DOCSLIB.ORG

Reimeretal2008coralli.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reimeretal2008coralli.Pdf Coral Reefs DOI 10.1007/s00338-008-0389-0 REPORT Morphological and molecular characterization of a new genus and new species of parazoanthid (Anthozoa: Hexacorallia: Zoantharia) associated with Japanese Red Coral J. D. Reimer · M. Nonaka · F. Sinniger · F. Iwase Received: 24 December 2007 / Accepted: 5 May 2008 © Springer-Verlag 2008 Abstract The Order Zoantharia has long been taxonomi- ribosomal DNA [mt 16S rDNA], cytochrome oxidase cally neglected primarily due to diYculty in examining the subunit I [COI], nuclear internal transcribed spacer of internal morphology of sand-encrusted zoanthids. How- ribosomal DNA [ITS-rDNA]) unambiguously place these ever, recent work using molecular markers has shown an specimens in a previously undescribed, new monophyletic unexpectedly high diversity of previously “hidden” taxa lineage within the family Parazoanthidae. Corallizoanthus (families and genera) within Zoantharia (=Zoanthidea, tsukaharai, gen. n. et sp. n. is the Wrst reported zoanthid Zoanthiniaria). In this study, unidentiWed sediment-encrust- species associated with the family Coralliidae and unlike ing zoanthid specimens (n = 8) were collected from living other described gorgonian-associated zoanthids (Savalia Japanese Red Coral Paracorallium japonicum (Family spp.) does not secrete its own hard axis. Morphologically, Coralliidae) during precious coral harvesting by Remotely C. tsukaharai sp. n. is characterized by generally unitary Operated Vehicle (ROV) and manned submersible (February polyps and bright yellow external coloration. 2004–January 2006) at depths of 194–250 m at six locations between Ishigaki-jima Island and Kikai-jima Keywords Zoanthid · Paracorallium · mt 16S rDNA · Island, southern Japan. DNA sequences (mitochondrial 16S COI · ITS-rDNA Communicated by Biology Editor Dr Ruth Gates Electronic supplementary material The online version of this Introduction article (doi:10.1007/s00338-008-0389-0) contains supplementary material, which is available to authorized users. Recent investigations using molecular phylogeny have prompted a reconsideration of species diversity and taxon- & J. D. Reimer ( ) · F. Sinniger omy in a wide variety of marine invertebrates (e.g., Knowl- Department of Chemistry, Biology and Marine Science, Faculty of Science, University of the Ryukyus, 1 Senbaru, Nishihara, ton and Weigt 1997). A proper understanding of marine Okinawa 903-0213, Japan invertebrate diversity levels and how to identify diVerent e-mail: [email protected] taxa is a critical Wrst step not only in further research, but also in making subsequent conservation and management J. D. Reimer Research Program for Marine Biology and Ecology, decisions. Thus, a molecular re-examination of previously Extremobiosphere Research Center, Japan Agency for misunderstood or taxonomically “neglected” taxa is impor- Marine-Earth Science and Technology (JAMSTEC), tant in helping clarify situations where morphological con- 2-15 Natsushima, Yokosuka, Kanagawa 237-0061, Japan clusions are ambiguous. M. Nonaka One such taxonomically “neglected” group is the Order Okinawa Churaumi Aquarium, 424 Ishikawa, Motobu, Zoantharia (=Zoanthiniaria, =Zoanthidea) (Cnidaria: Okinawa 905-0206, Japan Hexacorallia). Zoanthids are generally colonial (but some- times unitary/solitary) benthic hexacorallians having two F. Iwase Biological Institute on Kuroshio, 560 Nishidomari, rows of tentacles and a single ventral siphonoglyph, with Otsuki, Kochi 788-0333, Japan most families except one (Zoanthidae) using sand and other 123 Coral Reefs particles to help make their structure. Despite being world- Korea wide in distribution, the true levels of diversity within this (Cheju I.) Kochi-oki group are unknown (see