Heterologous Expression and Characterization of the Antibacterial Lasso Peptide LP2006

Heterologous expression and characterization of the antibacterial lasso peptide LP2006

Gaelen Moore

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Biochemistry University of Toronto

Heterologous expression and characterization of the antibacterial lasso peptide LP2006

Gaelen Moore

Master of Science

Department of Biochemistry University of Toronto

2019 Abstract

The lasso peptides are a class of ribosomally synthesized peptide natural products with diverse bioactivities and structures resembling a lasso. Although the targets of several antibacterial lasso peptides have been investigated to date, the majority remain uncharacterized. Among those that have been characterized, the antibacterial lasso peptides have diverse targets and unique mechanisms of action. One antibacterial lasso peptide with a unique structure, LP2006, is the only member of the class IV peptides. Currently the target and mechanism of action of LP2006 remains unknown. The aim of this study is to develop a system for the heterologous expression of LP2006 to allow for the study of its target and mode of action. I demonstrate that LP2006 can be heterologously expressed using Streptomyces coelicolor M1146, and that purified LP2006 does not appear to activate the cell wall stress response gene liaI .

Acknowledgments

The past two years of my Master’s research project would not have been possible without the support of many people.

Firstly, I would like to thank Dr. Justin Nodwell for providing me with the opportunity to work in his laboratory. Despite his busy schedule, he always manages to make plenty of time to meet with his students and never fails to inspire his students. I would also like to thank my committee members, Dr. Karen Maxwell and Dr. Alex Ensminger for their input and thoroughness over the course of my project.

I am deeply grateful to Dr. Sheila Pimental-Elardo for her guidance and support in conducting this project. I have thoroughly enjoyed our discussions about marine natural products in addition to our non-scientific discussions. Sheila's kindness and empathy have had a very positive influence on the lab. I am very thankful to have had the opportunity to meet and work with all of the Nodwell Lab members. I am appreciative of not only their scientific suggestions, but also their friendship, which has made my time in the lab highly enjoyable.

I would also like to thank my undergraduate thesis project mentor, Sohee Yun, for her guidance and enthusiasm. She inspired me to pursue research and she was always a positive presence during my time as her trainee. Finally, I would like to thank my parents for their steadfast support over the years.

iii

Table of Contents

Acknowledgments...... iii

Table of Contents ...... iv

List of Tables ...... vii

List of Figures ...... viii

Chapter 1 Introduction ...... 1

Introduction ...... 1

1.1 RiPPs ...... 1

1.1.1 Thiopeptides ...... 4

1.1.1.1 Biosynthesis of Thiopeptides ...... 4

1.1.1.2 Antibiotic Targets of Thiopeptides ...... 5

1.1.2 Lanthipeptides ...... 6

1.1.2.1 Biosynthesis of lanthipeptides ...... 9

1.1.2.2 Activity of lanthipeptides ...... 11

1.1.3 Lasso peptides ...... 12

1.1.3.1 Classification of lasso peptides ...... 13

1.1.3.2 Biosynthesis of lasso peptides ...... 17

1.1.3.3 Activity of lasso peptides ...... 20

1.1.3.4 Discovery and Heterologous expression of lasso peptides ...... 24

1.2 Aim of this work ...... 26

Chapter 2 Materials and Methods ...... 27

Materials and Methods ...... 27

2.1 General experimental procedures ...... 27

2.1.1 Materials ...... 27

2.1.2 Strains and plasmids used ...... 27

2.1.3 Primers Used ...... 28 iv

2.1.4 Culture conditions ...... 29

2.1.5 Heterologous expression of LP2006 ...... 29

2.2 Isolation and purification of bioactive metabolites ...... 30

2.2.1 Metabolite extraction ...... 30

2.2.2 Flash chromatography purification ...... 30

2.2.3 High-performance liquid chromatography purification ...... 31

2.2.4 Liquid chromatography mass spectrometry analysis ...... 31

2.3 Susceptibility testing ...... 32

2.3.1 Disk diffusion assays ...... 32

2.3.2 Broth microtiter dilution assay...... 32

2.4 Target identification ...... 32

2.4.1 LacZ reporter assay ...... 32

Results and discussion ...... 33

3.1 Nocardiopsis sp. HB141 extract testing...... 33

3.1.1 Extracts of Nocardiopsis sp. HB141 have antibacterial activity ...... 33

3.1.2 Nocardiopsis sp. HB141 is a producer of an antibacterial lasso peptide, LP2006 ...... 34

3.1.3 Purification of LP2006 ...... 35

3.2 Heterologous expression of LP2006 ...... 38

3.2.1 Heterologous expression in Escherichia coli ...... 38

3.2.2 Heterologous expression in Streptomyces coelicolor M1146 ...... 43

3.3 Bioactivity of LP2006 ...... 46

Conclusions and future directions ...... 48

References ...... 50

Appendix 1 Screen for novel bioactive natural products from marine bacteria ...... 62

Appendix 1 ...... 62

5.1 Introduction ...... 62

5.2 Methods...... 62

5.2.1 Bioactivity screen...... 62

5.2.1.1 Collection and Isolation of maritime strains ...... 62

5.2.1.2 Culture conditions ...... 63

5.2.1.3 Broth microtiter dilution and disk diffusion assay ...... 63

5.2.2 Isolation of the Marinobacter sp. N33 bioactive metabolite(s) ...... 64

5.2.2.1 Metabolite extraction ...... 64

5.2.2.2 Flash chromatography and HPLC purification ...... 64

5.2.3 Genomic studies ...... 65

5.2.3.1 Genomic DNA extraction ...... 65

5.2.3.2 Phylogenetic analysis ...... 65

5.2.3.3 Whole genome sequencing of Marinobacter sp. N33 ...... 66

5.3 Results and discussion ...... 66

5.3.1 Screen of marine bacteria ...... 66

5.3.1.1 Phylogenetic analysis ...... 66

5.3.1.2 Bioactivity screening ...... 70

5.3.2 Marinobacter sp. N33 extract testing ...... 72

5.3.2.1 Bioactivity testing ...... 72

5.3.2.2 Genome sequencing and genome mining ...... 73

5.3.2.3 Bioactivity guided fractionation and purification ...... 75

List of Tables

Table 1.1. Characterized lasso peptides and their tested bioactivity...... 14

Table 1.2. Heterologously produced lasso peptides...... 25

Table 2.1. Strains and plasmids used in this study...... 27

Table 2.2. Primers used in this study...... 28

Table 3.1. Ion comparison of HB141 mass and LP2006 ...... 35

Table 3.2. Sequence identity of LP2006 biosynthetic proteins of Nocardiopsis alba ATCC BAA- 2165 and Nocardiopsis sp. TP-A0876 compared to Nocardiopsis alba DSM 43377...... 39

Table 3.3. Comparison of LP2006 masses from the Nocardiopsis sp. HB141 and those produced by heterologous expression in S. coelicolor M1146...... 46

Table 5.1. Identity and characteristics of maritime strains ...... 67

Table 5.2. Comparison of Marinobacter sp. N33 genome statistics to close relatives...... 75

vii

List of Figures

Figure 1.1. Structures of selected commercially used RiPPs...... 2

Figure 1.2. Generalized RiPP Biosynthesis ...... 3

Figure 1.3. Biosynthesis of the thiomuracin core scaffold ...... 5

Figure 1.4. Post-translational modifications characteristic in lanthipeptides ...... 7

Figure 1.5. Distribution of lasso peptide, lanthipeptide and thiopeptide clusters in Streptomyces genomes ...... 8

Figure 1.6. Mechanisms of lanthipeptide synthesis ...... 10

Figure 1.7. Classes of lanthionine synthetases...... 11

Figure 1.8. Lasso peptide cyclization and structure ...... 13

Figure 1.9. Classes of lasso peptides ...... 14

Figure 1.10. Lasso peptide gene clusters and biosynthesis ...... 18

Figure 1.11. Proposed mechanism of microcin J25 biosynthesis ...... 19

Figure 1.12. Antibacterial targets of lasso peptides ...... 20

Figure 3.1. Disk diffusion assay of Nocardiopsis sp. HB141 extract ...... 33

Figure 3.2. Extracted ion chromatogram of LP2006 M+2H mass ...... 34

Figure 3.3. Mass spectrum of the Nocardiopsis sp. HB141 mass of 1002.9335 m/z ...... 35

Figure 3.4. Disk diffusion assay from flash chromatography fractionated Nocardiopsis sp. HB141 extract ...... 36

Figure 3.5. HPLC chromatogram of first-round purification of LP2006 ...... 37

Figure 3.6. HPLC chromatogram of second-round purification of LP2006 ...... 37

viii

Figure 3.7. LP2006 biosynthetic gene cluster from N. alba DSM 43377 ...... 39

Figure 3.8. Vectors used for E. coli heterologous expression ...... 40

Figure 3.9. Protein expression testing of LpeCEB ...... 42

Figure 3.10. Construct used for S. coelicolor heterologous expression ...... 44

Figure 3.11. Detection of heterologously expressed LP2006 by mass spectrometry ...... 45

Figure 3.12. Antibacterial MIC testing of pure LP2006 ...... 47

Figure 3.13. LP2006 does not activate the cell wall stress response gene liaI in B. subtilis 1A980 ...... 47

Figure 5.1. Phylogenetic tree of Nodwell Maritime Collection strains...... 69

Figure 5.2. Screen of Nodwell Maritime Collection strains ...... 70

Figure 5.3. Distribution of growth inhibition values...... 71

Figure 5.4. Phylogenetic tree and antibacterial activity of Nodwell Maritime Collection strains tested against B. subtilis ...... 72

Figure 5.5. Disk diffusion assay of Marinobacter sp. N33 crude extract using B. subtilis JH642...... 73

Figure 5.6. Circular representation of the Marinobacter sp. N33 genome ...... 74

Figure 5.7. UV chromatogram of the purification of fraction 19 from flash chromatography by HPLC ...... 76

Chapter 1 Introduction Introduction

The discovery of antibiotics has produced enormous benefits for both human and animal medicine. Today, many routine medical procedures would not be possible without effective antibiotics to prevent post-procedural infections. In the clinic, natural products and derivatives remain the primary source of novel antibiotics, even decades after the golden era of natural product-based antibiotic discovery of the 1940s to 1960s 1. With the advent of next-generation sequencing, it has become apparent that our knowledge of natural product chemistry and biology is incredibly incomplete. Further exploration of the natural product chemical space will undoubtedly lead to new therapeutics.

With the escalating threat of antibiotic resistance, it is important to continue to develop novel antibiotics to prevent the emergence of pathogens that are untreatable with our existing antibiotic arsenal. While antibiotics synthesized by nonribosomal peptide synthases and polyketide synthases are familiar in medicine, one overlooked class of natural products are the ribosomally synthesized and post-translationally modified peptides (RiPPs) which have a long history of documented antibiotic activity but have not been thoroughly explored for their therapeutic and industrial applications.

1.1 RiPPs

Peptide synthesis can occur either ribosomally or nonribosomally. Nonribosomal peptides are familiar to many – the class includes medically important compounds such as the beta-lactams, the glycopeptides, the depsipeptides, cyclosporine and daptomycin. The nonribosomal peptides have had an enormous impact on science and medicine. In contrast, ribosomally synthesized and post-translationally modified peptides (RiPPs) are less well-known but possess impressive structural diversity and potent bioactivity 2. The RiPPs, which are produced by all domains of life, are comparatively understudied in spite of their interesting bioactivity and therapeutic potential. Commercialized RiPPs include thiostrepton, an antibacterial used in veterinary

medicine, nisin, a food preservative, and omega-conotoxin MVIIA, which has been developed into the synthetic antinociceptive drug, Ziconotide (Figure 1.1)3–6.

Figure 1.1. Structures of selected commercially used RiPPs. A. Structure of thiostrepton. B. Structure of Ziconotide, the synthetic analogue of the omega-conotoxin MVIIA. C. Structure of nisin. The post-translationally modified residues are highlighted in red.

The RiPPs share a biosynthetic process, unifying the family which would otherwise be unrelated 2. Like other classes of microbial natural products, the genes required for RiPP biosynthesis are clustered within the genome. RiPPs are genetically encoded in the form of a 2

precursor peptide, which consists of an N-terminal leader sequence and a C-terminal core sequence (Figure 1.2). The core sequence undergoes a series of post-translational modifications, which are introduced by modification enzymes encoded in the biosynthetic gene cluster of the RiPP. RiPP biosynthetic gene clusters also encode a leader peptidase, which cleaves the N- terminal leader sequence from the C-terminal core, ultimately yielding the mature RiPP. RiPP clusters may sometimes encode genes for the export of the mature RiPPs or the regulation of the production of the RiPPs.

Figure 1.2. Generalized RiPP Biosynthesis. A. General biosynthetic cluster of a RiPP natural product. B. Generalized biosynthetic logic of RiPP biosynthesis. Adapted from Tan et al. , Antibiotics , 2019 7.

The RiPPs possess a unique ability to generate substantial chemical diversity at a low metabolic cost. The RiPP model has evolved to produce structural diversity as many of the enzymes that introduce post-translational modifications are permissive to mutations in the core sequence and primarily recognize the leader sequence. In fact, certain classes of RiPPs contain core regions that are naturally hypervariable 8. The broad chemical diversity of RiPPs, combined with their suitability for genome mining, heterologous expression and their potential for engineering proves advantageous in their therapeutic development. In the following sections I will discuss the

structural characteristics, biosynthesis and bioactivity of three RiPP classes which have a large body of literature and well-documented antibiotic activity.

1.1.1 Thiopeptides

Few classes of RiPPs have been studied as thoroughly as the thiopeptides. The thiopeptides are macrocyclic peptides characterized by sulfur-rich heterocycles and a central 6-membered nitrogen-containing oxidized ring. There are currently more than 100 known thiopeptides, which are classified into five categories based on the structure and oxidation state of the central nitrogen-containing ring 9. The first thiopeptide discovered was micrococcin in 1948, although the first thiopeptide gene clusters were only identified in 2009 10–12 . Most thiopeptides are potent antibacterial translation inhibitors and some have long been used in agricultural feed and veterinary treatments 13–16 .

1.1.1.1 Biosynthesis of Thiopeptides

For more than half a century after the discovery of the micrococcin in 1948 it was unclear whether the thiopeptides were synthesized ribosomally or nonribosomally. Finally, in 2009, several thiopeptide gene clusters were published, revealing that thiopeptides indeed belong to the RiPP family 10,11,17,18 .

After translation, thiopeptide biosynthesis typically involves three steps: installation of the sulfur-rich heterocycles, installation of the central nitrogen-containing ring, and leader peptide removal by the leader peptidase, producing the mature thiopeptide. The first step involves the dehydration of Cys and sometimes Ser/Thr residues to produce the sulfur and oxygen-containing heterocycles, thiazol(in)e or oxazol(in)e (Figure 1.3)19 . This step is catalyzed by a trimeric heterocycle synthetase, and is shared with the closely related class of RiPPs the linear azol(in)e- containing peptides, of which the DNA-gyrase inhibitor microcin B17 is a member 20,21 . Next, unmodified Ser/Thr residues are dehydrated by a LanB-like dehydratase to yield dehydroalanine (Dha) and dehydrobutyrine (Dhb) 22 . Finally, a [4 + 2] cycloaddition reaction occurs between two Dha residues and an amide backbone to produce a 6-membered nitrogen-containing ring, which constitutes part of the macrocycle 23 . Subsequent modifications such as hydroxylation, methylation, or the addition of a tryptophan-derived macrocycle have been reported for certain

thiopeptides 11,18,24,25 . Finally, after all post-translational modifications the leader peptide is cleaved from the core peptide, resulting in the mature thiopeptide.

Figure 1.3. Biosynthesis of the thiomuracin core scaffold. Thiazole heterocycles are depicted in purple; dehydroalanine residues are depicted in green; and the central nitrogen-containing heterocycle is depicted in orange. Figure adapted from Hudson et al ., 2015 26 .

1.1.1.2 Antibiotic Targets of Thiopeptides

The thiopeptides have long been known for their potent antibacterial activity, but their development into clinical therapeutics has been hampered by poor bioavailability and high rates of emergence of resistance 27 . Thiopeptides often have antibacterial activity with nanomolar potency against Gram-positive bacteria but lack activity against Gram-negatives due to their inability to bypass the outer membrane 12 . Thiopeptides are mostly protein synthesis inhibitors 5

and can inhibit translation through one of two mechanisms, dependent on the macrocycle size. Thiopeptides containing 26 or 32-atom macrocycles, such as thiostrepton and micrococcin, inhibit protein translation by binding directly to the ribosome, at the interface of the 23s rRNA and the N-terminal domain of ribosomal protein L11 28 . This results in stabilization of the N- terminal domain of ribosomal protein L11, restricting the interaction with elongation factor G and preventing the conformational shifts necessary for translocation to occur 29 . Resistance to this class of thiopeptides can occur through the three mechanisms: the deletion or mutation of the gene encoding the ribosomal protein L11, mutation of A1067 or A1095 of 23S rRNA (E. coli nomenclature) or methylation of the 23S rRNA 30–35 .

Thiopeptides that contain 29-atom macrocycles, such as GE2270A, inhibit translation by binding to elongation factor Tu (EF-Tu), where they prevent the binding of amino-acyl tRNAs to the protein. GE2270A partially occludes the binding of the aminoacyl-tRNA and GTP, but not GDP. Resistance to EF-Tu-targeting thiopeptides increases the affinity of elongation factor Tu for aminoacyl-tRNA in the presence of EF-Tu-targeting thiopeptides 36,37 .

