SUPPLEMENTAL INFORMATION
Titels and legends to 5 Supplemental Figures and 4 Supplemental Tables
5 Supplementary Figures
4 Supplementary Tables
SI METHODS
Titles and Legends to Supplemental Figures and Tables
Supplemental Figure 1. Definition of Hodgkin- and non-Hodgkin-specific accessible chromatin. (A) Examples of genes showing NH-specific (IGH, left) and HRS-specific (LTA,
TNF, right) increased chromatin accessibility. For details see legend to Fig. 1. (B) Definition of HRS- and NH-specific distal DHS-sets. The heat map on the left shows the L428 over Reh
DNaseI-Seq FC. HRS-(red) and NH-(green) specific DHSs, respectively, are represented on the bar next to the heat map and are defined by statistical thresholds corresponding to 2! significance. Non-varying genes are represented in black. The panels next to the bar show the average DNaseI-Seq profiles for each group indicating an average peak width of about 200 –
400 bp. Outermost right, box plot demonstrating that the differences in DNaseI-Seq FC for
NH-(green) and HRS-(red) specific DHSs are significant (***, p < 2.2*10-16). (C) Changes in chromatin accessibility correspond to changes in mRNA expression levels in HRS as compared to the NH cell lines. The L428 over Reh increasing DNAseI FC in distal elements depicted on the heat map on the left is correlated with the FC of mRNA expression of the nearest gene of multiple HRS cell lines compared to the NH cell line Reh. Spearman rank correlation coefficients are 0.71, 0.57, 0.52, 0.49, 0.53, 0.5, respectively. (D) Changes in chromatin accessibility at distal elements correspond to changes in mRNA expression levels compared to different NH cell lines. Comparison of FC in mRNA expression in multiple HRS cell lines compared to the NH cell lines Namalwa (left panel; Spearman rank correlation coefficients are 0.68, 0.62, 0.62, 0.63, 0.76, 0.61, respectively) or SU-DHL-4 (right panel; Spearman rank correlation coefficients are 0.58, 0.48, 0.58, 0.49, 0.71, 0.47, respectively) with DNaseI-Seq FC L1236 versus Reh as base line. (E) Box plots depicting the overall correlation in mRNA expression FC in different HRS cell lines over Reh of genes nearest to sites with low (NH-specific sites, green) and high (HRS-specific sites, red) L428 over Reh
DNaseI-Seq FC, revealing consistently up- and down-regulated genes common to all HRS cell lines. (F,G) Changes in chromatin accessibility inversely correlate to changes in methylation levels between NH and HRS cell lines. Direct comparison of the fold increase in
DNaseI accessibility for the L1236 and L428 HRS cell lines relative to the NH cell line Reh with the DNA-methylation pattern in the corresponding promoter regions as described in Fig.
1. The heat maps show the (F) L1236 over Reh and (G) L428 over Reh DNaseI FC sorted by increasing DNaseI ratio and corresponding methylation FC of the associated TSSs for promoter (left) and distal (right) DHSs in the indicated cell lines. Spearman rank correlation coefficients are: (F) L1236/Reh DHS vs. expr./m5C 0.707/-0.603 (promoters), and 0.723/-
0.45 (distal elements); (G) L428/Reh DHS vs expr./m5C 0.833/-0.671 (promoters), and
0.717/-0.346 (distal elements).
Supplemental Figure 2. Transcription factor binding motifs enriched in HRS- or NH- specific DHSs are centered around the DHS center. (A,B) Alignment of motifs in the different classes of distal DHSs (A, B, or C) with the DHS center for NH and HRS motifs in total L428 and Reh genes. Each heatmap represents the position, in yellow, of NH (left panels) and HRS (right panels) enriched motifs with respect to the maximum DNaseI-Seq signal within +/-200 bp, sorted by increasing (A) L1236 or (B) L428 over Reh DNaseI FC.
(C,D) Plots depicting average motif densities +/-200 bp around each DHS maximum for (C)
L1236 and (D) L428 versus Reh. Enriched motifs in HRS-specific DHSs are shown in red, shared DHSs in black, and motifs in NH-specific DHSs are depicted in green. (E) Binding motifs enriched in HRS-specific DHSs co-localize with NF-!B. Distribution of distances between AP-1, STAT and IRF motifs with regard to the position of the NF-!B motif in the union of L1236 over Reh distal regions. In each case, motifs exhibit preferentially proximal positioning in relation to the NF-!B motif. For STAT motifs, a preferential position was found at +7 bases from the start of the NF-!B site, thus forming a
GGGGAWTTCCNNAGAA composite consensus.
Supplemental Figure 3. Quantification of IRF5 mRNA levels by real-time PCR; increased chromatin accessibility and transcriptional activity at the IRF5 locus; detection of IRF5 protein-DNA complexes in HRS cells; IRF5 IHC analyses. (A) mRNA expression of IRF5 in various Hodgkin (L428, L1236), non-Hodgkin (Reh, Namalwa) as well as ABC-type- (OCI-Ly3, OCI-Ly10, HBL1, TMD8) and GCB-type- (HT, OCI-Ly1, OCI-
Ly7, OCI-Ly19) DLBCL cell lines was analyzed by quantitative real-time PCR relative to
GAPDH mRNA expression. Error bars denote 95% confidence intervals. (B) DNaseI-Seq profiles in the IRF5 gene locus reveal elevated DNaseI-accessibility as well as the usage of an alternative promoter in HRS cell lines. IGV screenshot of DNaseI-Seq profiles of the IRF5 gene locus in HRS and NH cell lines, as indicated on the left. HRS (L1236, L428 and L591; red) and NH (Namalwa and Reh; green) DNaseI-seq profiles are shown above the IRF5 gene annotation (black), where both TSSs (TSS1 and 2) are represented by red arrows, and correspond to phylogenetically conserved regions (blue, bottom). RefSeq annotations are shown underneath all profiles, where thin lines represent introns, thick blocks exons and thickest blocks coding sequences. Gene transcription direction is shown by arrows. Note, that the DNaseI-Seq signal upstream of TSS1 as well as in the corresponding 1st intron is higher in
HRS compared to NH cell lines, while TSS2 exhibits equivalent levels. (C-E) Epigenetic and transcriptional signatures of the IRF5 locus in the HRS cell lines L428 and L591 and the NH cell lines Reh and Namalwa, as indicated. One of three independent experiments is shown, respectively. Chromatin immunoprecipitation (ChIP) assay measuring (C) H3K4me3, (D) RNA PolII P-Ser5 (upper panel) and RNA PolII P-Ser2 (bottom panel) and (E) H3K9me3 at the indicated positions of the IRF5 locus, revealing higher enrichment for H3K4me3 as well as paused and elongating RNA PolII in the HRS cell lines at both TSSs. Histone modification marks and RNA PolII enrichment levels are shown as percentages of those of input or H3, respectively. (F) Northern blot analysis of IRF5 mRNA expression in HRS and NH cell lines, as indicated. GAPDH expression was analyzed as a control. (G-I) EMSA analyses of whole cell extracts using wt and mutated ISRE sites from the ISG15 promoter as a probe. (G) EMSA analysis of whole cell extracts of various HRS and NH cell lines, as indicated, using the wild- type ISRE site (ISRE wt) or an ISRE site with mutated IRF binding site (ISRE mut) as probe.
Positions of specific protein-DNA complexes are indicated. n.s., non-specific complex. The free probe of the gel using ISRE wt as probe is shown underneath. Note, that IRF5-containing complexes are detectable only in HRS cell lines, that mutation of the ISRE site results in the loss of the IRF-containing complexes but not the non-specific complexes, that IRF5- containing complexes are selectively detectable in HRS cell lines and that the complex detectable in Reh cells (marked by an open circle) does not react with the IRF5 antibody.
(H,I) EMSA analysis of whole cell extracts of the indicated cell lines using the (H) ISRE wt or (I) mutated site from the ISG15 promoter as a probe. Positions of specific protein-DNA complexes without (-) or with addition of IRF5 antibody (IRF5) or its isotype control (IC) are indicated (supershift, ss). n.s., non-specific complex. The free probe of the gel is shown underneath. Note, that in (I) mutation of the IRF5 site results in the loss of the IRF-containing complexes but not the non-specific complexes. (J) IRF5 immunohistochemistry of reactive tonsillar tissue (top panel), a tonsil from an infectious mononucleosis patient (center) and an
IRF5-negative DLBCL case (bottom panel). Note, that in reactive tonsillar tissue IRF5 was detectable in some dendritic cells and macrophages.
Supplemental Figure 4. IRF5 is required for the HRS cell-characteristic inflammatory gene expression and for HRS cell survival. (A) TFs IRF5 and NF-!B are required for endogenous IL13, IL6 and RANTES mRNA expression in HRS cell lines. The HRS cell line
L591 was transfected with control plasmid (Mock) or a dominant-negative variant of IRF5
(DNIRF5-4D) and/or the NF-!B super-repressor I!B"#N, respectively. Enriched transfected cells were analyzed for mRNA expression of IL13, IL6 and RANTES by real-time PCR. Error bars denote 95% confidence intervals. One of six experiments is shown. P-values are shown for the comparisons to the respective Mock control. (B) The HRS cell lines L540Cy and L591 were transfected with control plasmid (Mock), or plasmids encoding a dominant-negative variant of IRF5 (DNIRF5-4D) and/or the NF-!B super-repressor I!B"#N, respectively. After enrichment of transfected cells, whole cell extracts were prepared and protein expression of
DNIRF5-4D and I!B"#N was analyzed by use of antibodies (Ab) specific for IRF5 and
I!B", respectively, as indicated. Extracts of L428 and Namalwa cells and the analysis of $- actin were included as controls. (C) Measurement of secreted RANTES and IL-6 by ELISA of supernatants derived from Mock, and DNIRF5-4D and/or I!B"#N transfected L540Cy and L591 cells. Cells were prepared as described in Fig. 3F. Following purification, cells were re-cultured for additional 24 hours and supernatants were analyzed by an IL6- and
RANTES-specific ELISA. The amounts of IL-6 and RANTES are shown in pg/ml. Error bars denote SDs. One of three independent experiments is shown. p-values are shown for the comparisons to the respective Mock control. (D) The HRS cell line L591 was transfected with control siRNA constructs (siCTL) or siRNA-constructs targeting IRF5 (siIRF5_#1 and siIRF5_#2) along with pEGFP-expression constructs. 72 hours after transfection, GFP- positive cells were enriched and further cultured for the indicated times. The percentage of viable, GFP-positive cells was determined at the indicated times and is shown in relation to the viability of siCTL-transfected cells, which was set 1.0. Data are represented as mean +/- SD. One of four independent experiments is shown. P-values are shown for the comparisons to the siCTL sample at the indicated times, respectively. (E) The HRS cell lines L428,
L540Cy, and L591 were transfected with control siRNAs (siCTL) or siRNAs targeting IRF5
(siIRF5_#1 and siIRF5_#2) along with pEGFP. 72 hours after transfection, GFP-positive cells were enriched and whole cell extracts were analysed for IRF5 protein expression by WB.