Ryland and Muirhead 1993; Bur- Kashiwajima nett et al. 1997), although recent investigations strongly China East China X Japan Sea X 30 N indicate the number of genera is much higher than previ- X ously thought using solely traditional morphological identi- s d Kikai n Wcation characteristics such as septa arrangement, sphincter la Is i Izena Pacific Ocean muscle anatomy, etc. A combination of morphological, se an Okinoerabu N X u/ ecological, and molecular methods have resulted in the ky yu Tarama identiWcation of new zoanthid families and genera (i.e., R Miyako 25 N X Reimer et al. 2007a), and species (Reimer et al. 2006a), and X Ishigaki also in the identiWcation of synonymous taxa (Reimer et al. Taiwan 400 km 2004, 2006b). 125 E 130 E 135 E One group within Zoantharia in need of reorganization is the family Parazoanthidae and in particular the genus Para- Fig. 1 Map of sampling locations in this study. Closed circles indicate locations where the zoanthid Corallizoanthus tsukaharai sp. n. was zoanthus. Formerly a “catch-all” for almost any zoanthid found on Japanese Red Coral Paracorallium japonicum (Family not producing a scleroprotein axis (as opposed to the genus Coralliidae). Crosses indicate locations where P. japonicum was Savalia), and in association with sessile marine inverte- found, but with no C. tsukaharai present. Open circles indicate brates, Parazoanthus was shown to be paraphyletic in locations of records in Japan where potential Corallizoanthus speci- mens have been previously found on Coralliidae precious coral Sinniger et al. (2005) through the use of mitochondrial 12S ribosomal DNA and mitochondrial 16S ribosomal DNA (mt 16S rDNA) suggesting the genus Parazoanthus should (ROV) submersible Hakuyo 2000 or the manned submers- be reorganized to include several genera. Each clade can be ible Hakuyo between February 2004 and January 2006 (see relatively easily identiWed by substrate speciWcity (e.g., one Electronic Supplementary Material (ESM) Table S1 for clade primarily associates with hydrozoans, etc.), and all sampling details). Both submersibles were operated by clades form well-supported phylogenetic monophyletic SNK Ocean Co. Ltd. (Tokyo, Japan), and observation of groups based on obtained molecular data (Sinniger et al. harvesting by Okinawa Churaumi Aquarium (hereafter des- 2005). ignated “OCA”, Motobu, Japan) staV was undertaken In this study, specimens (n = 8) of an unknown azooxan- through a collaborative agreement. As part of the observa- thellate zoanthid were found living on seven living Japa- tion agreement and as precious coral harvesting is strictly nese Red Coral Paracorallium japonicum (Family regulated and subject to potential poaching, the exact coor- Coralliidae) colonies at six locations (depths 194–250 m) in dinates of the precious coral sampling locations cannot be southern Japan during commercial precious coral harvest- divulged. ing. As no previously described zoanthids are known to During commercial precious coral harvesting, 86 living associate with Coralliidae precious coral species, collected Coralliidae specimens were collected. Specimens were specimens were examined using molecular (cytochrome identiWed according to Kishinouye (1903, 1904), Bayer oxidase subunit I [COI], mt 16S rDNA, internal transcribed (1956), and Bayer and Cairns (2003). 