Although the vast majority of thiopeptides are bacterial translation inhibitors, there are several for which different activities have been reported. Notably, the cyclothiazomycins are reported to inhibit RNA polymerase, while lactazole has no reported antibiotic activity 38,39 .

1.1.2 Lanthipeptides

The lanthipeptides are another relatively well-studied class of RiPPs which contain the characteristic thioether amino acids lanthionine and methyllanthionine. The (methyl)lanthionine bridges are introduced via Michael addition between free cysteines and the alkene-containing amino acids, dehydroalanine (Dha) and dehydrobutyrine (Dhb) (Figure 1.4). This class of RiPPs has been the subject of much research interest not only because of the interesting biology and bioactivity, but also because of the potential of industrial and medical applications. Much of the interest has been surrounding the prototypical lanthipeptide nisin, which was first discovered in 1928 and has been widely used as a food preservative for several decades 40,41 . Nisin is also currently being pursued as a treatment for bovine mastitis 42 . Encouragingly, in spite of its heavy use in food preservation, widespread resistance to nisin has yet to emerge. Beyond nisin, the

lanthipeptide NVB302 was found to have strong in vitro results in the treatment of Clostridioides difficile infections when compared to vancomycin 43 .

Figure 1.4. Post-translational modifications characteristic in lanthipeptides. The (methyl)lanthionine, dehydroalanine and dehydrobutyrine modifications are characteristic of all classes of lanthipeptides, while the labionin modification is found only in the class III lanthipeptides. Figure adapted from Knerr and van der Donk, 2012 44 .

Lanthipeptides, along with other classes of RiPPs, are produced across many bacterial lineages, particularly by Actinobacteria. In fact, the Streptomyces , which are known producers of many important secondary metabolites of polyketide and nonribosomal peptide origin, appear to be prolific producers of RiPPs as well ( Figure 1.5)7. In a random sampling of 50 complete Streptomyces genomes, the genomes were found to encode as many as 8 RiPPs, with lanthipeptide clusters occurring more frequently compared to lasso peptide and thiopeptide clusters. Some lanthipeptides are known to be important for Streptomyces development, which may partially explain the frequency at which lanthipeptide clusters are found in the genus 45 .

Figure 1.5. Distribution of lasso peptide, lanthipeptide and thiopeptide clusters in Streptomyces genomes. 50 randomly-selected Streptomyces genomes, were analyzed using AntiSMASH 5.0 to detect for RiPP biosynthetic gene clusters. Lasso peptide clusters are shown in red, lanthipeptide clusters in blue, and thiopeptide clusters in green. From each genome, the genes atpD , gyrA , recA , rpoB , trpB and the 16S rRNA gene were compiled for cladogram construction using FastTree 2.0 and visualized using the interactive Tree of Life. 46–48 Figure from Tan et al. , 2019 7.

Lanthipeptides were originally categorized into two types: type A, including nisin and subtilisin which are long, flexible molecules and type B, including duramycin and cinnamycin, which are globular molecules 49 . With the discovery of lanthipeptides that did not fit well into these categories, a new classification scheme was proposed based on the enzymes used to synthesize lanthipeptides 50,51 . To date, there are four distinct classes of lanthipeptide biosynthetic enzymes, which will be discussed in the following section.

1.1.2.1 Biosynthesis of lanthipeptides

The characteristic lanthionine or methyllanthionine cross-bridges are introduced in lanthipeptides in two steps. First, Ser and Thr residues are selectively dehydrated to dehydroalanine or dehydrobutyrine, respectively. Next, the unsaturated Dha and Dhb amino acids undergo nucleophilic attack by select cysteines through a Michael reaction to generate lanthionine and methyllanthionines and form cross-links in the peptide structure (Figure 1.6).

Figure 1.6. Mechanisms of lanthipeptide synthesis. A. Mechanism of dehydration in LanB- type enzymes that synthesize class I lanthipeptides. B. Mechanism of dehydration in the synthesis of class II-IV lanthipeptides. C. Mechanism of cyclization via Michael addition used in lanthipeptide synthesis. Figure adapted from Ortega and van der Donk, 2016 52 .

There are four classes of lanthipeptides, which are categorized according to the enzymes that catalyze (methyl)lanthionine installation (Figure 1.7)44 . Class I lanthipeptides have dedicated proteins for dehydration and cyclization, named LanB and LanC, respectively. Class II have fused N-terminal dehydratase and C-terminal cyclase enzyme functionalities, whereby the enzymes are termed LanM. The N-terminal dehydratase domain does not display sequence homology with other lanthionine synthetases, although the C-terminal cyclase domain is homologous to the LanC cyclase protein of class I lanthionine synthetases. Class III and IV enzymes both contain lyase and kinase domains and C-terminal cyclase domains that are homologous to LanC cyclases, although the class III cyclase domain is missing several 10

conserved metal binding residues. The class III enzymes are the only class able to introduce labionin structures, an additional carbon-carbon crosslink of the lanthionine amino acid 53 .

Figure 1.7. Classes of lanthionine synthetases. The conserved motifs are highlighted. Figure adapted from Knerr and van der Donk, 2012 44 .

Ser/Thr dehydration can occur through one of two mechanisms, which is dependent on the biosynthetic machinery performing the dehydration. Class I enzymes convert Ser/Thr to Dha/Dhb in a tRNA-dependent process 54 . The LanB enzymes transfer a glutamate from tRNA Glu to Ser/Thr, thereby activating it for dehydration (Figure 1.6). In contrast, the class II-IV enzymes transfer the ɣ-phosphate of ATP to activate Ser/Thr for dehydration 55 . After Cys-dependent Michael addition to Dha/Dhb to produce (methyl)lanthionine residues, additional post- translational modifications are sometimes introduced including decarboxylation, hydroxylation and additional cross links between two amino acids 56,57 .

1.1.2.2 Activity of lanthipeptides

To date, only class I and II lanthipeptides are known to have antimicrobial activity. Nisin, the prototypical lanthipeptide, has been shown to inhibit Gram-positive bacteria at single-digit nanomolar concentrations which comparable to the potency of many clinical antibiotics 58 . Many experiments have been performed to investigate the mechanism of antibacterial activity of nisin. Nisin has since been found to target the bacterial cell wall by binding to the diphosphate of lipid II and forming pores in the membrane, ultimately resulting in a loss of membrane potential 58–60 .

In addition to its pore-forming ability, nisin was later found to have a second activity, whereby it sequesters lipid II at the cell division site, blocking cell wall synthesis and cell division 61 .

Certain class II lanthipeptides such as mersacidin complex with lipid II, but do not form pores 62 . It is believed that lanthipeptides of this class bind to a region of lipid II that encompasses the N- acetylglucosamine and the diphosphate, in contrast to nisin which has been shown to bind to the diphosphate and not the N-acetylglucosamine. Importantly, lanthipeptides have also been reported to have activities other than antibiotic. The SapB, SapT and catenulipeptin peptides, discovered from S. coelicolor , S. tendae and Catenulispora acidiphila , respectively, are morphogens in Streptomyces , enabling the formation of aerial mycelium 45,63,64 .

Although in vivo antimicrobial lanthipeptide resistance remains very rare, many mechanisms of resistance to lanthipeptides have been reported in vitro 65 . In lanthipeptide-producing organisms, self-resistance typically occurs through the expression of an ABC transporter or an immunity protein, which localizes to the membrane 66 . In vitro , several groups have reported nisin resistance occurring through changes in the phospholipid composition or rigidity of the membrane 67,68 . Lysine esterification of membrane lipids through MprF (multiple peptide resistance factor), reduces the net negative charge of the membrane, providing resistance against many cationic antimicrobial peptides including nisin 69 . A plasmid-encoded nisin resistance protein from certain strains of Lactococcus lactis was found to specifically degrade nisin through proteolysis 70,71 . In addition to these mechanisms, a number of other genes have been associated with lanthipeptide resistance including cell wall modification systems and two-component systems 65 .

1.1.3 Lasso peptides

Lasso peptides are a unique class of RiPPs with a simple structure, yet interesting and diverse bioactivities. The structure of the lasso peptides consists of a macrocycle formed by a macrolactam linkage between the N-terminal amine of the peptide and a glutamate or aspartate residue in the 7 th to 9 th position. The C-terminal tail of the peptide is threaded through the N- terminal ring, producing a structure which resembles a lasso (Figure 1.8). The lasso peptide structure is often stabilized by disulfide bridges or bulky residues such as Trp, Tyr or Phe, which are positioned above and below the ring to prevent unthreading. As a result, the lasso peptides 12

are surprisingly stable both to heat and proteolytic degradation. In fact, some lasso peptides can withstand temperatures up to 95°C for 8 hours, while others can withstand an autoclave cycle, although this feature is not universal 72–74 .

Figure 1.8. Lasso peptide cyclization and structure. The teal circles denote amino acids that form the N-terminal macrolactam ring, and grey circles represent amino acids that form the C- terminal tail. The reaction is catalyzed by an ATP-dependent lasso cyclase. Figure from Tan et al. , 2019 7.

1.1.3.1 Classification of lasso peptides

The lasso peptides are classified into four structural classes based on the location of disulfide bridges in their structure (Figure 1.9).Class I peptides contain two disulfide bridges; class II contains no disulfide bridges; class III contains a single disulfide bridge joining the N-terminal ring and the C-terminal tail; while class IV peptides contain a single intra-tail disulfide. An estimate in 2017 stated that 96% of bioinformatically-predicted lasso peptides belong to class II 75 . To date, 69 lasso peptides have been characterized, 47 of which belong to a unique family (Table 1.1).

While, the vast majority of characterized lasso peptides belong to class II, there is currently only a single member of the class IV peptides, LP2006 75 . LP2006 was identified using the genome mining algorithm RODEO and was reported to have antimicrobial activity against several Gram- positive bacteria. These included Bacillus anthracis , vancomycin-resistant Enterococcus faecium

and Mycobacterium smegmatis which were inhibited at 6.25, 12.5 and 12.5 μM concentrations of LP2006, respectively. Although LP2006 has antibacterial activity, it is not known what the target of the antibiotic is, and whether its mechanism of action differs from those of other lasso peptides because of its unique structure.

Figure 1.9. Classes of lasso peptides. The teal circles represent amino acids that form the macrolactam ring, and grey circles represent amino acids that form the C-terminal tail. The four classes differ in their disulfide bonds, which are depicted in yellow. Figure from Tan et al. , 2019 7.

Table 1.1. Characterized lasso peptides and their tested bioactivity. Antibacterial Peptide Name Producing Organism Sequence Activity? Class I Humidimycin MDN Streptomyces humidus CLGIGS CDDFAG CGYAIV CFW Not Tested 0010 F-100.629 Specialicin Streptomyces sp. CLGVGS CVDFAG CGYAVV CFW Yes Siamycin-1 Streptomyces sp. CLGVGS CNDFAG CGYAIV CFW Yes Siamycin-2 Streptomyces sp. CLGIGS CNDFAG CGYAIV CFW Not Tested Siamycin-3 Streptomyces sp. CLGIGS CNDFAG CGYAVV CFW Yes SSV 2083/Sviceucin Streptomyces sviceus CVWGGD CTDFLG CGTAWI CV Yes Class II Albusnodin Streptomyces albus GQGGGQS EDKRRAYNC Not Tested

Streptomyces Achromosin GIGSQTW DTIWLWD Yes achromogenes Acinetobacter Acinetodin GGKGPIF ETWVTEGNYYG Yes gyllenbergii Actinokineospora Actinokineosin GYPFWDNR DIFGGYTFIG Yes spheciospongiae Asticcacaulis Astexin-1 (23 residue) GLSQGVEP DIGQTYFEESRINQD Not Tested excentricus Asticcacaulis Astexin-1 (19 residue) GLSQGVEP DIGQTYFEESR No excentricus Asticcacaulis Astexin-2 GLTQIQAL DSVSGQFRDQLGL Not Tested excentricus Asticcacaulis Astexin-3 GPTPMVGL DSVSGQYWDQHAPL Not Tested excentricus Streptomyces Anantin A GFIGWGN DIFGHYSGDF Not Tested coerulescens Streptomyces sp. NRRL Anantin B1 GFIGWGN DIFGHYSGGF No S-146 Streptomyces sp. NRRL Anantin B2 GFIGWGN DIFGHYSGD Yes S-146 Asticcacaulis Benenodin-1 GVGFGRP DSILTQEQAKPMGLDRD Not Tested benevestitus Brevundimonas Brevunsin DGMGEEFI EGLVRDSLYPPAG No diminuta Burkholderia Burhizin GGAGQYK EVEAGRWSDR Not Tested rhizoxinica Burkholderia Capistruin GTPGFQTP DARVISRFGFN Yes thailandensis Caulonodulin-1 Caulobacter sp. GDVLNAP EPGIGREPTG Not Tested Caulonodulin-2 Caulobacter sp. GDVLFAP EPGVGRPPMG Not Tested Caulonodulin-3 Caulobacter sp. GQIYDHP EVGIGAYGCE Not Tested Caulonodulin-4 Caulobacter sp. SFDVGTIK EGLVSQYYFA Not Tested Caulonodulin-5 Caulobacter sp. SIGDSGLR ESMSSQTYWP Not Tested Caulonodulin-6 Caulobacter sp. AGTGVLLP ETNQIKRYDPA Not Tested Caulonodulin-7 Caulobacter sp. SGIGDVFP EPNMVRRWD Not Tested Caulosegnin-1 Caulobacter segnis GAFVGQP EAVNPLGREIQG No Caulosegnin-2 Caulobacter segnis GTLTPGLP EDFLPGHYMPG No Caulosegnin-3 Caulobacter segnis GALVGLLL EDITVARYDPM No Streptomyces Chaxapeptin GFGSKPL DSFGLNFF Yes leeuwenhoekii C58 Citrocin Citrobacter pasteurii GGVGKII EYFIGGGVGRYG Yes Citrulassin Streptomyces albulus LLGLAGN DRLVLSKN No

Fusilassin/Fuscanodin Thermobifida fusca WYTAEWGL ELIFVFPRFI No Klebsidin Klebsiella pneumoniae GSDGPII EFFNPNGVMHYG Yes Rhodococcus sp. K01- Lariatin A GSQLVYR EWVGHSNVIKP Yes BI0171 Rhodococcus sp. K01- Lariatin B GSQLVYR EWVGHSNVIKPGP Yes BI0171 Lagmysin Streptomyces sp. LAGQGSP DLLGGHSLL No Lassomycin Lentzea kentuckyensis GFIGWGN DIFGHYSGDF Yes Microcin J25 Escherichia coli AY25 GGAGHVP EYFVGIGTPISFYG Yes Cattlecin/Moomysin Streptomyces cattleya SYHWGDYH DWHHGWYGWWDD No Paenibacillus Paeninodin AGPGTSTP DAFQPDPDEDVHYDS No dendritiformis C454 Microbispora sp. SNA- Propeptin-1 GYPWWDYR DLFGGHTFISP Yes 115 Microbispora sp. SNA- Propeptin-2 GYPWWDYR DLFGGHTFI Yes 115 Bacillus Pseudomycoidin pseudomycoides DSM QVFEDED EQGALHHN Not Tested 12442 Streptomyces sp. RE- RES 701 1 GNWHGTAP DWFFNYYW Not Tested 701 Rhodanobacter Rhodanodin GVLPIGN EFMGHAATPG Not Tested thiooxydans LCS2 Rubrivinodin Rubrivivax gelatinosus GAPSLINS EDNPAFPQRV Not Tested Snou-LP S. noursei ATCC 11455 YFGLTGY ENLFHFYDKLH Not Tested Planomonospora Sphaericin GLPIGWWI ERPSGWYFPI Yes sphaerica Sphingonodin I Sphingobium japonicum GPGGITG DVGLGENNFG Not Tested Sphingonodin II Sphingobium japonicum GMGSGST DQNGQPKNLIGG Not Tested Sphingopyxis alaskensis Sphingopyxin I GIEPLGPV DEDQGEHYLFAGG Not Tested RB2256 Sphingopyxis alaskensis Sphingopyxin II GEALIDQ DVGGGRQQFLTG Not Tested RB2256 Streptomyces SRO15 2005 GYFVGSYK EYWSRRII Not Tested roseosporus Streptomonomicin Streptomonospora alba SLGSSPYN DILGYPALIVIYP Yes Sphingomonas Subteresin GPPGDRI EFGVLAQLPG No subterranea Streptomyces sp. Sungsanpin GFGSKPI DSFGLSWL Not Tested SNJ013 Sphingobium Syanodin-I GISGGTV DAPAGQGLAG Not Tested yanoikuyae XLDN2-5 Xanthomonin I Xanthomonas gardneri GGPLAG EEIGGFNVPG No 16

Xanthomonin II Xanthomonas gardneri GGPLAG EEMGGITT No Xanthomonin III Xanthomonas gardneri GGAGAG EVNGMSP No Streptomyces sp. Ulleungdin GFIGWGK DIFGHYGG Not Tested KCB13F003 Phenylobacterium Zucinodin GGIGGDF EDLNKPFDV Not Tested zucineum HLK1 Streptomyces sp. 9810-LP GYFVGSYK EYWTRRIV Not Tested ADI94-01 Class III Streptomyces sp. DSM BI-32169 GLPWG CPS DIPGWNTPWA C Not Tested 14996 Streptomyces sp. 9401-LP1 AFGP CVEN DWFAGTAWI C Not Tested ADI94-01 Class IV LP2006 Nocardiopsis alba GRPNQGF ENDWS CVRV C Yes

1.1.3.2 Biosynthesis of lasso peptides

Biosynthesis of lasso peptides requires a minimum of two enzymes: a lasso peptidase and a lasso cyclase (Figure 1.1)76 . The lasso peptidase is a cysteine protease which cleaves the leader sequence from the core sequence in the lasso precursor peptide. Some lasso peptides may require ATP in a pre-folding step prior to leader peptide removal and core cyclization, although this does not appear to be a universal requirement 77,78 . Yan et al . have found that in vitro , the lasso peptidase of microcin J25 requires the cyclase for proteolysis, likely forming a complex with the cyclase 77 . Although, leader peptide proteolysis does not require the presence of the cyclase protein in the case of fusilassin/fuscanodin 78 .

