www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 36 (2007) 392–407

A novel 165-kDa Golgin protein induced by brain ischemia and phosphorylated by Akt protects against apoptosis ⁎ Ruiqiong Ran,a, Ruiqin Pan,b Aigang Lu,a Huichun Xu,a Ryan R. Davis,c and Frank R. Sharpa aM.I.N.D. Institute and Department of Neurology, University of California at Davis Medical Center, University of California at Davis, Sacramento, CA 95817, USA bDepartment of Biochemistry and Molecular Medicine, University of California at Davis Medical Center, University of California at Davis, Sacramento, CA 95817, USA cDepartment of Pathology, University of California at Davis Medical Center, University of California at Davis, Sacramento, CA 95817, USA Received 25 January 2007; revised 18 July 2007; accepted 30 July 2007 Available online 9 August 2007

A cDNA encoding a novel protein was cloned from ischemic rat brain caspase-9 and then caspase-3 to produce apoptosis via the intrinsic and found to be homologous to testis Mea-2 Golgi-associated protein pathway (Adams and Cory, 1998; Ferri and Kroemer, 2001; (Golga3). The sequence predicted a 165-kDa protein, and in vitro Nicholson, 2000). Plasma membrane, death-receptor-initiated apop- translated protein exhibited a molecular mass of 165–170 kDa. tosis is mediated by caspase-8 via the extrinsic pathway (Nicholson, Because brain ischemia induced the mRNA, and the protein localized 2000). The endoplasmic reticulum (ER) senses local stress through to the Golgi apparatus, this protein was designated Ischemia-Inducible glucose-regulated proteins (GRPs) that detect the unfolded protein Golgin Protein 165 (IIGP165). In HeLa cells, serum and glucose response as well as proteins and channels that detect ER calcium deprivation-induced caspase-dependent cleavage of the IIGP165 protein, after which the IIGP165 fragments translocated to the levels. These ER stress responses can signal to caspase-12, an ER nucleus. The C-terminus of IIGP165, which contains a LXXLL motif, resident caspase, JNK and other signaling molecules to promote cell appears to function as a transcriptional co-regulator. Akt co-localizes apoptosis (Ferri and Kroemer, 2001; Nakagawa et al., 2000). with IIGP165 protein in the Golgi in vivo, and phosphorylates IIGP165 The Golgi apparatus is also involved in apoptosis. The Golgi on serine residues 345 and 134. Though transfection of IIGP165 cDNA apparatus can be actively disassembled as a part of mitosis and cellular alone does not protect HeLa cells from serum deprivation or Brefeldin- apoptosis as well as signal events that initiate as well as block A-triggered cell death, co-transfection of both Akt and IIGP165 cDNA apoptosis (Bartke et al., 2004; Machamer, 2003). Golgi membranes/ or combined IIGP165-transfection with PDGF treatment significantly proteins can be associated with caspase-2 and other caspases (Mancini protects HeLa cells better than either treatment alone. These data show et al., 2000; Shikama et al., 2002); can be associated with many death that Akt phosphorylation of IIGP165 protects against apoptotic cell receptors normally found at the plasma membrane that mediate the death, and add to evidence that the Golgi apparatus also plays a role in regulating apoptosis. extrinsic pathway of apoptosis; and are associated with GD3 synthase Published by Elsevier Inc. that converts ceramide to GD3 (De Maria et al., 1997) that can shuttle to mitochondria and induce mitochondrial membrane permeabiliza- Keywords: Brain ischemia; IIGP165; Golgi; Apoptosis; Akt; Phosphorylation; tion and apoptosis (Rippo et al., 2000). In addition, proteins including Golgi apparatus; Mea-2; Golgi associated protein BRUCE, Akt, Fas, Bid, GSK-3, GRASP65, ataxin-1, AIGP1, PI3K, PS-1, PKCδ and others are localized to the Golgi and are directly or indirectly involved in apoptosis (Aoki et al., 2002; Bartke et al., 2004; Introduction Bennett et al., 1998; Brune et al., 2003, 1999; Chen and Gao, 2002; Cockcroft, 1999; De Maria et al., 1997; Hauser et al., 1998; Hu et al., The role of organelles other than the mitochondria in programmed 2005; Huynh et al., 2003; Kajimoto et al., 2004; Kohyama-Koganeya cell death is being increasingly recognized, particularly for specific et al., 2004; Lane et al., 2002; Lotz et al., 2004; Nicholson, 2000; types of apoptotic stimuli. Respiratory chain inhibitors, toxins, Nozawa et al., 2002; Renshaw et al., 2004; Terro et al., 2002; Wang et chemotherapeutic agents and others stimulate release of cytochrome c al., 2004). and other pro-apoptotic molecules from mitochondria that activate Thus the Golgi, either alone or in concert with the ER, may play a role in cellular apoptosis (Jazwinski and Conzelmann, 2002). Recent ⁎ Corresponding author. M.I.N.D. Institute and Department of Neurology, studies in the brain, heart and other organs have implicated various University of California at Davis Medical Center, 2805 50th Street – Room modes of cell death including apoptosis and autophagic programmed 2417, Sacramento, CA 95817, USA. Fax: +1 916 703 0369. cell death (Bursch et al., 2000; Hu et al., 1999; Huang and Strasser, E-mail address: [email protected] (R. Ran). 2000; Jugdutt and Idikio, 2005; Nozawa et al., 2002). Partly because Available online on ScienceDirect (www.sciencedirect.com). of the failure of treatments to improve ischemic cell death outcomes in

1044-7431/$ - see front matter. Published by Elsevier Inc. doi:10.1016/j.mcn.2007.07.014 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 393 human brain (Green, 2004; Lipton, 1999), the search continues for contribute to cell death whereas others prevent it (Koistinaho and molecular targets to treat stroke. Studies of gene expression suggest Hokfelt, 1997; Lu et al., 2003; Soriano et al., 2000). Thus, we have that some molecular pathways induced following ischemia can searched for molecules that might provide unique insights into the

Fig. 1. Amino acid sequence of IIGP165. (A) Homology between IIGP165 and Mea-2. Amino acids of IIGP165 and Mea-2 are compared using Gap alignment. IIGP165 and Mea-2 demonstrate 85% sequence identity. The non-identical amino acids (15%) are underlined. (B) Sequence and structural analysis of IIGP165. Amino acid sequence of IIGP165 derived from the cDNA sequence. The conserved functional motifs are underlined and numbered. Numbers 1, 19, 29, and 34 are putative small ubiquitin-like protein (SUMO-1) conjugation sites. Numbers 2, 3 and 10 are extracellular signal-regulated kinase (ERK) phosphorylation sites. Numbers 5, 13, 25, and 28 are nuclear targeting signals. Numbers 6 and 12 are Akt phosphorylation sites. Numbers 7 and 8 are cAMP-dependent protein kinase phosphorylation sites. Numbers 11, 15, 21, 22, 23, 24, and 35 are calmodulin-dependent protein kinase phosphorylation sites. Number 16 is a Trans-Golgi network localization signal. Numbers 18 and 30 are the transcription factor activation domains. Number 33 is the co-activator LXXLL nuclear receptor/ transcription factor recognition motif. 394 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407

Fig. 1 (continued ). mechanisms of ischemic cell injury (Lu et al., 2003; Narasimhan et al., phosphorylation of FKHR, a transcriptional factor, blocks Fas ligand 1996; Sharp et al., 2004). During these studies, we found the novel gene expression and subsequently inhibits cell death (Brunet et al., gene in this study that is ischemia-inducible and that localizes to the 1999). Evidence is presented in this study that phosphorylation of Golgi apparatus, an organelle not often associated with ischemic IIGP165 by Akt, both of which localize to the Golgi apparatus, injury or programmed cell death (Hayashi and Abe, 2004; Martin et synergistically protects against cell death. al., 2000; Verhulst et al., 2002). The identified gene was cloned, sequenced and found to contain Results a typical Golgi targeting signal. This protein was designated IIGP165 (Ischemia-Inducible Golgin Protein 165) based upon its Identification of IIGP165, a novel ischemia-inducible gene predicted 165-kDa molecular weight and its Golgi localization in cells. Amino acid sequence analysis revealed that IIGP165 5′RACE yielded several products, the most frequent and longest of contained multiple functional domains, with typical Akt which was sequenced. The sequence obtained had no overall ho- (RXRXXS/T), potential SGK (K/RXRXXS/T), cAMP (R-R/K-X- mology to any known gene, but was similar to members of the Golgin S/T), cdc2 (S/T-P-X-basic amino acid), calmodulin-dependent family of proteins (GenBank accession number XM_194235). protein kinase (R-X-X-S/T), and extracellular signal-regulated GenBank database searches revealed that the sequence was most kinases (ERKs, X-S/T-Pro-X) phosphorylation motifs. We focused highly homologous to mouse Mea-2 Golgi-associated protein (85% on Akt phosphorylation of this protein because Akt plays a central homology, Fig. 1A). The deduced amino acid sequence revealed that role in promoting the survival of a wide range of cell types (Datta this protein had a predicted molecular weight of 165 kDa and et al., 1997; Dudek et al., 1997; Kennedy et al., 1997). Akt directly contained a typical trans-Golgi network localization signal (YQRL). phosphorylates pro-apoptotic proteins such as Bad and caspase-9 to Therefore, we designated the protein IIGP165 (Ischemia-Inducible suppress apoptosis (Cardone et al., 1998; Datta et al., 1997). Akt Golgin Protein, molecular weight of 165 kDa). Protein database R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 395 searches showed that IIGP165 has a nuclear localization signal promoter, and performed in vitro protein translation using the TNT (RRKIKR, and KRHRER), and SUMO-1 conjugating motif coupled transcription/translation kit. The translated, 35S-labeled (ψKXEX; Fig. 1B). The IIGP165 amino acid sequence also revealed protein was loaded onto 6% SDS–PAGE. When compared with two sites that conform to the consensus Akt phosphorylation sites standard molecular weight markers, the protein migrated in the region (RHRERS, RSRRDS; Fig. 1B), suggesting that IIGP165 might be a of 165–170 kDa that agrees with the predicted molecular weight substrate of Akt. In addition, IIGP165 also contains other potential (Fig. 2C). To further substantiate that this cDNA expresses protein in phosphorylation motifs including those for cAMP (R-R/K-X-S/T), mammalian cells, the GFP/IIGP165 fusion construct was transfected SGK (K/RXRXXS/T), cdc2 (S/T-P-X-basic amino acid), calmodulin- into HeLa cells. After a 24-h transfection, the extracted proteins from dependent protein kinase (R-X-X-S/T) and extracellular signal- cell lysates were Western blotted with an anti-GFP antibody. The GFP– regulated kinases (ERKs, X-S/T-Pro-X). IIGP165 fusion protein migrated at about 200 kDa, matching the Notably, the C-terminus of IIGP165 contains a conserved LXXLL predicted molecular weight (Fig. 2D). domain that has been shown to be essential for transcriptional co- activators that interact with nuclear receptors (Darimont et al., 1998; Localization of IIGP165 Nolte et al., 1998; Torchia et al., 1997). Moreover, the C-terminus of IIGP165 contains a glutamine-rich (N25%) domain with few charged Analysis of the IIGP165 amino acid sequence indicated that it amino acids, which is a typical feature of the trans-activation domain contains a Golgi targeting sequence and a nuclear localization of transcriptional factors. The various structural features, in com- signal. To determine whether IIGP165 localizes to the Golgi, the bination with its nuclear localization signals, suggest that IIGP165 subcellular localization of IIGP165 was examined using confocal could have several functions. microscopy. HeLa cells transfected with GFP–IIGP165 and a The presence of IIGP165 mRNA in tissues was confirmed by fluorescent Golgi marker showed that IIGP165 was co-localized Northern blot and RT–PCR. The gene was expressed in brain as two with the Golgi apparatus (Fig. 3A). This result indicates that the mRNA species of 3.5 kb and 6.2 kb, the latter transcript being the most bulk of the GFP–IIGP165 fusion protein is in the Golgi and not abundant (Fig. 2A). Both Northern blots (Fig. 2A) and RT–PCR in the nucleus (Fig. 3B), in spite of four putative nuclear (Fig. 2B) confirmed that the IIGP165 mRNA increased at least 3-fold localization signals in IIGP165. To examine this in more detail, following ischemia. The transcript revealed a long open reading frame we determined whether truncated forms of IIGP165 target the that codes for a putative protein of 1447 amino acid residues with a nucleus (Hicks and Machamer, 2002; Maag et al., 2003). calculated mass of 165 kDa (Fig. 1B). To confirm that the IIGP165 Therefore, NH2- and COOH-terminal deletion mutants containing cDNA can translate into protein and examine the molecular weight, we the nuclear localizing signals (NLS), but lacking the Golgi subcloned IIGP165 cDNA into pcDNA3–HisA bearing the T7 targeting sequence, were constructed. These truncated IIGP165