50 specimens had spacer of ribosomal DNA [ITS-rDNA]), ecological (sub- prickle-like twigs on the front and sides of branches, dark strate, depth, water temperature), and morphological (polyp red axes with nearly white branch tips, and eight-radiate dimensions, mesentery and tentacle count, polyp and col- sclerites dominating the coenenchyme, and were identiWed ony structure, nematocyst type) data to characterize these as Paracorallium japonicum (Kishinouye 1903). Seven of enigmatic zoanthids’ phylogenetic position within the order these specimens had unknown zoanthids associated with Zoantharia. them. Most zoanthids (n = 6) were photographed and immedi- ately preserved in 99.5% ethanol, excepting two specimens Materials and methods (OCACn20040228-001 and OCACn20040228-002; both on the same P. japonicum colony; see ESM Table S1), Sample collection and identiWcation of precious corals which were brought back to OCA live in an aquarium for further observation following procedures as in Nonaka The zoanthid samples were obtained at depths of 194– et al. (2006). As the submersibles used had no high-resolu- 250 m from six locations between Kikai-jima and Ishigaki- tion cameras, no high-resolution in situ images were jima, Japan (Fig. 1) during commercial precious coral har- obtained, and detailed images of living specimens were vesting dives using either the Remotely Operated Vehicle instead obtained in the aquarium at OCA. 123 Coral Reefs DNA extraction, PCR ampliWcation, and sequencing The alignments were inspected by eye and manually edited. All ambiguous sites of the alignments ((i.e., codes that were DNA was extracted from six of the collected zoanthid sam- not G, C, T, or A; n = <10 for all alignments) were removed ples (Table S1) (5–20 mg) following procedures outlined in from the dataset or edited based on other zoanthid sequences Reimer et al. (2004) by using a DNEasy Tissue Kit for ani- for phylogenetic analyses. Consequently, three alignment mals (QIAGEN, Tokyo, Japan). datasets were generated: (1) 784 sites of 23 taxa (mt 16S The mitochondrial cytochrome oxidase c subunit I (COI) rDNA), (2) 310 sites of 31 taxa (the COI gene) and (3) 905 gene was ampliWed using the zoanthid-speciWc primers sites of 9 taxa (ITS-rDNA). Phylogenetic analyses of ITS- COIZoanF (3Ј TGATAAGGTTAGAACTTTCTGCCCCG rDNA sequences included only sequences from Parazoan- GAAC 5Ј) and COIZoanR (3Ј AGGCTAAATATAGCCA thidae as other families such as Zoanthidae and Abyssoan- TGTCCACG 5Ј) (Reimer
Load more

Recommended publications
  • Di Camillo Et Al 2017
    This is a post-peer-review, pre-copyedit version of an article published in Biodiversity and Conservation on 23 December 2017 (First Online). The final authenticated version is available online at: https://doi.org/10.1007/s10531-017-1492-8 https://link.springer.com/article/10.1007%2Fs10531-017-1492-8 An embargo period of 12 months applies to this Journal. This paper has received funding from the European Union (EU)’s H2020 research and innovation programme under the Marie Sklodowska-Curie grant agreement No 643712 to the project Green Bubbles RISE for sustainable diving (Green Bubbles). This paper reflects only the authors’ view. The Research Executive Agency is not responsible for any use that may be made of the information it contains. © 2017. This manuscript version is made available under the CC-BY-NC-ND 4.0 AUTHORS' ACCEPTED MANUSCRIPT Building a baseline for habitat-forming corals by a multi-source approach, including Web Ecological Knowledge - Cristina G Di Camillo, Department of Life and Environmental Sciences, Marche Polytechnic University, CoNISMa, Ancona, Italy, [email protected] - Massimo Ponti, Department of Biological, Geological and Environmental Sciences and Interdepartmental Research Centre for Environmental SciencesUniversity of Bologna, CoNISMa, Ravenna, Italy - Giorgio Bavestrello, Department of Earth, Environment and Life Sciences, University of Genoa, CoNISMa, Genoa, Italy - Maja Krzelj, Department of Marine Studies, University of Split, Split, Croatia - Carlo Cerrano, Department of Life and Environmental Sciences, Marche Polytechnic University, CoNISMa, Ancona, Italy Received: 12 January 2017 Revised: 10 December 2017 Accepted: 14 December 2017 First online: 23 December 2017 Cite as: Di Camillo, C.G., Ponti, M., Bavestrello, G.
