DOCSLIB.ORG

Fine Mapping and Candidate Gene Analyses of Murine Lung Tumor Susceptibility Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fine Mapping and Candidate Gene Analyses of Murine Lung Tumor Susceptibility Genes FINE MAPPING AND CANDIDATE GENE ANALYSES OF MURINE LUNG TUMOR SUSCEPTIBILITY GENES DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Min Wang, B.S. ***** The Ohio State University 2003 Dissertation Committee: Approved by Professor Ming You, Advisor Advisor Professor Christoph Plass, Co-advisor Professor Gary Stoner Co-advisor Molecular Virology, Immunology and Professor Yian Wang Medical Genetics Graduate Program ABSTRACT Lung cancer is the leading cause of cancer death in men and women in the United States. While the exposure to tobacco smoking and other environmental carcinogens represents the main risk factors, it has been clear that inherited components may be also involved in the development of lung cancer. Segregation analysis has revealed that susceptibility of the human population to different forms of lung cancer follows a pattern of autosomal dominant Mendelian inheritance. However, due to the genetic heterogeneity, substantial variance in exposure to environmental risk factors, poor prognosis and other factors, identification of human lung cancer susceptibility genes by direct linkage analysis is difficult. Mouse inbred strains show widely different susceptibilities to both spontaneously occurring and chemically induced lung tumorigenesis and become a valuable model to study lung cancer genetics. To date, linkage analyses using various mouse crossing panels have uncovered more than 20 putative lung tumor susceptibility /resistance loci on mouse chromosomes. Considering the highly homologous relationship between mouse and human genomes, identifications of these putative loci may ultimately lead to the discovery of human lung cancer susceptibility genes. A quantitative trait locus (QTL), Pulmonary adenoma susceptibility 1 (Pas1), was previously mapped to the distal region of mouse chromosome 6 using genetic linkage ii analyses on crosses between susceptible A/J and resistant C3H/He or C57BL/6J strains. This locus accounts for approximately 40-60% variance in lung tumor multiplicity induced by chemical carcinogens between the A/J and C3H/He or C57BL/6J mice. In addition to predisposing lung tumor multiplicity, the Pas1 locus also affects mouse lung tumor sizes. Although it is the major QTL in predisposition to mouse lung tumor susceptibility, the Pas1 gene(s) has not been identified. In the present studies, we have fine-mapped the Pas1 locus using two independent strategies. We have utilized a newly developed F11 generation of Advanced Intercross Line (AIL) mouse population to fine map Pas1, Pas2 (on chromosome 17) and Pas3 (on chromosome 19) QTLs. By selectively genotyping 30% of the population, we have confirmed the Pas1 QTL and refined it into an interval of approximately 1.0-cM (~1.3 Mb) in the vicinity of the Kras2 gene. The Pas2 QTL was detected by both ANOVA and regression analysis but not by Mapmaker software. An interaction between the Pas1 and Pas2 QTLs was also revealed. However, the Pas3 QTL has not been confirmed in this study. Congenic strategy was also utilized to fine map the Pas1 QTL. Like in AIL project, we started with two parental strains: lung tumor susceptible A/J strain and lung tumor resistant C57BL/6J strain. After seven generations of backcrossing, N7 congenic mice that carried ~36Mb of the A/J Pas1 QTL region were further crossed to the C57BL/6J mice to generate subcongenic strains of mice (N8), which contain various iii Pas1 QTL regions. N9 mice, generated by mating each selected N8 male mouse with three C57BL/6J female mice, were treated with an initiating dosage of carcinogens and were allowed to form lung tumors. A set of new polymorphic markers has been developed to assist this fine-structure mapping. Combining results from the AIL project and the congenic project, we have refined the Pas1 QTL into a less than 1-Mb minimum candidate region based on the Celera/or public mouse genome maps encompassed