Fig. 2. IIGP165 mRNA and protein expression. (A) Northern blot: The blot was prepared using the Northern Max kit (Ambion). The IIGP165 probe was prepared by incorporating a biotin-modified nucleotide with BrightStar Psoralen Biotin labeling. 10 ng/ml of probe was used for non-isotopic hybridizations. Probe was hybridized overnight at 68 °C and blots washed according to the manufacturer's protocol. Non-isotopic probe was detected using the BrightStar BioDetect Kit. 20 μg total RNAwas loaded in each lane. Size markers (in kb) are indicated on the left. β-Actin mRNA was used as the loading control. (B) RT–PCR: TITANIUM one-step RT–PCR was performed using 1 μg of total RNA from normal rat brain cortex or cortex adjacent to an infarction 24 h after ischemia. A 500-bp IIGP165 mRNA fragment was reverse- transcribed at 50 °C for 60 min and amplified using 25 PCR cycles. Primers specific for the IIGP165 message are described in Experimental methods. For a normalization control, a 380-bp β-actin fragment was amplified using 20 PCR cycles. RT–PCR products were analyzed on an agarose/ethidium bromide-stained gel. (C) In vitro translated IIGP165 proteins. IIGP165 cDNA was inserted into a T7 promoter driven plasmid. IIGP165 plasmid DNA was transcribed/translated in a 25 μl reaction using T7 polymerase and 10 μCi 35S-labeled methionine at 30 °C for 90 min. 1 μl of each reaction was assessed on 6% SDS–PAGE and exposed to film overnight. (D) IIGP165 expression in HeLa cells. HeLa cells were transiently transfected with the GFP-tagged IIGP165 cDNA. After a 24-h transfection, the cell lysates were prepared and analyzed by 6% SDS–PAGE, and then detected with an anti-GFP antibody. 396 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407

Fig. 3. IIGP165 localizes to the Golgi and IIGP165 fragments translocate to the nucleus. (A) IIGP165 is localized to the Golgi apparatus. HeLa cells were transiently transfected with GFP–IIGP165 and GFP–IIGP165-truncated mutants containing the nuclear localization sequence, pDsRed2-Nuc. The localization of IIGP165 was examined by fluorescence microscope in HeLa cells that were co-stained with Golgi marker BODIPY TR-C5-Ceramide. The pseudocolor (yellow) of IIGP165 (green) and the Golgi marker (red) demonstrated overlap between the IIGP165 and the Golgi marker. (B) IIGP165 is located outside the nucleus. HeLa cells were co-transfected with IIGP165, pDsRed2-Nuc, and fixed. The images, obtained using fluorescence microscope, showed GFP–IIGP165 (green) is outside the red stained nucleus with no overlap. (C and D) Nuclear localization sequences in the N-terminal and C-terminal of IIGP165 mediate import of IIGP165-truncated fragments into the nucleus. HeLa cells were transfected with GFP/IIGP165N (amino acids 1–380, middle panel in C) or GFP/IIGP165C (amino acids 807–1127, middle panel in D) plasmids and pDsRed2-Nuc (left panels in C and D). At 24 h post-transfection, cells were fixed and visualized using fluorescence microscope. Both of the fragments, including IIGP165N (C) and IIGP165C (D) co-localized with the nucleus (overlay yellow-orange color, right panel in C and D). fragments were in frame inserted into the C-terminal of GFP and serum and glucose free medium for 36 h. The protein translocated the localization examined in transfected cells. Both of the from the Golgi apparatus (control, Fig. 4B) to the nucleus (serum/ truncated IIGP165 fragments (GFP/IIGP165, amino acids 1–380, glucose-deprived) (Fig. 4C). N terminal; and GFP/IIGP165 amino acids 1018–1447, C- terminal), both containing the nuclear localization signals, were Akt phosphorylates IIGP165 localized to the nucleus (Figs. 3C, D). Previous studies have shown that Akt localized in the Golgi com- Cleavage products of IIGP165 translocated to the nucleus plex phosphorylated endothelial nitric oxide synthase and regulated its enzyme activity (Fulton et al., 2004, 2002; Haynes et al., 2000; Because of growing evidence for fragmentation of the Golgi Morales-Ruiz et al., 2001; Papapetropoulos et al., 2004; Sessa et al., complex during apoptosis (Mancini et al., 2000; Nozawa et al., 2002, 1995). Other proteins are also phosphorylated in the Golgi, with two 2004), we determined whether IIGP165 can be cleaved during Golgin family proteins being phosphorylated by mixed lineage kinase apoptosis. HeLa cells were transfected with the GFP/IIGP165 plasmid 3(MLK3)andCdc2–cyclin B (Chen and Gao, 2002; Lowe et al., for 24 h and then cultured in serum and glucose-free DMEM for the 2000). Since two potential Akt phosphorylation sites (RHRERS, indicated times. Immunoblots of cell lysates of control and apoptotic RSRRDS) were found in the N-terminus of IIGP165 (Fig. 1B), we HeLa cells were performed using the anti-GFP antibody that determined whether Akt phosphorylates IIGP165. To test this, HeLa recognized the GFP–IIGP165 fusion protein. A single 200-kDa cells were co-transfected with DsRed/AktCA (Akt constitutively fusion protein was recognized in untreated cells, whereas GFP– active) and GFP–IIGP165. The two proteins, when examined using IIGP165 was cleaved to generate at least one ~66-kDa fragment (Fig. confocal microscopy at 24 h post-transfection, showed significant co- 4A, lanes 2–5). Since the IIGP165 construct was fused to the C- localization (Fig. 5A). To further confirm Akt interaction with IIGP165 terminal of GFP, the ~66-kDa fragment detected could be the in living cells, we carried out a bimolecular fluorescence complemen- combination of GFP (~30 kDa) and a 36-kDa fragment from the N- tation assay (BiFC) to detect protein interactions in living cells. This terminus of IIGP165. This would predict a cleavage site corresponding approach is based on cells simultaneously expressing two proteins to amino acids ~348–351 within the IIGP165 sequence. Note that the fusedtocomplementaryfragmentsof yellow fluorescence protein serum deprivation also led to cleavage of the caspase substrate PARP (YN: yellow fluorescence protein N-terminal; and YC: yellow (Fig. 4A, lanes 2–5). To determine whether the ischemia-mediated fluorescence protein C-terminal of yellow fluorescence protein YFP) proteolysis of IIGP165 is caspase-dependent, HeLa cells were treated that will not produce a fluorescent signal if they do not interact. Only if with a pan-caspase inhibitor (150 μM zVAD-fmk). This significantly the fused proteins physically interact and bring the complementary decreased proteolysis of IIGP165 and of PARP, indicating caspase- fragments of YFP into proximity do they reconstitute an active YFP so mediated cleavage of IIGP165 and PARP (Fig. 4A, lane 6). To that it will fluoresce (Hu et al., 2002; Hu and Kerppola, 2003; Mancini determine whether the distribution of IIGP165 is changed during et al., 2000). Therefore, we fused the Akt cDNA and IIGP165 cDNA apoptosis, GFP–IIGP165-transfected HeLa cells were cultured in to the N-terminal fragment of YFP (YN1–155aminoacids)andtothe R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 397

Fig. 4. IIGP165 protein is cleaved and translocates to the nucleus during serum and glucose deprivation-induced apoptosis. (A) IIGP165 is cleaved during apoptosis. HeLa cells were cultured in the presence or absence of serum and glucose. They were transiently transfected with GFP–IIGP165. Some cells were transiently transfected with AktCA (constitutively active) or treated with PDGF (PI3/Akt activator), Ly294002 (PI3K inhibitor), or cell-permeable pan-caspase inhibitor Z-VAD-fmk. Cell lysates were resolved by 6% SDS–PAGE and immunoblotted with anti-GFP, anti-PARP, or anti-β-actin antibodies. IIGP165 cleavage is shown in the top panel, PARP cleavage in the middle panel, and β-actin loading control in the bottom panel. Lane 1, normal culture conditions; Lane 2, serum and glucose depletion for 24 h; Lane 3, transfection with the active form of Akt; Lane 4, PDGF treatment; Lane 5, LY294002 treatment; Lane 6, caspase inhibitor treatment. (B) IIGP165 normally resides outside the nucleus. HeLa cells were co-transfected GFP–IIGP165 (green) and nuclear marker pDsRed2-Nuc (red). Cells were fixed and imaged 16 h later. Note the GFP–IIGP165 is in the cytoplasm and does not overlap with the nucleus (B, right panel). (C) IIGP165 translocates to the nucleus during apoptosis. GFP–IIGP165- (green) and pDsRed2-Nuc- (red) transfected HeLa cells were treated with serum and glucose deprivation for 36 h (serum+glucose-deprived) and imaged. Note that the GFP–IIGP165 signal (green) and the nuclear signal (red) overlap (right panel).

