Supplemental Table and Figure Legends

Suppl. Table 1: Results from a genome-wide microarray showing repression of genes normally induced during differentiation, and upregulation of genes associated with cell cycle regulation and cell proliferation upon knock-down of H19 in C2C12 myoblast cells. si-H19 or si-control were transfected into C2C12 cells twice, once in GM and then on DM1 and cells were harvested on DM3. Total RNA was isolated, converted to cDNA probe and hybridized to a Mouse Gene 1.0 ST Array (Affymetrix). The signals for specific probes and fold change (si-

H19/si-Control) are determined. The highlighted genes are known to be induced by muscle differentiation (among those that have a negative fold-change) or are involved in cell- proliferation and cell-cycle (among those that have a positive fold-change).

Suppl. Table 2: Effect of overexpression and inhibition of miR-675-3p and miR-675-5p on myoblast differentiation. C2C12 myoblast cells were transfected as in Fig 3. Cells were stained for myogenin at 32 hour or MHC at 60 hour. Fractions of myogenin- or MHC-positive cells were measured from 10 random fields and data are presented relative to the GL2 control as100%.

Suppl. Table 3: List of predicted target sites for miR-675-3p and/or miR-675-5p in the

3’UTRs of Smad1, Smad5 and Cdc6 from various species. MicroRNA target prediction algorithm (RNAHybrid) finds target sites for these two microRNAs in the 3’UTR of these target genes in various species including human, primate, mouse, and Drosophila. Number and location of predicted target sites are shown. 5’ most nucleotide of target site is listed.

Suppl. Table 4: Let-7 microRNAs are not profoundly up-regulated during C2C12

differentiation. Fold change of each mouse let-7 in C2C12 cells in growth medium (GM)

relative to four days in differentiation medium (DM4) as detected by hybridization to LNA

1 microarray for microRNAs (Exiqon). Hybridization done independently on two biological replicates. Fold change expressed as log to base 2.

Suppl. Table 5: List of qRT-PCR primers. Sequences and length of qRT-PCR primers used in this study are shown.

Suppl. Figure 1: Number of molecules of H19 and miR-675-3p and miR-675-5p level per cell in adult tissues and in differentiating myoblasts. H19 cDNA in a plasmid was used as qRT-PCR standard to determine the H19 molecules in adult skeletal muscles (A), in C2C12 cells in GM (B), and in mouse primary myoblast cells in GM (C). Similarly, synthetic microRNAs were used to make cDNAs for Taqman assay standards to determine the number of microRNA molecules in the same samples. Number of molecules in the rest of the samples was calculated from the expression levels relative to these three samples as determined by qRT-PCR in Fig. 1.

The number of molecules per 30 pg of total RNA is shown as number of molecules per cell, assuming that 30 pg is the average total RNA content of a cell.

Suppl. Figure 2: miR-675-3p and miR-675-5p is upregulated during C2C12 myoblast differentiation and in the adult skeletal muscle. Northern blots were carried out using probes specific to miR-675-3p (A) and miR-675-5p (B) in undifferentiated and differentiated myoblasts and in kidney and skeletal muscle samples. The ethidium bromide stained gel pictures showing equal loading of RNA in the lane-pairs.

Suppl. Figure 3: Number of molecules of H19 and miR-675-3p and miR-675-5p level per cell in C2C12 cells on day three of differentiation (DM3) after transfection with control or

H19 siRNA. The siRNA transfection protocol appears to decrease the upregulation H19 and microRNAs as evidenced by the comparison of siGL2, DM3 here with DM3 in untransfected

C2C12 cells in Suppl. Fig. 2B.

2

Suppl. Figure 4: Morphology of C2C12 cells after transfection of various siRNAs and/or microRNAs on differentiation day 3. Cells were transfected with indicated siRNAs and/or microRNAs in GM and changed to differentiation medium (DM) as in Fig. 2. The next day siRNAs and/or microRNAs were again transfected on DM1 and phase contrast images were taken on DM3.

Suppl. Figure 5: Knockdown of H19 decreases differentiation of mouse satellite cells.

Knockdown of H19 decreases H19 (A) and reduces expression of differentiation markers, myogenin and MHC mRNAs (B). The experiment was carried out as in Fig. 2.

Suppl. Figure 6: The H19 fragment containing pre-microRNA portion alone increases myogenic differentiation. Different portions of H19 were expressed in C2C12 cells by retroviral transduction, selected in GM containing puromycin for 2-3 days and the cells were harvested within 4 days after selection. The portion of H19 containing the pre-microRNA (Mid) specifically increased myogenin and MHC mRNA expression and this ability was lost when the

"Mid" was mutated in the seed sequences of both microRNAs. EV: empty vector; 5’-frag, Mid,

3'-frag and Mid-mut are described in the Methods. Mean +/- SEM of 6 replicates from two independent experiments. *P < 0.005.

