DOCSLIB.ORG

Oncostatin M‐Preconditioned Mesenchymal Stem Cells Alleviate

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oncostatin M‐Preconditioned Mesenchymal Stem Cells Alleviate Tissue Engineering and Regenerative Medicine TISSUE ENGINEERING AND REGENERATIVE MEDICINE aGraduate Institute of Oncostatin M-Preconditioned Mesenchymal Stem Biomedical Sciences, Division of Biotechnology, Cells Alleviate Bleomycin-Induced Pulmonary Fibrosis bDepartment of Medical Biotechnology and Through Paracrine Effects of the Hepatocyte Laboratory Science, cCenter for Molecular and Clinical Growth Factor Immunology, iDepartment of k Medicine, and Molecular YING-WEI LAN,a SI-MIN THENG,b TSUNG-TENG HUANG,b,c KONG-BUNG CHOO,d CHUAN-MU CHEN,e,f,g Medicine Research Center, HAN-PIN KUO,h,i,j KOWIT-YU CHONGa,b,h,k College of Medicine, Chang Gung University, Tao-Yuan, Key Words. Oncostatin M x Preconditioning x Stem cells x Bleomycin-induced pulmonary fibrosis x Taiwan, Republic of China; Hepatocyte growth factor dDepartment of Preclinical Sciences, Faculty of Medicine and Health Sciences, and ABSTRACT Centre for Stem Cell Mesenchymal stem cells (MSCs) are widely considered for treatment of pulmonary fibrosis based on Research, Universiti Tunku the anti-inflammatory, antifibrotic, antiapoptotic, and regenerative properties of the cells. Recently, Abdul Rahman, Selangor, elevated levels of oncostatin M (OSM) have been reported in the bronchoalveolar lavage fluid of a Malaysia; eDepartment of Life pulmonary fibrosis animal model and in patients. In this work, we aimed to prolong engrafted Sciences, fAgricultural MSC survival and to enhance the effectiveness of pulmonary fibrosis transplantation therapy by using Biotechnology Center, and OSM-preconditioned MSCs. OSM-preconditioned MSCs were shown to overexpress type 2 OSM re- ceptor (gp130/OSMRb) and exhibited high susceptibility to OSM, resulting in upregulation of the gRong-Hsing Translational paracrine factor, hepatocyte growth factor (HGF). Moreover, OSM-preconditioned MSCs enhanced Medicine Center, National cell proliferation and migration, attenuated transforming growth factor-b1- or OSM-induced extra- Chung Hsing University, cellular matrix production in MRC-5 fibroblasts through paracrine effects. In bleomycin-induced lung Taichung, Taiwan, Republic of fibrotic mice, transplantation of OSM-preconditioned MSCs significantly improved pulmonary re- China; hDepartment of spiratory functions and downregulated expression of inflammatory factors and fibrotic factors in Thoracic Medicine and the lung tissues. Histopathologic examination indicated remarkable amelioration of the lung fibro- jDepartment of Internal sis. LacZ-tagged MSCs were detected in the lung tissues of the OSM-preconditioned MSC-treated Medicine, Chang Gung mice 18 days after post-transplantation. Taken together, our data further demonstrated that HGF Memorial Hospital at Linkou, upregulation played an important role in mediating the therapeutic effects of transplanted OSM- STEM CELLS TRANSLATIONAL MEDICINE Tao-Yuan, Taiwan, Republic preconditioned MSCs in alleviating lung fibrosis in the mice. 2016;5:12017;6:1006–1017–12 of China Correspondence: Kowit-Yu Chong, Ph.D., Department of SIGNIFICANCE STATEMENT Medical Biotechnology and Laboratory Science, Chang Gung In this study, the investigation of a cytokine, oncostatin M (OSM), has been extended. The results University, 259 Wen-Hwa 1st showed that OSM preconditioning of mesenchymal stem cells (MSCs) could lead to comprehensive Road, Gui-Shan, Tao-Yuan, modification of gene regulation that enhances cell proliferation and migration and attenuates extracel- Taiwan 333, Republic of China. lular matrix production. Hence, transplantation of OSM-preconditioned MSCs improved pulmonary Telephone: 866-3-2118393; eE-Mail:-mail: kchong [email protected]@mail.cgu.edu.tw functions and reduced