DOCSLIB.ORG

Additional Information on the R. Filosa Genome Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Additional Information on the R. Filosa Genome Analysis Additional Supplemental file for “The Genome of the foraminiferan Reticulomyxa filosa ” Content 1. The Genome ........................................................................................................................... 3 1.1 Fosmid end sequencing ..................................................................................................... 3 1.2 Repeats ............................................................................................................................. 4 1.3 Repetitiveness between fosmid clones .............................................................................. 4 1.4 Transposons ...................................................................................................................... 5 1.5 Highly repetitive sequences tend to be not represented in the whole genome assembly.... 6 1.6 Genome size estimation ..................................................................................................... 7 2. Completeness ......................................................................................................................... 8 2.1 Completeness calculation using CEGMA ........................................................................... 8 2.2 Transcriptome coverage .................................................................................................... 9 2.3 Next generation transcriptome sequencing ...................................................................... 10 3. Gene repertoires and potential pseudogenes ........................................................................ 12 3.1 tRNA genes ..................................................................................................................... 12 3.2 Protein coding gene prediction ......................................................................................... 13 3.3 Homopolymer runs in the predicted proteins .................................................................... 14 3.4 Gene families ................................................................................................................... 15 3.5 Detailed analysis of some gene families .......................................................................... 16 3.5.1 GPCRs ...................................................................................................................... 16 3.5.2 Signaling proteins ...................................................................................................... 17 3.5.3 Adhesion and phagocytosis ....................................................................................... 20 3.5.4 Motor domain proteins ............................................................................................... 25 3.5.5 Meiosis related genes ................................................................................................ 28 1 3.5.6 Transcription factors .................................................................................................. 29 4. Comparative genomics ......................................................................................................... 32 4.1 Identification of common genes between R. filosa and other Foraminifera ....................... 32 4.2 Common and divergent gene sets in Rhizaria and other Eukaryote lineages ................... 33 4.3 Horizontal gene transfer (HGT) ........................................................................................ 36 4.3.1 Global analysis of potential HGT ............................................................................... 36 4.3.2 HGT from eukaryotes ................................................................................................ 38 5. References ............................................................................................................................ 40 2 1. The Genome 1.1 Fosmid end sequencing We sequenced more than 8,000 fosmids from each end using classical Sanger based technology. This yielded 16,715 raw sequences, which we mapped after quality clipping with varying thresholds to the complete assembly. Only 25 % of the fosmid end sequences we generated could be mapped to the assembled genome over the entire length if we assumed an error rate of 2 % in the sequencing reads. If we allow partial matches with varying identity thresholds we can match more than 15,000 fosmid end sequences to the assembly (Fig. S1). Most of the reads can be matched to the genome, if lower threshold values are applied, but higher thresholds prevent mapping of more than half of the sequences. This indicates that this half of the reads matches to repetitive contigs with slight sequence variation. Therefore, we concluded that most of the genome is repetitive and not represented by the assembly. Visual inspection of randomly selected alignments showed that indeed often nearly identical sections of fosmid end sequences are interspersed with other sequences, thus preventing the alignment of the whole read to the assembly. This finding underscores that the genome holds nearly identical sequences dispersed throughout the genome. This would thus prevent a whole genome assembly even if long range mapping information were available. Figure S1: Matching of fosmid end sequences to the whole genome assembly . The different curves were obtained by defining the minimum matching length in bases of the fosmid end sequence to the assembly. 3 1.2 Repeats To analyze the genome structure in more detail and resolve the discrepancy between previous genome size estimates (350 to 550 MB) we completely sequenced 15 fosmids using traditional Sanger sequencing technology. 