by the markers D6Osu6 and D6Osu11. Based on the fine-mapping results, the Pas1 locus was then sufficiently fine- mapped that candidate gene screening for the Pas1 locus could be performed. After initial screening, six genes located in the minimum Pas1 candidate region were selected for further examinations. The Lrmp/Jaw1 gene bears amino acid polymorphisms tightly co- segregating with strain Pas1 alleles. The RIKEN Ak016641 (re-named as Pas1c1 for Pas1 candidate 1) gene, encoding an intermediate filament tail domain-containing protein, produces alternatively spliced transcripts in inbred strains of mice and also Mus Spretus. Its mRNA splicing pattern tightly co-segregates with Pas1 alleles. Another novel gene, Pas1c2, identified in our study, was found bearing an amino-acid changing nucleotide polymorphism between lung tumor susceptible and resistant strains, which is also tightly correlated with strain Pas1 status. Thus, our results support these three genes as strong candidates for the Pas1 QTL, and they are being further tested by in vitro and in vivo functional analyses. We also examined the other three genes (Eca39, RIKEN iv Ak015530 and mHoj-1). Neither functional polymorphism nor expression difference has been found for Eca39 and mHoj-1 genes between lung tumor susceptible and resistant strains. The Ak015530 gene carries an amino-acid polymorphism but this polymorphism does not co-segregate with mouse lung tumor susceptibility. Thus, these three genes are less likely candidates for the Pas1 locus. Genetic studies have mapped a lung tumor resistance locus designated as Par2 to mouse chromosome 18. Par2 accounts for approximately 40% of the difference in lung tumor multiplicity between the susceptible A/J mice and the relative resistant BALB/c mice. We have fine mapped the Par2 locus using congenic mice that were constructed by placing an approximately 28-cM Par2 QTL region from the A/J mice onto the genetic background of BALB/c mice. Subcongenic strains of mice (N8) containing various Par2 QTL regions were generated and genotyped. Like in Pas1 congenic project, the N9 mice were generated by mating each selected N8 male mouse with three BALB/c female mice and were treated with urethane to induce lung tumor formation. Consequently, by analyzing the lung tumor multiplicity and genotypes of each subcongenic strain, the Par2 locus was narrowed to an approximately 6.3-Mb region flanked by the marker D18Mit103 and the marker D18Mit162. A mouse/human comparative map was constructed for the Par2 candidate region based on Celera genomic information. A high homology between the mouse Par2 candidate region and the human syntenic region on chromosome 18q21 has been observed. Based on recent mouse genome maps, there are v totally 79 putative genes residing in the candidate region. A subset of these genes was found to exhibit differential gene expression in lungs between the A/J and BALB/c mice when assayed by real-time RT-PCR. Four genes are possible Par2 candidates based on this assay, including Myo5b, Smad7, Mapk4, and GABA-A receptor-like gene mCG58197. More interestingly, sequencing analyses for this region found that the Rad30b gene, encoding the DNA–dependent polymerase iota (Polι), carries 25 nucleotide polymorphisms in its coding region between A/J and BALB/c inbred strains, causing ten amino-acid alterations. Functional analyses on the above five genes are needed to clarify their Par2 candidacy. In addition, 54 putative genes exhibited various types of SNPs when comparing genomic sequences from A/J, 129X1/svJ, 129S1/svImJ, DBA/2J, and C57BL/6J mice. Screening of these SNPs in the future may help us find polymorphic markers and identify new Par2 candidate genes. vi Dedicated to my family, my mentors and all my friends vii ACKNOWLEDGMENTS I wish to thank very much my advisor, Dr. Ming You, for his intellectual support, encouragement, and enthusiasm that made this thesis possible, and for his patience in correcting both my stylistic and scientific errors. I wish to thank my other advisory committee members, Dr. Christoph Plass, Dr. Gary Stoner and Dr. Yian