inflammatory and fibrotic mediators in a bleomycin-induced pulmonary fibrosis Received January 28, 2016; mouse model. The data further suggest that the upregulation of hepatocyte growth factor plays a key acceptedReceived forJanuary publication 28, 2016; August role in mediating the therapeutic effects of transplanted OSM-preconditioned MSCs. 29accepted, 2016; published for publicationOnline AugustFirst on29,O 2016.ctober 18, 2016. ©AlphaMed Press properties, modulation of immune responses, re- 1066-5099/2016/$20.00/0 INTRODUCTION pair of epithelial tissues, attenuation of extracel- http://dx.doi.org/ Idiopathic pulmonary fibrosis is a progressive lular matrix deposition, and modification of the 10.5966/sctm.2016-0054 and irreversible lung-restricted interstitial dis- microenvironment at the engraftment sites [4, 5]. This is an open access article ease characterized by alveolar epithelial cell injury, Inadditiontodirectcell-cellinteraction,MSCsalso under the terms of the Creative inflammatory cell infiltration, decrement of lung act via a paracrine mechanism in secreting soluble Commons Attribution License, volumes, and impaired pulmonary functions that factors that account for anti-inflammatory and which permits use, distribution eventually results in death [1, 2]. Different ap- antifibrotic effects in vitro and in vivo [6, 7]. How- and reproduction in any medium, provided the original work is proaches of mesenchymal stem cell (MSC)-based ever, a major challenge that is limiting the poten- properly cited. cell therapy have been reported for multiple lung tial of MSC-based cell therapy is the extensive loss diseases [3]. MSCs have the ability to specifically of transplanted cells and low paracrine activities target sites of injury, leading to antiapoptotic due to exposure to harsh microenvironmental STEM CELLS TRANSLATIONAL MEDICINE 2017;6:1006–10172016;5:1–12 www.StemCellsTM.comwww.StemCellsTM.com ©AlphaMedOc 2016 PressThe Authors 2016 STEM CELLS TRANSLATIONAL MEDICINE published by Wiley Periodicals, Inc. on behalf of AlphaMed Press ID: srinivasanv Time: 20:01 I Path: //chenas03/Cenpro/ApplicationFiles/Journals/Wiley/SCTM/Vol00603/170051/Comp/APPFile/JW-SCTM170051 2Lan, Theng, Huang et al. OSM-Preconditioned MSCs Ameliorate Lung Fibrosis1007 conditions and inflammation [8]. Ex vivo manipulation of MSCs and 1% penicillin/streptomycin and were incubated at 37°C is needed to enhance proliferation, migration, and antiapoptotic in a 5% CO2 incubator. Mouse macrophage-like cell line RAW264.7 capacity and to maximize the paracrine action of MSCs before (BCRC-60001) was purchased from Bioresource Collection and transplantation to improve the efficacy of MSCs transplantation Research Center. Cell lines were maintained in DMEM containing [9, 10]. Our previous study demonstrated that preconditioning 10% heat-inactivated FBS. MSCswithsublethalphysical stimulationby hypoxiaprior to trans- plantation bestowed higher cytoprotective abilities and exerted Oncostatin M Preconditioning better therapeutic effects in bleomycin (BLM)-induced pulmonary MSCs grown to confluence were treated with indicated concen- fibrotic mice [11]. In addition, a number of pharmacological pre- trations of OSM for 24 hours. Conditioned medium was collected – conditioning agents [12 14] have been shown to increase cell from MSCs that were cultured in the presence or absence of OSM. viability of engrafted cells through upregulating multiple prosurvival, antioxidant, or antiapoptotic genes and via enhanced paracrine shRNA Transduction effects, leading to improved functional recovery in an ischemic disease model. The hepatocytegrowth factor (HGF)shRNAclone (TRCN0000336131; Oncostatin M (OSM) is a pleiotropic cytokine that belongs to GGTAAAGGAGGCAGCTATAAA) targeted at the mouse HGF tran- the interleukin (IL)-6 subfamily that is upregulated in tissues of script was