Extracts of L428 and Reh cells and the analysis of !-actin were included as controls. (F)
Detection of apoptosis in transfected L540Cy HRS cells following IRF5 knock-down. The
HRS cell line L540Cy was transfected with control siRNA constructs (siCTL) or siRNA- constructs targeting IRF5 (siIRF5_#2) along with pEGFP-expression constructs. 48 hours after transfection, GFP-positive cells were enriched, and 48 hours after enrichment cell were analyzed for apoptosis by annexin V-APC/PI staining and flow cytometry. The percentage of apoptotic, annexin V-APC-positive and PI-negative cells is indicated. One of four independent experiments is shown. (G) Cells were treated as described in (F). 48 hours after enrichment, intracellular staining for active caspase-3 was performed. The percentage of active caspase-3-positive cells is shown. One of four independent experiments is shown.
Supplemental Figure 5. IRF5 is required for HRS-specific gene expression. (A) IRF5 and
NF-"B synergistically activate the RANTES promoter (P) in HEK 293 cells. Upper panel, analysis of luciferase activity of RANTES P constructs. pGL3-basic (negative control), pGL3-
RANTES P wild type (WT) or pGL3-RANTES P constructs with mutated ISRE (ISRE mut) or mutated NF-"B (NF-"B mut) DNA binding motifs were transiently transfected into HEK293 cells together with Mock plasmid (control) or expression plasmids for IRF5-4D and/or
IKK!(EE). Luciferase activity is shown as fold activation compared to pGL3 basic activity
(set as 1). Data are represented as mean ± SD. One of six experiments is shown. P-values are shown for comparisons to the respective Mock controls. Lower panel, 48 hours after transfection of HEK293 cells, whole cell extracts were prepared and protein expression of IRF5-4D and IKK!(EE) was analyzed by use of antibodies (Ab) specific for IRF5 and FLAG, respectively, as indicated. Extracts of L428 and Namalwa cells and the analysis of !-actin were included as controls. (B) Upper panel, measurement of secreted IL-6 and RANTES by
ELISA of supernatants derived from Mock, and IRF5-4D and/or IKK!(EE) transfected BJAB cells. Cells were prepared as described in Fig. 4B. Following purification, cells were recultured for additional 24 hours and supernatants were analyzed by IL6- and RANTES- specific ELISAs. The amounts of IL-6 and RANTES are shown in pg/ml. Error bars denote
SDs. One of four independent experiments is shown. P-values are shown for comparisons to the respective Mock controls. Lower panel, the NH cell lines BJAB and Reh were transiently transfected with control plasmids (Mock), or, alone or in combination, expression constructs encoding constitutively active variants of IRF5 (IRF5-4D) and IKK! (IKK!(EE)). After enrichment of transfected cells, whole cell extracts were prepared and protein expression of
IRF5-4D and IKK!(EE) was analyzed by use of antibodies (Ab) specific for IRF5 and FLAG, respectively, as indicated. The whole cell extract of L1236 HRS cells and the analysis of !- actin were included as controls. (C) GSEA enrichment plots of the primary HRS cell line mRNA signature of up-regulated genes (see Table S3; signature based on the comparison of primary HRS cells versus FL, BL, DLBCL (1), log2 FC cut-off 1) of IRF5-4D-, IKK!(EE)- or
IRF5-4D- and IKK!(EE)-induced gene expression changes in transiently transfected Reh cells, as indicated. The Java implementation of GSEA version 2.0.12 was used, taking the signal-to-noise ratio of log2-transformed expression values for gene-ranking. Note, that the absolute value of the normalized enrichment score (NES) is highest in the IRF5-4D plus
IKK!(EE) sample. This is indicative of an additive or synergistic effect of the two factors with respect to a Hodgkin-like phenotype shift of the Reh cell line. (D) GSEA analysis of
IRF5-4D-transduced primary murine B cells. Primary murine splenic B cells from wild-type
C57BL/6 mice were purified by MACS CD43-depletion, stimulated with LPS and retrovirally transduced with either Mock (Mock; MSCV-IRES-CFP) or IRF5-4D (IRF5-4D; MSCV-
IRF5-4D-IRES-CFP) viruses. After 72 hours, transduced CFP-positive cells were enriched by
FACS. GSEA enrichment plots of the IRF5-4D-induced gene expression changes, determined by microarray analyses, of the primary HRS cell signature for down- (left panel) and up-(right panel) regulated genes (see Table S3) are shown, respectively. Note, that IRF5-4D expression leads to a highly significant and specific shift of murine splenic B cells to a Hodgkin-like phenotype. (E) Murine splenic B cells were treated as described in Fig. 5A. Whole cell extracts were analyzed for IRF5 protein expression by WB. Expression of !-actin is shown as a control. Note, that expression of IRF5 in transduced murine B cells is comparable to the endogenous IRF5 expression in the HRS cell lines L428 and L1236. ns, not significant; *, p <
0.05; **, p < 0.01; ***, p < 0.001.
Supplemental Table 1. DNaseI digestion conditions and high-throughput sequencing statistics for HRS and NH cell line DNaseI-Seq analyses.
Supplemental Table 2. IRF5 protein expression analysis in sections of Hodgkin and non-
Hodgkin B cell lymphoma. B-CLL, B-cell chronic lymphocytic leukemia. *, including 10 molecularly characterized ABC-type- and GCB-type DLBCL cases, respectively. **, 3 GCB- type DLBCL cases and 1 ABC-type DLBCL case. ***, ABC-type DLBCL.
Supplemental Table 3. Gene lists of differentially expressed genes between HRS and NH cell lines (Köchert et al., Oncogene, 2011; GEO acc. no. GSE20011) and between primary
HRS and primary B-NHL samples (Tiacci et al., Blood, 2010; GSE12453).
Supplemental Table 4. Primers and oligonucleotides used for semiquantitative RT-PCR, real-time PCR and EMSA analyses. !"##$%&%'()*+ ,-."*% /
0 1 !"# $%& %'( 2678@.)/=*&>?( R6 8< .)/ ;3 ;3 < 2678 2579: C6 5 0 6< : < < AAA ;3 ;3 % < M 6 2678 C7<< < J7<< ,
< < ' % >
;3 ;3 J M
J 8< 2345 P .)/ 7 Q < < ' ) 1 2678 (
;3 ;3 C 6< ,"PJO&
N < N 0"#"$1" )"(- ) *
< < (
O < " ;3 ' C7 ;3 N C7<< < J7<< .)/ 0 < < E E0"() EDHJ*)"B(J?)*JS? 8< .)/ C6 4 2678 6< ? !"##"$ 5 5 > &1' %&'()*+",-&' < < < B C7<< < J7<< E0"()NC()QJM% E-(,"'O)J,&J #"LTJEDHJUS?V
4 3
/ ) / / / ) ) ) @. / @. @0"#"$1" @0"#"$1" @HICED2C6 @HICED2C6 @. 7 @. ) G 7 @0"#"$1" G 7 @HICED2C6 G 7 @. @0"#"$1" 7 @0"#"$1" @HICED2C6 7 @HICED2C6 < <% 8 < 8 < !CD 36 36 !CD 36 36<% !CD 36 36<% 2678@.)/2678@.)/2579: DE2!CF 2 2 2579:@.)/2579:@0"#"$1"267 DE2!CF 2 2 2579:@.)/2579:@HICED2C6267 DE2!CF 2 2 R6 R5 R6 R5 R6 R5 < < < < < < C6 C5 C6 C5 C6 C5 % % % J J J M M M J J J P P P Q Q Q ' ' ' ) ) ) ( ( ( C C C N N N )"(- )"(- )"(- ) ) ) * * * ( ( ( O O O " " " ' ' ' N N N 0 0 0 E E E