13 where picked randomly and two were selected according to matches of their ends to one of the sequenced fosmids to enlarge the contiguous sequenced area. We then used the fosmid sequences as backbone for the mapping of Illumina reads. From the sequenced fosmid clones we isolated sequence sections which are highly overrepresented indicated by sequence coverage. One of those sections is 351 bases long and is an inverted repeat. The coverage indicates that this small simple repeat makes up several Mb of the R. filosa genome (Fig. S2). A GACTAGTCAACCATAGGCCAAGTCATAGACTAACATTTTATACATAGACTTAGACTCATTGAAGCAATA CACTAGGGTGCTTATGCAACCTCATATGACTAGTAGGCTAACCTATTAGGCCAAAGTTATACTGATGA TCGATATCACTATCACTAAGACCTCGATAGGCTTAGCCCAGTAGGCCTATTTTGGTCTTAGTGATGGC GATATTGATCACTAGGCCAAACTTTGTCCTATATGGTAGACTACTAGTCCTATGAGGTTACATAAGCA CCCTACCCTATTGCTTCAATTGAGGTAGGCCAAGTATAAAATGTATAGTTTATGACTTGGCCTAGTAG GGCAGTCTAC B Figure S2: The most abundant simple repeat observed. A: Sequence of the inverted repeat. B: Graphical representation of the repeat structure of A. 1.3 Repetitiveness between fosmid clones In addition to the simple repeats we could identify in the fosmid clones we found that longer stretches of fosmid sequences were duplicated in other fosmid clones (Fig. S3). The respective fosmid clones are not overlapping clones from the same chromosomal region since differences in the similar sequences exist. Since we sequenced a haploid genome these sequences do not represent allelic differences but rather segmental duplications. 4 Figure S3: A miropeat graph [1] showing repeated structures in three fosmids . The simple repeat of Fig. S2 is represented by the end fragment of the third fosmid clone and present in several copies in the others. Fosmid Rf14 and FSTFLP are nearly identical showing that extensive similar segments exist in this genome. 1.4 Transposons We searched the predicted genes for presence of transposon domains and found 114 predicted genes with such domains. A coverage analysis of all contigs carrying these transposon-derived sequences revealed that the contig sequences are not overrepresented in the genome (Fig. S4). Closer inspection revealed that some contig parts exhibit a higher coverage than normal, but these parts do not contain the transposon domains. We also found that the coverage of these contigs has a more pronounced double peak than the whole genome. Indeed, most of the transposon sequences appear to be derived from the Rickettsia like endonuclear parasite. Figure S4: Coverage plot for all transposon containing contigs . The doted line shows coverage of all bases while the solid line indicates the coverage of contigs larger than 2 kb. 5 1.5 Highly repetitive sequences tend to be not represented in the whole genome assembly We checked, whether our assembly contained the previously sequenced SSU RNA gene. Interestingly, we did not find a contig matching to this sequence in the genome assembly. The transcriptome data, however, yielded an almost identical match to three individual contigs covering the whole published SSU sequence. We then mapped the raw sequencing reads from the Illumina run to this template and found that more than 400,000 reads could be mapped to this contig (Fig. S5). The mean coverage was more than 20,000 indicating that at least 200 SSU copies are present in the R. filosa genome. None of the other assembly approaches including the separate assembly of 454 reads only yielded SSU contigs. We conclude that the high coverage is unfavorable for the assembly due to sequencing errors, incomplete and varying copies. We checked whether proteins found to be missing in the assembly match to the 4x coverage raw sequencing reads from the 454 titanium runs. In no case we found such matches indicating that the observed failure to assemble the SSU regions is restricted to highly amplified segments. Figure S5: Illumina reads matching
Load more

Recommended publications
  • Sex Is a Ubiquitous, Ancient, and Inherent Attribute of Eukaryotic Life
    PAPER Sex is a ubiquitous, ancient, and inherent attribute of COLLOQUIUM eukaryotic life Dave Speijera,1, Julius Lukešb,c, and Marek Eliášd,1 aDepartment of Medical Biochemistry, Academic Medical Center, University of Amsterdam, 1105 AZ, Amsterdam, The Netherlands; bInstitute of Parasitology, Biology Centre, Czech Academy of Sciences, and Faculty of Sciences, University of South Bohemia, 370 05 Ceské Budejovice, Czech Republic; cCanadian Institute for Advanced Research, Toronto, ON, Canada M5G 1Z8; and dDepartment of Biology and Ecology, University of Ostrava, 710 00 Ostrava, Czech Republic Edited by John C. Avise, University of California, Irvine, CA, and approved April 8, 2015 (received for review February 14, 2015) Sexual reproduction and clonality in eukaryotes are mostly Sex in Eukaryotic Microorganisms: More Voyeurs Needed seen as exclusive, the latter being rather exceptional. This view Whereas absence of sex is considered as something scandalous for might be biased by focusing almost exclusively on metazoans. a zoologist, scientists studying protists, which represent the ma- We analyze and discuss reproduction in the context of extant jority of extant eukaryotic diversity (2), are much more ready to eukaryotic diversity, paying special attention to protists. We accept that a particular eukaryotic group has not shown any evi- present results of phylogenetically extended searches for ho- dence of sexual processes. Although sex is very well documented mologs of two proteins functioning in cell and nuclear fusion, in many protist groups, and members of some taxa, such as ciliates respectively (HAP2 and GEX1), providing indirect evidence for (Alveolata), diatoms (Stramenopiles), or green algae (Chlor- these processes in several eukaryotic lineages where sex has oplastida), even serve as models to study various aspects of sex- – not been observed yet.
