DOCSLIB.ORG

Git2 Acts As a Systems-Level Coordinator of Neurometabolic Activity and Pathophysiological Aging

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Git2 Acts As a Systems-Level Coordinator of Neurometabolic Activity and Pathophysiological Aging ORIGINAL RESEARCH published: 18 January 2016 doi: 10.3389/fendo.2015.00191 GIT2 Acts as a Systems-Level Coordinator of Neurometabolic Activity and Pathophysiological Aging Bronwen Martin1† , Wayne Chadwick2† , Jonathan Janssens3,4† , Richard T. Premont5 , Robert Schmalzigaug5 , Kevin G. Becker6 , Elin Lehrmann6 , William H. Wood6 , Yongqing Zhang6 , Sana Siddiqui2 , Sung-Soo Park2 , Wei-na Cong1 , Caitlin M. Daimon1 and Stuart Maudsley2,3,4* 1 Metabolism Unit, National Institute on Aging, National Institutes of Health, Baltimore, MD, USA, 2 Receptor Pharmacology Unit, National Institute on Aging, National Institutes of Health, Baltimore, MD, USA, 3 Translational Neurobiology Group, 4 Edited by: VIB Department of Molecular Genetics, University of Antwerp, Antwerp, Belgium, Laboratory of Neurogenetics, Institute 5 Brian Hudson, Born-Bunge, University of Antwerp, Antwerp, Belgium, Department of Medicine, Gastroenterology Division, Duke University, 6 University of Glasgow, UK Durham, NC, USA, Gene Expression and Genomics Unit, National Institutes of Health, Baltimore, MD, USA Reviewed by: Amanda E. Mackenzie, Aging represents one of the most complicated and highly integrated somatic processes. University of Glasgow, UK Keyong Du, Healthy aging is suggested to rely upon the coherent regulation of hormonal and Tufts Medical Center, USA neuronal communication between the central nervous system and peripheral tissues. *Correspondence: The hypothalamus is one of the main structures in the body responsible for sustaining Stuart Maudsley an efficient interaction between energy balance and neurological activity and therefore [email protected] likely coordinates multiple systems in the aging process. We previously identified, in †Bronwen Martin, Wayne Chadwick and Jonathan Janssens have hypothalamic and peripheral tissues, the G protein-coupled receptor kinase interacting contributed equally to this work. protein 2 (GIT2) as a stress response and aging regulator. As metabolic status profoundly affects aging trajectories, we investigated the role of GIT2 in regulating metabolic activity. Specialty section: This article was submitted to We found that genomic deletion of GIT2 alters hypothalamic transcriptomic signatures Molecular and Structural related to diabetes and metabolic pathways. Deletion of GIT2 reduced whole animal Endocrinology, respiratory exchange ratios away from those related to primary glucose usage for energy a section of the journal Frontiers in Endocrinology homeostasis. GIT2 knockout (GIT2KO) mice demonstrated lower insulin secretion levels, Received: 05 August 2015 disruption of pancreatic islet beta cell mass, elevated plasma glucose, and insulin resis- Accepted: 14 December 2015 tance. High-dimensionality transcriptomic signatures from islets isolated from GIT2KO Published: 18 January 2016 mice indicated a disruption of beta cell development. Additionally, GIT2 expression was Citation: Martin B, Chadwick W, Janssens J, prematurely elevated in pancreatic and hypothalamic tissues from diabetic-state mice Premont RT, Schmalzigaug R, (db/db), compared to age-matched wild type (WT) controls, further supporting the role Becker KG, Lehrmann E, Wood WH, of GIT2 in metabolic regulation and aging. We also found that the physical interaction of Zhang Y, Siddiqui S, Park S-S, Cong W-n, Daimon CM and pancreatic GIT2 with the insulin receptor and insulin receptor substrate 2 was diminished Maudsley S (2016) GIT2 Acts as a in db/db mice compared to WT mice. Therefore, GIT2 appears to exert a multidimen- Systems-Level Coordinator of Neurometabolic Activity and sional “keystone” role in regulating the aging process by coordinating somatic responses Pathophysiological Aging. to energy deficits. Front. Endocrinol. 