Analysis of the Role of Rhodobacter Sphaeroides Crpo in Tolerance to Nacl

Home , Rhodobacter, Rhodobacter sphaeroides

Analysis of the Role of Rhodobacter sphaeroides CrpO in Tolerance to NaCl

Susana Retamal

A Thesis Submitted to the Graduate College of Bowling Green State University in Partial Fulfillment of the Requirements for the Degree of

MASTER OF SCIENCE

Committee:

Jill Zeilstra-Ryalls, Advisor

Raymond Larsen

Scott Rogers

ABSTRACT

Jill Zeilstra-Ryalls, Advisor

For organisms such as Rhodobacter sphaeroides osmoadaptation is essential to survival, since it encounters changes in salinity in its natural habitat of brackish waters. Because it is metabolically versatile, it serves as a useful model in examining how regulatory features of osmoadaptation are integrated into the regulatory circuits that provide the cell with the means to switch from one metabolic option to another. Known components of osmoadaptation in R. sphaeroides include the transport or synthesis of compatible compounds and alterations in fatty acid and phospholipid composition of the cell membrane. However, the transcriptional regulation of the genes associated with these adaptations has not been unraveled. The R. sphaeroides crpO gene has been found to increase NaCl tolerance when present in multicopy.

Towards evaluating the role of crpO in NaCl tolerance, strains with different levels of functional

CrpO protein were constructed and characterized with respect to each component of osmoadaptation. The main findings are (1) crpO is an essential gene, (2) improved NaCl tolerance by increasing crpO gene dosage is not due to altered compatible solute synthesis or transport; rather (3) fatty acid and phospholipid, especially cardiolipin, composition and quantity are altered in cells with multiple copies of crpO. The importance of this work is its contribution towards understanding the regulatory events associated with osmoadaptation in an organism that is capable of many different energy metabolisms including both aerobic and anaerobic respirations and also anoxygenic photosynthesis. Improved knowledge of how this happens in R. sphaeroides has the potential to increase our understanding for other organisms having the same individual and combined metabolic capabilities. ii

ACKNOWLEDGMENTS

I would like to extend a heartfelt thank you to my advisor, Dr. Jill Zeilstra-Ryalls, for all your encouragement and for the opportunity to work in your laboratory. Your guidance was extremely important throughout this masters program; it enabled me to think for myself and truly learn about and appreciate every aspect of molecular research.

My committee members, Dr. Scott Rogers and Dr. Ray Larsen were both wonderful and inspiring in classes and seminars. I am grateful for your help, suggestions and ideas. Dr. Rogers has taught me how to read a scientific paper with a scientist's eye. Dr. Larsen made our summer seminar very interactive and interesting; you always made time to answer questions and shared chemicals and enzymes that I needed.

I would like to thank my husband, Henry and son, Ian for their love and support and especially for being so understanding about this period of my life. To my parents, my Mom for coming all the way from Brazil to help me with my son so I could study and work on my thesis and to my deceased Dad, who as a Biologist inspired me to pursue science and research. A special thanks to Dr. Marcia Salazar-Valentine for helping me through the admission’s process and to my great friend, Gesiel Fisch who was incredibly helpful during hard times. To my friend

Dr. Marcela d’ Alincourt Salazar for being available for advise, coffee, dinner, and so many qPCR-related questions.

To my dear former laboratory colleague and now one of my closest friends, Yana

Fedotova, for being there for me in so many ways. To Dr. Maneewan "Joy" Suwansaard, who from the very first day helped me find my way around the lab and finished running so many of my gels while I was in class. To everyone else in the lab, thank you! iii

TABLE OF CONTENTS

Page

ABSTRACT.………………………………………………………………………………. i

ACKNOWLEDGEMENTS.……………………………………………………...………... ii

LIST OF FIGURES/TABLES.…………………………………………………………….. vi

LIST OF ABBREVIATIONS.…………………………………………………………...... viii

CHAPTER I: Background information and specific aims………………………………... 1

Introduction……………………………………………………………………………. 1

A. Bacterial osmoregulation……………………..……...... 1

B. Rhodobacter sphaeroides.………………………...……………………...... 2

C. Salt tolerance in Rhodobacter sphaeroides……………….……………………. 3

D. Rsp1275………………………………...... …………………………………….. 8

Specific Aims………………………………………………………………………….. 11

CHAPTER II: Analysis of the relationship between NaCl tolerance and the intracellular concentration of active CrpO .…………………………………….…………….………… 12

Introduction…………………………………………………………………………..... 12

Materials and Methods……………………………………………………………….... 13

Bacterial strains and plasmids and growth conditions..…………………………...... 13

Measurement of culture densities………………………..………………………….. 13

DNA treatment and manipulations...... 14

Construction of a vector for engineering a crpO null mutant strain………………… 14 iv

Construction of plasmid pCrpO'-BBR.………………………………….………...... 14

Transformations and conjugations…………………...... 15

Results……………………………………………………………………………...... 17

The crpO gene may be essential….……………………………………………….… 17

Construction of a CrpO "knock down" strain……………………………..………… 18

CrpO-mediated NaCl tolerance does not work through altering compatible solute

synthesis or transport.………………………………..……………………………… 20

Is the CrpO-mediated increase in NaCl tolerance specific to photoheterotrophic

growth?...... 23

Does CrpO improve tolerance to other osmotic stressors?...... 25

Discussion...... 25

CHAPTER III: NaCl-mediated changes in membrane lipid composition and the role of CrpO...... ………………………………………….…………………………... 27

Introduction……………………………………………………………………….……. 27

Materials and Methods……………………………………………………………….... 29

Bacterial and plasmids strains and growth conditions………..…………….………. 29

Extraction of polar lipids...………………………………………………….……..... 29

Thin layer chromatography (TLC) analysis...……………………………….…….... 30

Mass Spectrometry…...... ……………………………………………...….……...... 30

Chemical determination of polar phospholipid concentrations...……...……………. 30

Results………………………………………………………………………….……… 31

Are NaCl-induced changes in polar phospholipid composition of the membrane 31 v

due to changes in enzyme levels or activity?…………………...…………………...

Does CrpO affect polar phospholipid composition of the membrane?...... …………. 33

Total membrane phospholipid concentrations correlate with crpO copy number.…. 35

Identification………………………………………………………………………... 37

Discussion……………………………………………………………………………... 43

CHAPTER IV: Investigation by quantitative PCR of putative crpO-regulated genes?...... 44

Introduction…………………………………………………………………………..... 44

Materials and Methods……………………………………………………….…...... 45

Bacterial strains and plasmids and growth conditions………..………………….…. 45

RNA isolations and quantitative PCR (qPCR)………...... 46

Results……………………………………………………………………….……….... 47

Evaluation of the effect of NaCl on transcription of rpoZ, the standard internal

control gene for R. sphaeroides 2.41 qPCR studies….……………....………..…..... 47

Investigation of other genes for their suitability as housekeeping

genes………………………………………………………………………………… 48

qPCR-based assessment of the effect of NaCl and crpO copy number on rsp2508-

11 transcription.………………………………………………………………...... 50

Are the rsp2508-11 transcript levels highly variable in cells?…….…..….………… 50

Discussion……………………………………………………….…...... 53

CHAPTER V: Summary and future perspectives…………….….……………………….. 55

REFERENCES……………………………………………………………….…………..... 57 vi

LIST OF FIGURES AND TABLES

Figure/Table Page

Figure 1. Growth of photosynthetic cultures of R. sphaeroides 2.4.1 in the presence and absence of added NaCl and having either the empty vector pRK415 or plasmid p1275-RK with the rsp1275 gene…………………………………….. 8

Figure 2. Models of the R. sphaeroides Fnr-Crp and E. coli Fnr proteins, and known structure of Crp….…..….....…………..….....…………..….....……..…...... 10

Figure 3. Schematic diagram of the construction of the crpO knock-out vector pSR2…………………………………………………...... 18

Figure 4. Schematic diagram of plasmid pCrpO'-BBR…..……………………………… 19

Figure 5. Photoheterotrophic growth of R. sphaeroides 2.4.1 with the plasmids, and with the additions of NaCl, indicated………………………………………….. 23

Figure 6. Chemoheterotrophic growth of R. sphaeroides 2.4.1 with the plasmids indicated, in 0% and 3% added NaCl………………….………………………. 24

Figure 7. Photoheterotrophic growth of R. sphaeroides 2.4.1 with the plasmids indicated in the presence of 3% added KCl…………...... 25

Figure 8. Proposed phosphatidylglycerol lipids biosynthetic pathway of R. sphaeroides……………………………………………………………………. 28

Figure 9. TLC of phospholipids extracted from equivalent numbers of photoheterotrophically grown R. sphaeroides 2.4.1 that were incubated with or without added NaCl…………..…..………………………………………… 36

Figure 10. Relative concentrations of total phospholipids extracted from equivalent numbers of R. sphaeroides 2.4.1 cells with either plasmid pCrpO-BBR or the plasmid vector pBBR1-MCS2...………...... 37 vii

Figure 11. Electron spray (negative) ionization mass spectrometry of total phospholipids extracted from photroheterotrophically grown cells…………………………... 39

Figure 12. Relative levels of rpoZ transcript measured using qPCR and normalized to

rsp1366 Ct values.……………………………………………………………... 49

Figure 13. Relative levels of rsp2508-11 transcript measured using qPCR and

normalized to rsp1366 Ct values………………………………………………. 50

Figure 14. Melting curve of the qPCR products generated using the primers indicated….. 51

Figure 15. cDNA concentration versus Ct value measured for the qPCR of rsp1366 using the primers listed in Table 7.………….……………………………………….. 52

Table 1. Transcriptional response of typical osmotic stress genes in R. sphaeroides...... 5

Table 2. Bacterial strains and plasmids…...... ……………………....…………………... 16

Table 3. The ratios of phospholipids present in resting cells from photoheterotrophic cultures of R. sphaeroides 2.4.1 following incubation without or with 0.8 M NaCl….…….……………....…...…………………………………………….... 33

Table 4. The CL:PC ratios in photoheterotrophically grown cells of R. sphaeroides 2.4.1 following a 45 min incubation without or with the addition of NaCl.……………....…………………....………………...……………………. 34

Table 5. The CL:PC ratios in photoheterotrophically grown cells of R. sphaeroides 2.4.1 following a 45 min incubation without or with the addition of sucrose.……………………………………...... 35

Table 6. Relative concentrations of selected phospholipids and the free fatty acids…………………………………………………………………………..... 42

Table 7. Primer sequences and amplification product used for qRT-PCR……………… 47

viii

LIST OF ABBREVIATIONS

ATP adenosine triphosphate bp base pair

CrpK Crp type transcription factor, K acknowledges Samuel Kaplan’s contributions

CrpO Crp type transcription factor associated with the osmotic stressor NaCl

CM cytoplasmic membrane

CL cardiolipin

FnrL fumarate-nitrate reductase regulator-type protein L g gravitational force

Kn kanamycin

µl microliter mM millimolar

PC phosphatidylcholine

PE phosphatidylethanolamine

PG phosphatidylglycerol

PS photosynthesis qPCR quantitative polymerase chain reaction ix

RC reaction center

Rif rifampicin

Sp spectinomycin

St streptomycin

Tp trimethoprim 1

Chapter 1: Background information and specific aims

Introduction

A – BACTERIAL OSMOREGULATION

Bacterial cells can adapt to growth under many different environmental conditions, including osmotic stress conditions that are often encountered when extracellular levels of compounds that are not diffusible through the membrane increase (21, 32). The most well- understood mechanisms by which bacteria relieve osmotic stress are by (i) net movement of ions, often potassium ions, which is typically accompanied by altered metabolism of compounds such as glutamate to serve as counterions and (ii) transport or synthesis of compatible solutes, which are substances that must be compatible with the cell's metabolic activities (1, 37). In addition to these processes that are directed towards re-establishing osmotic balance, bacteria have been shown to cope with osmotic stress through strategies that directly meet the challenges imposed by the stress. The best characterized strategy is that of altering the lipid composition of the membrane. This involves a change in fatty acid composition, in which they generally become less saturated, and also an increase in the concentrations of anionic lipids such as phosphatidylglycerol (PG) and especially cardiolipin (CL) (20). Both of these kinds of alterations have been observed in species of both Gram positive and Gram negative bacteria.

