DOCSLIB.ORG

Agapetes (Ericaceae) from Northwestern Myanmar

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Agapetes (Ericaceae) from Northwestern Myanmar J. Jpn. Bot. 91 Suppl.: 99–111 (2016) New or Noteworthy Plant Collections from Myanmar (9) Agapetes (Ericaceae) from Northwestern Myanmar a b c Nobuyuki TANAKA , Tetsuo OHI-TOMA , Hiroko MURATA , d b, Mu Mu AUNG and Jin MURATA * aDepartment of Botany, National Museum of Nature and Science, 4-1-1, Amakubo, Tsukuba, 305-0005 JAPAN; bBotanical Gardens, Graduate School of Sciences, the University of Tokyo, 3-7-1, Hakusan, Bunkyo-ku, Tokyo, 112-0001 JAPAN; cFaculty of Pharmaceutical Sciences, Setsunan University, Nagaotoge-cho, Hirakata, Osaka, 573-0101 JAPAN; dForest Research Institute, Forest Department, Ministry of Natural Resources and Environmental Conservation, Yezin, Nay Pyi Taw, MYANMAR *Corresponding author: [email protected] (Accepted on August 2, 2016) As the result of field explorations to northwestern Myanmar, a total of five species of the genus Agapetes (Ericaceae) were collected. Of these, two species were hitherto undescribed taxa. They were recorded with citation of voucher specimens and a photograph of each species was provided. Two new species were described as Agapetes oxycoccoides and A. pentastigma. Agapetes oxycoccoides is similar to A. bracteata, but distinguished by the corymbose inflorescence without distinct bract, and more strongly reflexed longer corolla lobes. Agapetes pentastigma is morphologically similar to A. hillii, but differs in having a greenish-yellow collora with ladder-like red stripes, and a short peduncle. (Continued from Acta Phytotax. Geobot. 65: 89–97, 2014) Key words: Agapetes oxycoccoides, Agapetes pentastigma, Myanmar, new species, phylogeny. The genus Agapetes D. Don ex G. Don is 2005, Watthana 2012, Tong and Xia 2014). assignable to the tribe Vaccinieae Rchb. of the In morphological and anatomical characters, subfamily Vaccinioideae Arn. (Ericaceae). The Agapetes is closely related to Vaccinium from SE past classification treated the species from New Asia (Stevens 1985). The molecular phylogeny Guinea and the SW Pacific as Agapetes (Airy indicated that Agapetes species nested among Shaw 1958). The species, however, except Vaccinium species, cf. V. gaultheriifolium A. scortechinii (King & Gamble) Sleumer, of (Griff.) Hook. f. and V. nummularia Hook. f. & which taxonomic status has been in question, Thomson, although only three Agapetes species, are currently placed in Paphia Seeman (Kron A. buxifolia Nutt. ex Hook. f., A. hosseana Diels, et al. 1999, Stevens 2004). Agapetes, holding and A. serpens (Wight) Sleumer, were analyzed about 80 species at present, is distributed (Kron et al. 2002). Currently it is thought that from the Himalayas to China, and Indo- many species of Agapetes are part of the same China to Southeast Asia (Fang and Stevens lineage as many SE Asian-Malesian Vaccinium —99— 100 The Journal of Japanese Botany Vol. 91 Centennial Memorial Issue (Fang and Stevens 2005). Myanmar, and A. pentastigma was close to A. Field expeditions to Kachin State, odontocera (Wight) Hook. f., distributed in E northwestern Myanmar to update the flora India. of Myanmar were carried out. Northwestern Myanmar is known for its wealth of plant Materials and Methods species diversity. Our previous works revealed Plant materials many new records and also new taxa based on Field excursions to the Hukaung Valley Tiger these northwestern excursions (Tanaka et al. Reserve, Kachin State, northwestern Myanmar 2006, Tanaka and Hughes 2007, Tanaka and have been conducted twice, in 2005 and 2007. Hayami 2011, Tanaka et al. 2016). The Hukaung Valley is one of the largest Differences in the amount of rainfall in conservation sites in the country, but it remains the dry and rainy seasons are remarkable in floristically poorly known. The