Distinct Activities of Stromal Cells Involved in the Organogenesis of Lymph Nodes and Peyer's Patches

This information is current as Masato Okuda, Atsushi Togawa, Hiromi Wada and Shin-ichi of September 24, 2021. Nishikawa J Immunol 2007; 179:804-811; ; doi: 10.4049/jimmunol.179.2.804 http://www.jimmunol.org/content/179/2/804 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2008/03/13/179.2.804.DC1 Material

References This article cites 39 articles, 16 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/179/2/804.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 24, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Distinct Activities of Stromal Cells Involved in the Organogenesis of Lymph Nodes and Peyer’s Patches1

Masato Okuda,*† Atsushi Togawa,* Hiromi Wada,† and Shin-ichi Nishikawa2*

It is now well established that the interaction between “inducer” cells of hemopoietic origin and “organizer” cells of mesenchymal lineage is involved in the organogenesis of lymph node (LN) and Peyer’s patch (PP). Organizer cells are defined by the expression of VCAM-1 and ICAM-1 and the production of homeostatic chemokines. However, several studies suggested the presence of a diversity among these cells from different lymphoid tissues. Thus, we attempted to define the difference of organizer cells of LN and PP in terms of gene expression profile. Microarray analyses of organizer cells revealed that these cells isolated from embryonic mesenteric LN expressed higher levels of genes that are related to inflammation, tissue remodeling, and development of mesenchymal lineage compared with those from PP. Several transcription factors related to epithelial-mesenchymal interactions were also up-regulated in organizer cells from LN.

These results indicate that organizer cells in LN and PP are indeed distinct and suggest that the organizer cells in LN are at a more Downloaded from activated stage than those in PP. The Journal of Immunology, 2007, 179: 804–811.

nlike the lymphopoietic tissues such as thymus that is specified as cells that express both VCAM-1 and ICAM-1. In- emerged simultaneously with the evolution of the ac- deed, this population turned out to express a series of molecules quired immune system, peripheral lymphoid tissues that are essential for PP organogenesis, and thus was designated as U3 (PLT) such as lymph node (LN) and Peyer’s patch (PP) appeared the PP organizer (4). In subsequent studies, we showed that http://www.jimmunol.org/ late along with the evolution of the mammals. This evolutionary VCAM-1/ICAM-1 double-positive (DP) cells were also present in difference is indeed reflected by the cellular mechanisms underly- the LN. More recently, Cupedo et al. (9) investigated in detail this ing the organogenesis of these old and new tissues (1). The induc- DP population in the LN and showed that DP cell is the population tion of the thymus anlage exploits a morphogenic process that is that expresses receptor activator for NF-␬B ligand (RANKL) that common for most organs, such as the ingression of epithelial struc- is essential for LN organogenesis. This paper also reported the ture and epithelial-mesenchymal interaction (2, 3), whereas cells presence of two distinct types of double-positive cells—one ex- of hemopoietic lineage that are rarely involved in usual organo- pressed both ICAM-1 and VCAM-1 at a high level (DPhigh), genesis play a role in the induction of the PLT (4). The bone whereas the other expressed both molecules at an intermediate med formation would be another example of the organogenesis regu- level (DP )—and demonstrated that the proportion of each of by guest on September 24, 2021 lated by cells of hemopoietic lineage, because osteoclasts arise the two DP populations was different between mesenteric LN from macrophage precursors in bone marrow (5). With respect to (MLN) and peripheral LN. This study was thus the first demon- PLT formation, previous studies including ours indicated that the stration of the presence of a diversity of DP organizer population ␣ ␣ ␤ hemopoietic cells that express IL-7R and 4 7 integrin are com- among PLT and raised a possibility that this diversity might be monly required for both LN and PP organogenesis (6–8). Because responsible for the difference in the molecular requirements for of this feature, these hemopoietic cells are now designated as the PLT organogenesis. For instance, IL-7R␣ and receptor activator inducer of PLT organogenesis. for NF-␬B (RANK) signal are required differentially for PP and During the initial stage of PLT organogenesis, the inducer cells LN organogenesis, respectively; it is plausible that the expression and surrounding mesenchymal components form a mutually inter- level of ligands for these receptors, such as IL-7 and RANKL, acting unit driving PLT organogenesis. We showed that the active respectively, in organizer cell population may differ among the compartment of mesenchymal cells involved in PP organogenesis organs (8, 10–12). The aim of this study was to define the difference in the DP