Figure 1.10. Lasso peptide gene clusters and biosynthesis. A. Generalized lasso peptide gene cluster. Although all lasso peptide clusters have the genes ACEB, they are not necessarily arranged in order depicted above. The E and B genes are sometimes fused into a single B gene . B. General mechanism of lasso peptide biosynthesis.

Ubiquitously found in lasso peptide clusters and widespread in other RiPP gene clusters is the RiPP recognition element (RRE). The RRE, which is present is roughly 50% of all RiPP clusters, recognizes the leader sequence of the precursor peptide and enables lasso peptide proteolysis and cyclization to occur 78,79 . The RRE forms a winged helix-turn-helix structure and interacts with the leader peptidase through electrostatic interactions, some of which are under co-evolutionary pressure 78 . In some gene clusters, including the microcin J25 gene cluster, the RRE is found fused to the N-terminus of the lasso peptidase. Recently, Sumida et al. crystallized the fusilassin/fuscanodin leader peptide with its cognate RRE 80 . They found that the RRE binds very tightly to the leader peptide with a dissociation constant of 6 nM, and that conserved residues play critical roles in the recognition of the leader sequence by the RRE. Specifically, the conserved YxxP motif and a conserved leucine fit into a hydrophobic cleft formed by the RRE.

There is also evidence of coevolution between residues of the leader sequence and the RRE. The conserved Tyr of the YxxP motif, as well as the conserved leucine are two of several residues found to be under strong coevolutionary pressure 78 .

After the leader sequence is cleaved from the core sequence by the lasso peptidase, the second lasso peptide biosynthesis enzyme, the lasso cyclase, catalyzes the cyclization of the peptide, producing the mature lasso peptide. The lasso cyclase, which is homologous the aspartate- dependent asparagine synthase AsnB, catalyzes the bond formation between the N-terminal amine of the core peptide with a carboxylate macrolactam acceptor, either glutamate or aspartate, ultimately producing a macrocycle. The Glu or Asp is located in the 8th or 9 th and occasionally the 7 th position in the core sequence of the precursor peptide. The cyclase catalyzes macrolactam formation presumably through adenylation of the carboxylate, thereby activating the carboxylate for nucleophilic attack by the free N-terminal amine (Figure 1.11 ).

Figure 1.11. Proposed mechanism of microcin J25 biosynthesis. Although microcin J25 requires ATP for proteolysis, another lasso peptide, fusilassin/fuscanodin does not. Figure adapted from Ortega and van der Donk, 2016 52 .

In addition, lasso peptide biosynthetic gene clusters often contain ABC transporters. In microcin J25, the dedicated ABC transporter, McjD, provides immunity to strains harbouring the microcin biosynthesis genes 81 . Other post-translational modifications have been found to occur on some lasso peptides, including phosphorylation, acetylation and methylation 82–84 .

The lasso peptide core sequence appears to be highly tolerant of substitutions. In a study analyzing more than 380 single substitutions in the microcin J25 core sequence, Pavlova and colleagues found that only three positions in the microcin J25 core sequence compromised peptide stability 85 . Substitutions in most positions did not completely compromise RNA polymerase inhibitory activity, demonstrating that lasso peptides are highly amenable to engineering. 19

1.1.3.3 Activity of lasso peptides

The lasso peptides display diverse activities including antibacterial, anti-HIV and inhibition of the glucagon receptor, endothelin B receptor, and cancer cell invasion 86–89 . Although diverse activities have been reported for the lasso peptides, antibacterial activity is the most common. Of the 69 studied lasso peptides, 21 have reported antibacterial activity and the targets of 8 of these antibacterial lasso peptides have been investigated. Among these 8 lasso peptides, there are three common targets: RNA polymerase, ClpC1P1P2 protease and cell wall/lipid II (Figure 1.12 ).

Figure 1.12 . Antibacterial targets of lasso peptides. Figure from Tan et al ., 2019 7.

1.1.3.3.1 Cell wall biosynthesis inhibitors

Siamycin-I, which is a 21-residue, class I lasso peptide produced by certain Streptomyces strains, has been found to inhibit cell wall biosynthesis by targeting lipid II. It has antimicrobial activity against many Gram-positive bacteria but not Gram-negatives 90,91 . Its antimicrobial activity

includes activity against pathogens such as vancomycin-resistant enterococci (VRE) and methicillin-resistant Staphylococcus aureus , against both of which the minimum inhibitory concentrations (MIC) of siamycin-I is 7μM. Daniel-Ivad et al. found that siamycin-I activates the lia (lipid II-interfering antibiotics) promotor, suggesting that the antibiotic acts at the cell wall. Further work by Tan et al. , revealed that mutations in S. aureus that confer resistance to siamycin-I were found in the walK/R genes 92 . The WalK/R two-component system is highly conserved and involved in the regulation of cell metabolism 93 . Interestingly, the walK/R mutants exhibited thickened peptidoglycan when compared to the wild type S. aureus. Further in vitro enzymatic inhibition studies found that siamycin-I interacted with lipid II to prevent the transglycosylation reaction catalyzed by penicillin-binding protein from occurring. Siamycin-I displays some distinct differences from other lipid II-interfering antibiotics, including a specific localization at the division septum of S. aureus and Bacillus subtilis and not resulting in the accumulation of the of cytoplasmic peptidoglycan precursor, UDP-MurNAc-pentapeptide 94 . Siamycin-I and its analogues have also been found to inhibit the entry of HIV into host cells through binding to CD4, CCR5 and CXCR4 and to block fsr quorum sensing in Enterococcus faecalis 86,95,96 .

The only other lasso peptide that has been found to target peptidoglycan synthesis is streptomonomicin, which is produced by Streptomonospora alba and is a member of the class II peptides that lack disulfide bridges 97 . Streptomonomicin has potent antibacterial activity against various strains of the genus Bacillus including B. anthracis , the causative agent of anthrax, against which the MIC is 2-4 μM. Similar to siamycin-I-resistant S. aureus , streptomonomicin- resistant clones of B. subtilis were found to have mutations in the walR gene, including some mutations that were identical between the resistant strains. This suggests that streptomonomicin also targets the cell wall, although further experiments are required to determine its specific molecular target.

1.1.3.3.2 RNA polymerase inhibitors

In contrast to siamycin-I and streptomonomicin, there are several lasso peptides produced by Proteobacteria which target RNA polymerase in Gram-negative bacteria. These lasso peptides,

which all lack disulfide bonds and therefore all belong to class II, include microcin J25, the first lasso peptide that was studied in-depth, capistruin, acinetodin, klebsidin and citrocin.

Microcin J25, a 21 amino acid plasmid-encoded peptide, was first discovered in 1992 by Salomon and Farías 73 . Microcin J25 is produced by certain strains of Escherichia coli , and is active against E. coli and Salmonella Newport at concentrations as low as 10 and 5 nM, respectively. Initially, the mechanism of microcin J25 action was thought to be related to the function of the cell envelope proteins fhuA, tonB, exbB and sbmA 98,99 . Later it was found that mutations in the rpoC gene (which encodes the β’ subunit of RNA polymerase) confers microcin resistance in E. coli 100 . RNA synthesis is impaired both in vitro and in vivo in E. coli treated with microcin J25 and it is thought that the filamentous phenotype of microcin J25-treated E. coli may result from impaired transcription of genes encoding cell division proteins.

It was then discovered that mutations in rpoB (encoding the β subunit of RNA polymerase) that confer resistance to streptolydigin result in cross-resistance to microcin J25, suggesting a shared mechanism of action 101 . Mutations conferring resistance to microcin J25 in both rpoC and rpoB map to the secondary channel, which is thought to be important for nucleotide substrate access to the active site as well as accepting the 3’ end of nascent RNA in backtracked elongation complexes 102 . Indeed, microcin J25 binding completely obstructs the secondary channel, inhibiting both the forward reaction of phosphodiester bond formation, and the reverse reaction of pyrophosphorolysis 103,104 . A recent crystal structure has validated this view, demonstrating that microcin binds deep within the RNA polymerase secondary channel, constricting the solvent accessible channel to less than 5 Å 105 . Further, microcin J25 blocks folding of an important mobile structural element of the β’ subunit called the trigger loop.

Much of the work understanding the mechanism of action of microcin J25 was performed prior to a published structure that was correct. In fact, the first three published structures of microcin J25 were later determined to be incorrect 106–108 . These structures proposed that microcin J25 was a 21 amino acid peptide cyclized between its N and C terminus, as opposed to the lasso-like structure known today 109 .

Another class II lasso peptide that targets RNA polymerase is capistruin. Capistruin is a 19 amino acid peptide, discovered in 2008 that is produced by Burkholderia thailandensis E264 110 . 22

It has antibacterial activity against certain strains of Burkholderia and E. coli , with MICs as low as 12 and 25 μM, respectively. In 2011, Kuznedelov et al. showed that microcin J25-resistant RNA polymerase is cross-resistant to capistruin, and that capistruin inhibits RNA polymerase- dependent transcript elongation in vitro 111 . These results strongly suggested that capistruin and microcin J25 have a common mechanism of action. Later, Braffman and colleagues determined the structure of capistruin-bound RNA polymerase and found that the binding sites of capistruin and microcin J25 largely overlap 105 . Among the differences, capistruin binds farther (12 Å) from the RNA polymerase active site than does microcin J25 (6.5 Å) and as a result, capistruin does not appear to restrict access of nucleotide substrates to the active site. Additionally, while microcin competitively inhibits binding of nucleotides in the active site, capistruin binds too far from the active site to be competitive with respect to nucleotide binding.

Acinetodin and klebsidin are two lasso peptide RNA polymerase inhibitors, produced by Acinetobacter gyllenbergii CIP 110306 and Klebsiella pneumoniae 4541–2, respectively 112 . Acinetodin and klebsidin were identified through a cysteine protease-guided genome mining approach and heterologously expressed in E. coli. Acinetodin does not have antibacterial activity against Gram-positive or Gram-negative bacteria, while klebsidin has very weak antibacterial activity against certain strains of the genus Klebsiella .

Although acinetodin and klebsidin do not have strong antibacterial activity, in vitro testing revealed that they are both inhibitors of RNA polymerase elongation 112 . Microcin J25, which was used as a positive control, was the most potent RNA polymerase inhibitor, followed by klebsidin, then finally acinetodin, which was significantly less potent. Further, a mutation in the rpoC subunit of RNA polymerase that confers resistance to microcin J25 was found to result in cross-resistance to acinetodin and klebsidin, indicating that similar to microcin J25 and capistruin, acinetodin and klebsidin likely target the RNA polymerase secondary channel. A crystal structure of acinetodin and klebsidin with RNA polymerase would reveal the differences between the binding modes of acinetodin, klebsidin, capistruin and microcin J25.

Recently, a 19 amino acid class II lasso peptide from Citrobacter pasteurii and Citrobacter braakii was characterized and also found to be an RNA polymerase inhibitor 113 . Citrocin has antimicrobial activity against several Gram-positive strains of bacteria, with MICs as low as 16

μM. In spite of its weaker antimicrobial activity when compared to microcin J25, citrocin is a more potent inhibitor of RNA polymerase. In fact, 100 μM of microcin J25 was required to achieve the same level of RNA polymerase inhibition as 1 μM of citrocin. This suggests that citrocin uptake is the factor limiting its antimicrobial activity.

1.1.3.3.3 ClpC1P1P2 protease inhibitors

Lassomycin, a class II lasso peptide, was identified in a screen of actinomycete extracts for those that specifically inhibited the growth of Mycobacterium tuberculosis . Lassomycin, which is produced by a Lentzea kentuckyensis sp, specifically inhibits the C1 subunit of the ClpC1P1P2 protease complex. Lassomycin potently inhibits strains of mycobacteria with MICs lower than 1 μM and is even able to inhibit the growth of multidrug-resistant M. tuberculosis . Lassomycin had weaker activity against other Actinobacteria such as Propionibacterium (Cutibacterium ) acnes , and no activity against other Gram-positive or Gram-negative bacteria. Lassomycin-resistant mutants of M. tuberculosis suggested that the target of lassomycin was the ClpC1 ATPase subunit of the ClpC1P1P2, as all of the mutations mapped to this region. In vitro enzymatic work revealed that lassomycin increased the ATPase activity of ClpC1, while decreasing the ability of ClpC1P1P2 to perform proteolysis. This ability of lassomycin to decouple the ATP activity of ClpC1 from proteolysis, represents a new antibiotic mechanism of action. Interestingly, lassomycin was highly specific to the ClpC1P1P2 protease, and did not affect ATP hydrolysis in any other AAA ATPases, including the E. coli ClpC1 homolog, ClpA.

Unlike nearly all other lasso peptides, the C-terminal tail of lassomycin is not threaded through the N-terminal ring which, in contrast to threaded lasso peptides, allows for the chemical synthesis of the peptide 114 . As a result of its potent anti-mycobacterial activity against resistant strains and the ease with which it is able to be synthesized, lassomycin offers great therapeutic promise 115 .

1.1.3.4 Discovery and Heterologous expression of lasso peptides

An advantageous feature of the RiPPs is their suitability for genome mining and heterologous expression. The lasso peptide characterization in particular has benefitted from genome mining and heterologous expression tools. Several groups have successfully characterized novel lasso peptides, which they predicted to have unique features based on genomic data 75,110,116 . Currently, 24

there are six genome mining tools that are able to detect lasso peptide biosynthetic gene clusters 46,75,117–120 . Perhaps the most commonly used genome mining tool for secondary metabolite genome mining is AntiSMASH, which has integrated the RODEO lasso peptide detection algorithm into its search function in its fourth and fifth releases.

Many of the lasso peptides that have been studied through heterologous expression, although the study of actinobacterial lasso peptides has lagged behind the study of those from Proteobacteria (Table 1.1). The most popular heterologous host for lasso peptide expression remains E. coli , although several have been expressed in Streptomyces sp. and one in Sphingomonas subterranean . To date, only two lasso peptides from Actinobacteria have been expressed in E. coli : chaxapeptin and fuscanodin/fusilassin, which has been successfully produced in E. coli by two separate groups. At 0.1 mg/L, the yield of heterologously-expressed chaxapeptin was much lower than the 0.7 mg/L yield of the natively-expressed peptide 121 .

Table 1.2. Heterologously produced lasso peptides.

Peptide Name Native Organism Heterologous Host Organism Class I Siamycin-3 Streptomyces sp. S. coelicolor M1152 SSV 2083/Sviceucin Streptomyces sviceus S. coelicolor M1146 Class II Albusnodin Streptomyces albus S. coelicolor M1146 and S. lividans 66 Astexin 1-3 Asticcacaulis excentricus E. Coli BL21 Benenodin-1 Asticcacaulis benevestitus E. Coli BL21 Brevunsin Brevundimonas diminuta Sphingomonas subterranea Burhizin Burkholderia rhizoxinica E. Coli BL21 Capistruin Burkholderia thailandensis E. Coli BL21 Caulonodulin 1-7 Caulobacter sp. E. Coli BL21 Caulosegnin 1-3 Caulobacter segnis E. Coli BL21 Chaxapeptin Streptomyces leeuwenhoekii C58 E. Coli BL21 Citrocin Citrobacter pasteurii E. Coli BL21 Citrulassin Streptomyces albulus S. lividans 66 Fusilassin/Fuscanodin Thermobifida fusca E. Coli BL21

Klebsidin K. pneumoniae E. Coli BW25113 Microcin J25 E. coli AY25 E. Coli XL-1 Blue Paeninodin Paenibacillus dendritiformis C454 E. Coli BL21 Rhodanodin Rhodanobacter thiooxydans LCS2 E. Coli BL21 Rubrivinodin Rubrivivax gelatinosus E. Coli BL21 Snou-LP Streptomyces noursei ATCC 11455 S. lividans TK24 Sphingonodin I-II Sphingobium japonicum E. Coli BL21 Sphingopyxin I-II Sphingopyxis alaskensis RB2256 E. Coli BL21 Syanodin-I Sphingobium yanoikuyae XLDN2-5 E. Coli BL21 Xanthomonin I-III Xanthomonas gardneri E. Coli BL21 Zucinodin Phenylobacterium zucineum HLK1 E. Coli BL21 9810-LP Streptomyces sp. ADI94-01 Streptomyces albus J1074 Class III 9401-LP1 Streptomyces sp. ADI94-01 S. albus J1074

1.2 Aim of this work

The aim of this thesis is to expand scientific knowledge about an emerging class of antibiotics, the lasso peptides. Specifically, the aim of this project is to investigate a unique and uncharacterized lasso peptide, LP2006. LP2006 is a structurally unique antibacterial lasso peptide, which may indicate that it has a novel mechanism of action with respect to other antibacterial lasso peptides. To facilitate the study of LP2006 and other lasso peptides, I intend develop a system for the production of lasso peptides by heterologous expression. I attempt to heterologously produce LP2006 in E. coli and several strains of Streptomyces , and successfully detect the production of LP2006 in a host strain of S. coelicolor M1146.