valley is a flat Myanmar, and it is presumed that plants there alluvial plain measuring about 80 km north– are adapted to the environment by having a south by 50 km east–west, surrounded on all characteristic life cycle. The genus Agapetes sides by hills (Cruickshank and KoKo 2003). with its characteristic storage rootstock may be A total of five species of Agapetes were one of such a kind of plant, and it has apparently collected in the evergreen tropical lowland diversified in Myanmar. Including twenty new forest in Shinbweyang, northwest of Tanaing, species that were previously described from Hukaung Valley, and they were morphologically Myanmar by Airy Shaw (1935, 1948, 1959, investigated. Voucher specimens were deposited 1960a, 1960b), Kress et al. (2003) listed 54 in TI, TNS and RAF. species of Agapetes from Myanmar. Recently Tong and Xia (2014) added two new taxa, DNA sequencing and phylogenetic analysis A. putaoensis Y. H. Tong & N. H. Xia and A. For molecular phylogenetic analyses, wardii W. W. Smith var. heterotricha Y. H. 24 species and one variety of Agapetes, Tong & N. H. Xia to the flora of Myanmar, for including A. scortechinii, eight representative a total of 56 taxa to date. However, many of species of Vaccinium including species that them were known from fragmentary information are morphologically and phylogenetically based on the type and few additional herbarium related to Agapetes (V. gaultheriifolium and specimens. Observation on living plants in V. nummularia; Kron et al. 2002), and two the field is desirable for a taxonomic and species of Paphia were collected (Appendix phylogenetic revision of Agapetes and related 1). Considering the phylogenetic relationship species. The identifications of the specimens of Vaccinieae, Andromeda polifolia L. and collected by our fieldworks led us to recognize Dimorphanthera kempteriana Schltr. were used five species of Agapetes (Ericaceae) from as outgroups. Total genomic DNA was extracted the field of northwestern Myanmar. Based on from silica-gel-dried leaf tissue, using the morphological and phylogenetic investigations modified HEPES-CTAB method described by two of them were recognized as new to Ohi-Toma et al. (2010). science. We describe these two species as A. Nucleotide sequences of the chloroplast oxycoccoides and A. pentastigma in this study. trnK intron (including the matK gene) were Molecular phylogenetic analysis was also determined using polymerase chain reaction applied to understand the relationship of these (PCR) and direct bi-directional sequencing. species among the related taxa. It suggested PCR amplification was conducted using that A. oxycoccoides was related to A. setigera TaKaRa ExTaq (TaKaRa Bio, Shiga, Japan), D. Don ex G. Don, distributed in India and with the following cycling conditions: December 2016 Tanaka et al.: Agapetes from NE Myanmar 101 Table. 1. List of primers for amplification and sequencing Primers Sequence from the 5’ end Note* Reference trnK-3914F TGGGTTGCTAACTCAATGG P, S Johnson and Soltis (1994) trnK-5-intron_Rv AGCTTTTCCCGCAACAGATAC S This study trnK-5-intron_Fw TTTCCAAAATCAAAAGAGCG S This study matK 10 ATGATTCTGTTGATACATTC P, S Kato et al. (1998) matK 800F CACTTGCTYATGATCGTGGT P, S This study matK 4R GCATCTTTTACCCARTAGCGAAG S Bremer et al. (2002) matK 1650R ACATTCCCAGAAATTKACAAGGT P, S This study matK 4F CTTCGCTAYTGGGTAAAAGATGC P, S Bremer et al. (2002) matK ERI_R GCACAAGAAAGTCGAAGTAT P, S Dunning and Savolainen (2010) matK 1660F TTTTCCATATGGGCTCAACC P, S This study matK AST_R CAAATAATATCCAAATACCAA P, S Dunning and Savolainen (2010) matK-3-intron Fw TACGGAGGAAGAGCAGGTTT S This study trnK-2R AACTAGTCGGATGGAGTAG P, S Johnson and Soltis (1994) *P. PCR amplification. S. Sequencing. denaturation at 96°C for 45 sec, followed by 33 coded gap-states were used as a fifth character; cycles at 96°C for 45 sec, annealing