*Laboratory for Stem Cell Biology, RIKEN Center for Developmental Biology, organizer population between PP and LN. Our results showed that high Kobe, Japan; and †Department of Thoracic Surgery, Faculty of Medicine, Kyoto DP populations in LN and PP are indeed completely distinct University, Kyoto, Japan populations, although both belong to the mesenchymal cell Received for publication October 12, 2006. Accepted for publication May 9, 2007. lineage. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Materials and Methods 1 This work was supported by Grants-in-Aid from the Ministry of Education, Culture, Mice Sports, Science and Technology (to A.T. and S.N.). 2 Pregnant C57BL/6J mice were purchased from Japan SLC. Noon of the Address correspondence and reprint requests to Dr. Shin-ichi Nishikawa, Laboratory day when the vaginal plug was found was designated as 0.5 days postcoi- for Stem Cell Biology, RIKEN Center for Developmental Biology, 2-2-3 Minatojima- minamimachi, Chuo-ku, Kobe 650-0047, Japan. E-mail address: nishikawa@cdb. tus. All animal experimental plans were reviewed and approved by the riken.jp Institutional Animal Experiment Review Board. 3 Abbreviations used in this paper: PLT, peripheral lymphoid tissue; LN, lymph node; MLN, mesenteric LN; PP, Peyer’s patch; DP, double positive; RANK, receptor ac- Antibodies tivator for NF-␬B; RANKL, RANK ligand; LT, lymphotoxin; E17.5, embryonic day 17.5; P4, postnatal day 4. For flow cytometry analyses, the following Abs were used: allophycocya- nin-Cy7 anti-CD45 (30-F11) and FITC anti-ICAM-1 (3E2) were purchased Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 from BD Pharmingen (San Jose, CA). Anti-VCAM-1 (M/K-2) was purified www.jimmunol.org The Journal of Immunology 805

Table I. PCR primers used for PCRs

Gene Name Forward Reverse

GAPDH GACGGACACATTGGGGGTAG TGACCACAGTCCATGCCATC ICAM-1 AGGGCTGGCATTGTTCTCTA AAGGACCTCACCGAAAGTCC VCAM-1 TGGTGAAATGGAATCTGAACC CCCAGATGGTGGTTTCCTT RANKL CAGCATCGCTCTGTTCCTGTA CTGCGTTTTCATGGAGTCTCA IL7 GTGCTGCTCGCAAGTTGAAG AGTTCACCAGTGTTTGTGTGC CXCL13 TGAGGCTCAGCACAGCAA ATGGGCTTCCAGAATACCG CCL19 GAAAGCCTTCCGCTACCTTC GCCCCTTAGTGTGGTGAACA CCL21 TCCAAGGGCTGCAAGAGA TGAAGTTCGTGGGGGATCT SpiC CCAGCAAAAGGGAGGAAGA TTGCACAGGGATTCGAAAA Lhx8 GAGCTCGGACCAGCTTCA TTGTTGTCCTGAGCGAACTG Meox2 AATCTAGACCTCACTGAAAGACAGG CTTTGACCCGCTTCCACTT Prrx1 AGTCACCGGGACTGACCA TCTTCTCCTCAGAGTTCAACTGG IL6 GCTACCAAACTGGATATAATCAGGA CCAGGTAGCTATGGTACTCCAGAA VEGFA GCAGCTTGAGTTAAACGAACG GGTTCCCGAAACCCTGAG VEGFC CAGACAAGTTCATTCAATTATTAGACG TGTCTTGTTAGCTGCCTGACAC CCL7 TCTGTGCCTGCTGCTCATAG TTGACATAGCAGCATGTGGAT CCL11 CACGGTCACTTCCTTCACC GGTCATGATAAAGCAGCAGGA CXCL1 CTGGGATTCACCTCAAGAACATC CAGGGTCAAGGCAAGCCTC Downloaded from