The net result is that the viscosity of the membrane is increased, and it is thought that this helps to maintain the integrity of the membrane against the change in turgor pressure. It is also thought to help protect and preserve the ability of proteins to function, especially membrane- localized proteins (1, 55).

Investigations into how cells respond to osmotic stress have recently been advanced by the availability of tools that make it possible to study this question on a genome-wide scale. 2

Those studies have included transcriptome analyses to identify genes whose expression is altered by an increase in osmolarity. They have revealed that transcription of surprisingly large numbers of genes are affected. Further, some details of regulatory events that mediate the cell's response to changes in osmotic pressure have emerged. However, the investigations have also demonstrated previously unsuspected complexities as to how cells sense and respond to changes in osmolarity. It is reasonable to assume that, among different organisms, different or additional genes that relate to their particular physiological and metabolic features are involved, and that regulatory differences will also exist.

B – Rhodobacter sphaeroides

Rhodobacter sphaeroides is a purple non-sulfur photosynthetic Gram-negative bacterium, which belongs to the alpha-proteobacteria group. This particular microorganism is metabolically complex and capable of adapting to a variety of different environmental conditions (28).

Energy-gathering metabolisms include phototrophy, aerobic and anaerobic respirations, and fermentations (56). This energetic flexibility, combined with its ability to fix both carbon dioxide and nitrogen, serves to illustrate how widely distributed the bacterium is in the environment.

Rhodobacter sphaeroides can sense and respond to a variety of environmental signals and adjusts its metabolism accordingly. Perhaps because these evoke the most visually dramatic and so until recently more experimental accessible responses, the most intensely studied of these signals are oxygen and light. However, there are many other changes that this organism encounters in its natural habitat, including changes in external osmolarity, and it is known to be capable of activating genes responsible for osmo-tolerance. Fluctuations in osmolarity are common, especially in fresh water where this organism can be found. As R. sphaeroides is 3 capable of enduring osmotic stress, it serves as a useful model in which to examine strategies for coping with changes in osmolarity within the context of a metabolically complex organism.

C – SALT TOLERANCE IN Rhodobacter sphaeroides

At present, three responses to an increase in NaCl have been documented at the molecular level for R. sphaeroides. These are (i) increased uptake of glycine betaine, (ii) increased synthesis of trehalose, and (iii) an increase in the relative amount of CL in the membrane. Whether or not the genes associated with those responses are affected at the transcription level was not known, nor what other genes might be responsive to changes in NaCl.

Also there was no description yet as to the regulatory events that bring about changes in gene expression for this organism.

Towards addressing those deficits, a transcriptome analysis using Affymetrix genechips was performed (53), in which message levels for all genes in untreated versus treated cells were compared. The treatment consisted of a 7 and 45 min exposure to an addition of 1.5% NaCl to phototrophically growing cultures. Two time points were used as a means to consider whether genes were important for immediate or primary transcriptome changes or were part of longer- term coping (adaptation) mechanisms. For the purposes of this discussion, the response at the 45 min time point is relevant. The transcriptome analysis revealed that, in all, the transcription of

690 genes were significantly (using a threshold of 2-fold difference) and reliably changed at the

45 min mark following the addition of NaCl. Among those are genes that further experiments showed are involved in the transport of glycine betaine and synthesis trehalose. However, compared to those genes, the transcriptional responsiveness of genes whose products are known or suspected to contribute to fatty acid and lipid synthesis in this organism (the list is currently incomplete) was relatively small or not reliable, and so the question as whether or not the 4 documented increase in CL or any other change in lipid composition is mediated at the transcription level was not answered by that investigation. The R. sphaeroides genes whose annotations indicate that they are associated with these molecular responses, together with their relative mRNA abundances are listed in Table 1.

In an effort to learn more about the mechanisms underlying the transcriptional response to NaCl, and/or osmotic stress, an investigation of NaCl-responsive genes encoding transcription factors was undertaken. A total of 43 genes annotated as such are altered in expression. Nearly all of these have not been previously characterized experimentally. Leaving aside sigma factors, as they would likely be mediating the response indirectly, among the most highly upregulated transcription factors are rsp0018 (8.6-fold), rsp1945 (6.6-fold), rsp1435 (5.6-fold), and rsp1275

(4.6-fold). Multiple copies (5-10) of rsp0018, rsp1945, rsp1435 conferred no increase in NaCl tolerance, but NaCl tolerance was improved with an increase in rsp1275 copy number (53); Fig.

1).

The role of rsp1275 in regulation of genes associated with compatible solute synthesis and transport that are transcriptionally affected by the addition of NaCl was performed. This involved the use of otsB::lacZ and proX::lacZ transcription reporter plasmids. While the assays of β-galactosidase activity in lysates of cells with these plasmids confirmed the transcriptional impact of added salt, consistent with the microarray analyses (Table 1), there was no statistically significant difference in the enzyme activities in cells with one versus multiple copies of rsp1275

(53). These results suggest that rsp1275 is not involved in regulation of those components of the

NaCl response.

Table 1. Transcriptional response of typical osmotic stress genes in R. sphaeroides.

Gene ID Gene name or product annotation Fold change

Compatible solute synthesis 5

Trehalose synthesis rsp0948a otsA 16.2 rsp0949 otsB 11.8 rsp2445 hypothetical protein 5.2 rsp2446 treS 3.5 rsp2447 hypothetical protein 2.7 rsp2448 hypothetical protein 2.9 rsp2449 hypothetical protein 2.2 rsp2450 treY no changee rsp2451 hypothetical protein no change rsp2452 treZ no change Glycine betaine synthesisb rsp2183 betB no change rsp2184 betA no change Counterion (glutamate) biosynthesis rsp1146 gltB no change rsp1147 conserved hypothetical protein no change rsp1148 conserved hypothetical protein no change rsp1149 gltD no change Compatible solute transport Glycine betaine transport rsp3057 proV (ABC-type proline/glycine betaine 17.4 transport inner membrane ATPase protein) rsp3058 proW (ABC-type proline/glycine betaine 56.4 transport permease protein) rsp3059 proX (ABC-type proline/glycine betaine 53.5 transport periplasmic substrate binding protein) rsp3998 proX1 (Periplasmic binding protein of low abundance, no proline/glycine betaine ABC-type transport change system) rsp3999 proW1 (ABC-type proline/glycine betaine low abundance, no transport permease protein) change rsp4000 proV1 (ABC-type proline/glycine betaine low abundance, no transport inner membrane ATPase protein) change rsp2179 proV2 (ABC-type proline/glycine betaine no change transport inner membrane ATPase protein) rsp2180 proW2 (ABC-type proline/glycine betaine no change 6

transport inner membrane ATPase protein) rsp2181 proX2 (ABC-type proline/glycine betaine no change transport inner membrane ATPase protein) rsp3080 betS 4.0 Cation (potassium) uptake rsp1265 kdpA low abundance, no change rsp1266 kdpB low abundance, no change rsp1267 kdpC low abundance, no change rsp1268 kdpD low abundance, no change rsp1269 kdpE low abundance, no change Couterion (glutamate) uptake rsp0634 putative TRAP-family transporter of glutamate 6.7 rsp0635 putative TRAP-family transporter of glutamate 17.7 rsp0636 putative TRAP-family transporter of glutamate 12.1 Fatty acid / phospholipid synthesisd Fatty acid biosynthesis rsp3833 fadB no change rsp0155 caiD no change rsp2506 ivdH 4.8 rsp2507 ompW not reliable rsp2508 mccB not reliable rsp2509 mccA not reliable rsp2510 hmgL not reliable rsp2511 putative echM not reliable rsp1254 ackA not reliable rsp1255 ptaA not reliable rsp1256 echR not reliable rsp1257 phbC2 3.6 rsp2344 fabI(I) no change rsp2461 fabG no change rsp2462 fabG-like no change rsp2463 acpP 0.4 7

rsp2464 fabF no change rsp2465 hypothetical protein no change rsp3176 fabI low abundance, no change rsp3177 fabB low abundance, no change rsp3178 fabA low abundance, no change Phospholipid biosynthesis rsp0472 hypothetical protein no change rsp0473 cls no change rsp0565 pcs no change rsp0719 psd no change rsp0720 pss no change rsp0721 pmtA no change rsp0735 plsC no change rsp1071 moaA no change rsp1072 moaD no change rsp1073 pgsA no change rsp2708 cdsA no change rsp2833 cinA no change rsp2834 pgpA no change rsp2835 ispD no change aFor those genes that are likely or known to belong to operons, all additionally co-transcribed genes are included. bTranscription of these genes is thought to be negatively regulated by betI (rsp2182), the first gene of the putative betIBA operon. The transcript levels of these genes are very low. cFractional values mean the transcript levels are lower. dNot all are known. These putative fatty acid and lipid metabolic genes were identified by

Tamot and Benning (22) using the annotated DNA sequence of R. sphaeroides 2.4.1. eThreshold for change is 2-fold or greater difference. 8

Fig. 1. Growth of photosynthetic cultures of R. sphaeroides 2.4.1 in the presence and absence of added NaCl and having either the empty vector pRK415 or plasmid p1275-RK with the rsp1275 gene. (A) Cultures after 6 days of incubation. (B) Turbidity measurements of the cultures versus time with the amounts of added NaCl indicated.

D – Rsp1275

Rsp1275 belongs to the FNR-CRP protein family. Members of the Fnr-Crp family of

DNA binding proteins are widely distributed among bacteria (25). Their defining structural elements are an N-terminal allosteric effector domain, which is connected by a dimerization region that includes a long α-helix to a C-terminal DNA-binding domain containing a helix-turn- helix motif. For the two founding members of this protein family the effectors that modulate their DNA binding activity are cAMP for E. coli Crp and oxygen for E. coli Fnr. While it is certain that other effectors regulate the activity of other Fnr-Crp proteins, there are few details available as to what those effectors are. Rhodobacter sphaeroides 2.4.1 encodes 8 members of this protein family; among these, the proteins FnrL and NnrR, have known functions. FnrL is regarded as the R. sphaeroides homolog of E. coli Fnr and its DNA binding activity responds to 9 oxygen availability (57). These regulatory proteins are essential for activating genes that participate in anaerobic energy metabolisms in their respective organisms. NnrR regulates genes associated with denitrification metabolism, and its activity responds to NO, although NnrR binding of NO has not been demonstrated as yet (30, 31, 52). Modeling of (seven out of 8 could be successfully modeled using 3D-Jigsaw (2, 3, 11) the Fnr-Crp proteins in R. sphaeroides 2.4.1 predicts that they are all very similar in structure to Crp (the only member for which the crystal structure has been solved), as is true of E. coli Fnr (9). Importantly, it is clear from these models that all of these proteins possess the effector-DNA binding two-domain structure (Fig. 2).

Therefore, regardless of the exact nature of the effector, it is predicted that there are amino acids within the N-proximal effector domain that detect its presence and are critical for regulating the

DNA binding activity of Rsp1275. Based on the multicopy analysis, it is hypothesized that rsp1275 regulates a gene or genes that are responsible for the ability of R. sphaeroides to tolerate high concentrations of salt. While the previous work indicates that rsp1275 multicopy tolerance does not work through altering transcription of genes involved with compatible solute synthesis and/or uptake, its potential role in mediated changes in lipid composition remains to be explored.