    [Show full text]
  • Protist Phylogeny and the High-Level Classification of Protozoa
    Europ. J. Protistol. 39, 338–348 (2003) © Urban & Fischer Verlag http://www.urbanfischer.de/journals/ejp Protist phylogeny and the high-level classification of Protozoa Thomas Cavalier-Smith Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK; E-mail: [email protected] Received 1 September 2003; 29 September 2003. Accepted: 29 September 2003 Protist large-scale phylogeny is briefly reviewed and a revised higher classification of the kingdom Pro- tozoa into 11 phyla presented. Complementary gene fusions reveal a fundamental bifurcation among eu- karyotes between two major clades: the ancestrally uniciliate (often unicentriolar) unikonts and the an- cestrally biciliate bikonts, which undergo ciliary transformation by converting a younger anterior cilium into a dissimilar older posterior cilium. Unikonts comprise the ancestrally unikont protozoan phylum Amoebozoa and the opisthokonts (kingdom Animalia, phylum Choanozoa, their sisters or ancestors; and kingdom Fungi). They share a derived triple-gene fusion, absent from bikonts. Bikonts contrastingly share a derived gene fusion between dihydrofolate reductase and thymidylate synthase and include plants and all other protists, comprising the protozoan infrakingdoms Rhizaria [phyla Cercozoa and Re- taria (Radiozoa, Foraminifera)] and Excavata (phyla Loukozoa, Metamonada, Euglenozoa, Percolozoa), plus the kingdom Plantae [Viridaeplantae, Rhodophyta (sisters); Glaucophyta], the chromalveolate clade, and the protozoan phylum Apusozoa (Thecomonadea, Diphylleida). Chromalveolates comprise kingdom Chromista (Cryptista, Heterokonta, Haptophyta) and the protozoan infrakingdom Alveolata [phyla Cilio- phora and Miozoa (= Protalveolata, Dinozoa, Apicomplexa)], which diverged from a common ancestor that enslaved a red alga and evolved novel plastid protein-targeting machinery via the host rough ER and the enslaved algal plasma membrane (periplastid membrane).
    [Show full text]
  • Author's Manuscript (764.7Kb)
    1 BROADLY SAMPLED TREE OF EUKARYOTIC LIFE Broadly Sampled Multigene Analyses Yield a Well-resolved Eukaryotic Tree of Life Laura Wegener Parfrey1†, Jessica Grant2†, Yonas I. Tekle2,6, Erica Lasek-Nesselquist3,4, Hilary G. Morrison3, Mitchell L. Sogin3, David J. Patterson5, Laura A. Katz1,2,* 1Program in Organismic and Evolutionary Biology, University of Massachusetts, 611 North Pleasant Street, Amherst, Massachusetts 01003, USA 2Department of Biological Sciences, Smith College, 44 College Lane, Northampton, Massachusetts 01063, USA 3Bay Paul Center for Comparative Molecular Biology and Evolution, Marine Biological Laboratory, 7 MBL Street, Woods Hole, Massachusetts 02543, USA 4Department of Ecology and Evolutionary Biology, Brown University, 80 Waterman Street, Providence, Rhode Island 02912, USA 5Biodiversity Informatics Group, Marine Biological Laboratory, 7 MBL Street, Woods Hole, Massachusetts 02543, USA 6Current address: Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, Connecticut 06520, USA †These authors contributed equally *Corresponding author: L.A.K - [email protected] Phone: 413-585-3825, Fax: 413-585-3786 Keywords: Microbial eukaryotes, supergroups, taxon sampling, Rhizaria, systematic error, Excavata 2 An accurate reconstruction of the eukaryotic tree of life is essential to identify the innovations underlying the diversity of microbial and macroscopic (e.g. plants and animals) eukaryotes. Previous work has divided eukaryotic diversity into a small number of high-level ‘supergroups’, many of which receive strong support in phylogenomic analyses. However, the abundance of data in phylogenomic analyses can lead to highly supported but incorrect relationships due to systematic phylogenetic error. Further, the paucity of major eukaryotic lineages (19 or fewer) included in these genomic studies may exaggerate systematic error and reduces power to evaluate hypotheses.