Suppl. Figure 7: Luciferase reporter responsive to miR-675-3p or -5p is de-repressed by the 2’O-Me inhibitor of miR-675-3p/miR-675-5p. Co-transfection of 2’O-Me inhibitor of miR-

675-3p or miR-675-5p abolish the repression by miR-675-3p or -5p microRNA on Smad1 or

Cdc6 luciferase reporter activity. The experiment was carried out as in Fig. 5.

Suppl. Figure 8: miR-675-3p and miR-675-5p target sites on Smad1, 4, 5 and Cdc6 3’UTR.

The RNAHybrid algorithm predicted miR-675-3p or -5p (green) matching target sites (red) on

3

Smad1 3’UTR; Smad5 3’UTR and Cdc6 3’UTR. The stability of microRNA binding with its target is expressed as mfe (minimum free energy). The point mutations created are indicated as “*”.

Suppl. Figure 9: qRT-PCR shows that let-7b is not significantly upregulated during C2C12 myoblast, and mouse and human satellite cells. let-7b is not significantly upregulated in (A)

DM4 of C2C12, (B) DM3 of mouse satellite cells, and (C) DM3 of human satellite cells whereas

(B, C) miR-206 is profoundly upregulated in the same samples. Mean +/- SEM of three replicates.

4

Dey_Suppl. Table1 probe set siControl siH19-2 fold change Gene Title 10553256 3322.19 1888.65 -1.76 Myod1: myogenic differentiation 1 10381603 1240.71 606.45 -2.05 Fzd2: frizzled homolog 2 (Drosophila) 10505071 248.9 124.22 -2 Tmem38b: transmembrane protein 38B 10370180 839.5 407.15 -2.06 Col6a2: collagen, type VI, alpha 2 10377117 488.21 236.59 -2.06 Myh4: myosin, heavy polypeptide 4, skeletal muscle 10493633 2620.09 1259.65 -2.08 Tpm3: tropomyosin 3, gamma 10572368 443 213.22 -2.08 Gdf1: growth differentiation factor 1 10506929 227.59 107.28 -2.12 Calr4: calreticulin 4 10402808 739.03 347.31 -2.13 Jag2: jagged 2 10483871 8139.7 3765.12 -2.16 Ttn: titin 10385466 586.5 275.59 -2.13 Sgcd: sarcoglycan, delta (dystrophin-associated glycoprotein) 10399725 1078.1 496.91 -2.17 Sox11: SRY-box containing gene 11 10392364 5374.82 2461.62 -2.18 Cacng1: calcium channel, voltage-dependent, gamma subunit 1 10419934 385.08 175.58 -2.19 Myh7: myosin, heavy polypeptide 7, cardiac muscle, beta 10430140 1025.29 467.15 -2.19 Mb: myoglobin 10517488 384.25 173.84 -2.21 Ephb2: Eph receptor B2 10572815 637.95 287.47 -2.22 Tmem38a: transmembrane protein 38A 10569429 849.68 381.12 -2.23 Cdkn1c: cyclin-dependent kinase inhibitor 1C (P57) 10431393 1034.12 449.99 -2.3 Mapk12: mitogen-activated protein kinase 12 10456021 452.52 196.84 -2.3 Camk2a: calcium/calmodulin-dependent protein kinase II alpha 10545130 2231.98 969.23 -2.3 Gadd45a: growth arrest and DNA-damage-inducible 45 alpha 10494672 3623.98 1563.98 -2.32 Tbx15: T-box 15 10495270 409.36 176.73 -2.32 Amigo1: adhesion molecule with Ig like domain 1 10402211 407.94 174.97 -2.33 Fbln5: fibulin 5 10426467 355.16 152.55 -2.33 Tmem117: transmembrane protein 117 10586118 443.53 187.96 -2.36 Calml4: calmodulin-like 4 10532574 246.36 101.78 -2.42 Myo18b: myosin XVIIIb 10491721 1256.7 516.58 -2.43 Spry1: sprouty homolog 1 (Drosophila) 10557738 468.03 190.67 -2.45 Ctf1: cardiotrophin 1 10347697 1152.23 468.47 -2.46 Slc4a3: solute carrier family 4 (anion exchanger), member 3 10416777 2573.85 1045.94 -2.46 Klf5: Kruppel-like factor 5 10464836 6168.57 2510.33 -2.46 Actn3: actinin alpha 3 10348234 240.81 97.19 -2.48 Neu2: neuraminidase 2 10515960 737.95 297.09 -2.48 Kcnq4: potassium voltage-gated channel, subfamily Q, member 4 10402708 4532.87 1782.37 -2.54 Ckb: creatine kinase, brain 10543411 265.58 104.72 -2.54 Slc13a1: solute carrier family 13 (sodium/sulfate symporters), member 1 10570518 4327.42 1609.55 -2.69 Myom2: myomesin 2 10440522 1859.81 688.89 -2.7 Adamts1: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1 Dey_Suppl. Table1 (contd) 10582429 695.01 257.85 -2.7 Cbfa2t3: core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) 10413726 9988.83 3617.96 -2.76 Tnnc1: troponin C, cardiac/slow skeletal 10455863 632.06 228.76 -2.76 Ctxn3: cortexin 3 10539517 1722.96 623.79 -2.76 Dysf: dysferlin 10381798 9655.6 3461.66 -2.79 Myl4: myosin, light polypeptide 4 10350149 4910.93 1731.9 -2.84 Tnni1: troponin I, skeletal, slow 1 10484195 1989.44 691.15 -2.88 Ttn: titin 10557575 5361.72 1831.78 -2.93 Mylpf: myosin light chain, phosphorylatable, fast skeletal muscle 10559221 7482.94 2536.21 -2.95 Tnnt3: troponin T3, skeletal, fast 10559547 2736.73 901.87 -3.03 Tnnt1: troponin T1, skeletal, slow 10587262 1235.23 405.55 -3.05 Klhl31: kelch-like 31 (Drosophila) 10493555 437.02 139.29 -3.14 Kcnn3: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 10540533 405.68 124.52 -3.26 Cav3: caveolin 3 10349993 4237.95 1260.29 -3.36 Myog: myogenin 10589462 2245.64 667.64 -3.36 Mtap4: microtubule-associated protein 4 10451665 3382 1003.52 -3.37 Apobec2: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 2 10412260 1404.28 391.18 -3.59 Fst: follistatin 10567879 6875.36 1780 -3.86 Atp2a1: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 10377018 7989.23 2063.52 -3.87 Myh3: myosin, heavy polypeptide 3, skeletal muscle, embryonic 10433403 462.91 118.85 -3.89 A2bp1: ataxin 2 binding protein 1 10494804 5393.44 1367.08 -3.95 Casq2: calsequestrin 2 10406434 1487.78 366.7 -4.06 Mef2c: myocyte enhancer factor 2C 10569344 1936.1 476.04 -4.07 Igf2: insulin-like growth factor 2 10550698 5520.72 1304.82 -4.23 Ckm: creatine kinase, muscle 10504692 3297.1 745.03 -4.43 Tmod1: tropomodulin 1 10559200 3444.12 739.36 -4.66 Tnni2: troponin I, skeletal, fast 2 10446619 1430.14 295.16 -4.85 Myom1: myomesin 1 10509073 1692.01 348.28 -4.86 Myom3: myomesin family, member 3 10377148 1225.05 249.2 -4.92 Myh8: myosin, heavy polypeptide 8, skeletal muscle, perinatal 10489545 6734.8 1356.53 -4.96 Tnnc2: troponin C2, fast 10377087 2305.8 385 -5.99 Myh1: myosin, heavy polypeptide 1, skeletal muscle, adult 10501895 2944.55 420.62 -7 Myoz2: myozenin 2 10377087 2305.8 385 -5.99 Myh1: myosin, heavy polypeptide 1, skeletal muscle, adult 10501895 2944.55 420.62 -7 Myoz2: myozenin 2