    [Show full text]
  • Ecological Mapping and Data Quality Assessment for the Needs of Ecosystem-Based Marine Spatial Management: Case Study Greek Ionian Sea and the Adjacent Gulfs
    Research Article Mediterranean Marine Science Indexed in WoS (Web of Science, ISI Thomson) and SCOPUS The journal is available on line at http://www.medit-mar-sc.net Ecological mapping and data quality assessment for the needs of ecosystem-based marine spatial management: case study Greek Ionian Sea and the adjacent gulfs Y. ISSARIS1,2, S. KATSANEVAKIS1,3, M. PANTAZI1, V. VASSILOPOULOU1, P. PANAYOTIDIS4, S. KAVADAS1, A. KOKKALI1, M. SALOMIDI4, A. FRANTZIS5, A. PANOU6, D. DAMALAS1,7, D. KLAOUDATOS1, D. SAKELLARIOU4, V. DRAKOPOULOU4, C. KYRIAKIDOU4, I. MAINA1, J. FRIC8, C. SMITH1, S. GIAKOUMI1 and G. KARRIS9 1 Institute of Marine Biological Resources, Hellenic Centre for Marine Research, Ag. Kosmas, Greece 2 Sector of Zoology and Marine Biology, Department of Biology, University of Athens, Zografos, Greece 3 European Commission, Joint Research Centre, Institute for Environment and Sustainability, Ispra, Italy 4 Institute of Oceanography, Hellenic Centre for Marine Research, Anavyssos, Greece 5 Pelagos Cetacean Research Institute, Vouliagmeni, Greece 6 Archipelagos – environment and development, Kifissia, Greece 7 European Commission, Joint Research Centre, Institute for the Protection and Security of the Citizen, Ispra, Italy 8 Hellenic Ornithological Society, Athens, Greece 9 Department of Environmental Technology and Ecology, TEI of the Ionian Islands, Zakynthos Island, Greece Corresponding author: [email protected] Received: 30 April 2012; Accepted: 2 November 2012; Published on line: 19 November 2012 Abstract Mapping of ecosystem components (natural and socioeconomic) is a prerequisite for ecosystem-based marine spatial manage- ment (EB-MSM). To initiate the process of EB-MSM in the Greek Ionian Sea and the adjacent gulfs, the main relevant ecosystem components were mapped based on existing spatial information and expert judgment.
    [Show full text]
  • Updated Classification of Benthic Marine Habitat Types for The
    Updated Classification of Benthic Marine Habitat Types for the Mediterranean Region TUNISIA - 2019 Legal notice: The designations employed and the presentation of the material in this document do not imply the expression of any opinion whatsoever on the part of the Specially Protected Areas Regional Activity Centre (SPA/RAC) and UN Environment/Mediterranean Action Plan (MAP) and those of the Lebanese Ministry of Environment concerning the legal status of any State, Territory, city or area, or of its authorities, or concerning the delimitation of their frontiers or boundaries. This publication was produced with the fi nancial support of the European Union in the framework of the MedMPA Network Project. Its contents are the sole responsibility of SPA/RAC and do not necessarily refl ect the views of the European Union. Copyright : All property rights of texts and content of different types of this publication belong to SPA/RAC. Reproduction of these texts and contents, in whole or in part, and in any form, is prohibited without prior written permission from SPA/RAC, except for educational and other non-commercial purposes, provided that the source is fully acknowledged. © 2019 - United Nations Environment Programme Mediterranean Action Plan Specially Protected Areas Regional Activity Centre (SPA/RAC) Boulevard du Leader Yasser Arafat B.P. 337 1080 Tunis Cedex - Tunisia. [email protected] For bibliographic purposes, this document may be cited as: SPA/RAC–UN Environment/MAP, 2019: Updated Classifi cation of Benthic Marine Habitat Types for the Mediterranean Region Layout : Atef OUERGHI Cover photos credit: © SPA/RAC, University of Seville, University of Alicante, Trainito E.