at 50°C for however, the length polymorphisms caused by 45 sec, extension at 72°C for 1 min, and a final mononucleotide repeats [poly(A) or poly(T)] extension at 72°C for 10 min. For amplifying and other unalignable portions were excluded and sequencing the trnK intron, we used newly from gap coding. In the data matrix, when designed primers in addition to published substitutions or overlapping gaps occurred at universal primers (Table 1). Amplification gap positions, the differences were indicated products were purified using illustra ExoProStar by adding ‘n’ to the position of the substitution (GE Healthcare UK Ltd., Buckinghamshire, and/or gap-state. In order to use coded gaps, England, UK). The purified PCR fragments were Maximum Parsimony analysis was applied using amplified using the Big Dye Terminator v3.1 PAUP* v. 4.0a149 (Swofford 2002). Nucleotide Cycle Sequencing Kit (Applied Biosystems, substitutions and coded gaps were given equal Foster City, California, USA). Cycle-sequencing weights, and the tree search was performed reactions were performed using the same primers using the branch-and-bound search option with for the PCR amplification and newly designed MulTrees in effect. The strict consensus tree primers for sequencing. Complementary strands of the most parsimonious trees was generated, of the sequenced regions were assembled and and changes of substitutions and gaps were edited using ATGC v. 4.2 (GENETXY Co., reconstructed on the tree using ACCTRAN Tokyo, Japan). All newly generated nucleotide character optimization. The MP bootstrap sequences were deposited in the DNA Data support (BS) values were estimated using a Bank of Japan (DDBJ) and their accession heuristic search of 10,000 replicates, with simple numbers are shown with sample information in sequence addition, TBR branch swapping, Appendix. Multrees in effect, and no limit of MaxTree. The nucleotide sequences were manually aligned and gap coding was employed as Results
Load more

Recommended publications
  • Agapetes Guangxiensis D. Fang (ERICACEAE), a NEW RECORD for the FLORA of VIETNAM
    TAPAgapetes CHI guangxiensis SINH HOC D.201 Fang5, 37 ((3Ericaceae): 296-299) DOI: 10.15625/0866-7160/v37n3.6542 Agapetes guangxiensis D. Fang (ERICACEAE), A NEW RECORD FOR THE FLORA OF VIETNAM Nguyen Thi Thanh Huong1*, Tong Yi Hua2,3, Vu Tien Chinh1, Xia Nian He2, Tran Thi Phuong Anh4 1Institute of Ecology and Biological Resources, VAST, *[email protected] 2South China Botanical Garden, Chinese Academy of Sciences, Guangzhou 510650, China 3University of Chinese Academy of Sciences, Beijing 100049, China 4Vietnam National Museum of Nature, VAST ABSTRACT: Agapetes guangxiensis D. Fang, previously known only from China, is reported here as a new record for the flora of Vietnam. This species was found in Dien Bien and Ha Giang provinces of North Vietnam. It differs from the allied species, A. rubrobracteata, in having leaf blades ovate with serrate margins, inflorescence barcts smaller (c. 0.5 mm long) and ecalcarate anthers. Information on the taxonomy, type, ecology and distribution is provided for A. guangxiensis. The vouchers are housed at the herbarium of the Institute Ecology and Biological Resources, Ha Noi, Vietnam (HN). A key to the nine species of Agapetes in Vietnam is provided. Keywords: Agapetes, A. guangxiensis, Ericaceae, New record, Dien Bien, Ha Giang, Vietnam. INTRODUCTION hitherto was considered endemic to China [5]. Agapetes D. Don ex G. Don with ca. 100 In the paper, we reported here Agapetes species, belongs to the family Ericaceae under guangxiensis as a new record for Vietnam’s subfamily Vaccinioideae Arn. and tribe flora. Vaccinieae Rchb. [1]. The genus is distributed MATERIALS AND METHODS principally from the East Himalayas through South-West China and Indochina to South-East Specimens of Agapetes at the following Asia [2].