There are other species of bacteria having rsp1275-like proteins (20). However, its role in any organism is not yet known. Other bioinformatic analyses have not be useful in telling us what the effector is, nor what sequence might be the target for DNA binding. 10

Figure 2. Models of the R. sphaeroides Fnr-Crp and E. coli Fnr proteins, and known structure of

Crp (coordinates from NCBI-MMDB).

SPECIFIC AIMS

The long term goals of these studies are to understand the physiological basis for improved NaCl tolerance mediated by rsp1275 and to identify the genes involved.

The following specific aims are proposed:

1. Construct strains with varying amounts of active Rsp1275, and use them to evaluate whether or not Rsp1275 responds specifically to NaCl or more generally to osmotic stress.

2. Evaluate the contribution of Rsp1275 to the known mechanisms of NaCl and/or osmotic tolerance in R. sphaeroides; i.e. compatible solute synthesis and transport, and changes in lipid composition of the membrane.

3. Examine genes whose transcription may be regulated by Rsp1275 by qPCR.

Chapters 2-4 describe the studies directed towards these specific aims. Chapter 5 summarizes the outcomes, and proposes future directions based upon those outcomes. 12

Chapter 2: Analysis of the relationship between NaCl tolerance and the intracellular

concentration of active CrpO

Introduction

The Rhodobacter sphaeroides rsp1275 gene product is a member of the Crp-Fnr protein family. These proteins regulate transcription by sensing a signal or condition through an allosteric effector domain within the N-terminal region that affects the conformation of the DNA binding domain within the C-terminal region. Studies of the transcriptional response of photoheterotrophically grown Rhodobacter sphaeroides to salt indicate that Rsp1275 activity is important for tolerance since the gene is upregulated approximately 4.6-fold after a 45 minutes incubation in the presence of 1.5 % added NaCl (since the culture medium already contains 8.5 mM NaCl, the total concentration is increased by this addition to 268.5 mM). The importance of

Rsp1275 with respect to NaCl tolerance was further evaluated by a multicopy test. The outcome was that increasing the dosage of the rsp1275 gene improved growth in the presence of added

NaCl. Since the effector domain of Rsp1275 is more similar to Crp than to Fnr, the protein is designated CrpO as a transcription factor associated with the osmotic stressor NaCl.

As a first step towards more fully understanding the role of any protein in NaCl tolerance, disabling the gene coding for the protein is a logical first step. However, that approach is rendered futile if the gene is essential. In that event, a possible alternative is to reduce the level of functional protein. For multimeric proteins, this can be achieved by introducing into the wild type cell a plasmid carrying a defective gene that behaves in a dominant-negative fashion. The present study describes the application of these approaches to develop strains having varying concentrations of active CrpO protein. The strains were then used to more fully examine the role of CrpO in NaCl tolerance. 13

Materials and Methods

Bacterial strains and plasmids and growth conditions. Table 2 lists the bacterial strains and plasmids used in these studies. Also included are their relevant characteristics and sources. E. coli was grown in Luria-Bertani medium (3) at 37°C, and R. sphaeroides was cultured in Sistrom’s succinate minimal medium A (50) at 30°C. Antibiotics for strain selection or plasmid maintenance were used at the following final concentrations: 100 µg/ml of ampicillin,

15 µg/ml for E. coli or 0.8 µg/ml for R. sphaeroides of tetracycline (Tc), and 50 µg/ml of kanamycin (Kn) or 50 µg/ml of spectinomycin (Sp) and 50 µg/ml of streptomycin (St). Semi- aerobic growth conditions were established by inoculating cells into 100 ml Sistrom’s succinate minimal medium A in a 250 ml erlenmeyer flask, which was incubated in a New Brunswick gyratory waterbath (model G76) at 30oC and at a rotation setting of 2.5. Photosynthetic growth conditions were achieved by growing cells in completely filled screw-capped tubes, or by sparging liquid cultures with a mixture of 98% nitrogen and 2% carbon dioxide, in front of incandescent lights. Salt stress was imposed upon cultures by the addition of 0 to 3% NaCl to the medium, resulting in an increase from 8.5 up to 508.5 mM.

Measurements of culture densities. Cell densities of R. sphaeroides were determined at

660 nm using a U-2010 UV/Vis spectrophotometer (Hitachi High Technologies America, Inc.,

Schaumburg, IL), or a Klett colorimeter with a number 66 filter.

DNA treatments and manipulations. DNA isolations, restriction endonuclease treatments, and other enzymatic treatments of DNA fragments and plasmids were performed according to standard protocols (46) or manufacturers' instructions. Enzymes were purchased from New England Biolabs, Inc. (Beverly, MA), Gibco-BRL/Life Technologies, Inc.

(Gaithersburg, MD), and Promega (Madison, WI). DNA was analyzed by standard 14 electrophoretic techniques (46), and isolation of DNA from agarose was performed using a

Zymoclean purification kit (Zymo Research Co., Orange, CA). Oligonucleotide mutagenesis was performed using primers purchased from IDT DNA (Coralville, IA) and the Stratagene

QuikChange II mutagensis kit (La Jolla, CA).

Construction of a vector for engineering a crpO null mutant strain. Plasmid pCrpO carries the wild type crpO gene. The crpO null mutant allele was created by insertion of the 2 kbp SmaI-ended ΩSpR/StR cassette (isolated from pUI1638, Table 2) into the SmaI site within the CrpO coding sequences (pSR1). Then a 3.7 kbp PvuII fragment encompassing the entire disrupted gene was ligated into the vector fragment of pSUP202 that had been treated with ScaI

(deletes a 0.7 kbp fragment) creating plasmid pSR2.

Construction of plasmid pCrpO'-BBR. The QuikChange II mutagenesis kit and the oligonucleotide 1275HTH-FOR (5'- GCCGGGTGCCGATGCCCTGGAGGCCTCGCGAGAC-

GGCCACGCGCTG -3') and its complement 1275HTH-REV were used to delete a 3' portion of the crpO gene coding for amino acid residues 190-249. This mutation also created a unique StuI site, which was used to screen candidates for the presence of the deletion. The integrity of the complete crpO' sequences present on the resulting plasmid pCrpO' were confirmed by DNA sequence analysis (Geneway, Hayward, CA). To construct plasmid pCrpO'-BBR, which is capable of replicating in R. sphaeroides, a 567-basepair DNA fragment containing crpO' was isolated from pCrpO' using HindIII and StuI, and then ligated with pBBR1-MCS2 (29) restricted with HindIII and Ecl136II.

Transformations and conjugations. E. coli cells were prepared for transformation by

CaCl2 treatment (46), with the exception of XL1-Blue competent cells included in the

QuikChange site-directed mutagenesis kit. Mobilizations of plasmids into R. sphaeroides were 15 performed by triparental matings with HB101(pRK2013), as described previously by Davis et al.

(12). 16

Table 2. Bacterial strains and plasmids.

Strain or plasmid Relevant characteristic(s) Reference

Rhodobacter sphaeroides

2.4.1 wild type 50

Escherichia coli

− F ( 80dlacZΔM15) recA1 endA1 hsdR17 supE44 DH5α 23 thi-1 gyrA96 relA1 deoR Δ(lacZYA-argF)U169

R DH5αphe DH5α with phe::Tn10d; Cm 17

− HB101 F Δ(gpt-proA)62 leuB6 supE44 ara-14 galK2 lacY1 6

r q XL1-BLUE [F′::Tn10(Tc ) proAB lacI Δ(lacZ)M15] recA1 Stratagene endA1 gyrA96 thi-1 supE44 relA1 lac

Plasmids

pBSIISK+ ColE1; ApR Stratagene

pUI1087 pBSIISK+ with modified polylinker; ApR 58 Laboratory pCrpO pUI1087 with crpO; ApR collection pCrpO' pUI1087 with the crpO' mutant allele; ApR This study

pBBR1-MCS2 KnR 29 Laboratory pCrpO-BBR pBBR1-MCS2 with crpO; KnR collection pCrpO'-BBR pBBR1-MCS2 with crpO'; KnR This study

pRK415 R6K ori; TcR 27 Laboratory pCrpO-RK pRK415 with crpO; TcR collection pUI1638 source of ΩSpR/StR cassette 17

+ pRK2013 Tra of RK2; KnR 15 17

+ pSUP202 R R R pBR325 derivative, Mob Ap Cm Tc 49

pCrpO with ΩSpR/StR cassette inserted into pSR1 This study the SmaI of crpO

pSR2 pSUP202 derivative with crpO::Ω SpR/StR This study

Results

The crpO gene may be essential. The improvement in salt tolerance achieved by the presence of the plasmid pCrpO-BBR (Table 2) is considered to be due to an increase in the intracellular concentration of CrpO over levels present in cells having only the single chromosomal copy of the crpO gene. Construction and characterization of a crpO null mutant would confirm this. To isolate such a mutant, the suicide plasmid pSR2, which carries crpO disrupted with an ΩSpR/StR transcription-translation termination cassette (17) was constructed according to the schematic diagram shown in Fig. 3 (details are provided in the Materials and

Methods). The plasmid was then mobilized into R. sphaeroides wild type strain 2.4.1. Sp/St- resistant recombinants were isolated, and among them allele replacement (double crossover, Tc- sensitive) candidates were identified. However, when those candidates were evaluated by PCR in order to confirm that only the defective gene was present in the chromosome, they were found to have retained an intact copy of crpO; i.e., only false-positives were obtained. This negative outcome suggested that crpO may be essential. 18

Figure 3. Schematic diagram of the construction of the crpO knock-out vector pSR2. The pUI1638 plasmid contains the ΩSpR/StR cassette; pCrpO carries the wild type crpO gene; pSR1 contains the disrupted crpO gene; crpO interrupted gene fragment that was ligated into pSUP202 creating pSR2.

Construction of a CrpO "knock down" strain. Since crpO may be essential, isolation of a crpO null mutant would be impossible. Therefore, an alternate approach was undertaken that would "knock down" but not elimination CrpO activity. This approach was based on the predicted structure of the protein (Fig. 2). The Fnr-Crp family of proteins bind to DNA as dimers, and the dimerization region connects the N-terminal effector domain with the C-terminal

DNA binding domain (Fig. 2). Therefore, a mutant crpO gene encoding a truncated protein in which the dimerization region is preserved, but that is missing the DNA binding domain, may 19 behave in a dominant-negative fashion, forming heterodimers with the wild type CrpO protein.

As a result, the presence of a plasmid with such a crpO' mutant gene would reduce the concentration of CrpO homodimers competent for DNA binding.

Using oligonucleotide-directed mutagenesis, the 3'-184 bp were deleted from crpO creating a gene coding for a protein that is truncated at amino acid residue 189. As shown in Fig.

4, the insertion of the crpO' sequences into plasmid pBBR1-MCS2 positioned the vector sequences such that five codons followed by a nonsense codon were added to the 3' end of the gene. From the model of the protein structure (Fig. 2), it is expected that this shortened protein should contain the effector domain, be capable of dimerization, but lack the ability to bind DNA, as it misses the C-terminus proximal helix-turn-helix region spanning amino acid residues 191-

212.

Figure 4. Schematic diagram of plasmid pCrpO'-BBR. (A) Relevant features of the plasmid, including the additional vector-encoded amino acid residues. (B) Model of the mutant protein generated using 3D-Jigsaw; a model of the wild type CrpO protein is shown in Figure 2 (Chapter

1).

