The Pluripotency Regulator PRDM14 Requires Hematopoietic Regulator CBFA2T3 to Initiate Leukemia in Mice Lauren J

Published OnlineFirst April 23, 2019; DOI: 10.1158/1541-7786.MCR-18-1327

Cancer Genes and Networks Molecular Cancer Research The Pluripotency Regulator PRDM14 Requires Hematopoietic Regulator CBFA2T3 to Initiate Leukemia in Mice Lauren J. Tracey1,2, Travis Brooke-Bisschop2, Pascal W.T.C. Jansen3, Eric I. Campos1,2, Michiel Vermeulen3, and Monica J. Justice1,2

Abstract

PR domain–containing 14 (Prdm14) is a pluripotency leukemia. These results suggest a model whereby PRDM14 regulator central to embryonic stem cell identity and pri- recruits CBFA2T3 to DNA, leading to gene misregulation mordial germ cell specification. Genomic regions contain- causing progenitor cell expansion and lineage perturba- ing PRDM14 are often amplified leading to misexpression tions preceding T-ALL development. Strikingly, Prdm14- in human cancer. Prdm14 expression in mouse hematopoi- induced T-ALL does not occur in mice deficient for Cbfa2t3, etic stem cells (HSC) leads to progenitor cell expansion demonstrating that Cbfa2t3 is required for leukemogenesis. prior to the development of T-cell acute lymphoblastic Moreover, T-ALL develops in Cbfa2t3 heterozygotes with a leukemia (T-ALL), consistent with PRDM14's role in cancer significantly longer latency, suggesting that PRDM14-asso- initiation. Here, we demonstrate mechanistic insight into ciated T-ALL is sensitive to Cbfa2t3 levels. Our study high- PRDM14-driven leukemias in vivo.Massspectrometry lights how an oncogenic protein uses a native protein in revealed novel PRDM14–protein interactions including progenitor cells to initiate leukemia, providing insight into histone H1, RNA-binding proteins, and the master hemato- PRDM14-driven oncogenesis in other cell types. poietic regulator CBFA2T3. In mouse leukemic cells, CBFA2T3 and PRDM14 associate independently of the Implications: The pluripotency regulator PRDM14 requires related ETO family member CBFA2T2, PRDM14's primary the master hematopoietic regulator CBFA2T3 to initiate leu- protein partner in pluripotent cells. CBFA2T3 plays crucial kemia in progenitor cells, demonstrating an oncogenic role for roles in HSC self-renewal and lineage commitment, and CBFA2T3 and providing an avenue for targeting cancer- participates in oncogenic translocations in acute myeloid initiating cells.

Introduction Our lab previously identified PR domain–containing 14 (Prdm14) as a potent mammalian oncogene (3, 4). Prdm14 is a Leukemia is the most common cancer in children (1). Despite pluripotency regulator central to embryonic stem cell (ESC) advances in chemotherapies that improve survival, most relapsed identity (5–7) and primordial germ cell (PGC) specification (8, 9). patients succumb to the disease (1, 2). Cancer initiation is difficult Prdm14 is not expressed in adult tissues; however, its misexpres- to study in human patients, as by the time of diagnosis multiple sion, often as a result of genomic amplification, is found in genetic lesions are often present, making the initiating event multiple human cancers including leukemia (4, 10). A high level difficult to deduce (2). Mouse models of cancer offer powerful of expression of PRDM14 is associated with poor outcomes tools that allow for the study of cancer initiation to improve the in both non–small cell lung carcinoma (11) and breast understanding of disease progression. cancer (12, 13). Prdm14 was misexpressed in hematopoietic stem cells (HSC) by mating mice carrying a Rosa26-floxed-stop-Prdm14-IRES-GFP transgene to mice carrying Tg(Mx1-cre; R26PR;Mx1-cre; ref. 14). 1Department of Molecular Genetics, University of Toronto, Toronto, Ontario, Upon inducing expression of Prdm14, R26PR;Mx1-cre mice rap- 2 Canada. Genetics and Genome Biology Program, The Hospital for Sick Children, idly succumb to a completely penetrant T-cell acute lymphoblas- 3 þ Toronto, Ontario, Canada. Faculty of Science, Department of Molecular Biology, tic leukemia (T-ALL) with a highly infiltrative CD8 immature Radboud Institute for Molecular Life Sciences, Oncode Institute, Radboud University Nijmegen, Nijmegen, the Netherlands. single positive T-cell immunophenotype (14). Prior to the onset of leukemia, abnormal HSC-like and lymphoid progenitor cells Note: Supplementary data for this article are available at Molecular Cancer accumulate in the bone marrow (BM) of the mice. Subsequent Research Online (http://mcr.aacrjournals.org/). work showed that the T-ALL is driven by activating mutations on Corresponding Author: Monica J. Justice, Hospital for Sick Children, The Peter Notch1 (15). In contrast, when Prdm14 is expressed in committed Gilgan Centre for Research and Learning, 686 Bay Street, Toronto, Ontario M5G T cells using a dLck-cre line (R26PR;dLck-cre), mice remain 0A4, Canada. Phone: 416-813-7654. Fax: 416-813-4931; E-mail: [email protected]. healthy and do not show signs of leukemia, suggesting that Prdm14 requires additional factor(s) present in progenitor cells Mol Cancer Res 2019;XX:XX–XX to act as an oncogene (14). However, the mechanism through doi: 10.1158/1541-7786.MCR-18-1327 which Prdm14 functions in progenitor cells to initiate cancer is 2019 American Association for Cancer Research. poorly understood.

www.aacrjournals.org OF1

Tracey et al.