10498309 116.7 585.46 5.02 Pfn2: profilin 2 10492798 269.69 1265.42 4.69 Sfrp2: secreted frizzled-related protein 2 10380289 575.24 2235.76 3.89 Mmd: monocyte to macrophage differentiation-associated 10562563 618.84 1776.34 2.87 Ccne1: cyclin E1 Dey_Suppl. Table1 (contd) 10353010 292.5 818.27 2.8 Mybl1: myeloblastosis oncogene-like 1 10503264 377.55 1043.36 2.76 Ccne2: cyclin E2 10529977 100.91 277.86 2.75 Ppargc1a: peroxisome proliferative activated receptor, gamma, coactivator 1 alpha 10604528 518.45 1384.9 2.67 Mbnl3: muscleblind-like 3 (Drosophila) 10605571 133.4 356.39 2.67 Gyk: glycerol kinase 10576911 553.73 1442.51 2.61 Efnb2: ephrin B2 10569646 1762.27 4561.78 2.59 Ccnd1: cyclin D1 10536505 928.5 2261.78 2.44 Met: met proto-oncogene 10603099 305.38 745.61 2.44 Figf: c-fos induced growth factor 10391461 209.64 506.44 2.42 Brca1: breast cancer 1 10506822 99.61 240.58 2.42 Orc1l: origin recognition complex, subunit 1-like (S.cereviaiae) 10578493 95.87 229.14 2.39 Tlr3: toll-like receptor 3 10474902 247.54 587.96 2.38 Rad51: RAD51 homolog (S. cerevisiae) 10556266 786 1871.22 2.38 Wee1: WEE 1 homolog (S. pombe) 10500183 287 678.58 2.36 Adamtsl4: ADAMTS-like 4 10536494 407.43 943.44 2.32 Cav2: caveolin 2 10607619 131.37 300.12 2.28 Cdkl5: cyclin-dependent kinase-like 5 10382300 111.72 249.7 2.24 Map2k6: mitogen-activated protein kinase kinase 6 10601011 349.19 780.36 2.23 Kif4: kinesin family member 4 10571680 160.82 351.47 2.19 Mlf1ip: myeloid leukemia factor 1 interacting protein 10460585 472.37 1020.88 2.16 Fosl1: fos-like antigen 1 10477970 442.47 946.27 2.14 Src: Rous sarcoma oncogene 10352048 143.01 296.6 2.07 Exo1: exonuclease 1 10458195 205.39 407.15 1.98 Cdc25c: cell division cycle 25 homolog C (S. pombe) 10589420 397.41 661.58 1.66 Cdc25a: cell division cycle 25 homolog A (S. pombe) 10494595 2145.96 4119.35 1.92 Notch2: Notch gene homolog 2 (Drosophila) 10462363 300.03 560.48 1.87 Jak2: Janus kinase 2 10437945 663.6 1231.12 1.86 Mcm4: minichromosome maintenance deficient 4 homolog (S. cerevisiae) 10357043 427.9 793.26 1.85 Bcl2: B-cell leukemia/lymphoma 2 10357436 659.32 1182.23 1.79 Mcm6: minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) 10369815 1940.64 3251.64 1.68 Cdc2a: cell division cycle 2 homolog A (S. pombe) 10534974 728.61 1168.96 1.6 Mcm7: minichromosome maintenance deficient 7 (S. cerevisiae) 10381072 207.59 326.3 1.57 Cdc6: cell division cycle 6 homolog (S. cerevisiae) 10523802 136.98 215.66 1.57 Cdc7: cell division cycle 7 (S. cerevisiae) 10573867 811.71 1272.45 1.57 Rbl2: retinoblastoma-like 2 10592201 337.74 529.18 1.57 Chek1: checkpoint kinase 1 homolog (S. pombe) 10511333 193.54 294.91 1.52 Plag1: pleiomorphic adenoma gene 1 10548116 938.87 1428.33 1.52 Ccnd2: cyclin D2 Dey _Suppl Table 2

Transfectant Myog-positive Cells MHC-positive Cells

Total % Control Total % Control counts counts (10 fields) Mean SEM (10 fields) Mean SEM

GL2 462 100 5.98 208 100 4.90 miR-675 865 188.04 6.13 410 197.11 11.57

Anti-GL2 365 100 4.51 190 100 5.97

Anti-675 243 0.67 3.83 129 0.67 4.67 Dey _Suppl Table 3

microRNAs Target 3’UTRs Species Predicted target sites Number Positions miR-675-3p Smad1 Human 4 1844, 2062, 2316, 2360 Primate 2 1454, 1674 Mouse 4 2328, 2361, 2722, 2932 Drosophila 3 1967, 2045, 3045 miR-675-3p Smad5 Human 4 2101,2451,2930, 3755 Primate 4 2010, 2415, 2357, 2769 Mouse 4 2612, 2704, 3516, 3832 miR-675-5p Cdc6 Human 3 2134, 2254, 2376 Primate 3 2130, 2299, 2273 Mouse 3 1883, 2886, 3719 Drosophila 2 2138, 2351 Dey _Suppl Table 4

