] Running title: Sleep changes in knockout mice bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Transcriptional Modulator ZBED6 Affects Cell Cycle and Growth of Human Colorectal Cancer Cells
    Transcriptional modulator ZBED6 affects cell cycle and growth of human colorectal cancer cells Muhammad Akhtar Alia,1, Shady Younisb,c,1, Ola Wallermand, Rajesh Guptab, Leif Anderssonb,d,e,1,2, and Tobias Sjöbloma,1 aScience For Life Laboratory, Department of Immunology, Genetics and Pathology, Uppsala University, SE-751 85 Uppsala, Sweden; bScience for Life Laboratory, Department of Medical Biochemistry and Microbiology, Uppsala University, SE-751 85 Uppsala, Sweden; cDepartment of Animal Production, Ain Shams University, Shoubra El-Kheima, 11241 Cairo, Egypt; dDepartment of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, SE-75007 Uppsala, Sweden; and eDepartment of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843 Contributed by Leif Andersson, May 15, 2015 (sent for review December 10, 2014; reviewed by Jan-Ake Gustafsson) The transcription factor ZBED6 (zinc finger, BED-type containing 6) (QTN) with a large impact on body composition (muscle growth is a repressor of IGF2 whose action impacts development, cell pro- and fat deposition); mutant animals showed threefold higher IGF2 liferation, and growth in placental mammals. In human colorectal expression in postnatal muscle (11). ZBED6 was identified as the cancers, IGF2 overexpression is mutually exclusive with somatic nuclear factor specifically binding the wild-type IGF2 sequence but mutations in PI3K signaling components, providing genetic evi- not the mutated site. ChIP sequencing (ChIP-seq) in mouse C2C12 dence for a role in the PI3K pathway. To understand the role of cells identified more than 1,200 putative ZBED6 target genes, in- ZBED6 in tumorigenesis, we engineered and validated somatic cell cluding 262 genes encoding transcription factors (6).
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Identification of Novel Sleep Related Genes from Large Scale Phenotyping Experiments in Mice
    University of Kentucky UKnowledge Theses and Dissertations--Biology Biology 2017 IDENTIFICATION OF NOVEL SLEEP RELATED GENES FROM LARGE SCALE PHENOTYPING EXPERIMENTS IN MICE Shreyas Joshi University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/ETD.2017.159 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Joshi, Shreyas, "IDENTIFICATION OF NOVEL SLEEP RELATED GENES FROM LARGE SCALE PHENOTYPING EXPERIMENTS IN MICE" (2017). Theses and Dissertations--Biology. 42. https://uknowledge.uky.edu/biology_etds/42 This Doctoral Dissertation is brought to you for free and open access by the Biology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Biology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • DNA Modifications in Models of Alcohol Use Disorders
    Alcohol 60 (2017) 19e30 Contents lists available at ScienceDirect Alcohol journal homepage: http://www.alcoholjournal.org/ DNA modifications in models of alcohol use disorders * Christopher T. Tulisiak a, R. Adron Harris a, b, Igor Ponomarev a, b, a Waggoner Center for Alcohol and Addiction Research, The University of Texas at Austin, 2500 Speedway, A4800, Austin, TX 78712, USA b The College of Pharmacy, The University of Texas at Austin, 2409 University Avenue, A1900, Austin, TX 78712, USA article info abstract Article history: Chronic alcohol use and abuse result in widespread changes to gene expression, some of which Received 2 September 2016 contribute to the development of alcohol-use disorders (AUD). Gene expression is controlled, in part, by a Received in revised form group of regulatory systems often referred to as epigenetic factors, which includes, among other 3 November 2016 mechanisms, chemical marks made on the histone proteins around which genomic DNA is wound to Accepted 5 November 2016 form chromatin, and on nucleotides of the DNA itself. In particular, alcohol has been shown to perturb the epigenetic machinery, leading to changes in gene expression and cellular functions characteristic of Keywords: AUD and, ultimately, to altered behavior. DNA modifications in particular are seeing increasing research Alcohol fi Epigenetics in the context of alcohol use and abuse. To date, studies of DNA modi cations in AUD have primarily fi fi fi DNA methylation looked at global methylation pro les in human brain and blood, gene-speci c methylation pro les in DNMT animal models, methylation changes associated with prenatal ethanol exposure, and the potential DNA hydroxymethylation therapeutic abilities of DNA methyltransferase inhibitors.