Chapter 2 Materials and Methods Materials and Methods 2.1 General experimental procedures

2.1.1 Materials

Unless otherwise stated, all chemicals were purchased from Sigma-Aldrich. Difco Marine Broth 2216 Agar was purchased from BD Biosciences. Bacto Agar, Bacto Malt Extract and Bacto Yeast Extract were purchased from BD Biosciences.

2.1.2 Strains and plasmids used

Table 2.1. Strains and plasmids used in this study.

Strain/Plasmid Description Source

Environmental strains

Maritime Strains (Table 5.1) Isolates from the maritime provinces of eastern Canada Nocardiopsis sp. HB141 (=H153) Environmental isolates from the sponge (Schneemann et al., Halichondria panacea (harvested near Kiel, 2010)122 Germany) Cloning and expression strains

Streptomyces albus J1074 Used commonly for heterologous expression Streptomyces avermitalis SUKA22 S. avermitalis containing a large, systematic (Komatsu et al.,2013) 123 deletions of nonessential genes Streptomyces coelicolor M1146 S. coelicolor M145, ∆cda ∆red ∆act ∆cpk (Gomes-Escribano and Bibb, 2011) 124 Streptomyces coelicolor M1154 S. coelicolor M145, ∆cda ∆red ∆act ∆cpk + rpsL and rpoB mutations

Escherichia coli ET12567(pUZ8002) Methylation-deficient conjugal donor strain r (dam-13:: Tn 9 dcm-6 hsdM Cm ) Escherichia coli TOP10 General cloning host

Escherichia coli BL21(DE3) Protein expression host

Antimicrobial Testing strains Bacillus subtilis 168 YB5018 dinC18::Tn917Iac metB5 trpC2 xin-1 SPβ- (Jani et al., 2015) 125 amyE+ Bacillus subtilis 168 1A980 Em trpC2 liaI::pMUTIN attSPβ Bacillus Genetic Spore Center Bacillus subtilis JH642 Common laboratory strain Enterococcus ATCC 51299 Vancomycin-resistant ATCC

Enterococcus faecalis ATCC 29212 Vancomycin-sensitive ATCC

Escherichia coli BW25113 Common laboratory strain

Escherichia coli BW25113 ∆tolC ∆bamB Hyperpermeable strain of E. coli

Micrococcus luteus Antibacterial test strain Mycobacterium smegmatis Antibacterial test strain

Saccharomyces cerevisiae Y7092 Anti-yeast test strain Staphylococcus aureus ATCC BAA-41 Methicillin-resistant ATCC Staphylococcus aureus ATCC 29213 Methicillin-sensitive ATCC Staphylococcus epidermis ATCC 14990 Antibacterial test strain ATCC

Plasmids pACYCDuet-1 Inducible co-expression plasmid Novagen pRSFDuet-1 Inducible co-expression plasmid Novagen pSET152-ermE*p Streptomyces overexpression plasmid Bibb et al. , 1985 126 pGEM T-Easy Cloning vector Promega

2.1.3 Primers used

Table 2.2. Primers used in this study. Primer Primer Name Sequence (5’ to 3’) Number 1 27F_16S_universal_primer GAGTTTGATCCTGGCTCA 2 1492R_16S_universal_primer TACGGCTACCTTGTTACGACTT 3 LpeA_For GCGCACACCATGGACGAAGAAAAGATCGGC 4 LpeA_Rev TAATTCAAGCTTTCAGCAGACCCGGACGCAGGA 5 LpeC_For GCGCACCATATGAAGTTCATCGTTCTTCCC 6 LpeC_Rev GACCACGATATCTCAGCCTTCCAGGATCGATAC 7 LpeE_For GCGCACACCATGGAATTCATCGACGACACG 8 LpeE_Rev TAATTCAAGCTTTCATCGCCGCAGCACCCCCAC 9 LpeB_For TAATTCCATATGACGGTACCCGTGGCCCTC 10 LpeB_Rev TAGCTCGATATCTCAGTCATCATCACGGACCAC 11 ACYCDuetUP1 GGATCTCGACGCTCTCCCT 12 DuetDOWN1 GATTATGCGGCCGTGTACAA 13 DuetUP2 TTGTACACGGCCGCATAATC 14 T7_Terminator GCTAGTTATTGCTCAGCGG 15 LpeACEBDD_For GCCGGTTGGTAGGATCAGGAGGATATCATATGGACGAAGAAAAGATCGGC 16 LpeACEBDD_Rev AAGCTTGGGCTGCAGGTCGACTCTAGACGGTCTCGCGACGCAGGTGGT 17 pSET152_ermE*_For GCTCACTCATTAGGCACCCCAGGC 18 pSET152_ermE*_Rev AGGGGGATGTGCTGCAAGGCG

2.1.4 Culture conditions

Nocardiopsis sp. HB141 was grown on either GYM medium (per L Milli-Q water: 4g yeast extract, 10g malt extract, 4g dextrose), SMMS medium (per L Milli-Q water: 2g Difco casamino acids, 5.3g TES buffer), ATCC medium 172 (per L Milli-Q water: 10g glucose, 20g soluble starch, 5g yeast extract, 5g Bacto Peptone, 1g CaCO3), YEME medium (per L Milli-Q water: 10g glucose, 170g sucrose, 3g yeast extract, 5g Bacto Peptone, 3g malt extract) or TSB medium

(per L Milli-Q water: 2.5g glucose, 17g tryptone, 3g soytone, 5g NaCl, 2.5g K2HPO 4). 16g per L of Bacto agar was added to each media if solid growth medium was desired. Nocardiopsis sp. HB141 was grown for 3 weeks at 30°C and extracted with methanol.

All strains used for antimicrobial testing, DNA manipulation and E. coli used for heterologous expression were grown using LB medium (per L Milli-Q water: 10g tryptone, 10g NaCl, 5g yeast extract) and grown at 37°C. All Streptomyces strains used for heterologous expression were cultured on MYM medium (per L Milli-Q water: 4g yeast extract, 10g malt extract, 4g maltose, 16g agar) at 30°C unless otherwise indicated.

2.1.5 Heterologous expression of LP2006

For the heterologous expression of LP2006 in E. coli , the vectors pACYCDuet-1 and pRSFDuet- 1 were used. The genes lpeACEB were amplified from genomic DNA extracted from Nocardiopsis sp. HB141 using the primers 3-8 (Table 2.2). A two-step reaction using Q5 DNA polymerase was used for all PCR reactions unless otherwise specified due to the high GC content of the template DNA and the high annealing temperature of the primers. The lpeAC gene fragments were cloned into the pACYCDuet-1 vector, while the lpeEB gene fragments were cloned into the pRSFDuet-1 vector, resulting in the vectors pACYCDuet-1-lpeAC and pRSFDuet-1-lpeEB . The correct gene sequences were confirmed by Sanger sequencing with the primers 11-14.

E. coli BL21(DE3), co-transformed with pACYCDuet-1-lpeAC and pRSFDuet-1-lpeEB was grown at 37°C in 1L LB medium, induced with IPTG after reaching an OD of 0.4-0.8 and returned to the shaking incubator for 4-16 hours at 20°C. Several IPTG concentrations were tested, ranging from 50 μM to 500 μM. Cells were harvested, and the pellet was extracted with methanol, sonicated and macerated overnight. The supernatant was combined with 20 g/L 29

XAD16 resin (Sigma Aldrich), stirred overnight, then removed by filtration. The resin was washed several times with ddH 2O, then adsorbed molecules were eluted with 100 mL of methanol.

For the heterologous expression of LP2006 in S. coelicolor , the integrative vector pSET152- ermE* p was used. The entire 8-gene LP2006 gene cluster was amplified from the Nocardiopsis sp. HB141 genomic DNA using the primers 15 and 16 and cloned into pSET152-ermE* p. The sequence was confirmed using the primers 11-16 and 17-18 (Table 2.2). The vector pSET152- ermE* p-lpeACEBDD was transformed into E. coli ET12567(pUZ8002) to use as a conjugal donor. Conjugation to S. coelicolor M1146, M1154, S. avermitalis SUKA22 and S. albus J1074 was performed according to the protocol outlined in Kieser et al. , 2000 127 . Exconjugants were re- streaked on MYM containing apramycin twice and genomic DNA was extracted to confirm that the insert was present without mutations. S. coelicolor M1146 pSET152-ermE* p-lpeACEBDD was grown on MYM and GYM media for 5-7 days and the production of LP2006 was assessed by LC-MS.

2.2 Isolation and purification of bioactive metabolites

2.2.1 Metabolite extraction

Nocardiopsis sp. HB141 metabolites were extracted from agar or liquid cultures with HPLC- grade methanol, using a volume of methanol equivalent to the volume of the culture or 200-300 mL, whichever is less. Organic solvent was evaporated from the extracts using a Genevac EZ-2 Elite series evaporator (SP scientific).

2.2.2 Flash chromatography purification

Crude extracts were resuspended in 5% aqueous HPLC-grade methanol to a concentration of 100 mg/mL. After centrifugation and/or filtration, the resuspended crude extracts were further purified on a Reveleris® X2 Flash chromatography system (Buchi Labortechnik). A 20g C18 40- 60um 100Å cartridge (Aegio Technologies) was used for the separation by flash chromatography, with a linear gradient from 5 to 100% aqueous HPLC-grade methanol at a flow rate of 10mL/min. 20mL fractions were collected, dried by Genevac or rotary evaporation and

tested for bioactivity by broth microtiter dilution assay (5.2.1.3). Fractions that were bioactive were pooled, resuspended and further purified by HPLC.

2.2.3 High-performance liquid chromatography purification

After flash chromatography, the Nocardiopsis sp. HB141 extract was further purified by HPLC to study the activity of the bioactive metabolite(s). Individual and pooled bioactive flash chromatography fractions were purified on a Waters Alliance HPLC with a Phenomonex Luna C18 column (100 Å, 5 μm, 4.6x250mm). The Nocardiopsis sp. HB141 fractions from flash chromatography were purified by HPLC over two steps. The first step involved the following 30- minute linear solvent gradient of water/0.1% formic acid (solvent A) and acetonitrile/0.1% formic acid was used: hold at 5% B for 2 minutes, followed by linear increase until 95% B at 20 minutes, hold at 95% B until 25 minutes, then return to 5% B until 30 minutes. The peak containing LP2006 was collected and the fraction was dried by Genevac evaporator and confirmed as LP2006 by mass spectrometry.

The second step involved the following 30-minute linear solvent gradient of water/0.1% formic acid (solvent A) and acetonitrile/0.1% formic acid was used: hold at 20% B for 2 minutes, followed by linear increase until 60% B at 20 minutes, hold at 60% B until 25 minutes, then return to 20% B until 30 minutes. During both purification steps the column temperature was 35°C and the flow rate was 1 mL/min. Again, the LP2006-containing fraction was collected, dried and confirmed by mass spectrometry.

2.2.4 Liquid chromatography mass spectrometry analysis

A Waters Xevo G2-S QTOF mass spectrometer with Acquity liquid chromatography was used to analyze extract metabolites. An Acquity UPLC BEH C18 (1.7 μm 2.1*50mm) column was used to achieve liquid chromatography separation of the sample with a column temperature of 40°C and a flow rate of 0.2 mL/min. A 20-minute linear solvent gradient of water/0.1% formic acid (solvent A) and acetonitrile/0.1% formic acid was used: linear increase from 5% to 95% B from 0-12 minutes, hold at 95% B until 17 minutes, return to 5% B at 18 minutes and hold at 5% B until 20 minutes. Samples were analyzed in the positive mode, using the electrospray ionization source.

2.3 Susceptibility testing

2.3.1 Disk diffusion assays

The test organism was inoculated from an agar streak plate into a 5mL liquid culture of LB or YPD media, depending on the organism. The cultures were grown in a shaking incubator overnight at 30°C or 37°C, depending on the test organism. The next day, the cultures were diluted 1:100 into fresh media and returned to the shaking incubator. Cultures were grown to an OD600 of 0.4-0.6, diluted 1:1000 in LB or YPD media and inoculated onto agar plates of the desired medium to produce a lawn of growth. 6 mm paper filter disks (BS Biosciences) were placed on the agar plates and 2-10 uL of crude extract resuspended in DMSO were placed onto the filter disks. The agar plates were incubated overnight at 30°C or 37°C depending on the test organism and the plates were imaged in the morning and the zone of inhibition surrounding each filter disk was observed.

2.3.2 Broth microtiter dilution assay

The test organism was inoculated from an agar streak plate into a 5mL liquid culture of YPD medium for S. cerevisiae or LB medium for all other test organisms. The liquid culture was grown overnight at 30°C (for S. cerevisiae ) or at 37°C for (all other organisms) and a 1:100 subculture was started in the morning. Each culture was grown to an OD of 0.4-0.6 and diluted 1:1000 with fresh media in a 96-well plate. The test compound or extract, resuspended in DMSO, was added to each well and the plate was incubated overnight. The next morning, the

OD 600 of each well was measured. When testing extracts, the extract was considered active if inhibition of growth was greater than 50%. For the determination of MICs, the same protocol was followed and antibiotics at twofold increasing concentrations were added to the 96 well plate liquid cultures.

2.4 Target identification

2.4.1 LacZ reporter assay

Disk diffusion assays were performed using two B. subtilis lacZ reporter strains with 8mg/mL X- gal added to monitor either cell envelope stress of the induction of the SOS response. The B.

subtilis reporter strain 1A980 ( liaI-lacZ fusion) while the strain YB5018 was used to monitor the DNA damage SOS response ( dinC-lacZ fusion).

Results and discussion 3.1 Nocardiopsis sp. HB141 extract testing

3.1.1 Extracts of Nocardiopsis sp. HB141 have antibacterial activity

In a search for novel antimicrobial natural products, nearly 50 strains of marine bacteria were screened against M. luteus , B. subtilis , E. coli , and S. cerevisiae. Each strain was grown on several media types for 5 days, extracted with organic solvent and tested for antibacterial or anti- yeast activity in a broth microtiter dilution assay (for details about the screen see section 5.3.1.2). The extract was considered a hit if it produced a 50% reduction in the OD600 value of the indicator organism as compared to the control. Among the hit strains was Nocardiopsis sp. HB141, which was isolated from homogenates of the marine sponge Halichondria panacea harvested in the Baltic Sea near Kiel, Germany 122 . Extracts of Nocardiopsis sp. HB141, grown on GYM medium, have antibacterial activity against the Gram-positive bacteria M. luteus and B. subtilis, as demonstrated by the growth inhibitory effect of the extracts in broth microtiter dilution and disk diffusion assays (Figure 3.1).

Figure 3.1. Disk diffusion assay of Nocardiopsis sp. HB141 extract. DMSO or Nocardiopsis sp. HB141 extract was added to the filter disk, which was placed on a lawn of bacteria grown on an agar plate. The HB141 extract inhibits growth of B. subtilis and M. luteus , as indicated by the zone of growth inhibition surrounding the filter disk demonstrating that has antibacterial activity against these test organisms.

3.1.2 Nocardiopsis sp. HB141 is a producer of an antibacterial lasso peptide, LP2006

To identify bioactive metabolites that were responsible for the antibacterial activity of the Nocardiopsis sp. HB141 extract, I analyzed the extract by LC-MS. Metabolite profiling by LC- MS revealed that the HB141 crude extract contained a mass that was not present in the media control extract, which eluted at 5 minutes (Figure 3.2). Based on the averaged mass spectra of the sample, the mass of the identified peak was 1002.9335 m/z and was identified as an M+2H ion based on the isotope pattern.

Figure 3.2. Extracted ion chromatogram of LP2006 M+2H mass. LC-MS chromatogram of the ion 1002.93 m/z, the most abundant ion of LP2006. The ion is present in the HB141 crude extract, but absent in the media control extract.

Next, I used The Dictionary of Natural Products to determine if there is a known natural product with this mass. I found that the mass and fragmentation pattern of the Nocardiopsis sp. HB141 metabolite matches the reported values of a recently discovered lasso peptide, LP2006 75 (Figure 3.3 and Table 1.1). LP2006 was identified by a genome-mining tool and it is the establishing and only member of the class IV lasso peptides.

The error values on all detected ions were all lower than 2 ppm, which is well within the instrument error of the mass spectrometer. Additionally, there is a close phylogenetic relationship between Nocardiopsis sp. HB141 and the strain from which LP2006 was first discovered, Nocardiopsis alba NRRL B-24146. Since there is often a close association between 34

bacterial chemotype and phylotype, this provides more evidence that Nocardiopsis sp. HB141 is a producer of LP2006 128 . Collectively, the phylogenetic data and the mass spectra strongly suggest that Nocardiopsis sp. HB141 is a producer of LP2006.

Figure 3.3. Mass spectrum of the Nocardiopsis sp. HB141 mass of 1002.9335 m/z. The amino acid sequence of LP2006 is overlaid on the spectrum and the ions are assigned based on the values reported for LP2006 by Tietz et al. , 2017 75 .

Table 3.1. Ion comparison of HB141 mass and LP2006 Calculated Observed Ion Error (ppm) Mass (Da) Mass (Da) y6 + 664.2905 664.2905 0

y7+ 850.3698 850.3683 -1.7

[M+2H] 2+ 1002.9338 1002.9335 -0.3

b10 + 1155.4966 1155.4951 -1.3

3.1.3 Purification of LP2006

To study the activity of LP2006, I decided to purify the peptide. I started with purification by flash chromatography, a preparative method for the rapid purification of crude extracts. After purification by flash chromatography, only two fractions retained antibacterial activity, fractions 6 and 7 (Figure 3.4). I found that fractions 6 and 7 contained the vast majority of the eluted

LP2006, with other fractions containing only trace amounts. These results are consistent with the hypothesis that LP2006 is responsible for the antibacterial activity of the Nocardiopsis sp. HB141 crude extract.