    [Show full text]
  • Agapetes Heana, a New Species of A. Ser. Longifiles (Ericaceae) from Yunnan, China
    PhytoKeys 180: 133–139 (2021) A peer-reviewed open-access journal doi: 10.3897/phytokeys.180.69667 RESEARCH ARTICLE https://phytokeys.pensoft.net Launched to accelerate biodiversity research Agapetes heana, a new species of A. ser. Longifiles (Ericaceae) from Yunnan, China Yi-Hua Tong1,2, Ying Bai3, Jian-Ming Feng4, Ji-Dong Ya4 1 Key Laboratory of Plant Resources Conservation and Sustainable Utilization & Key Laboratory of Digital Botanical Garden of Guangdong Province, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, 510650, China 2 Center of Conservation Biology, Core Botanical Gardens, Chinese Academy of Sciences, Guangzhou, 510650, China 3 Forestry and Grassland Bureau of Honghe Prefecture, Honghe Avenue, Mengzi, Yunnan, 661100, China 4 Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences, Lanhei Road 132, Heilongtan, Kunming, Yunnan, 650201, China Corresponding author: Yi-Hua Tong ([email protected]) Academic editor: Peter de Lange | Received 3 June 2021 | Accepted 15 July 2021 | Published 9 August 2021 Citation: Tong Y-H, Bai Y, Feng J-M, Ya J-D (2021) Agapetes heana, a new species of A. ser. Longifiles (Ericaceae) from Yunnan, China. PhytoKeys 180: 133–139. https://doi.org/10.3897/phytokeys.180.69667 Abstract Agapetes heana Y. H. Tong & J. D. Ya (Ericaceae), a new species from Lüchun Xian, Yunnan Province, China is described and illustrated. This new species is assigned toAgapetes sect. Agapetes ser. Longifiles Airy Shaw. It is closest to A. inopinata Airy Shaw and A. oblonga Craib, but differs in having bead-like tubers, leaf blade with a wholly serrulate margin, subulate and much longer calyx lobes, much larger corollas that are carmine, green at the apex and maroon on angles, and longer stamens without spurs on the back.
    [Show full text]
  • The Taxonomy of VACCINIUM Section RIGIOLEPIS (Vaccinieae, Ericaceae)
    BLUMEA 50: 477– 497 Published on 14 December 2005 http://dx.doi.org/10.3767/000651905X622743 THE TAXONOMY OF VACCINIUM SECTION RIGIOLEPIS (VACCINIEAE, ERICACEAE) S.P. VANDER KLOET Department of Biology, Acadia University, Wolfville, Nova Scotia, B4P 2R6 Canada SUMMARY Vaccinium section Rigiolepis (Hook.f.) Sleumer is revised for the Flora Malesiana region. In the introduction a short history of the genus (section) and its defining characters are presented followed by comments about Sleumer’s classification for this section. Numerical techniques using features suggested by Sleumer on ‘indet’ specimens at Leiden counsel a more conservative approach to species delimitation and the resultant revision for this section recognizes thirteen species including three new taxa, viz., V. crinigrum, V. suberosum, and V. linearifolium. Lectotypes for V. borneense W.W. Sm. and V. leptanthum Miq. are also proposed. Key words: Vaccinium, Rigiolepis, Malesia, new species. INTRODUCTION Since its inception in 1876, the genus Rigiolepis Hook.f. has been a perennial candidate for the Rodney Dangerfield ‘No Respect’ Award. All the other SE Asian segregates of Vaccinieae, such as Agapetes D. Don, Dimorphanthera F. Muell., and Costera J.J. Sm. have gained widespread acceptance among botanists, but not so Rigiolepis where even the staunchest supporters, viz., Ridley (1922) and Smith (1914, 1935) could not agree on a common suite of generic characters for this taxon. Ridley (1922) argued that Rigiolepis could be separated from Vaccinium by its epiphytic habit, extra-axillary racemes and very small flowers. Unfortunately, neither small flowers nor the epiphytic habit are unique to Rigiolepis but are widespread in the Vaccinieae; indeed V.