#.0KJ)L?*)((-&'JM% #.0KJ)L?*)((-&'JM% #.0KJ)L?*)((-&'JM%
2 ,
/ .) )/ .)/ . )/ G@.)/ 2579:@.)/ #.0KJ)L?*)((-&'JM%E0KJ#),/G$",-&'JM% 2579:@.)/ #.0KJ)L?*)((-&'JM%E0KJ#),/G$",-&'JM% . % <@ < R5 R5 R % 7 M % % ' J J M M J J P P Q Q ' ' ) 5 ) ( ( C C N N )"(- )"(- ) ) * * ( ( O O " " ' ' N < N 0 0 E E J#.0KJ)L?*)((-& C5 E0"()NC()QJM% ? ? ? ? ? ? > > > > > > &1' &1' &1' &1' &1' &1' 2678@.)/ B B B B B B W*&#&,)*JEDH( 0)"*)(,JXHH E-(,"$JEDH( 0)"*)(,JXHH 6 2678@.)/ #.0KJ)L?*)((-&'JM%E0KJ#),/G$",-&'JM% 2678@.)/ #.0KJ)L?*)((-&'JM%E0KJ#),/G$",-&'JM% R5 R5 R W*&#&,)*JEDH( 0)"*)(,JXHH E-(,"$JEDH( 0)"*)(,JXHH !"##$%&%'()*+,-./"*%,0 2 :8> 7 56 . 4 9 * , 9 9 * -P . -P " κ -P -P κ D0.O F 3 D0.O F # - 5H D0.O F ! " D0.O F - -*&0 2 ,-. " G " + ,-. 7 $%&'(< /"! / 1+" , 628 $%&'(< # ! 87 567 * $%&'( O , 2 O , 2 O , 2 O , 2 + + + + ) ) ) ) 7 7 7 7 ) ) ) ) T T T T I I I I ? ? ? ? A A A 1 1 1 A 1 < < 1 < < - - - - 5 5 5 5 A><; A><; A><; A><; A A A A % % % % < < < < @ @ @ @ > > > > ? ? ? ? 5 5 5 5 8 8 8 8 : : : : 3 3 3 3 O O O O O O O O O O O O O O O O O O O O -JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO -JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO -JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO -JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO-JOO 4JOO :;<=>?@A)=&)B>03):C!)DE(F :;<=>?@A)=&)B>03):C!)DE(F :;<=>?@A)=&)B>03):C!)DE(F :;<=>?@A)=&)B>03):C!)DE(F 3 4 /"! /-*&0 #,-. !"#" /"! 1+" #,-. 6289 .O Q Q Q .O .O Q U O O O O O O O O ) ) F -JOO O )JOO -JOO O )JOO -JOO O )JOO -JOO O )JOO F -JOO O )JOO -JOO O )JOO -JOO O )JOO -JOO O )JOO ( ( E E ) ) ) ) % % /-*&0 S 87- * 567 S ,23.)4)567 87-κ* !"#" A 1+" ,23.)4)567 κ A @ .J @ ( ( Q ) U ) Q ? U ? Q Q < Q < A A A A @ @ ? ? %AI' %AI' A A R R % % ) ) R R ' ' ; ; = = @ @ & & @ O O O O @ O O O O & & H H ) ) -JOO O )JOO -JOO O )JOO -JOO O )JOO -JOO O )JOO P -JOO O )JOO -JOO O )JOO -JOO O )JOO -JOO O )JOO P - - O O . . D 6289 *G5H,. D 6289 567 Q Q $%&'()# U $%&'()# Q $%&'()# $%&'()# $%&'()* $%&'()* $%&'()* $%&'()* $%&'()+ $%&'()+ $%&'()+ $%&'()+ O O O O -JOO O )JOO -JOO O )JOO -JOO O )JOO -JOO O )JOO :;<=>?@A)=&) :;<=>?@A)=&) :;<=>?@A)=&) :;<=>?@A)=&) B>03):C!)DE(F B>03):C!)DE(F B>03):C!)DE(F B>03):C!)DE(F ) 5 #,-. !"#" 567 A A UO A @ .O @ @ .O ? ? ? '%%A '%%A '%%A @ @ @ @ @ @ & & & ) ) ) R R R ; ; ; = = = & & & H O H O H O -JOO O )JOO -JOO O )JOO -JOO O )JOO :;<=>?@A)=&) :;<=>?@A)=&) :;<=>?@A)=&) 87-κ*)B&=;R)4.)DE(F 87-κ*)B&=;R)4.)DE(F 87-κ*)B&=;R)4.)DE(F Supplementary Figure 3 A F Hodgkin cell lines a -4 -2 y w L 6 2 C l H 8 3 H 1 M 0 0 a D 1.75 2 2 - 9 L 4 h m - A 4 4 1 M 5 D 5 5 e a U N cell line L L K L H L L R N S e n R v i o t i 1.25 m a s l s H e IRF5 r e D r 5 0.75 p P F x A e R I G GAPDH o 0.25 t 0 8 6 h a 3 0 1 8 T 1 7 9 2 3 e w y 1 L D y y 1 4 2 R l L y B H -L L y L 1 a I- L M I I- -L L m C I- H T C C I a O C O O C N O O G Hodgkin cell lines a -4 -2 y w L 6 2 C l H 8 3 H 1 M 0 0 a 0 B D 2 2 - 9 L 4 4 h m -6 A - B 4 1 M 5 D 5 5 e a L J U cell line L L K L H L L R N B B S IRF5 ISRE wt n.s. ISRE mut n.s. free probe 2 a H 2 - lw H 1 M a - 9 L m h M 5 D a e cell line K L H N R 5 5 5 5 5 F F F F F ss IR IC IR IC IR IC IR IC IR IC C ss H3K4me3 35 Reh e IRF5 v i Namalwa t a 3 l 25 L428 n.s. e e r L591 n t o n t e s i 15 free m h h probe o c t i r n E 5 a -4 w L 0 6 l H 8 3 0 a D L b b 1 2 b R I 2 2 4 m - V k k S S k 4 1 5 a U I 9 0 7 T cell line L L L N S 2 1 S S + ´U - - T T 3 5 5 5 5 5 F F F F F D ss IR IC IR IC IR IC IR IC IR IC RNAP II P-Ser5 45 Reh Namalwa t n.s. u t 35 L428 p n n i L591 e o m free t h 25 e c probe i v r i t n a l E 15 e r 5 J tonsil 0 b b b 1 b 2 b R g k k k S k S k T b 9 0 5 S 6 7 2 1 . . S + ´U - - -7 T -2 T 3 RNAP II P-Ser2 1.2 Reh Namalwa 1 t L428 u t p n L591 n 0.8 i e o m t h 0.6 e c i IM v r i t n 0.4 a l E e r 5 0 b b b 1 b 2 b R g k k k S k S k T b 9 0 5 S 6 7 2 1 . . S + ´U - - -7 T -2 T 3 E H3K9me3 Reh e DLBCL v i Namalwa t 6 a 3 l L428 e e r L591 n 4 t o n t e s i 2 m h h o c t i r 0 n L b b b E 1 2 R V k k S S k I 9 0 7 T 2 1 S S + ´U - - T T 3 Supplementary Figure 4 A D L591 IL13 IL6 RANTES 1.2 s l L 1.4 l 1.0 T A e e c C N v i L591 h t ns n + R 0.8 s a 1.0 * o l * P * siCTL i * m * o e * s F t * * r siIRF5_#1 s * H ** 0.6 * G * * e e e D * r 0.6 * *** v siIRF5_#2 n e i i l p P t k *** 0.4 b x a A ** l o a e t i e G r y 0.2 *** V c 0.2 o *** t 0 Mock + + + 0 DNIRF5-4D hours after + + + + + + 0 96 144 I"B#$N + + + + + + cell sorting B E L428 1 2 # # _ _ 5 5 8 L F F L540Cy L591 2 h T R 4 e iC iIR iI cell type L R s s s + + D D D D a -4 -4 a -4 -4 IRF5 w 5 5 w 5 5 l N F N l N F N a k F $ $ a k F $ $ 8 m c IR # IR # 8 m c IR # IR # 2 a o N B N B 2 a o N B N B !-actin cell type 4 " " 4 " " L N M D I D I L N M D I D I Ab IRF5 IRF5 L540Cy L591 DNIRF5-4D 1 2 1 2 I B # # # # " # I"B# _ _ _ _ L 5 5 L 5 5 I"B#$N 8 T F F T F F 2 h R R R R 4 e iC iI iI iC iI iI !-actin !-actin cell type L R s s s s s s IRF5 !-actin C F siCTL siIRF5_#2 5 5 L540Cy L591 ) 10 7.5% 10 20.9% C P 4500 2500 A 4 4 ( 10 10 V - n S 3 3 i ) l 3000 10 10 x E ** ** 1500 e m T / ** * n N g * n 102 102 p A * A ( 1500 R 500 102 103 104 105 102 103 104 105 0 0 PI 450 500 G 400 siCTL siIRF5_#2 ) l 300 400 6 300 m - ** / 300 L g I p 4.4% 14.1% ( 200 300 150 *** *** s 200 *** 100 ****** t n 200 u o 0 0 c 100 100 Mock + + DNIRF5-4D + + + + I"B#$N + + 0 0 + + 102 103 104 102 103 104 active caspase-3 (APC) Supplementary Figure 5 A B * 900 * * * * 9 * * y t ) i BJAB BJAB n v i t o 6 i c t * * a a * 600 * 180 * 600 * v * S i 3 * e ) ) t l l s E c 6 a * m 120 m 400 T a - / / r * * 0 L N g g e d I f l i p p A 300 ( ( o c 60 200 f R ( u * * L * * * * ns * * 0 0 Mock + Mock + 0 + + + + Mock + + + IRF5-4D IRF5-4D + + IRF5-4D + + + + + + IKK!(EE) IKK!(EE) + + IKK!(EE) + + + + + + reporter 3 3 3 L L L G G G BJAB Reh p WT p ISRE p NF-"B mut mut ) + ) ) + ) D E D E D E D E 6 -4 (E -4 (E -4 (E -4 (E 3 k 5 k 2 c 5 ! ! c 5 ! 5 ! 1 o F K F K o F K F K HEK293 cell type L M IR IK IR IK M IR IK IR IK Ab a ) + ) IRF5 IRF5 w D E D E l -4 (E -4 (E 8 a k 5 2 m c 5 ! ! IKK!(EE) 4 a o F K F K cell type L N IR IK IR IK Ab FLAG M IRF5 IRF5 IRF5 !-actin !-actin IKK!(EE) FLAG !-actin !