Detection and Characterization of Caffeine-Less Tea Plants Originated from Interspecific Hybridization

Breeding Science 59: 277–283 (2009)

Detection and characterization of caffeine-less tea plants originated from interspecific hybridization

Akiko Ogino*1), Junichi Tanaka1), Fumiya Taniguchi1), Masayuki P. Yamamoto2) and Kyoji Yamada2)

1) National Institute of Vegetable and Tea Science, 87 Seto, Makurazaki, Kagoshima 898-0087, Japan 2) Department of Life, Information and System Sciences, Graduate School of Science and Engineering, University of Toyama, 3190 Gofuku, Toyama, Toyama 930-8555, Japan

Two tea plants containing little caffeine (caffeine-less) were found in a population derived from natural crossings of an interspecific hybrid ‘Cha Chuukanbohon Nou 6’ (Camellia taliensis × C. sinensis). Two caffeine- less plants showed low caffeine content and rather high theobromine, which is a precursor of caffeine, whereas all tested tea (C. sinensis) cultivars including ‘Cha Chuukanbohon Nou 6’ were observed high caffeine/ low theobromine contents. Component analysis by HPLC showed that ‘Taliensis-akame’ (C. taliensis), which is the seed parent of ‘Cha Chuukanbohon Nou 6’, showed low caffeine content and rather high theobromine and may be a caffeine-less character donor. Pedigree analysis using SSR markers suggested that parent- offspring relationship was found between tea plants related to caffeine-less tea breeding lines. Therefore, it is considered that caffeine-less character of caffeine-less plants could be inherited recessively from ‘Taliensis-akame’ via ‘Cha Chuukanbohon Nou 6’. Preliminary genetic analysis using 33 progenies of ‘Cha Chuukanbohon Nou 6’ suggested the possibility that the caffeine-less character might be controlled by one recessive locus. Caffeine-less tea plants found in this study, will be efficiently used for genetic resources to introgress caffeine-less traits to tea cultivars in breeding programs.

Key Words: tea, caffeine, interspecific crossing, genetic resources, Camellia sinensis, Camellia taliensis, caffeine-less.

Introduction methods already exist to remove caffeine (Nagaya and Iwahashi 2005, Maeda-Yamamoto et al. 2007), but the re- Caffeine is an important ingredient of tea as a beverage crop sulting green tea is expensive and of low quality. However, and stimulates mental activity by increasing concentration, if we can breed caffeine-less tea cultivars, there will be no in- and reducing fatigue and drowsiness. There is a report that creased cost and loss of quality associated with the industrial caffeine consumption may be associated with a reduced risk removal of caffeine. for type 2 diabetes (Iso et al. 2006), but excessive intake of Genetic resources and breeding materials are required to caffeine may cause inflammation of the digestive organ, generate new cultivars in breeding programs. Silvarolla et as well as insomnia and arrhythmia (Chou et al. 1994, al. (2004) has found three coffee plants (Coffea arabica L.) Nurminen et al. 1999). Side effects of caffeine are marked that contain little caffeine. These coffee plants were collect- in children and the elderly. ed in Ethiopia and contain 0.08% dry matter weight caffeine, Recently, healthy people have become concerned about which is much lower than the 1.18% dry matter weight of caffeine’s side effects because they tend to drink a large caffeine in regular coffee plants. However, there are no re- amount of green tea for its beneficial ingredients. At the ports of caffeine-less coffee plants being bred using these same time, awareness of the health benefits of green tea has breeding materials. Similarly, there are no reports of domes- increased, because of increasing reports about its functional ticated tea plants that contain little caffeine, whereas some ingredients, such as methylate catechins, which are benefi- wild relatives (C. irrawadiensis P.K. Barua, C. ptilophylla cial against allergies. It was reported that a green tea cultivar chang) that contain little caffeine have been reported ‘Benifuuki’ (C. sinensis (L.) O. Kuntze) has a particularly (Nagata and Sakai 1984, Ashihara et al. 1998). high content of methylate catechins (Maeda-Yamamoto et New breeding materials have begun to be produced for al. 2001). The caffeine content of green tea should therefore caffeine-less plants using biotechnological methods. Previ- be controlled to enhance its benefits to our health. Industrial ous studies have clarified that caffeine is synthesized in young tea leaves via the caffeine biosynthesis pathway shown in Communicated by T. Yamamoto Fig. 1. In this pathway, three methylation steps are catalyzed Received March 11, 2009. Accepted July 24, 2009. by S-adenosyl-methionine-dependent N-methyltransferases. *Corresponding author (e-mail: [email protected]) It is known that a single enzyme catalyzes the second and 278 Ogino, Tanaka, Taniguchi, Yamamoto and Yamada