6:191. doi: 10.3389/fendo.2015.00191 Keywords: GIT2, metabolism, keystone, aging, dysglycemia, trajectory Frontiers in Endocrinology | www.frontiersin.org 1 January 2016 | Volume 6 | Article 191 Martin et al. GIT2 Regulation of Neurometabolism INTRODUCTION that both neurodegenerative diseases and pathophysiological aging involve a functional interplay between a series of diverse The natural aging process is associated with an accumulation biological systems including neurological, endocrinological, of molecular perturbations affecting almost all cells, tissues and sensory, and metabolic activities (13–23). Many of these systems organs of the body. These alterations have long been known are functionally integrated together in one crucial CNS organ, to affect multiple processes related to cell survival, genomic i.e., the hypothalamus (24). The hypothalamus is responsible for instability, altered gene expression patterns, aberrant cellular the regulation of many metabolic pathways by synthesizing and replication, oxidative damage by reactive oxygen species (ROS), secreting numerous neuronal hormones that stimulate or inhibit and fluctuations in protein expression and coherent protein the secretion of trophic hormones from the anterior pituitary. post-translational modification 1( ). Life expectancy in most The hypothalamus therefore can control global metabolism, body westernized and developing countries is demonstrating an temperature, thirst, hunger, fatigue, and circadian rhythms (25). inexorable increase (2, 3), therefore either natural or pathological Not only does the hypothalamus act as a trophic master-controller aging could be considered the primary threat to global health in of the endocrine system but it also possesses neuronal projections the future. With increasing age, there is a system-wide reduction to many autonomous and higher centers of the brain (26), thereby in the ability of the body to cope with stress in-part due to a providing a crucial link between aging and age-related disorders degradation of the efficiency of energy-generating [e.g., ATP such as dementia (27). We have previously shown, through the (adenosine triphosphate)] metabolic systems (4–6). Disruption development of in cellula aging models (19), that regulation of the of the primary energy-synthesizing system, i.e., glucose catabo- G protein-coupled receptor kinase interacting protein 2 (GIT2) lism by oxidative phosphorylation, leads to both ATP depletion is highly sensitive to the chronological aging process and also to (thus affecting electrical cellular excitability, proteolytic activi- the presence of age-linked stressors such as ROS. Using a combi- ties, transmembrane transport processes, and kinase activity) natorial informatics and proteomics approach, we demonstrated as well as an increase in the deleterious effects of unregulated that GIT2 acts as a hypothalamic aging “keystone” factor (13). hyperglycemia, e.g., systemic inflammation, arterial stenosis, Subsequently, GIT2 has also been implicated in regulating DNA impaired tissue healing, neuronal damage, and renal failure. integrity via its interaction with ataxia telangiectasia-mutated Hence, one of the most characteristic factors in the aging process (ATM), a DNA damage repair (DDR) kinase (18). In response to are the generation of insulin resistance, disruptions to oxidative multiple forms of DNA damaging insults, GIT2 is rapidly phos- phosphorylation of glucose, and changes in body fat composi- phorylated by ATM and then forms a complex with multiple DDR tion (6). Therapeutic interventions, such as caloric restriction or proteins including MDC1, MRE11, and phosphorylated H2AX visceral fat depletion, designed to address features of metabolic/ (18). Genomic deletion of GIT2 in mice (GIT2KO) resulted in glycemic aging, have succeeded in improving insulinotropic a significant increase in the rate of DNA damage accumulation activity and life span in rodents (7, 8). The importance of the effi- compared to wild type (WT) age-matched control mice (18). DNA ciency in glucose metabolism in the aging process is underscored instability has been associated with an advanced rate of aging for by the demonstration that multiple glucose-regulatory factors several decades (28–30) and this has been reinforced with the in nematode worms were also major age-regulating genes, e.g., appreciation that accelerated molecular aging occurs in patients daf-2 [insulin receptor analog (9)] and age-1 [phosphoinositide possessing mutations in multiple DDR proteins including ATM 3-kinase analog – a primary downstream factor of insulin recep- (31), WRN [Werner syndrome, RecQ helicase-like (32, 33)], tor functions (10)]. Translation of these fundamental insulin/ and BLM [Bloom syndrome, RecQ helicase-like (34)]. Glucose- glucose-mediated life span alterations from nematodes to higher related diabetic pathologies often result in elevated cellular levels organisms has proven problematical: a