    [Show full text]
  • The Genus Vaccinium in North America
    Agriculture Canada The Genus Vaccinium 630 . 4 C212 P 1828 North America 1988 c.2 Agriculture aid Agri-Food Canada/ ^ Agnculturo ^^In^iikQ Canada V ^njaian Agriculture Library Brbliotheque Canadienno de taricakun otur #<4*4 /EWHE D* V /^ AgricultureandAgri-FoodCanada/ '%' Agrrtur^'AgrntataireCanada ^M'an *> Agriculture Library v^^pttawa, Ontano K1A 0C5 ^- ^^f ^ ^OlfWNE D£ W| The Genus Vaccinium in North America S.P.VanderKloet Biology Department Acadia University Wolfville, Nova Scotia Research Branch Agriculture Canada Publication 1828 1988 'Minister of Suppl) andS Canada ivhh .\\ ailabla in Canada through Authorized Hook nta ami other books! or by mail from Canadian Government Publishing Centre Supply and Services Canada Ottawa, Canada K1A0S9 Catalogue No.: A43-1828/1988E ISBN: 0-660-13037-8 Canadian Cataloguing in Publication Data VanderKloet,S. P. The genus Vaccinium in North America (Publication / Research Branch, Agriculture Canada; 1828) Bibliography: Cat. No.: A43-1828/1988E ISBN: 0-660-13037-8 I. Vaccinium — North America. 2. Vaccinium — North America — Classification. I. Title. II. Canada. Agriculture Canada. Research Branch. III. Series: Publication (Canada. Agriculture Canada). English ; 1828. QK495.E68V3 1988 583'.62 C88-099206-9 Cover illustration Vaccinium oualifolium Smith; watercolor by Lesley R. Bohm. Contract Editor Molly Wolf Staff Editors Sharon Rudnitski Frances Smith ForC.M.Rae Digitized by the Internet Archive in 2011 with funding from Agriculture and Agri-Food Canada - Agriculture et Agroalimentaire Canada http://www.archive.org/details/genusvacciniuminOOvand
    [Show full text]
  • ABSTRACTS 117 Systematics Section, BSA / ASPT / IOPB
    Systematics Section, BSA / ASPT / IOPB 466 HARDY, CHRISTOPHER R.1,2*, JERROLD I DAVIS1, breeding system. This effectively reproductively isolates the species. ROBERT B. FADEN3, AND DENNIS W. STEVENSON1,2 Previous studies have provided extensive genetic, phylogenetic and 1Bailey Hortorium, Cornell University, Ithaca, NY 14853; 2New York natural selection data which allow for a rare opportunity to now Botanical Garden, Bronx, NY 10458; 3Dept. of Botany, National study and interpret ontogenetic changes as sources of evolutionary Museum of Natural History, Smithsonian Institution, Washington, novelties in floral form. Three populations of M. cardinalis and four DC 20560 populations of M. lewisii (representing both described races) were studied from initiation of floral apex to anthesis using SEM and light Phylogenetics of Cochliostema, Geogenanthus, and microscopy. Allometric analyses were conducted on data derived an undescribed genus (Commelinaceae) using from floral organs. Sympatric populations of the species from morphology and DNA sequence data from 26S, 5S- Yosemite National Park were compared. Calyces of M. lewisii initi- NTS, rbcL, and trnL-F loci ate later than those of M. cardinalis relative to the inner whorls, and sepals are taller and more acute. Relative times of initiation of phylogenetic study was conducted on a group of three small petals, sepals and pistil are similar in both species. Petal shapes dif- genera of neotropical Commelinaceae that exhibit a variety fer between species throughout development. Corolla aperture of unusual floral morphologies and habits. Morphological A shape becomes dorso-ventrally narrow during development of M. characters and DNA sequence data from plastid (rbcL, trnL-F) and lewisii, and laterally narrow in M.
    [Show full text]
  • Terrestrial Biodiversity Field Assessment in the May River and Upper Sepik River Catchments SDP-6-G-00-01-T-003-018
    Frieda River Limited Sepik Development Project Environmental Impact Statement Appendix 8b – Terrestrial Biodiversity Field Assessment in the May River and Upper Sepik River Catchments SDP-6-G-00-01-T-003-018 Terrestrial Biodiversity Field Assessment in the May River and Upper Sepik River Catchments Sepik Development Project (Infrastructure Corridor) August 2018 SDP-6-G-00-01-T-003-018 page i CONTRIBUTORS Wayne Takeuchi Wayne is a retired tropical forest research biologist from the Harvard University Herbaria and Arnold Arboretum. He is one of the leading floristicians in Papuasian botany and is widely known in professional circles for wide-ranging publications in vascular plant taxonomy and conservation. His 25-year career as a resident scientist in Papua New Guinea began in 1988 at the Wau Ecology Institute (subsequently transferring to the PNG National Herbarium in 1992) and included numerous affiliations as a research associate or consultant with academic institutions, non-governmental organisations (NGOs) and corporate entities. Despite taking early retirement at age 57, botanical work has continued to the present on a selective basis. He has served as the lead botanist on at least 38 multidisciplinary surveys and has 97 peer-reviewed publications on the Malesian flora. Kyle Armstrong, Specialised Zoological Pty. Ltd – Mammals Dr Kyle Armstrong is a consultant Zoologist, trading as ‘Specialised Zoological’, providing a variety of services related to bats, primarily on acoustic identification of bat species from echolocation call recordings, design and implementation of targeted surveys and long term monitoring programmes for bats of conservation significance, and the provision of management advice on bats. He is also currently Adjunct Lecturer at The University of Adelaide, an Honorary Research Associate of the South Australian Museum, and had four years as President of the Australasian Bat Society, Inc.