purchased from the National RNAi Core Facility, Aca- various airway diseases [15]. OSM has been shown to signal demia Sinica (Taipei, Taiwan, http://rnai.genmed.sinica.edu. through two receptors: The type 1 receptor is a heterodimer of tw). Lentiviral constructs were generated by using three pack- — — leukemia inhibitory factor receptor (LIFR) and gp130; the type aging plasmids pMDLg/pRRE, CMV-VSVG, and RSV-Rev in 2 receptor is a heterodimer of OSM receptor b chain (OSMRb) 293T cells, as described by Chen et al. [19]. MSCs were treated and gp130 [16]. However, mouse OSM exclusively binds to the with viral supernatant and polybrene for 24 hours before selec- type 2 receptorandexertsmultiple physiological functions through tion with 0.5 mg/ml puromycin. activating various signal cascades [16, 17]. In addition, enhancing the responsiveness of the damaged hepatocytes to interact with Cell Proliferation Test OSM by upregulating the OSMR significantly inhibited hepatocyte MSCs were plated at a density of 1 3 104 cells per well in a 12-well apoptosis andpromotedhepatocyteproliferation,leadingtoactive culture plate and incubated overnight to allow adhesion. The cells liver regeneration [18]. were cultured under serum-starved condition and treated with In this work, we investigated, in a mouse fibrotic lung model, the indicated concentration OSM for 24 or 48 hours before being whether OSM preconditioning of MSCs would upregulate expres- detached by trypsinization for cell count. sion of OSM receptors to enhance interaction with OSM to pro- mote survival of transplanted cells via enhanced cytoprotection Coculture MSCs With Fibroblast and the mechanism of such events. Two different coculture experiments were performed: (1) MSCs and MRC-5 cells were plated in transwells and six-well culture plates, respectively, and were cultured overnight. MSCs were MATERIALS AND METHODS then treated with the indicated OSM concentrations for 24 hours. Chemicals MRC-5 cells were treated with
Load more

Recommended publications
  • A Model of Inflammatory Arthritis Highlights a Role for Oncostatin M In
    Available online http://arthritis-research.com/content/7/1/R57 ResearchVol 7 No 1 article Open Access A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANKL Wang Hui1, Tim E Cawston1, Carl D Richards2 and Andrew D Rowan1 1Musculoskeletal Research Group, The Medical School, University of Newcastle, Newcastle upon Tyne, UK 2Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario, Canada Corresponding author: Andrew D Rowan, [email protected] Received: 21 Jul 2004 Revisions requested: 20 Sep 2004 Revisions received: 5 Oct 2004 Accepted: 11 Oct 2004 Published: 10 Nov 2004 Arthritis Res Ther 2005, 7:R57-R64 (DOI 10.1186/ar1460)http://arthritis-research.com/content/7/1/R57 © 2004 Hui et al., licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/ 2.0), which permits unrestricted use, distribution and reproduction in any medium, provided the original work is cited. Abstract Oncostatin M is a pro-inflammatory cytokine previously shown to RANK and its ligand RANKL in the inflammatory cells, in promote marked cartilage destruction both in vitro and in vivo inflamed synovium and in articular cartilage of knee joints treated when in combination with IL-1 or tumour necrosis factor alpha. with the cytokine combinations compared with expression in However, the in vivo effects of these potent cytokine joints treated with the cytokines alone or the control. This model combinations on bone catabolism are unknown. Using of inflammatory arthritis demonstrates that, in vivo, oncostatin M adenoviral gene transfer, we have overexpressed oncostatin M in combination with either IL-1 or tumour necrosis factor alpha in combination with either IL-1 or tumour necrosis factor alpha represents cytokine combinations that promote bone intra-articularly in the knees of C57BL/6 mice.