Wang, for their continual devotion of precious time and energy to my Ph.D graduate training. I would like to thank our collaborators: Dr. Alvin M. Malkinson from University of Colorado, Dr. Fuad Iraqi from International Livestock Research Institute in Kenya and Theodora R. Devereux from National Institute of Environmental Health Science, for their intellectual and material supports to our projects. I am grateful to Dr. Zhongqiu Zhang, Dr. William J. Lemon and Dr. Futamura Manabu for their critical contribution to the present projects and intellectual discussion during my research. I appreciate the opportunity of working in such a wonderful laboratory. I thank my colleagues in this laboratory for all the helps I have received from them during my research. Finally, I cannot thank enough to my family for their both mental and physical support during my Ph.D. training period. viii VITA Dec.12, 1975………………………..Born, Hubei Province, P. R. China 1997…………………………………BS in Biology, South China Normal University, P. R. China 1997-1998……………….………….MS student, Dept. of Cancer Biochemistry, Guangzhou Medical College, P. R. China 1998-1999…………………………..MS student, Dept. of Pathology, Medical College of Ohio, Toledo, Ohio 1999-2000…………………………..Ph.D. fellowship, Molecular Basis of Disease Program, Medical College of Ohio, Toledo, Ohio 2000-present………………………...Ph.D. Graduate Research Assistant, Molecular Virology, Immunology and Medical Genetics Program, The Ohio State University, Ohio ix PUBLICATIONS Research Publication 1. Fine mapping of Pulmonary adenoma susceptibility1 (Pas1) gene using congenic mice. (Temporary title and in preparation) 2. Identification of Pulmonary adenoma resistance 2 (Par2) gene(s) on mouse chromosome 18. (Temporary title and in preparation) 3. Wang M, Lemon WJ, Liu GJ, Wang Y, Teale AJ, Iraqi F, Malkinson AM, and You M. Fine mapping of the pulmonary adenoma susceptibility gene 1 (Pas1) locus using advanced intercross lines. Cancer Research 2003 Jun 15, 63 (12) 4.
Load more

Recommended publications
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • Maintenance of Self-Renewal Ability of Mouse Embryonic Stem Cells in The
    MaintenanceBlackwellMalden,GTCGenes1365-2443©?117OriginalDnmt1/3a/3bA 2006 TsumuraBlackwell to USA ArticleCells Publishing et Publishing al. triple knockoutInc Ltd ES cells of self-renewal ability of mouse embryonic stem cells in the absence of DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b Akiko Tsumura1,4, Tomohiro Hayakawa2, Yuichi Kumaki3,6, Shin-ichiro Takebayashi1, Morito Sakaue1, Chisa Matsuoka1, Kunitada Shimotohno4, Fuyuki Ishikawa5, En Li7, Hiroki R. Ueda3, Jun-ichi Nakayama2 and Masaki Okano1,* 1Laboratory for Mammalian Epigenetic Studies, 2Laboratory for Chromatin Dynamics, and 3Laboratory for Systems Biology, Center for Developmental Biology, RIKEN, 2-2-3 Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan 4Department of Viral Oncology, Institute for Virus Research, Kyoto University, 53 Kawaharacho, Shogoin, Sakyo-ku, Kyoto 606-8501, Japan 5Department of Gene Mechanisms, Graduate School of Biostudies, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan 6INTEC Web and Genome Informatics Corp., 1-3-3 Shinsuna, Koto-ku, Tokyo 136-8637, Japan 7Epigenetics Program, Novartis Institute for Biomedical Research, 250 Massachusetts Ave., Cambridge, MA 02139, USA DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b cooperatively regulate cytosine methylation in CpG dinucleotides in mammalian genomes, providing an epigenetic basis for gene silencing and maintenance of genome integrity. Proper CpG methylation is required for the normal growth of various somatic cell types, indicating its essential role in the basic cellular function of mammalian cells. Previous studies using Dnmt1–/– or Dnmt3a–/–Dnmt3b–/– ES cells, however, have shown that undifferentiated embryonic stem (ES) cells can tolerate hypomethylation for their proliferation. In an attempt to investigate the effects of the complete loss of CpG DNA methyltransferase function, we established mouse ES cells lacking all three of these enzymes by gene targeting.
