Coral Reefs DOI 10.1007/s00338-008-0389-0 REPORT Morphological and molecular characterization of a new genus and new species of parazoanthid (Anthozoa: Hexacorallia: Zoantharia) associated with Japanese Red Coral J. D. Reimer · M. Nonaka · F. Sinniger · F. Iwase Received: 24 December 2007 / Accepted: 5 May 2008 © Springer-Verlag 2008 Abstract The Order Zoantharia has long been taxonomi- ribosomal DNA [mt 16S rDNA], cytochrome oxidase cally neglected primarily due to diYculty in examining the subunit I [COI], nuclear internal transcribed spacer of internal morphology of sand-encrusted zoanthids. How- ribosomal DNA [ITS-rDNA]) unambiguously place these ever, recent work using molecular markers has shown an specimens in a previously undescribed, new monophyletic unexpectedly high diversity of previously “hidden” taxa lineage within the family Parazoanthidae. Corallizoanthus (families and genera) within Zoantharia (=Zoanthidea, tsukaharai, gen. n. et sp. n. is the Wrst reported zoanthid Zoanthiniaria). In this study, unidentiWed sediment-encrust- species associated with the family Coralliidae and unlike ing zoanthid specimens (n = 8) were collected from living other described gorgonian-associated zoanthids (Savalia Japanese Red Coral Paracorallium japonicum (Family spp.) does not secrete its own hard axis. Morphologically, Coralliidae) during precious coral harvesting by Remotely C. tsukaharai sp. n. is characterized by generally unitary Operated Vehicle (ROV) and manned submersible (February polyps and bright yellow external coloration. 2004–January 2006) at depths of 194–250 m at six locations between Ishigaki-jima Island and Kikai-jima Keywords Zoanthid · Paracorallium · mt 16S rDNA · Island, southern Japan. DNA sequences (mitochondrial 16S COI · ITS-rDNA Communicated by Biology Editor Dr Ruth Gates Electronic supplementary material The online version of this Introduction article (doi:10.1007/s00338-008-0389-0) contains supplementary material, which is available to authorized users. Recent investigations using molecular phylogeny have prompted a reconsideration of species diversity and taxon- & J. D. Reimer ( ) · F. Sinniger omy in a wide variety of marine invertebrates (e.g., Knowl- Department of Chemistry, Biology and Marine Science, Faculty of Science, University of the Ryukyus, 1 Senbaru, Nishihara, ton and Weigt 1997). A proper understanding of marine Okinawa 903-0213, Japan invertebrate diversity levels and how to identify diVerent e-mail: [email protected] taxa is a critical Wrst step not only in further research, but also in making subsequent conservation and management J. D. Reimer Research Program for Marine Biology and Ecology, decisions. Thus, a molecular re-examination of previously Extremobiosphere Research Center, Japan Agency for misunderstood or taxonomically “neglected” taxa is impor- Marine-Earth Science and Technology (JAMSTEC), tant in helping clarify situations where morphological con- 2-15 Natsushima, Yokosuka, Kanagawa 237-0061, Japan clusions are ambiguous. M. Nonaka One such taxonomically “neglected” group is the Order Okinawa Churaumi Aquarium, 424 Ishikawa, Motobu, Zoantharia (=Zoanthiniaria, =Zoanthidea) (Cnidaria: Okinawa 905-0206, Japan Hexacorallia). Zoanthids are generally colonial (but some- times unitary/solitary) benthic hexacorallians having two F. Iwase Biological Institute on Kuroshio, 560 Nishidomari, rows of tentacles and a single ventral siphonoglyph, with Otsuki, Kochi 788-0333, Japan most families except one (Zoanthidae) using sand and other 123 Coral Reefs particles to help make their structure. Despite being world- Korea wide in distribution, the true levels of diversity within this (Cheju I.) Kochi-oki group are unknown (see Ryland and Muirhead 1993; Bur- Kashiwajima nett et al. 1997), although recent investigations strongly China East China X Japan Sea X 30 N indicate the number of genera is much higher than previ- X ously thought using solely traditional morphological identi- s d Kikai n Wcation characteristics such as septa arrangement, sphincter la Is i Izena Pacific Ocean muscle anatomy, etc. A combination of morphological, se an Okinoerabu N X u/ ecological, and molecular methods have resulted in the ky yu Tarama identiWcation of new zoanthid families and genera (i.e., R Miyako 25 N X Reimer et al. 2007a), and species (Reimer et al. 2006a), and X Ishigaki also in the identiWcation of synonymous taxa (Reimer et al. Taiwan 400 km 2004, 2006b). 