C-terminal fragment of YFP (YC156–238), respectively. The resultant phosphorylation (Fig. 5F), other minor phosphorylation sites may constructs (YN/Akt, YC/IIGP165) were transfected into HeLa cells. exist, possibly including residues 828–836 that contained an atypical Expression of either YN/Akt or YC/IIGP165 alone did not produce Akt phosphorylation site (KKRLDS). detectable fluorescence (Fig. 5B, panels 3 and 4) but did show evidence To determine whether phosphorylation of IIGP165 can affect its of fluorescence/interaction when expressed together in vivo,andthis cleavage by serum and glucose deprivation in cells, we analyzed the interaction occurred in the Golgi (Fig. 5B, panel 5). cleavage of the IIGP165 mutants that cannot be phosphorylated To demonstrate that Akt phosphorylates IIGP165 in vivo,HeLa during serum and glucose deprivation-mediated apoptosis (Fig. 5F). cells were transfected with GFP–IIGP165 and AktCA (constitutive The data show that the IIGP165 mutants are cleaved more with serum active form of Akt) constructs. The transfected cells were treated with and glucose deprivation-induced apoptosis with PDGF (PI3K–Akt PDGF (PI3K–Akt pathway activator) or with the PI3K–Akt inhibitor, activation) treatment compared to the IIGP165WT (Fig. 5G). Thus LY294002. The GFP–IIGP165 fusion protein was immunoprecipi- Akt phosphorylation of IIGP165 decreases but does not eliminate tated with the anti-GFP antibody. Phosphorylation was detected using ischemia induced IIGP165 cleavage (Fig. 5G). an anti-phospho-Akt substrate antibody (Fig. 5C). Since the control experiment showed that Akt did not phosphorylate GFP (Fig. 5D), the Phosphorylation of IIGP165 and apoptosis Akt phosphorylation of the GFP–IIGP165 fusion protein (Fig. 5C) suggested that Akt phosphorylated IIGP165. Akt phosphorylation of Bad and caspase-9 abrogates their pro- To further confirm Akt phosphorylation of IIGP165, we examined apoptotic properties (Datta et al., 1997; Cardone et al., 1998; Datta the two consensus sites at serine 134 and 345. To determine which of et al., 2000; Zha et al., 1996). The discovery that IIGP165 is a substrate these residues can be phosphorylated, we generated mutant IIGP165 of Akt led us to speculate that IIGP165 may affect cell survival. To cDNAs in which S134 and S345, either singly or in combination, study this, we first performed a cell survival assay in serum deprived were converted to alanines to prevent phosphorylation of IIGP165 at PC12 cells. Overexpression of IIGP165 alone had little effect on these sites. These mutants were transiently transfected into HeLa cells. apoptosisinthissystem(Fig. 6A, lane 3), and even constitutively The phosphorylation of IIGP165 was detected as above. Mutation of active Akt alone only increased cell survival from 5% to 15% S134 and S345 resulted, respectively, in a 10% and a 90% decrease in ( pb0.05; Fig. 6A, lane 4) under these fairly stringent survival the level of phosphorylation compared with wild-type IIGP165 conditions (Fig. 6A). However, co-transfection of both IIGP165 and (Fig. 5F). These data suggest that residue S345 is the major site of Akt AktCA increased cell survival from 5% (Fig. 6A, lanes 2 and 3) to 30% phosphorylation, because S134 accounts for only 10% of the total (6 fold improvement in survival, pb0.01; Fig. 6A, lane 5). In addition, phosphorylation and because mutation of S345 almost completely co-treatment with IIGP165 and PDGF (which activates PI3K/Akt abolishes phosphorylation (Fig. 5F). These results indicate that Akt pathway) improved cell survival to 33% ( pb0.01; Fig. 6A, lane 8) can directly phosphorylate IIGP165 on the Ser 345 and 134 residues. compared to lesser survival with PDGF alone (17%, Fig. 6A, lane 6) or As the combination of all mutations did not result in a complete loss of PDGF with transfection with IIGP165 antisense (10%, Fig. 6A, lane 7). 398 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407

Fig. 5. IIGP165–Akt interaction and Akt phosphorylation of IIGP165 in vivo. (A) IIGP165 co-localizes with Akt. HeLa cells were co-transfected with Red/Akt and GFP/IIGP165 (green). Note overlap in right panel (yellow). (B) IIGP165 interaction with Akt in the Golgi (protein complementary assay). 1, HeLa cells were transfected with YN.Flag.Akt construct, then immunostained with anti-Flag antibody and FITC-conjugated second antibody. 2, HeLa cells were transfected with YC.HA.IIGP165 construct, then immunostained with anti-HA antibody and FITC-conjugated second antibody. 3, YN.Flag.Akt transfection alone. 4, YC.HA. IIGP165 transfection alone. 5, YN.Flag.Akt and YC.HA.IIGP165 co-expression. All fluorescence images of HeLa cells in each panel were acquired 24 h after transfection. (C) IIGP165 phosphorylation by Akt and the PI3K-dependent pathway. HeLa cells were transfected with GFP–IIGP165 plasmid. After a 24-h transfection, cells were treated with PDGF (PI3/Akt activator), serum and glucose deprivation, the PI3K inhibitor LY294002, the constitutively active construct AktCA, or CIP (phosphatase) at the indicated concentrations. IIGP165 proteins were immunoprecipitated with anti-GFP antibody, and the immunoprecipitated proteins resolved by 6% SDS–PAGE and transferred to a membrane. The membrane was immunoblotted with a specific anti-Akt substrate antibody and anti-GFP antibody. The upper panel represents IIGP165 phosphorylated by Akt and the lower panel represents total GFP–IIGP165 protein. Lane 1, Normal culture conditions; Lane 2, Serum and glucose deprivation for 16 h; Lane 3, PDGF treatment; Lane 4, PDGF plus PI3K inhibitor treatment; Lane 5, constitutively active Akt transfection; Lane 6, CIP (a phosphatase, dephosphorylation) treatment. (D) GFP-transfected HeLa cells were used as a control for the experiments shown in panel C. Note the absence of signal for the Akt substrate antibody (i.e. GFP was not phosphorylated by Akt). (E) Schematic representation of mutations introduced into IIGP165 at the two putative Akt phosphorylation sites, S134 and S345. WT indicates wild-type IIGP165; S134A indicates a serine to alanine mutation at amino acids 134; and S345A indicates a serine to alanine mutation at amino acids 345. (F) In vivo phosphorylation of IIGP165 mutants. HeLa cells were transfected with the IIGP165WTand the mutants (see panel E) in the absence of PDGF (leftmost lane) or in the presence of PDGF (four right lanes). Phosphorylation of IIGP165 mutants (the upper band) was detected as described above. Western blotting (with GFP antibody) of the same membranes confirmed equal expression for IIGP165 (the lower band) across all of the lanes. Significant phosphorylation is observed for the WT and S134A mutant in the presence of PDGF. (G) The IIGP165 non-phosphorylated mutant is more sensitive to cleavage during apoptosis. HeLa cells were transiently transfected with the GFP–IIGP165 and GFP–IIGP165/S134A/S345A mutant and/ or in the presence or absence of serum and PDGF. 36 h later, cell lysates were immunoblotted with anti-GFP. Lane 1, normal culture conditions; Lane 2, IIGP165WT, serum and glucose depletion for 36 h in the presence of PDGF; Lane 3, IIGP165 mutant (GFP–IIGP165/S134A/S345A) following serum and glucose depletion in the presence of PDGF. The upper band represents uncleaved GFP–IIGP165WT or uncleaved mutant GFP–IIGP165/S134A/S345A, and the lower band indicates the cleavage product of the WT or S134A/S345A mutant.

TheIIGP165antisense(seeFig. 6C for design) effectively suppressed lane 4) or the combination of IIGP165 and PDGF (Fig. 6B, lane 5). In endogenous IIGP165 expression (Fig. 6D), and promoted cell death contrast, Brefeldin-A (BFA) produced HeLa cell death (cell survival even in the presence of PDGF (Fig. 6A, lane 7). 10%, Fig. 6B, lane 6) – that was not significantly improved by To further examine the protective properties of IIGP165, cells IIGP165 alone (Fig. 6B, lane 7) or by PDGF alone (Fig. 6B, lane 8), were treated with CH11 to produce Fas-related apoptosis (Fig. 6B, but was significantly improved by the combination of IIGP165 and lanes 2–5) or with Brefeldin-A, a Golgi disrupting and apoptosis- PDGF (cell survival improved from 10% to 40%, pb0.01; Fig. 6B, inducing drug (Chennathukuzhi et al., 2001). CH11 produced lane 9). These results show that the combination of IIGP165 and Akt significant HeLa cell death (Fig. 6B, lane 2) that was not statistically can protect against Brefeldin-A-induced apoptosis, but does not improved by IIGP165 alone (Fig. 6B, lane 3), PDGF alone (Fig. 6B, protect against Fas-mediated apoptosis. R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 399

Fig. 6. Akt-mediated phosphorylation of IIGP165 decreases apoptosis produced by serum deprivation and Brefeldin-A (BFA), but does not protect from Fas (CH11)-mediated cell death. (A) PC12 cells were co-transfected with β-gal and the other indicated expression vectors. After a 24-h transfection, cells were untreated or were stimulated as indicated. 24 h later, cells were harvested and processed for β-gal assays that were used to indicate the relative cell survival. Results represent the percentage of the control. Column 1 – Control; Column 2 – serum and glucose deprivation; Column 3 – IIGP165 transfection; Column 4 – constitutively active Akt transfection; Column 5 – IIGP165 and constitutively active Akt co-transfection; Column 6 – PDGF treatment; Column 7 – PDGF treatment plus IIGP165 anti-sense transfection; Column 8 – PDGF treatment plus IIGP165 transfection. ⁎pb0.05, column 4 compared to columns 3 and 2; ⁎⁎pb0.01, column 5 compared to columns 2, 3 and 4; ⁎⁎pb0.01, column 8 compared to columns 6 and 7. (B) HeLa cells were co-transfected with β-gal and the other indicated expression vectors. After a 24-h transfection, cells were treated as indicated. 24 h later, cells were harvested and processed for β-gal assays that were used to indicate relative cell survival. Results represent the percentage of the control. Column 1 – Control with IIGP165; Column 2 – CH11 antibody (Fas-mediated cell death) treatment; Column 3 – CH11 antibody plus IIGP165-transfected cells; Column 4 – CH11 plus PDGF co-treatment; Column 5 – CH11 antibody and PDGF co- treatment of IIGP165-transfected cells; Column 6 – Brefeldin-A (BFA) plus empty vector control; Column 7 – BFA treatment of IIGP165-transfected cells; Column 8 – BFA and PDGF co-treatment of cells; Column 9 – BFA and PDGF co-treatment of IIGP165-transfected cells. ⁎pb0.01, column 9 compared to columns 6, 7 and 8. (C) Structure of the antisense directed against the IIGP165 gene. The target site for antisense inhibition is a 280-bp oligonucleotide that resides within the promoter (−82 bp) and continues through the translation start codon (ATG) to +198 bp. (D) Endogenous IIGP165 mRNA levels were reduced after antisense transfection. HeLa cells were transfected with IIGP165 antisense construct. RNA was prepared 48 h later and semi-quantitative RT–PCR was performed. Amplification of the RNA from the β-Actin gene served as the control (lower bands). Lane 1: 900 ng of pcDNA3; Lane 2: 100 ng of pcDNA3/IIGP165 antisense; Lane 3: 300 ng of pcDNA3/IIGP165 antisense; Lane 4: 900 ng of pcDNA3/IIGP165 antisense. Increasing concentrations of IIGP165 antisense decreased IIGP165 mRNA. (E) Phosphorylation on Ser345 of IIGP165 decreased serum withdrawal-induced apoptosis. H293 cells, transfected to express equal amounts of IIGP165WT and its mutants (see panel F), were incubated in the presence of normal serum either with (+) without (−) with PDGF. Following serum and glucose deprivation, cell viability (y axis) was assessed as described in Experimental methods. Note that the GFP vector in the absence of PDGF pretreatment had the lowest survival. IIGP165WT and the IIGP165/S134A mutant, with PDGF pretreatment, had the best survival. (F) The expression levels of IIGP165 and its mutants. 293 cells were transfected with equal amount of GFP–IIGP165 and its mutant plasmids. 24 h latter, the protein levels of IIGP165 and its mutants were analyzed by immunoblotting with the GFP antibody. Note equal amounts of WT and mutant GFP–IIGP165 proteins in each lane that were used in the experiments in panel E. 400 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407