    [Show full text]
  • Composition and Abundance of Octocorals in the Sea of Marmara, Where the Mediterranean Meets the Black Sea
    SCIENTIA MARINA 79(1) March 2015, 125-135, Barcelona (Spain) ISSN-L: 0214-8358 doi: http://dx.doi.org/10.3989/scimar.04120.09A Composition and abundance of octocorals in the Sea of Marmara, where the Mediterranean meets the Black Sea Eda N. Topçu 1,2, Bayram Öztürk 1,2 1 Istanbul University Fisheries Faculty, Ordu cad No 200 Laleli, 34470 Istanbul, Turkey. E-mail: [email protected] 2 Turkish Marine Research Foundation, No 10, Beykoz, 81650, Istanbul, Turkey. Summary: Species composition and abundance of octocoral assemblages were investigated in the Sea of Marmara, which forms the connection between the Mediterranean and the Black Seas, two semi-enclosed seas with peculiar oceanographic conditions. Fourteen octocoral species were collected in the saline layer of the Marmara Sea (20-40 m), with a mean coral abundance of 5.21±5.11 colonies m–2 (mean ± SD) calculated from a total of 1390 colonies counted in transects. In spite of severe anthropogenic disturbances, dense assemblages of corals/gorgonians were observed during this study. The coral- ligenous communities—one of the most valuable structures of the Mediterranean Sea—harbored either Eunicella cavolini or Paramuricea macrospina as the dominant gorgonian in the Marmara Sea. Furthermore, the gorgonian assemblages of the Marmara Sea differed from those of the Mediterranean in their high abundance of P. macrospina and Spinimuricea klavereni, two species rarely encountered in the Mediterranean Sea at the studied depth range. The factors behind the observed differ- ences are discussed in regard to the particular oceanographic conditions of the Marmara Sea. Finally, we revised the main threats to corals/gorgonians in the Marmara Sea and provided some insights on management recommendations for coral conservation in this area.
    [Show full text]
  • Integralni Program Monitoringa Crna Gora
    Integralni program monitoringa Crna Gora Impresum Glavna koordinatorka: Nada Krstulović Koordinacija projektnih Ivana Stojanović, Marina Marković, Anis Zarrouk, Ivan Sekovski, Milena Bataković, Ivana Mitrović, Daniel Cebrian timova: Autori: EO1: Vesna Mačić, Slavica Petović i Ivan Guala (bentoski habitati); Mirko Đurović, Zdravko Ikica, Draško Holcer i Yakup Kaska (morski sisari i morske kornjače), Darko Saveljić i Marco Zenatello (morske ptice); Nada Krstulović, Dragana Drakulović i Branka Pestorić (plankton) EO2: Vesna Mačić, Argyro Zenetos EO3: Aleksandar Joksimović EO5: Robert Precali, Danijela Šuković, Jelena Rešetar, Vladimir Živković EO7: Luka Čalić, Radovan Kandić, Olivier Brivois EO8: Željka Čurović, Ivan Sekovski EO9: Danijela Šuković, Jelena Knežević, Carlos Guitart, Vladimir Živković, Aleksandra Ivanović, Darinka Joksimović EO10: Milica Mandić, Christos Ioakemidis Karte: Robert Precali Uređivanje: Dizajn naslovne strane: swim2birds.co.uk Grafički dizajn: Ljudomat Prevod: Mia Laušević Fotografija naslovne strane: Acanthella cannabina, Dražin vrt (Crna Gora) © Egidio Trainito Upotrijebljene odrednice i materijali prikazani u ovom dokumentu ne izražavaju mišljenje UNEP/MAP-a u pogledu pravnog statusa države, teritorije, grada ili oblasti, ili njihovih organa vlasti, ili u pogledu linija razgraničenja ili državnih granica. Ovu studiju izradili su PAP/RAC, SPA/RAC, UNEP/MAP i Ministarstvo ekologije, prostornog planiranja i urbanizma Crne Gore u okviru "GEF Adriatik" projekta, uz podršku Globalnog fonda za životnu sredinu (GEF).
    [Show full text]
  • Cnidaria: Hexacorallia: Zoantharia
    ARTICLE IN PRESS Organisms, Diversity & Evolution 9 (2009) 23–36 www.elsevier.de/ode Zoanthids (Cnidaria: Hexacorallia: Zoantharia) from shallow waters of the southern Chilean fjord region, with descriptions of a new genus and two new species Frederic Sinnigera,Ã, Verena Ha¨ussermannb,c aDepartment of Chemistry, Biology and Marine Science, University of the Ryukyus, 1 Senbaru, Nishihara, Okinawa 903-0213, Japan bFundacio´n Huinay, Puerto Montt, Chile cEscuela de Ciencias del Mar, Facultad de Recursos Naturales, Pontificia Universidad Cato´lica de Valparaı´so, Avda. Brazil 2950, Valparaı´so, Chile Received 27 June 2008; accepted 25 September 2008 Abstract The taxonomy of the order Zoantharia (¼ Zoanthidea ¼ Zoanthiniaria) is greatly hampered by the paucity of diagnostic morphological features. To facilitate discrimination between similar zoanthids, a combination of morphological and molecular analyses is applied here. The three most abundant zoanthid species in shallow waters of the southern Chilean fjord region are described. Comparison with other zoanthids using molecular markers reveals that two of them are new to science; these are described as Mesozoanthus fossii gen. n., sp. n. and Epizoanthus fiordicus sp. n. Their representatives grow on rocky substratum and do not live in symbiosis with demosponges. In the less abundant M. fossii, animals are greyish in colour and resemble members of Parazoanthus in growth form. Individual polyps can be up to 35 mm long. The more abundant E. fiordicus are also greyish; the polyps arise from thin stolons and reach only 12 mm in length. The third species studied is Parazoanthus elongatus McMurrich, 1904. For these three Chilean zoanthid species, in-situ photographs are presented as well as information on distribution, habitat and associated species.