Fig. 1. Caffeine biosynthesis pathway. SAM: S-adenosyl-methionine, SAH: S-adenosyl-homocysteine third methylation steps (Kato et al. 1999), and that coffee Materials and Methods plants have an additional minor pathway (Ogawa et al. 2001). Enzymes that participate in this pathway have been Plant materials identified (Kato et al. 2000, Uefiji et al. 2003). A transgenic A total of seven plant materials including two tea culti- system has been developed in coffee plants (Hatanaka et al. vars (Camellia sinensis) ‘Yabukita’ and ‘Okumusashi’ 1999) and caffeine-less coffee plants have been bred using (Matsumoto et al. 1962), a hybrid tea cultivar (C. taliensis × this technique (Ogita et al. 2003). On the other hand, there C. Sinensis) ‘Cha Chuukanbohon Nou 6’ (Ogino et al. has been little success in creating transgenic tea plants, and 2005), three tea breeding lines ‘Makura F1-95180’, there is no stable transgenic system for tea. ‘CafLess1’ and ‘Cafless2’, and a wild relative of tea In this study, two caffeine-less plants were detected in ‘Taliensis-akame’ (C. taliensis) were used for the compo- the progeny population of an interspecific hybrid ‘Cha nent and SSR analysis. Chuukanbohon Nou 6’ (C. taliensis × C. sinensis). Then, ‘Yabukita’ is the leading tea cultivar of Japan, and it is the caffeine-less character was characterized by analyzing cultivated in about 75% of the country’s tea fields. It was contents of caffeine and its precursor theobromine. SSR anal- used here as a standard tea plant for the component analysis. ysis was conducted to confirm the pedigree of two caffeine- ‘Taliensis-akame’ naturally grown in Yunnan province in less plants, ‘Cha Chuukanbohon Nou 6’ and ‘Taliensis- China can be crossed with C. sinensis. It was registered that akame’ (C. taliensis), in order to reveal the origin of caffeine- ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ were less character. In preliminary genetic analysis, mode of the derived from interspecific crossings of ‘Taliensis-akame’ caffeine-less character inheritance could be suggested. The and ‘Okumusashi’. ‘CafLess1’ and ‘CafLess2’ were ob- application of caffeine-less genetic resources identified in tained from a natural cross of ‘Cha Chuukanbohon Nou 6’. this study was discussed. A sib-crossing population between‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ was created during 2005– 2008. Sixty-two seedlings were obtained, and 29 of which Detection and characterization of caffeine-less tea plants 279

Table 1. HPLC gradient condition for component composition analysis Mobile phase Time AB 0.0 99 1 10.0 99 1 15.0 94 6 40.0 81 19 40.1 10 90 47.0 10 90 47.1 99 1

added to 50 mg powdered tea samples and stirred gently. The Fig. 2. Pedigree chart of a caffeine-less plant. Double lines mean samples were left for one hour at room temperature. Then, crossing. Dashed double lines indicate that the registered parent is false. they were filtered with filter paper (qualitative filter paper No. 2: Advantec) and a disposable membrane filter unit (Dismic-13CP: Advantec) before analysis. High-performance died during growth. Thirty-three hybrid plants were estab- liquid chromatography (HPLC) for component analysis was lished for component analysis and preliminary genetic anal- performed by using Crestpak C18T (JASCO) as the ODS col- ysis. A pedigree chart of the materials used in this study umn at 40°C. The flow rate of a mobile phase was 1 ml/min. except Yabukita is shown in Fig. 2. The composition of the mobile phase A was 0.1% phosphoric acid, 0.1% acetonitrile and 5% N,N-dimethylformamide Sample preparation for the component analysis in distilled water and the composition of the mobile phase First flush young shoots of tea cultivars and breeding B was 100% acetonitrile. The gradient condition is shown in lines were harvested in a field at the National Institute of Table 1. Caffeine and theobromine peaks were identified Vegetables and Tea Science (Makurazaki, Japan). 30 g new with a standard sample (06710-91, 336-05; Nacalai Tesque). shoots (approximately 60 shoots) plucked from a plant as a sample except sib-crossing population. Only one or two Simple sequence repeat (SSR) analysis shoots were used for test in the case of individuals of sib- DNA was extracted from leaves using diatomaceous crossing population, because they have only 2–3 shoots. The earth and a spin filter (Tanaka and Ikeda 2002). A total of 16 harvested new shoots were steamed and dried immediately. SSR markers shown in Table 2 were used in this study. SSR- All the dried samples were ground to a fine powder with grin- PCR amplification was carried out in a 10 μl solution con- der mill (CSM-F1: Shizuoka Seiki) or mortar before analysis. taining 0.5 U AmpliTaq Gold DNA Polymerase (Applied Caffeine and theobromine in green tea shoots were ex- Biosystems), 1xGold Buffer, 0.8 mM dNTP mix, 2.5 mM tracted by the method described by Horie et al. (2002). A MgCl2, 0.01% formamide, 1 pmol forward primer labeled mixture of 5 ml ethanol and 5 ml of 1% phosphoric acid was with fluorecent chemical Fam, 1 pmol reverse primer, and