    [Show full text]
  • Exploring Alternative Systems of Classification Kathleen A
    Aliso: A Journal of Systematic and Evolutionary Botany Volume 15 | Issue 2 Article 5 1996 Exploring Alternative Systems of Classification Kathleen A. Kron Wake Forest University Follow this and additional works at: http://scholarship.claremont.edu/aliso Part of the Botany Commons Recommended Citation Kron, Kathleen A. (1996) "Exploring Alternative Systems of Classification," Aliso: A Journal of Systematic and Evolutionary Botany: Vol. 15: Iss. 2, Article 5. Available at: http://scholarship.claremont.edu/aliso/vol15/iss2/5 Aliso, 15(2), pp. 105-112 © 1997, by The Rancho Santa Ana Botanic Garden, Claremont, CA 91711-3157 EXPLORING ALTERNATIVE SYSTEMS OF CLASSIFICATION KATHLEEN A. KRoN Department of Biology Wake Forest University Winston-Salem, NC 27109-7325 ABSTRACT Classification involves the development of a system of naming clades that can represent evolutionary relationships accurately and concisely. Using the acid-loving heath plants (Ericales) as an example, one can explore the application of different classification methods. The Linnean system of naming retains the traditional hierarchical framework (named ranks) and allows for the application of many cuqently used names. The "phylogenetic systematic" approach recommends the removal of an ab­ solute hierarchy but allows retention of traditionally used endings such as -aceae. Historical usage of these names can lead to confusion when the names are used within a discussion or text, especially when a cladogram is not presented at the same time. Another method is suggested that removes the Linnean endings and adds the same ending (ina) to all clade names. This effectively eliminates absolute rank and clearly indicates that the group name represents a clade.
    [Show full text]
  • Scalariform-To-Simple Transition in Vessel Perforation Plates Triggered by Differences in Climate During the Evolution of Adoxaceae
    Annals of Botany Page 1 of 14 doi:10.1093/aob/mcw151, available online at www.aob.oxfordjournals.org Scalariform-to-simple transition in vessel perforation plates triggered by differences in climate during the evolution of Adoxaceae Frederic Lens1,*, Rutger A. Vos1, Guillaume Charrier2, Timo van der Niet1,3, Vincent Merckx1, Pieter Baas1, Jesus Aguirre Gutierrez1,4, Bart Jacobs5, Larissa Chacon Doria 1, Erik Smets1,5, Sylvain Delzon6 and Steven B. Janssens7 1Naturalis Biodiversity Center, Leiden University, P.O. Box 9517, 2300RA Leiden, The Netherlands, 2INRA, University of Bordeaux, UMR EGFV, F-33450 Talence, France, 3School of Life Sciences, University of Kwazulu-Natal, P. Bag X01, 3209, Scottsville, South Africa, 4Institute for Biodiversity and Ecosystem Dynamics, Computation Geo-Ecology, University of Amsterdam, Amsterdam, The Netherlands, 5Section Ecology, Evolution and Biodiversity Conservation, KU Leuven, Belgium, 6INRA, University of Bordeaux, UMR BIOGECO, F-33450 Talence, France and 7Botanic Garden Meise, Nieuwelaan 38, BE-1860 Meise, Belgium *For correspondence. E-mail [email protected] Downloaded from Received: 8 June 2016 Returned for revision: 8 June 2016 Accepted: 10 June 2016 Background and Aims Angiosperms with simple vessel perforations have evolved many times independently of species having scalariform perforations, but detailed studies to understand why these transitions in wood evolution http://aob.oxfordjournals.org/ have happened are lacking. We focus on the striking difference in wood anatomy between two closely related gen- era of Adoxaceae, Viburnum and Sambucus, and link the anatomical divergence with climatic and physiological insights. Methods After performing wood anatomical observations, we used a molecular phylogenetic framework to esti- mate divergence times for 127 Adoxaceae species.