    [Show full text]
  • The Earliest Diverging Extant Scleractinian Corals Recovered by Mitochondrial Genomes Isabela G
    www.nature.com/scientificreports OPEN The earliest diverging extant scleractinian corals recovered by mitochondrial genomes Isabela G. L. Seiblitz1,2*, Kátia C. C. Capel2, Jarosław Stolarski3, Zheng Bin Randolph Quek4, Danwei Huang4,5 & Marcelo V. Kitahara1,2 Evolutionary reconstructions of scleractinian corals have a discrepant proportion of zooxanthellate reef-building species in relation to their azooxanthellate deep-sea counterparts. In particular, the earliest diverging “Basal” lineage remains poorly studied compared to “Robust” and “Complex” corals. The lack of data from corals other than reef-building species impairs a broader understanding of scleractinian evolution. Here, based on complete mitogenomes, the early onset of azooxanthellate corals is explored focusing on one of the most morphologically distinct families, Micrabaciidae. Sequenced on both Illumina and Sanger platforms, mitogenomes of four micrabaciids range from 19,048 to 19,542 bp and have gene content and order similar to the majority of scleractinians. Phylogenies containing all mitochondrial genes confrm the monophyly of Micrabaciidae as a sister group to the rest of Scleractinia. This topology not only corroborates the hypothesis of a solitary and azooxanthellate ancestor for the order, but also agrees with the unique skeletal microstructure previously found in the family. Moreover, the early-diverging position of micrabaciids followed by gardineriids reinforces the previously observed macromorphological similarities between micrabaciids and Corallimorpharia as
    [Show full text]
  • Cnidarian Phylogenetic Relationships As Revealed by Mitogenomics Ehsan Kayal1,2*, Béatrice Roure3, Hervé Philippe3, Allen G Collins4 and Dennis V Lavrov1
    Kayal et al. BMC Evolutionary Biology 2013, 13:5 http://www.biomedcentral.com/1471-2148/13/5 RESEARCH ARTICLE Open Access Cnidarian phylogenetic relationships as revealed by mitogenomics Ehsan Kayal1,2*, Béatrice Roure3, Hervé Philippe3, Allen G Collins4 and Dennis V Lavrov1 Abstract Background: Cnidaria (corals, sea anemones, hydroids, jellyfish) is a phylum of relatively simple aquatic animals characterized by the presence of the cnidocyst: a cell containing a giant capsular organelle with an eversible tubule (cnida). Species within Cnidaria have life cycles that involve one or both of the two distinct body forms, a typically benthic polyp, which may or may not be colonial, and a typically pelagic mostly solitary medusa. The currently accepted taxonomic scheme subdivides Cnidaria into two main assemblages: Anthozoa (Hexacorallia + Octocorallia) – cnidarians with a reproductive polyp and the absence of a medusa stage – and Medusozoa (Cubozoa, Hydrozoa, Scyphozoa, Staurozoa) – cnidarians that usually possess a reproductive medusa stage. Hypothesized relationships among these taxa greatly impact interpretations of cnidarian character evolution. Results: We expanded the sampling of cnidarian mitochondrial genomes, particularly from Medusozoa, to reevaluate phylogenetic relationships within Cnidaria. Our phylogenetic analyses based on a mitochogenomic dataset support many prior hypotheses, including monophyly of Hexacorallia, Octocorallia, Medusozoa, Cubozoa, Staurozoa, Hydrozoa, Carybdeida, Chirodropida, and Hydroidolina, but reject the monophyly of Anthozoa, indicating that the Octocorallia + Medusozoa relationship is not the result of sampling bias, as proposed earlier. Further, our analyses contradict Scyphozoa [Discomedusae + Coronatae], Acraspeda [Cubozoa + Scyphozoa], as well as the hypothesis that Staurozoa is the sister group to all the other medusozoans. Conclusions: Cnidarian mitochondrial genomic data contain phylogenetic signal informative for understanding the evolutionary history of this phylum.