    [Show full text]
  • Oncostatin M Exhibit Elevated Responsiveness to IL-31 Receptor
    IL-31 Receptor (IL-31RA) Knockout Mice Exhibit Elevated Responsiveness to Oncostatin M This information is current as Janine Bilsborough, Sherri Mudri, Eric Chadwick, Brandon of September 28, 2021. Harder and Stacey R. Dillon J Immunol 2010; 185:6023-6030; Prepublished online 18 October 2010; doi: 10.4049/jimmunol.0902769 http://www.jimmunol.org/content/185/10/6023 Downloaded from References This article cites 29 articles, 6 of which you can access for free at: http://www.jimmunol.org/content/185/10/6023.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology IL-31 Receptor (IL-31RA) Knockout Mice Exhibit Elevated Responsiveness to Oncostatin M Janine Bilsborough,1 Sherri Mudri,1 Eric Chadwick,2 Brandon Harder,3 and Stacey R. Dillon IL-31 signals through the heterodimeric receptor IL-31RA and oncostatin M receptor (OSMR), and has been linked with the development of atopic dermatitis, a Th2 cytokine-associated disease in humans.
    [Show full text]
  • Respiratory Viral Infection Function for Innate Defense Against Airway Epithelial Versus Immune Cell Stat1
    Airway Epithelial versus Immune Cell Stat1 Function for Innate Defense against Respiratory Viral Infection This information is current as Laurie P. Shornick, Audrey G. Wells, Yong Zhang, Anand of September 27, 2021. C. Patel, Guangming Huang, Kazutaka Takami, Moises Sosa, Nikhil A. Shukla, Eugene Agapov and Michael J. Holtzman J Immunol 2008; 180:3319-3328; ; doi: 10.4049/jimmunol.180.5.3319 Downloaded from http://www.jimmunol.org/content/180/5/3319 Supplementary http://www.jimmunol.org/content/suppl/2008/02/20/180.5.3319.DC1 Material http://www.jimmunol.org/ References This article cites 47 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/180/5/3319.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Airway Epithelial versus Immune Cell Stat1 Function for Innate Defense against Respiratory Viral Infection1 Laurie P.
    [Show full text]
  • Oncostatin M Is a Proinflammatory Mediator. in Vivo Effects Correlate with Endothelial Cell Expression of Inflammatory Cytokines and Adhesion Molecules
    Oncostatin M is a proinflammatory mediator. In vivo effects correlate with endothelial cell expression of inflammatory cytokines and adhesion molecules. V Modur, … , G A Zimmerman, T M McIntyre J Clin Invest. 1997;100(1):158-168. https://doi.org/10.1172/JCI119508. Research Article Oncostatin M is a member of the IL-6 family of cytokines that is primarily known for its effects on cell growth. Endothelial cells have an abundance of receptors for oncostatin M, and may be its primary target. We determined if oncostatin M induces a key endothelial cell function, initiation of the inflammatory response. We found that subcutaneous injection of oncostatin M in mice caused an acute inflammatory reaction. Oncostatin M in vitro stimulated: (a) polymorphonuclear leukocyte (PMN) transmigration through confluent monolayers of primary human endothelial cells; (b) biphasic PMN adhesion through rapid P-selectin expression, and delayed adhesion mediated by E-selectin synthesis; (c) intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 accumulation; and (d) the expression of PMN activators IL-6, epithelial neutrophil activating peptide-78, growth-related cytokine alpha and growth-related cytokine beta without concomitant IL-8 synthesis. The nature of the response to oncostatin M varied with concentration, suggesting high and low affinity oncostatin M receptors independently stimulated specific responses. Immunohistochemistry showed that macrophage-like cells infiltrating human aortic aneurysms expressed oncostatin M, so it is present during a chronic inflammatory reaction. Therefore, oncostatin M, but not other IL-6 family members, fulfills Koch's postulates as an inflammatory mediator. Since its effects on endothelial cells differ significantly from established mediators like TNFalpha, it may uniquely contribute to the inflammatory cycle.