125 E 130 E 135 E One group within Zoantharia in need of reorganization is the family Parazoanthidae and in particular the genus Para- Fig. 1 Map of sampling locations in this study. Closed circles indicate locations where the zoanthid Corallizoanthus tsukaharai sp. n. was zoanthus. Formerly a “catch-all” for almost any zoanthid found on Japanese Red Coral Paracorallium japonicum (Family not producing a scleroprotein axis (as opposed to the genus Coralliidae). Crosses indicate locations where P. japonicum was Savalia), and in association with sessile marine inverte- found, but with no C. tsukaharai present. Open circles indicate brates, Parazoanthus was shown to be paraphyletic in locations of records in Japan where potential Corallizoanthus speci- mens have been previously found on Coralliidae precious coral Sinniger et al. (2005) through the use of mitochondrial 12S ribosomal DNA and mitochondrial 16S ribosomal DNA (mt 16S rDNA) suggesting the genus Parazoanthus should (ROV) submersible Hakuyo 2000 or the manned submers- be reorganized to include several genera. Each clade can be ible Hakuyo between February 2004 and January 2006 (see relatively easily identiWed by substrate speciWcity (e.g., one Electronic Supplementary Material (ESM) Table S1 for clade primarily associates with hydrozoans, etc.), and all sampling details). Both submersibles were operated by clades form well-supported phylogenetic monophyletic SNK Ocean Co. Ltd. (Tokyo, Japan), and observation of groups based on obtained molecular data (Sinniger et al. harvesting by Okinawa Churaumi Aquarium (hereafter des- 2005). ignated “OCA”, Motobu, Japan) staV was undertaken In this study, specimens (n = 8) of an unknown azooxan- through a collaborative agreement. As part of the observa- thellate zoanthid were found living on seven living Japa- tion agreement and as precious coral harvesting is strictly nese Red Coral Paracorallium japonicum (Family regulated and subject to potential poaching, the exact coor- Coralliidae) colonies at six locations (depths 194–250 m) in dinates of the precious coral sampling locations cannot be southern Japan during commercial precious coral harvest- divulged. ing. As no previously described zoanthids are known to During commercial precious coral harvesting, 86 living associate with Coralliidae precious coral species, collected Coralliidae specimens were collected. Specimens were specimens were examined using molecular (cytochrome identiWed according to Kishinouye (1903, 1904), Bayer oxidase subunit I [COI], mt 16S rDNA, internal transcribed (1956), and Bayer and Cairns (2003). 50 specimens had spacer of ribosomal DNA [ITS-rDNA]), ecological (sub- prickle-like twigs on the front and sides of branches, dark strate, depth, water temperature), and morphological (polyp red axes with nearly white branch tips, and eight-radiate dimensions, mesentery and tentacle count, polyp and col- sclerites dominating the coenenchyme, and were identiWed ony structure, nematocyst type) data to characterize these as Paracorallium japonicum (Kishinouye 1903). Seven of enigmatic zoanthids’ phylogenetic position within the order these specimens had unknown zoanthids associated with Zoantharia. them. Most zoanthids (n = 6) were photographed and immedi- ately preserved in 99.5% ethanol, excepting two specimens Materials and methods (OCACn20040228-001 and OCACn20040228-002; both on the same P. japonicum colony; see ESM Table S1), Sample collection and identiWcation of precious corals which were brought back to OCA live in an aquarium for further observation following procedures as in Nonaka The zoanthid samples were obtained at depths of 194– et al. (2006). As the submersibles used had no high-resolu- 250 m from six locations between Kikai-jima and Ishigaki- tion cameras, no high-resolution in situ images were jima, Japan (Fig. 1) during commercial precious coral har- obtained, and detailed images of living specimens were vesting dives using either the Remotely Operated Vehicle instead obtained in the aquarium at OCA. 123 Coral Reefs DNA extraction, PCR ampliWcation, and sequencing The alignments were inspected by eye and manually edited. All ambiguous sites of the alignments ((i.e., codes that were DNA was extracted from six of the collected zoanthid sam- not G, C, T, or A; n = <10 for all alignments) were removed ples (Table S1) (5–20 mg) following procedures outlined in from the dataset or edited based on other zoanthid sequences Reimer et al. (2004) by using a DNEasy Tissue Kit for ani- for phylogenetic analyses. Consequently, three alignment mals (QIAGEN, Tokyo, Japan). datasets were generated: (1) 784 sites of 23 taxa (mt 16S The mitochondrial cytochrome oxidase c subunit I (COI) rDNA), (2) 310 sites of 31 taxa (the COI gene) and (3) 905 gene was ampliWed using the zoanthid-speciWc primers sites of 9 taxa (ITS-rDNA). Phylogenetic analyses of ITS- COIZoanF (3Ј TGATAAGGTTAGAACTTTCTGCCCCG rDNA sequences included only sequences from Parazoan- GAAC 5Ј) and COIZoanR (3Ј AGGCTAAATATAGCCA thidae as other families such as Zoanthidae and Abyssoan- TGTCCACG 5Ј) (Reimer