and labeled with allophycocyanin in our laboratory. RANKL on the cell sur- min, and H2O2 was added to 0.01%. The enzymatic reaction was allowed face was detected with biotin anti-mouse TRANCE (IK22/5; eBioscience) to proceed until the desired color intensity was reached, and the specimens followed by streptavidin PE (BD Pharmingen). Biotin anti-rat IgG2a isotype were rinsed three or four times in PBST. Finally, the specimens were control (eBR2a; eBioscience) was used as a negative control. dehydrated and the solution was exchanged to glycerol before being

photographed. http://www.jimmunol.org/ Flow cytometry Embryonic organs were dissected under stereomicroscope and dissociated Real-time quantitative RT-PCR by dispase (Invitrogen Life Technologies) incubation for 15 min at 37°C. Total RNA was purified using TRIzol. First-strand cDNA was synthe- After gentle pipetting, dissociated cells were washed with HBSS contain- sized from 2 ␮g of total RNA using oligo(dT) primers, random hex- ing 20% FCS and DNase (Sigma-Aldrich). Cells were filtered through amers, and SuperScript II (Invitrogen Life Technologies). Primers were nylon mesh to remove large clumps, washed, and stained with mAbs as designed using assay design center in Universal ProbeLibrary site (https:// described. These cells were analyzed or sorted by FACSAria (BD www.roche-applied-science.com). Designs were based on publicly Biosciences). available sequences. Real-time RT-PCR analysis was performed on ABI PRISM 7500 Sequence Detection System using the SYBR Green