    [Show full text]
  • TRANSDIFFERENTATION in Turritopsis Dohrnii (IMMORTAL JELLYFISH)
    TRANSDIFFERENTATION IN Turritopsis dohrnii (IMMORTAL JELLYFISH): MODEL SYSTEM FOR REGENERATION, CELLULAR PLASTICITY AND AGING A Thesis by YUI MATSUMOTO Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Chair of Committee, Maria Pia Miglietta Committee Members, Jaime Alvarado-Bremer Anja Schulze Noushin Ghaffari Intercollegiate Faculty Chair, Anna Armitage December 2017 Major Subject: Marine Biology Copyright 2017 Yui Matsumoto ABSTRACT Turritopsis dohrnii (Cnidaria, Hydrozoa) undergoes life cycle reversal to avoid death caused by physical damage, adverse environmental conditions, or aging. This unique ability has granted the species the name, the “Immortal Jellyfish”. T. dohrnii exhibits an additional developmental stage to the typical hydrozoan life cycle which provides a new paradigm to further understand regeneration, cellular plasticity and aging. Weakened jellyfish will undergo a whole-body transformation into a cluster of uncharacterized tissue (cyst stage) and then metamorphoses back into an earlier life cycle stage, the polyp. The underlying cellular processes that permit its reverse development is called transdifferentiation, a mechanism in which a fully mature and differentiated cell can switch into a new cell type. It was hypothesized that the unique characteristics of the cyst would be mirrored by differential gene expression patterns when compared to the jellyfish and polyp stages. Specifically, it was predicted that the gene categories exhibiting significant differential expression may play a large role in the reverse development and transdifferentiation in T. dohrnii. The polyp, jellyfish and cyst stage of T. dohrnii were sequenced through RNA- sequencing, and the transcriptomes were assembled de novo, and then annotated to create the gene expression profile of each stage.
    [Show full text]
  • Paulinella Micropora KR01 Holobiont Genome Assembly for Studying Primary Plastid Evolution
    bioRxiv preprint doi: https://doi.org/10.1101/794941; this version posted October 7, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Paulinella micropora KR01 holobiont genome assembly for studying primary plastid evolution Duckhyun Lhee1, JunMo Lee2, Chung Hyun Cho1, Ji-San Ha1, Sang Eun Jeong3, Che Ok Jeon3, Udi Zelzion4, Dana C. Price5, Ya-Fan Chan4, Arwa Gabr4, Debashish Bhattacharya4,*, Hwan Su Yoon1,* 1Department of Biological Sciences, Sungkyunkwan University, Suwon 16419, Korea 2Department of Oceanography, Kyungpook National University, Daegu 41566, Korea 3Department of Life Science, Chung-Ang University, Seoul 06974, Korea 4Department of Biochemistry and Microbiology, Rutgers University, New Brunswick, NJ 08901, U.S.A. 5Department of Plant Biology, Center for Vector Biology, Rutgers University, New Brunswick, NJ 08901, U.S.A. *Authors for correspondence Key words: Paulinella, primary endosymbiosis, endosymbiotic gene transfer Running title: Analysis of Paulinella draft genome Abstract The widespread algal and plant (Archaeplastida) plastid originated >1 billion years ago, therefore relatively little can be learned about plastid integration during the initial stages of primary endosymbiosis by studying these highly derived species. Here we focused on a unique model for endosymbiosis research, the photosynthetic amoeba Paulinella micropora KR01 (Rhizaria) that underwent a more recent independent primary endosymbiosis about 124 Mya. A total of 149 Gbp of PacBio and 19 Gbp of Illumina data were used to generate the draft assembly that comprises 7,048 contigs with N50=143,028 bp and a total length of 707 Mbp. Genome GC-content was 44% with 76% repetitive sequences.