Figure 3.4. Disk diffusion assay from flash chromatography fractionated Nocardiopsis sp. HB141 extract. The flash chromatography fractions of the purified Nocardiopsis sp. HB141 extract are added to a filter disk, which is placed on a lawn of M. luteus or B. subtilis . Fractions 6 and 7 were able to inhibit growth of M. luteus or B. subtilis , while the remaining fractions and the DMSO control were not able to.

LP2006 was further purified in a two-step HPLC purification to remove co-eluting compounds (Figure 3.5 and Figure 3.6). The purity of the LP2006 was confirmed by LC-MS and HPLC. After the three-step purification, the yield of pure LP2006 was less than 100 μg per L of GYM agar. Nocardiopsis sp. HB141 requires ~3 weeks to reach the sporulation stage of its growth on GYM agar medium, which is substantially longer than the less than 1 week typical for the secondary metabolite-rich Streptomyces to sporulate on solid media. As a result, the purification of LP2006 from Nocardiopsis sp. HB141 is time and labour-intensive. Additionally, Nocardiopsis sp. HB141 does not grow in the liquid growth media GYM, MYM, or YEME and only grows on the solid growth media, GYM, MYM or ATCC172 agar. To combat such challenges, I sought to produce LP2006 through another means. Chemical synthesis has not been demonstrated for the lasso peptides (with the exception of lassomycin), thus I decided to pursue the heterologous expression of LP2006. Lasso peptides are generally highly amenable to heterologous expression, owing to the fact that their biosynthesis requires very few genes (1.1.3.4).

Figure 3.5. HPLC chromatogram of first-round purification of LP2006. The major peaks were collected and analyzed by mass spectrometry to determine which peak corresponded to LP2006. The LP2006 peak was then further purified.

Figure 3.6. HPLC chromatogram of second-round purification of LP2006. The major peaks were collected and analyzed by mass spectrometry to determine which peak corresponded to LP2006.

3.2 Heterologous expression of LP2006

3.2.1 Heterologous expression in Escherichia coli

Since Nocardiopsis sp. HB141 is a slow-growing organism and the yields of LP2006 are very low, I decided to heterologously express the peptide in a host strain. I decided to use E. coli to heterologously express LP2006 as there has been much success expressing lasso peptides using E. coli, although, at the time, no other labs had been able to heterologously express lasso peptides from Actinobacteria in E. coli (Table 1.2).

As LP2006 was originally identified from a strain of Nocardiopsis alba , I searched the NCBI to see if there were any genome sequences of N. alba available. Indeed, there are three N. alba published, each of which contains a gene cluster capable of producing LP2006, as verified by AntiSMASH. The LP2006 biosynthetic gene clusters of each of these three strains have >98% sequence identity, with no differences in the sequence of the core peptide (Table 3.2). Based on the high sequence identity between the LP2006 gene clusters and the taxonomic similarity between N. alba DSM 43377 and Nocardiopsis sp. HB141, I reasoned that the LP2006 gene cluster of Nocardiopsis sp. HB141 is likely highly similar to those in published genomes sequences and to be amenable to amplification with primers based on published genome sequences. Therefore, I designed primers based on the LP2006 cluster of N. alba DSM 43377, with the primers designed to separately amplify the lpeACEB genes in the cluster (Table 2.2). The lpeACEB genes are the core genes responsible for biosynthesis, while there are two transporter genes in the cluster that I did not amplify and two genes flanking the ABC transporters that are unrelated to the biosynthesis of LP2006 ( Figure 3.7). The lpeACEB genes were cloned into the protein expression vectors pACYCDuet-1 and pRSFDuet-1, with each gene under the control of its own IPTG-inducible promotor ( Figure 3.8).

Table 3.2. Sequence identity of LP2006 biosynthetic proteins of Nocardiopsis alba ATCC BAA-2165 and Nocardiopsis sp. TP-A0876 compared to Nocardiopsis alba DSM 43377.

LpeC LpeE (RiPP LpeB LpeD1 LpeD2 LpeA Strain (Lasso recognition (Leader (ABC (ABC (Precursor) cyclase) element) peptidase) transporter) transporter)

Nocardiopsis alba 100.0 98.2 100.0 100.0 99.0 99.7 ATCC BAA-2165

Nocardiopsis sp. TP- 100.0 99.7 100.0 100.0 100.0 98.6 A0876

Figure 3.7. LP2006 biosynthetic gene cluster from N. alba DSM 43377. The cluster contains 6 genes important for the biosynthesis of LP2006, lpeACEB , two ABC transporters for export of LP2006, and two genes flanking the transporters which are unrelated to the biosynthesis of LP2006.

Figure 3.8. Vectors used for E. coli heterologous expression. The lpeACEB genes were amplified from Nocardiopsis sp. HB141 using primers designed from the LP2006 gene cluster from N. alba DSM 43377.

Heterologously expressed LP2006 in E. coli was undetectable by LC-MS under any tested condition. The conditions manipulated included changing induction time, induction temperature, inducer (IPTG) concentration. Other groups have been unable to express or have had incredibly low yields expressing actinobacterial lasso peptides in E. coli , although it is not clear why this is the case. In fact, only two lasso peptides from Actinobacteria have been expressed E. coli , chaxapeptin and fusilassin/fuscanodin, although others have tried unsuccessfully 83 . It is likely that additional failed heterologous expression attempts have gone unreported in the literature.

Chaxapeptin was the first successful expression of an actinobacterial lasso peptide in E. coli , although the yield of the expression was 0.1 mg/L, which is lower than the yield of the natively- produced chaxapeptin at 0.7 mg/L 121 . Martin-Gomez and colleagues used an approach where the four chaxapeptin biosynthesis genes, cptACEB, were cloned into a single vector for expression. cptA was placed under the inducible T7 promotor, while cptCEB were placed under the promotor from the microcin J25 biosynthesis cluster. Following chaxapeptin, two groups were able to independently produce the lasso peptide fusilassin/fuscanodin. The first group, who did not report their final yield, took an approach of expressing the five biosynthesis genes tfuACEBD on a single plasmid 129 . The second group took a similar approach used in this study whereby tfuA was cloned into the pET28 vector and the tfuCEB genes were cloned into the pACYC vector. A

numerical value is not reported for the final yield by this method, although the yield is reported to be “low” 78 .

It is possible that the transporter genes may be required for proper biosynthesis of LP2006. In their heterologous expression of fusilassin/fuscanodin, Koos and Link included the transporter gene in construct for heterologous expression, although it is not clear if the gene is required for biosynthesis. Other groups have been able to heterologously express lasso peptides without the transporter gene(s) present on the expression plasmid. Additionally, the ABC transporters were not required during in vitro synthesis of the lasso peptides, microcin J25, paeninodin and fusilassin/fuscanodin 76–78,129,130 . When recombinantly expressing proteins in E. coli , an approach often taken to overcome low or no expression is to correct for codon bias in the recombinant gene 131 . Koos and Link codon optimized the tfuE and tfuB genes for the in vitro biosynthesis of fusilassin/fuscanodin 129 . In other classes of RiPPs, the biosynthetic genes have been codon optimized for heterologous expression, although the optimization has not always resulted in higher yields 132,133 .

I decided to investigate the production of the LP2006 biosynthesis enzymes by SDS-PAGE. As no antibodies are available against LpeACEB, I relied simply on the observance of induced bands in crude cell lysates. I compared the cell lysates of E. coli transformed with pACYC- lpeAC and pRSF-lpeEB and E. coli transformed with the pACYC and pRSF empty vectors (Figure 3.9). A single, prominent band is observed in +lpeACEB lanes at the expected molecular weight for LpeC (68 kDa), becoming more prominent in the three hours following induction. It is likely that this band corresponds to LpeC, although analysis by western blot or mass spectrometry is required for confirmation. Despite my efforts, the remaining proteins (LpeA: 2 kDa, LpeE: 10 kDa and LpeB: 16 kDa) were not detectable by SDS-PAGE.

Figure 3.9. Protein expression testing of LpeCEB. The crude cell lysates of E. coli either containing the vector with the lpeACEB genes or containing the empty vectors are compared. The cells are induced with IPTG and are harvested at induction, or 1, 2 or 3 hours post-induction. The appearance of a band at the molecular weight of LpeC is visible post-induction in the lpeACEB -containing cells. Cells were grown at 37°C, and induced with 100 uM IPTG at 20°C.

It is becoming clear that the success of a heterologous expression experiment is dependent on the lasso peptide and its biosynthetic enzymes as well as the host organism. It is therefore difficult to predict whether the expression will be successful and what the resulting yield will be. Although there have bene significant challenges associated with the expression of actinobacterial lasso peptides in E. coli , the expression of these peptides in an actinobacterial host has been successful. In light of these findings, I shifted my approach to express LP2006 in a Streptomyces host strain.

3.2.2 Heterologous expression in Streptomyces coelicolor M1146

To overcome the challenges of expressing an actinobacterial lasso peptide in E. coli , I attempted to heterologously express LP2006 in a host more closely related to Nocardiopsis sp. HB141. I chose to try several strains of Streptomyces sp. that have been designed for the heterologous expression of secondary metabolites, S. coelicolor M1146 and M1154 and S. avermitalis SUKA22. S. coelicolor M1146 and M1154 are strains that were derived from S. coelicolor M145 through the deletion of four endogenous secondary metabolite gene clusters, allowing for the strains to allocate resources for the production of heterologous secondary metabolites 124 . S. coelicolor M1154 contains two additional point mutations in rpoB and rpsL from S. coelicolor M1146, which have both been shown to enhance levels of antibiotic production 134,135 . Additionally, I tried using S. albus J1074, a strain commonly used as a chassis strain for the production of secondary metabolites due to its naturally minimized genome and fast growth 136 .

In contrast to the approach taken the heterologous expression of LP2006 in E. coli , for the heterologous expression in the Streptomyces host strains, I PCR-amplified and cloned the entire LP2006 cluster into a cloning vector (Figure 3.10 ). This approach takes into account the possibility that the ABC transporters are required for LP2006 biosynthesis. The entire cluster was cloned into a modified version of the nonreplicative pSET152 plasmid, which contains the attP site and the integrase φC31 and can integrate in a site-specific manner into the attB site of the chromosomal φC31 phage. A version of the pSET152 plasmid containing the promotor of the erythromycin resistance gene ( ermE ), modified to provide strong, constitutive expression, was used in this study 126 .

Figure 3.10. Construct used for S. coelicolor heterologous expression. The entire LP2006 gene cluster was amplified from Nocardiopsis sp. HB141 and cloned into the vector pSET152, containing the constitutive promotor ermE *p.

Conjugation was attempted using the strains S. coelicolor M1146, M1154, S. avermitalis SUKA22 and S. albus J1074, but exconjugants were only detected from S. coelicolor M1146 and M1154. S. coelicolor M1154 exconjugants had a substantial growth defect, thus S. coelicolor M1146 was chosen for the heterologous expression of the peptide. The integration of pSET152- ermE* p-lpeACEBDD was confirmed by PCR amplification and Sanger sequencing; no mutations were present in the cluster.

LP2006 was detected in trace quantities by LC-MS from 5 day MYM cultures, eluting in two peaks (Figure 3.11 ).The elution pattern contrasts with that of LP2006 produced by Nocardiopsis sp. HB141, which elutes in one peak just before 5 minutes. The mass and fragmentation pattern of the peaks at 5 and 5.5 minutes are identical, suggesting that the molecule eluting at 5.5 minutes exists in a slightly different conformation than then peak at 5 minutes. The peak at 5.5 minutes may correspond to the unthreaded conformation of LP2006, although additional experiments would be required to test this hypothesis.

Figure 3.11. Detection of heterologously expressed LP2006 by mass spectrometry. Mass spectrometry chromatogram of the ion 1003.43 m/z, the [M+2H]2+ and most abundant ion of LP2006. LP2006 is detected in the S. coelicolor M1146 pSET152-ermE *p-lpeACEBDD culture but not the S. coelicolor M1146 negative control culture.

Additionally, there is a mass discrepancy between LP2006 produced by Streptomyces M1146 and Nocardiopsis sp. HB141 (Table 3.3). Although the y6 + and y7 + ions (corresponding to the charged C-terminal fragments of the peptide) are at the expected masses for the peptide, the b10 + and b11 + ions are shifted approximately 1000 mDa higher than expected. This suggests that there is either a mutation in the peptide or a modification on the peptide on the N-terminal half of the peptide. A single-nucleotide N4D or N9D mutation would result in a mass shift of 0.98401 Da, consistent with the experimental evidence. However, no mutations were detected in the precursor peptide when sequenced after conjugation into the S. coelicolor M1146. It is possible that the strain may have acquired a mutation in the peptide after the conjugation stage, perhaps in response to peptide toxicity. Another possibility is that the mass shift is a result of a post- translational modification occurs on the peptide. Analogous to N4D or N9D mutations, nucleophilic addition of a water in the side chain of either Asn4 or Asn9 would yield the mass observed by LC-MS. Unfortunately, the low ion intensity of the heterologous LP2006 precludes the measurement of more accurate ion masses which would be valuable in determining the exact molecular formulae of the peptide and fragment ions. Additionally, the low yield precludes structure determination by NMR, which would reveal both modifications and the conformation of the LP2006. 45

Table 3.3. Comparison of LP2006 masses from the Nocardiopsis sp. HB141 and those produced by heterologous expression in S. coelicolor M1146.

HB141 Extract M1146 Extract Calculated Ion Observed Observed Mass (m/z) Error (mDa) Error (mDa) Mass (m/z) Mass (m/z) y6 + 664.2905 664.2905 0 664.2877 -2.8

y7 + 850.3698 850.3683 -1.7 850.3655 -4.3

[M+2H] 2+ 1002.9338 1002.9335 -0.3 1003.4315 497.7

b10 + 1155.4966 1155.4951 -1.3 1156.5081 1011.5

b11 + 1341.5759 1342.5654 989.5

Regardless of the exact nature of the heterologously produced LP2006, the yield of the peptide was still too low to purify or perform functional studies. The peptide was undetectable by UV- Vis, and only detectable in trace amounts by LC-MS. Other groups have had similar issues with peptides expressed in Streptomyces host strains. Zong et al. attempted to heterologously express albusnodin, encoded in the host strain S. albus DSM 41398, in the strains S. coelicolor M1146, S. lividans 66 and S. albus J1074 83 . Albusnodin was detected in S. coelicolor M1146 and S. lividans 66 cultures but surprisingly not in S. albus J1074. In all cases, albusnodin was truncated by a single amino acid at the C-terminus, and it was only detectable by mass spectrometry due to low yields, precluding NMR studies. The expression of lasso peptides in host Streptomyces strains has worked for some groups, with some reported yields has high as 6-15 mg/L75,137 .

3.3 Bioactivity of LP2006

In the absence of a heterologous producer of LP2006, I shifted efforts to produce the peptide from the native strain, Nocardiopsis sp. HB141. Large-scale batch cultures of Nocardiopsis sp. HB141 grown on GYM agar using aluminum baking sheets allowed the purification of nearly 1 mg of LP2006. Pure LP2006 from Nocardiopsis sp. HB141 was tested for antibacterial activity using the broth microtiter dilution method but no activity was observed (Figure 3.12 ). The solubility of the peptide was very likely the reason why no antibacterial activity was observed in this case as precipitate was visible when resuspending the peptide into the stock solution to perform the testing.

Figure 3.12. Antibacterial MIC testing of pure LP2006. LP2006 was tested in duplicate against B. subtilis , E. coli and E. coli ∆tolC ∆bamB using the broth microtiter dilution assay.

Antibacterial activity was retested by disk diffusion assay with the peptide leftover from the first round of antibacterial testing and with newly purified peptide. LP2006 was resuspended in DMSO to a lower concentration to prevent precipitation and was tested against the liaI-lacZ fusion strain, B. subtilis 1A980. LP2006 does not appear to activate the cell wall stress response gene liaI , indicted by the absence of a blue ring surrounding the zone of inhibition of LP2006 (Figure 3.13 ). This result contrasts with the lipid II-targeting lasso peptide, siamycin I, which does activate liaI , suggesting that the antibacterial target of LP2006 may not be the cell wall.

Figure 3.13. LP2006 does not activate the cell wall stress response gene liaI in B. subtilis 1A980. The presence of a blue ring indicates the activation of liaI , resulting in production of LacZ.

This result may indicate that LP2006 does not target the cell wall, although further experiments are required to rule out the cell wall as a target. More LP2006 is required to test against the activation of the SOS response dinC gene using the dinC-lacZ reporter strain B. subtilis YB5018. Additionally, LP2006-resistance mutants would like prove highly useful in elucidating the target of LP2006.