Table 2. Primer information of SSR markers marker repeat motif a forward primer (5′ to 3′) reverse primer (5′ to 3′) Accession No. MSE0022 (tc)19, (ta)9, (ac)5 cctgcagtgtagaaaagccccaat cgatctgggagcttcttggagata AB361048 MSE0023 (tc)13, (tc)7, (ct)3, (ta)5 tgaaacaaccacctcccttgatct agcagcgaagaaggattcattacg AB485966 MSE0026 (ac)3, (ag)7, (ac)4, (ag)3, (ag)6, (tc)3 atcaccaaaggaaacccctactgg cgcaggtggatctggagaaaatac AB461371 MSE0030 (tc)4, (ca)3, (tc)5, (tc)11 ttccaaaaccctagtttcactcca acgctctgtatcggtgaaggctac AB461369 MSE0035 (tc)13, (ag)4, (ag)5 caccttcaatcttccattgacgc cacaaaaaccccaaaataccctcc AB461372 MSE0037 (ca)3, (tc)12, (ag)4, (gaa)3 tatacccatttgccttgcttggtc gaagcaaatttgggaaatcagtgc AB485967 MSE0039 (ag)21 ccattctgctgcaattacacatcc gattttggtaagcggctcattgtc AB485968 MSE0040 (tc)18, (ctt)3 tctccgacgagtccagttcctaac tttgtacatttgcagaggcagagc AB485969 MSE0045 (ag)14, (ga)3, (ag)4 ttggcgataacttcgagacacaaa ctccctccctcccttttaatggtt AB461368 MSE0047 (tc)13, (tc)4, (tc)3 tgatcatctctaaacccctaaaaccc tgatgttggaatggttgaaggaga AB485970 MSE0100 (tc)15 ttctttccgtgtacatacaccccc gaattgttggaggccgtagaattg AB461370 MSE0107 (tc)8, (ca)3, (cct)3 tctctctactcctgcgcaatctca tcaaagatgttgctctcgtcaacc AB485971 MSE0113 (tc)14 taccttctgcaactccagcaatcc tgagattgaccatctttcatcgga AB485972 MSE0119 (tg)3, (ag)10 gcccgaagagatgttcaagtttgt tttccatttccacctacttcccaa AB485973 MSE0121 (ag)13 ccgctcgctaactacgactctctc cggcaagtatgatttttccaggag AB485974 MSE0149 (tc)12 caaaccagaattaccagctcatatcc tgggtatttggagacagcaacaga AB485975 a Commas indicate gap between the two motifs. 280 Ogino, Tanaka, Taniguchi, Yamamoto and Yamada

0.2–0.5 ng template DNA. PCR conditions were initial de- naturation at 94°C for 5 min; 14 cycles at 94°C for 30 sec, 62–55°C (decrease of 0.5°C for every cycle) for 30 sec, 26 cycles at 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min, and final extension at 72°C for 5 min. The PCR products were separated and detected using 3130xl Genetic Analyzer (Applied Biosystems). The size of the amplified bands was determined on an internal standard DNA (GeneScane 500 LIZ, Applied Biosystems) using GeneMapper software (Applied Biosystems).