    [Show full text]
  • Foraminifera and Cercozoa Share a Common Origin According to RNA Polymerase II Phylogenies
    International Journal of Systematic and Evolutionary Microbiology (2003), 53, 1735–1739 DOI 10.1099/ijs.0.02597-0 ISEP XIV Foraminifera and Cercozoa share a common origin according to RNA polymerase II phylogenies David Longet,1 John M. Archibald,2 Patrick J. Keeling2 and Jan Pawlowski1 Correspondence 1Dept of zoology and animal biology, University of Geneva, Sciences III, 30 Quai Ernest Jan Pawlowski Ansermet, CH 1211 Gene`ve 4, Switzerland [email protected] 2Canadian Institute for Advanced Research, Department of Botany, University of British Columbia, #3529-6270 University Blvd, Vancouver, British Columbia, Canada V6T 1Z4 Phylogenetic analysis of small and large subunits of rDNA genes suggested that Foraminifera originated early in the evolution of eukaryotes, preceding the origin of other rhizopodial protists. This view was recently challenged by the analysis of actin and ubiquitin protein sequences, which revealed a close relationship between Foraminifera and Cercozoa, an assemblage of various filose amoebae and amoeboflagellates that branch in the so-called crown of the SSU rDNA tree of eukaryotes. To further test this hypothesis, we sequenced a fragment of the largest subunit of the RNA polymerase II (RPB1) from five foraminiferans, two cercozoans and the testate filosean Gromia oviformis. Analysis of our data confirms a close relationship between Foraminifera and Cercozoa and points to Gromia as the closest relative of Foraminifera. INTRODUCTION produces an artificial grouping of Foraminifera with early protist lineages. The long-branch attraction phenomenon Foraminifera are common marine protists characterized by was suggested to be responsible for the position of granular and highly anastomosed pseudopodia (granulo- Foraminifera and some other putatively ancient groups of reticulopodia) and, typically, an organic, agglutinated or protists in rDNA trees (Philippe & Adoutte, 1998).
    [Show full text]
  • A Fossilized Microcenosis in Triassic Amber. Schönborn, W., Dörfelt, H., Foissner, W., Krienitz, L
    J:' Eu.l@ryot. Microbiol., 46(6), 1999 pp. 57 l-584 @ 1999 by the Society of Protozoologists l A Fossilized Microcenosis in Triassic Amber WILFRIED SCTTÖNNONN," HEINIRICH DÖRtr'ELT,O WILHELM FOISSNER," LOTIIAR KRIEMTZd ANd URSULA SCHAF'ER" "Friedrich-schiller-[Jniversität Jeru, Institut fiir ökologie, Arbeitsgruppe Limnologie, Winzerlaer Strafie 10, D-07745 Jena, Germany, and bFriedrich-Schiller-tlniversität Jena,Institut fiir Ernährung und (Jmwelt, Ichrgebiet Landschaftsökologie und Naturschutz, Dornburgerstrat3e 159, D-07743 Jena, Germany, and "Unbersität Salaburg, Institut für Zoologie, HellbrunnerstraJ3e 34, A-5020 Salzburg, Austria, and dlnstitutfür Gewässerökologie und Binnenfischerei, Alte Fischerhütte 2, D-16775 Neuglobsow, Germany ABSTRACT. Detailed data on bacterial and protistan microfossils axe presented from a 0.003 mm3 piece of Ttiassic amber (Schlier- seerit, Upper Tliassic period, 22O-23O million years old). This microcenosis, which actually existed as such within a very small, probably semiaquatic habitat, included the remains of about two bacteria species, four fungi (Palaeodikaryomyces bauerL Pithornyces-like conidia, capillitium-Iike hyphae, yeast cells) two euglenoids, two chlamydomonas (Chlamydomonas sp., Chloromonas sp.), two coccal green microalgae (Chlorell.a sp., Choricystis-like cells), one zooflagellate, three testate amoebae (Centropyxis aculeata var. oblonga-like, Cyclopyxis eurystoma-like, Hyalosphenia baueri n. sp.), seven ciliates (Pseudoplatyophrya nana-l|ke, Mykophagophrys terricola-like, Cyrtolophosis
    [Show full text]
  • Genome-Reconstruction for Eukaryotes from Complex Natural Microbial Communities
    Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Genome-reconstruction for eukaryotes from complex natural microbial communities ,$ Patrick T. West1, Alexander J. Probst2 , Igor V. Grigoriev1,5, Brian C. Thomas2, Jillian F. Banfield2,3,4* 1Department of Plant and Microbial Biology, University of California, Berkeley, CA, USA. 2Department of Earth and Planetary Science, University of California, Berkeley, CA, USA. 3Department of Environmental Science, Policy, and Management, University of California, Berkeley, CA, USA. 4Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA. 5US Department of Energy Joint Genome Institute, Walnut Creek, California, USA. * Corresponding Author $present address: Group for Aquatic Microbial Ecology, Biofilm Center, Department of Chemistry, University of Duisburg-Essen, Essen, Germany Running title Metagenomic Reconstruction of Eukaryotic Genomes Keywords metagenomics, eukaryotes, genome, gene prediction Corresponding author contact info Jillian Banfield Department of Environmental Science, Policy, & Management UC Berkeley 