J. Jpn. Bot. 91 Suppl.: 99–111 (2016) New or Noteworthy Plant Collections from Myanmar (9) Agapetes (Ericaceae) from Northwestern Myanmar a b c Nobuyuki TANAKA , Tetsuo OHI-TOMA , Hiroko MURATA , d b, Mu Mu AUNG and Jin MURATA * aDepartment of Botany, National Museum of Nature and Science, 4-1-1, Amakubo, Tsukuba, 305-0005 JAPAN; bBotanical Gardens, Graduate School of Sciences, the University of Tokyo, 3-7-1, Hakusan, Bunkyo-ku, Tokyo, 112-0001 JAPAN; cFaculty of Pharmaceutical Sciences, Setsunan University, Nagaotoge-cho, Hirakata, Osaka, 573-0101 JAPAN; dForest Research Institute, Forest Department, Ministry of Natural Resources and Environmental Conservation, Yezin, Nay Pyi Taw, MYANMAR *Corresponding author: [email protected] (Accepted on August 2, 2016) As the result of field explorations to northwestern Myanmar, a total of five species of the genus Agapetes (Ericaceae) were collected. Of these, two species were hitherto undescribed taxa. They were recorded with citation of voucher specimens and a photograph of each species was provided. Two new species were described as Agapetes oxycoccoides and A. pentastigma. Agapetes oxycoccoides is similar to A. bracteata, but distinguished by the corymbose inflorescence without distinct bract, and more strongly reflexed longer corolla lobes. Agapetes pentastigma is morphologically similar to A. hillii, but differs in having a greenish-yellow collora with ladder-like red stripes, and a short peduncle. (Continued from Acta Phytotax. Geobot. 65: 89–97, 2014) Key words: Agapetes oxycoccoides, Agapetes pentastigma, Myanmar, new species, phylogeny. The genus Agapetes D. Don ex G. Don is 2005, Watthana 2012, Tong and Xia 2014). assignable to the tribe Vaccinieae Rchb. of the In morphological and anatomical characters, subfamily Vaccinioideae Arn. (Ericaceae). The Agapetes is closely related to Vaccinium from SE past classification treated the species from New Asia (Stevens 1985). The molecular phylogeny Guinea and the SW Pacific as Agapetes (Airy indicated that Agapetes species nested among Shaw 1958). The species, however, except Vaccinium species, cf. V. gaultheriifolium A. scortechinii (King & Gamble) Sleumer, of (Griff.) Hook. f. and V. nummularia Hook. f. & which taxonomic status has been in question, Thomson, although only three Agapetes species, are currently placed in Paphia Seeman (Kron A. buxifolia Nutt. ex Hook. f., A. hosseana Diels, et al. 1999, Stevens 2004). Agapetes, holding and A. serpens (Wight) Sleumer, were analyzed about 80 species at present, is distributed (Kron et al. 2002). Currently it is thought that from the Himalayas to China, and Indo- many species of Agapetes are part of the same China to Southeast Asia (Fang and Stevens lineage as many SE Asian-Malesian Vaccinium —99— 100 The Journal of Japanese Botany Vol. 91 Centennial Memorial Issue (Fang and Stevens 2005). Myanmar, and A. pentastigma was close to A. Field expeditions to Kachin State, odontocera (Wight) Hook. f., distributed in E northwestern Myanmar to update the flora India. of Myanmar were carried out. Northwestern Myanmar is known for its wealth of plant Materials and Methods species diversity. Our previous works revealed Plant materials many new records and also new taxa based on Field excursions to the Hukaung Valley Tiger these northwestern excursions (Tanaka et al. Reserve, Kachin State, northwestern Myanmar 2006, Tanaka and Hughes 2007, Tanaka and have been conducted twice, in 2005 and 2007. Hayami 2011, Tanaka et al. 2016). The Hukaung Valley is one of the largest Differences in the amount of rainfall in conservation sites in the country, but it remains the dry and rainy seasons are remarkable in floristically poorly known. The valley is a flat Myanmar, and it is presumed that plants there alluvial plain measuring about 80 km north– are adapted to the environment by having a south by 50 km east–west, surrounded on all characteristic life cycle. The genus Agapetes sides by hills (Cruickshank and KoKo 2003). with its characteristic storage rootstock may be A total of five species of Agapetes were one of such a kind of plant, and it has apparently collected in the evergreen tropical lowland diversified in Myanmar. Including twenty new forest in Shinbweyang, northwest of Tanaing, species that were previously described from Hukaung Valley, and they were morphologically Myanmar by Airy Shaw (1935, 1948, 1959, investigated. Voucher specimens were deposited 1960a, 1960b), Kress et al. (2003) listed 54 in TI, TNS and RAF. species of Agapetes from Myanmar. Recently Tong and Xia (2014) added two new taxa, DNA sequencing and phylogenetic analysis A. putaoensis Y. H. Tong & N. H. Xia and A. For molecular phylogenetic analyses, wardii W. W. Smith var. heterotricha Y. H. 24 species and one