Results

Component analysis of caffeine and detection of caffeine- less tea plants Component analysis of caffeine content was established by using HPLC. In the HPLC system, caffeine and its precursor theobromine were detected as the retention times of about 16 and 7 minutes, respectively (Fig. 3). It was analyzed the caffeine content of 213 individuals derived from a natural crossing of ‘Cha Chuukanbohon Nou 6’. As a result, almost all individuals contained caffeine with the range of 1.51–4.18% of dry matter weight, whereas two individuals showed extremely low amounts of caffeine, but a high amount of theobromine (Fig. 3 and Table 3). We defined the tea plants containing 0.20% or less of caffeine per dry matter weight as “caffeine-less” tea plants and designated the two caffeine-less individuals ‘CafLess1’ and ‘CafLess2’. In 2005, ‘CafLess1’ and ‘CafLess2’ contained 0.12 and 0.13% of dry matter weight caffeine and 3.38 and 1.81% of dry matter weight theobromine, respectively. And this composition was observed in 2008. Caffeine and theobromine contents were also obtained for ‘Yabukita’, ‘Okumusashi’, ‘Cha Chuukanbohon Nou 6’, ‘Makura F1-95180’, and ‘Taliensis-akame’ in 2005 and Fig. 3. HPLC chromatograms of component analysis. A: ‘Yabukita’; 2008 (Table 3). In 2005, ‘Yabukita’ and ‘Okumusashi’ con- B: ‘CafLess1’. Peak1: Theobromine; Peak2: Caffeine. tained 2.72 and 2.97% of dry matter weight caffeine, and 0.08 and 0% of dry matter weight theobromine, respectively. Table 3. Caffeine and theobromine contents of 7 tea plants × Hybrid cultivar from C. taliensis C. sinensis, i.e., ‘Cha Content (% of dry matter weight) Chuukanbohon Nou 6’ contained 1.97% of dry matter Theobromine Caffeine weight caffeine, and 0.15% of dry matter weight theobro- Cultivar mine. On the other hand, ‘Taliensis-akame’ contained only 2005 2008 2005 2008 0.14% of dry matter weight caffeine and 5.07% of dry matter 1st flush 1st flush 1st flush 1st flush weight theobromine. In 2008, these tea cultivars showed Taliensis-akame 5.07 2.81 0.14 NDa similar compositions and ‘Makura F1-95180’ contained Okumusashi NDa 0.05 2.97 4.02 4.21% of dry matter weight caffeine, and 0.97% of dry mat- Cha Chuukanbohon Nou 6 0.15 0.13 1.97 2.19 b b ter weight theobromine. The caffeine and theobromine ratios Makura F1-95180 – 0.97 – 4.21 of ‘CafLess1’ and ‘CafLess2’ were similar to ‘Taliensis- CafLess1 3.38 4.29 0.12 0.02 CafLess2 1.81 –b 0.13 –b akame’ and largely different from general green tea cultivars. Yabukita 0.08 0.00 2.72 2.60 Parentage test by SSR markers a not detected. Pedigree relationships of ‘Taliensis-akame’, ‘Cha b no analysis. Chuukanbohon Nou 6’, ‘Makura F1-95180’, ‘Okumusashi’, ‘CafLess1’ and ‘CafLess2’ were investigated by 16 single- for all 16 SSR markers, direct parent-offspring relationships locus SSR markers (Table 4). Since ‘CafLes1’ and ‘CafLess2’ were strongly suggested for ‘Cha Chuukanbohon Nou 6’ vs. shared one SSR alleles with ‘Cha Chuukanbohon Nou 6’ ‘CafLess1’ as well as ‘Cha Chuukanbohon Nou 6’ vs. Detection and characterization of caffeine-less tea plants 281