situation likely due to the of ROS due to an attenuated glucose uptake capacity and support increased functional diversity of insulin/insulin-related ligands of oxidative phosphorylation causing cells to generate ATP via in more complex, higher organisms. Despite this however, other less-efficient synthetic mechanisms. Prematurely elevated adipose tissue-specific insulin receptor deletion is associated ROS levels, as with mutations in DDR proteins, are considered to with life span alterations in mice (11). Linked to this observa- be one of the major causes of advanced aging (35–37). Reinforcing tion, experimental paradigms in rhesus macaques that attenuate the link between dysfunctional aging, diabetic pathologies, and age-related glycemic disruption and increase insulin sensitivity DNA instability, DDR proteins
Load more

Recommended publications
  • Title: Therapeutic Potential of HSP90 Inhibition for Neurofibromatosis Type 2
    Author Manuscript Published OnlineFirst on May 28, 2013; DOI: 10.1158/1078-0432.CCR-12-3167 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Title: Therapeutic Potential of HSP90 Inhibition for Neurofibromatosis type 2 Karo Tanaka1, Ascia Eskin3, Fabrice Chareyre1, Walter J. Jessen4, Jan Manent5, Michiko Niwa-Kawakita6, Ruihong Chen7, Cory H. White2, Jeremie Vitte1, Zahara M. Jaffer1, Stanley F. Nelson3, Allan E. Rubenstein8, Marco Giovannini1,9§. Authors’ affiliations: House Research Institute, 1Center for Neural Tumor Research and 2Section on Genetics of Hereditary Ear Disorders, Los Angeles, CA; 3Department of Human Genetics, University of California, Los Angeles, CA; 4Informatics, Covance Inc., Princeton, NJ; 5Peter MacCallum Cancer Institute, Melbourne, Australia; 6Inserm U944, CNRS U7212, Université Paris, Institut Universitaire d'Hématologie, Paris, France; 7NexGenix Pharmaceuticals, Burlingame, CA; and 8New York University Langone Medical Center, New York, NY; and Department of Cell and Neurobiology, University of Southern California, Keck School of Medicine, Los Angeles, CA Running title: HSP90 Inhibition for NF2 Keywords: NF2, HSP90 inhibitors, Transcriptome Financial support: This work was supported by a Drug Discovery Initiative Award, Children’s Tumor Foundation, to M.G., and by the House Research Institute. Corresponding author: Marco Giovannini, House Research Institute, Center for Neural Tumor Research, 2100 West 3rd street, Los Angeles, CA90057. Phone: +1-213-989-6708; Fax: +1-213-989-6778; E-mail: [email protected] 1 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 28, 2013; DOI: 10.1158/1078-0432.CCR-12-3167 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • 1 Genome-Wide Comparisons of Variation in Linkage Disequilibrium
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Genome-wide comparisons of variation in linkage disequilibrium Yik Y. Teo1,*, Andrew E. Fry1, Kanishka Bhattacharya1, Kerrin S. Small1, Dominic P. Kwiatkowski1,2, Taane G. Clark1,2 1 Wellcome Trust Centre for Human Genetics, University of Oxford, United Kingdom 2 Wellcome Trust Sanger Institute, Hinxton, United Kingdom Running title: Genome-wide comparisons of LD Keywords: linkage disequilibrium, imputation, positive selection, meta-analysis, genome-wide association study * Corresponding author: Wellcome Trust Centre for Human Genetics, Roosevelt Drive, Oxford OX3 7BN, United Kingdom. Email: [email protected], phone: +44 1865 287712, fax: +44 1865 287 501. ABSTRACT Current genome-wide surveys of common diseases and complex traits fundamentally aim to detect indirect associations where the SNPs carrying the association signals are not biologically active but are in linkage disequilibrium (LD) with some unknown functional polymorphisms. Reproducing any novel discoveries from these genome-wide scans in independent studies is now a prerequisite for the putative findings to be accepted. Significant differences in patterns of LD between populations can affect the portability of phenotypic associations when the replication effort or meta-analyses are attempted in populations that are distinct from the original population which the genome-wide study is performed in. Here we introduce a novel method for genome-wide analyses of LD variations between populations that allow the identification of candidate regions with different patterns of LD. The evidence of LD variation provided by the introduced method correlated with the degree of differences in the frequencies of the most common haplotype across the populations.