variety of Agapetes, Tong & N. H. Xia to the flora of Myanmar, for including A. scortechinii, eight representative a total of 56 taxa to date. However, many of species of Vaccinium including species that them were known from fragmentary information are morphologically and phylogenetically based on the type and few additional herbarium related to Agapetes (V. gaultheriifolium and specimens. Observation on living plants in V. nummularia; Kron et al. 2002), and two the field is desirable for a taxonomic and species of Paphia were collected (Appendix phylogenetic revision of Agapetes and related 1). Considering the phylogenetic relationship species. The identifications of the specimens of Vaccinieae, Andromeda polifolia L. and collected by our fieldworks led us to recognize Dimorphanthera kempteriana Schltr. were used five species of Agapetes (Ericaceae) from as outgroups. Total genomic DNA was extracted the field of northwestern Myanmar. Based on from silica-gel-dried leaf tissue, using the morphological and phylogenetic investigations modified HEPES-CTAB method described by two of them were recognized as new to Ohi-Toma et al. (2010). science. We describe these two species as A. Nucleotide sequences of the chloroplast oxycoccoides and A. pentastigma in this study. trnK intron (including the matK gene) were Molecular phylogenetic analysis was also determined using polymerase chain reaction applied to understand the relationship of these (PCR) and direct bi-directional sequencing. species among the related taxa. It suggested PCR amplification was conducted using that A. oxycoccoides was related to A. setigera TaKaRa ExTaq (TaKaRa Bio, Shiga, Japan), D. Don ex G. Don, distributed in India and with the following cycling conditions: December 2016 Tanaka et al.: Agapetes from NE Myanmar 101 Table. 1. List of primers for amplification and sequencing Primers Sequence from the 5’ end Note* Reference trnK-3914F TGGGTTGCTAACTCAATGG P, S Johnson and Soltis (1994) trnK-5-intron_Rv AGCTTTTCCCGCAACAGATAC S This study trnK-5-intron_Fw TTTCCAAAATCAAAAGAGCG S This study matK 10 ATGATTCTGTTGATACATTC P, S Kato et al. (1998) matK 800F CACTTGCTYATGATCGTGGT P, S This study matK 4R GCATCTTTTACCCARTAGCGAAG S Bremer et al. (2002) matK 1650R ACATTCCCAGAAATTKACAAGGT P, S This study matK 4F CTTCGCTAYTGGGTAAAAGATGC P, S Bremer et al. (2002) matK ERI_R GCACAAGAAAGTCGAAGTAT P, S Dunning and Savolainen (2010) matK 1660F TTTTCCATATGGGCTCAACC P, S This study matK AST_R CAAATAATATCCAAATACCAA P, S Dunning and Savolainen (2010) matK-3-intron Fw TACGGAGGAAGAGCAGGTTT S This study trnK-2R AACTAGTCGGATGGAGTAG P, S Johnson and Soltis (1994) *P. PCR amplification. S. Sequencing. denaturation at 96°C for 45 sec, followed by 33 coded gap-states were used as a fifth character; cycles at 96°C for 45 sec, annealing at 50°C for however, the length polymorphisms caused by 45 sec, extension at 72°C for 1 min, and a final mononucleotide repeats [poly(A) or poly(T)] extension at 72°C for 10 min. For amplifying and other unalignable portions were excluded and sequencing the trnK intron, we used newly from gap coding. In the data matrix, when designed primers in addition to published substitutions or overlapping gaps occurred at universal primers (Table 1). Amplification gap positions, the differences were indicated products were purified using illustra ExoProStar by adding ‘n’ to the position of the substitution (GE Healthcare UK Ltd., Buckinghamshire, and/or gap-state. In order to use coded gaps, England, UK). The purified PCR fragments were Maximum Parsimony analysis was applied using amplified using the Big Dye Terminator v3.1 PAUP* v. 4.0a149 (Swofford 2002). Nucleotide Cycle Sequencing Kit (Applied Biosystems, substitutions and coded gaps were given equal Foster City, California, USA). Cycle-sequencing weights, and the tree search was performed reactions were performed using the same primers using the branch-and-bound search option with for the PCR amplification and newly designed MulTrees in effect. The strict consensus tree primers for sequencing. Complementary strands of the most parsimonious trees was generated, of the sequenced regions were assembled and and changes of substitutions and gaps were edited using ATGC v. 4.2 (GENETXY Co., reconstructed on the tree using ACCTRAN Tokyo, Japan). All newly generated nucleotide character optimization. The MP bootstrap sequences were deposited in the DNA Data support (BS) values were estimated using a Bank of Japan (DDBJ) and their accession heuristic search of 10,000 replicates, with simple numbers are shown with sample information in sequence addition, TBR branch swapping, Appendix. Multrees in effect, and no limit of MaxTree. The nucleotide sequences were manually aligned and gap coding was employed as Results