Table 4. SSR genotypes of 6 tea plants SSR genotype (bp) Marker Cha Chuukanbohon Taliensis-akame Okumusashi Makura F1-95180 CafLess1 CafLess2 Nou 6 MSE0022 174/188 202/204 174/186 174/(174) a 174/186 174/186 MSE0023 194/196 188/194 194/217 194/217 194/217 194/217 MSE0026 287/(287)a 284/296 282/287 284/287 266/287 284/287 MSE0030 249/254 260/(260)a 249/260 254/260 249/254 249/254 MSE0035 231/236 223/225 214/236 214/231 214/236 214/(214)a MSE0037 213/(213)a 219/(219)a 206/213 206/213 206/213 206/213 MSE0039 138/141 146/(146)a 138/172 141/172 138/172 138/172 MSE0040 149/158 125/147 142/149 125/149 142/149 125/149 MSE0045 222/(222)a 226/228 222/228 222/228 222/(222)a 222/(222)a MSE0047 272/(272)a 274/280 263/272 263/272 263/272 263/272 MSE0100 255/261 241/267 255/261 255/261 255/261 261/(261)a MSE0107 287/288 305/313 287/313 287/290 290/313 287/290 MSE0113 350/366 350/379 358/366 358/366 358/366 358/(358)a MSE0119 86/98 86/92 86/92 86/102 86/98 86/102 MSE0121 179/(179)a 180/(180)a 179/(179)a 179/190 179/(179)a 179/190 MSE0149 209/(209)a 218/227 209/227 209/227 227/(227)a 209/227 a Numbers in parentheses indicate that is not clear whether the genotype is a homozygote or a null allele. In either case, though, the results would not have been affected.

‘CafLess2’. The pollen parent of ‘CafLess1’ could not be identified in this study, because no candidate parents showed agreement with ‘CafLess1’ by SSR analysis. When ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ are considered as parents of ‘CafLess2’, all SSR genotypes of ‘CafLess2’ showed no discrepancy, suggesting that ‘CafLess2’ was generated by a cross of ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’. Parent-offspring relationships were examined for ‘Taliensis-akame’ vs. ‘Cha Chuukanbohon Nou 6’ and ‘Taliensis-akame’ vs. ‘Makura F1-95180’ by 16 SSR markers. Since all 16 SSR markers showed no discrepancy for allele shares for these 2 sets of cultivars, their parent-offspring relationships were confirmed. Additionally, ‘Okumusashi’ registered as a pollen parent of ‘Cha Chuukanbohon Nou 6’ showed allele discrepancies in 11 SSRs, indicating that ‘Okumusashi’ is not the pollen parent of ‘Cha Chuukanbohon Nou 6’.

Genetic analysis of caffeine-less trait by a sib-crossing pop- Fig. 4. Distribution of caffeine-contained individuals and caffeine- ulation less individuals in the sib-crossing population. : ‘Taliensis-akame’, A sib-crossing population crossed between ‘Cha : ‘Cha Chuukanbohon Nou 6’, : ‘Makura F1-95180’, : sib- Chuukanhbohon Nou 6’ and ‘Makura F1-95180’ was used crossing population (caffeine-less), : sib-crossing population (con- for evaluation of caffeine-less character. Thirty-three F1 tains caffeine) plantlets were analyzed for their caffeine and theobromine contents by HPLC analysis. Out of 33 individuals analyzed, vs. ‘Cha Chuukanbohon Nou 6’ and ‘Taliensis-akame’ vs. 9 caffeine-less (high theobromine and low caffeine) individu- ‘Makura F1-95180’, caffeine-less trait of ‘Taliensis-akame’ als were detected (Fig. 4). Nine caffeine-less individuals could be inherited to 9 caffeine-less individuals and might contained from 0.01–0.14% in dry matter weight caffeine, be recessive inheritance. The preliminary genetic analysis and 1.61–3.35% in dry matter weight theobromine. Since using 33 progenies of ‘Cha Chuukanbohon Nou 6’ × both ‘Cha Chuukanhbohon Nou 6’ and ‘Makura F1-95180’ ‘Makura F1-95180’ suggested the possibility that the showed high caffeine (low theobromine) and parent- caffeine-less character might be controlled by one recessive offspring relationships were confirmed for ‘Taliensis-akame’ locus (χ2 = 0.091, P < 0.05). 282 Ogino, Tanaka, Taniguchi, Yamamoto and Yamada