PRDM14 contains six zinc finger motifs that bind the same Protein extraction consensus DNA sequence in both mouse and human, and a PR Protein lysates from HEK293T cells and R26FLPR or R26FLPR; domain, which is related to the SET domain (6, 16). Certain PR Mx1-cre BM and thymus single-cell suspensions were extracted family proteins have histone methyltransferase activity; however, using NP-40 lysis buffer [50 mmol/L Tris-HCl pH 8.0, 150 mmol/L no methyltransferase activity has been reported for PRDM14 (15). NaCl, 1% NP-40, 2 mmol/L EDTA, protease inhibitors (Roche)]. Instead, it is likely that PRDM14 regulates gene expression After 30-minute incubation on ice the lysates were centrifuged through protein interaction partners. In support of this hypoth- for 15 minutes at 16,000 g. Protein concentrations were deter- esis, PRDM14 requires an interaction with the core-binding factor, mined using the Pierce Coomassie (Bradford) Protein Assay Kit runt domain, alpha subunit 2 translocated to 2 (CBFA2T2) (Thermo Fisher Scientific). protein to promote ESC self-renewal and to establish pluripotent PGCs (17, 18). In this context, the CBFA2T2–PRDM14 protein Mass spectrometry interaction stabilizes the complex on chromatin to regulate gene Label-free pull downs were performed in triplicate per sample expression. CBFA2T2 belongs to the eight-twenty-one (ETO) as described previously (23). Briefly, 1 mg of protein lysate per family of chromatin-associated proteins, which includes myeloid pull down was incubated with 10 mL of FLAG M2 beads translocation gene 8 (MTG8, ETO) and CBFA2T3 (MTG16, (Sigma-Aldrich) in a total volume of 600 mL NP-40 lysis buffer ETO-2). These proteins each contain 4 Nervy Homology Region containing 50 mg/mL ethidium bromide. After incubation for 1.5 (NHR) domains, and form homo- or hetero-oligomeric ETO hours on a rotation wheel at 4C, the pull downs were sequen- complexes via the NHR2 domain (19–21). Each of the three ETO tially washed twice with 1 mL of lysis buffer (300 mmol/L NaCl family members participate in oncogenic translocations with and 0.5% NP40), twice with 1 mL PBS with 0.5% NP40 and three RUNX1 in acute myeloid leukemia (AML; ref. 22). times with 1 mL PBS. Bead-bound proteins were then subjected to Despite evidence that protein-binding partners are critical for trypsin digestion as described previously (24). Finally, tryptic PRDM14's function, PRDM14's functional interactors in a cancer peptides were acidified and desalted with C18 Stagetips prior to model have not been described. We hypothesize that when mass spectrometry (MS) analyses (25). Desalted tryptic peptides Prdm14 is expressed in progenitor cells, outside its normal milieu were separated on an Easy-nLC 1000 (Thermo Fisher Scientific) in a pluripotent cell, it requires a protein partner to facilitate connected online to a Thermo scientific Orbitrap Fusion Tribid oncogenesis. Here, we report the first PRDM14–protein interac- Mass spectrometer. MS and MS/MS spectra were recorded in a top tion in an in vivo cancer model and demonstrate how PRDM14 can speed modus with a run cycle of three seconds. Raw files were hijack a hematopoietic regulatory protein, CBFA2T3, in progen- analyzed using MAXQuant software version 1.5.1.0. with default itor cells to initiate leukemogenesis. The protein domains settings (24). Raw MS data were searched against the Uniprot involved in the interaction suggest a model whereby PRDM14 mouse proteome database, released 2015_12. Perseus version recruits CBFA2T3 to chromatin, which is stabilized in a large 1.3.0.4 (26) was used to further analyze the data. Briefly, the chromatin complex to initiate leukemia. We show that CBFA2T3 protein list was filtered for contaminants and reverse hits. Label- has a critical role in PRDM14-induced leukemia initiation, as mice free quantification (LFQ) values were transformed into log2 expressing Prdm14 in hematopoietic progenitor cells fail to devel- values and missing values were imputed by normal distribution. op T-ALL on a Cbfa2t3 null genetic background. Volcano plots were generated with an in-house R script.

Immunoprecipitation Materials and Methods Tissue protein lysates (500 mg) were incubated at 4C over- Mouse strains/animal care night with Protein A Dynabeads (Invitrogen) and anti-FLAG (M2, All mouse experiments were carried out under the approval of Sigma), anti-ETO-2 (C20, Santa Cruz Biotechnology), or anti- the Animal Use Committee (AUC), and housed at The Centre for MTGR1 (KT42, Abcam) antibodies. HEK293T lysates were incu- Phenogenomics, which is accredited by the Association for Assess- bated at 4C overnight with anti-FLAG (M2, Sigma) or anti-HA ment and Accreditation of Laboratory Animal Care International. (Thermo Fisher Scientific) magnetic beads. Beads were washed All mouse strains were maintained on a C57BL/6J congenic genetic three times with PBST (PBS, 0.1% Tween-20). Laemmli Sample background: B6.Gt(ROSA)26Sortm1(LSL-Prdm14-IRES-EGFP)Jus,abbrevi- Buffer 2X (Bio-Rad) was added to the beads and boiled for 5 ated "R26PR," B6.Gt(ROSA)26Sortm(LSL-3XFLAG-Prdm14-P2A-EGFP)Jus minutes at 95C to obtain coimmunoprecipitated proteins. abbreviated "R26FLPR," (14, 15) B6.Tg(Mx1-cre)1Cgn/J abbreviated "Mx1-cre" (from Dr. Margaret A. Goodell, Baylor College Density gradient of Medicine, Houston, TX), B6.Cbfa2t3tm1.1Swh abbreviated Protein lysate (100 mL) was loaded onto a linear 15%–40% "Cbfa2t3 / " (from Dr. Scott W. Hiebert, Vanderbilt University, glycerol gradient. The gradient was placed in a SW60 Ti swinging- Nashville, TN). Polyinosinic:polycytidylic acid (pIpC) administra- bucket rotor (Beckman Coulter) and spun in an Optima XPN-80 tion to activate Mx1-cre was performed at 8 weeks of age with one Ultracentrifuge (Beckman Coulter) at 44,000 rpm for 16 hours at intraperitoneal injection of 250 mg. Mice were monitored for signs 4C. The gradient was immediately fractionated into 21 fractions of cancer including enlarged lymph nodes and abdomen, lethargy, of 200 mL. and labored breathing. Tissues from moribund mice were dissected and processed for protein, RNA, flow cytometry, and/or blood Western blot analysis analyses. Samples for pathology analysis were fixed in 10% neutral Protein lysates were resolved on a 4%–12% Polyacrylamide buffered formalin (NBF) overnight. Tissues were paraffinembed- Gradient Gel (Bio-Rad) and transferred to a polyvinylidene ded and sectioned, and slides stained with hematoxylin and eosin difluoride (PVDF) membrane (Bio-Rad) for blotting. Membranes (H&E). Images were acquired with an Eclipse E100 (Nikon) were blocked in 5% skim milk for 1 hour and subsequently microscope and DS-Qi1Mc (Nikon) camera. incubated with primary antibodies diluted in 5% skim milk for