    [Show full text]
  • Hourigan TF, Etnoyer PJ, Cairns SD (2017) Introduction to the State of Deep‐Sea Coral and Sponge Ecosystems of the United States
    Introduction to the State of Deep-Sea Coral and Sponge Ecosystems of the United States Chapter 1 in The State of Deep‐Sea Coral and Sponge Ecosystems of the United States Report Recommended citation: Hourigan TF, Etnoyer PJ, Cairns SD (2017) Introduction to the State of Deep‐Sea Coral and Sponge Ecosystems of the United States. In: Hourigan TF, Etnoyer, PJ, Cairns, SD (eds.). The State of Deep‐Sea Coral and Sponge Ecosystems of the United States. NOAA Technical Memorandum NMFS‐OHC‐4, Silver Spring, MD. 38 p. Available online: http://deepseacoraldata.noaa.gov/library. Iridogorgia soft coral with squat lobsters in the northwestern Gulf of Mexico. Courtesy of the NOAA Office of Ocean xii Exploration and Research. INTRODUCTION TO THE STATE OF DEEP‐SEA CORAL AND SPONGE ECOSYSTEMS OF THE UNITED STATES INTRODUCTION TO THE Thomas F. STATE OF DEEP-SEA Hourigan1*, Peter J. CORAL AND SPONGE Etnoyer2, and ECOSYSTEMS OF THE Stephen D. Cairns3 UNITED STATES 1 NOAA Deep Sea Coral Research and Technology Program, Office of Habitat Conservation, Silver I. Introduction Spring, MD * Corresponding Author: Large, long‐lived, sessile organisms contribute structural [email protected] complexity to seafloor habitats and play an important role in marine ecosystems. In deep or cold oceanic waters, corals and 2 NOAA Center for Coastal sponges are the most important organisms forming such biogenic Monitoring and Assessment, National habitats (Roberts et al. 2009, Buhl‐Mortensen et al. 2010, Hogg et al. Centers for Coastal Ocean 2010, Rossi et al. 2017). They increase the physical heterogeneity of Science, Charleston, SC habitat, provide refuge and substrate, increase the number and 3 National Museum of availability of micro‐habitats for other organisms, and thereby Natural History, create hotspots of biological diversity in the deep sea.
    [Show full text]
  • Review of Trade in Ornamental Coral, Coral Products and Reef Associated Species to the United States
    © Anja G. Burns / WWF-US Review of Trade in Ornamental Coral, Coral Products and Reef Associated Species to the United States November 2012 World Wildlife Fund, Washington DC 1 © WWF. 2012 All rights reserved. This material has no commercial purposes. The reproduction of the material contained in this product is prohibited for sale or other commercial purposes. Any reproduction in full or in part of this publication must credit WWF as copyright owner. The document was financed by Kingfisher Foundation. The opinions, findings and conclusions stated herein are those of the author[s] and do not necessarily reflect those of the donor and partner organizations listed in the acknowledgements. Suggested citation: Craig, V., Allan, C., Lyet, A. Brittain, A., Richman, E, 2011. Review of trade in ornamental coral, coral products and reef associated species to the United States. World Wildlife Fund, Washington DC. USA, 2 Acknowledgements Many people were involved in the production of this report. The US trade data analyses in this report were produced by Valerie Craig and Arnaud Lyet PhD The project was managed by and conclusions drawn by Crawford Allan Research and case studies were provided by Anna Brittain and Eliza Richman Additional research and product production by Ben Freitas Aquaria trade research by Brendan Galloway The production team would like to thank the following people for their critical inputs towards this report: Environmental Defense Fund: Cara Cooper, Ted Morton Defenders of Wildlife: Daniel Thornhill Humane Society International: Teresa Telecky WWF: America Pintabutr, Roberta Elias, Elizabeth Schuler, TRAFFIC: Ernie Cooper, Steve Broad, Julie Gray for report reviews 3 Contents Acknowledgements ...................................................................................................................................