    [Show full text]
  • Step-Two Lectotypification and Epitypification of Pentapterygium Sikkimense W.W
    Panda, S. and J.L. Reveal. 2012. A step-two lectotypification and epitypification of Pentapterygium sikkimense W.W. Sm. (Ericaceae) with an amplified description. Phytoneuron 2012-8: 1–7. Published 1 February 2012. ISSN 2153 733X A STEP-TWO LECTOTYPIFICATION AND EPITYPIFICATION OF PENTAPTERYGIUM SIKKIMENSE W.W. SM. (ERICACEAE) WITH AN AMPLIFIED DESCRIPTION SUBHASIS PANDA Taxonomy & Biosystematics Laboratory Post-Graduate Department of Botany Darjeeling Government College P.O. North Point Darjeeling-734101, India e-mail: [email protected] JAMES L. REVEAL L.H. Bailey Hortorium Department of Plant Biology 412 Mann Library Building Cornell University Ithaca, New York 14853-4301 e-mail: [email protected] ABSTRACT An epitype is selected for Pentapterygium sikkimense W.W. Sm., the basionym of Agapetes smithiana Sleumer, to augment the inadvertent lectotypification by Airy Shaw (1959) on a G.A. Gammie collection from Sikkim, India. A step-two lectotypfication on the specimen at Kew is designated here. An amplified description of var. smithiana is provided. Photographs of the lectotype, isolectotype, epitype, and live plants are provided to facilitate identification. KEY WORDS: typification, Sikkim, West Bengal, India. Pentapterygium sikkimense was described by William Wright Smith (1911 268) based on specimens collected by George Alexander Gammie in 1892 ( 1216 , K! [Fig. 1], CAL! [Fig. 2]) from Lachung Valley in the state of Sikkim, and by Charles Gilbert Rogers in 1899 (accession no. 264374, CAL!) from the lower Tonglu region of the Darjeeling Himalaya in the state of West Bengal, India. Sleumer (1939: 106) transferred P. sikkimense to Agapetes D. Don ex G. Don and proposed a new named, A.
    [Show full text]
  • Plants at MCBG
    Mendocino Coast Botanical Gardens All recorded plants as of 10/1/2016 Scientific Name Common Name Family Abelia x grandiflora 'Confetti' VARIEGATED ABELIA CAPRIFOLIACEAE Abelia x grandiflora 'Francis Mason' GLOSSY ABELIA CAPRIFOLIACEAE Abies delavayi var. forrestii SILVER FIR PINACEAE Abies durangensis DURANGO FIR PINACEAE Abies fargesii Farges' fir PINACEAE Abies forrestii var. smithii Forrest fir PINACEAE Abies grandis GRAND FIR PINACEAE Abies koreana KOREAN FIR PINACEAE Abies koreana 'Blauer Eskimo' KOREAN FIR PINACEAE Abies lasiocarpa 'Glacier' PINACEAE Abies nebrodensis SILICIAN FIR PINACEAE Abies pinsapo var. marocana MOROCCAN FIR PINACEAE Abies recurvata var. ernestii CHIEN-LU FIR PINACEAE Abies vejarii VEJAR FIR PINACEAE Abutilon 'Fon Vai' FLOWERING MAPLE MALVACEAE Abutilon 'Kirsten's Pink' FLOWERING MAPLE MALVACEAE Abutilon megapotamicum TRAILING ABUTILON MALVACEAE Abutilon x hybridum 'Peach' CHINESE LANTERN MALVACEAE Acacia craspedocarpa LEATHER LEAF ACACIA FABACEAE Acacia cultriformis KNIFE-LEAF WATTLE FABACEAE Acacia farnesiana SWEET ACACIA FABACEAE Acacia pravissima OVEN'S WATTLE FABACEAE Acaena inermis 'Rubra' NEW ZEALAND BUR ROSACEAE Acca sellowiana PINEAPPLE GUAVA MYRTACEAE Acer capillipes ACERACEAE Acer circinatum VINE MAPLE ACERACEAE Acer griseum PAPERBARK MAPLE ACERACEAE Acer macrophyllum ACERACEAE Acer negundo var. violaceum ACERACEAE Acer palmatum JAPANESE MAPLE ACERACEAE Acer palmatum 'Garnet' JAPANESE MAPLE ACERACEAE Acer palmatum 'Holland Special' JAPANESE MAPLE ACERACEAE Acer palmatum 'Inaba Shidare' CUTLEAF JAPANESE
    [Show full text]
  • Ericaceae in Malesia: Vicariance Biogeography, Terrane Tectonics and Ecology