Plasmid pCrpO'-BBR was introduced into the R. sphaeroides wild type strain 2.4.1, and photoheterotrophic growth of the exconjugants in the presence and absence of added NaCl was 20 compared to cells with the empty vector, pBBR1-MCS2, and also to cells with the equivalent plasmid having the intact crpO gene, pCrpO-BBR (Table 2). All cultures were inoculated with equivalent numbers of cells (approximately 26 Klett66 units), and time zero refers to the first measurement following 13 h of incubation of the cultures under phototrophic conditions. As shown in Fig. 1, even in the absence of NaCl added to the medium, growth of R. sphaeroides with pCrpO'-BBR was retarded relative to R. sphaeroides with the empty plasmid vector, and growth was further inhibited by added NaCl. After several days of incubation, growth of the culture of R. sphaeroides with pBBR1-MCS2 in medium with 3% added NaCl was observed.

However, this was found to be due to the emergence of mutants in the population (determined by comparing the rate of growth in 3% added NaCl of a dilution of the culture to that of a culture inoculated with the original "parent" cells). Therefore, the interval of time that was considered to reliably indicate the ability of any given culture to grow in the presence of added NaCl was approximately 59 h of incubation (includes the 13 h of cultivation prior to the zero time point measurement). Within this timeframe, in the presence of all concentrations of NaCl tested, growth of R. sphaeroides with plasmid pCrpO-BBR was better than cells with the plasmid vector alone, which in turn was better than R. sphaeroides with pCrpO'-BBR (Fig. 1). Collectively, these results indicate that multiple copies of crpO' reduces the concentration of functional CrpO, and that the amount of active CrpO correlates with the concentration of NaCl that is tolerated by the cells.

CrpO-mediated NaCl tolerance does not work through altering compatible solute synthesis or transport. The most extensive studies of compatible solute synthesis and transport in R. sphaeroides have been done using R. sphaeroides f. sp. denitrificans IL106. The results for

R. sphaeroides 2.4.1, the strain used here, are consistent with those data. For R. sphaeroides f. 21 sp. denitrificans IL106, trehalose was found to be the major organic compatible solute that is accumulated in response to salt stress (55). Based on measurements of the intracellular levels of trehalose following the addition of NaCl to photoheterotrophic cultures of R. sphaeroides 2.4.1, trehalose synthesis increases with increasing NaCl (53), and transcription of the trehalose biosynthesis genes otsA and B genes are strongly upregulated (Table 1). Other studies that were described in Chapter 1 indicate that their transcriptional response does not involve CrpO.

The situation with respect to uptake of compatible solutes is more complex. Both potassium ions and glycine-betaine are reported to be transported and used for osmoprotection in

R. sphaeroides f. sp. denitrificans IL106 (55). The transcriptome data for R. sphaeroides 2.4.1 in response to NaCl stress suggest that at the transcription level there is little response of potassium uptake genes (53), and data to be presented below (Does CrpO improve tolerance to other osmotic stressors?; Fig. 7) indicate that potassium chloride is an osmotic stressor. Glycine- betaine increases NaCl tolerance of R. sphaeroides 2.4.1 (53), and transport is apparently mediated in part by the betS gene, since disruption of betS reduces the increase in NaCl tolerance brought about by the addition of exogenous glycine-betaine (53). The betS gene encodes a putative betaine/carnitine/choline transporter that couples proton motive force to solute transport across the membrane (5, 53). In Sinorhizobium meliloti, another alpha-proteobacterium the betS gene is apparently constitutively transcribed but post-transcriptionally up-regulated by osmotic stress (5). However, in R. sphaeroides 2.4.1, transcript levels are 4-fold higher following the addition of NaCl (Table 1, Chapter 1). Whether or not CrpO is responsible for this altered betS transcription is not yet known. Further, while the glycine-betaine effect is reduced in the betS mutant, it is not abolished (53), indicating that other proteins can also transport the compatible solute. A possible candidate, based on the dramatic transcriptional response of the operon to 22 added NaCl (Table 1), is the proVWX-encoded ABC-type transporter. Studies have already suggested that CrpO does not affect proVWX transcription (Chapter 1). Whether or not other possible transporters contribute to glycine-betaine uptake is not yet known, nor is the role of

CrpO in their transcription.

To examine the relationship between CrpO-mediated improved NaCl tolerance and that achieved by increased uptake of glycine-betaine, growth of the three R. sphaeroides strains that vary in the amounts of active CrpO were examined in the presence of the compatible solute and with different concentrations of NaCl. This assessment was performed in parallel with the growth analysis shown in Fig. 5A, and so the results can be directly compared. As already described, the reliable window of time for assessing growth was considered to be approximately

59 hours. During that period, glycine-betaine was found to increase the growth rate of all of the cells, including pCrpO'-BBR, in the presence of 0, 0.75, and 1.5% added NaCl (Fig. 5B).

Therefore, increased glycine-betaine uptake appears to be independent of the concentration of functional CrpO. These results suggest that the mechanism by which CrpO activity improves salt tolerance is separate from that by which glycine-betaine improves salt tolerance. 23

Figure 5. Photoheterotrophic growth of R. sphaeroides 2.4.1 with the plasmids, and with the additions of NaCl, indicated. (A) Media did not contain glycine-betaine, (B) the media contained 1 mM glycine-betaine.

Is the CrpO-mediated increase in NaCl tolerance specific to photoheterotrophic growth? All of the studies reported to this point had been performed by culturing cells under photoheterotrophic conditions. However, the plasmid-bearing strains were constructed under chemoheterotrophic (aerobic) conditions, and precultures were also grown 24 chemoheterotrophically; this includes R. sphaeroides with pCrpO'-BBR, which grows very slowly under photoheterotrophic conditions even in the absence of added NaCl (Fig. 5).

Therefore, it is possible that CrpO-mediated salt tolerance is only manifested under photoheterotrophic conditions. To test this, chemoheterotrophic growth of R. sphaeroides with pBBR1-MCS2, pCrpO, and pCrpO' was examined in the absence and in the presence of 3% added NaCl. The results (Fig. 6) indicate that the amount of CrpO that is competent to bind

DNA in the cell correlates with the level of NaCl tolerance under both chemoheterotrophic and photoheterotrophic conditions. It was important to consider the fact that the standard growth medium contains 0.05% (8.5 mM) NaCl. Using medium without any NaCl, neither chemohetero- nor photoheterotrophic growth was observed for R. sphaeroides with improper levels of CrpO; i.e. with either plasmid pCrpO-BBR or plasmid pCrpO'-BBR (results not shown). Evidently, whatever physiological parameter(s) is being impacted by genes regulated by

CrpO, the range of NaCl concentrations that support growth is dictated by the level of their expression, and so by the level of CrpO that is competent to bind DNA.

Figure 6. Chemoheterotrophic growth of R. sphaeroides 2.4.1 with the plasmids indicated, in

0% and 3% added NaCl. 25

Does CrpO improve tolerance to other osmotic stressors? The effector that is sensed by CrpO is not known. Towards determining whether not CrpO is specific for NaCl stress, which would be useful in efforts to identify the effector, growth of the three plasmid-bearing R. sphaeroides strains with varying amounts of active CrpO were evaluated for their ability to grow in the presence of different concentrations of KCl. The results shown in Fig. 7 indicate that KCl tolerance also correlates with CrpO levels, which suggests that CrpO is not specifically responsive to NaCl.

Figure 7. Photoheterotrophic growth of R. sphaeroides 2.4.1 with the plasmids indicated in the presence of 3% added KCl.

Discussion

The initial goal of this study was to construct a crpO null mutant to confirm its role in improving NaCl tolerance, which would make feasible investigations of candidate genes regulated by CrpO. Attempts to construct such a null mutant failed. However, an alternative approach using a dominant-negative mutant gene proved successful in reducing salt tolerance, 26 and so the presumption is that this reduction is due to a decrease in the level of functional CrpO protein.

The mechanism of NaCl tolerance mediated by CrpO has not been demonstrated in this study. Rather, the data presented here support and extend other preliminary findings (Chapter 1) which indicate that CrpO does not work through either of two of the well-established means by which cells cope with changes in osmolarity; i.e. altering compatible solute synthesis and/or transport. Therefore, while the means by which increased levels of CrpO increases the NaCl tolerance of the cell have yet to determined, the importance of the protein was made fully apparent from these studies, in that the proper level of CrpO activity is required for both chemoheterotrophic and photoheterotrophic growth. This study also demonstrated that CrpO is not only important for NaCl tolerance, but also for KCl tolerance, suggesting that the effector signal is not NaCl per se; rather it may be osmotic stress. 27

Chapter 3: NaCl-mediated changes in membrane lipid composition and the role of CrpO

Introduction

Membrane restructuring is one component of processes by which organisms adapt to different growth conditions. In Rhodobacter sphaeroides, it is well-established that the formation of the specialized photosynthetic intracytoplasmic membrane is induced in response to lowering oxygen tensions, and it encompasses dramatic changes in protein composition within the membrane as well as the lipid composition of the membrane (10, 45). Another membrane restructuring documented in many bacteria occurs in response to changes in osmotic pressure, and includes alterations in both lipid and fatty acid composition (21). To cope with elevated turgor pressure, these alterations increase membrane viscosity, preserving the integrity of the membrane while also sustaining function of proteins embedded within or associated with the membrane. As mentioned in Chapter 1, with increasingly hypertonic media, the ratio of polar anionic to zwitterionic lipid increases. Since the anionic phospholipid cardiolipin is normally present in very small amounts under normal physiological conditions (38), its increased presence in response to increasing osmolarity is most notable among all anionic lipids. The de novo formation of cardiolipin involves a transesterification reaction between two phosphatidylglycerol molecules, which in some bacteria is known to be catalyzed by a cardiolipin synthase (Cls) (47).

Cls is a phospholipase D-type enzyme whose role is to maintain phosphatidylglycerol PG and

CL in a state of balance under non-stress conditions (47). The observation is that, when osmotic stress is imposed the balance of the reaction shifts in favor of CL formation and PG levels remains constant, since PG synthase is also osmotically induced (42-44). In R. sphaeroides a change in phospholipid composition in response to osmotic stress has already been reported; specifically, the shift to CL formation from PG (13). 28

The known features of phospholipid formation and regulation as it takes place in R. sphaeroides have been summarized in a recent review by Tamot and Benning. Although the alterations in phospholipid composition of R. sphaeroides membranes in response to changes in oxygen availability and also certain osmotic stressors have been examined (10, 45), the mechanism(s) that regulate genes responsible for those changes is not known. Fig. 8 is a schematic diagram of the phospholipid biosynthesis pathway, including known or suspected genes coding for the associated enzymes in R. sphaeroides 2.4.1.

Figure 8. Proposed phosphatidylglycerol lipid biosynthetic pathway of R. sphaeroides 2.4.1.

ACP, acyl carrier protein; AdoHcy, S-adenosylhomocysteine; AdoMet, S-adenosylmethionine;

CDP, cytidinediphosphate; CMP, cytidine monophosphate; CTP, cytidine triphosphate; DMPE,

N,N-dimethyl phosphatidylethanolamine; MMPE, N-monomethyl phosphatidylethanolamine. 29

The studies presented in Chapter 2 demonstrated that multiple copies of crpO improve

NaCl tolerance. However, the means by which this comes about were not established, other than it is likely not to involve compatible solute synthesis or uptake (55). The goal of this study is to determine whether or not crpO increases NaCl tolerance by bringing about changes in the lipid composition of the membrane. Specifically, the relationship between CL concentration and crpO gene dosage will be examined.

Materials and Methods

Bacterial strains and plasmids, and growth conditions. Table 2 includes the bacterial strains and plasmids used in these studies. R. sphaeroides was grown in Sistrom's succinate minimal medium A (50) at 30oC under either chemoheterotrophic or photoheterotrophic conditions. Cultures were grown to approximately equivalent densities prior to the application of osmotic stress brought about by the addition of NaCl to the medium, increasing the concentration from 0.085M to a final concentration of 0.585M, or of sucrose to a final concentration of 0.5M.