To address the role of Akt at individual phosphoserine residues of IIGP165 appears to be a co-activator or repressor of transcription IIGP165 in regulating cell survival, we measured the viability of PDGF-treated 293 cells expressing comparable levels of WT IIGP165 The C-terminus of IIGP165 contains a glutamine-rich (N25%) or phosphorylation-defective IIGP165 mutants during glucose region with few charged amino acids, suggesting that this might be a deprivation and serum withdrawal (Fig. 6F). Following PDGF transactivation domain for transcription factors (Fig. 1B). We treatment to activate Akt pathway, the best survival was obtained with therefore determined whether the glutamine-rich region of IIGP165 the WT IIGP165 and mutant S134A (Fig. 6E). In contrast, 25% more possesses trans-activational activity. To test this, the C-terminus of cell death was associated with transfection with the S345 or S134A/ IIGP165 containing the glutamine-rich sequences (amino acids S345 mutants even in the presence of PDGF (Fig. 6E). This indicates 1087 to 1447, IIGP165C) was fused to the pM plasmid that contains that Akt phosphorylation of IIGP165 primarily on serine residue S345 the Gal-4 DNA-binding domain. As a control, the N-terminal (amino improves cell survival. acids 1–380, IIGP165N) was also cloned into the pM plasmid. When

Fig. 7. Trans-activation function of IIGP165. (A) IIGP165 contains a transactivation domain. The amino-terminal (IIGP165N, amino acids 1–380), or carboxy-terminal (IIGP165C, amino acids 380–1447) fragments of IIGP165 were inserted into the pM vector that contained the Gal-4 DNA binding motif. These plasmids were named pM/IIGP165N or pM/IIGP165C. Cos-1 cells were co-transfected with 50 ng of a Gal-4-responsive reporter gene plasmid, 50 ng of β-gal plasmid, 250 ng of pM, and 250 ng of pM/IIGP165N or pM/IIGP165C. Luciferase activity was determined 24 h later. ⁎pb0.05, column 4 compared to columns 1, 2 and 3. (B) Influence of transcription factor-dependent transactivation by IIGP165. Cos-1 cells were transfected with the NF-κB-luc, Nur77-luc, HSF1-Luc or p53-Luc reporter genes with or without p65, Nur77, HSF1, p53 expression plasmids together with or without IIGP165WT. Luciferease activity was determined 24 h after transfection with: 1, NF-κB reporter; 2, Nurr77 reporter; 3, HSF1 reporter; 4, p53 reporter. ⁎pb0.05, column 4 (far right) compared to columns 1, 2 and 3. (C) The effects of IIGP165 overexpression on levels of Hsp70, Hsp32 and PUMA proteins. 293 cells were transiently transfected with GFP–IIGP165WT and GFP–IIGP165N (amino acids 1–380). At 48 h after transfection, cell extracts were immuno-blotted using the indicated antibodies. Lane 1, 100 ng of IIGP165N; Lane 2, 300 ng of IIGP165N; Lane 3, 900 ng of IIGP165N; Lane 4, 100 ng of IIGP165WT; Lane 5, 300 ng of IIGP165WT; Lane 6, 900 ng of IIGP165WT. R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 401 the pM–IIGP165C chimeric construct was co-transfected into Cos-1 Golga3 (Banu et al., 2002; Kondo and Sutou, 1997; Matsukuma et al., cells with a Gal-4 reporter gene, this protein strongly trans-activated 1999; Su et al., 1992). However, IIGP165 and Mea-2 are somewhat a reporter gene containing five Gal-4-binding sites linked to different at the amino acid level (Fig. 1), and the Mea-2 gene is only luciferase (Fig. 7A). In contrast, the control vector (pM alone) and expressed in testis (Banu et al., 2002; Kondo and Sutou, 1997; the pM–IIGP165N chimera did not significantly activate the Matsukuma et al., 1999; Su et al., 1992), whereas the IIGP165 gene transcription of the reporter gene (Fig. 7A). identified here is expressed in mammalian brain and possibly other Transcriptional regulation occurs via protein complexes that organs. assemble on promoter regions of target genes. These complexes contain activators and co-activators of transcription as well as Akt phosphorylation of IIGP165 elements of the basal transcription machinery (Darimont et al., 1998; Lemon and Tjian, 2000; Nolte et al., 1998). Nuclear receptors Since the amino acid sequence of IIGP165 revealed a typical Akt require co-activator binding in order to activate transcription of their phosphorylation motif (RXRXXS/T), we determined whether Akt cognate genes. The LXXLL motif is required for co-activators to phosphorylates IIGP165. Akt is shown to phosphorylate IIGP165 in bind to nuclear receptors (Darimont et al., 1998; Lemon and Tjian, vivo and both proteins are shown to localize to the Golgi. Following 2000; Nolte et al., 1998). Since IIGP165 contains the typical serum deprivation, and after treatment with a PI3K specific inhibitor LXXLL motif, we assessed the ability of IIGP165 to affect nuclear (LY294002), the PI3K/Akt pathway was inhibited, IIGP165 was un- receptor- or transcription factor-mediated activation of their phosphorylated, IIGP165 was cleaved and the cells died. When HeLa respective reporter genes. Therefore, we used four transcription cells were exposed to PDGF or serum, or were transfected with the factor-responsive reporter genes including NF-κBRE (this reporter active Akt construct, Akt was activated and catalyzed the phosphory- has 3 p65 response elements), Nur77RE (this reporter contains four lation of IIGP165. The phosphorylated IIGP165 was resistant to Nur77 nuclear receptor response elements), HspRE (this reporter caspase-mediated cleavage; and co-transfection of IIGP165 and Akt bears three HSF1 response elements), and p53RE (this reporter synergistically inhibited cell death. These results demonstrate that consists of three p53 response elements) to test whether IIGP165 can IIGP165 is a functional substrate of Akt. As IIGP165 is a serine rich modulate gene transcription. These reporter genes drove a firefly protein, and the serum- and glucocorticoid-inducible kinase (SGK) luciferase gene. displays a similar sequence (45–55%) throughout its catalytic domain Cos-1 cells were co-transfected either with full-length IIGP165 with Akt (SGK phosphorylation sequence is K/RXRXXS/T), future or with the N-terminus of IIGP165. The data show that IIGP165WT studies will be required to determine whether SGK also phosphory- significantly enhanced (~2-fold increase) Nur77-, HSF1- and p65- lates IIGP165. mediated reporter gene transcription (Fig. 7B, panels 1, 2, 3). The N- Akt has been localized to the Golgi in previous studies, and terminus of IIGP165 had no effect on reporter gene transcription phosphorylates endothelial nitric oxide synthase (eNOS), another (Fig. 7A). IIGP165 probably does not act as a general transcription Golgi-associated protein. Akt is necessary for the efficient synthesis of co-activator since IIGP165 slight decreased (~30%) p53-mediated nitric oxide (Dreyer et al., 2004; Fulton et al., 2002; Fulton et al., 1999; reporter gene transcription (Fig. 7B, panel 4). Nuszkowski et al., 2001; Sessa et al., 1995). Akt has previously been To further confirm that IIGP165 modulates gene transcription, the shown to play a vital role in promoting the survival of a wide range of effects of over-expressed IIGP165 were examined on the protein cell types (DeBusk et al., 2004; Dudek et al., 1997; Kennedy et al., levels of Hsp70 (HSF1 target), Hsp32 (NF-κB target) and PUMA 1997). Survival factors, such as insulin-like growth factor and (p53 target). At 48 h after IIGP165 transfection, Hsp70, Hsp32 and neurotrophins, bind to their cell surface receptors and trigger activation PUMA protein levels were examined by Western blot in 293 cells of survival kinases, including PI3K (Fruman et al., 1998) and the (Fig. 7C). As levels of IIGP165 WTwere increased, Hsp70 and Hsp32 calmodulin-dependent kinase kinase (Yano et al., 1998). These kinases proteins increased whereas PUMA decreased (Fig. 7C). Actin protein in turn activate the serine/threonine kinase, Akt. Akt phosphorylates levels were similar in both groups (Fig. 7C) and N-terminal IIGP165 and inhibits pro-apoptotic components of the intrinsic cell death (amino acids 1–380), which has no LXXLL motifs, had no effect on machinery present within the cytoplasm such as Bad, 14-3-3, caspase- the levels of these proteins (Fig. 7C). 9andIKKα (Cardone et al., 1998; Datta et al., 1997; del Peso et al., 1997). Akt also phosphorylates nuclear transcriptional factor FKHRL Discussion to block Fas ligand gene expression (Brunet et al., 1999). Thus, IIGP165 joins the list of Akt targets that regulate cell survival. This study has identified and characterized a previously un- Other kinases have also been associated with the Golgi, and this reported, novel gene that was detected during a screen for genes localization can be crucial for function (De Matteis et al., 1993; induced by cerebral ischemia (Lu et al., 2003). Moreover, this novel Lehel et al., 1995). PKCδ and PKCθ normally localize primarily to gene contained a typical Golgi targeting signal and microtubule the Golgi complex. When the C1b domain was deleted from PKCδ binding motif, and GFP–IIGP165 transfection confirmed that it was and PKCθ, both the localization to the Golgi and induction of localized to the Golgi complex. Hence, it is a new member of the apoptosis were abrogated, indicating that PKC apoptotic effect is Golgin family of proteins (Farquhar and Palade, 1998; Machamer, correlated to localization to the Golgi apparatus (Schultz et al., 2003; Marra et al., 2001; Rios and Bornens, 2003). The rat full-length 2003). Lyn, a member of the Src-family kinases, is widely expressed cDNA for IIGP165 encodes a 1447-amino-acid protein that differs in a variety of organs, tissues and cell types including neurons, and from the previously characterized Golgin proteins with similar plays an important role in signal transduction (Tsukita et al., 1991). molecular weights including GCP170, Golgin-160 and GRP-1 Once synthesized, Lyn rapidly associated with the Golgi apparatus sequences with no more than 25% homology (Cha et al., 2004; where it is protected from proteolytic degradation in the Golgi milieu Fritzler et al., 1993; Gonatas et al., 1989; Kim, 2003; Misumi et al., (Tsukita et al., 1991). Cdc42, a member of the Rho family of small 1997). IIGP165 showed the most significant sequence similarity (85% guanosine triphosphatase (GTPase) proteins, regulates multiple cell sequence identity) with Mea-2 (male-enhanced antigen-2), also called functions, including motility, proliferation and apoptosis (Kjoller 402 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 and Hall, 1999; Schmidt and Hall, 2002; Tsukita et al., 1991). Cdc42 resistant, non-cleavable mutant preserved Golgi morphology and activation occurs in the trans-Golgi compartment (Nalbant et al., decreased staurosporine- and anisomycin-induced apoptosis (Kusano 2004). It will be interesting to determine whether other potential et al., 2001). GRASP65 function may be complex since it also binds phosphorylation motifs in IIGP165, including SGK (K/RXRXXS/ Fas and caspase-8 (Wang et al., 2004). The Golgi vesicle transport T), cAMP (R-R/K-X-S/T), cdc2 (S/T-P-X-basic amino acid) and protein p115 is cleaved by caspase-3 at Asp757 during staurosporine calmodulin-dependent protein kinase (R-X-X-S/T), are phosphory- and etoposide induced apoptosis, and again a non-cleavable mutant lated by Golgi-localized kinases. Indeed, cdc2 is localized to the delayed Golgi disassembly during apoptosis (Chiu et al., 2002). In this Golgi and is required for Golgi fragmentation during mitosis (Lowe latter study, overexpression of the C-terminal caspase cleavage frag- et al., 1998). CaMKK phosphorylates and activates Akt – probably ment of p115 localized to the nucleus, and promoted both Golgi in the Golgi (Yano et al., 1998); and, GSK3 beta likely localizes to disassembly and apoptosis (Chiu et al., 2002). It was postulated that the Golgi (Elyaman et al., 2002). the cleavage fragment of p115 entered the nucleus and promoted The data show that Akt directly phosphorylates IIGP165 mostly on apoptosis (Chiu et al., 2002; Machamer, 2003). A similar situation serine 345, and to a lesser degree on S134. The functional con- could occur with IIGP165 in the present study, since fragments of sequences of this Akt phosphorylation included the finding that IIGP165 do enter the nucleus. Future studies will need to determine expression of IIGP165/S345A, a non-phosphorylatable mutant of whether caspase cleavage of IIGP165 produces fragments that enter IIGP165, increased its cleavage during serum and glucose deprivation- the nucleus and promote apoptosis possibly by modulating pro- or mediated apoptosis, showing that Akt phosphorylation of IIGP165 anti-apoptotic genes. decreased cleavage. More importantly, this Akt non-phosphorylatable Our data showing that IIGP165 modulated apoptosis produced by mutant was unable to inhibit cell death even in the presence of Akt- serum deprivation and Brefeldin-A, but did not affect Fas-mediated activating PDGF treatment as compared to IIGP165WT. Of particular cell death, suggests that the IIGP165 is not a general anti-apoptotic note, however, was that though Akt can protect against apoptosis, the protein. Although the anti-apoptotic mechanism of IIGP165 is un- combination of Akt and Akt-phosphorylated IIGP165 was much more clear, several models can be proposed. Since IIGP165 co-localized effective than either alone at decreasing cell death due to glucose and with eNOS (data not show), IIGP165 may modulate eNOS activity serum deprivation as well as Brefeldin-A-induced apoptosis. Thus the and affect cell apoptosis. Phosphorylation of IIGP165 by calmodulin- described protective properties of Akt in many previous studies might dependent protein kinase and other kinases could modulate Golgi pro- be due, at least in part, to the combined actions of Akt and Akt- apoptotic proteins like Bid or caspase-2. IIGP165 could also modulate phosphorylated IIGP165. cell death by functioning as a co-activator of transcription factors including NF-κB and HSF1. Golgi-associated apoptosis Golgi function in brain ischemia A growing body of evidence indicates that the Golgi apparatus, including intrinsic Golgin proteins and protein traffic through the Ischemia in the brain and other organs is associated with disso- Golgi complex, plays a vital role in cell apoptosis. The data from the ciation of the polyribosomes and disruption of the endoplasmic present study support such a role as well. In our studies, phos- reticulum. This is the structural correlate of the blockade of protein phorylation of IIGP165 by Akt inhibited serum-deprivation induced synthesis that occurs following most types of cell stress (Kaufman, cell death. The mechanism by which the phosphorylated IIGP165 1999; Lipton, 1999; Sharp et al., 2000; White et al., 2000). However, protects against apoptosis is completely unknown, but could include protein synthesis recovers and the rough endoplasmic reticulum re- interacting with local Golgi proteins, interacting with Golgi proteins accumulates in neurons that survive the stresses (Petito and Lapinski, that are processed and traffic through the Golgi, sequestering pro- 1986; Petito and Pulsinelli, 1984). In lethally injured cells, however, apoptotic proteins such as caspase-3 in the cytoplasm or other the Golgi apparatus is transformed with dilation of Golgi cisternae and organelles, or potentially modulating transcription as a co-regulator. vesicles, and large clusters of small vesicles without cisterns (Petito The non-phosphorylatable IIGP165 was cleaved during apoptosis, and Pulsinelli, 1984). Thiamine pyrophosphatase activity, which is a and fragments of IIGP165 were shown to translocate to the nucleus. functional histochemical marker for the transcisternae of the Golgi, is Though the sites of cleavage and functions of cleaved IIGP165 have permanently decreased in neurons destined to die and suggests that not been established in our studies, cleavage is likely caspase- defects in glycosylation of lipids and proteins is associated with mediated, and the fragments might promote apoptosis since IIGP165 ischemic cell death in the brain (Petito and Lapinski, 1986). Ischemia cleavage was associated with cell death. can be thought of as the prototypical ER–Golgi stress (Kaufman, Other Golgin proteins are also cleaved by caspases and provide 1999). However, it is the fragmentation of the Golgi into vacuoles and some insights into the role of the Golgi in apoptosis. For instance, vesicles that best correlates with neuronal cell injury that is likely caspase-2 is located at the Golgi complex, and cleaves Golgin-160 at caused by ischemia-induced lipid peroxidation (Castejon, 1999; Asp 59 and Asp 311 during apoptosis (Mancini et al., 2000; O'Reilly Rafols et al., 1995). et al., 2002). Golgin-160 can be cleaved late by caspase-3 (Machamer, An analysis of the functional domains in the IIGP165 protein 2003). Prevention of Golgin-160 cleavage at the unique caspase-2 site showed that it had features common to co-activators of transcription. delays disintegration of the Golgi complex after delivery of a pro- IIGP165 contains two typical nuclear targeting signals, indicating it apoptotic signal (Mancini et al., 2000). The MLK3 kinase directly can be translocated to nucleus. Our data show that fragments of phosphorylates Golgin-160 in the N-terminal head region between IIGP165 translocate to the nucleus. Moreover, IIGP165 possesses a residues 96 and 259, and MLK3 overexpression enhanced caspase- LXXLL motif that mediates protein–protein interactions in transcrip- dependent cleavage of Golgin-160 at Asp139 and is likely pro- tional regulation. Though it is unclear whether IIGP165 directly binds apoptotic (Cha et al., 2004). GRASP65 (Golgi re-assembly and to DNA as a transcription factor, our preliminary data strongly suggest stacking protein of 65 kDa) is cleaved by caspase-3 at Asp 320, Asp that it acts at least as a co-activator or repressor to modulate gene 375 and Asp 393 at early times during apoptosis, and a caspase- transcription. R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 403