    [Show full text]
  • Multidimensional Informatic Deconvolution Defines Gender
    Mechanisms of Ageing and Development 184 (2019) 111150 Contents lists available at ScienceDirect Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev Multidimensional informatic deconvolution defines gender-specific roles of hypothalamic GIT2 in aging trajectories T Jaana van Gastela, Huan Caib, Wei-Na Congb, Wayne Chadwickc, Caitlin Daimonb, Hanne Leysena, Jhana O. Hendrickxa, Robin De Scheppera, Laura Vangenechtena, Jens Van Turnhouta, Jasper Verswyvela, Kevin G. Beckerd, Yongqing Zhangd, Elin Lehrmannd, William H. Wood IIId, Bronwen Martinb,e,**,1, Stuart Maudsleya,c,*,1 a Receptor Biology Lab, Department of Biomedical Sciences, University of Antwerp, 2610, Wilrijk, Belgium b Metabolism Unit, Laboratory of Clinical Investigation, National Institute on Aging, National Institutes of Health, Biomedical Research Center, 251 Bayview Boulevard, Baltimore, MD, 21224, United States c Receptor Pharmacology Unit, Laboratory of Neuroscience, National Institute on Aging, National Institutes of Health, Biomedical Research Center, 251 Bayview Boulevard, Baltimore, MD, 21224, United States d Gene Expression and Genomics Unit, Laboratory of Genetics and Genomics, National Institute on Aging, National Institutes of Health, Biomedical Research Center, 251 Bayview Boulevard, Baltimore, MD, 21224, United States e Faculty of Pharmacy, Biomedical and Veterinary Sciences, University of Antwerp, 2610, Wilrijk, Belgium ARTICLE INFO ABSTRACT Keywords: In most species, females live longer than males. An understanding of this female longevity advantage will likely GIT2 uncover novel anti-aging therapeutic targets. Here we investigated the transcriptomic responses in the hy- Longevity pothalamus – a key organ for somatic aging control – to the introduction of a simple aging-related molecular Aging perturbation, i.e. GIT2 heterozygosity. Our previous work has demonstrated that GIT2 acts as a network con- Female troller of aging.
    [Show full text]
  • NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer
    Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-7-2018 Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer Jairo Ramos [email protected] Follow this and additional works at: https://digitalcommons.fiu.edu/etd Part of the Clinical Epidemiology Commons Recommended Citation Ramos, Jairo, "Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer" (2018). FIU Electronic Theses and Dissertations. 3872. https://digitalcommons.fiu.edu/etd/3872 This work is brought to you for free and open access by the University Graduate School at FIU Digital Commons. It has been accepted for inclusion in FIU Electronic Theses and Dissertations by an authorized administrator of FIU Digital Commons. For more information, please contact [email protected]. FLORIDA INTERNATIONAL UNIVERSITY Miami, Florida DECIPHER MECHANISMS BY WHICH NUCLEAR RESPIRATORY FACTOR ONE (NRF1) COORDINATES CHANGES IN THE TRANSCRIPTIONAL AND CHROMATIN LANDSCAPE AFFECTING DEVELOPMENT AND PROGRESSION OF INVASIVE BREAST CANCER A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in PUBLIC HEALTH by Jairo Ramos 2018 To: Dean Tomás R. Guilarte Robert Stempel College of Public Health and Social Work This dissertation, Written by Jairo Ramos, and entitled Decipher Mechanisms by Which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer, having been approved in respect to style and intellectual content, is referred to you for judgment.