Extraction of polar lipids. R. sphaeroides cultures were incubated in the presence of the osmotic stressor for 45 minutes. Chloramphenicol (20 mg/ml ethanol) was added to a final concentration of 0.3 mg/ml to halt further protein synthesis. The cells were pelleted in 50 ml conical tubes by centrifugation at 3220 x g for 20 minutes at 25oC. The cell pellets were resuspended in 0.1 M potassium phosphate buffer, pH 7.4 before extraction of polar lipids. Polar lipid extraction was performed using standard protocols (4, 13). Following evaporation of the solvents used in extraction, the extracts were weighed. The lipids were then dissolved in chloroform:methanol (1:1, v/v) to a final concentration of approximately 20 µg/µl. All phospholipid samples were stored at -20oC. 30

To investigate transcriptional versus post-transcriptional requirements for increased CL levels in response to osmotic stress 100 ml photosynthetic cultures were divided in two and harvested by centrifugation at 3220 x g for 15 minutes at 10oC. The cell pellets were washed with 0.1M potassium phosphate buffer, pH 7.4. One pellet was resuspended in 50 ml of the same buffer with chloramphenicol to a final concentration of 0.3 mg/ml and the other was resuspended in buffer without chloramphenicol. Varying amounts of NaCl (0.085-0.585 M final concentrations) were added to these "resting" cell suspensions and they were then transferred to

250 ml erlenmeyer flasks that were incubated with gentle rotation at 30oC overnight (30).

Thin layer chromatography (TLC) analysis. For TLC analysis, extracted lipid samples were applied to TLC silica gel plates (0.2 mm layer thickness, Sigma) which had been washed twice with chloroform:methanol (1:1, v/v), and then activated by placing the plates in a dry oven for 30 minutes at 120oC. Standard solutions of cardiolipin (CL), phosphatidylcholine (PC) and phosphatidylethanolamine (PE) (Sigma) were prepared to a final concentration of 10 µg/µl in chloroform:methanol (1:1, v/v). The development conditions that were used were previously described (8, 13). Visualization of the phospholipids was achieved by exposing the charred TLC plates to UV light. Digital images were captured using the Kodak DC290 zoom digital camera.

Phospholipid ratios were determined using Image J software (http://rsb.info.nih.gov/ij).

Mass Spectrometry. Lipid extracts in chloroform:methanol (1:1, v/v) solution were subjected to negative ion mass spectrometry analysis. Electron spray ionization was performed according to standard protocols (57).

Chemical determination of polar phospholipid concentrations. The amounts of polar phospholipids were determined using a colorimetric method based on the formation of a complex between phospholipids and ammonium ferrothiocyanate as described previously (51). 31

Thiocyanate reagent solution was prepared by mixing ferric chloride (FeCl3 6H2O) and ammonium thiocyanate (NH4SCN) in water. Concentrations were determined by first redissolving the polar lipid extract in chloroform and thiocyanate reagent solution (2:1, v/v). The chemical solution was then vortexed for 1 minute and the red lower organic-chloroform phase was separated from the aqueous phase by centrifugation at low speed (5.4 x g) for 30 seconds.

Aliquots of from 10 to 50 µl were then added to 1 to 1.5 ml of chloroform and the absorbance at

488 nm was measured using a Hitachi U-2010 UV/Vis spectrophotometer. A standard curve was generated using phosphatidylcholine (PC) solution and measuring concentrations ranging from

10 to 100 µg (33, 51).

Results

Are NaCl-induced changes in polar phospholipid composition of the membrane due to changes in enzyme levels or activity? An elevation in relative CL levels in response to increased osmotic pressure is well-documented for R. sphaeroides (13). However, whether or not this is due to changes in enzyme availability or activity has not been determined. To address this question, an experiment emulating the previously published study of the responsiveness of

CL levels to NaCl treatment (13) was performed with two important modifications. First, certain strains of R. sphaeroides can synthesize the xenobiotic lipid phosphatidyl Tris when cells are exposed to tris-hydroxymethylaminomethane buffer (48). While R. sphaeroides 2.4.1 apparently does not have that capability (16), whether or not it altered the outcome of the published study

(13) is not known. Therefore potassium phosphate buffer rather than Tris buffer was used to prepare metabolically resting cells. The second modification was to include the addition of a chloramphenicol treatment to halt protein synthesis, in parallel with an untreated control. 32

Table 3 reports the ratios of CL:PC and PG:PC CL determined from the relative intensities of an image of the TLC plate upon which the polar lipids extracted from the treated and untreated samples were resolved. For chloramphenicol-treated cells, the CL:PC ratio was higher for NaCl-induced versus uninduced cells. However, in the absence of chloramphenicol, the CL:PC ratio did not increase as much following NaCl induction. Quite a different outcome was observed with respect to the PG:PC ratio; i.e. the ratio decreased following the addition of chloramphenicol to cells that were treated with NaCl, while in the absence of chloramphenicol the ratio increased. As shown in Fig. 8, CL is formed by combining two PG molecules, releasing a glycerol molecule. Therefore, while the addition of NaCl causes an increase in the relative levels of CL that does not require protein synthesis, this is apparently at the expense of PG.

When protein synthesis is not halted, the relative levels of both CL and PG increase with the addition of NaCl. Based on these results, the addition of NaCl alters the phospholipid composition in two ways. On the one hand, NaCl stimulates enzyme activity, which increases

CL but not PG formation; on the other hand, NaCl induces the levels of enzyme or enzymes that support increased PG synthesis. This finding makes it reasonable to propose that phospholipid changes in response to NaCl come about at least in part through changes in transcription of phospholipid biosynthesis genes. It should be noted that this outcome could not be predicted from the transcriptome data (Table 1) pertaining to the known phospholipid biosynthesis genes, as they are not significantly or reliably affected by NaCl. Thus, the results presented here underscore the importance of improving our understanding of phospholipid metabolism, and also its regulation, in this organism.

Table 3. The ratios of phospholipids present in resting cells from photoheterotrophic cultures of

R. sphaeroides 2.4.1 following incubation without or with 0.8 M NaCl.

Ratios of phospholipidsa

Strain and condition CL:PC PG:PC

2.4.1 without NaCl 0.57 0.59

2.4.1 with NaCl, protein synthesis haltedb 0.85 0.30

2.4.1 with NaCl 0.65 0.79

aPhospholipids are CL: cardiolipin, PC: phosphatidylcholine, and PG: phosphatidylglycerol. bProtein synthesis was halted by the addition of chloramphenicol to the resting cells (final concentration was 0.3 mg/ml).

Does CrpO affect polar phospholipid composition of the membrane? Having established that NaCl affects phospholipid composition of the R. sphaeroides 2.4.1 membrane, and that it happens in part through altered transcription, one can now consider whether or not multiple copies of crpO improve NaCl tolerance by participating in that transcriptional response.

The phospholipid whose concentration in the membrane most strongly correlates with increased

NaCl tolerance in this and other bacteria is CL (13) and so its relative concentration (CL:PC) was determined in photoheterotrophically grown R. sphaeroides 2.4.1 with the empty vector versus bacteria with pCrpO-BBR that were or were not induced by the addition of NaCl to a final concentration of 0.585 mM. The data (Table 4) indicate that crpO regulates the phospholipid composition of the membrane, since the CL:PC ratio in cells with multiple copies of crpO with no added NaCl, 0.72 ± 0.04 is almost as high as that in cells with the empty vector that had been subjected to the NaCl treatment, 0.75 ± 0.01. This interpretation of the data assumes that by 34 increasing the crpO gene dosage, the intracellular concentration of CrpO is increased, and at these higher concentrations some of the protein is competent for DNA binding, bypassing the normal allosteric regulation of the effector molecule or signal. This concentration effect has already been described for other Crp-Fnr type proteins.

Table 4. The CL:PC ratios in photoheterotrophically grown cells of R. sphaeroides 2.4.1

following a 45 min incubation without or with the addition of NaCl.

Strain and condition CL:PC ratio

2.4.1(pBBR1-MCS2), no NaCl added 0.55 ± 0.02a

2.4.1(pBBR1-MCS2), NaCl added 0.75 ± 0.01

2.4.1(pCrpO-BBR), no NaCl added 0.72 ± 0.04

2.4.1(pCrpO-BBR), NaCl added 0.85 ± 0.03

aReported are the mean values of the ratios from three independent replicates, with their standard deviations.

In Rhodobacter sphaeroides and other bacteria, CL levels are reported to change not only in response to NaCl but also in response to other osmotic stressors including non-ionic compounds such as sucrose (8). Evidence that CrpO-mediated tolerance is not limited to NaCl was already presented in Chapter 2, since cells with pCrpO-BBR could grow in the presence of higher amounts of added KCl than cells with the plasmid vector pBBR1-MCS2. Here, the relative levels of CL were examined in cells having one (chromosomal) copy versus multiple copies of crpO that were osmotically stressed by the addition of sucrose (final concentration 0.5

M). The values of the ratios (Table 5) are nearly the same as those obtained when cells were treated with NaCl (Table 4). These findings argue that CrpO is responsive to an effector signal 35 that represents the osmotic state of the cell, and that it regulates genes of phospholipid metabolism.

Table 5. The CL:PC ratios in photoheterotrophically grown cells of R. sphaeroides 2.4.1

following a 45 min incubation without or with the addition of sucrose.

Strain and condition CL:PC ratio

2.4.1(pBBR1-MCS2), no sucrose added 0.54

2.4.1(pBBR1-MCS2), sucrose added 0.74

2.4.1(pCrpO-BBR), no sucrose added 0.78

2.4.1(pCrpO-BBR), sucrose added 0.89

Total membrane phospholipid concentrations correlate with crpO copy number.

During the course of analyzing the relative phospholipid composition of the membrane, a qualitative assessment of the total amount of extracted phospholipids indicated that R. sphaeroides with pCrpO-BBR had higher concentrations than cells with the empty plasmid vector, and this was independent of the presence or absence of added NaCl. In order to accurately compare the total amounts of phospholipids, they were extracted from equivalent numbers of cells. Fig. 9 is an image of the TLC plate after application of equal volumes of the phospholipid extracts, and again, regardless of the presence or absence of added NaCl, it appears that cells with multiple copies of crpO have higher concentrations of phospholipids than cells with a single copy of the gene. The higher relative amounts of CL are also clearly evident in the figure.

Figure 9. TLC of phospholipids extracted from equivalent numbers of photoheterotrophically grown R. sphaeroides 2.4.1 that were incubated with or without added NaCl. Lane A: phospholipid standards (CL, cardiolipin; PE, phosphatidylethanolamine; PC, phosphatidylcholine), lane B: R. sphaeroides 2.4.1(pBBR1-MCS2) that had been incubated 45 min with 0.26 M added NaCl, lane C: R. sphaeroides 2.4.1(pBBR1-MCS2) that had been incubated without added NaCl, lane D: R. sphaeroides 2.4.1(pCrpO-BBR) that had been incubated 45 min with 0.26 M added NaCl, lane E: R. sphaeroides 2.4.1(pCrpO-BBR) that had been incubated without added NaCl.

The phospholipid concentrations extracted from equivalent numbers of cells were also quantitated using a colorimetric assay (Materials and Methods). As shown in Fig 10, in the absence of added NaCl, the amount of phospholipid in R. sphaeroides with pCrpO-BBR is 2.1- 37 fold greater than the amount in R. sphaeroides with pBBR1-MCS. The addition of NaCl does not greatly affect this difference as there is 2.4-fold more phospholipid present in R. sphaeroides with multiple copies of crpO than in R. sphaeroides with the single (chromosomal) copy of crpO. Therefore, in addition to altering the phospholipid composition of the membrane, an increase in crpO gene dosage leads to an increase of the total phospholipid concentration.