OF2 Mol Cancer Res; 2019 Molecular Cancer Research

Cbfa2t3 Is Essential for Prdm14-Induced T-ALL

2 hours. After washing with PBST, membranes were incubated 2% FBS (Wisent), 10 mmol/L HEPES, pH 7.2]. One million cells with horseradish peroxidase (HRP)-conjugated secondary anti- of each sample were stained with fluorochrome-conjugated antibodies diluted in 5% skim milk for 1 hour. Membranes were bodies for 30 minutes on ice in the dark, and washed with SM. washed again with PBST, and chemiluminescence Clarity Western Samples were analyzed on a LSR II flow cytometer (BD ECL Substrate (Bio-Rad) was added for signal detection with Biosciences) in the Flow and Mass Cytometry Facility at the Amersham Hyperfilm ECL (GE Healthcare). The following pri- Hospital for Sick Children. Data collection and analysis were mary antibodies were used: FLAG (M2, Sigma), ETO-2 (C20, performed with FACSDiva (BD Biosciences) and FlowJo v10 (BD) Santa Cruz Biotechnology), MTGR1 (Abcam), HA (Sigma). The software. The following antibodies were used: CD4-Alexa 700 following secondary antibodies were used: Goat Anti-Rat IgG (eBioscience), CD8a-eFluor 450 (eBioscience), CD24-PE H&L HRP (Abcam), Rabbit Anti-Goat IgG H&L HRP (Abcam), (eBioscience), TCRBeta-APC (eBioscience), 7-AAD (BioLegend). Peroxidase AffiniPure Goat Anti-Mouse IgG Light Chain Specific (Jackson ImmunoResearch). Statistical analysis A t test was performed on LFQ values and the FDR-corrected P Protein domain interactions value was calculated to determine significant proteins after Full-length coding sequences of mouse PRDM14 and CBFA2T3 AP/MS. Kaplan–Meier survival curves were compared using a were amplified using CloneAmp HiFi PCR Premix (ClonTech) log-rank (Mantel–Cox) test for statistical significance in Prism with the following primer sequences (50 to 30): PRDM14, GAC- (GraphPad). An unpaired t test was performed to identify changes GATGACGACAAGTTCCGCATGGCCTTACCGCCCTCTGGT and in quantified flow cytometry data in Prism (GraphPad). AACGGGCCCTCTAGACTCGAGCTAGCAGGTTTTATGAAGCCT; CBFA2T3, CCAGACTACGCGGGAATAAGGATGTCCCAGGCAT- CCACCACC and GGGTTTAAACGGGCCCTCTAGATCAGCGG- Results GGCACAGCAGCGTC. In-Fusion HD Cloning Kit (Takara Bio) PRDM14 interacts with CBFA2T3 in leukemia cells was used to clone fragments into the pcDNA3.1þ (Invitrogen) To determine the molecular mechanism for PRDM14-induced mammalian expression vector. The resulting plasmids were used cancer initiation, we sought to identify PRDM14 protein– to amplify and subclone the deletion constructs into pcDNA3.1þ interacting partners. Prdm14 expression was induced in 8-week- vectors for expression with the following primer sequences (50 to old R26FLPR;Mx1-cre animals by injection of polyinosinic:poly- 30): PRDM14-DZF, GACGATGACGACAAGTTCCGCATGGCCT- cytidylic acid (pIpC). Immunoprecipitation (IP) of FLAG- TACCGCCCTCTGGT and AACGGGCCCTCTAGACTCGAGCTA- PRDM14 was conducted on BM from moribund R26FLPR; CTCATAGCCATTTCCGTACCA; PRDM14-DN-PR, GACGATGAC- Mx1-cre with anti-FLAG magnetic beads. Bead-bound proteins GACAAGTTCCGCAAGTTCCTGGGCGTTCCCATG and AACG- were digested with trypsin and subjected to quantitative LC/MS- GGCCCTCTAGACTCGAGCTAGCAGGTTTTATGAAGCCT; PRD- MS for identification. AP/MS analysis was performed using meth- M14-PR, GACGATGACGACAAGTTCCGCGGCTTCAACTTCACA- ods that are optimized for low protein inputs. Control BM from GAGGAG and AACGGGCCCTCTAGACTCGAGCTACTCATAG- R26FLPR animals not exposed to cre and therefore not expressing CCATTTCCGTACCA; CBFA2T3- DNterm, CCAGACTACGCGG- Prdm14 was also subjected to LC/MS-MS to eliminate proteins GAATAAGGCAGCTGCTGCTGGACGCCAGC and GGGTTTAAA- pulled down through nonspecific antibody binding. LFQ analysis CGGGCCCTCTAGATCAGCGGGGCACAGCAGCGTC; CBFA2- revealed several strong interactions with proteins involved in T3-DCterm, CCAGACTACGCGGGAATAAGGATGTCCCAGGCAT- NOTCH1 activation (SGK223/PEAK1), splicing (THRAP3, CCACCACC and GGGTTTAAACGGGCCCTCTAGACTATTCGT- RBM10), and chromatin binding (CBFA2T3, linker histone var- GCTGGGCCAGGTACTG; CBFA2T3-NHR1, CCAGACTACGCG- iants HIST1h1d/H1.3 and HIST1h1b/H1.5, CBFA2T2; Fig. 1A; GGAATAAGGTGTCTCTTGATGAACGGCAGC and GGGTTTAAA- Supplementary Table S1). The protein with the strongest fold CGGGCCCTCTAGACTATTCGTGCTGGGCCAGGTACTG. Accu- change over control was ETO family member CBFA2T3. PRDM14 rate plasmid sequence was confirmed by Sanger sequencing. To interaction with both ETO family members was confirmed using coexpress constructs, HEK293T cells were cultured in DMEM reciprocal co-IP on thymus tissue with FLAG-PRDM14 and (Wisent) with penicillin/streptomycin and 10% FBS. Cells were endogenous CBFA2T3 (Fig. 1B) or CBFA2T2 (Fig. 1C). The transfected with Lipofectamine 2000 (Invitrogen) as per the man- leukemias that develop in PRDM14-expressing mice are highly ufacturer's instructions and lysed 24 hours posttransfection. infiltrative, saturating all hematopoietic tissues, with monoclonal immature pre-T cells (14, 15). Therefore, thymus tissue was used RT-PCR to confirm the interaction in a second tissue type, producing high RNA extraction was performed with RNeasy Mini Kit (Qiagen). protein yields to reduce the number of animals required, and RNA was reverse transcribed using SuperScript VILO cDNA Syn- providing a more homogeneous wild-type control tissue than BM. thesis Kit (Invitrogen). cDNA was amplified with AccuStart II PCR Co-IP with IgG alone confirmed proteins were not being recov- SuperMix (Quantabio). Primers used (50 to 30) were as follows: ered through nonspecific binding to the antibody (Fig. 1B and C). Cbfa2t3, TGGAAGCACCTCAACAGTCTTC and GTGGTTGAGTT- The strength of the interaction with CBFA2T3 and its importance CCTCACGGT; Tbp, CCTTGTACCCTTCACCAATGAC and ACA- in hematopoietic cell regulation led us to further investigate its GCCAAGATTCACGGTAGA. relationship with PRDM14. To further characterize the interaction with PRDM14, we ran Flow cytometry R26FLPR;Mx1-cre thymus protein lysates through a density gra- Single-cell suspensions were prepared from thymus, spleen, dient to separate potential protein complexes. Western blot and BM tissues. Red blood cells were lysed with Red Blood Cell analysis showed a partial cofractionation of PRDM14 (64 kDa) Lysis Solution (Miltenyi Biotec) and washed with staining media and CBFA2T3 (68 kDa) interacting in a fraction corresponding to [SM: Hanks' Balanced Salt Solution (Thermo Fisher Scientific), approximately 400–500 kDa in size, suggesting that additional

www.aacrjournals.org Mol Cancer Res; 2019 OF3

Tracey et al.