Homology of IIGP165 with Mea-2 These were named GSP3 and GSP4, acted as forward and reverse primers, respectively, for amplification of the full-length cDNA. The GSP3 sequence IIGP165 and Mea-2 are likely to be functionally and structurally was: 5′–CCAGAGTTACTTGTAG–3′. The GSP4 sequence was: 5′– – ′ related because they share 85% sequence identity over the entire AATTCCTTCAACAGTC 3 . The PCR product was purified, inserted into the pCR-TOP vector and DNA sequencing performed. length of the proteins. The Mea-2 gene was originally isolated by Su et al. (1992) andwasnamedforamale-enhancedantigengenethat IIGP165 RNA analysis was expressed in the testis, and was a potential candidate gene responsible for spermatogenesis (Banu et al., 2002; Matsukuma et al., Northern blot analysis was carried out using total RNA from ischemic 1999). Mea-2 localized to the Golgi apparatus of pachytene sper- and control rat brain tissue, and 293 cells transfected with the IIGP165 anti- matocytes and round spermatids. In mutant mice with low levels of sense construct. The cDNA probe (about 700 bp) specific for the 5′ Mea-2 protein, neither spermatids nor spermatozoa were present in translation region was generated by digesting the pCR.TOP/IIGP165 plasmid the homozygous testis. In homozygous testis, the pachytene sper- with the Pst I restriction enzyme. Total RNA extracted from brain tissue using matocytes that failed to express Mea-2 underwent apoptotic the acid guanidinium/phenol/chloroform method was subjected to formalde- degeneration (Banu et al., 2002). Thus, though the function of hyde–agarose (1%) gel electrophoresis and transferred overnight to Bright- IIGP165 in brain is still only speculative, the high homology with Star-Plus Positive Charged Nylon Membranes. Northern blots were performed using a non-isotope system (BrightStar Psoralen–Biotin Northern Mea-2 suggests that IIGP165 might modulate apoptosis of dividing Max, Ambion) according to the user's manual. The standard procedure cells in brain, possibly including newborn neurons and glia and included an overnight upward capillary transfer using 20× SSC, hybridiza- perhaps dividing endothelial and inflammatory cells like microglia. tion in a buffer composed of 50% formamide, 6× SSC, 5× Denhardt's, 0.5% The latter possibility might explain why IIGP165 is ischemia induc- SDS and 0.1 mg /ml Salmon sperm DNA, and washing with 2× SSC/0.1% ible because it might be associated with several types of dividing cells SDS and 0.1× SSC/0.1% SDS. The blot was hybridized overnight at 68 °C that populate ischemic tissue. Further study is needed to identify with IIGP165 or β-actin probes at a concentration of 10 ng/ml hybridization which cells express IIGP165 and to more clearly describe its function solution. Non-isotopic probes were detected using the Bright Star BioDetect in normal tissue and following ischemia. kit. Semi-quantitative RT–PCR was carried out using primers beginning at amino acid number 1201 5′–GACTTGACAGAGCAACAGG–3′, and 5′– TGAGGCTGGGACAGGGC–3′ from amino acid number 1368 (Fig. 1). The Experimental methods amplified fragment was 500 bp in size. The one-step RT–PCR kit was used to amplify DNA from the RNA sample. β-Actin served as the internal control. Reagents, antibodies and cell lines RT–PCR products were analyzed on agarose gels with ethidium bromide staining. All chemicals and other reagents were from Sigma unless otherwise stated, including Protein-A and Protein-G, anti-Flag-, HA and β-actin- Plasmids antibodies, and the 3×FLAG vector. Cell culture media (Dulbecco's modified Eagle's medium), Transfection reagent (Lipofectamine 2000), GFP–IIGP165 and the pcDNA3-his/IIGP165 plasmids were constructed pcDNA3-HisA vector, the β-gal assay kit, and the 293 cell line were from as follows. The IIGP165 full-length cDNA was obtained by PCR am- Invitrogen Inc. Anti-His antibody, anti-phosphorylated Akt substrate anti- plification of pCR-TOP/IIGP165 with primers 5′–CGGGATCCTG GAG- body, and the PI3K inhibitor (LY294002) were from Cell Signal Inc. Anti- CATCAGAAC–3′ and 5′–GGAATTCTCAG–CAGCTCCTCTAG–3 GFP antibody, pEGFP, pDsRed2/Nuc, pM (containing the Gal-4 DNA flanked by BamH I and EcoR I sites, respectively. The PCR products were binding domain) plasmids, the one-step RT–PCR kit and the 5′RACE kit subcloned into Bgl II/EcoR I sites of pEGFPC2. IIGP165 cDNA was also were from Clontech. Reporter luciferase plasmids (NF-κB, p53) and the Gal- cloned into pEGFPN2 and pcDNA3–HisA. To produce pDsRed2/AktCA, 4-luciferase reporter gene were from Stratagene. BODIPY TR-C5-Ceramide the Akt cDNA fragment with Myri-tag encoding constitutively active Akt (Marker for Golgi complex, B-34400), FITC-, and Cy3-conjugated second was isolated from pcDNA3.myri.Flag.Akt using Kpn I and Xba I (blunt Xba antibodies were from Molecular Probes. The PC12, HeLa, 293 and Cos-1 I). The fragment was then inserted in-frame into Kpn1/Sma1-digested cells were from the ATCC. The construct pcDNA3.myri.Flag.Akt was the pDsRed2–C1 vector. To produce the pM/IIGP165 N-terminal deleted mutant kind gift of Dr. JM Woodgett (Ontario Cancer Institute). The TNT coupled in (pM/IIGP165C), the truncated IIGP165 cDNA fragment encoding the C- vitro transcription–translation kit, Luciferase assay kit, Luciferase, β-gal terminal 460 amino acids was cut from the pCR.TOP/IIGP165 plasmid using plasmid, and the Calf intestinal alkaline Phosphatase (CIAP) were from restriction enzyme digestion. The fragment was inserted in frame into the pM Promega. The antibodies to Hsp32 and Hsp70 were from Stressgene. PUMA plasmid that contains the Gal-4 DNA binding domain (DBD). To produce the antibody was from Calbiochem. The Non-isotopic Northern blot kit was from GFP/IIGP165 C-terminal truncated mutant (GFP/IIGP165aa1–380, GFP/ Ambion. The bimolecular fluorescence complementation system for testing IIGP165aa807–1127, a IIGP165 cDNA fragment encoding the N-terminal protein–protein interactions was from Drs. CD Hu and TK Kerppola as 380 amino acids or encoding the C-terminal 320 amino acids) was isolated described in their publication (Hu and Kerppola, 2003). The CH11 antibody from the pCR.TOP/IIGP165 plasmid by restriction enzyme digestion. The and recombinant PDGF protein were from Upstate. fragments were inserted in frame into the pEGFP plasmid. All point mutations were generated using PCR-mutagenesis kit (Stratagene). To Cloning of IIGP165 produce the pcDNA3/IIGP165 anti-sense, the 5′ region (about 280 bp, from −82 to +198) of IIGP165 was inserted into the pcDNA3 vector in the anti- The rat cerebral ischemia study and the microarray data have been sense direction. published (Lu et al., 2003). 5′RACE was performed to identify one EST (GenBank accession number AA875126) that was induced about 5-fold by Expression of IIGP165 ischemia. Briefly, using the EST tag sequence, we designed the gene specific primer 5′TGATGGGGCCCATGCTGCCACAGTACCG–3′ for 5′RACE Protein in vitro translation was performed using the TNT-Quick- using the manufacturer's protocol to obtain the initial IIGP165 cDNA. The coupled transcription/translation kit according to the manufacturer's PCR products were loaded onto a 1% Agarose gel and then purified from the instructions. Briefly, differing amounts of T7-tagged IIGP165 (5 ng, 35 gel. The amplified cDNA fragment was cloned into the pCR.TOP vector and 50 ng, 500 ng), 40 μl TNT reagent, 1 μl S-methionine, and 8 μlH2O were was sequenced. We then designed another set of primers based upon the incubated for 90 min at 30 °C. Different amounts of the product were sequences of the 5′-end RACE fragment and the 3′-end RACE fragment. analyzed by 6% SDS–PAGE. To perform Western blot analysis, HeLa cells 404 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 were transiently transfected with GFP/IIGP165 vector (25 ng, 250 ng, was tested in triplicate for every experiment, and every experiment was 2500 ng in 60-mm dishes). Cell lysates were prepared 24 h later. The repeated at least three times. Cell viability is shown as the relative protein samples were loaded on 6% SDS–PAGE (25 μg/lane). Electro- luciferase activity. phoresis, transfer, and Western blots were performed using standard methods with appropriate antibodies as we have previously described (Ran Fragmentation and translocation of IIGP165 during apoptosis et al., 2004a,b). GFP/IIGP165-transfected HeLa cells were subjected to serum depriva- Confocal microscopy and localization of IIGP165 tion for different times and compared to untreated control cells. Cells were also treated with PDGF or were transfected with the constitutively active HeLa cells were transfected with GFP/IIGP165. 24 h later, the cells Akt construct (AktCA) to activate PI3 kinase. Cells were lysed and were washed, and Golgi apparatus staining was performed using the collected at the indicated times. Western blots were performed with an anti- BODIPY TR ceramide analogue (Molecular Probes) according to the user's GFP antibody. To explore whether IIGP165 or its cleaved fragments manual. Briefly, a 1 mM sphingolipid stock solution was prepared in translocate from the Golgi to other subcellular compartments during chloroform: ethanol (19:1 v/v). 50 μl of the sphingolipid stock solution was apoptosis, GFP/IIGP165 and pDsRed2–Nuc co-transfected HeLa cells were dispensed into a small glass test tube, dried with nitrogen, and then placed grown in serum and glucose free medium for 36 h. The cells were washed under a vacuum for at least 1 h. It was then dissolved in 200 μl of absolute with PBS and then fixed with 2% paraformaldehyde. The cells, which had ethanol. 3.4 mg of defatted BSA was added to 10 ml of serum-free DMEM been grown on coverglasses, were mounted on slides and examined using a in a 50-ml plastic centrifuge tube. The cells grown on glass coverslips were fluorescence microscope. rinsed in DMEM medium. The cells were incubated for 30 min at 4 °C with newly prepared 5 μM staining solution. Cells were rinsed several Transient transfection and reporter gene assay times with ice-cold medium and incubated in fresh medium at 37 °C for an additional 30 min. Cells were washed in fresh medium, mounted on slides Cos-1 cells were seeded into 24-well plates at a density of 105 cells/ and examined using a fluorescence microscope. The 293 cells were co- well. They were co-transfected with 250 ng of pM/IIGP165N, pM/ transfected with GFP/IIGP165, GFP–IIGP165N, GFP–IIGP165C and IIGP165C plasmid or pcDNA3/IIGP165, 50 ng of β-gal construct and pDsRed2/Nuc plasmids. 24 h later, cells were examined using a Zeiss either 50 ng of Gal-4-luciferase plasmid, NF-κB-luciferase, Nur77- LSM-510 confocal microscope as previously described (Ran et al., 2004a). luciferase, HSF1-luciferase, or p53-luciferase. One day after transfection, cells were treated with 200 μl of lysis buffer, and luciferase activity Yellow fluorescence protein (YFP) protein–fragment assayed as previously described (Ran et al., 2004a). complementation assay (PCA) Western blots The cDNAs encoding Akt and IIGP165 were amplified by PCR and subcloned into the YN–Flag (amino acids 1–155) and YC-HA (amino 293 cells were transfected with GFP–IIGP165N and IIGP165WT. After 48 h acids 156–238) fragments of YFP, respectively. These yielded YN/Akt of transfection, cell extracts were immunoblotted with the indicated antibodies. and YC/IIGP165 plasmids (Hu and Kerppola, 2003; Hu et al., 2002). – HeLa cells were transfected alone or co-transfected with YN Flag/Akt Acknowledgments and YC-HA/IIGP165 plasmids. 16 h after transfection, the cells were placed at 25 °C for 5 h. To examine the localization of IIGP165 and Akt in HeLa cells, the cells were immunostained with anti-Flag antibody (for We are grateful to Dr. Yuxin Feng for valuable insights and Akt) or anti-HA antibody (for IIGP165). FITC-conjugated second antibody suggestions. We thank Dr. Changdeng Hu and Dr. Tom Kapporal was used. The cells were washed, mounted on slides and examined using a for providing the FCA system; Dr. J Woodgett, Dr. ME Greenberg fluorescence microscope. and Dr. R Roth for providing Akt constructs; Dr. Christaina Sample for providing technical assistance with the confocal In vivo kinase assay microscope (University of Cincinnati); and college student Don Wei for experimental assistance. This work was supported by NIH HeLa cells were transiently transfected with GFP/IIGP165 and Grants: NS043252, NS054652, and NS056302. pcDNA3-Myri-Flag.Akt plasmids. 24 h later, cells were serum-deprived for 12 h and treated for 20 min either with 50 ng/ml PDGF or 50 μM LY294002. GFP-tagged IIGP165 was immunoprecipitated from cell lysates with an anti-GFP antibody. After extensive washing, the precipitated GFP– References IIGP165 proteins were separated by 6% SDS–PAGE and transferred to a nitrocellulose membrane. The membrane was subsequently probed with an Adams, J.M., Cory, S., 1998. The Bcl-2 protein family: arbiters of cell anti-phospho-(Ser/Thr) Akt substrate antibody. survival. Science 281, 1322–1326. Aoki, S., Su, Q., Li, H., Nishikawa, K., Ayukawa, K., Hara, Y., Namikawa, Measurement of cell viability K., Kiryu-Seo, S., Kiyama, H., Wada, K., 2002. Identification of an axotomy-induced glycosylated protein, AIGP1, possibly involved in cell To evaluate the effects of IIGP165 on cell survival, luciferase reporter death triggered by endoplasmic reticulum–Golgi stress. J. Neurosci. 22, gene plasmid was transfected into PC12 cells. For the first set of 10751–10760. experiments PC12 cells were serum deprived or not. They were then Banu, Y., Matsuda, M., Yoshihara, M., Kondo, M., Sutou, S., Matsukuma, transfected with IIGP165, IIGP165 antisense or AktCA; or treated with S., 2002. Golgi matrix protein gene, Golga3/Mea2, rearranged and re- PDGF. 24 h later cells were washed with PBS, harvested and the Luciferase expressed in pachytene spermatocytes restores spermatogenesis in the assay performed as previously described (Datta et al., 1997; Nechushtan et mouse. Mol. Reprod. Dev. 61, 288–301. al., 1999; Ran et al., 2004a). For the second set of experiments, cells were Bartke, T., Pohl, C., Pyrowolakis, G., Jentsch, S., 2004. Dual role of BRUCE transfected with the expression reporter gene and IIGP165 or control as an antiapoptotic IAP and a chimeric E2/E3 ubiquitin ligase. Mol. Cell vector. The cells were then untreated, or treated with CH11 (antibody that 14, 801–811. induces Fas-mediated cell death) or with BFA; or treated with PDGF for Bennett, M., Macdonald, K., Chan, S.W., Luzio, J.P., Simari, R., Weissberg, 24 h. 24 h later, cells were washed with PBS, harvested and the luciferase P., 1998. Cell surface trafficking of Fas: a rapid mechanism of p53- assay performed as previously described (Ran et al., 2004a). Each construct mediated apoptosis. Science 282, 290–293. R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 405