    [Show full text]
  • Oncostatin M Regulation of Inflammatory Responses By
    Regulation of Inflammatory Responses by Oncostatin M Philip M. Wallace,1,2* John F. MacMaster,† Katherine A. Rouleau,† T. Joseph Brown,* James K. Loy,† Karen L. Donaldson,3* and Alan F. Wahl3* Oncostatin M (OM) is a pleiotropic cytokine produced late in the activation cycle of T cells and macrophages. In vitro it shares properties with related proteins of the IL-6 family of cytokines; however, its in vivo properties and physiological function are as yet ill defined. We show that administration of OM inhibited bacterial LPS-induced production of TNF-a and lethality in a dose-dependent manner. Consistent with these findings, OM potently suppressed inflammation and tissue destruction in murine models of rheumatoid arthritis and multiple sclerosis. T cell function and Ab production were not impaired by OM treatment. Taken together these data indicate the activities of this cytokine in vivo are antiinflammatory without concordant immunosuppression. The Journal of Immunology, 1999, 162: 5547–5555. he normal development of an inflammatory response must from the inflammatory effector phase back to homeostasis also are be rapidly followed by the engagement of a feedback sys- being evaluated for their clinical potential as drugs. The cytokines T tem to minimize adventitious tissue damage and regulate IL-10 and IL-11 both appear to accelerate this process and their the eventual return to homeostasis. This system involves a multi- administration have proven effective in resolving several animal tude of regulators including cytokines, adhesion molecules, pro- models of chronic inflammatory disease (10). teases, corticosteroids, and subsequent regulators of each of these Oncostatin M (OM)4 is a pleiotropic cytokine that is produced agents.
    [Show full text]
  • Potential Target Genes (Whole List)
    Potential target genes (whole list) 1. MGC3200 hypothetical protein MGC3200, LocusLink=84265 2. FLJ20277 hypothetical protein FLJ20277, LocusLink=55624 3. POU2F1 POU domain, class 2, transcription factor 1, LocusLink=5451 4. EFNA3 ephrin-A3, LocusLink=1944 5. OAZ3 ornithine decarboxylase antizyme 3, LocusLink=51686 6. FLJ20139 hypothetical protein FLJ20139, LocusLink=54833 7. ARHC ras homolog gene family, member C, LocusLink=389 8. CRABP2 cellular retinoic acid-binding protein 2, LocusLink=1382 9. SIAT6 sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) 10. FLJ13181 hypothetical protein FLJ13181, LocusLink=80263 11. TNFRSF14 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator); 12. NUF2R hypothetical protein NUF2R, LocusLink=83540 13. PTAFR platelet-activating factor receptor, LocusLink=5724 14. LOC57147 hypothetical protein LOC57147, LocusLink=57147 15. GFI1 growth factor independent 1, LocusLink=2672 16. FLJ11220 hypothetical protein FLJ11220, LocusLink=54665 17. KIAA0673 KIAA0673 protein, LocusLink=23128 18. FLJ23323 hypothetical protein FLJ23323, LocusLink=79707 19. CEZANNE zinc finger protein Cezanne, LocusLink=56957 20. KIAA0736 KIAA0736 gene product, LocusLink=9900 21. KIAA0761 Mid-1-related chloride channel 1, LocusLink=23155 22. DD96 epithelial protein up-regulated in carcinoma, membrane associated protein 17 23. DDOST dolichyl-diphosphooligosaccharide-protein glycosyltransferase, LocusLink=1 24. FLJ10349 hypothetical protein FLJ10349, LocusLink=54707 25. FLJ12455 hypothetical protein FLJ12455, LocusLink=63906 26. DKFZP564D0478 hypothetical protein DKFZp564D0478, LocusLink=84065 27. NCF2 neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2) 28. AP4B1 adaptor-related protein complex 4, beta 1 subunit, LocusLink=10717 29. ASML3B acid sphingomyelinase-like phosphodiesterase, LocusLink=27293 30. CLASPIN homolog of Xenopus Claspin, LocusLink=63967 31. FLJ20435 hypothetical protein FLJ20435, LocusLink=54933 32.