Figure 1. PRDM14 interacts with CBFA2T3 in leukemia cells. A, Volcano plot of LFQ mass spectrometry data from R26FLPR;Mx1-cre leukemic BM performed technically in triplicate. Datapoints represent individual proteins with signiﬁcant hits in the top right corner having –log FDR

>1.301 and log2 fold change (FC) >8 over control R26FLPR animals. B, Co-IP in leukemic thymus confirms protein interaction between PRDM14 and CBFA2T3, which is not due to unspecific IgG binding. Representative image from four experiments. C, Co-IP in leukemic thymus confirms protein interaction between PRDM14 and CBFA2T2, which is not due to unspecificIgG binding. Representative image from four experiments. D and E, Western blot probing for FLAG (PRDM14), CBFA2T3, and CBFA2T2 after separation of protein complexes via density gradient. Top arrows indicate approximate size of complexes running at fraction 5 or between fractions 13 and 15 based on purified protein standards, and side arrows indicate expected size of the indicated protein. D, FLAG (PRDM14) and CBFA2T3 proteins, but not CBFA2T2, peak in fraction 13. Fractions 12–14 were pooled and FLAG-PRDM14 was pulled down with aCBFA2T3 antibody confirming an association in those fractions. Representative images from four experiments. E, In control R26FLPR tissue not expressing PRDM14, CBFA2T3 peaks in fraction 5. Representative images from three experiments.

complex members or CBFA2T3 oligomerization may contribute fying enzymes that bind NHR3-4 (27). PRDM14 interacts to the formation of multimeric protein associations (Fig. 1D). with other proteins primarily via its PR domain (17). To CBFA2T2, PRDM14's primary interaction partner in pluripotent identify the protein domain at which the PRDM14–CBFA2T3 cells (17, 18), peaked in the first fractions (5 and 7), but did not interaction occurs, a series of deletion constructs lacking cofractionate with PRDM14 or CBFA2T3 in the later fractions, individual functional domains was created for each protein indicating that it does not participate abundantly in the same (Fig. 2A). To test the interacting domains, tagged expression CBFA2T3-containing complex in murine leukemia cells. Co-IP plasmids were cotransfected into HEK293T cells followed by performed with an aCBFA2T3 antibody from lysates from frac- protein extraction and co-IP with either anti-FLAG tions 12–14 confirmed an association between FLAG-PRDM14 (PRDM14) or anti-HA (CBFA2T3) magnetic beads. PRDM14 and CBFA2T3 in those peak fractions. In contrast, a density bound to full length CBFA2T3 without its C-terminal zinc gradient carried out in R26FLPR control thymus lacking cre fingers, but the N-PR region was required for interaction. revealed that CBFA2T3 shows a peak in fraction 5 with no PRDM14's PR domain alone was sufficient to pull down detectable signal in later fractions when PRDM14 is absent, CBFA2T3 (Fig. 2B). CBFA2T3 bound full length PRDM14 demonstrating that CBFA2T3 is predominantly found as a mono- without the C-terminal half of the protein, but the N-ter- mer in wild-type thymus (Fig. 1E). minal half was required for interaction. Furthermore, the NHR1 domain of CBFA2T3 alone was sufficient to pull down PRDM14 and CBFA2T3 interact through the PR and NHR1 PRDM14 (Fig. 2C; Supplementary Fig. S1), even though this domains small region of the protein appeared to be less stable than CBFA2T3 contains four NHR domains that bind diverse the larger components. Together, these data demonstrate that types of proteins, enabling it to act as a bridge between PRDM14 and CBFA2T3 interact through the PR and NHR1 transcription factors that bind NHR1 and chromatin-modi- domains, respectively.

OF4 Mol Cancer Res; 2019 Molecular Cancer Research

Cbfa2t3 Is Essential for Prdm14-Induced T-ALL

Figure 2. PRDM14 and CBFA2T3 interact through the PR and NHR1 domains, respectively. A, Deletion constructs lacking key functional domains were constructed for PRDM14 (FLAG-tagged) and CBFA2T3 (HA-tagged). Numbers indicate beginning and ending amino acid positions for each corresponding full-length protein. Western blot results after co-IP with anti-FLAG (B) or anti-HA (C) antibodies. The constructs important for facilitating interaction are detected in the bottom panels. The NHR1 panel of the HA blot in (C) shows a longer exposure due to decreased expression. Representative images from three experiments. PRDM14-FL (67 kDa), PRDM14-DZF (42 kDa), PRDM14-DN-PR (25 kDa), PRDM14-PR (21 kDa), CBFA2T3-FL (70 kDa), CBFA2T3-DNterm (45 kDa), CBFA2T3-DCterm (25 kDa), CBFA2T3-NHR1 (13 kDa). UT, untransfected; FL, full length.

Altering levels of Cbfa2t3 can prevent or slow T-ALL that Cbfa2t3 is essential for Prdm14-induced T-ALL (Fig. 3C). þ þ development Unexpectedly, R26PR;Mx1-cre;Cbfa2t3 / mice showed a signif- Cbfa2t3 is important for HSC self-renewal and is most highly icant delay in leukemia onset with 6/12 mice succumbing to expressed in hematopoietic stem and progenitor cells (27–30). disease in 32–136 days post-pIpC injection, and 6/12 mice Therefore, we hypothesized that a misappropriation of its role in remaining healthy by 150 days post-pIpC injection, in contrast þ þ BM when PRDM14 is ectopically present is critical for T-ALL to R26PR;Mx1-cre;Cbfa2t3 / mice. These data suggest that the pathogenesis. To test this idea, we placed the R26PR and Mx1- leukemia that develops due to expression of Prdm14 is sensitive to cre constructs together on a Cbfa2t3 / genetic background levels of Cbfa2t3. (R26PR;Mx1-cre;Cbfa2t3) prior to pIpC induction (Fig. 3A and þ/ B) and assessed leukemia phenotypes over time. Strikingly, T-ALL has a similar disease phenotype in both Cbfa2t3 and þ þ þ þ although R26PR;Mx1-cre;Cbfa2t3 / animals (11/12) develop Cbfa2t3 / backgrounds a very penetrant T-ALL as early as 16 days post-pIpC injection, The signiﬁcant difference in survival between Prdm14-expres- þ þ þ R26PR;Mx1-cre;Cbfa2t3 / animals (11/11) did not develop any sing mice on a Cbfa2t3 / or Cbfa2t3 / background led us to signs of leukemia over 150 days post-pIpC injection, suggesting consider that the cell type may also differ in leukemias that arose

www.aacrjournals.org Mol Cancer Res; 2019 OF5

Tracey et al.

Figure 3. Deletion of Cbfa2t3 prevents T-ALL development in R26PR;Mx1-cre mice. A, Mouse cross of R26PR;Mx1- cre mice with Cbfa2t3/ mice and experimental timeline. B, RT-PCR detecting Cbfa2t3 and Tbp expression (internal control) in Cbfa2t3þ/þ and Cbfa2t3þ/ mice, but not Cbfa2t3/. C, Kaplan– Meier survival curve of R26PR;Mx1- cre;Cbfa2t3 mice presented as percent survival by days post-pIpC injection (Prdm14 expression) for each genotype. Signiﬁcance was determined by comparing the three curves using a log-rank (Mantel– Cox) test for statistical signiﬁcance. None of the R26PR;Mx1-cre; Cbfa2t3/ mice died by 150 days (n ¼ 11); R26PR;Mx1-cre;Cbfa2t3þ/ mice died between 32 and 136 days post-pIpC (n ¼ 12, mean ¼ 100 days); R26PR;Mx1-cre;Cbfa2t3þ/þ mice died between 16 and 74 days post-pIpC (n ¼ 12, mean ¼ 38 days). Tbp, TATA-box binding protein.