Conclusions and future directions

The RiPPs are a diverse and underexplored class of peptides many of which have potent activity. A subclass of the RiPPs, the lasso peptides, are highly stable to heat and proteolysis owing to their eponymous structure and disulfide bonds. Many lasso peptides have antimicrobial activity, targeting RNA polymerase, the ClpC1 protease and lipid II with unique mechanisms. The targets of 8 lasso peptides have been characterized to date, and many more with antibacterial activity have uncharacterized targets. LP2006, produced by Nocardiopsis sp. HB141, is a structurally unique lasso peptide as the only class IV lasso peptide reported to date. It has antibacterial activity against Gram-positive bacteria including Bacillus anthracis , vancomycin-resistant Enterococcus faecium and Mycobacterium smegmatis . To investigate the activity of LP2006, the heterologous expression of the peptide was pursued. First, expression was attempted using an E. coli host strain, but with LP2006 remaining undetectable by LC-MS and the absence of comparable expression in the literature, a strategy using a Streptomyces host strain was pursued instead. LP2006 was successfully heterologously expressed in Streptomyces coelicolor M1146 as detected by mass spectrometry, but low yield precluded any further experiments with the heterologously expressed peptide. Additionally, an unexplained shift in the mass and retention time calls into question the structure and conformation of the heterologously expressed peptide. Ultimately, the LP2006 was purified from the native strain, Nocardiopsis sp. HB141, and tested for antimicrobial activity and the activation of the cell wall stress response gene liaI. LP2006 does not appear to activate liaI , unlike the lasso peptide siamycin-I. This suggests that LP2006 differs from siamycin-I in its antibacterial mechanism and considering its unique structure, may ultimately prove to have a mechanism unique from all other antibacterial lasso peptides.

Exploring the biology and chemistry of novel classes of antimicrobial compounds such as the lasso peptides is important in the current climate of escalating antibiotic resistance. Identifying

the target of LP2006 will expand our knowledge of both the lasso peptides and the ability of nature to produce chemically and functionally diverse molecules. In particular, the generation of LP2006-resistant mutants would likely provide insight into the mechanism of action of the peptide, at least revealing whether LP2006 shares a mechanism of action with the other antibacterial lasso peptides. LP2006 could be screened against a library such as the B. subtilis single gene deletion library to reveal LP2006-resistant and/or hypersensitive strains 138 . Dependent upon which genes confer resistance to LP2006 and which B. subtilis single gene deletion strains have altered susceptibility, molecular target inhibition assays could be performed to understand the nature of its activity. Ultimately, a crystal or NMR structure would reveal the precise interactions between LP2006 and its target. I believe this study has helped understand a promising and understudied group of antibiotics, the lasso peptides, which will enable their translation into therapeutic and industrial applications.

References

1. Newman, D. J. & Cragg, G. M. Natural Products as Sources of New Drugs from 1981 to 2014. J. Nat. Prod. 79 , 629–661 (2016). 2. Arnison, P. G. et al. Ribosomally synthesized and post-translationally modified peptide natural products: overview and recommendations for a universal nomenclature. Nat. Prod. Rep. 30 , 108–160 (2013). 3. Further Observations on an Inhibitory Substance (Nisin) From Lactic Streptococci. Lancet 250 , 5–8 (1947). 4. Highland, J. H. et al. Identification of a Ribosomal Protein Necessary for Thiostrepton Binding to Escherichia coli Ribosomes. J. Biol. Chem. 250 , 1141–1145 (1975). 5. Olivera, B. M. et al. Peptide neurotoxins from fish-hunting cone snails. Science 230 , 1338–1343 (1985). 6. Schmidtko, A., Lötsch, J., Freynhagen, R. & Geisslinger, G. Ziconotide for treatment of severe chronic pain. Lancet 375 , 1569–1577 (2010). 7. Tan, S., Moore, G. & Nodwell, J. Put a Bow on It: Knotted Antibiotics Take Center Stage. Antibiotics 8, 117 (2019). 8. Woodward, S. R., Cruz, L. J., Olivera, B. M. & Hillyard, D. R. Constant and hypervariable regions in conotoxin propeptides. EMBO J. 9, 1015–20 (1990). 9. Hensens, O. D. & Albers-Schönberg, G. Total structure of the peptide antibiotic components of thiopeptin by 1H and 13C NMR spectroscopy. Tetrahedron Lett. 19 , 3649–3652 (1978). 10. Wieland Brown, L. C., Acker, M. G., Clardy, J., Walsh, C. T. & Fischbach, M. A. Thirteen posttranslational modifications convert a 14-residue peptide into the antibiotic thiocillin. Proc. Natl. Acad. Sci. 106 , 2549–2553 (2009). 11. Kelly, W. L., Pan, L. & Li, C. Thiostrepton Biosynthesis: Prototype for a New Family of Bacteriocins. J. Am. Chem. Soc. 131 , 4327–4334 (2009). 12. SU, T. L. Micrococcin, an antibacterial substance formed by a strain of Micrococcus. Br. J. Exp. Pathol. 29 , 473–81 (1948). 13. Bagley, M., Dale, J., Merritt, E. & Xiong, X. Thiopeptide Antibiotics. Chem. Rev. 105 . 685-714 (2005). 14. Cromwell, G. L., Stahly, T. S., Speer, V. C. & O’Kelly, R. Efficacy of Nosiheptide as a

Growth Promotant for Growing-Finishing Swine-A Cooperative Study. J. Anim. Sci. 59 , 1125–1128 (1984). 15. Dennis, S. M., Nagaraja, T. G. & Dayton, A. D. Effect of lasalocid, monensin and thiopeptin on rumen protozoa. Res. Vet. Sci. 41 , 251–256 (1986). 16. Miyairi, N. et al. Thiopeptin, a new feed additive antibiotic: microbiological and chemical studies. Antimicrob. Agents Chemother. 1, 192–6 (1972). 17. Liao, R. et al. Thiopeptide biosynthesis featuring ribosomally synthesized precursor peptides and conserved posttranslational modifications. Chem. Biol. 16 , 141–7 (2009). 18. Morris, R. P. et al. Ribosomally Synthesized Thiopeptide Antibiotics Targeting Elongation Factor Tu. J. Am. Chem. Soc. 131 , 5946–5955 (2009). 19. Li, Y.-M. et al. From Peptide Precursors to Oxazole and Thiazole-Containing Peptide Antibiotics: Microcin B17 Synthase. Science (80-. ). 274 , 1188–1193 (1996). 20. Lee, S. W. et al. Discovery of a widely distributed toxin biosynthetic gene cluster. Proc. Natl. Acad. Sci. 105 , 5879–5884 (2008). 21. Dunbar, K. L., Melby, J. O. & Mitchell, D. A. YcaO domains use ATP to activate amide backbones during peptide cyclodehydrations. Nat. Chem. Biol. 8, 569–575 (2012). 22. Zhang, Z. et al. Biosynthetic Timing and Substrate Specificity for the Thiopeptide Thiomuracin. J. Am. Chem. Soc. 138 , 15511–15514 (2016). 23. Bycroft, B. W. & Gowland, M. S. The structures of the highly modified peptide antibiotics micrococcin P1 and P2. J. Chem. Soc. Chem. Commun. 6, 256-258 (1978). 24. Yu, Y. et al. Nosiheptide biosynthesis featuring a unique indole side ring formation on the characteristic thiopeptide framework. ACS Chem. Biol. 4, 855–64 (2009). 25. Zhang, Q. et al. Radical-mediated enzymatic carbon chain fragmentation-recombination. Nat. Chem. Biol. 7, 154–60 (2011). 26. Hudson, G. A., Zhang, Z., Tietz, J. I., Mitchell, D. A. & Donk, W. A. van der. In Vitro Biosynthesis of the Core Scaffold of the Thiopeptide Thiomuracin. J. Am. Chem. Soc. 137 , 16012 (2015). 27. Bower, J. et al. Structure-based design of agents targeting the bacterial ribosome. Bioorg. Med. Chem. Lett. 13 , 2455–2458 (2003). 28. Weisblum, B. & Demohn, V. Thiostrepton, an inhibitor of 5OS ribosome subunit function. J. Bacteriol. 101 , 1073–5 (1970).

29. Harms, J. M. et al. Translational Regulation via L11: Molecular Switches on the Ribosome Turned On and Off by Thiostrepton and Micrococcin. Mol. Cell 30 , 26–38 (2008). 30. Cundliffe, E. et al. Ribosomes in thiostrepton-resistant mutants of Bacillus megaterium lacking a single 50 S subunit protein. J. Mol. Biol. 132 , 235–252 (1979). 31. Cameron, D. M., Thompson, J., Gregory, S. T., March, P. E. & Dahlberg, A. E. Thiostrepton-resistant mutants of Thermus thermophilus. Nucleic Acids Res. 32 , 3220– 3227 (2004). 32. Porse, B. T., Leviev, I., Mankin, A. S. & Garrett, R. A. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre. J. Mol. Biol. 276 , 391–404 (1998). 33. Wienen, B. et al. Ribosomal protein alterations in thiostrepton- and Micrococcin-resistant mutants of Bacillus subtilis. J. Biol. Chem. 254 , 8031–41 (1979). 34. Hummel, H. & Böck, A. Thiostrepton resistance mutations in the gene for 23S ribosomal RNA of halobacteria. Biochimie 69 , 857–61 (1987). 35. Thompson, J., Schmidt, F. & Cundliffe, E. Site of action of a ribosomal RNA methylase conferring resistance to thiostrepton. J. Biol. Chem. 257 , 7915–7 (1982). 36. Zuurmond, A.-M. et al. GE2270A-resistant Mutations in Elongation Factor Tu Allow Productive Aminoacyl-tRNA Binding to EF-Tu·GTP·GE2270A Complexes. J. Mol. Biol. 304 , 995-1005 (2000). 37. Möhrle, V. G., Tieleman, L. N. & Kraal, B. Elongation Factor Tu1 of the Antibiotic GE2270A producer planobispora rosea has an unexpected resistance profile against EF-Tu targeted antibiotics. Biochemical And Biophysical Research Communications 230 , (1997). 38. Hashimoto, M. et al. An RNA polymerase inhibitor, cyclothiazomycin B1, and its isomer. Bioorg. Med. Chem. 14 , 8259–8270 (2006). 39. Hayashi, S. et al. Genome Mining Reveals a Minimum Gene Set for the Biosynthesis of 32-Membered Macrocyclic Thiopeptides Lactazoles. Chem. Biol. 21 , 679–688 (2014). 40. Rogers, L. A. The inhibiting effect of streptococcus lactis on lactobacillus bulgaricus. J. Bacteriol. 16 , 321–5 (1928). 41. Cleveland, J., Montville, T. J., Nes, I. F. & Chikindas, M. L. Bacteriocins: safe, natural antimicrobials for food preservation. Int. J. Food Microbiol. 71 , 1–20 (2001).

42. Cao, L. T., Wu, J. Q., Xie, F., Hu, S. H. & Mo, Y. Efficacy of Nisin in Treatment of Clinical Mastitis in Lactating Dairy Cows. J. Dairy Sci. 90 , 3980–3985 (2007). 43. Crowther, G. S. et al. Evaluation of NVB302 versus vancomycin activity in an in vitro human gut model of Clostridium difficile infection. J. Antimicrob. Chemother. 68 , 168– 176 (2013). 44. Knerr, P. J. & van der Donk, W. A. Discovery, Biosynthesis, and Engineering of Lantipeptides. Annu. Rev. Biochem. 81 , 479–505 (2012). 45. Kodani, S. et al. From The Cover: The SapB morphogen is a lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces coelicolor. Proc. Natl. Acad. Sci. 101 , 11448–11453 (2004). 46. Blin, K. et al. antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res. 47 , W81–W87 (2019). 47. Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2 – Approximately Maximum- Likelihood Trees for Large Alignments. PLoS One 5, e9490 (2010). 48. Letunic, I. & Bork, P. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. 47 , W256–W259 (2019). 49. Jung, G. Lantibiotics—Ribosomally Synthesized Biologically Active Polypeptides containing Sulfide Bridges and α,β‐Didehydroamino Acids. Angew. Chemie Int. Ed. English 30 , 1051–1068 (1991). 50. Pag, U. & Sahl, H.-G. Multiple Activities in Lantibiotics - Models for the Design of Novel Antibiotics? Curr. Pharm. Des. 8, 815–833 (2002). 51. Willey, J. M. & van der Donk, W. A. Lantibiotics: Peptides of Diverse Structure and Function. Annu. Rev. Microbiol. 61 , 477–501 (2007). 52. Ortega, M. A. & Van Der Donk, W. A. New Insights into the Biosynthetic Logic of Ribosomally Synthesized and Post-translationally Modified Peptide Natural Products. Cell Chem. Biol. 23 , 31–44 (2016). 53. Meindl, K. et al. Labyrinthopeptins: A New Class of Carbacyclic Lantibiotics. Angew. Chemie Int. Ed. 49 , 1151–1154 (2010). 54. Ortega, M. A. et al. Structure and mechanism of the tRNA-dependent lantibiotic dehydratase NisB. Nature 517 , 509–512 (2015). 55. Chatterjee, C. et al. Lacticin 481 Synthetase Phosphorylates its Substrate during

Lantibiotic Production. J. Am. Chem. Soc. 127 , 15332–15333 (2005). 56. Kupke, T., Kempter, C., Jung, G. & Gotz, F. Oxidative decarboxylation of peptides catalyzed by flavoprotein EpiD. Determination of substrate specificity using peptide libraries and neutral loss mass spectrometry. J. Biol. Chem. 270 , 11282–11289 (1995). 57. Ökesli, A., Cooper, L. E., Fogle, E. J. & van der Donk, W. A. Nine post-translational modifications during the biosynthesis of cinnamycin. J. Am. Chem. Soc. 133 , 13753–60 (2011). 58. Breukink, E. et al. Use of the cell wall precursor lipid II by a pore-forming peptide antibiotic. Science 286 , 2361–4 (1999). 59. Wiedemann, I. et al. Specific binding of nisin to the peptidoglycan precursor lipid II combines pore formation and inhibition of cell wall biosynthesis for potent antibiotic activity. J. Biol. Chem. 276 , 1772–9 (2001). 60. Hsu, S.-T. D. et al. The nisin–lipid II complex reveals a pyrophosphate cage that provides a blueprint for novel antibiotics. Nat. Struct. Mol. Biol. 11 , 963–967 (2004). 61. Hasper, H. E. et al. An Alternative Bactericidal Mechanism of Action for Lantibiotic Peptides That Target Lipid II. Science 313 , 1636–1637 (2006). 62. Brotz, H., Bierbaum, G., Reynolds, P. E. & Sahl, H.-G. The Lantibiotic Mersacidin Inhibits Peptidoglycan Biosynthesis at the Level of Transglycosylation. Eur. J. Biochem. 246 , 193–199 (1997). 63. Kodani, S., Lodato, M. A., Durrant, M. C., Picart, F. & Willey, J. M. SapT, a lanthionine- containing peptide involved in aerial hyphae formation in the streptomycetes. Mol. Microbiol. 58 , 1368–1380 (2005). 64. Wang, H. & van der Donk, W. A. Biosynthesis of the class III lantipeptide catenulipeptin. ACS Chem. Biol. 7, 1529–35 (2012). 65. Draper, L. A., Cotter, P. D., Hill, C. & Ross, R. P. Lantibiotic resistance. Microbiol. Mol. Biol. Rev. 79 , 171–91 (2015). 66. Hill, C., Draper, L., Ross, R. & Cotter, P. Lantibiotic Immunity. Curr. Protein Pept. Sci. 9, 39–49 (2008). 67. Mazzotta, A. S. & Montville, T. J. Nisin induces changes in membrane fatty acid composition of Listeria monocytogenes nisin-resistant strains at 10 degrees C and 30 degrees C. J. Appl. Microbiol. 82 , 32–8 (1997).