Brune, W., Nevels, M., Shenk, T., 2003. Murine cytomegalovirus m41 open Ferri, K.F., Kroemer, G., 2001. Organelle-specific initiation of cell death reading frame encodes a Golgi-localized antiapoptotic protein. J. Virol. pathways. Nat. Cell Biol. 3, E255–E263. 77, 11633–11643. Fritzler, M.J., Hamel, J.C., Ochs, R.L., Chan, E.K., 1993. Molecular Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., characterization of two human autoantigens: unique cDNAs encoding Anderson, M.J., Arden, K.C., Blenis, J., Greenberg, M.E., 1999. Akt 95- and 160-kD proteins of a putative family in the Golgi complex. J. Exp. promotes cell survival by phosphorylating and inhibiting a Forkhead Med. 178, 49–62. transcription factor. Cell 96, 857–868. Fruman, D.A., Meyers, R.E., Cantley, L.C., 1998. Phosphoinositide kinases. Bursch, W., Ellinger, A., Gerner, C., Frohwein, U., Schulte-Hermann, R., Ann. Rev. Biochem. 67, 481–507. 2000. Programmed cell death (PCD). Apoptosis, autophagic PCD, or Fulton, D., Gratton, J.P., McCabe, T.J., Fontana, J., Fujio, Y., Walsh, K., others? Ann. N.Y. Acad. Sci. 926, 1–12. Franke, T.F., Papapetropoulos, A., Sessa, W.C., 1999. Regulation of Cardone, M.H., Roy, N., Stennicke, H.R., Salvesen, G.S., Franke, T.F., endothelium-derived nitric oxide production by the protein kinase Akt. Stanbridge, E., Frisch, S., Reed, J.C., 1998. Regulation of cell death Nature 399, 597–601. protease caspase-9 by phosphorylation. Science 282, 1318–1321. Fulton, D., Fontana, J., Sowa, G., Gratton, J.P., Lin, M., Li, K.X., Michell, Castejon, O.J., 1999. Ultrastructural pathology of Golgi apparatus of B., Kemp, B.E., Rodman, D., Sessa, W.C., 2002. Localization of nerve cells in human brain edema associated to brain congenital endothelial nitric-oxide synthase phosphorylated on serine 1179 and malformations, tumours and trauma. J. Submicrosc. Cytol. Pathol. 31, nitric oxide in Golgi and plasma membrane defines the existence of two 203–213. pools of active enzyme. J. Biol. Chem. 277, 4277–4284. Cha, H., Smith, B.L., Gallo, K., Machamer, C.E., Shapiro, P., 2004. Fulton, D., Babbitt, R., Zoellner, S., Fontana, J., Acevedo, L., McCabe, T.J., Phosphorylation of Golgin-160 by mixed lineage kinase 3. J. Cell Sci. Iwakiri, Y., Sessa, W.C., 2004. Targeting of endothelial nitric-oxide 117, 751–760. synthase to the cytoplasmic face of the Golgi complex or plasma mem- Chen, L., Gao, X., 2002. Neuronal apoptosis induced by endoplasmic brane regulates Akt- versus calcium-dependent mechanisms for nitric reticulum stress. Neurochem. Res. 27, 891–898. oxide release. J. Biol. Chem. 279, 30349–30357. Chennathukuzhi, V.M., Kurihara, Y., Bray, J.D., Hecht, N.B., 2001. Trax Gonatas, J.O., Mezitis, S.G., Stieber, A., Fleischer, B., Gonatas, N.K., 1989. MG- (translin-associated factor X), a primarily cytoplasmic protein, inhibits 160. A novel sialoglycoprotein of the medial cisternae of the Golgi apparatus the binding of TB-RBP (translin) to RNA. J. Biol. Chem. 276, (published erratum appears in J Biol Chem 1989 Mar 5;264(7):4264) J. Biol. 13256–13263. Chem. 264, 646–653. Chiu, R., Novikov, L., Mukherjee, S., Shields, D., 2002. A caspase cleavage Green, A.R., 2004. Protecting the brain: the search for a clinically effective fragment of p115 induces fragmentation of the Golgi apparatus and neuroprotective drug for stroke. Crit. Rev. Neurobiol. 16, 91–97. apoptosis. J. Cell Biol. 159, 637–648 (Electronic publication 2002 Nov Hauser, H.P., Bardroff, M., Pyrowolakis, G., Jentsch, S., 1998. A giant 2018). ubiquitin-conjugating enzyme related to IAP apoptosis inhibitors. J. Cell Cockcroft, S., 1999. Mammalian phosphatidylinositol transfer proteins: Biol. 141, 1415–1422. emerging roles in signal transduction and vesicular traffic. Chem. Phys. Hayashi, T., Abe, K., 2004. Ischemic neuronal cell death and organellae Lipids 98, 23–33. damage. Neurol. Res. 26, 827–834. Darimont, B.D., Wagner, R.L., Apriletti, J.W., Stallcup, M.R., Kushner, P.J., Haynes, M.P., Sinha, D., Russell, K.S., Collinge, M., Fulton, D., Morales- Baxter, J.D., Fletterick, R.J., Yamamoto, K.R., 1998. Structure and Ruiz, M., Sessa, W.C., Bender, J.R., 2000. Membrane estrogen receptor specificity of nuclear receptor–coactivator interactions. Genes Dev. 12, engagement activates endothelial nitric oxide synthase via the PI3- 3343–3356. kinase–Akt pathway in human endothelial cells. Circ. Res. 87, Datta, S.R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y., Greenberg, 677–682.