on the two genetic backgrounds. However, the difference was Lymphoblasts could also be detected in the meninges and blood restricted to penetrance and the timing of onset, because few vessel linings within the brain (Fig. 4F). differences in leukemia subtype or pathology were noted between We have previously shown that cells misexpressing þ þ moribund R26PR;Mx1-cre;Cbfa2t3 / and R26PR;Mx1-cre; PRDM14 have a block in T-cell development leading to an þ þ Cbfa2t3 / mice. All moribund animals presented with lethargy, accumulation of CD8 immature single-positive (ISP) T cells þ þ distended abdomens, and labored breathing and upon dissection (CD4 CD8 CD24 TCRb lo/ ) at the expense of double-positive þ þ had grossly enlarged thymi, spleens, and livers. However, (DP) T cells (CD4 CD8 ; ref. 14). We confirmed this result using þ only 67% of R26PR;Mx1-cre;Cbfa2t3 / mice (4/6) developed flow cytometry immunophenotyping of R26PR;Mx1-cre; þ þ þ enlarged lymph nodes compared with 100% of R26PR;Mx1-cre; Cbfa2t3 / mice and showed that R26PR;Mx1-cre;Cbfa2t3 / þ þ þ Cbfa2t3 / mice (11/11). Complete blood counts in R26PR;Mx1- mice develop a corresponding accumulation of CD8 ISP T cells þ cre;Cbfa2t3 / mice showed a significant increase in white blood in the thymus (Fig. 5A and B). Taken together, these results cell counts (48–192 109/L, mean 90.74 26.37) over control indicate that the T-ALL that develops in R26PR;Mx1-cre; þ animals (2.1–8.2 109/L, mean 5.63 1.38; Fig. 4A). Although Cbfa2t3 / mice is similar in cell type to that in R26PR;Mx1- þ þ þ þ R26PR;Mx1-cre;Cbfa2t3 / mice showed a significant decrease in cre;Cbfa2t3 / mice but with a significantly delayed onset. Strik- red blood cell numbers from control animals (5.71–8.3 1012/L, ingly, the absence of Cbfa2t3 prevents T-ALL when Prdm14 is mean 7.62 0.49 in moribund animals versus 8.8–9.9 1012/L, misexpressed in HSCs. mean 9.49 0.24 in control animals), those in R26PR;Mx1-cre; þ Cbfa2t3 / mice were more variable, and did not reach significance (4.6–11.4 1012/L, mean 8.25 1.10 in moribund Discussion animals versus 8.4–9.3 1012/L, mean 8.95 0.20 in control Our work suggests that the presence of CBFA2T3 in hemato- animals; Fig. 4B). Hemoglobin, hematocrit, and platelet values poietic progenitors is required for PRDM14 to initiate T-ALL. The were statistically unchanged between moribund and control mice protein–protein interaction between PRDM14 and CBFA2T3 that (Fig. 4C–E). Histopathologic analyses of both R26PR;Mx1-cre; occurs in conserved family motifs suggests a model where this þ þ þ Cbfa2t3 / and R26PR;Mx1-cre;Cbfa2t3 / mice revealed a loss of complex, which likely contains multiple CBFA2T3 oligomers, normal architecture in the BM, spleen, thymus, liver, and kidney provides a platform that recruits chromatin-modifying enzymes associated with an extensive infiltration of lymphoblast cells. to initiate leukemia (Fig. 6). The master hematopoietic regulator

OF6 Mol Cancer Res; 2019 Molecular Cancer Research

Cbfa2t3 Is Essential for Prdm14-Induced T-ALL

Figure 4. R26PR;Mx1-cre;Cbfa2t3þ/ moribund mice develop T-ALL with a similar disease phenotype compared with R26PR;Mx1-cre;Cbfa2t3þ/þ moribund mice. White blood cell (A; WBC), red blood cell (B; RBC), hemoglobin (C), platelet (D), and hematocrit counts (E) in peripheral blood of control (n ¼ 4) and moribund (n ¼ 5) mice. Significance was determined using an unpaired t test. F, Representative images of hematoxylin and eosin–stained sections of fixed BM, thymus, spleen, kidney, liver, and brain tissues. All images were taken with a 40 objective. Scale bar, 100 mm(, P < 0.0006; , P < 0.05; ns, not significant).

þ þ CBFA2T3 is crucial for HSC quiescence and hematopoietic lineage self-renewal with fewer quiescent Lin Sca-1 c-Kit (LSK) cells, decisions. Cbfa2t3 homozygous mice are viable and fertile (31), and failure of BM to repopulate in transplant assays (30, 31). developing a mild anemia due to reduced erythroid progenitor CBFA2T3 controls the expression of many hematopoietic tran- cells (32). Homozygous mutant mice exhibit defects in stem cell scription factors, including a key complex that includes the E2A

www.aacrjournals.org Mol Cancer Res; 2019 OF7

Tracey et al.

Figure 5. Lymphoblasts have a block in T-cell development. A, Representative plots from ﬂow cytometry analysis of thymus cells using markers of T-cell development. B, Quantiﬁcation of T-cell populations in thymus from 3 to 6 biological replicates per genotype. , P < 0.03; , P < 0.003. DN, double negative; DP, double positive; ISP, immature single positive; SP, single positive.

transcription factor, T-cell acute lymphocytic leukemia 1 (TAL1), primary perturbations in the DN1 populations (29). After BM LIM domain only 2 (LMO2), and LIM domain binding 1 (LDB1; transplantation, Cbfa2t3 null mice fail to repopulate the T lineage ref. 33), which regulates long term (LT)-HSC quiescence. Relevant because lymphoid-primed multipotent progenitors (LMPP) and to the initiation of leukemia by PRDM14, both TAL1 and LMO2 early T-cell precursor (ETP) cells are reduced (29). In contrast, are required for leukemia initiation (34, 35). Homozygous Prdm14 misexpression in BM expands progenitor cells, including Cbfa2t3-mutant mice also have lower numbers of T cells, with cells that resemble LT-HSCs and common lymphoid progenitors,

OF8 Mol Cancer Res; 2019 Molecular Cancer Research

Cbfa2t3 Is Essential for Prdm14-Induced T-ALL

Figure 6. Model of PRDM14/CBFA2T3– mediated cancer initiation. In normal hematopoietic cells lacking PRDM14, CBFA2T3 exists predominantly as a monomer or in transient protein complexes. Upon aberrant Prdm14 expression in preleukemic cells, PRDM14 can hijack CBFA2T3 and potentially additional proteins via CBFA2T3 to PRDM14-target genes, leading to chromatin remodeling, gene misregulation, and cancer initiation.