LogMedianRatios GM-A / DM-A GM-B / DM-B Probe Id Annotation Slide 1 Slide 2 17748 mmu-let-7a -0.44 -0.52 17888 mmu-let-7a* 0.47 0.30 29502 mmu-let-7b -0.41 -0.36 42769 mmu-let-7b* 0.12 0.28 19004 mmu-let-7c -0.22 -0.23 42668 mmu-let-7c-1* -0.43 -0.63 17750 mmu-let-7d -0.35 -0.48 10914 mmu-let-7d -0.30 -0.45 42505 mmu-let-7d* -0.09 -0.24 42459 mmu-let-7e 0.36 0.39 17752 mmu-let-7f -0.35 -0.55 33401 mmu-let-7f -0.18 -0.31 42768 mmu-let-7f* NA 0.44 19602 mmu-let-7g -0.32 -0.50 42463 mmu-let-7g -0.05 -0.06 42778 mmu-let-7g* NA NA 9938 mmu-let-7i 0.30 0.08 19580 mmu-let-7i 0.22 0.19 42534 mmu-let-7i* NA NA Dey _Suppl Table 5

Primer Name Length Sequence U6sn 20 CTGCGCAAGGATGACACGCA let7b 22 TGAGGTAGTAGGTTGTGTGGTT miR-206 22 TGGAATGTAAGGAAGTGTGTGG miR-675-3p 22 CTGTATGCCCTAACCGCTCAGT miR-675-5p 22 TGGTGCGGAAAGGGCCCACAGT Myogenin Forward 24 AGCGCAGGCTCAAGAAAGTGAATG Myogenin Reverse 24 CTGTAGGCGCTCAATGTACTGGAT MHC Forward 22 TCCAAACCGTCTCTGCACTGTT MHC Reverse 22 AGCGTACAAAGTGTGGGTGTGT moH19 Forward 24 TGACTTCATCATCTCCCTCCTGTC moH19 Reverse 24 GGGTAAATGGGGAAACAGAGTCAC huH19 Forward 23 AAAGAAATGGTGCTACCCAGCTC huH19 Reverse 23 GGTTCCTCTAGCTTCACCTTCCA GAPDH Forward 24 ATGACATCAAGAAGGTGGTGAAGC GAPDH Reverse 24 GAAGAGTGGGAGTTGCTGTTGAAG Dey _Suppl Figure 1

A

900 H19 miR-675-3p miR-675-5p 800 700 600 500 400 300 200 100 Number of molecules per cell cell per of molecules Number 0

B C 2500 4500 H19 H19 miR-675-3p

4000 miR-675-3p miR-675-5p miR-675-5p 2000 3500

3000 1500 2500 2000 1000 1500 500 1000

500 cell per of molecules Number Number of molecules per cell per of molecules Number 0 0 GM DM3 GM DM3 Dey _Suppl Figure 2

A B 675-3p 675-5p

stained gel stained stained gel stained

EtBr EtBr Dey _Suppl Figure 3

2000

siControl 1800 siH19 1600 1400 1200 1000 800 600 400 200 Number of molecules per cell per of molecules Number 0 H19 miR-675-3p miR-675-5p Dey _Suppl Figure 4

si Control si H19 si H19 + 3p5p Dey _Suppl Figure 5

A B

1.4 1.2 siControl siH19

1.2 1

1 0.8 0.8 0.6 & MHC mRNA level & mRNA MHC 0.6 0.4 Myog Relative H19 level H19 Relative 0.4

0.2 0.2 Relative 0 0 siControl siH19 Myog MHC Dey _Suppl Figure 6

A 3.5 Myog MHC * 3

2.5 level

2 * mRNA mRNA 1.5

1 Relative 0.5

0 EV 5'-frag Mid Mid-mut 3'-frag

B 4

3.5 3 2.5 2 1.5 1 expression level expression 0.5 Relative H19 fragment fragment H19 Relative 0 EV 5'-frag Mid Mid-mut 3'-frag Dey _Suppl Figure 7

A B 1.2 PRL PRL-Smad1 1.2 PRL PRL-cdc6

1 1 activity activity 0.8 0.8

0.6 0.6 liciferase luciferase 0.4 0.4

0.2 Relative 0.2 Relative

0 0 3p 3p + Anti-3p 5p 5p + Anti-5p Dey _Suppl Figure 8

B A Smad1 3’UTR Site: 566-590 Smad1 3’UTR Site: 533-565

C Smad1 3’UTR Site: 927-950

D

Smad1 3’UTR Site: 1137-1159

E F Smad5 3’UTR Site: 401-424 Cdc6 3’UTR Site: 91-116 Dey _Suppl Figure 9

A B C 80 69.87 160 1.8 GM DM3 118.6 let-7b 1.42 GM DM3

1.6 70 140 level level 1.4 level 120

60 1 1.2 50 100 1 40 80 0.8 microRNA microRNA microRNA 30 60 0.6 20 40 0.4 Relative Relative 0.2 Relative 10 20 1.61 1.33 0 0 0 GM DM4 let-7b miR-206 let-7b miR-206