Microarray analysis PCR Master Mix (GE Healthcare Bio-Sciences). The PCR consisted of by guest on September 24, 2021 ␮ ␮ GeneChip murine genome U74v2 arrays (Affymetrix) were used to identify 12.5 l of SYBR Green PCR Master Mix, 10 M forward and reverse Ϫ ␮ genes differentially expressed in CD45 VCAM-1highICAM-1high organizer primers, and 10 l of 1/2-diluted template cDNA in a total volume of ␮ cell population from MLN and PP compared with the negative control 25 l. Cycling was performed using the default conditions of the ABI population (CD45ϪVCAM-1ϪICAM-1Ϫ). RNA sample preparation, array 7500 SDS Software 1.2: 2 min at 50°C, 10 min at 95°C, followed by 40 hybridization, array washing, and scanning were performed according to rounds of 15 s at 95°C and 1 min at 60°C. The relative expression of the manufacturer’s protocol. Ten micrograms of total RNA was extracted each gene was normalized against GAPDH. Sequences for each primer from the sorted cells with TRIzol reagent (Invitrogen Life Technologies). pair are listed in Table I. Double-stranded cDNA was synthesized in two steps using the Superscript Choice System (Invitrogen Life Technologies) and the reverse transcrip- Results tion primer T7-(dT) (GE Healthcare Bio-Sciences). Subsequently, biotin- 24 The organizer cell populations in PP and LN labeled cRNA was synthesized using the BioArray RNA Transcript label- ing Kit (Affymetrix). Biotin-labeled cRNA was fragmented in a 40-␮l Previous studies showed that both RANK and its ligand RANKL reaction mixture containing 40 mM Tris-acetate (pH 8.1), 100 mM potas- were essential signal mediators for LN organogenesis, whereas sium acetate, and 30 mM magnesium acetate, and incubated at 94°C for 35 min, and then hybridized onto the MGU74v2 series of arrays and they were dispensable for PP organogenesis, which requires IL- scanned according to the manufacturer’s protocol. Data were analyzed 7R␣ signaling instead (8, 10–12). In addition, a line of evidence further using D-CHIP (http://www.dchip.org). suggests that the inducer cells that are involved in the induction of PP and LN organogenesis represent almost identical lineage, or at Immunohistochemistry least share common features, and can react to both RANKL and ␣ ␤ Whole-mount immunostaining was performed as previously described with IL-7 to express lymphotoxin (LT) 1 2 (6, 11). From these results, slight modifications. In brief, excised guts were incubated in fixing solution it is plausible that the factor that determines the nature of signals (4% paraformaldehyde in PBS) for 30 min at 4°C. After washing three times in PBS each for 30 min at 4°C, specimens were dehydrated by in- for activating inducers in PP and LN is the diversity among the cubating 30 min each with 50, 75, 100, 100% methanol in PBS at 4°C. To organizer cell population (13). block endogenous peroxidase, the fixed specimens were bleached (meth- To explore the diversity of organizer cell populations in LN and anol to 30% H2O2, 20:1) for 30 min at room temperature. For staining, the PP, we examined the expression pattern of VCAM-1 and ICAM-1 dehydrated specimens were first blocked by incubating twice in PBSMT in MLN and PP of embryonic day 17.5 (E17.5) embryos. Consis- (2% skim milk and 0.1% Triton X-100 in PBS) for1hatroom tempera- ture, incubated with PBSMT containing 0.5 ␮g/ml anti-VCAM-1 mAb tent with the previous study of Cupedo et al. (9), both ICAM- high high high med med med (clone 429; BD Pharmingen) overnight at 4°C. After washing five times in 1 VCAM-1 (DP ) and ICAM-1 VCAM-1 (DP ) PBSMT each for1hat4°C, the primary Ab was detected by incubating 1 populations were present in MLN, whereas only a small population ␮g/ml HRP-conjugated goat anti-rat Ig Ab (BioSource International) over- of DPmed cells was present in PP. However, this difference in the night at 4°C. After extensive washing with more than five exchanges of composition of organizer populations may not represent the inher- PBSMT, including the final washes in PBST (0.1% Triton X-100 in PBS) med three times for 20 min each at room temperature, specimens were soaked ent difference between LN and PP, because DP cells increase

in PBST containing 0.05% NiCl2 and 250 mg/ml diaminobenzidine for 20 during neonatal development (Fig. 1A). This result was confirmed 806 DISTINCT ACTIVITIES OF STROMAL CELLS IN PLT ORGANOGENESIS Downloaded from

FIGURE 1. Organizer cells in PLT. Single-cell suspensions of whole FIGURE 3. Cell sorting of organizer cell population. Single-cell sus- http://www.jimmunol.org/ mesenteries or whole intestines from embryonic (E17.5) or neonatal (P4) pensions of E17.5 and P4 mesenteries or intestines were stained with C57BL/6 mice were prepared and analyzed by FACS analysis. Each CD45- anti-CD45, anti-VCAM-1, and anti-ICAM-1 Abs. CD45ϪVCAM-1high negative population from either organ was stained by anti-VCAM-1 and ICAM-1high population from both tissues were FACS sorted. CD45Ϫ anti-ICAM-1 Abs. A, R1, R2, and R3 populations represent the VCAM- VCAM-1ϪICAM-1Ϫ cells from mesenteries were also sorted to use as high high med med Ϫ Ϫ 1 ICAM-1 , VCAM-1 ICAM-1 , and VCAM-1 ICAM-1 cells, a negative control. Purity of the sorting process was assessed by the respectively. B, Intestines from E17.5 embryo or P4 neonates were stained analysis of the postsort samples. with anti-VCAM-1 Ab by whole-mount immunohistochemistry. by guest on September 24, 2021 histologically, because a gradation in VCAM-1 staining was ob- Expression of RANK and RANKL in the organizer cells served in the day 4 PP, whereas the staining was more monotonous We next sought to determine the cell surface expression of RANK in E17.5 PP (Fig. 1B) (14, 15). Nonetheless, we confirmed the and RANKL in each organizer population by flow cytometry analysis result of Cupedo et al. showing that there are two types of DP cells; (6, 16). RANK expression could not be detected in any of the orga- one is DPhigh and the other is DPmed. Our results further showed nizer populations, be it DPmed or DPhigh (data not shown). In contrast, that composition of those two populations varies over the devel- the surface expression of RANKL was detected in the DPhigh popu- opmental stages of each organ as well as among organs. lation of MLN but not that of PP, whereas the DPmed population in either tissue did not express RANKL (Fig. 2). This result suggests that the DPhigh organizer cells in MLN are distinct from those in PP, and is consistent with the notion that the differential activity of the orga- nizers, particularly the DPhigh population, is responsible for the dif- ference in the signals used for the activation of the inducer cells.