M.E., 1997. Akt phosphorylation of BAD couples survival signals to the Hicks, S.W., Machamer, C.E., 2002. The NH2-terminal domain of Golgin- cell-intrinsic death machinery. Cell 91, 231–241. 160 contains both Golgi and nuclear targeting information. J. Biol. Datta, S.R., Katsov, A., Hu, L., Petros, A., Fesik, S.W., Yaffe, M.B., Chem. 277, 35833–35839 (Electronic publication 32002 Jul 35818). Greenberg, M.E., 2000. 14-3-3 proteins and survival kinases cooperate Hu, C.D., Kerppola, T.K., 2003. Simultaneous visualization of multiple to inactivate BAD by BH3 domain phosphorylation. Mol. Cell 6, 41–51. protein interactions in living cells using multicolor fluorescence com- De Maria, R., Lenti, L., Malisan, F., d'Agostino, F., Tomassini, B., Zeuner, plementation analysis. Nat. Biotechnol. 21, 539–545. A., Rippo, M.R., Testi, R., 1997. Requirement for GD3 ganglioside in Hu, W.H., Johnson, H., Shu, H.B., 1999. Tumor necrosis factor-related CD95- and ceramide-induced apoptosis. Science 277, 1652–1655. apoptosis-inducing ligand receptors signal NF-kappaB and JNK De Matteis, M.A., Santini, G., Kahn, R.A., Di Tullio, G., Luini, A., 1993. activation and apoptosis through distinct pathways. J. Biol. Chem. 274, Receptor and protein kinase C-mediated regulation of ARF binding to 30603–30610. the Golgi complex. Nature 364, 818–821. Hu, C.D., Chinenov, Y., Kerppola, T.K., 2002. Visualization of interactions DeBusk, L.M., Hallahan, D.E., Lin, P.C., 2004. Akt is a major angiogenic among bZIP and Rel family proteins in living cells using bimolecular mediator downstream of the Ang1/Tie2 signaling pathway. Exp. Cell fluorescence complementation. Mol. Cell 9, 789–798. Res. 298, 167–177. Hu, W., Xu, R., Zhang, G., Jin, J., Szulc, Z.M., Bielawski, J., Hannun, Y.A., del Peso, L., Gonzalez-Garcia, M., Page, C., Herrera, R., Nunez, G., 1997. Obeid, L.M., Mao, C., 2005. Golgi fragmentation is associated with Interleukin-3-induced phosphorylation of BAD through the protein ceramide-induced cellular effects. Mol. Biol. Cell 16, 1555–1567 kinase Akt. Science 278, 687–689. (Electronic publication 2005 Jan 1512). Dreyer, J., Schleicher, M., Tappe, A., Schilling, K., Kuner, T., Kusumawi- Huang, D.C., Strasser, A., 2000. BH3-Only proteins – essential initiators of dijaja, G., Muller-Esterl, W., Oess, S., Kuner, R., 2004. Nitric oxide apoptotic cell death. Cell 103, 839–842. synthase (NOS)-interacting protein interacts with neuronal NOS and Huynh, D.P., Yang, H.T., Vakharia, H., Nguyen, D., Pulst, S.M., 2003. regulates its distribution and activity. J. Neurosci. 24, 10454–10465. Expansion of the polyQ repeat in ataxin-2 alters its Golgi localization, Dudek, H., Datta, S.R., Franke, T.F., Birnbaum, M.J., Yao, R., Cooper, G.M., disrupts the Golgi complex and causes cell death. Hum. Mol. Genet. 12, Segal, R.A., Kaplan, D.R., Greenberg, M.E., 1997. Regulation of neuronal 1485–1496. survival by the serine–threonine protein kinase Akt. Science 275, 661–665. Jazwinski, S.M., Conzelmann, A., 2002. LAG1 puts the focus on ceramide Elyaman, W., Yardin, C., Hugon, J., 2002. Involvement of glycogen signaling. Int. J. Biochem. Cell Biol. 34, 1491–1495. synthase kinase-3beta and tau phosphorylation in neuronal Golgi Jugdutt, B.I., Idikio, H.A., 2005. Apoptosis and oncosis in acute coronary disassembly. J. Neurochem. 81, 870–880. syndromes: assessment and implications. Mol. Cell. Biochem. 270, Farquhar, M.G., Palade, G.E., 1998. The Golgi apparatus: 100 years of 177–200. progress and controversy. Trends Cell Biol. 8, 2–10. Kajimoto, T., Shirai, Y., Sakai, N., Yamamoto, T., Matsuzaki, H., Kikkawa, 406 R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407