    [Show full text]
  • And Calcium PIX Proteins Β the Concerted Action of GIT1/ Derived Mast Cells Is Regulated by − Marrow Microtubule Nucleation I
    Published March 27, 2015, doi:10.4049/jimmunol.1402459 The Journal of Immunology Microtubule Nucleation in Mouse Bone Marrow–Derived Mast Cells Is Regulated by the Concerted Action of GIT1/ bPIX Proteins and Calcium Vadym Sulimenko,* Zuzana Ha´jkova´,*,† Marke´ta Cernohorska ´,*,† Tetyana Sulimenko,* Vladimı´ra Sla´dkova´,* Lubica Dra´berova´,‡ Stanislav Vinopal,* Eduarda Dra´berova´,* and Pavel Dra´ber* Ag-mediated activation of mast cells initiates signaling events leading to Ca2+ response, release of allergic mediators from cytoplasmic granules, and synthesis of cytokines and chemokines. Although microtubule rearrangement during activation has been described, the molecular mechanisms that control their remodeling are largely unknown. Microtubule nucleation is mediated by complexes that are formed by g-tubulin and g-tubulin complex proteins. In this study, we report that, in bone marrow–derived mast cells (BMMCs), g-tubulin interacts with p21-activated kinase interacting exchange factor b (bPIX) and G protein–coupled receptor kinase-interacting protein (GIT)1. Microtubule regrowth experiments showed that the depletion of bPIX in BMMCs stimulated microtubule nucleation, whereas depletion of GIT1 led to the inhibition of nucleation compared with control cells. Phenotypic rescue experiments confirmed that bPIX and GIT1 represent negative and positive regulators of microtubule nucle- ation in BMMCs, respectively. Live-cell imaging disclosed that both proteins are associated with centrosomes. Immunoprecipi- tation and pull-down experiments revealed that an enhanced level of free cytosolic Ca2+ affects g-tubulin properties and stimulates the association of GIT1 and g-tubulin complex proteins with g-tubulin. Microtubule nucleation also was affected by Ca2+ level. Moreover, in activated BMMCs, g-tubulin formed complexes with tyrosine-phosphorylated GIT1.
    [Show full text]
  • GIT2 (NM 139201) Human Tagged ORF Clone – RC200045 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC200045 GIT2 (NM_139201) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GIT2 (NM_139201) Human Tagged ORF Clone Tag: Myc-DDK Symbol: GIT2 Synonyms: CAT-2; CAT2; PKL Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 GIT2 (NM_139201) Human Tagged ORF Clone – RC200045 ORF Nucleotide >RC200045 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGAAACGGCTCCGGAGCAGCGAGGTGTGCGCTGACTGCAGCGGGCCGGATCCTTCCTGGGCATCAG TAAATAGGGGAACGTTTTTATGTGATGAGTGCTGCAGTGTCCATCGGAGTCTAGGGCGCCATATCTCCCA AGTGAGGCATCTGAAACACACACCGTGGCCTCCAACACTGCTTCAGATGGTTGAGACCTTGTATAATAAC GGTGCTAACTCTATATGGGAGCATTCTTTGCTGGACCCTGCGTCTATTATGAGTGGAAGACGTAAAGCTA ATCCACAGGATAAAGTACATCCCAATAAAGCGGAATTCATCAGAGCCAAGTATCAGATGTTAGCGTTCGT CCATCGCTTGCCCTGCCGGGATGACGATAGTGTGACTGCCAAAGATCTTAGCAAGCAACTCCATTCGAGC GTGAGAACAGGGAATCTTGAAACCTGTTTGAGACTGTTATCTTTAGGAGCACAAGCCAACTTCTTTCATC CTGAAAAAGGAAACACCCCACTCCATGTTGCCTCCAAAGCAGGGCAGATTTTACAGGCTGAATTATTGGC AGTATATGGAGCAGACCCAGGCACACAGGATTCTAGTGGGAAAACTCCCGTTGATTATGCAAGGCAAGGA
    [Show full text]
  • Oxidized Phospholipids Regulate Amino Acid Metabolism Through MTHFD2 to Facilitate Nucleotide Release in Endothelial Cells