130 Mulford Hall #3114 Berkeley, CA 94720 [email protected] (510) 643-2155 1 Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Microbial eukaryotes are integral components of natural microbial communities and their inclusion is critical for many ecosystem studies yet the majority of published metagenome analyses ignore eukaryotes. In order to include eukaryotes in environmental studies we propose a method to recover eukaryotic genomes from complex metagenomic samples. A key step for genome recovery is separation of eukaryotic and prokaryotic fragments. We developed a k-mer- based strategy, EukRep, for eukaryotic sequence identification and applied it to environmental samples to show that it enables genome recovery, genome completeness evaluation and prediction of metabolic potential.
    [Show full text]
  • Reticulomyxa: a New Model System of Intracellular Transport
    y. Cell Sci. Suppl. 5, 145-159 (1986) 145 Printed in Great Britain © The Company of Biologists Limited 1986 RETICULOMYXA: A NEW MODEL SYSTEM OF INTRACELLULAR TRANSPORT MICHAEL P. KOONCE, URSULA EUTENEUER a n d MANFRED SCHLIWA Department of Zoology, University of California, Berkeley, CA 94720, USA SUMMARY Reticulomyxa is a large multinucleated freshwater protozoan that provides a new model system in which to study intracellular transport and cytoskeletal dynamics. Within the cell body and reticulopodial network, rapid, visually striking saltatory organelle motility as well as bulk cytoplasmic streaming can be readily observed. In addition, the cytoskeletal elements within these strands undergo dynamic splaying and fusing rearrangements, which can be visualized by video­ enhanced light microscopy. A reactivatable lysed cell model has been developed that appears to preserve, and therefore permits examination of, these three forms of motility in a more controlled environment. Individual organelle movements are microtubule-based and have similarities to, but also differences from, the recently described kinesin-based transport. This lysed cell model can be further manipulated to provide native, ordered, completely exposed networks of either microtubules or microfilaments, or a combination of both, and thus may serve as a versatile motility assay system in which to examine the movement of exogenously added isolated organelles or latex beads. INTRODUCTION The transport of organelles from one subcellular region to another is a fundamental process of nearly every eukaryotic cell. Many pharmacological and correlative light- and electron-microscopical studies have demonstrated that microtubules and microfilaments play an integral role in this phenomenon (reviewed by Schliwa, 1984). In general, the directed, often saltatory, movement of individual organelles is representative of microtubule-based transport systems in animal cells including neurons (Allen et al.
    [Show full text]
  • The Evolution of Early Foraminifera
    The evolution of early Foraminifera Jan Pawlowski†‡, Maria Holzmann†,Ce´ dric Berney†, Jose´ Fahrni†, Andrew J. Gooday§, Tomas Cedhagen¶, Andrea Haburaʈ, and Samuel S. Bowserʈ †Department of Zoology and Animal Biology, University of Geneva, Sciences III, 1211 Geneva 4, Switzerland; §Southampton Oceanography Centre, Empress Dock, European Way, Southampton SO14 3ZH, United Kingdom; ¶Department of Marine Ecology, University of Aarhus, Finlandsgade 14, DK-8200 Aarhus N, Denmark; and ʈWadsworth Center, New York State Department of Health, P.O. Box 509, Albany, NY 12201 Communicated by W. A. Berggren, Woods Hole Oceanographic Institution, Woods Hole, MA, August 11, 2003 (received for review January 30, 2003) Fossil Foraminifera appear in the Early Cambrian, at about the same loculus to become globular or tubular, or by the development of time as the first skeletonized metazoans. However, due to the spiral growth (12). The evolution of spiral tests led to the inadequate preservation of early unilocular (single-chambered) formation of internal septae through the development of con- foraminiferal tests and difficulties in their identification, the evo- strictions in the spiral tubular chamber and hence the appear- lution of early foraminifers is poorly understood. By using molec- ance of multilocular forms. ular data from a wide range of extant naked and testate unilocular Because of their poor preservation and the difficulties in- species, we demonstrate that a large radiation of nonfossilized volved in their identification, the unilocular noncalcareous for- unilocular Foraminifera preceded the diversification of multilocular aminifers are largely ignored in paleontological studies. In a lineages during the Carboniferous. Within this radiation, similar previous study, we used molecular data to reveal the presence of test morphologies and wall types developed several times inde- naked foraminifers, perhaps resembling those that lived before pendently.