-actin C Enrichment profile t t 0.0 t 0.0 ) ) ) n 0.0 n n Hits e e e S S S E E E m m m ( ( ( Ranking metric scores e e e e e e h NES -1.91 h NES -2.34 h NES -2.55 r r r c c c i i i o o o r FDR 0.000 r FDR 0.000 r FDR 0.000 c c c n n n s s s E E E -0.4 -0.5 -0.6 c c c i i i ) ) ) r r r e e e t t t s s s e e e i i i o o o m m m n 2 n n 2.0 d Mock d 1 Mock d Mock o o o e e e t t t k 0 k k l l 0 l 0.0 n n n a a a a a a n n n r r r g g g t t t i i i s s s s s -3 s i -4 i i -4.0 ( IRF5 ( IKK ( IRF5/IKK L 0 5,000 10,000 15,000 L 0 5,000 10,000 15,000 L 0 5,000 10,000 15,000 Rank in ordered dataset Rank in ordered dataset Rank in ordered dataset IRF5-4D IKK!(EE) IRF5-4D+IKK!(EE) D E Enrichment profile 0.6 0.2 t t ) ) n n Hits splenic B cells e e S S 0.0 E E m m ( ( Ranking metric scores e e e e h NES 1.93 h NES -1.56 r r D c c i i o o 4 r r 6 - c FDR 0.000 c FDR 0.004 k n n 8 3 5 s s c E 0.0 E 2 2 o F 4 1 R -0.5 cell type L L M I c c i i ) ) r r e e t t IRF5 s s e e i i o o m m n n d Mock d Mock o o e e t 2.5 t 2.5 !-actin k k l l n n a 0 a 0 a a n n r r g g t t i i s s s s i i ( IRF5 ( IRF5 L -5.0 L -5.0 0 10,000 20,000 0 10,000 20,000 Rank in ordered dataset Rank in ordered dataset IRF5-4D IRF5-4D Supplementary Table 1 Cell line DNAseI quantity Read count Peaks Namalwa 12 U/ml 50442620 29325 Reh 6 U/ml 73262244 28043 L1236 6 U/ml 138249644 25865 L428 6 U/ml 103441244 23329 L591 12 U/ml 119706136 26662 Supplementary Table 2: IRF5 protein expression analysis in sections of Hodgkin and non- Hodgkin B cell lymphoma Immunohistochemistry staining intensity No. of Lymphoma entity cases cytoplasmic cytoplas. and nuclear absent weak strong weak strong Classical Hodgkin lymphoma 38 1 37 Diffuse large B cell lymphoma* 45 27 9 4 4** 1*** Burkitt lymphoma 8 7 1 Follicular lymphoma (grade 3b) 5 3 2 Follicular lymphoma (grades 1-2) 13 13 Nodal and extranodal marginal zone 18 18 lymphoma B-CLL 7 7 Plasma cell myeloma 8 8 Mantle cell lymphoma 7 7 Lymphoblastic B-cell lymphoma 5 5 B-CLL, B-cell chronic lymphocytic leukemia. *, including 10 molecularly characterized ABC-type- and GCB-type DLBCL cases, respectively. **, 3 GCB-type DLBCL cases and 1 ABC-type DLBCL case. ***, ABC-type DLBCL. Supplementary Table 3. Gene lists of differentially expressed genes between HRS and NH cell lines (Köchert et al., 2011; GEO acc. no. GSE20011) and between primary HRS and B- NHL samples (Tiacci et al., 2010; GSE12453). HRS cell line signature log2 FC – down Log2FC Gene symbol Log2FC Gene symbol Log2FC Gene symbol Log2FC Gene symbol -7,33 POU2AF1 -3,67 P2RX5 -2,81 KCNK12 -2,34 TMC6 -7,11 IGJ -3,67 AFF3 -2,81 PALD1 -2,34 TPST2 -6,85 MME -3,65 SASH3 -2,79 SLC17A9 -2,34 ZNF573 -6,71 COCH -3,58 UBE2J1 -2,77 ARPP21 -2,33 LOC100129447 -6,47 FAM213A -3,57 LY86 -2,77 KCNN3 -2,32 GCSAM -6,45 IGLL1 -3,56 CDK14 -2,77 LEF1 -2,32 ARHGAP9 -6,35 VPREB3 -3,55 GCHFR -2,75 TP73-AS1 -2,31 FAM78A -6,18 RCSD1 -3,53 RAP1GAP2 -2,75 ZNF93 -2,31 DPY19L2P2 -6,15 DOK3 -3,51 ABCA1 -2,75 ZNF385B -2,31 QPRT -6,00 TCL1A -3,51 PAG1 -2,74 CBS -2,31 ORAI2 -5,99 CD79B -3,50 BCL7A -2,73 ARHGAP15 -2,30 TCF12 -5,92 ARHGDIB -3,49 APBB1IP -2,72 CD84 -2,29 BCAS4 -5,84 BACH2 -3,48 GSPT2 -2,71 TGFBR2 -2,29 SLC43A1 -5,68 CD24 -3,47 CD22 -2,71 GRAMD4 -2,29 PLD4 -5,65 RALGPS2 -3,47 ZNF320 -2,71 MAGED1 -2,27 TESPA1 -5,54 BLNK -3,45 STS -2,67 TMC8 -2,27 ZCCHC7 -5,52 CD19 -3,43 ST14 -2,66 CCL4 -2,27 PHACTR1 -5,46 SYK -3,43 JAZF1 -2,66 MACROD1 -2,26 SLAMF6 -5,37 MEST -3,43 ZNF468 -2,65 LMO2 -2,26 CYFIP2 -5,31 ARL11 -3,40 CPXM1 -2,64 CMTM8 -2,26 TAPT1 -5,21 CTBP2 -3,39 ELL3 -2,61 ELF1 -2,25 NOL4 -5,12 CD79A -3,39 BMP7 -2,61 KANK2 -2,24 LTBP1 -4,98 BTK -3,39 CKAP4 -2,61 RASGRP2 -2,24 LOC441179 -4,90 CCDC69 -3,39 TBC1D1 -2,60 CD69 -2,24 ZNF682 -4,78 LAPTM5 -3,36 BLK -2,59 DNMBP -2,23 DET1 -4,74 SCRN1 -3,35 FAM129C -2,59 GUSBP11 -2,23 EFCAB2 -4,72 IGHM -3,32 WASF1 -2,58 PKHD1L1 -2,23 ZBED3 -4,69 ID3 -3,30 STAP1 -2,58 CYCS -2,23 FAM132B -4,68 P2RY8 -3,30 SYTL1 -2,58 TUBA4A -2,22 SEPT9 -4,64 RGCC -3,27 KIAA0922 -2,57 LAT2 -2,22 LPAR5 -4,57 RASSF6 -3,27 LCK -2,56 AUTS2 -2,22 LZTS1 -4,56 PLAC8 -3,26 ZNF439 -2,56 PID1 -2,21 CCND3 -4,47 C16orf54 -3,23 E2F2 -2,56 SORBS2 -2,21 INPP5A -4,44 RAG2 -3,20 PCDH9 -2,56 TNFSF8 -2,21 SCML2 -4,42 COTL1 -3,19 TNFRSF21 -2,55 SERINC5 -2,20 SSBP2 -4,34 MS4A1 -3,17 PNOC -2,55 CD180 -2,20 SH2B2 -4,33 PLCG2 -3,16 ARHGEF6 -2,53 SLC44A2 -2,20 SUSD3 -4,32 ZNF551 -3,16 ZNF608 -2,52 BDH1 -2,17 HOXA3 -4,32 CD52 -3,16 LRMP -2,52 AEBP1 -2,17 SYNGR1 -4,31 TNFRSF17 -3,12 FAM221A -2,51 SEPT1 -2,16 KIAA0930 -4,30 CD38 -3,11 BID -2,51 CPNE5 -2,15 SLC7A3 -4,24 PAX5 -3,10 HDAC9 -2,50 GTF2IRD1 -2,14 PRDM15 -4,22 ST6GAL1 -3,09 NFATC1 -2,50 TSPO -2,14 MSI2 -4,22 APP -3,08 ZNF718 -2,50 SETDB2 -2,13 MYH10 -4,19 PIK3AP1 -3,07 GAPT -2,50 FAM69B -2,12 GAB1 -4,19 GNG7 -3,04 DIP2C -2,50 ZHX2 -2,12 PM20D2 -4,19 KIAA0226L -3,03 POU2F2 -2,49 ALOX5 -2,12 ZNF826P -4,18 PVRIG -3,01 SFMBT2 -2,49 LYL1 -2,12 MEF2C -4,14 PRKCB -3,00 GFOD1 -2,49 CUX1 -2,11 QRSL1 -4,13 GJC1 -2,99 CAB39L -2,48 UMODL1 -2,11 TRPM4 -4,10 DTX1 -2,99 BEST3 -2,48 ATPAF1 -2,10 ANKRD36BP2 -4,05 EVI2B -2,98 FLJ38379 -2,45 TET1 -2,08 ZNF137P -4,03 LRRC34 -2,96 IGLL3P -2,45 KDM5B -2,08 ATP2A3 -3,96 CBFA2T3 -2,96 FLJ43489 -2,44 NASP -2,08 C3orf37 -3,96 LRIG1 -2,95 ERVH-3 -2,43 TBC1D10C -2,06 FOXO1 -3,96 IL7R -2,95 NREP -2,43 GLRX -2,06 TTN -3,93 CD72 -2,94 DBN1 -2,42 MIR181A2HG -2,05 C12orf77 -3,93 EVI2A -2,93 PLEKHG4B -2,40 MACC1 -2,05 RAB40B -3,91 ZNF83 -2,93 MPEG1 -2,39 ZNF704 -2,05 LRP6 -3,89 EBF1 -2,88 RCBTB2 -2,39 DEF6 -2,05 FBRSL1 -3,89 INSR -2,88 IGHV5-78 -2,38 VNN2 -2,04 DTX4 -3,84 TCEAL4 -2,87 LXN -2,38 ZNF253 -2,04 FAM81A -3,83 FCRLA -2,86 COL9A3 -2,37 CEP41 -2,03 STRBP -3,78 MILR1 -2,86 TP53INP1 -2,36 DANCR -2,02 RAPGEF5 -3,78 DOCK8 -2,84 CXXC5 -2,35 SPI1 -2,02 ZNF709 -3,78 MNS1 -2,83 LOC440864 -2,35 RGS18 -2,01 SMIM14 -3,75 TLR10 -2,83 GPER -2,35 RASA3 -2,00 PRKACB -3,74 LOC100130458 -2,81 PPP1R16B -2,34 RNASEH2B -2,00 HPS4 ! HRS cell line signature log2 FC – up Log2FC Gene symbol Log2FC Gene symbol Log2FC Gene symbol Log2FC Gene symbol 8,05 CCR7 3,76 INHBE 2,89 NFKB2 2,39 FZD3 7,98 IL1R2 3,72 MCC 2,88 EPSTI1 2,38 VMP1 7,65 PHLDA2 3,71 DUSP5 2,87 RHEBL1 2,38 CD86 7,08 RUNX2 3,71 MYEF2 2,87 TDRD7 2,38 ABCD2 6,81 FAS 3,70 TNFSF10 2,87 NOTCH2 2,37 MTTP 6,53 CCND2 3,69 FAM171B 2,85 LACTB 2,36 DDR2 6,42 BATF3 3,65 C9orf64 2,85 TNF 2,36 TNIK 6,31 IQCG 3,65 TMEM173 2,85 JAK3 2,35 B4GALT1 6,12 MYOF 3,64 LINC00184 2,84 ADPRH 2,35 NFIL3 6,01 APOBEC3B 3,61 MYO3B 2,84 CDC14B 2,35 ADAM23 5,98 ANXA1 3,61 FBXO6 2,84 TUBB2A 2,35 CDKN1B 5,92 LGALS1 3,59 NCF2 2,84 RNASE4 2,34 IFIT2 