    ARTICLE DOI: 10.1038/s41467-018-04602-0 OPEN Oxidized phospholipids regulate amino acid metabolism through MTHFD2 to facilitate nucleotide release in endothelial cells Juliane Hitzel1,2, Eunjee Lee3,4, Yi Zhang 3,5,Sofia Iris Bibli2,6, Xiaogang Li7, Sven Zukunft 2,6, Beatrice Pflüger1,2, Jiong Hu2,6, Christoph Schürmann1,2, Andrea Estefania Vasconez1,2, James A. Oo1,2, Adelheid Kratzer8,9, Sandeep Kumar 10, Flávia Rezende1,2, Ivana Josipovic1,2, Dominique Thomas11, Hector Giral8,9, Yannick Schreiber12, Gerd Geisslinger11,12, Christian Fork1,2, Xia Yang13, Fragiska Sigala14, Casey E. Romanoski15, Jens Kroll7, Hanjoong Jo 10, Ulf Landmesser8,9,16, Aldons J. Lusis17, 1234567890():,; Dmitry Namgaladze18, Ingrid Fleming2,6, Matthias S. Leisegang1,2, Jun Zhu 3,4 & Ralf P. Brandes1,2 Oxidized phospholipids (oxPAPC) induce endothelial dysfunction and atherosclerosis. Here we show that oxPAPC induce a gene network regulating serine-glycine metabolism with the mitochondrial methylenetetrahydrofolate dehydrogenase/cyclohydrolase (MTHFD2) as a cau- sal regulator using integrative network modeling and Bayesian network analysis in human aortic endothelial cells. The cluster is activated in human plaque material and by atherogenic lipo- proteins isolated from plasma of patients with coronary artery disease (CAD). Single nucleotide polymorphisms (SNPs) within the MTHFD2-controlled cluster associate with CAD. The MTHFD2-controlled cluster redirects metabolism to glycine synthesis to replenish purine nucleotides. Since endothelial cells secrete purines in response to oxPAPC, the MTHFD2- controlled response maintains endothelial ATP. Accordingly, MTHFD2-dependent glycine synthesis is a prerequisite for angiogenesis. Thus, we propose that endothelial cells undergo MTHFD2-mediated reprogramming toward serine-glycine and mitochondrial one-carbon metabolism to compensate for the loss of ATP in response to oxPAPC during atherosclerosis.
    [Show full text]
  • GIT/PIX Condensates Are Modular and Ideal for Distinct Compartmentalized Cell Signaling
    Article GIT/PIX Condensates Are Modular and Ideal for Distinct Compartmentalized Cell Signaling Graphical Abstract Authors Jinwei Zhu, Qingqing Zhou, Yitian Xia, ..., Mengjuan Peng, Rongguang Zhang, Mingjie Zhang Correspondence [email protected] (J.Z.), [email protected] (R.Z.), [email protected] (M.Z.) In Brief Cells often concentrate limited amounts of enzymes at specific subcellular regions for distinct functions. Zhu et al. show that the small GTPase regulatory enzymes GIT and PIX autonomously form phase- separated condensates without the need for scaffolding molecules. GIT/PIX condensates are modular and positioned at specific cellular compartments for distinct signaling. Highlights d Small GTPase regulatory enzymes GIT and PIX bind to each other very tightly d The GIT/PIX complex forms highly concentrated condensates via phase separation d Formation of GIT/PIX condensates does not require other scaffold molecules d GIT/PIX condensates are modular for signaling in distinct cellular compartments Zhu et al., 2020, Molecular Cell 79, 1–15 September 3, 2020 ª 2020 Elsevier Inc. https://doi.org/10.1016/j.molcel.2020.07.004 ll Please cite this article in press as: Zhu et al., GIT/PIX Condensates Are Modular and Ideal for Distinct Compartmentalized Cell Signaling, Molecular Cell (2020), https://doi.org/10.1016/j.molcel.2020.07.004 ll Article GIT/PIX Condensates Are Modular and Ideal for Distinct Compartmentalized Cell Signaling Jinwei Zhu,1,2,6,* Qingqing Zhou,3,6 Yitian Xia,1 Lin Lin,1,2 Jianchao Li,3 Mengjuan Peng,1,4 Rongguang Zhang,1,4,*
    [Show full text]
  • Toward an Understanding of the Protein Interaction Network of the Human Liver