    [Show full text]
  • Gadd45b Acts As Neuroprotective Effector in Global Ischemia- Induced Neuronal Death
    INTERNATIONAL NEUROUROLOGY JOURNAL INTERNATIONAL INJ pISSN 2093-4777 eISSN 2093-6931 Original Article Int Neurourol J 2019;23(Suppl 1):S11-21 NEU INTERNATIONAL RO UROLOGY JOURNAL https://doi.org/10.5213/inj.1938040.020 pISSN 2093-4777 · eISSN 2093-6931 Volume 19 | Number 2 June 2015 Volume pages 131-210 Official Journal of Korean Continence Society / Korean Society of Urological Research / The Korean Children’s Continence and Enuresis Society / The Korean Association of Urogenital Tract Infection and Inflammation einj.org Mobile Web Gadd45b Acts as Neuroprotective Effector in Global Ischemia- Induced Neuronal Death Chang Hoon Cho1,*, Hyae-Ran Byun1,*, Teresa Jover-Mengual1,2, Fabrizio Pontarelli1, Christopher Dejesus1, Ah-Rhang Cho3, R. Suzanne Zukin1, Jee-Yeon Hwang1,4 1Dominick P. Purpura Department of Neuroscience, Albert Einstein College of Medicine, New York, NY, USA 2 Unidad Mixta de Investigación Cerebrovascular, Instituto de Investigación Sanitaria La Fe - Universidad de Valencia; Departamento de Fisiología, Universidad de Vale---ncia, Valencia, Spain 3Department of Beauty-Art, Seo-Jeong University, Seoul, Korea 4Department of Pharmacology, Creighton University School of Medicine, Omaha, NE, USA Purpose: Transient global ischemia arising in human due to cardiac arrest causes selective, delayed neuronal death in hippo- campal CA1 and cognitive impairment. Growth arrest and DNA-damage-inducible protein 45 beta (Gadd45b) is a well- known molecule in both DNA damage-related pathogenesis and therapies. Emerging evidence suggests that Gadd45b is an anti-apoptotic factor in nonneuronal cells and is an intrinsic neuroprotective molecule in neurons. However, the mechanism of Gadd45b pathway is not fully examined in neurodegeneration associated with global ischemia.
    [Show full text]
  • Gadd45b Deficiency Promotes Premature Senescence and Skin Aging
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 19 Gadd45b deficiency promotes premature senescence and skin aging Andrew Magimaidas1, Priyanka Madireddi1, Silvia Maifrede1, Kaushiki Mukherjee1, Barbara Hoffman1,2 and Dan A. Liebermann1,2 1 Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA 2 Department of Medical Genetics and Molecular Biochemistry, Temple University School of Medicine, Philadelphia, PA, USA Correspondence to: Dan A. Liebermann, email: [email protected] Keywords: Gadd45b, senescence, oxidative stress, DNA damage, cell cycle arrest, Gerotarget Received: March 17, 2016 Accepted: April 12, 2016 Published: April 20, 2016 ABSTRACT The GADD45 family of proteins functions as stress sensors in response to various physiological and environmental stressors. Here we show that primary mouse embryo fibroblasts (MEFs) from Gadd45b null mice proliferate slowly, accumulate increased levels of DNA damage, and senesce prematurely. The impaired proliferation and increased senescence in Gadd45b null MEFs is partially reversed by culturing at physiological oxygen levels, indicating that Gadd45b deficiency leads to decreased ability to cope with oxidative stress. Interestingly, Gadd45b null MEFs arrest at the G2/M phase of cell cycle, in contrast to other senescent MEFs, which arrest at G1. FACS analysis of phospho-histone H3 staining showed that Gadd45b null MEFs are arrested in G2 phase rather than M phase. H2O2 and UV irradiation, known to increase oxidative stress, also triggered increased senescence in Gadd45b null MEFs compared to wild type MEFs. In vivo evidence for increased senescence in Gadd45b null mice includes the observation that embryos from Gadd45b null mice exhibit increased senescence staining compared to wild type embryos.
    [Show full text]