    [Show full text]
  • Crystal Structure and Functional Dissection of the Cytostatic Cytokine
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Research Article 863 Crystal structure and functional dissection of the cytostatic cytokine oncostatin M Marc C Deller1,2†#, Keith R Hudson2‡#, Shinji Ikemizu1, Jerónimo Bravo1§, E Yvonne Jones1* and John K Heath2 Background: The cytokine oncostatin M (OSM) inhibits growth of Addresses: 1Cancer Research Campaign Receptor certain tumour-derived cells, induces proliferation in other cell types Structure Group, Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, (e.g. haemangioblasts) and is a mediator of inflammatory responses. Its University of Oxford, Roosevelt Drive, Oxford OX3 mechanism of action is via specific binding to gp130 and either the leukaemia 7BN, UK and 2Cancer Research Campaign Growth inhibitory factor receptor (LIFR) or oncostatin M receptor (OSMR) systems Factors Group, School of Biochemistry, University of at the cell surface to form an active signalling complex. Birmingham, Edgbaston, Birmingham B15 2TT, UK. Present addresses: †Yale University School of Results: We report here the crystal structure of human oncostatin M (hOSM) Medicine, Department of Pharmacology, Sterling along with mutagenesis data which map the receptor-binding epitopes of the Hall of Medicine, PO Box 208066, New Haven, molecule. The structure was determined to a resolution of 2.2 Å and conforms CT 06520-8066, USA, ‡Genesis Research and to the haematopoietin cytokine up-up-down-down four-helix bundle topology. Development, 1 Fox Street, Parnell, Auckland, New Zealand and §Laboratory of Molecular Biology, The site 2 epitope, responsible for gp130 binding, is centred around Gly120 Medical Research Council Centre, Hills Road, which forms a ‘dimple’ on the surface of the molecule located on helices A and Cambridge CB2 2QH, UK.
    [Show full text]
  • Oncostatin M Suppresses Activation of IL-17/Th17 Via SOCS3 Regulation in CD4+ T Cells
    Oncostatin M Suppresses Activation of IL-17/Th17 via SOCS3 Regulation in CD4 + T Cells This information is current as Hye-Jin Son, Seung Hoon Lee, Seon-Yeong Lee, of September 28, 2021. Eun-Kyung Kim, Eun-Ji Yang, Jae-Kyung Kim, Hyeon-Beom Seo, Sung-Hwan Park and Mi-La Cho J Immunol published online 16 January 2017 http://www.jimmunol.org/content/early/2017/01/15/jimmun ol.1502314 Downloaded from Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 28, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/198/12/4879.full.pdf The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published January 16, 2017, doi:10.4049/jimmunol.1502314 The Journal of Immunology Oncostatin M Suppresses Activation of IL-17/Th17 via SOCS3 Regulation in CD4+ T Cells Hye-Jin Son,*,1 Seung Hoon Lee,*,1 Seon-Yeong Lee,*,1 Eun-Kyung Kim,* Eun-Ji Yang,* Jae-Kyung Kim,* Hyeon-Beom Seo,* Sung-Hwan Park,*,2 and Mi-La Cho*,†,2 Oncostatin M (OSM) is a pleiotropic cytokine and a member of the IL-6 family.