    [Show full text]
  • Ubiquitinated Proliferating Cell Nuclear Antigen Activates Translesion DNA Polymerases ␩ and REV1
    Ubiquitinated proliferating cell nuclear antigen activates translesion DNA polymerases ␩ and REV1 Parie Garg and Peter M. Burgers* Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, 660 South Euclid, St. Louis, MO 63110 Edited by Jerard Hurwitz, Memorial Sloan–Kettering Cancer Center, New York, NY, and approved November 4, 2005 (received for review July 14, 2005) In response to DNA damage, the Rad6͞Rad18 ubiquitin-conjugat- and requiring additional activation by the Cdc7͞Dbf4 protein ing complex monoubiquitinates the replication clamp proliferating kinase that normally functions in cell cycle progression (5, 12). cell nuclear antigen (PCNA) at Lys-164. Although ubiquitination of It is this complex pathway that mainly contributes to DNA PCNA is recognized as an essential step in initiating postreplication damage induced mutagenesis in eukaryotic cells. Although repair, the mechanistic relevance of this modification has remained normally involved in lagging strand DNA replication, the high- elusive. Here, we describe a robust in vitro system that ubiquiti- fidelity Pol ␦ is also required for damage-induced mutagenesis. nates yeast PCNA specifically on Lys-164. Significantly, only those The functions of Pol ␨ and Rev1 appear to be uniquely confined PCNA clamps that are appropriately loaded around effector DNA to mutagenesis. Pol ␨ is an error-prone DNA polymerase that can by its loader, replication factor C, are ubiquitinated. This observa- bypass damage (13). Rev1 is a deoxycytidyl transferase that tion suggests that, in vitro, only PCNA present at stalled replication shows the highest catalytic activity opposite template guanines forks is ubiquitinated. Ubiquitinated PCNA displays the same and abasic sites (14, 15). Rev1 is primarily responsible for replicative functions as unmodified PCNA.
    [Show full text]
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
    [Show full text]
  • AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By
    AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation.
    [Show full text]
  • Variation in the Anopheles Gambiae TEP1 Gene Shapes Local Population Structures of Malaria Mosquitoes
    Variation in the Anopheles gambiae TEP1 Gene Shapes Local Population Structures of Malaria Mosquitoes D i s s e r t a t i o n Zur Erlangung des akademischen Grades D o c t o r r e r u m n a t u r a l i u m (Dr. rer. nat.) Im Fach Biologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin von BSc. (Biochemistry and Molecular Biology), MSc. (Biochemistry) Evans Kiplangat Rono Präsidentin der Humboldt-Universität zu Berlin: Prof. Dr.-Ιng. Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät: Prof. Dr. Bernhard Grimm Gutachter/innen: 1. Dr. Elena A. Levashina 2. Prof. Dr. Arturo Zychlinski 3. Prof. Dr. Susanne Hartmann Eingereicht am: Donnerstag, 04.05.2017 Tag der mündlichen Prüfung: Donnerstag, 29.06.2017 ii Zusammenfassung Abstract Zusammenfassung Rund eine halbe Million Menschen sterben jährlich im subsaharischen Afrika an Malaria Infektionen, die von der Anopheles gambiae Mücke übertragen werden. Die Allele (*R1, *R2, *S1 und *S2) des A. gambiae complement-like thioester-containing Protein 1 (TEP1) bestimmen die Fitness der Mücken, welches die männlichen Fertilität und den Resistenzgrad der Mücke gegen Pathogene wie Bakterien und Malaria- Parasiten. Dieser Kompromiss zwischen Reproduktion und Immunnität hat Auswirkungen auf die Größe der Mückenpopulationen und die Rate der Malariaübertragung, wodurch der TEP1 Lokus ein Primärziel für neue Malariakontrollstrategien darstellt. Wie die genetische Diversität von TEP1 die genetische Struktur natürlicher Vektorpopulationen beeinflusst, ist noch unklar. Die Zielsetzung dieser Doktorarbeit waren: i) die biogeographische Kartographierung der TEP1 Allele und Genotypen in lokalen Malariavektorpopulationen in Mali, Burkina Faso, Kamerun, und Kenia, und ii) die Bemessung des Einflusses von TEP1 Polymorphismen auf die Entwicklung humaner P.