in which Cbfa2t3 is overexpressed (4, 14). Therefore, the expan- occur on a Cbfa2t3 / genetic background within 150 days of sion of LT-HSC–like cells and lymphoid progenitors in PRDM14- inducing Prdm14 expression. Furthermore, leukemia onset was þ expressing mice is consistent with Cbfa2t3's role in HSC self- significantly delayed on the heterozygous Cbfa2t3 / genetic renewal and T-cell development. background. CBFA2T3 is poised to interact with PRDM14 in CBFA2T3's family member CBFA2T2, which is required for immature cell types in the event that Prdm14 becomes misex- PRDM14 to reset potency in PGCs, also interacted with PRDM14 pressed and is likely the essential factor mediating PRDM14- in leukemia cells. The protein structure and function of the ETO induced cancer initiation in progenitor hematopoietic cell types. family members overlap, leading to the idea that the different The presence of Cbfa2t3 in progenitors could explain why Prdm14 members interact with a common set of transcription factors and transforms hematopoietic stem and progenitor cells but lacks this corepressors to provide functional redundancy, and explaining capacity in committed cells (14). rather mild phenotypes in knockout mice. ETO proteins can form CBFA2T3's NHR1 domain is required for the interaction with multimers, including heterodimeric and tetrameric structures. PRDM14 in cultured cells. PRDM14 binds DNA at a specific However, specificity arises because they are normally expressed sequence that is identical between mouse and human in different cell types. Consistently, CBFA2T3 expression is high in (GGTC[TC]CTAA) through its six zinc fingers (7, 8). ETO family hematopoietic stem and progenitor cells, and decreases during members do not bind DNA directly, so it is likely that PRDM14 differentiation, remaining high in megakaryocyte-erythroid and serves as a bridge between DNA and CBFA2T3, while the NHR3 þ B220 progenitor cells (27, 28). In mouse HSCs, Cbfa2t3 is and NHR4 domains complex with other chromatin-modifying expressed at twice the level of Cbfa2t2 (36), which could give proteins (27), similar to other related family members that CBFA2T3 a competitive advantage over CBFA2T2 for interaction contain Nervy homology domains (Fig. 6). CBFA2T3 may form with PRDM14. Importantly, density gradient experiments show a corepressor complex with histone deacetylases (HDAC) 1–3as that CBFA2T3 and PRDM14 associate and potentially assemble well as 6 and 8 to regulate gene expression in this context as into a protein complex in leukemic tissue without CBFA2T2, well (18, 27). Thus, PRDM14 may recruit repressive CBFA2T3 and supporting the idea that PRDM14 preferentially associates with indirectly HDAC proteins that are capable of depositing epige- the predominant ETO family member present in HSCs. Moreover, netic marks onto chromatin at specific DNA targets. This mech- Cbfa2t3 is highly expressed in Prdm14-driven preleukemia cells anism suggests that PRDM14 hijacks CBFA2T3 to misregulate compared with immunophenotype-matched progenitor cells (4). gene expression, expanding stem and progenitor cells as it per- A partnership with overexpressed CBFA2T3, then, is consistent turbs normal lineage development to initiate T-ALL. with an overabundance of LT-HSC–like and LMPP-like cells in NOTCH signaling is critical to T-cell development and for the PRDM14-expressing preleukemia cells (14). transition from HSCs to common lymphoid progenitors. Acti- Altogether, these data support the idea that Cbfa2t3 is required vating mutations at the NOTCH1 locus are found in greater than for Prdm14-induced leukemogenesis. Strikingly, T-ALL did not 50% of T-ALL cases (37). We previously showed that in mouse

www.aacrjournals.org Mol Cancer Res; 2019 OF9

Tracey et al.

preleukemia cells, PRDM14 binds DNA adjacent to cryptic recom- readily detect less stable interactions or complex members indi- bination signal sequence sites at Notch1 to recruit RAG recombi- rectly bound via interaction with CBFA2T3. nase enzymes (15) that allow for illegitimate recombination, Together, our results demonstrate how an oncogenic protein creating a constitutively active NOTCH1 that drives T-ALL (38). can hijack proteins already present in a given cell type to initiate PRDM14-induced T-ALLs are extremely aggressive and early leukemia. Although CBFA2T3 has been associated with tumor onset, more-so than in models that overexpress Notch1 (15), suppressor functions in cancers of epithelial origin, it is reported suggesting that other factors are at play to promote NOTCH- to have oncogenic properties in hematopoietic cancers (49, 50). driven tumorigenesis. The Notch intracellular domain (ICD) and Ours is the first study to definitively show an oncogenic function CBFA2T3 NHR1 are critical for integrating NOTCH functions for CBFA2T3 as a partner with PRDM14. PRDM14 overexpression during T-cell development. Similar to other hematopoietic tran- and amplification is also implicated in cancer initiation in breast scription factors, the level of CBFA2T3 affects appropriate tran- and other solid tumors, and the association with CBFA2T3 may be sient NOTCH signaling, and perturbations can lead to activation a common mechanism in PRDM14-driven oncogenesis that of NOTCH (39). Thus, both constitutive activation of NOTCH1 extends to many other cancer subtypes. Because Prdm14 is not through illegitimate recombination driven by PRDM14 and high expressed in mature cells, targeting its interaction with CBFA2T3 levels of CBFA2T3 may lead to this aggressive T-ALL. could be specifi c to cancer cells, thereby avoiding detrimental off- AP/MS identified several new partners for PRDM14 that may target effects and allowing for therapeutic strategies for a subset of reveal additional functions for this intriguing protein. Bcl2- tumors. associated transcription factor 1 (BCLAF1) is an apoptosis regulator associated with repressor complexes, whose expres- Disclosure of Potential Conflicts of Interest sion is linked to poor outcomes in AML (40). RBM10 and No potential conflicts of interest were disclosed. THRAP3 are RNA-binding factors that potentially associate with CBFA2T3, which can bind RNA through the NHR4- and Disclaimer NHR2-proximal regions (41). Noncoding RNAs have a well- The Vermeulen lab is part of the Oncode Institute, which is partly funded by established role in recruiting chromatin-binding complexes to the Dutch Cancer Society (KWF). remodel the genome (42, 43). Finally, two Histone 1 (H1) variants, H1.3 and H1.5, were also recovered. H1 is not Authors' Contributions involved in the core nucleosome, but rather binds as a linker Conception and design: L.J. Tracey, M.J. Justice Development of methodology: L.J. Tracey, E.I. Campos, M.J. Justice histone that is important for higher-order chromatin structure. Acquisition of data (provided animals, acquired and managed patients, H1.3 binds at the imprinting control regions of the imprinted provided facilities, etc.): L.J. Tracey, T. Brooke-Bisschop, P.W.T.C. Jansen, long noncoding RNAs H19 and maternally expressed gene 3 M. Vermeulen (Meg3), altering DNA methylation at these sites in ovarian Analysis and interpretation of data (e.g., statistical analysis, biostatistics, cancer cells (44). Many imprinted genes, among them Meg3 computational analysis): L.J. Tracey, T. Brooke-Bisschop, M. Vermeulen, and its overlapping imprinted transcript Deiodinase-2 (Dio2), M.J. Justice Writing, review, and/or revision of the manuscript: L.J. Tracey, T. Brooke- are misexpressed in Prdm14 preleukemia cells (4, 45). In vitro Bisschop, M. Vermeulen, M.J. Justice assays have not detected histone H3 methyltransferase activity Administrative, technical, or material support (i.e., reporting or organizing for the PR domain of PRDM14 (15, 17); however, given its data, constructing databases): T. Brooke-Bisschop association with H1, it will be prudent to determine whether Study supervision: M.J. Justice PRDM14 can directly modify H1. Previous studies of PRDM14–protein interactions using a co-IP Acknowledgments technique have identified chromatin remodelers that were not The authors thank Dr. Scott W. Hiebert of Vanderbilt University (Nashville, identified here. Two studies in ESCs reported that PRDM14 TN) and Dr. Margaret Goodell for supplying mice, Christine Taylor and Julie Ruston for help with mouse colony management, Alexandra Khozin and interacts with the polycomb repressor complex 2 (PRC2), which Stephanie Tran for technical assistance, and all members of the Justice lab for conferstheH3K27me3marktorepressgenetranscription(46,47). helpful discussions. This work was supported by the NIH (R01CA163849, A separate study in ESCs showed an interaction with coactivator to M.J. Justice); NSERC (Discovery Grant to E.I. Campos); CIHR (Project Grant associated arginine methyltransferase 1 (CARM1), a histone argi- PJT-159683 to E.I. Campos.); Cancer Research Society (Operating Grant to nine methyltransferase important for cell fate specification in the E.I. Campos.); Garron Family Cancer Centre (Pitblado Discovery Grant to early embryo (48). However, it is noteworthy that these interac- E.I. Campos). tions were not found in the AP/MS analysis from mouse leukemic The costs of publication of this article were defrayed in part by the payment of tissues reported here, nor in AP/MS experiments carried out in ESC page charges. This article must therefore be hereby marked advertisement in and human germ cell tumor-derived (NCCIT) cell lines (17, 18). accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Although a complete overlap in binding partners for PRDM14 and ETO family members was not found in this experiment, an Received December 13, 2018; revised February 7, 2019; accepted April 19, alternative protein interaction approach may be needed to more 2019; published first April 23, 2019.