5,80 TNFRSF9 3,56 CYFIP1 2,84 S1PR1 2,33 ARHGAP26 5,78 SRGN 3,52 SPATS2L 2,83 TJP2 2,32 LINC00537 5,66 ZC3H12C 3,52 ATL1 2,81 NDFIP2 2,32 ATF3 5,62 GATA3 3,50 EOGT 2,81 KDELC1 2,32 SPATA20 5,61 PERP 3,50 FBXO32 2,80 RAB27A 2,31 MB21D1 5,60 PLA2G4A 3,50 ATXN1 2,80 FAM127A 2,30 MAST4 5,53 MET 3,49 BAG3 2,79 ARHGEF40 2,29 PLGRKT 5,46 SQRDL 3,49 SRGAP1 2,78 COL9A2 2,28 SGCB 5,37 CLIC2 3,47 ITPR1 2,77 ANO10 2,28 FLJ42709 5,36 KIF21A 3,47 KIAA1804 2,77 ACVR1C 2,28 PDE4D 5,35 IL32 3,45 PRKCDBP 2,75 NFE2L3 2,27 GPR19 5,34 TPRG1 3,44 LOC285972 2,72 GPR161 2,26 ERO1L 5,28 TIMP1 3,44 SVIP 2,72 EIF4E3 2,26 NCEH1 5,25 CCL5 3,44 BIRC3 2,71 PPM1L 2,26 CHMP2B 5,22 MINPP1 3,43 SERPINB1 2,71 ANXA5 2,26 LOXL3 5,19 CAPN2 3,42 JAM2 2,70 ACPL2 2,26 NFKBIZ 5,13 RNF157 3,42 SIGLECL1 2,70 TAP1 2,26 ARL6IP5 5,13 PLEKHA5 3,41 FUCA2 2,70 IL6ST 2,25 DUSP5P1 5,10 IL2RB 3,40 AHNAK 2,69 STAT3 2,25 EXD2 5,10 EBI3 3,40 REPS2 2,69 NDFIP1 2,24 THEM4 5,08 PTPRN2 3,39 SPAG1 2,69 LOC285957 2,23 DHRS7 5,08 SOCS3 3,39 IL15 2,69 STXBP5 2,23 FLNA 5,07 IL13RA1 3,38 HSPB1 2,69 LOC100507312 2,23 FAM50B 5,04 CCL17 3,38 ARHGEF3 2,68 C17orf58 2,23 C6orf170 4,95 LTA 3,38 TES 2,68 PSEN2 2,22 DGAT2 4,95 IER3 3,35 GBP2 2,67 ZYG11A 2,21 BCL3 4,94 TTC39A 3,34 USP18 2,66 DENND5A 2,21 RNF207 4,93 ENPP2 3,34 TENM3 2,66 NFKBIA 2,21 DENND1B 4,91 TNFRSF8 3,34 FUT4 2,66 FBN1 2,21 SLC26A11 4,90 KRT7 3,33 LOC100132891 2,66 NKIRAS1 2,21 PARVB 4,88 CD274 3,32 GPHN 2,65 NCK2 2,21 ACTA2 4,86 SLC27A2 3,30 ANXA2 2,64 EIF5A2 2,20 RFC5 4,80 IL4I1 3,30 VDR 2,64 FGGY 2,20 LITAF 4,77 SERPINB6 3,30 SEPT8 2,63 ARID5A 2,20 FDXR 4,76 AAED1 3,30 ETV6 2,63 SEPW1 2,19 KIF1B 4,73 MDFIC 3,30 COL22A1 2,63 TRPC1 2,19 UEVLD 4,73 FSCN1 3,30 FAM78B 2,62 STAT1 2,18 HSD3B7 4,72 IRF4 3,27 RAB39B 2,61 BAMBI 2,18 SLFN13 4,71 CFI 3,26 ONECUT2 2,61 SYTL3 2,17 CPOX 4,70 TMEM71 3,24 ELOVL4 2,59 SLC2A3 2,16 CSF1 4,69 CTTN 3,23 LOC154761 2,58 LIMA1 2,16 MAML2 4,68 VIM 3,21 CRYBG3 2,58 TP53BP2 2,16 JAK2 4,62 SH2D1A 3,21 ERC2 2,58 SLC19A2 2,15 SLC41A2 4,59 ACVR1 3,20 PHKA1 2,57 NFIC 2,15 ANKRD33B 4,59 CLU 3,19 TNFRSF11A 2,57 RAB7L1 2,14 FZD7 4,59 LOC389831 3,18 TBC1D4 2,57 HOXB9 2,14 MTUS1 4,49 DHRS2 3,16 EOMES 2,56 LRIG3 2,14 CDON 4,40 EML1 3,14 NMT2 2,56 ANG 2,13 LEPROT 4,31 OPTN 3,14 ICAM1 2,55 STAT5A 2,13 TRIP10 4,29 ARNTL2 3,13 EMP3 2,55 HIST1H2BD 2,12 CREBRF 4,25 ENO2 3,13 MBOAT1 2,54 CELSR3 2,12 HMOX1 4,24 ID2 3,11 LRRC16A 2,54 LEPR 2,12 EXT1 4,24 CYP19A1 3,11 VWA5A 2,53 CPEB2 2,12 WSB2 4,20 SDC4 3,09 HIST1H2AC 2,52 PTGER4 2,11 KLF6 4,19 PLA2G16 3,09 INPP1 2,52 OSBPL6 2,11 SAMD4A 4,15 NCALD 3,08 LINC00158 2,52 CTNNA1 2,11 CTTNBP2NL 4,14 IFITM1 3,06 ABCG2 2,52 TSPAN5 2,10 TRAF3IP3 4,14 IL18R1 3,06 GAD1 2,52 KCNMA1 2,10 CLDND1 4,13 PRAME 3,06 HIST1H2BK 2,51 FRMD6 2,09 C1RL 4,11 ELL2 3,06 JUNB 2,51 KIFAP3 2,09 CASP6 4,10 IL10RA 3,04 SLC37A3 2,51 SHB 2,09 MYO1G 4,05 CMAHP 3,04 SP140 2,51 IL15RA 2,08 KLHL9 4,04 JUN 3,02 PRRG4 2,51 SYNGR3 2,08 PQLC3 4,02 ITGAV 3,01 PTPRR 2,51 HIST3H2A 2,08 FAM24B 4,00 BHLHE40 3,01 BATF 2,50 GALNT6 2,08 TMEM185B 4,00 PPP2R2B 3,00 ZBTB32 2,49 TTC8 2,07 C1orf198 3,96 HIST1H1C 3,00 RYBP 2,48 SEMA4C 2,07 NR4A2 3,95 AKT3 2,99 LOC283485 2,47 SOCS1 2,07 NQO1 3,94 CYP1B1 2,98 LYST 2,47 SPIRE1 2,07 SGPL1 3,93 TMOD1 2,97 LMNA 2,45 TNFSF14 2,06 F12 3,92 RALB 2,96 MVP 2,45 MLLT3 2,04 SLC35G1 3,90 PRDM1 2,96 PCBD1 2,45 IFFO2 2,04 ST8SIA4 3,90 IL6 2,96 CFLAR 2,45 HNRPLL 2,03 DCBLD1 3,89 KSR1 2,96 TNFSF13B 2,44 TMEM216 2,03 CHCHD5 3,88 MSC 2,96 GEM 2,44 ANKRD37 2,03 IL2RG 3,86 SLC2A13 2,95 ARG2 2,43 APOLD1 2,02 C9orf89 3,85 KIAA1211L 2,95 MYO6 2,43 RNF11 2,02 ZBTB38 3,84 CD44 2,93 TDRKH 2,43 NINJ1 2,01 ZYX 3,83 EMR1 2,93 FNBP1 2,43 JMY 2,01 DMXL2 3,83 PON2 2,91 F8 2,43 SPAG4 2,01 SQSTM1 3,82 ANXA4 2,91 IL21R 2,43 ARID3B 2,01 CTNS 3,81 RCN1 2,90 BIVM 2,42 FGF2 2,00 IFIH1 3,80 STX11 2,90 RAPH1 2,42 CHN1 3,80 PHLDA1 2,90 LDLRAD3 2,41 IRF5 3,79 CISH 2,90 RNF213 2,40 ANO3 ! ! Primary HRS cell signature log2 FC – down Log2FC Gene symbol Log2FC Gene symbol Log2FC Gene symbol Log2FC Gene symbol -4,01 CD79B -1,59 HAUS8 -1,25 RGL2 -1,11 METTL21D -3,72 MS4A1 -1,59 CD52 -1,25 FUNDC1 -1,11 TBC1D10C -3,69 TCL1A -1,58 ZNF738 -1,25 EIF1B -1,11 FAM220A -3,44 BLNK -1,56 AIM2 -1,25 GRHPR -1,11 BTG2 -3,24 FAM129C -1,56 STAP1 -1,25 MRPL48 -1,11 HCG27 -3,16 LRMP -1,54 ZHX2 -1,24 CCNI -1,10 CERK -2,61 BIK -1,54 LYL1 -1,24 GNAZ -1,10 PAN2 -2,55 MZB1 -1,54 NAPSB -1,24 LPXN -1,10 EIF2B1 -2,53 IGJ -1,53 FCRL1 -1,24 HMGB2 -1,10 ZFP62 -2,49 AICDA -1,52 PRPSAP2 -1,23 SYPL1 -1,10 ODC1 -2,37 RCSD1 -1,51 LMO2 -1,23 PALD1 -1,09 TCF4 -2,35 FCRLA -1,51 NA -1,23 RPL13A -1,09 HADH -2,25 CD19 -1,51 UBE2J1 -1,23 PCED1B -1,09 RSL1D1 -2,22 ADA -1,50 CBFA2T3 -1,22 LYPLA1 -1,09 EZR -2,20 CXXC5 -1,49 GMDS -1,22 TNFRSF13C -1,09 ZNF776 -2,19 IGHM -1,49 HAUS1 -1,21 DBF4 -1,08 CTCF -2,16 TNFRSF17 -1,49 POLR3GL -1,21 BTG1 -1,08 EHD3 -2,15 PLCG2 -1,48 NUP88 -1,21 LAPTM5 -1,08 POLE3 -2,13 EML6 -1,47 PDLIM1 -1,20 PLA2G12A -1,07 SRM -2,12 PNOC -1,47 FAM83D -1,20 FAM107B -1,07 ADNP -2,11 DTX1 -1,46 ANKRD13A -1,20 STRBP -1,07 SLC25A33 -2,03 P2RY8 -1,46 CCDC109B -1,20 PKIG -1,07 EIF3L -1,97 PMS2P1 -1,45 C1orf186 -1,20 PGLS -1,06 NAP1L1P3 -1,95 CORO1A -1,45 KBTBD8 -1,20 FAM117A -1,06 HLA-DRA -1,91 SYTL1 -1,44 CYFIP2 -1,20 POU2AF1 -1,06 MAP4K1 -1,90 SORL1 -1,43 ACTL6A -1,19 GCSAM -1,05 TMEM154 -1,89 SMIM14 -1,42 SYK -1,19 NLRC3 -1,05 GNPAT -1,85 OSBPL10 -1,41 ZSCAN18 -1,19 NEIL1 -1,05 SET -1,82 GPR18 -1,41 FAM102A -1,19 LTA4H -1,05 CARD11 -1,82 CD72 -1,40 FCRL5 -1,18 GAS5 -1,05 UIMC1 -1,82 SH3BP5 -1,40 DCAF12 -1,18 TNFAIP8L1 -1,04 EIF3KP2 -1,81 HLA-DOB -1,39 LSM10 -1,18 PITPNA-AS1 -1,04 ZNF627 -1,79 VPREB3 -1,38 SEL1L3 -1,18 RFTN1 -1,04 DLEU1 -1,78 GPR160 -1,37 CD22 -1,18 IMP4 -1,04 ARHGAP9 -1,77 UBE2G1 -1,36 MBD4 -1,18 ASB13 -1,04 PPP1CC -1,76 TMEM243 -1,36 KIAA0922 -1,17 CYB561A3 -1,04 SBF2-AS1 -1,74 ZNF600 -1,36 THOC7 -1,17 CD27 -1,04 METTL23 -1,74 ID3 -1,35 TAF7 -1,17 FDFT1 -1,04 HNRNPA3 -1,74 RGCC -1,34 TMSB15B -1,17 PTS -1,03 PPCS -1,73 RPL15 -1,33 ZNF232 -1,17 EEF2 -1,03 ATP5LP2 -1,72 FCRLB -1,33 ACADM -1,17 IRF8 -1,03 MAD2L1 -1,72 GCHFR -1,32 GGA2 -1,17 CDCA7 -1,03 SWAP70 -1,72 DCK -1,32 UCHL1 -1,16 NUSAP1 -1,03 TPGS2 -1,71 DANCR -1,31 RBBP8 -1,16 RBM3 -1,03 SMDT1 -1,70 MYBL2 -1,31 RMI2 -1,16 ENOPH1 -1,03 RPL22 -1,70 SMIM20 -1,30 BCAS4 -1,16 RPL12 -1,03 MPLKIP -1,69 LY86 -1,30 BRI3BP -1,16 ANAPC16 -1,03 SMIM19 -1,69 PRDX2 -1,29 RCCD1 -1,15 COPS4 -1,03 CUTC -1,69 VNN2 -1,29 EIF3E -1,15 GPX7 -1,03 PEX11B -1,68 SYVN1 -1,29 RASSF2 -1,15 SNX3 -1,02 POLR3B -1,68 CCDC69 -1,29 SP140 -1,15 TCTEX1D2 -1,02 SLC1A4 -1,66 BCL11A -1,29 RPL4 -1,15 METTL7A -1,02 RBMX -1,65 RHOH -1,28 C12orf52 -1,14 GMNN -1,02 RPL8 -1,65 NGLY1 -1,28 CSK -1,13 FCRL3 -1,02 SLC25A6 -1,64 SRP9 -1,26 NSUN5P1 -1,13 FCRL2 -1,02 HDHD2 -1,63 LINC00094 -1,26 RAB4A -1,13 GTF3A -1,01 TSPYL1 -1,63 GPT2 -1,26 CDCA7L -1,13 DYM -1,01 TOPBP1 -1,62 ITGAE -1,26 TOMM20 -1,13 KLHDC2 -1,01 LSM6 -1,61 HDAC1 -1,26 DTX4 -1,12 NSUN5P2 -1,01 GOT2 -1,59 STX7 -1,26 MICU2 -1,12 DOK3 -1,00 CCND3 -1,59 MCTS1 -1,26 TMC8 -1,12 FAM214A -1,00 FANCA ! ! Primary HRS cell signature log2 FC – up log2FC Gene symbol log2FC Gene symbol log2FC Gene symbol log2FC Gene symbol 5,52 CCL22 1,81 CHST7 1,46 CD3D 1,17 MLPH 5,19 CCL17 1,80 TNFAIP3 1,45 TMEM173 1,16 C17orf96 4,43 MMP12 1,76 GABRB1 1,44 DSE 1,16 LGALS1 4,39 BATF3 1,75 CTSK 1,44 RCL1 1,16 TIGD2 4,23 TENM2 1,75 SYTL3 1,43 MAFF 1,16 FAM136A 4,21 TUBB2B 1,74 FPR1 1,43 CTTN 1,16 INHBE 3,82 IL1R2 1,74 HSD11B1 1,40 NT5DC4 1,15 C9orf38 3,37 PHLDA2 1,74 CCND2 1,40 SYNGR3 1,14 CCL26 3,36 TFPI2 1,73 GNA15 1,38 SRGN 1,13 SLC22A18 3,11 CYP4Z1 1,72 IFI6 1,36 VIM 1,13 HK3 3,10 EMR1 1,72 IL2RB 1,35 HEXB 1,13 CAV1 2,82 TNFRSF8 1,71 G0S2 1,34 MMP9 1,12 DPYSL2 2,80 CYP27B1 1,66 LAMB3 1,34 CD97 1,11 ANKFN1 2,79 CCR7 1,66 LAG3 1,33 IL15RA 1,11 SLC2A3 2,77 IL6 1,65 F12 1,33 DHRS2 1,11 VDR 2,72 APOBEC3B 1,65 IL7R 1,32 VWA5A 1,10 NEURL3 2,60 ZBTB32 1,62 EBI3 1,32 PXDC1 1,10 ITGAV 2,54 IQCG 1,62 ICOS 1,32 SOCS2 1,08 ANKRD22 2,45 LAMP3 1,62 CD80 1,31 CLEC10A 1,08 ANXA2 2,36 C15orf48 1,62 GPR171 1,31 CD59 1,08 TNFRSF9 2,33 RRAD 1,60 NFKBIA 1,29 FHOD3 1,08 MRPL46 2,31 CHI3L1 1,59 HSPA1B 1,29 LAT 1,06 GNS 2,30 IER3 1,59 FBXO6 1,28 RGL1 1,06 LMNA 2,23 ALPK2 1,58 INPP1 1,26 MGST3 1,06 BLVRA 2,21 TUBB2A 1,58 FNIP2 1,26 SERPINB6 1,04 DGAT2 2,16 ID2 1,56 DUSP4 1,25 PDGFRA 1,04 THY1 2,07 CD274 1,55 C17orf58 1,24 CTSC 1,04 TEX2 1,98 MAL 1,54 DENND5A 1,24 TMIGD2 1,03 SLC27A2 1,98 AMPH 1,54 RCAN2 1,24 PERP 1,03 DAPK1 1,97 GADD45G 1,54 TXN 1,22 SLC2A6 1,03 BHLHE40 1,92 STOM 1,53 ENPP2 1,21 CMBL 1,02 DUSP1 1,92 LAYN 1,52 TMOD1 1,21 FBP1 1,02 STEAP3 1,91 CHIT1 1,51 ITGAM 1,20 ARID5A 1,02 MT-ND5 1,88 CCL18 1,49 RYBP 1,20 HOMER1 1,01 PARP12 1,87 MT-ND2 1,48 EMP3 1,19 MT-ND3 1,01 DCSTAMP 1,85 STAT5A 1,48 IL4I1 1,18 GPR19 1,00 AKR1C3 1,84 CD86 1,48 SLAMF8 1,18 WARS 1,83 HTRA4 1,46 CLIC2 1,17 PBX4 ! ! Supplementary Table 4 Primers and oligonucleotides used for semiquantitative RT-PCR, real time PCR and EMSA analyses were: Human Primers name 5‘-sequence-3‘ product length GAPDH F ATGCTGGCGCTGAGTAC 258 bp GAPDH R TGAGTCCTTCCACGATAC IRF1 F CTGTCGCCATGTGCTGTC 419 bp IRF1 R GGAATGGCCTGGATGGAG IRF2 F AGTCCCATCTGGACAGCAAC 406 bp IRF2 R GAAGAAAGGGGGAGGTCTTG IRF3 F GTGGGGGACTGGCTCTCT 432 bp IRF3 R GCAGGTAGGCCTTGTACTGG IRF4 F GAGCCAAGCATAAGGTCTGC 476 bp IRF4 R GGGTCTGGAAACTCCTCTCC IRF5 F AGGACATCCCCAGTGACAAG 480 bp IRF5 R GATGGAGCTCCTTGAATTGC IRF6 F CCAATGAGAAGCAGAAGCTGT 500 bp IRF6 R CCAGCTCTCCTGGGTTTGA IRF7 F GCTACACGGAGGAACTGCTG 465 bp IRF7 R GCTCCATAAGGAAGCACTCG IRF8 F GTGACGCGGAAGCTGTTC 428 bp IRF8 R TCTGGAAACATCCGGAAGAC IRF9 F GAGCAGCATGGAGCAGGT 405 bp IRF9 R TGCTGCTCTGGAGTCTGCT IL6 F AGGAGACTTGCCTGGTGAAA 329 bp IL6 R GAGGTGCCCATGCTACATTT IL13 F GGTCAACATCACCCAGAACC 411 bp IL13 R TACCCCTCCCTAACCCTCCT TNFA F CTCTTCTGCCTGCTGCACTT 383 bp TNFA R TTGATGGCAGAGAGGAGGTT LTA F ACCACCCTACACCTCCTCCT 435 bp LTA R CAGCCCTGGATACACCATCT RANTES F CGCTGTCATCCTCATTGCTA 409 bp RANTES R CCTGGGGAAGGTTTTTGTAA CSF2 F CTGCTGCTCTTGGGCACT 401 bp CSF2 R CAGCAGTCAAAGGGGATGAC CXCL10 F CCATTCTGATTTGCTGCCTTA 338 bp CXCL10 R CCTCTGTGTGGTCCATCCTT CXCL11 F GCCTTGGCTGTGATATTGTG 229 bp CXCL11 R TAAGCCTTGCTTGCTTCGAT JUN F ACGCAAACCTCAGCAACTTC 421 bp JUN R TGTTTAAGCTGTGCCACCTG CCR7 F TCTTTGCATCAGCATTGACC 486 bp CCR7 R TCGTAGGCGATGTTGAGTTG LITAF F GTCGGTTCCAGGACCTTACC 457 bp LITAF R AGCTCTGCAGTTGGGACAGT GAPDH F (real time) CTCTGCTCCTCCTGTTCGAC 144 bp GAPDH R (real time) TTAAAAGCAGCCCTGGTGAC IL13 F (real time) CATCGAGAAGACCCAGAGGA 114 bp IL13 R (real time) TTTACAAACTGGGCCACCTC RANTES F (real time) TACACCAGTGGCAAGTGCTC 100 bp RANTES R (real time) TGTACTCCCGAACCCATTTC IL6 F (real time) CGAGCCCACCGGGAACGAAAG 192 bp IL6 R (real time) GTGGCTGTCTGTGTGGGGCG IRF5 F (real time) CAGGGGAGCTATCTTGGTCA 96 bp IRF5 R (real time) GATGGAGCTCCTTGAATTGC Murine Primers name 5‘-sequence-3‘ product length CCL5 F CCCTCACCATCATCCTCACT 254 bp CCL5 R GCTCATCTCCAAATAGTTGATGT TNFA F GAACTGGCAGAAGAGGCACT 438 bp TNFA R GTGGGTGAGGAGCACGTAGT IL6 F CTTCACAAGTCCGGAGAGGA 501 bp IL6 R AGATGAATTGGATGGTCTTGG CXCL10 F AAGTGCTGCCGTCATTTTCT 347 bp CXCL10 R GAGGCTCTCTGCTGTCCATC CXCL11 F AGCTGCTCAAGGCTTCCTTA 334 bp CXCL11 R GCATGTTCCAAGACAGCAGA c-MET F GGGTGCCAAGCTACCAGTAA 405 bp c-MET R TCAATGTTGTCTTGGGATGG CD30 F CACGGGACACAAGTTGAGC 400 bp CD30 R CCCATGGTCCTCTTTTCCTC CBFA2T3 F ACCATTTCCGGGACTCCTAC 586 bp CBFA2T3 R ATGACAGTCAGGGCATCCTC JUNB F AAGCTAGCCTCCACGGAACT 405 bp JUNB R ATGTGGGAGGTAGCTGATGG LTA F ACCTCTTGAGGGTGCTTGG 516 bp LTA R TGGACAGCTGGTCTCCCTTA CCR7 F TGGTGGCTCTCCTTGTCATT 503 bp CCR7 R ACAGGACAGCTTGCTGATGA LITAF F CACCCCCAACCTATGAAGAA 558 bp LITAF R CACCCCCTAAAAGACACGAA AICDA F GATATGGACAGCCTTCTGATG 606 bp AICDA R TTGCTTTCAAAATCCCAACA BCL6 F CACACTCGAATTCACTCTG 299 bp BCL6 R TATTGCACCTTGGTGTTGG XBP1 F ACACGCTTGGGAATGGACAC 171 bp XBP1 R CCATGGGAAGATGTTCTGGG PAX5 F GTCCCAGCTTCCAGTCACAGC 351 bp PAX5 R CATGGCTGAATACTCTGTGGT IRF4 F TCTCTGCCAGCCCAGCAGGT 544 bp IRF4 R CCAGGGGCCCATCCCAGTAG EBF1 F CCCTCCAACTGCAGTAGCTC 339 bp EBF1 R GCAAGGTCGGTGATTTTGTT ATF3 F CAACAGACCCCTGGAGATGT 612 bp ATF3 R GGCCAGCTAGGTCATCTGAG JUN F TGAGAACTTGACTGGTTGCG 304 bp JUN R AGTTTGTAACCCCTCCCACC PRDM1 F TGGACTGGGTGGACATGAGAG 550 bp PRDM1 R AAGTGGTGGAACTCCTCTCTG E2A F AGTTCCCTCCCTGACCTCTC 307 bp E2A R GCTCCTTAAAGGCCTCATTG ABF1 F AGAGGAGGACGGTGAAGAGG 457 bp ABF1 R GGAAGTTCCACAAAGCCTGT ID2 F CCAGAGACCTGGACAGAACC 420 bp ID2 R TCCCCATGGTGGGAATAGTA Oligonucleotides for EMSA name 5‘-sequence-3‘ ISRE- sense AGCTGGGAAAGGGAAACCGA-AACTGAAG ISRE- antisense AGCTCTTCAGTTTCGGTTTCCCTTTCCC ISREmut- sense AGCTGGGGATGGCGATCCAGATCTGAAG ISREmut- antisense AGCTCTTCAGATCTGGATCGCCATCCCC AP-1- sense AGCTAGCATGAGTCAGACAC AP-1- antisense AGCTGTGTCTGACTCATGCT Sp1- sense AGCTATTCGATCGGGGCGGGGCGAGC Sp1- antisense AGCTGCTCGCCCCGCCCCGATCGAAT SI Methods DNaseI-Seq library preparation. DNA samples were prepared for sequencing essentially as described previously (2). Cell pellets were washed once with 1 ml of cold PBS, centrifuged at 500 g for 1 min in a microcentrifuge at 