Discussion between ‘Taliensis-akame’ and ‘Makura F1-95180’, between ‘Cha Chuukanbohon Nou 6’ and ‘CafLess1’, and be- There are approximately 3,600 tea germplasms stored as ge- tween ‘Cha Chuukanbohon Nou 6’ and ‘CafLess2’. And netic resources at the National Institute of Vegetables and there is no discrepancy about the thing that ‘CafLess2’ was Tea Science (Makurazaki, Japan). Among them, about 2,600 generated by a cross of ‘Cha Chuukanbohon Nou 6’ and were collected from Japan, China, Korea, India, Indonesia, ‘Makura F1-95180’. This information is very important for Vietnam, Iran and so on. The remaining 1,000 or so are application of caffeine-less trait in tea breeding programs. progenies of collected germplasms. Until the present study, Kato et al. (2000) cloned the caffeine synthase (S- no caffeine-less germplasms were detected and found adenosylmethionine dependent N-methyltransferase) gene among genetic resources, so it was thought that the caffeine- from tea which catalyzes methylation involved in the last less character almost never appeared. In this study, two two steps in caffeine biosynthesis. Uefuji et al. (2003) iso- caffeine-less breeding lines, ‘CafLess1’ and ‘CafLess2’, were lated three types of cDNAs (CaXMT1, CaMXMT2, and detected in a progeny population of ‘Cha Chuukanbohon CaDXMT1) encoding S-adenosylmethionine dependent N- Nou 6’. This is the first report of the detection of caffeine- methyltransferases from immature fruits of coffee (Coffea less plants in progenies of cultivated tea. arabica) plants, corresponding to three methylation steps in The two caffeine-less breeding lines contained a high caffeine biosynthesis. We found that ‘Taliensis-akame’, amount of theobromine but little caffeine. Low caffeine trait ‘CafLess1’ and ‘CafLess2’ had low caffeine and rather high has been observed in wild relatives of tea, C. ptilophylla theobromine. As theobromine is a precursor of caffeine, it is (Ashihara et al. 1998) and C. irrawadiensis (Nagata and considered that methylation step from theobromine to caf- Sakai 1984). However, there are no reports of progenies of feine is inhibited for the present caffeine-less trait. It will be C. ptilophylla and C. irrawadiensis being bred because these interesting to investigate caffeine-less trait and structure of wild relatives might be difficult to cross with C. sinensis. In caffeine synthase in order to identify the mechanism of in- this study, caffeine-less trait was found in the progenies of a hibition of caffeine synthesis. It is also important to try to different wild relative, C. taliensis. Because of the report obtain DNA markers tightly linked to caffeine-less trait by that C. taliensis usually contains caffeine (Nagata and Sakai using information of caffeine biosynthesis genes, which will 1984), there are 3 possibilities that the caffeine content of lead to perform marker assisted selection in tea breeding C. taliensis species might vary, ‘Taliensis-akame’ might programs. have a different background from the previously analyzed C. taliensis or ‘Taliensis-akame’ might mutate. In any case, Acknowledgments ‘Taliensis-akame’ is very rare germplasm and valuable breeding material, because it contains little or no caffeine This work was supported by KAKENHI (19780009). We are and can easily be crossed with C. sinensis. grateful to M. M. Yamamoto and A. Nesumi (National Insti- The caffeine-less character of ‘Taliensis-akame’ did not tute of Vegetable and Tea Science) for their invaluable ad- appear in the F1 generation but in the F2 generation (Fig. 3 vice. We also wish to thank K. Ogawa (National Institute of and Table 3). ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1- Vegetable and Tea Science) for her technical assistance. 95180’, which were offsprings of ‘Taliensis-akame’, showed high caffeine content. ‘CafLess1’ and ‘CafLess2’ Literature Cited were the offsprings of ‘Cha Chuukanbohon Nou 6’ and showed caffeine-less character. Nine out of 33 progenies of Ashihara,H., M.Kato and Y.C.Xing (1998) Biosynthesis and metabo- lism of purine alkaloids in leaves of Cocoa Tea (Camellia ‘Cha Chuukanbohon Nou 6’ and ‘Makura F1-95180’ ptilophylla). J. Plant Res. 111: 599–604. showed caffeine-less phenotypes. These results suggested Chou, T.M. and N.L. Benowitz (1994) Caffeine and coffee: effects on that the caffeine-less character of ‘Taliensis-akame’ is reces- health and cardiovascular disease. Comp. Biochem. Physiol. 109C: sively inherited and that ‘Cha Chuukanbohon Nou 6’ and 173–189. ‘Makura F1-95180’ would be caffeine-less heterozygotes. Hatanaka, T., Y.E. Choi and H. Sano (1999) Transgenic plants of coffee Since genetic analysis was conducted in rather small popula- Coffea canephora from embryogenic callus via Agrobacterium tion size, it will be necessary to evaluate caffeine-less char- tumefaciens-mediated transformation. Plant Cell Rep. 19: 106– acter in larger progeny size, in order to reveal whether other 110. factors will be involved in caffeine-less trait or not. Horie, H., M. Maeda-Yamamoto, T. Ujihara and K. Kohata (2002) Ex- Recently, SSR markers have provided a more reliable traction of tea catechins for chemical analysis. Tea Res. J. 94: 60– method for parentage analysis, constructing genetic maps 64. Iso, H., C. Date, K. Wakai, M. Fukui and A. Tamakoshi (2006) The rela- and evaluating genetic diversity because of the co-dominant tionship between green tea and total caffeine intake and risk for inheritance and abundance of alleles per locus. In this study, self-reported Type 2 diabetes among Japanese adults. Ann. Intern. 16 SSR markers showing single-locus inheritance were de- Med. 144: 554–562. veloped from tea and were used for evaluation of pedigree. Kato, M., K. Mizuno, T. Fujimura, M. Iwama, M. Irie, A. Crozier and SSR analysis revealed direct parent-offspring relation be- H.Ashihara (1999) Purification and characterization of caffeine tween ‘Taliensis-akame’ and ‘Cha Chuukanbohon Nou 6’, synthase from tea leaves. Plant Physiol. 120: 579–586. Detection and characterization of caffeine-less tea plants 283