References 1. Roberts KG, Mullighan CG. Genomics in acute lymphoblastic leukaemia : 3. Dettman EJ, Justice MJ. The zinc ﬁnger SET domain gene Prdm14 is insights and treatment implications. Nat Rev Clin Oncol 2015;12:344–57. overexpressed in lymphoblastic lymphomas with retroviral insertions at 2. Mullighan CG, Phillips LA, Su X, Ma J, Miller CB, Shurtleff SA, et al. Evi32. PLoS One 2008;3:e8323. Genomic analysis of the clonal origins of relapsed acute lymphoblastic 4. Dettman EJ, Simko SJ, Ayanga B, Caroﬁno BL, Margolin JF, Morse HC 3rd, leukemia. Science 2008;322:1377–80. et al. Prdm14 initiates lymphoblastic leukemia after expanding a

OF10 Mol Cancer Res; 2019 Molecular Cancer Research

Cbfa2t3 Is Essential for Prdm14-Induced T-ALL

population of cells resembling common lymphoid progenitors. Oncogene 26. Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, et al. The 2011;30:2859–73. Perseus computational platform for comprehensive analysis of (prote) 5. Tsuneyoshi N, Sumi T, Onda H, Nojima H, Nakatsuji N, Suemori H. omics data. Nat Methods 2016;13:731–40. PRDM14 suppresses expression of differentiation marker genes in human 27. Steinauer N, Guo C, Zhang J. Emerging roles of MTG16 in cell-fate control embryonic stem cells. Biochem Biophys Res Commun 2008;367:899–905. of hematopoietic stem cells and cancer. Stem Cells Int 2017;2017: 6. Chia NY, Chan YS, Feng B, Lu X, Orlov YL, Moreau D, et al. A genome-wide 6301385. RNAi screen reveals determinants of human embryonic stem cell identity. 28. Lindberg SR, Olsson A, Persson AM, Olsson I. The leukemia-associated Nature 2010;468:316–20. ETO homologues are differently expressed during hematopoietic differ- 7. Ma Z, Swigut T, Valouev A, Rada-Iglesias A, Wysocka J. Sequence-specific entiation. Exp Hematol 2005;33:189–98. regulator Prdm14 safeguards mouse ESCs from entering extraembryonic 29. Hunt A, Fischer M, Engel ME, Hiebert SW. Mtg16/Eto2 contributes to endoderm fates. Nat Struct Mol Biol 2011;18:120–7. murine T-cell development. Mol Cell Biol 2011;31:2544–51. 8. Yamaji M, Seki Y, Kurimoto K, Yabuta Y, Yuasa M, Shigeta M, et al. Critical 30. Fischer MA, Moreno-Miralles I, Hunt A, Chyla BJ, Hiebert SW. Myeloid function of Prdm14 for the establishment of the germ cell lineage in mice. translocation gene 16 is required for maintenance of haematopoietic stem Nat Genet 2008;40:1016–22. cell quiescence. EMBO J 2012;31:1494–505. 9. Magnusd ottir E, Dietmann S, Murakami K, Gunesdogan€ U, Tang F, Bao S, 31. Chyla BJ, Moreno-Miralles I, Steapleton MA, Thompson MA, Bhaskara S, et al. A tripartite transcription factor network regulates primordial germ cell Engel M, et al. Deletion of Mtg16, a target of t(16;21), alters hematopoietic specification in mice. Nat Cell Biol 2013;15:905–15. progenitor cell proliferation and lineage allocation. Mol Cell Biol 2008;28: 10. Gell JJ, Zhao J, Chen D, Hunt TJ, Clark AT. PRDM14 is expressed in germ cell 6234–47. tumors with constitutive overexpression altering human germline differ- 32. Hamlett I, Draper J, Strouboulis J, Iborra F, Porcher C, Vyas P. Character- entiation and proliferation. Stem Cell Res 2018;27:46–56. ization of megakaryocyte GATA1-interacting proteins: the corepressor 11. Zhang T, Meng L, Dong W, Shen H, Zhang S, Liu Q, et al. High ETO2 and GATA1 interact to regulate terminal megakaryocyte maturation. expression of PRDM14 correlates with cell differentiation and is a novel Blood 2008;112:2738–49. prognostic marker in resected non-small cell lung cancer. Med Oncol 33. Schuh AH, Tipping AJ, Clark AJ, Hamlett I, Guyot B, Iborra FJ, et al. ETO- 2013;30:605. 2 associates with SCL in erythroid cells and megakaryocytes and 12. Nishikawa N, Toyota M, Suzuki H, Honma T, Fujikane T, Ohmura T, et al. provides repressor functions in erythropoiesis. Mol Cell Biol 2005; Gene amplification and overexpression of PRDM14 in breast cancers. 25:10235–50. Cancer Res 2007;67:9649–57. 34. McCormack MP, Young LF, Vasudevan S, de Graaf CA, Codrington R, 13. Taniguchi H, Hoshino D, Moriya C, Zembutsu H, Nishiyama N, Rabbitts TH, et al. The Lmo2 oncogene initiates leukemia in mice by Yamamoto H, et al. Silencing PRDM14 expression by an innovative inducing thymocyte self-renewal. Science 2010;327:879–83. RNAi therapy inhibits stemness, tumorigenicity, and metastasis of 35. Gerby B, Tremblay CS, Tremblay M, Rojas-sutterlin S, Sauvageau G. SCL, breast cancer. Oncotarget 2017;8:46856–74. LMO1 and Notch1 reprogram thymocytes into self-renewing cells. 14. Carofino BL, Ayanga B, Justice MJ. A mouse model for inducible over- PLoS Genet 2014;10:e1004768. expression of Prdm14 results in rapid-onset and highly penetrant T-cell 36. Heng TS, Painter MW, The Immunological Genome Project Consortium. acute lymphoblastic leukemia (T-ALL). Dis Model Mech 2013;6: The Immunological Genome Project : networks of gene expression in 1494–506. immune cells. Nat Immunol 2008;9:1091–4. 15. Carofino BL, Ayanga B, Tracey LJ, Brooke-Bisschop T, Justice MJ. PRDM14 37. Weng AP, Ferrando AA, Lee W, Morris JP IV, Silverman LB, Sanchez-Irizarry promotes RAG-dependent Notch1 driver mutations in mouse T-ALL. C, et al. Activating mutations of NOTCH1 in human T cell acute lympho- Biol Open 2016;5:645–53. blastic leukemia. Science 2004;306:269–71. 