    [Show full text]
  • Hippo Signaling Interactions with Wnt/Β-Catenin and Notch Signaling Repress Liver Tumorigenesis
    The Journal of Clinical Investigation RESEARCH ARTICLE Hippo signaling interactions with Wnt/β-catenin and Notch signaling repress liver tumorigenesis Wantae Kim,1,2 Sanjoy Kumar Khan,1,2 Jelena Gvozdenovic-Jeremic,1 Youngeun Kim,3 Jason Dahlman,1 Hanjun Kim,1,2 Ogyi Park,4 Tohru Ishitani,5 Eek-hoon Jho,3 Bin Gao,4 and Yingzi Yang1,2 1Genetic Disease Research Branch, National Human Genome Research Institute (NHGRI), NIH, Bethesda, Maryland, USA. 2Department of Developmental Biology, Harvard School of Dental Medicine (HSDM), Boston, Massachusetts, USA. 3Department of Life Sciences, University of Seoul, Seoul, South Korea. 4Section on Liver Biology, National Institute on Alcohol Abuse and Alcoholism (NIAAA), NIH, Bethesda, Maryland, USA. 5Division of Cell Regulation Systems, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan. Malignant tumors develop through multiple steps of initiation and progression, and tumor initiation is of singular importance in tumor prevention, diagnosis, and treatment. However, the molecular mechanism whereby a signaling network of interacting pathways restrains proliferation in normal cells and prevents tumor initiation is still poorly understood. Here, we have reported that the Hippo, Wnt/β-catenin, and Notch pathways form an interacting network to maintain liver size and suppress hepatocellular carcinoma (HCC). Ablation of the mammalian Hippo kinases Mst1 and Mst2 in liver led to rapid HCC formation and activated Yes-associated protein/WW domain containing transcription regulator 1 (YAP/TAZ), STAT3, Wnt/β-catenin, and Notch signaling. Previous work has shown that abnormal activation of these downstream pathways can lead to HCC. Rigorous genetic experiments revealed that Notch signaling forms a positive feedback loop with the Hippo signaling effector YAP/TAZ to promote severe hepatomegaly and rapid HCC initiation and progression.
    [Show full text]
  • Molecular Signatures Differentiate Immune States in Type 1 Diabetes Families
    Page 1 of 65 Diabetes Molecular signatures differentiate immune states in Type 1 diabetes families Yi-Guang Chen1, Susanne M. Cabrera1, Shuang Jia1, Mary L. Kaldunski1, Joanna Kramer1, Sami Cheong2, Rhonda Geoffrey1, Mark F. Roethle1, Jeffrey E. Woodliff3, Carla J. Greenbaum4, Xujing Wang5, and Martin J. Hessner1 1The Max McGee National Research Center for Juvenile Diabetes, Children's Research Institute of Children's Hospital of Wisconsin, and Department of Pediatrics at the Medical College of Wisconsin Milwaukee, WI 53226, USA. 2The Department of Mathematical Sciences, University of Wisconsin-Milwaukee, Milwaukee, WI 53211, USA. 3Flow Cytometry & Cell Separation Facility, Bindley Bioscience Center, Purdue University, West Lafayette, IN 47907, USA. 4Diabetes Research Program, Benaroya Research Institute, Seattle, WA, 98101, USA. 5Systems Biology Center, the National Heart, Lung, and Blood Institute, the National Institutes of Health, Bethesda, MD 20824, USA. Corresponding author: Martin J. Hessner, Ph.D., The Department of Pediatrics, The Medical College of Wisconsin, Milwaukee, WI 53226, USA Tel: 011-1-414-955-4496; Fax: 011-1-414-955-6663; E-mail: [email protected]. Running title: Innate Inflammation in T1D Families Word count: 3999 Number of Tables: 1 Number of Figures: 7 1 For Peer Review Only Diabetes Publish Ahead of Print, published online April 23, 2014 Diabetes Page 2 of 65 ABSTRACT Mechanisms associated with Type 1 diabetes (T1D) development remain incompletely defined. Employing a sensitive array-based bioassay where patient plasma is used to induce transcriptional responses in healthy leukocytes, we previously reported disease-specific, partially IL-1 dependent, signatures associated with pre and recent onset (RO) T1D relative to unrelated healthy controls (uHC).