4 °C, and resuspended to a concentration of 3 x 107 cells/ml in nuclei digestion buffer (60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 10 mM Tris pH 7.4, 0.3 M sucrose) on ice. Individual aliquots were equilibrated for 3 min at 22 °C, and DNaseI digestions were then performed by adding the enzyme in an equal volume of ~2 to 20 units/ml DNaseI (Worthington) in digestion buffer containing 2 mM CaCl2 and 0.4% NP-40, and digesting for 3 min at 22 °C. Reactions were terminated by addition of an equal volume of 0.3 M Na Acetate, 10 mM EDTA pH 7.4, 1% SDS, 1 mg/ml Proteinase K, and incubated at 45 °C overnight. RNaseA was then added to 0.1 mg/ml and samples were incubated for 1 h at 37 °C before purifying the DNA by phenol and chloroform extractions followed by ethanol precipitation. DHS-derived DNA fragments were isolated by purifying ~100-500 bp DNA samples on an agarose gel. DNA libraries were then prepared for sequencing using Illumina adaptors, as described previously (2). DNaseI-Seq data processing and fold change analysis. For all DNaseI-Seq samples, raw read sequences were obtained in FASTQ format and subsequently aligned via Bowtie (3). In- silico fragment size estimation and tag-count normalization were performed as described in Koch et al. (4). All read densities were scaled to L1236. Peak detection was subsequently carried out via CoCAS (5) which revealed 25865 peaks for L1236, 23329 for L428 and 28043 for Reh cells; for read counts and full peak detection results see Table S1. The union of all L1236 and Reh peaks, or total number of overlapping or specific peaks represented 47258 unique regions, whereby overlapping peaks were defined as those displaying summits within 200 bp and were thus merged. Gene names corresponding to regions were retrieved on the basis of the nearest transcription start site (TSS) via BedTools. Regions were subsequently discriminated according to the distance of the nearest TSS into 8630 promoter regions, within [-1500bp; +1500 bp], and into 26783 inter/intra-genic regions, outside of [-5000bp; +5000bp] around the TSS, respectively. The total number of reads per base pair was retrieved for the union of all regions for all tracks [-200bp; +200bp] around the maximum DNaseI-Seq signal. DNaseI fold changes were computed as log2 ratios of total tag count within [-200bp; +200bp] around the maximum DNaseI-Seq, following median normalization. NH- and HRS-specific gene populations were identified using medium stringent statistical thresholds corresponding to 2! significance relative to means of sub-Gaussians identified using Gaussian fit in R. Heatmaps were generated via Java Treeview (6). For all DHS heatmaps, datasets were center- scaled. DNaseI-Seq data are available from the Gene Expression Omnibus of the National Center for Biotechnology Information (GSE51726; www.ncbi.nlm.nih.gov/geo/). DNaseI cut profiles. To determine the average DNaseI cutting frequency, start and end coordinates for positive and negative strand reads, respectively, were used as 5´ends of DNaseI digested fragments. Densities for DNaseI cut sites were thus generated for each base pair of the human genome. Average cut-site profiles within sets of DHS were subsequently generated by retrieving densities [-100bp; +100bp] around the candidate motifs identified above, and subdividing them into up, down and invariant fractions by intersecting motif coordinates with corresponding DHS. RNA preparation, Northern blot and PCR analyses. RNA preparation and Northern blot (NB) analyses were performed as described (7, 8). For NB analyses, membranes were hybridized with ["-32P]dCTP random prime-labeled DNA probes specific for IRF5 and GAPDH. For RT-PCR analyses, cDNA synthesis was performed with the 1st Strand cDNA Synthesis Kit (AMV; Roche). Semi-quantitative RT-PCR and real-time PCR analyses were performed as described (7). All primers used are listed in Table S4. All PCR products were verified by sequencing. Analysis of cell death. The percentage of viable GFP-positive cells was determined by propidium iodide (PI) staining and subsequent FACS analysis. The percentage of GFP- positive, PI-negative cells, considered as viable population, was determined. Apoptotic cell death was determined by annexin V-APC/PI double staining (Bender MedSystems) according to the manufacturer´s recommendations. For staining of active caspase-3, intracellular FACS analysis was performed using standard protocols and rabbit caspase-3, Active Form antibody (#560626; BD Biosciences). Oligonucleotide microarray analyses and gene set enrichment analysis (GSEA). Transfected Reh cells and transduced murine splenic B cells were enriched, and RNA processing and hybridization to U133 Plus 2.0 (Affymetrix) or mouse arrays (WG-6 v2.0, Illumina) were performed according to the manufacturer´s recommendations. All processing of data was done in R (http://www.r-project.org). RMA background correction and quantile normalization were applied to raw data. Processed data were variance-filtered with an interquartile range cut-off of 0.5. Significantly deregulated features were extracted using LIMMA with an adjusted p-value cut-off of 0.05 and a log2-fold change cut-off of 0.5. Microarray data are available from the Gene Expression Omnibus of the National Center for Biotechnology Information (GSE51717 and GSE51719!" www.ncbi.nlm.nih.gov/geo/). The Java implementation of GSEA according to Subramanian et al. (9) was applied to compute enrichment of particular gene sets. Preparation of protein extracts, Western blotting (WB), and electrophoretic mobility shift assay (EMSA). Whole-cell and nuclear extract preparation, EMSA and WB were performed as described (7, 8). For WB, the following primary antibodies were used: polyclonal anti-IRF5 (3257; Cell Signaling Technology), monoclonal anti-PARP1 (sc-8007), polyclonal anti-I!B" (sc-371; both Santa Cruz Biotechnology), monoclonal anti-FLAG M2 (F1804), monoclonal anti-#-actin (A5316, both Sigma Aldrich). Filters were incubated with HRP-conjugated secondary antibodies. Bands were visualized using the enhanced ECL system (Amersham Pharmacia Biotech). Oligonucleotides used for EMSA analyses are listed in Table S4. The following antibodies were used for supershift analyses: anti-IRF5 (3257; Cell Signaling Technology), anti-c-Jun (sc-1694), anti-JunB (sc-046), anti-pan-Jun (sc-044; all Santa Cruz Biotechnology), isotype control (AB-105-c, R&D