16. Ma Z, Swigut T, Valouev A, Rada-Iglesias A, Wysocka J. Sequence-specific 38. Ashworth TD, Pear WS, Chiang MY, Blacklow SC, Mastio J, Xu L, et al. regulator Prdm14 safeguards mouse ESCs from entering extraembryonic Deletion-based mechanisms of Notch1 activation in T-ALL : key roles for endoderm fates. Nat Struct Mol Biol 2011;18:120–7. RAG recombinase and a conserved internal translational start site in 17. Nady N, Gupta A, Ma Z, Swigut T, Koide A, Koide S, et al. ETO family Notch1. Blood 2010;116:5455–65. protein Mtgr1 mediates Prdm14 functions in stem cell maintenance and 39. Butko E, Pouget C, Traver D. Complex regulation of HSC emergence by the primordial germ cell formation. Elife 2015;4:e10150. Notch signaling pathway. Dev Biol 2016;409:129–38. 18. Tu S, Narendra V, Yamaji M, Vidal SE, Rojas LA, Wang X, et al. Co-repressor 40. Dell'Aversana C, Giorgio C, D'Amato L, Lania G, Matarese F, Saeed S, et al. CBFA2T2 regulates pluripotency and germline development. Nature 2016; miR-194-5p / BCLAF1 deregulation in AML tumorigenesis. Leukemia 534:387–90. 2017;31:2315–25. 19. Amann JM, Nip J, Strom DK, Lutterbach B, Harada H, Lenny N, et al. ETO, a 41. Rossetti S, van Une L., Sacchi N, Hoogeveen AT. Novel RNA-binding target of t(8;21) in acute leukemia, makes distinct contacts with multiple properties of the MTG chromatin regulatory proteins. BMC Mol Biol histone deacetylases and binds mSin3A through its oligomerization 2008;9:93. domain. Mol Cell Biol 2001;21:6470–83. 42. Tsai M, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, et al. Long 20. Lindberg S, Olsson A, Persson AM, Olsson I. Interactions between the noncoding RNA as molecular scaffold of histone modification complexes. leukaemia- associated ETO homologues of nuclear repressor proteins. Eur J Science 2010;329:689–94. Haematol 2003;71:439–47. 43. Hendrickson DG, Kelley DR, Tenen D, Bernstein B, Rinn JL. Widespread 21. Hug BA, Lazar MA. ETO interacting proteins. Oncogene 2004;23: RNA binding by chromatin- associated proteins. Genome Biol 2016;17:28. 4270–4. 44. Medrzycki M, Zhang Y, Zhang W, Cao K, Pan C, Lailler N, et al. Histone H1. 22.GuastadisegniM,LonoceA,ImperaL,DiTerlizziF,FugazzaG, 3 suppresses H19 noncoding RNA expression and cell growth of ovarian Aliano S, et al. CBFA2T2 and C20orf112 : two novel fusion cancer cells. Cancer Res 2014;74:6463–74. partners of RUNX1 in acute myeloid leukemia. Leukemia 2010; 45. Simko SJ, Voicu H, Carofino BL, Justice MJ. Mouse lymphoblastic leuke- 24:1516–9. mias induced by aberrant Prdm14 expression demonstrate widespread 23. SmitsAH,JansenPW,PoserI,HymanAA,VermeulenM.Stoichiometry copy number alterations also found in human ALL. Cancers 2012;4: of chromatin-associated protein complexes revealed by label-free quan- 1050–66. titative mass spectrometry-based proteomics. Nucleic Acids Res 2012; 46. Yamaji M, Ueda J, Hayashi K, Ohta H, Yabuta Y, Kurimoto K, et al. PRDM14 41:e28. ensures naive pluripotency through dual regulation of signaling and 24. Cox J, Mann M. MaxQuant enables high peptide individualized p.p.b.- epigenetic pathways in mouse embryonic stem cells. Cell Stem Cell range mass accuracies and proteome-wide protein quantification. 2013;12:368–82. Nat Biotechnol 2008;26:1367–72. 47. Chan YS, Goke€ J, Lu X, Venkatesan N, Feng B, Su IH, et al. A PRC2- 25. Rappsilber J, Mann M, Ishihama Y. Protocol for micro-purification, enrich- dependent repressive role of PRDM14 in human embryonic stem cells and ment, pre-fractionation and storage of peptides for proteomics using induced pluripotent stem cell reprogramming. Stem Cells 2013;31: StageTips. Nat Protoc 2007;2:1896–906. 682–92.

www.aacrjournals.org Mol Cancer Res; 2019 OF11

Tracey et al.

48. Burton A, Muller J, Tu S, Padilla-Longoria P, Guccione E, Torres-Padilla identity and self-renewal in pediatric acute megakaryoblastic leukemia. ME. Single-cell profiling of epigenetic modifiers identifies PRDM14 as Cancer Cell 2017;31:452–65. an inducer of cell fate in the mammalian embryo. Cell Rep 2013;5: 50. Salaverria I, Akasaka T, Gesk S, Szczepanowski M, Burkhardt B, Harder L, 687–701. et al. The CBFA2T3/ACSF3 locus is recurrently involved in IGH chromo- 49. Thirant C, Ignacimouttou C, Lopez CK, Diop M, Le Mou€el L, Thiollier C, somal translocation t(14;16)(q32;q24) in pediatric B-cell lymphoma with et al. ETO2-GLIS2 hijacks transcriptional complexes to drive cellular germinal center phenotype. Genes Chromosomes Cancer 2012;51:338–43.

OF12 Mol Cancer Res; 2019 Molecular Cancer Research

The Pluripotency Regulator PRDM14 Requires Hematopoietic Regulator CBFA2T3 to Initiate Leukemia in Mice

Lauren J. Tracey, Travis Brooke-Bisschop, Pascal W.T.C. Jansen, et al.

Mol Cancer Res Published OnlineFirst April 23, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-18-1327

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2019/04/23/1541-7786.MCR-18-1327.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2019/06/03/1541-7786.MCR-18-1327. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.