    Molecular Systems Biology 7; Article number 536; doi:10.1038/msb.2011.67 Citation: Molecular Systems Biology 7: 536 & 2011 EMBO and Macmillan Publishers Limited All rights reserved 1744-4292/11 www.molecularsystemsbiology.com REPORT Toward an understanding of the protein interaction network of the human liver Jian Wang1,6, Keke Huo2,6, Lixin Ma3,6, Liujun Tang1,6, Dong Li1,6, Xiaobi Huang1, Yanzhi Yuan1, Chunhua Li3, Wei Wang2, Wei Guan1, Hui Chen1, Chaozhi Jin1, Junchen Wei1, Wanqiao Zhang1, Yongsheng Yang1, Qiongming Liu1, Ying Zhou1, Cuili Zhang1, Zhihao Wu1, Wangxiang Xu1, Ying Zhang1, Tao Liu1, Donghui Yu1, Yaping Zhang1, Liang Chen3, Dewu Zhu3, Xing Zhong3, Lixin Kang3, Xiang Gan3, Xiaolan Yu3,QiMa2, Jing Yan2, Li Zhou2, Zhongyang Liu1, Yunping Zhu1, Tao Zhou4, Fuchu He1,5,* and Xiaoming Yang1,* 1 State Key Laboratory of Proteomics, Beijing Proteome Research Center, Beijing Institute of Radiation Medicine, Beijing, China, 2 State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai, China, 3 Institute of Biochemistry and Molecular Biology, Hubei University, Wuhan, China, 4 National Center of Biomedical Analysis, Beijing, China and 5 Institutes of Biomedical Sciences, Fudan University, Shanghai, China 6 These authors contributed equally to this work * Corresponding author. X Yang or F He, State Key Laboratory of Proteomics, Beijing Proteome Research Center, Beijing Institute of Radiation Medicine, No. 33, Life Science Park Road, Changping District, Beijing 102206, China. Tel.:/Fax: þ 86 106 817 6833; E-mail: [email protected] or Tel.:/Fax: þ 86 108 070 5155; E-mail: [email protected] Received 4.4.11; accepted 5.8.11 Proteome-scale protein interaction maps are available for many organisms, ranging from bacteria, yeast, worms and flies to humans.
    [Show full text]
  • A Computational Assessment of ARHGEF6 Gene ⇑ Yashvant M
    The Egyptian Journal of Medical Human Genetics 19 (2018) 333–344 Contents lists available at ScienceDirect The Egyptian Journal of Medical Human Genetics journal homepage: www.sciencedirect.com Original article Pathogenic predictions of non-synonymous variants and their impacts: A computational assessment of ARHGEF6 gene ⇑ Yashvant M. Khimsuriya, Jenabhai B. Chauhan Post Graduate Department of Genetics, Ashok & Rita Patel Institute of Integrated Study & Research in Biotechnology & Allied Sciences (ARIBAS), New Vallabh Vidyanagar, Anand, India article info abstract Article history: Introduction: ARHGEF6, a key member and activator of RhoGTPases family that is involved in G-Protein Received 21 March 2018 Coupled receptor (GPCR) pathway and stimulate Rho dependent signals in the brain, and mutations in Accepted 8 May 2018 this gene can cause intellectual disability (ID) in Human. Therefore, we aimed to study the consequences Available online 23 August 2018 of ARHGEF6 non-synonymous mutations by using advanced computational methods. Methods: Classification of the genetic mutations in ARHGEF6 gene was performed according to Ensembl Keywords: Genome Database and data mining was done using ensemble tools. The functional and disease effect of Computational methods missense mutations, and pathogenic characteristics of amino acid substitutions of ARHGEF6 were ana- ARHGEF6 lyzed using eleven diversified computational tools and servers. Intellectual disability Missense mutation Results: Overall, 47 ARHGEF6 non-synonymous (NS) variants were predicted to be deleterious by SIFT, Polyphen2 and PROVEAN scores. Above that, SNPs&GO and PhD SNP were further graded 21 customarily pathogenic NS-variants. Protein stability analysis resulted in the significant change in terms of DDGof most identified NS-variants, except K609I.