68. Verheul, A., Russell, N. J., Van’T Hof, R., Rombouts, F. M. & Abee, T. Modifications of membrane phospholipid composition in nisin-resistant Listeria monocytogenes Scott A. Appl. Environ. Microbiol. 63 , 3451–7 (1997). 69. Staubitz, P., Neumann, H., Schneider, T., Wiedemann, I. & Peschel, A. MprF-mediated biosynthesis of lysylphosphatidylglycerol, an important determinant in staphylococcal defensin resistance. FEMS Microbiol. Lett. 231 , 67–71 (2004). 70. Froseth, B. R. & McKay, L. L. Molecular characterization of the nisin resistance region of Lactococcus lactis subsp. lactis biovar diacetylactis DRC3. Appl. Environ. Microbiol. 57 , 804–11 (1991). 71. Sun, Z. et al. Novel Mechanism for Nisin Resistance via Proteolytic Degradation of Nisin by the Nisin Resistance Protein NSR. Antimicrob. Agents Chemother. 53 , 1964–1973 (2009). 72. Zimmermann, M., Hegemann, J. D., Xie, X. & Marahiel, M. A. Characterization of caulonodin lasso peptides revealed unprecedented N-terminal residues and a precursor motif essential for peptide maturation. Chem. Sci. 5, 4032–4043 (2014). 73. Salomón, R. A., Farías, R. N., Salomn, R. A. & Farias, R. N. Microcin 25, a novel antimicrobial peptide produced by Escherichia coli. J. Bacteriol. 174 , 7428–35 (1992). 74. Zimmermann, M., Hegemann, J. D., Xie, X. & Marahiel, M. A. The Astexin-1 Lasso Peptides: Biosynthesis, Stability, and Structural Studies. Cell Chem. Biol. 20 , 558–569 (2013). 75. Tietz, J. I. et al. A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nat. Chem. Biol. 13 , 470–478 (2017). 76. Duquesne, S. et al. Two Enzymes Catalyze the Maturation of a Lasso Peptide in Escherichia coli. Chem. Biol. 14 , 793–803 (2007). 77. Yan, K.-P. et al. Dissecting the Maturation Steps of the Lasso Peptide Microcin J25 in vitro. ChemBioChem 13 , 1046–1052 (2012). 78. DiCaprio, A. J., Firouzbakht, A., Hudson, G. A. & Mitchell, D. A. Enzymatic Reconstitution and Biosynthetic Investigation of the Lasso Peptide Fusilassin. J. Am. Chem. Soc. 141 , 290–297 (2019). 79. Burkhart, B. J., Hudson, G. A., Dunbar, K. L. & Mitchell, D. A. A prevalent peptide- binding domain guides ribosomal natural product biosynthesis. Nat. Chem. Biol. 11 , 564–

570 (2015). 80. Sumida, T., Dubiley, S., Wilcox, B., Severinov, K. & Tagami, S. Structural Basis of Leader Peptide Recognition in Lasso Peptide Biosynthesis Pathway. ACS Chem. Biol. 14 , 1619–1627 (2019). 81. Solbiati, J. O., Ciaccio, M., Farías, R. N. & Salomón, R. A. Genetic analysis of plasmid determinants for microcin J25 production and immunity. J. Bacteriol. 178 , 3661–3 (1996). 82. Zhu, S. et al. Insights into the Unique Phosphorylation of the Lasso Peptide Paeninodin. J. Biol. Chem. 291 , 13662–13678 (2016). 83. Zong, C., Cheung-Lee, W. L., Elashal, H. E., Raj, M. & Link, A. J. Albusnodin: An acetylated lasso peptide from: Streptomyces albus. Chem. Commun. 54 , 1339–1342 (2018). 84. Gavrish, E. et al. Lassomycin, a Ribosomally Synthesized Cyclic Peptide, Kills Mycobacterium tuberculosis by Targeting the ATP-Dependent Protease ClpC1P1P2. Chem. Biol. 21 , 509–518 (2014). 85. Pavlova, O., Mukhopadhyay, J., Sineva, E., Ebright, R. H. & Severinov, K. Systematic structure-activity analysis of microcin J25. J. Biol. Chem. 283 , 25589–25595 (2008). 86. Constantine, K. L. et al. High-resolution solution structure of siamycin II: Novel amphipathic character of a 21-residue peptide that inhibits HIV fusion. J. Biomol. NMR 5, 271–286 (1995). 87. Katahira, R., Shibata, K., Yamasaki, M., Matsuda, Y. & Yoshida, M. Solution structure of endothelin B receptor selective antagonist RES-701-1 determined by 1H NMR spectroscopy. Bioorg. Med. Chem. 3, 1273–1280 (1995). 88. Knappe, T. A., Linne, U., Xie, X. & Marahiel, M. A. The glucagon receptor antagonist BI-32169 constitutes a new class of lasso peptides. FEBS Lett. 584 , 785–789 (2010). 89. Um, S. et al. Sungsanpin, a lasso peptide from a deep-sea streptomycete. J. Nat. Prod. 76 , 873–879 (2013). 90. Daniel-Ivad, M. et al. An Engineered Allele of afsQ1 Facilitates the Discovery and Investigation of Cryptic Natural Products. ACS Chem. Biol. 12 , 628–634 (2017). 91. Tsunakawa, M. et al. Siamycins I and II, New Anti-HIV Peptides. I. Fermentation, Isolation, Biological Activity and Initial Characterization. J. Antibiot. (Tokyo). 48 , 433– 434 (1995).

92. Tan, S., Ludwig, K. C., Mueller, A., Schneider, T. & Nodwell, J. R. The Lasso Peptide Siamycin‐I Targets Lipid II at the Gram-Positive Cell Surface. ACS Chem. Biol. 14 , 966– 974 (2019). 93. Dubrac, S., Bisicchia, P., Devine, K. M. & Msadek, T. A matter of life and death: Cell wall homeostasis and the WalKR (YycGF) essential signal transduction pathway. Mol. Microbiol. 70 , 1307–1322 (2008). 94. Tiyanont, K. et al. Imaging peptidoglycan biosynthesis in Bacillus subtilis with fluorescent antibiotics. Proc. Natl. Acad. Sci. 103 , 11033–11038 (2006). 95. Lin, P. F. et al. Characterization of siamycin I, a human immunodeficiency virus fusion inhibitor. Antimicrob. Agents Chemother. 40 , 133–138 (1996). 96. Nakayama, J. et al. Siamycin Attenuates fsr Quorum Sensing Mediated by a Gelatinase Biosynthesis-Activating Pheromone in Enterococcus faecalis. J. Bacteriol. 189 , 1358– 1365 (2007). 97. Metelev, M. et al. Structure, Bioactivity, and Resistance Mechanism of Streptomonomicin, an Unusual Lasso Peptide from an Understudied Halophilic Actinomycete. Chem. Biol. 22 , 241–250 (2015). 98. Salomon, R. A. & Farias, R. N. The FhuA Protein Is Involved in Microcin 25 Uptake. J. Bacteriol. 175 , 7741–7742 (1993). 99. Salomon, R. A. & Farias, R. N. The Peptide Antibiotic Microcin 25 Is Imported through the TonB Pathway and the SbmA Protein. J. Bacteriol. 177 , 3323–3325 (1995). 100. Delgado, M. A. A. et al. Escherichia coli RNA polymerase is the target of the cyclopeptide antibiotic microcin J25. J. Bacteriol. 183 , 4543–50 (2001). 101. Yuzenkova, J. et al. Mutations of bacterial RNA polymerase leading to resistance to microcin j25. J. Biol. Chem. 277 , 50867–75 (2002). 102. Korzheva, N. et al. A structural model of transcription elongation. Science 289 , 619–25 (2000). 103. Adelman, K. et al. Molecular mechanism of transcription inhibition by peptide antibiotic Microcin J25. Mol. Cell 14 , 753–62 (2004). 104. Mukhopadhyay, J., Sineva, E., Knight, J., Levy, R. M. & Ebright, R. H. Antibacterial peptide microcin J25 inhibits transcription by binding within and obstructing the RNA polymerase secondary channel. Mol. Cell 14 , 739–51 (2004).

105. Braffman, N. R. et al. Structural mechanism of transcription inhibition by lasso peptides microcin J25 and capistruin. Proc. Natl. Acad. Sci. 116 , 1273–1278 (2019). 106. Blond, A. et al. The cyclic structure of microcin J25, a 21-residue peptide antibiotic from Escherichia coli. Eur. J. Biochem. 259 , 747–756 (2001). 107. Blond, A. et al. Solution structure of microcin J25, the single macrocyclic antimicrobial peptide from Escherichia coli . Eur. J. Biochem. 268 , 2124–2133 (2001). 108. Blond, A. et al. Thermolysin-linearized microcin J25 retains the structured core of the native macrocyclic peptide and displays antimicrobial activity. Eur. J. Biochem. 269 , 6212–6222 (2002). 109. Bayro, M. J. et al. Structure of antibacterial peptide microcin J25: A 21-residue lariat protoknot. J. Am. Chem. Soc. 125 , 12382–12383 (2003). 110. Knappe, T. A. et al. Isolation and Structural Characterization of Capistruin, a Lasso Peptide Predicted from the Genome Sequence of Burkholderia thailandensis E264. J. Am. Chem. Soc. 130 , 11446–11454 (2008). 111. Kuznedelov, K. et al. The Antibacterial Threaded-lasso Peptide Capistruin Inhibits Bacterial RNA Polymerase. J. Mol. Biol. 412 , 842–848 (2011). 112. Metelev, M. et al. Acinetodin and Klebsidin, RNA Polymerase Targeting Lasso Peptides Produced by Human Isolates of Acinetobacter gyllenbergii and Klebsiella pneumoniae. ACS Chem. Biol. 12 , 814–824 (2017). 113. Cheung-Lee, W. L., Parry, M. E., Cartagena, A. J., Darst, S. A. & James Link, A. Discovery and structure of the antimicrobial lasso peptide citrocin. J. Biol. Chem. 294 , 6822–6830 (2019). 114. Lear, S. et al. Total chemical synthesis of lassomycin and lassomycin-amide. Org. Biomol. Chem. 14 , 4534–4541 (2016). 115. Lee, H. & Suh, J.-W. Anti-tuberculosis lead molecules from natural products targeting Mycobacterium tuberculosis ClpC1. J Ind Microbiol Biotechnol 43 , 205–212 (2016). 116. Maksimov, M. O., Pelczer, I. & Link, A. J. Precursor-centric genome-mining approach for lasso peptide discovery. Proc. Natl. Acad. Sci. 109 , 15223–8 (2012). 117. Agrawal, P., Khater, S., Gupta, M., Sain, N. & Mohanty, D. RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Res. 45 , W80–W88 (2017).

118. van Heel, A. J. et al. BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Res. (2018). doi:10.1093/nar/gky383 119. Skinnider, M. A., Merwin, N. J., Johnston, C. W. & Magarvey, N. A. PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. Nucleic Acids Res. 45 , W49–W54 (2017). 120. Santos-Aberturas, J. et al. Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Res. 47 , 4624–4637 (2019). 121. Martin-Gómez, H., Linne, U., Albericio, F., Tulla-Puche, J. & Hegemann, J. D. Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli- Based Production System. J. Nat. Prod. 81 , 2050-2056 (2018). 122. Schneemann, I. et al. Comprehensive investigation of marine Actinobacteria associated with the sponge Halichondria panicea. Appl. Environ. Microbiol. 76 , 3702–14 (2010). 123. Komatsu, M. et al. Engineered Streptomyces avermitilis host for heterologous expression of biosynthetic gene cluster for secondary metabolites. ACS Synth. Biol. 2, 384–96 (2013). 124. Pablo Gomez-Escribano, J. & Bibb, M. J. Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. Microbial Biotechnology 4, 207-215 (2010). 125. Jani, C. et al. Streptomyces: a screening tool for bacterial cell division inhibitors. J. Biomol. Screen. 20 , 275–84 (2015). 126. Bibb, M. J., Janssen, G. R. & Ward, J. M. Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene 38 , 215–226 (1985). 127. Kieser T, Bibb MJ, Buttner MJ & Chater KF. Practical Streptomyces Genetics. 2nd ed. (2000). 128. Jensen, P. R., Williams, P. G., Oh, D.-C., Zeigler, L. & Fenical, W. Species-specific secondary metabolite production in marine actinomycetes of the genus Salinispora. Appl. Environ. Microbiol. 73 , 1146–52 (2007). 129. Koos, J. D. & Link, A. J. Heterologous and in Vitro Reconstitution of Fuscanodin, a Lasso Peptide from Thermobifida fusca. J. Am. Chem. Soc. 141 , 928–935 (2019). 130. Zhu, S. et al. The B1 Protein Guides the Biosynthesis of a Lasso Peptide. Sci. Rep. 6,

35604 (2016). 131. Rosano, G. L. & Ceccarelli, E. A. Recombinant protein expression in Escherichia coli: advances and challenges. Front. Microbiol. 5, 172 (2014). 132. Garg, N., Tang, W., Goto, Y., Nair, S. K. & van der Donk, W. A. Lantibiotics from Geobacillus thermodenitrificans. Proc. Natl. Acad. Sci. U. S. A. 109 , 5241–6 (2012). 133. Schmidt, E. W. et al. Patellamide A and C biosynthesis by a microcin-like pathway in Prochloron didemni, the cyanobacterial symbiont of Lissoclinum patella. Proc. Natl. Acad. Sci. U. S. A. 102 , 7315–20 (2005). 134. Shima, J., Hesketh, A., Okamoto, S., Kawamoto, S. & Ochi, K. Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). J. Bacteriol. 178 , 7276–7284 (1996). 135. Hu, H., Zhang, Q. & Ochi, K. Activation of antibiotic biosynthesis by specified mutations in the rpoB gene (encoding the RNA polymerase beta subunit) of Streptomyces lividans. J. Bacteriol. 184 , 3984–91 (2002). 136. Zaburannyi, N., Rabyk, M., Ostash, B., Fedorenko, V. & Luzhetskyy, A. Insights into naturally minimised Streptomyces albus J1074 genome. BMC Genomics 15 , 97 (2014). 137. Li, Y. et al. Characterization of Sviceucin from Streptomyces Provides Insight into Enzyme Exchangeability and Disulfide Bond Formation in Lasso Peptides. ACS Chem. Biol. 10 , 2641–2649 (2015). 138. Koo, B.-M. et al. Construction and Analysis of Two Genome-Scale Deletion Libraries for Bacillus subtilis. Cell Syst. 4, 291-305.e7 (2017). 139. Ling, L. L. et al. A new antibiotic kills pathogens without detectable resistance. Nature 517 , 455–459 (2015). 140. Feling, R. H. et al. Salinosporamide A: A Highly Cytotoxic Proteasome Inhibitor from a Novel Microbial Source, a Marine Bacterium of the New Genus Salinospora. Angew. Chemie Int. Ed. 42 , 355–357 (2003). 141. Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33 , 1870–1874 (2016). 142. Tanizawa, Y., Fujisawa, T. & Nakamura, Y. DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication. Bioinformatics 34 , 1037–1039 (2018).

143. Aziz, R. K. et al. The RAST Server: Rapid Annotations using Subsystems Technology. BMC Genomics 9, 75 (2008). 144. Kim, M., Oh, H.-S., Park, S.-C. & Chun, J. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int. J. Syst. Evol. Microbiol. 64 , 346–351 (2014). 145. Stewart, E. J. Growing unculturable bacteria. J. Bacteriol. 194 , 4151–60 (2012). 146. Ritchie, K. B. et al. Survey of Antibiotic-producing Bacteria Associated with the Epidermal Mucus Layers of Rays and Skates. Front. Microbiol. 8, 1050 (2017). 147. Gärdes, A. et al. Complete genome sequence of Marinobacter adhaerens type strain (HP15), a diatom-interacting marine microorganism. Stand. Genomic Sci. 3, 97–107 (2010). 148. Hollensteiner, J., Poehlein, A. & Daniel, R. Complete Genome Sequence of Marinobacter sp. Strain JH2, Isolated from Seawater of the Kiel Fjord. Microbiol. Resour. Announc. 8, (2019). 149. Martinez, J. S. & Butler, A. Marine amphiphilic siderophores: Marinobactin structure, uptake, and microbial partitioning. J. Inorg. Biochem. 101 , 1692–1698 (2007). 150. Robinson, S. L., Christenson, J. K. & Wackett, L. P. Biosynthesis and chemical diversity of β-lactone natural products. Nat. Prod. Rep. 36 , 458–475 (2019).

Appendix 1 Screen for novel bioactive natural products from marine bacteria Appendix 1 5.1 Introduction

The discovery of antibiotics has resulted in substantial improvements in the outcome of treatments for bacterial infections and has enabled certain medical procedures to occur. Natural products remain extremely relevant in the discovery and development of novel antibiotics, even in the years following the golden age of antibiotics (~1940-1960). In fact, over the past 35 years, roughly 60% of approved antibiotics are derivatives of natural products. 1

Due to the challenges such as high rediscovery rates of known compounds, interest in natural product screening is not what it once was. However, since bacterial chemotype roughly follows phylotype, in theory novel compounds can be discovered by screening uncharacterized environmental isolates, thereby reducing rates of rediscovery 128 . An excellent example of this is the discovery of the antibiotic teixobactin, which was discovered from the previously uncharacterized microbe, Eleftheria terrae , using a unique culturing method 139 . A second example of the discovery of novel natural products by studying uncharacterized microbes is the discovery of salinosporamide A from Salinispora tropica 140 . S. tropica is an obligate species of marine Actinobacteria, which produces the potent 20S proteasome inhibitor, salinosporamide A. These examples demonstrate that bacteria are capable of producing substantial chemical diversity, much of which has yet to be discovered. The aim of this project was to investigate the ability of marine bacteria to produce antibacterial metabolites and to identify and characterize novel antimicrobial compounds from the Nodwell Maritime Collection.

5.2 Methods

5.2.1 Bioactivity screen

5.2.1.1 Collection and Isolation of maritime strains

There are 42 strains that make up the Nodwell Maritime Collection (NMarC). These strains were isolated from marine sediments collected at 5 locations in the maritime provinces of Canada (Hopewell Rocks, New Brunswick; Brackley Beach, PEI; Cavendish Beach, PEI; Fisherman’s

Cove, NS; Crystal Crescent Beach, NS). Marine sediment samples were collected at a depth of 1- 2 metres by Dr. Sheila Elardo. Dr. Sheila Elardo isolated the marine strains by diluting the sediment samples with sterile artificial seawater and plating them on four types of media: M1, M2, ISP2 and M2216 medium, each supplemented with 25% artificial seawater (5.2.1.2). The cultures were incubated at 30°C for up to 12 weeks and individual colonies were picked and re- streaked on the four different media types.

5.2.1.2 Culture conditions

The growth of all maritime strains was tested on four agar media types: M1 medium (per L: 10g soluble starch, 4g yeast extract, 2g peptone, 16g agar), M2 medium (per L: 6mL glycerol, 1g arginine, 1g K 2HPO 4, 0.5g MgSO 4, 16g agar), ISP2 medium (per L: 4g yeast extract, 10g malt extract, 4g dextrose, 16g agar), and Difco Marine Agar 2216 medium (per L: 55.1g Difco Marine Agar 2216), all of which were dissolved in artificial seawater (per L: 23.477 g NaCl, 10.64 g MgCl2 hexahydrate, 3.917 g Na2SO4, 1.102 g CaCl2, 0.664 g KCl, 0.192 g NaHCO3, 0.096 g KBr, 0.026 g H3BO3, 0.024 g SrCl2, 0.03 g NaF) with the exception of M2216 medium which was dissolved in Milli-Q water. For metabolite extraction and bioactivity testing, all maritime strains were grown for 5 days at 30°C prior to methanol extraction.