    [Show full text]
  • Characterization of the Zooxanthellate and Azooxanthellate Morphotypes of the Mediterranean Gorgonian Eunicella Singularis
    Mar Biol (2012) 159:1485–1496 DOI 10.1007/s00227-012-1928-3 ORIGINAL PAPER Characterization of the zooxanthellate and azooxanthellate morphotypes of the Mediterranean gorgonian Eunicella singularis Andrea Gori • Lorenzo Bramanti • Pablo Lo´pez-Gonza´lez • Jana N. Thoma • Josep-Maria Gili • Jordi Grinyo´ • Vanessa Uceira • Sergio Rossi Received: 26 September 2011 / Accepted: 14 March 2012 / Published online: 18 April 2012 Ó Springer-Verlag 2012 Abstract The gorgonian Eunicella singularis (Esper, with more ramified colonies at 40–60 m lacks symbionts. 1794) is abundant on rocky bottoms at Cap de Creus Sclerite differences among colonies were also identified (42°1804900 N; 003°1902300 E) in the western Mediterranean, along the depth gradient. The mitochondrial marker msh1 and this study compared zooxanthellate colonies from did not discriminate between the two morphotypes and relatively shallow depths with azooxanthellate colonies indeed did not discriminate among several Mediterranean living at depths to 60 m. The goal was to determine the species of Eunicella. Other genetic markers will be needed taxonomic status of a previously described subspecies, to firmly establish the taxonomic status of the two depth- E. singularis aphyta. Sampling at 10-m intervals from 20 to related morphotypes. 60 m using scuba or a remotely operated vehicle (ROV) in 2004 and 2010 allowed examination of colony shape, sclerite variability, genetic variability, and the presence/ Introduction absence of zooxanthellae. Two morphotypes were identi- fied: a shallow morphotype with candelabra-like colonies Morphological variation is ubiquitous within coral species, at 20–30 m has zooxanthellae, while a deep morphotype creating significant challenges for the advancement of taxonomic, evolutionary, and ecological studies (Vermeij et al.
    [Show full text]
  • Mediterranean Deep-Sea Corals in Need of Protection July 2013
    Mediterranean deep-sea corals in need of protection July 2013 Since the entry into force of the SPA/BD Protocol and its Annexes several amendments have been adopted in the framework of the Barcelona Convention bringing up to more than 150 the number of species listed in Annex II and more than 40 the number of species listed in Annex III. Such modifications have corresponded to different additions of species of flora, fish and birds. However, cnidarians group remain today represented only by Astroides calycularis, Errina aspera and Gerardia savaglia (Savalia savaglia) in Annex II, and Antipathes sp.plur. and Corallium rubrum in Annex III. Despite the important role of deep-sea corals for ecosystem functioning, they are neither sufficiently represented in the SPA/BD Protocol nor protected by the existing MPA network in the Mediterranean Sea. Up to date, this fact could have been justified by the lack of information for open and deep-sea environments in the Mediterranean basin. However, according to last years’ findings and scientific publications related to deep-sea corals, apart from the threats they are facing, there is an imperative need to amend the Annexes for an appropriate and urgent consideration of deep-sea corals. These fragile habitats are commonly found in summits and flanks of seamounts or submarine canyons among other deep-sea geological features. Furthermore, their occurrence is frequently patched accompanying other important habitats like sponge grounds (e.g. Asconema setubalense, Phakellia robusta, Pachastrella monilifera). Coral aggregations have been identified as special ecological features which require protection under the Convention of Biological Diversity [UNEP/CBD/EWS.MPA/1/2].
    [Show full text]