    [Show full text]
  • Systema Naturae. the Classification of Living Organisms
    Systema Naturae. The classification of living organisms. c Alexey B. Shipunov v. 5.601 (June 26, 2007) Preface Most of researches agree that kingdom-level classification of living things needs the special rules and principles. Two approaches are possible: (a) tree- based, Hennigian approach will look for main dichotomies inside so-called “Tree of Life”; and (b) space-based, Linnaean approach will look for the key differences inside “Natural System” multidimensional “cloud”. Despite of clear advantages of tree-like approach (easy to develop rules and algorithms; trees are self-explaining), in many cases the space-based approach is still prefer- able, because it let us to summarize any kinds of taxonomically related da- ta and to compare different classifications quite easily. This approach also lead us to four-kingdom classification, but with different groups: Monera, Protista, Vegetabilia and Animalia, which represent different steps of in- creased complexity of living things, from simple prokaryotic cell to compound Nature Precedings : doi:10.1038/npre.2007.241.2 Posted 16 Aug 2007 eukaryotic cell and further to tissue/organ cell systems. The classification Only recent taxa. Viruses are not included. Abbreviations: incertae sedis (i.s.); pro parte (p.p.); sensu lato (s.l.); sedis mutabilis (sed.m.); sedis possi- bilis (sed.poss.); sensu stricto (s.str.); status mutabilis (stat.m.); quotes for “environmental” groups; asterisk for paraphyletic* taxa. 1 Regnum Monera Superphylum Archebacteria Phylum 1. Archebacteria Classis 1(1). Euryarcheota 1 2(2). Nanoarchaeota 3(3). Crenarchaeota 2 Superphylum Bacteria 3 Phylum 2. Firmicutes 4 Classis 1(4). Thermotogae sed.m. 2(5).
    [Show full text]
  • High-Throughput Sequencing of Astrammina Rara: Sampling The
    Habura et al. BMC Genomics 2011, 12:169 http://www.biomedcentral.com/1471-2164/12/169 RESEARCHARTICLE Open Access High-throughput sequencing of Astrammina rara: Sampling the giant genome of a giant foraminiferan protist Andrea Habura1,4*, Yubo Hou2, Andrew A Reilly3 and Samuel S Bowser2 Abstract Background: Foraminiferan protists, which are significant players in most marine ecosystems, are also genetic innovators, harboring unique modifications to proteins that make up the basic eukaryotic cell machinery. Despite their ecological and evolutionary importance, foraminiferan genomes are poorly understood due to the extreme sequence divergence of many genes and the difficulty of obtaining pure samples: exogenous DNA from ingested food or ecto/endo symbionts often vastly exceed the amount of “native” DNA, and foraminiferans cannot be cultured axenically. Few foraminiferal genes have been sequenced from genomic material, although partial sequences of coding regions have been determined by EST studies and mass spectroscopy. The lack of genomic data has impeded evolutionary and cell-biology studies and has also hindered our ability to test ecological hypotheses using genetic tools. Results: 454 sequence analysis was performed on a library derived from whole genome amplification of microdissected nuclei of the Antarctic foraminiferan Astrammina rara. Xenogenomic sequence, which was shown not to be of eukaryotic origin, represented only 12% of the sample. The first foraminiferal examples of important classes of genes, such as tRNA genes, are reported, and we present evidence that sequences of mitochondrial origin have been translocated to the nucleus. The recovery of a 3’ UTR and downstream sequence from an actin gene suggests that foraminiferal mRNA processing may have some unusual features.
    [Show full text]