    [Show full text]
  • Jimmunol.0901240.Full.Pdf
    A Critical Role for REV1 in Regulating the Induction of C:G Transitions and A:T Mutations during Ig Gene Hypermutation This information is current as Keiji Masuda, Rika Ouchida, Yingqian Li, Xiang Gao, of September 24, 2021. Hiromi Mori and Ji-Yang Wang J Immunol published online 8 July 2009 http://www.jimmunol.org/content/early/2009/07/08/jimmuno l.0901240 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2009/07/07/jimmunol.090124 Material 0.DC1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 24, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published July 8, 2009, doi:10.4049/jimmunol.0901240 The Journal of Immunology A Critical Role for REV1 in Regulating the Induction of C:G Transitions and A:T Mutations during Ig Gene Hypermutation Keiji Masuda,* Rika Ouchida,* Yingqian Li,†* Xiang Gao,† Hiromi Mori,* and Ji-Yang Wang1* REV1 is a deoxycytidyl transferase that catalyzes the incorporation of deoxycytidines opposite deoxyguanines and abasic sites.
    [Show full text]
  • PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC
    [Show full text]
  • In Human Metabolism
    Supporting Information (SI Appendix) Framework and resource for more than 11,000 gene-transcript- protein-reaction associations (GeTPRA) in human metabolism SI Appendix Materials and Methods Standardization of Metabolite IDs with MNXM IDs Defined in the MNXref Namespace. Information on metabolic contents of the Recon 2Q was standardized using MNXM IDs defined in the MNXref namespace available at MetaNetX (1-3). This standardization was to facilitate the model refinement process described below. Each metabolite ID in the Recon 2Q was converted to MNXM ID accordingly. For metabolite IDs that were not converted to MNXM IDs, they were manually converted to MNXM IDs by comparing their compound structures and synonyms. In the final resulting SBML files, 97 metabolites were assigned with arbitrary IDs (i.e., “MNXMK_” followed by four digits) because they were not covered by the MNXref namespace (i.e., metabolite IDs not converted to MNXM IDs). Refinement or Removal of Biochemically Inconsistent Reactions. Recon 2 was built upon metabolic genes and reactions collected from EHMN (4, 5), the first genome-scale human liver metabolic model HepatoNet1 (6), an acylcarnitine and fatty-acid oxidation model Ac-FAO (7), and a small intestinal enterocyte model hs_eIEC611 (8). Flux variability analysis (9) of the Recon 2Q identified blocked reactions coming from these four sources of metabolic reaction data. The EHMN caused the greatest number of blocked reactions in the Recon 2Q (1,070 reactions corresponding to 69.3% of all the identified blocked reactions). To refine the EHMN reactions, following reactions were initially disregarded: 1) reactions having metabolite IDs not convertible to MNXM IDs; and 2) reactions without genes.