U., Saito, N., 2004. Ceramide-induced apoptosis by translocation, 1999. Mea2/Golga3 gene is disrupted in a line of transgenic mice with a phosphorylation, and activation of protein kinase Cdelta in the Golgi reciprocal translocation between chromosomes 5 and 19 and is responsible complex. J. Biol. Chem. 279, 12668–12676. for a defective spermatogenesis in homozygotes. Mamm. Genome 10, 1–5. Kaufman, R.J., 1999. Stress signaling from the lumen of the endoplasmic Misumi,Y.,Sohda,M.,Yano,A.,Fujiwara,T.,Ikehara,Y.,1997.Molecular reticulum: coordination of gene transcriptional and translational controls. characterization of GCP170, a 170-kDa protein associated with the Genes Dev. 13, 1211–1233. cytoplasmic face of the Golgi membrane. J. Biol. Chem. 272, 23851–23858. Kennedy, S.G., Wagner, A.J., Conzen, S.D., Jordan, J., Bellacosa, A., Morales-Ruiz, M., Lee, M.J., Zollner, S., Gratton, J.P., Scotland, R., Shiojima, Tsichlis, P.N., Hay, N., 1997. The PI 3-kinase/Akt signaling pathway I., Walsh, K., Hla, T., Sessa, W.C., 2001. Sphingosine 1-phosphate delivers an anti-apoptotic signal. Genes Dev. 11, 701–713. activates Akt, nitric oxide production, and chemotaxis through a Gi protein/ Kim, D.W., 2003. Characterization of Grp1p, a novel cis-Golgi matrix phosphoinositide 3-kinase pathway in endothelial cells. J. Biol. Chem. 276, protein. Biochem. Biophys. Res. Commun. 303, 370–378. 19672–19677. Kjoller, L., Hall, A., 1999. Signaling to Rho GTPases. Exp. Cell Res. 253, Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B.A., Yuan, 166–179. J., 2000. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis Kohyama-Koganeya, A., Sasamura, T., Oshima, E., Suzuki, E., Nishihara, S., and cytotoxicity by amyloid-beta. Nature 403, 98–103. Ueda, R., Hirabayashi, Y., 2004. Drosophila glucosylceramide synthase: a Nalbant, P., Hodgson, L., Kraynov, V., Toutchkine, A., Hahn, K.M., 2004. negative regulator of cell death mediated by proapoptotic factors. J. Biol. Activation of endogenous Cdc42 visualized in living cells. Science 305, Chem. 279, 35995–36002 (Electronic publication 32004 Jun 35921). 1615–1619. Koistinaho, J., Hokfelt, T., 1997. Altered gene expression in brain ischemia. Narasimhan, P., Sklar, R., Murrell, M., Swanson, R.A., Sharp, F.R., 1996. NeuroReport 8. Methylmalonyl-CoA mutase induction by cerebral ischemia and Kondo, M., Sutou, S., 1997. Cloning and molecular characterization of neurotoxicity of the mitochondrial toxin methylmalonic acid. J. Neurosci. cDNA encoding a mouse male-enhanced antigen-2 (Mea-2): a putative 16, 7336–7346. family of the Golgi autoantigen. DNA Seq. 7, 71–82. Nechushtan, A., Smith, C.L., Hsu, Y.T., Youle, R.J., 1999. Conformation of Kusano, I., Kageyama, A., Tamura, T., Oda, T., Muramatsu, T., 2001. the Bax C-terminus regulates subcellular location and cell death. Embo Enhancement of diphtheria toxin-induced apoptosis in Vero cells by J. 18, 2330–2341. combination treatment with Brefeldin A and okadaic acid. Cell Struct. Nicholson, D.W., 2000. From bench to clinic with apoptosis-based Funct. 26, 279–288. therapeutic agents. Nature 407, 810–816. Lane, J.D., Lucocq, J., Pryde, J., Barr, F.A., Woodman, P.G., Allan, V.J., Nolte, R.T., Wisely, G.B., Westin, S., Cobb, J.E., Lambert, M.H., Kurokawa, Lowe, M., 2002. Caspase-mediated cleavage of the stacking protein R., Rosenfeld, M.G., Willson, T.M., Glass, C.K., Milburn, M.V., 1998. GRASP65 is required for Golgi fragmentation during apoptosis. J. Cell Ligand binding and co-activator assembly of the peroxisome prolif- Biol. 156, 495–509. erator-activated receptor-gamma. Nature 395, 137–143. Lehel, C., Olah, Z., Jakab, G., Anderson, W.B., 1995. Protein kinase C Nozawa, K., Casiano, C.A., Hamel, J.C., Molinaro, C., Fritzler, M.J., Chan, epsilon is localized to the Golgi via its zinc-finger domain and modulates E.K., 2002. Fragmentation of Golgi complex and Golgi autoantigens Golgi function. Proc. Natl. Acad. Sci. U. S. A. 92, 1406–1410. during apoptosis and necrosis. Arthritis 4. Lemon, B., Tjian, R., 2000. Orchestrated response: a symphony of transcription Nozawa, K., Fritzler, M.J., von Muhlen, C.A., Chan, E.K., 2004. Giantin is factors for gene control. Genes Dev. 14, 2551–2569. the major Golgi autoantigen in human anti-Golgi complex sera. Arthritis Lipton, P., 1999. Ischemic cell death in brain neurons. Physiol. Rev. 79, Res. 6. 1431–1568. Nuszkowski, A., Grabner, R., Marsche, G., Unbehaun, A., Malle, E., Heller, Lotz, K., Pyrowolakis, G., Jentsch, S., 2004. BRUCE, a giant E2/E3 R., 2001. Hypochlorite-modified low density lipoprotein inhibits nitric ubiquitin ligase and inhibitor of apoptosis protein of the trans-Golgi oxide synthesis in endothelial cells via an intracellular dislocalization of network, is required for normal placenta development and mouse endothelial nitric-oxide synthase. J. Biol. Chem. 276, 14212–14221. survival. Mol. Cell. Biol. 24, 9339–9350. O'Reilly, L.A., Ekert, P., Harvey, N., Marsden, V., Cullen, L., Vaux, D.L., Lowe, M., Rabouille, C., Nakamura, N., Watson, R., Jackman, M., Jamsa, Hacker, G., Magnusson, C., Pakusch, M., Cecconi, F., Kuida, K., E., Rahman, D., Pappin, D.J., Warren, G., 1998. Cdc2 kinase directly Strasser, A., Huang, D.C., Kumar, S., 2002. Caspase-2 is not required for phosphorylates the cis-Golgi matrix protein GM130 and is required for thymocyte or neuronal apoptosis even though cleavage of caspase-2 is Golgi fragmentation in mitosis. Cell 94, 783–793. dependent on both Apaf-1 and caspase-9. Cell Death Differ. 9, 832–841. Lowe, M., Gonatas, N.K., Warren, G., 2000. The mitotic phosphorylation Papapetropoulos, A., Fulton, D., Lin, M.I., Fontana, J., McCabe, T.J., cycle of the cis-Golgi matrix protein GM130. J. Cell Biol. 149, 341–356. Zoellner, S., Garcia-Cardena, G., Zhou, Z., Gratton, J.P., Sessa, W.C., Lu, A., Tang, Y., Ran, R., Clark, J.F., Aronow, B.J., Sharp, F.R., 2003. 2004. Vanadate is a potent activator of endothelial nitric-oxide synthase: Genomics of the periinfarction cortex after focal cerebral ischemia. evidence for the role of the serine/threonine kinase Akt and the 90-kDa J. Cereb. Blood Flow Metab. 23, 786–810. heat shock protein. Mol. Pharmacol. 65, 407–415. Maag, R.S., Hicks, S.W., Machamer, C.E., 2003. Death from within: Petito, C.K., Lapinski, R.L., 1986. Postischemic alterations in ultrastructural apoptosis and the secretory pathway. Curr. Opin. Cell Biol. 15, 456–461. cytochemistry of neuronal Golgi apparatus. Lab. Invest. 55, 696–702. Machamer, C.E., 2003. Golgi disassembly in apoptosis: cause or effect? Petito, C.K., Pulsinelli, W.A., 1984. Sequential development of reversible and Trends Cell Biol. 13, 279–281. irreversible neuronal damage following cerebral ischemia. J. Neuropathol. Mancini, M., Machamer, C.E., Roy, S., Nicholson, D.W., Thornberry, N.A., Exp. Neurol. 43, 141–153. Casciola-Rosen, L.A., Rosen, A., 2000. Caspase-2 is localized at the Rafols, J.A., Daya, A.M., O'Neil, B.J., Krause, G.S., Neumar, R.W., White, Golgi complex and cleaves Golgin-160 during apoptosis. J. Cell Biol. B.C., 1995. Global brain ischemia and reperfusion: Golgi apparatus 149, 603–612. ultrastructure in neurons selectively vulnerable to death. Acta Neuro- Marra, P., Maffucci, T., Daniele, T., Tullio, G.D., Ikehara, Y., Chan, E.K., Luini, pathol. (Berl) 90, 17–30. A., Beznoussenko, G., Mironov, A., De Matteis, M.A., 2001. The GM130 Ran, R., Lu, A., Zhang, L., Tang, Y., Zhu, H., Xu, H., Feng, Y., Han, C., and GRASP65 Golgi proteins cycle through and define a subdomain of the Zhou, G., Rigby, A.C., Sharp, F.R., 2004a. Hsp70 promotes TNF- intermediate compartment. Nat. Cell Biol. 3, 1101–1113. mediated apoptosis by binding IKK gamma and impairing NF-kappa B Martin, L.J., Brambrink, A.M., Price, A.C., Kaiser, A., Agnew, D.M., survival signaling. Genes Dev. 18, 1466–1481. Ichord, R.N., Traystman, R.J., 2000. Neuronal death in newborn Ran, R., Zhou, G., Lu, A., Zhang, L., Tang, Y., Rigby, A.C., Sharp, F.R., striatum after hypoxia–ischemia is necrosis and evolves with oxidative 2004b. Hsp70 mutant proteins modulate additional apoptotic pathways stress. Neurobiol. Dis. 7, 169–191. and improve cell survival. Cell Stress Chaperones 9, 229–242. Matsukuma, S., Kondo, M., Yoshihara, M., Matsuda, M., Utakoji, T., Sutou, S., Renshaw, S.A., Dempsey, C.E., Barnes, F.A., Bagstaff, S.M., Dower, S.K., R. Ran et al. / Mol. Cell. Neurosci. 36 (2007) 392–407 407

Bingle, C.D., Whyte, M.K., 2004. Three novel Bid proteins generated by Su, H., Kozak, C.A., Veerhuis, R., Lau, Y.F., Wiberg, U., 1992. Isolation of a alternative splicing of the human Bid gene. J. Biol. Chem. 279, 2846–2855. phylogenetically conserved and testis-specific gene using a monoclonal Rios, R.M., Bornens, M., 2003. The Golgi apparatus at the cell centre. Curr. antibody against the serological H-Y antigen. J. Reprod. Immunol. 21, Opin. Cell Biol. 15, 60–66. 275–291. Rippo, M.R., Malisan, F., Ravagnan, L., Tomassini, B., Condo, I., Terro, F., Czech, C., Esclaire, F., Elyaman, W., Yardin, C., Baclet, M.C., Costantini, P., Susin, S.A., Rufini, A., Todaro, M., Kroemer, G., Testi, Touchet, N., Tremp, G., Pradier, L., Hugon, J., 2002. Neurons over- R., 2000. GD3 ganglioside directly targets mitochondria in a bcl-2- expressing mutant presenilin-1 are more sensitive to apoptosis induced by controlled fashion. FASEB J. 14, 2047–2054. endoplasmic reticulum–Golgi stress. J. Neurosci. Res. 69, 530–539. Schmidt, A., Hall, A., 2002. Guanine nucleotide exchange factors for Rho Torchia, J., Rose, D.W., Inostroza, J., Kamei, Y., Westin, S., Glass, C.K., GTPases: turning on the switch. Genes Dev. 16, 1587–1609. Rosenfeld, M.G., 1997. The transcriptional co-activator p/CIP binds Schultz, A., Jonsson, J.I., Larsson, C., 2003. The regulatory domain of protein CBP and mediates nuclear-receptor function. Nature 387, 677–684. kinase Ctheta localises to the Golgi complex and induces apoptosis in Tsukita, S., Oishi, K., Akiyama, T., Yamanashi, Y., Yamamoto, T., 1991. neuroblastoma and Jurkat cells. Cell Death Differ. 10, 662–675. Specific proto-oncogenic tyrosine kinases of src family are enriched in Sessa, W.C., Garcia-Cardena, G., Liu, J., Keh, A., Pollock, J.S., Bradley, J., cell-to-cell adherens junctions where the level of tyrosine phosphory- Thiru, S., Braverman, I.M., Desai, K.M., 1995. The Golgi association of lation is elevated. J. Cell Biol. 113, 867–879. endothelial nitric oxide synthase is necessary for the efficient synthesis Verhulst, A., Persy, V.P.,Van Rompay, A.R., Verstrepen, W.A., Helbert, M.F., of nitric oxide. J. Biol. Chem. 270, 17641–17644. De Broe, M.E., 2002. Osteopontin synthesis and localization along the Sharp, F.R., Lu, A., Tang, Y., Millhorn, D.E., 2000. Multiple molecular human nephron. J. Am. Soc. Nephrol. 13, 1210–1218. penumbras after focal cerebral ischemia. J. Cereb. Blood Flow Metab. Wang, X., Zhang, J., Kim, H.P., Wang, Y., Choi, A.M., Ryter, S.W., 2004. Bcl- 20, 1011–1032. XL disrupts death-inducing signal complex formation in plasma membrane Sharp, F.R., Ran, R., Lu, A., Tang, Y., Strauss, K.I., Glass, T., Ardizzone, T., induced by hypoxia/reoxygenation. FASEB J. 18, 1826–1833. Bernaudin, M., 2004. Hypoxic preconditioning protects against ischemic White, B.C., Sullivan, J.M., DeGracia, D.J., O'Neil, B.J., Neumar, R.W., brain injury. Neurorx 1, 26–35. Grossman, L.I., Rafols, J.A., Krause, G.S., 2000. Brain ischemia and Shikama, Y., Shen, L., Yonetani, M., Miyauchi, J., Miyashita, T., Yamada, reperfusion: molecular mechanisms of neuronal injury. J. Neurol. Sci. M., 2002. Death effector domain-only polypeptides of caspase-8 and -10 179, 1–33. specifically inhibit death receptor-induced cell death. Biochem. Biophys. Yano, S., Tokumitsu, H., Soderling, T.R., 1998. Calcium promotes cell Res. Commun. 291, 484–493. survival through CaM-K kinase activation of the protein-kinase-B Soriano, M.A., Tessier, M., Certa, U., Gill, R., 2000. Parallel gene pathway. Nature 396, 584–587. expression monitoring using oligonucleotide probe arrays of multiple Zha, J., Harada, H., Yang, E., Jockel, J., Korsmeyer, S.J., 1996. Serine transcripts with an animal model of focal ischemia. J. Cereb. Blood Flow phosphorylation of death agonist BAD in response to survival factor Metab. 20, 1045–1055. results in binding to 14-3-3 not BCL-X(L). Cell 87, 619–628.