systems). Measurement of the secreted amount of IL-6 and RANTES by ELISA. ELISA was performed with supernatants of transfected cell lines L591, L540Cy, Reh and BJAB, as indicated. For generation of supernatants, cell lines were transfected and enriched by FACS sorting, and re-cultured for another 24 – 48 h before collection of supernatants. For RANTES detection, the Rantes DuoSet ELISA Development kit (DY360; R&D Systems) was used according to the manufacturer´s recommendations. For measurement of IL-6, MAB206 was used as capture antibody and BAF206 as detection antibody (both R&D Systems). rhIL-6 (206-IL; R&D Systems) was used as standard. Optical density was determined at 450 nm (corrected for optical imperfections of the plate measured at 570 nm). Chemotaxis assay. Reh and BJAB cells were transfected and enriched as described above. Supernatants were collected following re-culture of enriched cells for another 24 – 48 h. Peripheral blood mononuclear cells (PMNC) from different donors were purified using Ficoll- Paque (Pharmacia Biotech), and 106 PMNCs were added in 3-µm pore size transwell inserts (Corning) into the supernatants. Following incubation for 2.5 hours at 37 °C, inserts were removed and migrated cells were enriched and counted in a Neubauer chamber as described (10). Immunohistochemistry (IHC). For IHC, the dewaxed 4 µm sections were subjected to an antigen-demasking procedure of brief, high-temperature heating of the sections immersed in citrate buffer (10 mM, pH 6.0) and heating for 2 min in a high-pressure cooker. IRF5 antibody (#3257; Cell Signaling Technology) was applied at a dilution of 1:500. Bound antibody was visualized using the alkaline phosphatase anti-alkaline phosphatase method and FastRed as chromogen (DAKO). Methylation data processing and fold change analysis. DNA-methylation levels in promoter regions of various cell lines, as indicated in the Figure legends, were analyzed using an Illumina 450K array according to the manfacturer´s recommendations. For the analysis of methylation sample data, image scanning, processing, feature extraction and normalization were performed in Illumina GenomeStudio. Higher-level analysis was performed in R using IMA (https://www.rforge.net/IMA/index.html) followed by a custom R pipeline where probe methylation levels were aggregated per promoter. Promoter methylation fold changes were computed as log2 ratios. Methylation data are available from the Gene Expression Omnibus of the National Center for Biotechnology Information (GSE51813; www.ncbi.nlm.nih.gov/geo/). Expression fold change analysis. Expression data was obtained as Affymetrix CEL files, which were processed, background subtracted and normalized in R using gc.rma. Unique gene expression data was subsequently derived as the average of all probe set values corresponding to one gene. Expression fold change boxplots were computed in R. The significance between NH- and HRS-specific gene expression levels was assessed using pairwise KS tests in R. For DNaseI-Seq versus expression fold change correlation plots, total DNaseI-Seq tag counts and expression data were sorted by ascending log2 (L1236 over Reh) DNaseI fold change and averaged into 1000 points. Linear fits, Spearman correlation coefficients and graphs were computed in R. mRNA microarray expression data of the cell lines were previously published (11). Chromatin immunoprecipitation (ChIP) assays and real-time PCR analyses. Growing cells were harvested and washed in cold PBS. Chromatin was cross-linked with 1% formaldehyde (Thermo Scientific) for 1 hour at 4 °C. The crosslinking reaction was quenched by the addition of glycine to a final concentration of 200 mM, followed by two washes with ice-cold PBS. The cells were lysed in 10 mM HEPES (pH 8), 10 mM EDTA, 0.5 mM EGTA, 0.25% Triton X100 and protease inhibitor cocktail (PIC, Sigma). The nuclei were collected by centrifugation and lysed in 10 mM HEPES (pH 8), 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.01% Triton X100 and PIC. Chromatin was transferred to IP buffer containing 25 mM Tris-HCl (pH 8), 2 mM EDTA, 150 mM NaCl, 1% Triton X100, 0.25% SDS, PIC and sheared using a Bioruptor sonicating water bath (Diagenode) to an average length of 200 – 500 bp. The chromatin solution was diluted in 25 mM Tris-HCl (pH 8), 2 mM EDTA, 150 mM NaCl, 1% Triton X100, 7.5% glycerol and antibody precipitations were performed. Chromatin from 106 cells and 10 µl of Dynabeads protein G (Invitrogen) coupled with 1 µg of RNA Pol II phospho S2, RNA Pol II phospho S5, H3K9me3, H3K4me3, Histone 3 antibody (respectively ab5095, ab5131, ab8898, ab8580, ab1791; all Abcam, Cambridge, UK) were incubated for 2 hours at 4 °C with rotation. The immune complexes were collected using a magnet separator and washed with low salt wash buffer 1 (20 mM Tris-HCl (pH 8), 2 mM EDTA, 1% Triton X100, 0.1% SDS, 150 mM NaCl), high salt wash buffer 2 (20 mM Tris- HCl (pH 8), 2 mM EDTA, 1% Triton X100, 0.1% SS, 500 mM NaCl), LiCl buffer (10 mM Tris-HCl (pH 8), 1 mM EDTA, 0.25 M LiCl, 0.5% NP40, 0.5% Na-deoxycholate) and TE/NaCl buffer (10 mM Tris-HCl (pH 8), 1 mM EDTA, 50 mM NaCl). Precipitated DNA was eluted in 1% SDS and 100 mM NaHCO3 followed by crosslinking reversal by heating at 65 °C overnight. Chromatin DNA was purified using Ampure PCR purification kit (Agencourt AMPure, APN 000130) and quantified using real-time qPCR with SYBR Green. Primers used in this assay were hIVL F 5´- GCCGTGCTTTGGAGTTCTTA, hIVL R 5´- CCTCTGCTGCTGCCACTT; IRF5 -29 kb F 5´- GACGGGCTGGTAAAATCTCA, IRF5 -29 kb R 5´- GTACCAAAGCCTTGCAGCTC; IRF5 -10 kb F 5´- CCCGACCCTCGAGACAGGCA, IRF5 -10 kb R 5´- GTGTCCCGGAGCCTTGGTGC; IRF5 -7.5 kb F 5´- GAGGGCAGGGGTTTTTAGAC, IRF5 -7.5 kb R 5´- TCACGAATTGGCTGTGAGTC; IRF5 TSS2 F 5´- GGCCTGCAATGTGAGACAGT, IRF5 TSS2 R 5´- CTGAAATTCCCTGCCCAGTA; IRF5 -2.6 kb F 5´- TTCTTTCTGGGCACCTTTTG, IRF5 -2.6 kb R 5´- CAGCTCAGGGAGAGGACAAG; IRF5 TSS1 F 5´- AGGTACGGGGTTGTCAAATG, IRF5 TSS1 R 5´- GGGAGATGCCAGACGGCG; IRF5 3´UTR F 5´- CTCAAACTCCTGGCCTCAAG, IRF5 3´UTR R 5´- GTGGGAATGATGCTTCACCT; IRF5 +7 kb F 5´- TTCAGCCTGGAGCATTTTCT, IRF5 +7 kb R 5´- TCCCTAGTCAGAGGCTGGAA. References mentioned in SI Methods !"# $%&''%#(!")*#&+## ,-.!-/# 01&+23%14# 56%7&62# 89:4;%1# &1:# <)):=>*)61?)64#')++@#*9#'&5*A6)# *B)# 79+)'A+&6# &1:# ')++A+&6# 5&*B94)1)@%@# 9C# '+&@@%'&+# 89:4;%1# +275B97&"# $%&&'# !-.,-D/EFG.H=FG-."# -"## I*&@%1@;�J#)*#&+"#,-.!-/#K)5+)*%91#9C#