Figure 10. Relative concentrations of total phospholipids extracted from equivalent numbers of

R. sphaeroides 2.4.1 cells with either plasmid pCrpO-BBR or the plasmid vector pBBR1-MCS2.

The dark grey bars are values for cells collected following a 45 min incubation with 0.26 M

NaCl added to the medium and the light grey bars are values for cells that were not incubated with added NaCl. Data represents the mean values ± standard deviations obtained from two independent replicates.

Identification. To confirm the assignment of the phospholipid species extracted and resolved by TLC from R. sphaeroides 2.4.1 grown in the presence and absence of added NaCl, 38 and with one or more copies of crpO, total phospholipid extracts was analyzed by mass spectrometry. By and large the spectra corresponded closely to those previously reported for another strain of R. sphaeroides (8, 13), and the m/z peaks of the molecular ions derived from

CL, PG, sulfoquinovosyldiacylglycerol (SQDG) and phosphatidylethanolamine (PE) could be identified for each of the samples (Fig. 11); the discrepancies were two to four mass units, and are thought to be due to differences in saturation among the fatty acids (further details are provided below). PC is absent, as it is not readily ionized in the negative mode used in this analysis (8). In addition to the phospholipids, peaks corresponding to molecular ions of the fatty acids C18:1 and C16:0 were present. As this analysis was not quantitative, it is not possible to compare concentrations between samples. However, the relative concentrations of the different fatty acids and phospholipid can be determined by comparing the peak heights in the spectra, and these are listed in Table 6. Evidently, the relative concentrations are shifted in favor of less saturated fatty acid species in cells having multiple copies of crpO, as are the relative concentrations of the free fatty acids. Further, the actual masses of the detectable molecular ions derived from SQDG and CL that were extracted from R. sphaeroides with pCrpO-BBR are lighter by approximately 2 atomic mass units (Table 6 and Fig. 11), suggesting that they contain fatty acids that are less saturated as well. 39

Figure 11. Electron spray (negative) ionization mass spectrometry of total phospholipids extracted from photroheterotrophically grown cells. Spectra are (A) R. sphaeroides

2.4.1(pBBR1-MCS2) grown in the absence of added NaCl, (B) R. sphaeroides 2.4.1(pBBR1-

MCS2) collected following a 45 min incubation with 0.26 M NaCl added to the medium (C) R. sphaeroides 2.4.1(pCrpO-BBR) grown in the absence of added NaCl, and (D) R. sphaeroides

2.4.1(pCrpO-BBR) collected following a 45 min incubation with 0.26 M NaCl added to the medium. 42

Table 6. Relative concentrations of selected phospholipids and the free fatty acids.

Sample Observed m/z Molecular Ion Peak Relative (literature Assignment Height Concentrations value) WT (pBBR1-MCS2), no added NaCl 748.0 (747.5) PG (34:1) 19.0 1.0 774.0 (773.5) PG (36:2) 150.0 7.9

822a (821.5) SQDG (34:0?) 29.0 1.0 848 (847.5) SQDG (36:1?) 47.5 1.6

255.2 C16:0 6.0 1.0 281.4 C18:1 64.0 10.7

WT (pBBR1-MCS2), NaCl added 748.0 (747.5) PG (34:1) 16.0 1.0 774.0 (773.5) PG (36:2) 126.0 7.9

822 (821.5) SQDG (34:0?) 50.0 1.0 848 (847.5) SQDG (36:1?) 71.0 1.4

255.2 C16:0 5.0 1.0 281.4 C18:1 61.0 12.2

WT (pCrpO-BBR), no added NaCl 748.0 (747.5) PG (34:1) 8.0 1.0 774.0 (773.5) PG (36:2) 149.0 18.6

820 (821.5) SQDG (34:0?) 20.0 1.0 846 (847.5) SQDG (36:1?) 44.5 2.2

255.2 C16:0 1.5 1.0 281.4 C18:1 36.0 24.0

WT (pCrpO-BBR), NaCl added 748.0 (747.5) PG (34:1) 6.8 1.0 774.0 (773.5) PG (36:2) 150.0 22.1

820 (821.5) SQDG (34:0?) 10.0 1.0 846 (847.5) SQDG (36:1?) 35.0 3.5

255.2 C16:0 2.0 1.0 281.4 C18:1 41.0 20.5 aNumbers in red indicate m/z values for the molecular ion that differ between cells with pBBR1-

MCS2 and with pCrpO-BBR.

Discussion

This study has provided information to support the hypothesis that the means by which multiple copies of the crpO gene improves osmotic tolerance is by altering the expression of genes associated with fatty acid and lipid metabolism. The outcomes of this altered expression include (1) increased total phospholipid production, (2) an increase in the relative amounts of

CL, and (3) a shift towards higher concentrations of unsaturated fatty acids. Any and all of these are known to improve the ability of bacteria to cope with osmotic stress (42).

Inspection of the transcriptional response to NaCl (Table 1) of the currently known phospholipid biosynthesis genes (22) provides no guidance as to what genes might be involved since they are all unresponsive to the addition of NaCl. The list of genes associated with fatty acid metabolism is also incomplete (22) and, other than the acpP gene which it is actually down- regulated by the addition of NaCl (Table 1), those that are known are either unresponsive to added NaCl or their mRNA levels cannot be reliably measured (Table 1). According to the recent review by Tamot and Benning (22), the R. sphaeroides 2.4.1 genome lacks genes for desaturases that could introduce double bonds into pre-existing fatty acids. One might then conclude that the higher relative amounts of unsaturated fatty acids present in cells with multiple copies of crpO is due to altered expression of the R. sphaeroides genes encoding FadA and B that catalyze the formation of a double bond during the process of fatty acid biosynthesis.

However, there is no annotation of a fadA gene, and the transcriptome data for the fadB gene

(Table 1) indicate that it is not responsive to added NaCl. This evidence reduces but does not eliminate the possibility that crpO regulates fadB expression. The alternative possibility is that the R. sphaeroides 2.4.1 genome does contain a gene(s) encoding a fatty acid desaturase(s) that remains to be identified, and that this gene(s) is(are) the target for crpO regulation. 44

Chapter 4: Investigation by quantitative PCR of putative crpO-regulated genes

Introduction

Multiple copies of the R. sphaeroides crpO gene increases tolerance to osmotic stress.

Evidence presented in Chapter 3 supports the hypothesis that this improved tolerance is a consequence of altered fatty acid and lipid metabolism brought about by the increased crpO gene dosage. It is thought that crpO in multicopy elevates the concentration of CrpO protein that is capable of binding to DNA and thereby activate or repress transcription of target genes. A logical first choice of potential target genes are those known to be involved in fatty acid and lipid metabolism. However, transcriptome data for the genes responsive to added NaCl failed to provide any indication as to the identity of the crpO-regulated genes that could bring about those changes. Without question, this is at least partly due to the fact that our knowledge of the genes that participate in fatty acid and lipid metabolism is far from complete.

A literature search suggested the possibility that an echM gene might be a target for crpO transcriptional regulation since increasing enoyl-CoA hydratase (EchM) activity was reported to improve salt tolerance. The study consisted of the following. A pond water metagenomic library was screened in E. coli, and a clone conferring increased NaCl tolerance was identified.

DNA sequence analysis revealed the clone contained a gene that codes for a protein with 77% identity to the enoyl-CoA hydratase/isomerase protein of Polaromonas sp JS666 (26). Several

R. sphaeroides 2.4.1 genes encode products that are annotated as members of the ECH Enoyl-

CoA hydratase/isomerase protein family. Among them, the rsp2511 gene was considered to be the best candidate gene to evaluate as a potential target for crpO since the transcriptome data available when this study was initiated indicated that the gene and the apparently co-transcribed genes rsp2508-2510 are upregulated approximate 3-fold following the addition of NaCl to the 45 media. Since then, an additional microarray replicate was performed, and the expression profile generated by combining all of the microarray data indicate that transcription of rsp2508-2511 cannot be reliably measured (Table 1). However, the data from this third replicate differs considerably from that of the other two replicates, which are in very good agreement with each other, not just for these genes but for many other genes, and so suggests that the third replicate data may be problematic.

The goal of this study was to develop and use quantitative PCR as a tool to evaluate genes potentially regulated by crpO, which would also resolve questions regarding expression profiles generated using the Affymetrix microarrays. Therefore, the rsp2508-11 putative operon was considered a suitable first choice for this investigation.

Materials and Methods

Bacterial strains and plasmids and growth conditions. Table 2 includes the bacterial strains and plasmids used in these studies. R. sphaeroides strains were grown under photoheterotrophic conditions (sparging 100 ml liquid cultures with a mixture of 98% nitrogen and 2% carbon dioxide that were illuminated with approximately 10 W/m2 of incandescent light) in Sistrom's succinate minimal medium A at 30°C. High external osmolarity was achieved by the addition of NaCl to a final concentration of 585 mM for a period of 45 min before RNA synthesis was halted by the addition of rifampicin (10 mg/ml in methanol) to a final concentration of 200 µg/ml. Cells were collected in centrifugation bottles half filled with ice, and the cell pellets were either immediately processed for RNA extraction or frozen at -80°C for further use.

RNA isolations and quantitative PCR (qPCR). Total RNA was isolated according to 46 manufactures’ instructions using the Qiagen RNeasy kit (Chatsworth, CA). DNA was removed by DNase I treatement according to manufactures’ instructions with Qiagen RNase-Free DNase.

The quality of RNA was checked by comparing absorbance at 260 versus 280 nm. A ratio of between 1.6 to 2.0 was considered acceptable. The RNA integrity was further evaluated by agarose gel electrophoresis. cDNA was made from DNA-free RNA using the Bio-Rad iScript cDNA Synthesis Kit (Hercules, CA).The primers used in this study were designed using the

"Primer3" web interface (http://frodo.wi.mit/edu/primer3) and the default parameters other than the following: product size between 70 and 150 bp, Tm of the primers between 59-61oC. All primers were evaluated for specificity by comparing them to the entire R. sphaeroides 2.4.1 genome, and for the absence of self-complementarity using "Mfold"

(http://biotools.idtdna.com/mfold) applying a cutoff melting temperature of 60oC. The sequences of the primers are provided in Table 8, and amplifications were performed in a MyiQ cycler using SYBR Green Supermix (Bio-Rad). 47

Table 7. Primer sequences and amplification product used for qRT-PCR.

Size of PCR Gene Primer sequence 5’-3’ References product (bp) rpoZ rpoZ-F ATCGCGGAAGAGACCCAGAG 108 rpoZ-R GAGCAGCGCCATCTGATCCT 41 rsp2508 rsp2508-F TACAATCAGGCGCAGATGAG

125 This study rsp2508-R CCCTGGTTTCTCACGATGAT

rsp1366 rsp1336-F GACTGGGAACTGACCGAGAG

rsp1336-R TCTCGACCTTGTTGACGTTCT 70 This study

rsp2011-R GGTCCAGACCACCTTTTCG

rsp0212 rsp0212-F TCCAACCTGACTTCCCTTTG

150 This study rsp0212-R TGAGCATGGGATCTCCTTTT

rsp2011 rsp2011-F GCACCGTCTGGGAGQTCA

122 This study rsp2011-R GGTCCAGACCACCTTTTCG

Results

Evaluation of the effect of NaCl on transcription of rpoZ, the standard internal control gene for R. sphaeroides 2.41 qPCR studies. The approach used to compare transcript levels of genes between control (a single copy of crpO) and experimental cells (multiple copies of crpO) was to perform amplifications of a "housekeeping gene" and the target gene of interest in parallel using the same cDNA samples, and then calculate the relative number of amplification cycles required for the fluorescence emitted from the production of double-stranded DNA intercalated with SYBR GREEN to surpass a detection threshold (Ct); i.e. the data for the gene of interest are normalized using the data for the housekeeping gene. That cycle number depends upon the original concentration of mRNA of both the housekeeping and the target gene.