    [Show full text]
  • Evaluation of the FHIT Gene in Colorectal Cancers1
    [CANCER RESEARCH 56, 2936-2939. July I. 1996] Advances in Brief Evaluation of the FHIT Gene in Colorectal Cancers1 Sam Thiagalingam, Nikolai A. Lisitsyn, Masaaki Hamaguchi, Michael H. Wigler, James K. V. Willson, Sanford D. Markowitz, Frederick S. Leach, Kenneth W. Kinzler, and Bert Vogelstein2 The Johns Hopkins Oncology Center. Baltimore, Maryland 21231 [S. T.. F. S. L., K. W. K., B. V.]; Department of Genetics. University of Pennsylvania, Philadelphia, Pennsylvania 9094 ¡N.A. LI: Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 ¡M.H., M. H. W.]; Department of Medicine and Ireland Cancer Center, University Hospitals of Cleveland and Case Western Resene University. Cleveland. Ohio 44106 ¡J.K. V. W., and S. D. M.¡; and Howard Hughes Medical Institute [B. V.¡,The Johns Hopkins Oncology Center, Baltimore, Maryland 21231 Abstract suppressor genes (13), the RDA results strongly supported the exist ence of a tumor suppressor gene in this area (14). A variety of studies suggests that tumor suppressor loci on chromosome Finally, Ohta et al. (15) have recently used a positional cloning 3p are important in various forms of human neoplasia. Recently, a chro approach to identify a novel gene that spanned the t(3;8) breakpoint. mosome 3pl4.2 gene called FHIT was discovered and proposed as a They named this gene FHIT (fragile histidine triad gene), reflecting its candidate tumor suppressor gene in coloréela!and other cancers. We evaluated the FHIT gene in a panel of colorectal cancer cell lines and homology to the Schizosaccharomyces pombe gene encoding Ap4A xenografts, which allowed a comprehensive mutational analysis.
    [Show full text]
  • Quantitative Live Cell Imaging Reveals Influenza Virus Manipulation Of
    ARTICLE https://doi.org/10.1038/s41467-019-13838-3 OPEN Quantitative live cell imaging reveals influenza virus manipulation of Rab11A transport through reduced dynein association Amar R. Bhagwat 1, Valerie Le Sage1, Eric Nturibi1, Katarzyna Kulej2, Jennifer Jones 1, Min Guo3, Eui Tae Kim 2, Benjamin A. Garcia4,5, Matthew D. Weitzman2,5,6, Hari Shroff3 & Seema S. Lakdawala 1,7* fl 1234567890():,; Assembly of infectious in uenza A viruses (IAV) is a complex process involving transport from the nucleus to the plasma membrane. Rab11A-containing recycling endosomes have been identified as a platform for intracellular transport of viral RNA (vRNA). Here, using high spatiotemporal resolution light-sheet microscopy (~1.4 volumes/second, 330 nm isotropic resolution), we quantify Rab11A and vRNA movement in live cells during IAV infection and report that IAV infection decreases speed and increases arrest of Rab11A. Unexpectedly, infection with respiratory syncytial virus alters Rab11A motion in a manner opposite to IAV, suggesting that Rab11A is a common host component that is differentially manipulated by respiratory RNA viruses. Using two-color imaging we demonstrate co-transport of Rab11A and IAV vRNA in infected cells and provide direct evidence that vRNA-associated Rab11A have altered transport. The mechanism of altered Rab11A movement is likely related to a decrease in dynein motors bound to Rab11A vesicles during IAV infection. 1 Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, 450 Technology Drive, Pittsburgh, PA 15219, USA. 2 The Children’s Hospital of Philadelphia Research Institute, 3501 Civic Center Dr., Philadelphia, PA 19104, USA. 3 Section on High Resolution Optical Imaging, National Institute of Biomedical Imaging and Bioengineering, National Institutes of Health, 13 South Drive, Building 13, Bethesda, MD 20892, USA.
    [Show full text]
  • Mitoxplorer, a Visual Data Mining Platform To
    mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, Cecilia Garcia-Perez, José Villaveces, Salma Gamal, Giovanni Cardone, Fabiana Perocchi, et al. To cite this version: Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, et al.. mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dy- namics and mutations. Nucleic Acids Research, Oxford University Press, 2020, 10.1093/nar/gkz1128. hal-02394433 HAL Id: hal-02394433 https://hal-amu.archives-ouvertes.fr/hal-02394433 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gkz1128 Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gkz1128/5651332 by Bibliothèque de l'université la Méditerranée user on 04 December 2019 mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim1,†, Prasanna Koti1,†, Adrien Bonnard2, Fabio Marchiano3, Milena Durrbaum¨ 1, Cecilia Garcia-Perez4, Jose Villaveces1, Salma Gamal1, Giovanni Cardone1, Fabiana Perocchi4, Zuzana Storchova1,5 and Bianca H.
    [Show full text]