The test strains of M. luteus , B. subtilis JH642, E. coli BW25113 and E. coli BW25113 ∆tolC ∆bamB were grown in LB medium (per L Milli-Q water: 10g tryptone, 10g NaCl, 5g yeast extract) at 37°C, while S. cerevisiae Y7092 was grown in YPD medium (per L Milli-Q water: 10g Yeast extract, 20g Peptone, 20g Dextrose). 16 g of agar per 1L of medium was used to make solid media for disk diffusion assays.

5.2.1.3 Broth microtiter dilution and disk diffusion assay

To perform the disk diffusion assay, the procedure indicated above was followed until the subculture reached an OD of 0.4-0.6, at which point the culture was diluted 1:1000 in fresh media. 100 μL of the diluted culture was spread across an agar plate of LB medium using sterile glass beads. The plate was dried for 5 minutes and a maximum of five paper filter disks were distributed across the plate. 2-10 μL of resuspended crude extracts were added to the filter disks and plates were placed overnight in the incubator at 30°C (for S. cerevisiae ) or at 37°C for (all other organisms). After overnight incubation, the plates were imaged and the zone of inhibition was measured.

5.2.2 Isolation of the Marinobacter sp. N33 bioactive metabolite(s)

5.2.2.1 Metabolite extraction

Metabolites were extracted from agar or liquid cultures with HPLC-grade methanol, using a volume of methanol equivalent to the volume of the culture or 200-300 mL, whichever is less. Samples were sonicated for 15 minutes and macerated overnight. In the morning, extracts were dried using a Genevac EZ-2 Elite series evaporator (SP scientific) or a Hei-VAP Precision Rotary Evaporator (Heidolph).

5.2.2.2 Flash chromatography and HPLC purification

Individual and pooled bioactive flash chromatography fractions were purified on a Waters Alliance HPLC with a Phenomonex Luna C18 column (100 Å, 5 μm, 4.6x250mm). The following 30-minute linear solvent gradient of water/0.1% formic acid (solvent A) and acetonitrile/0.1% formic acid was used: hold at 5% B for 2 minutes, followed by linear increase until 95% B at 20 minutes, hold at 95% B until 25 minutes, then return to 5% B until 30 minutes. The collected peak fractions were dried by Genevac evaporator and tested for bioactivity.

5.2.3 Genomic studies 5.2.3.1 Genomic DNA extraction

For taxonomic identification, genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). For genomic DNA extraction, each strain was grown in an overnight 5mL liquid culture using the medium from which the strain was first originally isolated. Following the overnight incubation, the cells were harvested, lysed and the genomic DNA was purified according to the DNeasy Blood and Tissue Kit protocol for DNA extraction from Gram-positive bacteria.

For Pacific Biosciences sequencing of Marinobacter sp. N33, genomic DNA was extracted using the Genomic-tip 20/G Kit (Qiagen). 10mL liquid overnight cultures of Difco Marine Agar 2216 medium (5.2.1.2) were used for genomic DNA extraction. Following the overnight liquid culture incubation, the cells were harvested and the DNA was extracted and purified according to the Genomic-tip 20/G protocol for the extraction of DNA from Gram-negative bacteria. In order to minimize DNA shearing, the sample was handled with care, the DNA vortexing steps were skipped, and only wide-bore pipette tips were used. The genomic DNA was resuspended to a concentration of in 10 mM Tris·Cl, pH 8.5 and was shipped on ice to Genome Quebec where the sample was sequenced using a Pacific Biosciences RSII SMRT sequencer.

5.2.3.2 Phylogenetic analysis

Using the extracted genomic DNA, the 16S rRNA gene of each member of the maritime strain collection was amplified by PCR using 27F and 1492R universal primers. The amplified sequence was cloned into the pGEM-T Easy vector (Promega) and transformed in E. coli TOP10 for plasmid propagation. Plasmids were harvested and purified using the QIAprep Spin Miniprep

Kit (Qiagen) and were sequenced by Sanger sequencing. The 16S rRNA gene sequences were then aligned using the ClustalW multiple sequence alignment. Phylogenetic trees were constructed by maximum likelihood method using the MEGA 7 program 141 .

5.2.3.3 Whole genome sequencing of Marinobacter sp. N33

Whole genome sequencing of Marinobacter sp. N33 was performed using the long-read sequencing technology PacBio SMRT sequencing using the RSII sequencer with one SMRT cell. The Marinobacter sp. N33 genome was assembled by Genome Quebec using the Hierarchical Genome Assembly Process 2.2.0 . Genome annotation was performed using two annotation pipelines: DDBJ Fast Annotation and Submission Tool (DFAST) and Rapid Annotation using Subsystem Technology (RAST) 142,143 .

5.3 Results and discussion

5.3.1 Screen of marine bacteria 5.3.1.1 Phylogenetic analysis

Phylogenetic analysis was used a means to prioritize strains for further study for the discovery of novel antibacterial metabolites. As Actinomycetes tend to be more prolific producers of secondary metabolites, and bacterial chemotype tends to follow phylotype, I reasoned that studying rare Actinomycetes would result in a higher discovery rate of novel antibacterial metabolites 128 . Thus, the taxonomic identity of each Nodwell Maritime Collection strain was determined using the PCR-amplified 16S gene sequences of each strain (Table 5.1). BLAST was used to determine the top-hit taxon and strain, and the percent similarity of the 16S gene to that of the top-hit taxon was recorded. The phylogenetic identity of fungal strains was not pursued.

Considering that 98.65% 16S similarity is commonly used as the cutoff for the definition of a new species, among the Maritime Collection there were several strains in the collection that may be potential novel species 144 . Of note, N31 had a 16S percent similarity of 96.2% to the top-hit taxon of Pontibacter ummariensis , indicating that this strain is almost certainly a novel taxon. Several other strains had 16S percent similarity values very close to the cut off and therefore further chemical characterization is required to determine if the strain is a novel species.

Table 5.1. Identity and characteristics of maritime strains

NMarC Sediment Source Top-hit taxon name Top-hit strain % Identity 1 Brackley Beach, PEI Erythrobacter seohaensis SW-135(T) 100 2 Brackley Beach, PEI Celeribacter halophilus ZXM137(T) 99.93 3 Brackley Beach, PEI Streptomyces coelescens DSM 40421(T) 99.86 4 Brackley Beach, PEI Bacillus algicola KMM 3737(T) 99.66 5 Fisherman's Cove, NS Paracoccus seriniphilus DSM 14827(T) 98.05 6 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.86 7 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.93 8 Fisherman's Cove, NS Sphingomonas paucimobilis NBRC 13935(T) 99.79 9 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.86 10 Fisherman's Cove, NS Bacillus hwajinpoensis SW-72(T) 99.46 11 Fisherman's Cove, NS Cobetia marina DSM 4741(T) 99.93 12 Fisherman's Cove, NS Streptomyces gancidicus NBRC 15412(T) 99.86 13 Fisherman's Cove, NS Cobetia marina DSM 4741(T) 99.93 Crystal Crescent Beach, 14 Streptomyces coelescens DSM 40421(T) 99.65 NS Crystal Crescent Beach, 15 Bacillus tequilensis KCTC 13622(T) 99.73 NS 16 Hopewell Rocks, NB Pseudoalteromonas rubra ATCC 29570(T) 98.66 17 Hopewell Rocks, NB Bacillus algicola KMM 3737(T) 100 18 Hopewell Rocks, NB Pseudoalteromonas rubra ATCC 29570(T) 98.73 19 Hopewell Rocks, NB Streptomyces venezuelae ATCC 10712(T) 99.65 20 Hopewell Rocks, NB Fungal 21 Hopewell Rocks, NB Altererythrobacter sp. * 22 Hopewell Rocks, NB Bacillus zhangzhouensis DW5-4(T) 99.66 23 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.86 24 Cavendish Beach, PEI Pseudoalteromonas rubra ATCC 29570(T) 98.8 25 Cavendish Beach, PEI Kribbella hippodromi S1.4(T) 98.78 26 Cavendish Beach, PEI Streptomyces venezuelae ATCC 10712(T) 99.93 NRRL B- 27 Cavendish Beach, PEI Streptomyces gibsonii 99.72 1335(T) 28 Cavendish Beach, PEI Microbacterium aquimaris JS54-2(T) 99.79 ATCC BAA- 29 Hopewell Rocks, NB Altererythrobacter ishigakiensis 98.72 2084(T) 30 Brackley Beach, PEI Streptomyces gancidicus NBRC 15412(T) 99.58 31 Brackley Beach, PEI Pontibacter ummariensis NKM1(T) 96.19

ATCC 32 Fisherman's Cove, NS Streptomyces venezuelae 99.72 10712(T) 33 Fisherman's Cove, NS Marinobacter litoralis SW-45(T) 99.86 34 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.93 35 Cavendish Beach, PEI Bacillus mesophilus SA4(T) 98.15 36 Cavendish Beach, PEI Streptomyces venezuelae ATCC 10712(T) 99.72 37 Brackley Beach, PEI Labrenzia alba CECT 5094(T) 98.93 Crystal Crescent Beach, 38 Fungal NS 39 Hopewell Rocks, NB Vibrio diabolicus HE800(T) 99.54 Crystal Crescent Beach, 40 Bacillus tequilensis KCTC 13622(T) 99.86 NS 41 Brackley Beach, PEI Fungal 42 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.93

*Incomplete coverage of 16S rRNA gene sequence

To understand the composition of the Nodwell Maritime Collection, a phylogenetic tree was constructed using the 16S rRNA gene sequences ( Figure 5.1). Most NMarC strains were found to be Actinobacteria or Proteobacteria (17 and 13 strains out of 42, respectively). This bias towards Actinobacteria or Proteobacteria is likely reflective of the fact that many bacterial taxa are unculturable or very difficult to culture under standard laboratory conditions which may lack specific growth factors required for growth 145 .

Many of the strains were very closely related strains from the Streptomyces , which are not easily differentiated based solely on the 16S rRNA gene sequence. Differentiation between strains of Streptomyces often requires multi-locus sequence typing to provide sufficient resolution.

Figure 5.1. Phylogenetic tree of Nodwell Maritime Collection strains. 69

5.3.1.2 Bioactivity screening

The extracts of each Maritime strain, cultured on a four different media types, were screened for antimicrobial activity against M. luteus , B. subtilis , E. coli and S. cerevisiae (Figure 5.3). This screen was performed with the help of 5 other students: Jan Falguera, Jethro Prinston, Victoria Riccio, Bilyana Ivanova and Brian Hicks. Nearly 500 conditions were screened, with each condition representing a different NMarC strain, culture condition, or test strain. Conditions that were considered hits were those that had OD values 50% lower than the culture controls. The majority of conditions tested resulted in less than 50% increase or reduction in OD values with respect to the controls ( Figure 5.3). Some extracts appear to have enhanced growth of the test organism, perhaps providing additional nutrients for growth. Many of the extracts that improved growth of the test organism were tested against S. cerevisiae , suggesting that no antifungal compounds were present in those extracts. In total, there were 69 hits among the conditions screened, many of which were against M. luteus or B. subtilis .

Figure 5.2. Screen of Nodwell Maritime Collection strains. Hit conditions, highlighted in blue, are those with Y values lower than -1, indicating a 50% reduction in optical density with respect to the culture control.

Figure 5.3. Distribution of growth inhibition values.

When the hits are analyzed based on phylotype of the NMarC organism, as expected, most of the hits are from actinobacterial extracts (Figure 5.4). There was one reproducible hit from a non- actinobacterial strain: strain N33, for which the top-hit taxon is Marinobacter litoralis (Table 5.1). Marinobacter sp. N33 had antibacterial activity against M. luteus and B. subtilis when grown on either ISP2 medium or M1 medium. Although some species of Marinobacter are reported to have antibacterial activity, no antibacterial metabolites have thus far been isolated from a Marinobacter species 146 . Therefore, I chose to purify and characterize the metabolite(s) produced by Marinobacter sp. N33 that are responsible for the antibacterial activity of the strain, in hopes that the metabolite(s) have not yet been reported.

Figure 5.4. Phylogenetic tree and antibacterial activity of Nodwell Maritime Collection strains tested against B. subtilis. A 50% reduction of OD is considered a hit, depicted in red. Extracts were also tested against M. luteus , E. coli , and S. cerevisiae (data included in Figure 5.2 and Figure 5.3).

5.3.2 Marinobacter sp. N33 extract testing

5.3.2.1 Bioactivity testing

The Marinobacter sp. N33 extracts was retested for antibacterial activity against B. subtilis and M. luteus by disk diffusion assay (Figure 5.5). The antibacterial activity of Marinobacter sp. N33 is substantially more pronounced when the organism is grown on ISP2 medium compared to M1 medium. The extract also had antibacterial activity against M. luteus but not against E. coli , consistent with the findings of the screen by broth microtiter dilution assay (5.3.2.1).

N33 Extract N33 Extract DMSO ISP2 Media M1 Media Neg Control

Figure 5.5. Disk diffusion assay of Marinobacter sp. N33 crude extract using B. subtilis JH642. The extract of Marinobacter sp. N33 grown on ISP2 medium has a larger zone of inhibition than when grown on M1 medium.

5.3.2.2 Genome sequencing and genome mining

To investigate the antibacterial activity of Marinobacter sp. N33, the genome was sequenced using Pacific Biosciences Single-Molecule Real-Time sequencing (SMRT). SMRT sequencing was chosen because this sequencing technology produces long reads which facilitates the assembly of a complete genome. Since secondary metabolite gene clusters can be large or contain repetitive DNA sequences, long-read sequencing aid the complete and accurate assembly of gene clusters for secondary metabolite biosynthesis.

The Marinobacter sp. N33 DNA reads were assembled into a single 3.4 Mbp contig of 54% GC content with an average read length of 12,600 bases and 204X coverage. The contig had overlapping ends, resulting in a closed circular genome, which is in accordance with the genomes of other species of Marinobacter 147,148 (Figure 5.6). Although other contigs were assembled from the sequence reads, it is likely that these remaining contigs are due to minor DNA contamination as the read coverage was low and the contigs had low sequence similarity to Marinobacter sequences. As a result, no plasmids were identified from the Pacific Biosciences sequencing run.

Figure 5.6. Circular representation of the Marinobacter sp. N33 genome. The circular tracks from the outside inward are: Tracks 1 and 2 depict protein-coding genes on the forward and reverse sequences, respectively; Track 3 depicts tRNA genes; Track 4 depicts rRNA genes; Track 5 depicts GC content; Track 6 depicts GC skew [(G−C)/(G+C)].

The results from genome annotation using the RAST program were in highly similar to those obtained using DFAST. Overall, the DFAST annotation program predicted 3184 genes, with a mean length of 981 bp, similar to the genome statistics of close relatives ( Table 5.2).

Table 5.2. Comparison of Marinobacter sp. N33 genome statistics to close relatives.

Marinobacter sp . N33 M. excellens HL-55 M. vinifirmus FB1

Length (Mbp) 3.4 4.0 3.8

GC Content (%) 54.1 56.3 58.0

# Genes 3184 3670 3522 Mean Gene Length 981 995 986 (bp) BGCs 2 1 1 (AntiSMASH)

To investigate the ability of Marinobacter sp. N33 to produce antibacterial secondary metabolites, I analyzed the complete genome sequence using several genome mining tools for secondary metabolite detection (). Using AntiSMASH 4.0 and PRISM, only two secondary metabolite gene clusters were identified in the Marinobacter sp. N33 genome: the gene cluster for the synthesis of ectoine, an osmoprotectant and the cluster for the synthesis of a siderophore, likely a marinobactin, a class of siderophores isolated from members of the Marinobacter genus 149 . Neither ectoine nor a siderophore are expected to have antibacterial activity, suggesting that AntiSMASH 4.0 and PRISM were not detecting the gene cluster of the antibacterial metabolite. Recently, AntiSMASH 5.0 has been released and is able to detect more secondary metabolite gene clusters 46 . Analyzing the Marinobacter sp. N33 genome sequence by AntiSMASH 5.0 reveals the presence of two additional biosynthetic gene clusters not detected by AntiSMASH 4.0. Both of these predicted clusters belong to the beta-lactones, a diverse class of natural products which includes members with antibacterial activity 150 . It is possible that the antibacterial metabolite(s) produced by Marinobacter sp. N33 are beta-lactones and went undetected due to the detection limits of AntiSMASH 4.0. This would also explain the difficulty in purifying the active metabolite(s) using formic acid (5.3.2.3), as beta-lactones are highly prone to acid hydrolysis and thermal degradation 150 .

5.3.2.3 Bioactivity guided fractionation and purification

Unable to initially glean any information about the class of antibacterial secondary metabolite from genome mining tools, I focused on purification and characterization of the bioactive

metabolite. Following initial preparative purification by flash chromatography, the bioactivity of each collected fraction was assessed and the bioactive fractions 17, 18 and 19 were further purified via HPLC ( Figure 5.7). Several peaks were collected from each HPLC run, although none of the collected peaks had antibacterial activity. This may be because the antibacterial metabolite is unstable at high temperatures or in the presence of acid (which was added to each solvent during the HPLC purification but not during the flash chromatography purification).

Figure 5.7. UV chromatogram of the purification of fraction 19 from flash chromatography by HPLC. The baseline drift is due to the percent composition of acetonitrile increasing over the course of the run. The displayed UV wavelength is 220nm.

Explicit copyright permission is not required for reproduction of the following articles in this thesis:

Tan, S., Moore, G. & Nodwell, J. Put a Bow on It: Knotted Antibiotics Take Center Stage. Antibiotics 8, 117 (2019).