Therefore, the choice of the housekeeping gene is critical to the ability to successfully and 48 accurately determine the relative levels of mRNA of the gene of interest.

The rpoZ coding for the ω subunit of RNA polymerase has proven to be a suitable choice for many qPCR measurements of gene expression in R. sphaeroides 2.4.1 (19, 40, 41). Further, the transcriptome data indicated that rpoZ mRNA varied less than 2-fold between cells grown with versus without added NaCl (53). Therefore, this gene was used as the housekeeping gene in the first studies to examine mRNA levels of the rsp2508-11 operon using real-time PC reactions.

However, when approximately equivalent amounts of cDNA from cells grown in the presence versus the absence of NaCl were used in amplifications of rpoZ, it became apparent that the differences in message levels, reflected in the number of cycles required to reach the detection threshold, were larger than could be accounted for by inherent imprecisions in measuring cDNA concentrations (results not shown).

Investigation of other genes for their suitability as housekeeping genes. A total of three other genes, rsp0212, rsp1366, and rsp2011 (primers are provided in Table 7), were evaluated by real time PCR with respect to their NaCl responsiveness in the same manner as described for rpoZ. They were selected as potential housekeeping genes using the following criteria: (1) the genes should not code for membrane-localized proteins or other products that are known or suspected to be associated with cell adaptations to osmotic stressors, (2) the transcriptome data for the genes should give no indication they are sensitive to variations in

NaCl concentrations, and (3) the transcript levels of the genes should be similar to those of rpoZ; i.e. they should not be very highly transcribed genes nor should they be genes whose transcription levels are very low. Among the three candidates only amplifications of rsp1366 indicated mRNA levels did not fluctuate between cells grown with versus without NaCl. Also important to this study, the presence or absence of multiple copies of crpO did not appear to 49 influence rsp1366 mRNA levels, since detection thresholds were nearly the same when using approximately equivalent amounts of total cDNA from cells with and without pCrpO-BBR

(results not shown).

The initial finding regarding the effect of NaCl on rpoZ transcription was then assessed using qPCR with rsp1366 for normalizing the rpoZ data. The results are shown in Fig 12, and were generated from total RNA isolated from three different sets of cultured bacteria. Since there is variability among the replicates, each is shown separately. In all replicates with plasmid pCrpO-BBR, the levels of rpoZ transcript are at a minimum 2-fold higher in cells cultured with

NaCl added versus without, and for two of the three replicates with pBBR1-MCS2. These data indicate that relative rpoZ levels are inconsistent between the samples, and suggests NaCl does indeed affect rpoZ transcription.

Figure 12. Relative levels of rpoZ transcript measured using qPCR and normalized to rsp1366

Ct values.

qPCR-based assessment of the effect of NaCl and crpO copy number on rsp2508-11 transcription. Using primers specific for the first gene of the rsp2508-2511 operon and normalizing the Ct values to those of rsp1366, the amount of message in cells with either pBBR1-MCS2 or pCrpO-BBR and that had been incubated in the absence or presence of added

NaCl was measured by qPCR. This was performed for three sets of RNA samples, and the results are shown in Fig. 13. Obviously, the values fluctuate considerably among the replicates, and there is no clear pattern of transcription discernable.

Figure 13. Relative levels of rsp2508-11 transcript measured using qPCR and normalized to rsp1366 Ct values.

Are the rsp2508-11 transcript levels highly variable in cells? Based on spectral analysis and agarose gel electrophoresis, the quality of all of the RNA samples used in this study were considered to be acceptable (Materials and Methods), which means that the variability in the rsp2508-11 transcript levels as measured by qPCR stems from some other source. However, in 51 order to be able to conclude that the variability in the qPCR results among the replicates is a consequence of actual differences in the amounts of rsp2508-11 transcript present in the samples, any possible flaws in the qPCR itself must be eliminated. Towards that end, a number of potential problems were evaluated here.

First, while a comparison of the sequences of the primers used here to the R. sphaeroides

2.4.1 genomic sequences failed to discern any sequences that are similar enough to contribute to mispriming using the reaction conditions that are appropriate for the calculated Tm of the primers, a direct test for mispriming and/or primer-primer artifacts was performed. This consisted of melting the PCR products generated by the qPCR itself. The curves for both the rsp1366 and rsp2508 PCR products are shown in Fig. 14. The presence of a single peak for all of the replicates suggests that amplification generated only one product in each case.

Figure 14. Melting curve of the qPCR products generated using the primers indicated. There are twelve products in all, as the reactions were performed in triplicate using cDNAs generated from

RNA isolated from four samples: R. sphaeroides 2.4.1 with either plasmid pBBR1-MCS2 or pCrpO-BBR that had been incubated with or without added NaCl.

Second, the efficiency of the amplification reaction is important; if the extension reactions catalyzed by DNA polymerase are impeded, then the amount of product formed in each cycle is 52 lessened relative to that which would result if extension were not impeded. Here, since the same sequences were being amplified among the different samples, this was not considered to be a factor that could significantly influence the outcome. However, to be confident in using rsp1366 as the internal control to examine any other candidate genes that may be regulated by crpO, its amplification efficiency was evaluated. To do so, the amplification reaction was performed using a series of cDNA dilutions, which is the standard method for determining PCR efficiencies. The efficiency is calculated from a plot of the slope of the Ct values for the reactions using the equation E = [10(-1/slope) -1] x 100 (36). For amplifications of the rsp1366 sequences, the E value was found to be approximately 65.5% (Fig. 15), which indicates that the extensions are not optimal, and could be improved upon by choosing another region of the gene to target for amplification.

Figure 15. cDNA concentration versus Ct value measured for the qPCR of rsp1366. The primers used are listed in Table 7.

While these qPCR performance tests have identified some adjustments to the conditions that could improve the precision of the measurements, none provide persuasive evidence that the 53 qPC reaction itself is the basis for the large differences in rsp2508-11 transcript levels present in the different cell samples, and collectively suggests that transcription of the operon is, in fact, highly variable.

Discussion

The goal of this work was to develop and use qPCR as a tool to evaluate potential gene targets of regulation by crpO. A number of issues were identified and successfully resolved; most importantly, the standard control gene used in all of the qPCR studies involving this organism that had been published at the time this work began, proved to be unreliable, since transcription of the control gene is affected by NaCl. During the course of this study, a second report of variability in rpoZ transcription was published (36). Those investigators were examining the transcriptional response of genes to cobalt exposure. It is interesting of itself to note that both cobalt and osmotic stresses affect transcription of rpoZ, which is a subunit of RNA polymerase whose function is still in the process of being determined. In E. coli, it is the only

RNA polymerase subunit gene that can be deleted without affecting the survival of the organism.

However recent studies indicate that it functions as a protein chaperone in RNA polymerase assembly and is also involved in the response of RNA polymerase to ppGpp, the so-called stringent response that modulates transcription rates according to amino acid availability (39).

Little attention seems to have been paid to date about any potential regulation of rpoZ transcription itself, however, and this may be because, until the work of Losurdo et al. (36) and now this study, there was no evidence to suggest that the gene was affected by any condition.

Indeed this would be the rationale for choosing rpoZ as a control for qPCR in the first place.

The results of the qPCR measurement of rsp2508-11 transcripts indicate that they cannot be reliably measured as the levels vary independent of the parameters that were controlled for in 54 this study, which include among others incubation temperature, media composition, incident light intensity, cell inoculation (and collection) density. Most importantly, the levels apparently fluctuate independent of the copy number of crpO and also regardless of the presence or absence of added NaCl. Therefore, it seems reasonable to conclude that altered expression (transcription) of rsp2508-11 cannot account for the alterations in fatty acid and lipid composition of cells having multiple copies of crpO. 55

Chapter 5: Summary and future perspectives

This work has generated evidence supporting the hypothesis that crpO is an essential gene.

It has also demonstrated that the gene is important for coping with increasing osmolarity.

Multiple copies of crpO seems to achieve this by altering the total and relative amounts of phospholipids and their composition, which apparently shifts in favor of more unsaturated fatty acids. While both the microarray data ((53); Table 1), and qPCR results failed to indicate that known or suspected phospholipid biosynthesis genes are regulated by CrpO, certain among the fatty acid metabolic genes of R. sphaeroides 2.4.1 are altered in their transcription in response to increasing NaCl concentrations. These would then be logical choices for future evaluation towards identifying genes regulated by CrpO.

The current picture of lipid and fatty acid metabolism in R. sphaeroides is far from complete. For example, consider our current knowledge of CL formation. While the construction of a cls- (cardiolipin synthase) has been reported (22), it remains incompletely characterized, and at present there is no information available with respect to whether or not the mutant is altered in its ability to cope with changes in osmolarity. If the gene is found to be important for osmotolerance in R. sphaeroides, it would constitute a reasonable choice for consideration as to whether or not CrpO regulates its expression at the level of transcription.

Cardiolipin has recently caught the attention of researchers in many different fields, as this phospholipid is present in cells belonging to all three domains of life (47). CL concentrations range between only 2 to 14% in bacteria, compared to 20% in mitochondria. However, despite its underrepresentation among phospholipids present in the bacterial membrane it is of considerable interest, because of the important role it plays in many aspects of normal bacterial physiology, such as optimal function of respiratory chains and the photosynthetic reaction center 56

(7, 14, 18, 24). More broadly, changes in CL concentrations are an established feature of adaptation to osmotic stress in many bacteria (13, 34, 35, 42). In addition to changes in CL synthesis, as is true of all phospholipids, the molecule can undergo remodeling by phospholipid acyltransferases (54). Since CL has four acyl groups, as opposed to the two that are components of other phospholipids, such remodeling can and does generate a large number of different molecular species, suggesting CL as a target for remodeling may be particularly important in modulating membrane fluidity. Certainly it is true to say that much further work is required to develop a full understanding of CL metabolism, and that its obvious importance in cell physiology warrants such efforts.

If CrpO is up-regulating fatty acid biosynthesis this could account for the elevated amount of total phospholipid in cells having extra copies of crpO gene, provided the fatty acids are limiting with respect to phospholipid biosynthesis. It is also possible that CrpO is down- regulating genes involved in the breaking down of lipids, which would have the same outcome with respect to phospholipid production.

This study has successfully linked an outward phenotype, increased osmotolerance, to a change at the molecular level, altered membrane composition, which comes about by increasing the crpO copy number. The changes in the membrane described here have been documented in the literature for other bacteria as accounting for increased osmotolerance. While the identity of the crpO target genes remains to be determined, samples and procedures have also been developed here that will make it possible to use qPCR as a rapid and effective means to assess any candidate gene in future. 57

References

1. Abee, T., R. Palmen, K. J. Hellingwerf, and W. N. Konings. 1990. Osmoregulation in

Rhodobacter sphaeroides. J Bacteriol 172:149-54.

2. Bates, P. A., L. A. Kelley, R. M. MacCallum, and M. J. Sternberg. 2001.

Enhancement of protein modeling by human intervention in applying the automatic

programs 3D-JIGSAW and 3D-PSSM. Proteins Suppl 5:39-46.

3. Bates, P. A., and M. J. Sternberg. 1999. Model building by comparison at CASP3:

using expert knowledge and computer automation. Proteins Suppl 3:47-54.

4. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and

purification. Can. J. Biochem. Physiol.:911-917.

5. Boscari, A., K. Mandon, L. Dupont, M.-C. Poggi, and D. Le Rudulier. 2002. BetS Is

a Major Glycine Betaine/Proline Betaine Transporter Required for Early Osmotic

Adjustment in Sinorhizobium meliloti. J Bacteriol 184:2654-2663.

6. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the

restriction and modification of DNA in Escherichia coli. J Mol Biol 41:459-72.