Kato, M., K. Mizuno, A. Crozier, T. Fujimura and H. Ashihara (2000) Nurminen, M.L., L. Niittynen, R. Korpela and H. Vapaatalo (1999) Caffeine synthesis gene from tea leaves. Nature 406: 956–957. Coffee, caffeine and blood pressure. Eur. J. Clin. Nutr. 53: 831– Maeda-Yamamoto, M., M. Sano, N. Matsuda, T. Miyase, K. Kawamoto, 839. N. Suzuki, M. Yoshimura, H. Tachibana and K. Hakamata (2001) Ogawa, M., Y. Herai, N. Koizumi, T. Kusano and H. Sano (2001) 7- The change of epigallocatechin-3-O-(3-O-methyl) gallate content Methylxanthine methyltransferase of coffee plants. J. Biol. Chem. in tea of different varieties, tea seasons of crop and processing 276: 8213–8218. method. J. of the Jpn. Soc. for Food Sci. and Technol. 48: 64–68. Ogita, S., H. Uefiji, Y. Yamaguchi, N. Koizumi and H. Sano (2003) Pro- Maeda-Yamamoto, M., H. Nagaya, T. Mitsumori, Y. Yamaguchi, ducting decaffeineated coffee plants. Nature 423: 823. H.Horie, K. Ema, M. Suzuki, H. Yamauchi, F. Warashina, Y. Ogino, A., J. Tanaka, K. Yoshida, F. Taniguchi, H. Omae, A. Nesumi, Mizukami et al. (2007) A change of chemical components and ef- T.Saba, T. Takyu and Y. Takeda (2005) New parental line ‘Cha fects on anti-allergic activity in ‘Benifuuki’ green tea which was Chuukanbohon Nou 6’ for anthocyanin-rich tea. Bull. Natl. Inst. produced with a low caffeine processing machine. Jpn. J. of Food Veg. & Tea Sci. Jpn. 4: 77–85. Eng. 8: 109–116. Silvarolla, M.B., P. Mazzafera and L.C. Fazuoli (2004) A naturally de- Matsumoto, T., Y. Fuchinoue, T. Yonemaru and M. Tanaka (1962) A caffeinated arabica coffee. Nature 429: 826. newly registered tea variety ‘Oku-Musashi’ for green tea. Tea Res. Tanaka, J. and S. Ikeda (2002) The rapid and robust DNA extraction J. 19: 6–9. method from various plant species using diatomaceous earth and a Nagata, T. and S. Sakai (1984) Differences in caffeine, flavanols and spin filter. Breed. Sci. 52: 151–155. amino acids contents in leaves of cultivated species of camellia. Uefuji, H., S. Ogita, Y. Yamaguchi, N. Koizumi and H. Sano (2003) Jpn. J. Breed. 34: 459–467. Molecular cloning and functional characterization of three distinct Nagaya, H. and S. Iwahashi (2005) Cha namaha shori souchi to cha N-Methyltransferases involved in the caffeine biosynthetic path- namaha shori hohou (Measures and methods for processing raw tea way in coffee plants. Plant Physiol. 132: 372–380. leaves). JP pat. P2005–185200A.