    [Show full text]
  • Diverse Gene Expression and DNA Methylation Profiles Correlate with Differential Adaptation of Breast Cancer Cells to the Antiestrogens Tamoxifen and Fulvestrant
    Research Article Diverse Gene Expression and DNA Methylation Profiles Correlate with Differential Adaptation of Breast Cancer Cells to the Antiestrogens Tamoxifen and Fulvestrant Meiyun Fan,1 Pearlly S. Yan,2 Cori Hartman-Frey,1 Lei Chen,1 Henry Paik,1 Samuel L. Oyer,1 Jonathan D. Salisbury,1 Alfred S.L. Cheng,2 Lang Li,3 Phillip H. Abbosh,1 Tim H-M. Huang,2 and Kenneth P. Nephew1,4,5 1Medical Sciences, Indiana University School of Medicine, Bloomington, Indiana; 2Division of Human Cancer Genetics, Comprehensive Cancer Center, Ohio State University, Columbus, Ohio; 3Division of Biostatistics, Department of Medicine and 4Department of Cellular and Integrative Physiology, Indiana University School of Medicine; and 5Indiana University Cancer Center, Indianapolis, Indiana Abstract Introduction The development of targeted therapies for antiestrogen- The steroid hormone estrogen is strongly implicated in the resistant breast cancer requires a detailed understanding development and progression of breast cancer (1). The primary of its molecular characteristics. To further elucidate the mediator of estrogen action in breast cancer cells is estrogen molecular events underlying acquired resistance to the receptor a (ERa), a ligand-activated transcription factor (1). antiestrogens tamoxifen and fulvestrant, we established Consequently, the leading drugs used for endocrine therapy of drug-resistant sublines from a single colony of hormone- breast cancer all block ERa activity, including antiestrogens (i.e., dependent breast cancer MCF7 cells. These model systems tamoxifen and fulvestrant) and aromatase inhibitors (2). Despite allowed us to examine the cellular and molecular changes the efficacy and favorable safety profile of these agents, the use of induced by antiestrogens in the context of a uniform clonal endocrine therapy is limited by the onset of drug resistance, in background.
    [Show full text]
  • Anti-Interferon-Alpha/Beta Receptor 1 (I4902)
    Anti-Interferon-/ Receptor 1 produced in goat, affinity isolated antibody Catalog Number I4902 Synonym: Anti-IFN-/ R1 IFN/R1 is very responsive to type I interferons and bind to IFN- and IFN- subtypes. It is also functionally Product Description involved in signal transduction because of its Anti-Interferon-/ Receptor 1 is produced in goat using association with the cytoplasmic tyrosine kinase JAK1.4 as immunogen a purified recombinant human The type I interferons, and , are produced by interferon-/ receptor 1 extracellular domain, leukocytes ( subunits), fibroblasts ( subtypes), expressed in Sf21 insect cells. Affinity isolated antibody lymphocytes ( subtypes), and ruminant embryos is obtained from goat anti-IFN/R1 antiserum by (subtypes).5 Interferon receptors are generally found on immunospecific purification which removes essentially most human cell types whatever their origin, even on all goat serum proteins, including immunoglobulins, cells poorly responsive to interferon. IFN/R1 is which do not specifically bind to the peptide. expressed on the cell surface in a variety of human cell lines.1 Anti-Interferon-/ Receptor 1 recognizes recombinant human IFN-/ R by various immunochemical Reagent techniques including immunoblotting and flow Lyophilized from 0.2 m-filtered solution in phosphate cytometry. Based on immunoblotting, this antibody buffered saline containing carbohydrates. shows no cross-reactivity with recombinant human IFN- RI and IFN- RII. Immunoblotting of lysates from Precautions and Disclaimer a variety of human cell lines showed that IFN/R1 has This product is for R&D use only, not for drug, an apparent molecular mass of 135 kDa.1 household, or other uses. Please consult the Safety Data Sheet for information regarding hazards and safe IFN/R1 is a member of the cytokine receptor handling practices.
    [Show full text]