    [Show full text]
  • Downloaded from Reactome (Release 55), the Latest (BJT), All Supplemented with 10% Fetal Bovine Serum Version of KEGG (November 2015), Biocarte (January (FBS)
    Sutherland et al. BMC Molecular Biol (2017) 18:19 DOI 10.1186/s12867-017-0096-x BMC Molecular Biology RESEARCH ARTICLE Open Access Splicing arrays reveal novel RBM10 targets, including SMN2 pre‑mRNA Leslie C. Sutherland1,2,3* , Philippe Thibault4, Mathieu Durand4, Elvy Lapointe4, Jose M. Knee1, Ariane Beauvais5, Irina Kalatskaya6, Sarah C. Hunt3, Julie J. Loiselle2, Justin G. Roy3, Sarah J. Tessier1, Gustavo Ybazeta1, Lincoln Stein6, Rashmi Kothary5,7, Roscoe Klinck4,8 and Benoit Chabot8 Abstract Background: RBM10 is an RNA binding protein involved in message stabilization and alternative splicing regulation. The objective of the research described herein was to identify novel targets of RBM10-regulated splicing. To accom- plish this, we downregulated RBM10 in human cell lines, using small interfering RNAs, then monitored alternative splicing, using a reverse transcription-PCR screening platform. Results: RBM10 knockdown (KD) provoked alterations in splicing events in 10–20% of the pre-mRNAs, most of which had not been previously identifed as RBM10 targets. Hierarchical clustering of the genes afected by RBM10 KD revealed good conservation of alternative exon inclusion or exclusion across cell lines. Pathway annotation showed RAS signaling to be most afected by RBM10 KD. Of particular interest was the fnding that splicing of SMN pre-mRNA, encoding the survival of motor neuron (SMN) protein, was infuenced by RBM10 KD. Inhibition of RBM10 resulted in preferential expression of the full-length, exon 7 retaining, SMN transcript in four cancer cell lines and one normal skin fbroblast cell line. SMN protein is expressed from two genes, SMN1 and SMN2, but the SMN1 gene is homozygously disrupted in people with spinal muscular atrophy; as a consequence, all of the SMN that is expressed in people with this disease is from the SMN2 gene.
    [Show full text]
  • Gene Targeting Protocols
    Beginners Guide to Gene Targeting updated February 2006 Prepared by Aurora Burds Connor, Manager of the Rippel Transgenic Facility at MIT • Step 1: Gather information about your gene & protein from the literature • Step 2: Get exon/intron sequence information about your gene • Step 3: Develop a general strategy - which exons to remove • Step 4: Obtain the genomic DNA for your gene • Step 5: Design the construct • Step 6: Develop the PCR screening strategy for the small arm and recombinations • Step 7: Design a Southern strategy for the long arm(s) • Step 8: Test your Southern strategy with mouse genomic DNA to get a wild type band • Step 9: Build your construct • Step 10: Prepare your DNA for electroporation Step 1: Gather the latest information about your gene & protein from the literature • What is the size of the protein in kD? • How many amino acids? • Where are the functional domains, binding domains, localization sequences? • Do you have full-length cDNA or EST sequence? • Is there any intron/exon information from mouse or human? • Are there any enhancers located in introns? • Are any products made with splice variants from the gene? A great place to start gathering data is the CMC Knowledgebase: http://data.cellmigration.org/cmckb/ Sometimes, this information is available for the human gene, but not for the mouse. Therefore, make sure you check publications for both species to gather the most information possible. You can search publications using PubMed at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed Do not rely completely on public websites for all your information because these can be out of date.
    [Show full text]