7. Camara-Artigas, A., D. Brune, and J. P. Allen. 2002. Interactions between lipids and

bacterial reaction centers determined by protein crystallography. Proc Natl Acad Sci U S

A 99:11055-60.

8. Catucci, L., N. Depalo, V. M. Lattanzio, A. Agostiano, and A. Corcelli. 2004.

Neosynthesis of cardiolipin in Rhodobacter sphaeroides under osmotic stress.

Biochemistry 43:15066-72. 58

9. Chen, S., J. Vojtechovsky, G. N. Parkinson, R. H. Ebright, and H. M. Berman. 2001.

Indirect readout of DNA sequence at the primary-kink site in the CAP-DNA complex:

DNA binding specificity based on energetics of DNA kinking. J Mol Biol 314:63-74.

10. Chory, J., T. J. Donohue, A. R. Varga, L. A. Staehelin, and S. Kaplan. 1984.

Induction of the photosynthetic membranes of Rhodopseudomonas sphaeroides:

biochemical and morphological studies. J Bacteriol 159:540-54.

11. Contreras-Moreira, B., and P. A. Bates. 2002. Domain fishing: a first step in protein

comparative modelling. Bioinformatics 18:1141-2.

12. Davis, J., T. J. Donohue, and S. C. P. Kaplan. 1988. Construction, characterization,

and complementation of a Puf- mutant of Rhodobacter sphaeroides. J Bacteriol 170:320-

13. De Leo, V., L. Catucci, A. Ventrella, F. Milano, A. Agostiano, and A. Corcelli. 2009.

Cardiolipin increases in chromatophores isolated from Rhodobacter sphaeroides after

osmotic stress: structural and functional roles. J Lipid Res 50:256-64.

14. Dezi, M., F. Francia, A. Mallardi, G. Palazzo, and G. Venturoli. 2007. Confinement

of cardiolipin and ubiquinone in reaction-center core complexes purified from the

photosynthetic bacterium Rhodobacter sphaeroides. Ital J Biochem 56:259-64.

15. Ditta, G., S. Stanfield, D. Corbin, and D. C. P. Helinski. 1980. Broad host range DNA

cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium

meliloti. Proc Natl Acad Sci U S A 77:7347-51.

16. Donohue, T. J., B. D. Cain, and S. Kaplan. 1982. Alterations in the phospholipid

composition of Rhodopseudomonas sphaeroides and other bacteria induced by Tris. The

J Bacteriol 152:595-606. 59

17. Eraso, J. M., and S. Kaplan. 1994. prrA, a putative response regulator involved in

oxygen regulation of photosynthesis gene expression in Rhodobacter sphaeroides. J

Bacteriol 176:32-43.

18. Fyfe, P. K., N. W. Isaacs, R. J. Cogdell, and M. R. Jones. 2004. Disruption of a

specific molecular interaction with a bound lipid affects the thermal stability of the purple

bacterial reaction centre. Biochim Biophys Acta 1608:11-22.

19. Gomelsky, L., J. Sram, O. V. Moskvin, I. M. Horne, H. N. Dodd, J. M. Pemberton,

A. G. McEwan, S. Kaplan, and M. Gomelsky. 2003. Identification and in vivo

characterization of PpaA, a regulator of photosystem formation in Rhodobacter

sphaeroides. Microbiology 149:377-88.

20. Hahne, H., U. Mader, A. Otto, F. Bonn, L. Steil, E. Bremer, M. Hecker, and D.

Becher. 2010. A Comprehensive Proteomics and Transcriptomics Analysis of Bacillus

subtilis Salt Stress Adaptation. J Bacteriol 192:870-882.

21. Higgins, C. F., J. Cairney, D. A. Stirling, L. Sutherland, and I. R. Booth. 1987.

Osmotic regulation of gene expression: ionic strength as an intracellular signal? Trends in

Biochemical Sciences 12:339-344.

22. Hunter, C. N. D., F.; Thurnauer, M.C.; Beatty, J.Th. (Eds.). 2008. The Purple

Phototrophic Bacteria, vol. 28. Springer, Urbana, IL.

23. Jessee, J. 1986. New subcloning-efficiency competent cells: >1 × 106 transformants/µg.

Focus:9.

24. Jones, M. R., P. K. Fyfe, A. W. Roszak, N. W. Isaacs, and R. J. Cogdell. 2002.

Protein-lipid interactions in the purple bacterial reaction centre. Biochim Biophys Acta

1565:206-14. 60

25. Kˆrner, H., H. J. Sofia, and W. G. Zumft. 2003. Phylogeny of the bacterial superfamily

of Crp-Fnr transcription regulators: exploiting the metabolic spectrum by controlling

alternative gene programs. FEMS Microbiol Rev 27:559-92.

26. Kapardar, R. K., R. Ranjan, A. Grover, M. Puri, and R. Sharma. 2010. Identification

and characterization of genes conferring salt tolerance to Escherichia coli from pond

water metagenome. Bioresource technology 101:3917-24.

27. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-

range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-7.

28. Kiley, P. J., and S. C. P. Kaplan. 1988. Molecular genetics of photosynthetic membrane

biosynthesis in Rhodobacter sphaeroides. Microbiol Rev 52:50-69.

29. Kovach, M. E., R. W. Phillips, P. H. Elzer, R. M. Roop, 2nd, and K. M. Peterson.

1994. pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16:800-2.

30. Kwiatkowski, A. V., W. P. Laratta, A. Toffanin, and J. C. P. Shapleigh. 1997.

Analysis of the role of the nnrR gene product in the response of Rhodobacter sphaeroides

2.4.1 to exogenous nitric oxide. J Bacteriol 179:5618-20.

31. Laratta, W. P., and J. P. Shapleigh. 2003. Site-directed mutagenesis of NnrR: a

transcriptional regulator of nitrite and nitric oxide reductase in Rhodobacter sphaeroides.

FEMS Microbiol Lett 229:173-8.

32. Le Rudulier, D., A. R. Strom, A. M. Dandekar, L. T. Smith, and R. C. Valentine.

1984. Molecular biology of osmoregulation. Science 224:1064-8.

33. Leray, D. C. Cyberlipid Center (http://www.cyberlipid.org/). 61

34. Lobasso, S., P. Lopalco, V. M. Lattanzio, and A. Corcelli. 2003. Osmotic shock

induces the presence of glycocardiolipin in the purple membrane of Halobacterium

salinarum. J Lipid Res 44:2120-6.

35. Lopalco, P., S. Lobasso, F. Babudri, and A. Corcelli. 2004. Osmotic shock stimulates

de novo synthesis of two cardiolipins in an extreme halophilic archaeon. J Lipid Res

45:194-201.

36. Losurdo, L., F. Italiano, M. Trotta, R. Gallerani, R. C. Luigi, and F. De Leo. 2010.

Assessment of an internal reference gene in Rhodobacter sphaeroides grown under cobalt

exposure. J Basic Microbiol 50:302-5.

37. Makihara, F., M. Tsuzuki, K. Sato, S. Masuda, K. V. Nagashima, M. Abo, and A.

Okubo. 2005. Role of trehalose synthesis pathways in salt tolerance mechanism of

Rhodobacter sphaeroides f. sp. denitrificans IL106. Arch Microbiol 184:56-65.

38. Marinetti, G. V., and K. Cattieu. 1981. Lipid analysis of cells and chromatophores of

Rhodopseudomonas sphaeroides. Chemistry and Physics of Lipids 28:241-251.

39. Mathew, R., and D. Chatterji. 2006. The evolving story of the omega subunit of

bacterial RNA polymerase. Trends in microbiology 14:450-455.

40. Moskvin, O. V., L. Gomelsky, and M. C. P. Gomelsky. 2005. Transcriptome analysis

of the Rhodobacter sphaeroides PpsR regulon: PpsR as a master regulator of

photosystem development. J Bacteriol 187:2148-56.

41. Pappas, C. T., J. Sram, O. V. Moskvin, P. S. Ivanov, R. C. Mackenzie, M.

Choudhary, M. L. Land, F. W. Larimer, S. Kaplan, and M. C. P. Gomelsky. 2004.

Construction and validation of the Rhodobacter sphaeroides 2.4.1 DNA microarray:

transcriptome flexibility at diverse growth modes. J Bacteriol 186:4748-58. 62

42. Romantsov, T., Z. Guan, and J. M. Wood. 2009. Cardiolipin and the osmotic stress

responses of bacteria. Biochimica et Biophysica Acta (BBA) - Biomembranes

1788:2092-2100.

43. Romantsov, T., S. Helbig, D. E. Culham, C. Gill, L. Stalker, and J. M. Wood. 2007.

Cardiolipin promotes polar localization of osmosensory transporter ProP in Escherichia

coli. Molecular Microbiology 64:1455-1465.

44. Romantsov, T., L. Stalker, D. E. Culham, and J. M. Wood. 2008. Cardiolipin Controls

the Osmotic Stress Response and the Subcellular Location of Transporter ProP in

Escherichia coli. Journal of Biological Chemistry 283:12314-12323.

45. Russell, N. J., and J. C. P. Harwood. 1979. Changes in the acyl lipid composition of

photosynthetic bacteria grown under photosynthetic and non-photosynthetic conditions.

Biochem J 181:339-45.

46. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press.

47. Schlame, M. 2007. Cardiolipin synthesis for the assembly of bacterial and mitochondrial

membranes. Journal of Lipid Research 49:13.

48. Schmid, P. C., V. V. Kumar, B. K. Weis, and H. H. O. Schmid. 1991. Phosphatidyl-

Tris rather than N-acylphosphatidylserine is synthesized by Rhodopseudomonas

sphaeroides grown in Tris-containing media. Biochemistry 30:1746-1751.

49. Simon R., U. P. a. A. P. 1983. A broad host range mobilization system for in vivo

genetic engineering: transposon mutagenesis in Gram-negative bacteria. .

Bio/technology:784–791. 63

50. Sistrom, W. 1960. A requirement for sodium in growth of Rhodopseudomonas

sphaeroides. J. Gen. Microbiol. 22:778-785.

51. Stewart, J. C. M. 1980. Colorimetric determination of phospholipids with ammonium

ferrothiocyanate. Anal. Biochem. 104:10-14.

52. Tosques, I. E., J. Shi, and J. C. P. Shapleigh. 1996. Cloning and characterization of

nnrR, whose product is required for the expression of proteins involved in nitric oxide

metabolism in Rhodobacter sphaeroides 2.4.3. J Bacteriol 178:4958-64.

53. Tsuzuki M, O. M., M Kuribayashi, K Sato, M Abo, M Gomelsky, and J Zeilstra-

Ryalls. unpublished.

54. Waite, M. 1999. The PLD superfamily: insights into catalysis. Biochimica et Biophysica

Acta (BBA)/Molecular and Cell Biology of Lipids 1439:187-197.

55. Xu, X., Abo, M., Okubo, A., Yamazaki, S. 1998. Trehalose as osmoprotectant in

Rhodobacter sphaeroides f. sp. denitrificans IL106. Biosci Biotechnol Biochem 62:334-

56. Zeilstra-Ryalls, J., M. Gomelsky, J. M. Eraso, A. Yeliseev, J. O'Gara, and S.

Kaplan. 1998. Control of Photosystem Formation in Rhodobacter sphaeroides. The

Journal of Bacteriology 180:2801-2809.

57. Zeilstra-Ryalls, J. H., and S. Kaplan. 2004. Oxygen intervention in the regulation of

gene expression: the photosynthetic bacterial paradigm. Cellular and Molecular Life

Sciences 61:417-436-436.

58. Zeilstra-Ryalls, J. H., and S. Kaplan. 1995. Regulation of 5-aminolevulinic acid

synthesis in Rhodobacter sphaeroides 2.4.1: the genetic basis of mutant H-5 auxotrophy.

J Bacteriol 177:2760-8.