    311 Ericaceae in Malesia: vicariance biogeography, terrane tectonics and ecology Michael Heads Abstract Heads, Michael (Science Faculty, University of Goroka, PO Box 1078, Goroka, Papua New Guinea. Current address: Biology Department, University of the South Pacific, P.O. Box 1168, Suva, Fiji. Email: [email protected]) 2003. Ericaceae in Malesia: vicariance biogeography, terrane tectonics and ecology. Telopea 10(1): 311–449. The Ericaceae are cosmopolitan but the main clades have well-marked centres of diversity and endemism in different parts of the world. Erica and its relatives, the heaths, are mainly in South Africa, while their sister group, Rhododendron and relatives, has centres of diversity in N Burma/SW China and New Guinea, giving an Indian Ocean affinity. The Vaccinioideae are largely Pacific-based, and epacrids are mainly in Australasia. The different centres, and trans-Indian, trans-Pacific and trans-Atlantic Ocean disjunctions all indicate origin by vicariance. The different main massings are reflected in the different distributions of the subfamilies within Malesia. With respect to plant architecture, in Rhododendron inflorescence bracts and leaves are very different. Erica and relatives with the ‘ericoid’ habit have similar leaves and bracts, and the individual plants may be homologous with inflorescences of Rhododendron. Furthermore, in the ericoids the ‘inflorescence-plant’ has also been largely sterilised, leaving shoots with mainly just bracts, and flowers restricted to distal parts of the shoot. The epacrids are also ‘inflorescence-plants’ with foliage comprised of ‘bracts’, but their sister group, the Vaccinioideae, have dimorphic foliage (leaves and bracts). In Malesian Ericaceae, the four large genera and the family as a whole have most species in the 1500–2000 m altitudinal belt, lower than is often thought and within the range of sweet potato cultivation.
    [Show full text]
  • New Taxa of Agapetes (Ericaceae) from Myanmar
    Phytotaxa 184 (1): 039–045 ISSN 1179-3155 (print edition) www.mapress.com/phytotaxa/ PHYTOTAXA Copyright © 2014 Magnolia Press Article ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.184.1.5 New taxa of Agapetes (Ericaceae) from Myanmar YI HUA TONG1,2 & NIAN HE XIA1* 1Key Laboratory of Plant Resources Conservation and Sustainable Utilization, South China Botanical Garden, Chinese Academy of Sciences, CN-510650, Guangzhou, China. 2University of Chinese Academy of Sciences, CN-100049, Beijing, China. Email: [email protected] *Author for correspondence. Email: [email protected] Abstract A new species and a new variety of the genus Agapetes from Kachin State, Myanmar are described and illustrated here. Aga- petes putaoensis sp. nov. can be easily recognized by its very short peduncles and small cylindric-conical corollas divided more than a half, and Agapetes wardii var. heterotricha var. nov. differs from the typical variety in having longer pedicels and puberulous pedicels and calyxes sometimes with glandular setae. The distribution map of these two new taxa is also provided. Key words: Asia, Agapetes lobbii, pollen morphology, taxonomy Introduction Agapetes D.Don ex G.Don (1834: 862) (Ericaceae) with ca. 100 species, is mainly distributed from the East Himalayas through South-West China and Indochina to South-East Asia (Fang & Stevens 2005). The genus belongs to the subfamily Vaccinioideae Arn., tribe Vaccinieae Rchb. (Stevens et al. 2004), but the generic delimitation has not been satisfactorily solved due to the very closely related polyphyletic genus Vaccinium Linnaeus (1753: 349) (Stevens, 1985; Kron et al. 2002; Stevens et al.
    [Show full text]