Gene expression profile of organizer cells in PP and MLN To further define the difference in the DPhigh organizer populations between LN and PP, we compared the gene expression profile of these two populations by DNA microarray analysis. DPhigh cells were FACS sorted from either whole mesentery or whole intestine of E17.5 embryos, which includes MLN or PP, respectively (Fig. 3). VCAM-1lowICAM-1low cells from the whole mesentery were also sorted to use as a negative control. Purity of sorted cells was confirmed by the analysis of sorted cell samples. Cell sorting was repeated until the total cell number reached up to Ͼ104. Total RNA isolated from the pooled cells was amplified and used for the hybridization with Affymetrix chips. The same experiments were repeated twice and the lists of genes that showed Ͼ2-fold differ- FIGURE 2. Cell surface expression of RANKL on organizer cells. Each ence in both experiments in their expression levels between PP and organizer cell population described in Fig. 1 was analyzed for its cell sur- MLN are presented (supplemental Tables I–VI).4 Because the face expression level of RANKL. Cells were stained with anti-RANKL Ab and analyzed by FACS (blue line). Anti-rat IgG isotype control was used as a negative control (red line). 4 The online version of this article contains supplemental material. The Journal of Immunology 807

Table II. Genes expressed in MLN organizer cells Ͼ2-fold increase than in PP organizer cells

Fold Change

Gene Name Accession No. Expt. 1 Expt. 2

Cell adhesion molecules Activated leukocyte cell adhesion molecule L25274 7.06 3.03 Amine oxidase, copper containing 3 AF078705 6.48 7.34 Spondin 1 (f-spondin) extracellular matrix protein AW124931 5.59 3.73 Extracellular link domain-containing 1 AI266876 4.77 7.87 CD34 Ag AI847784 4.74 4.06 ␣ Integrin 6 X69902 4.15 4.39 Rho family GTPase 3 AW210072 3.54 2.20 Catenin ␣-like 1 AF006071 3.32 3.61 Von Willebrand factor homolog AI843063 3.29 2.50 Dermatopontin AA717826 2.96 2.49 Activated leukocyte cell adhesion molecule AI853494 2.86 5.33 Melanoma cell adhesion molecule AI853261 2.46 2.71 Nidogen 1 L17324 2.22 2.77 Cytokines IL-6 X54542 13.23 4.48 Chemokine (C-X-C motif) ligand 1 J04596 4.90 13.49 Small chemokine (C-C motif) ligand 11 U77462 3.40 2.83 Chemokine (C-C motif) ligand 7 X70058 3.38 12.05 Downloaded from TNF (ligand) superfamily, member 11 (RANKL) AF019048 3.09 2.67 Chemokine (C-C motif) ligand 2 M19681 2.59 5.66 Transcription factors Paired related homeobox 1 AI851714 193.01 65.55 Mesenchyme homeobox 2 Z16406 64.31 81.95 Homeobox A9 AI173898 24.73 63.35 Spi-C transcription factor (Spi-1/PU.1 related) AA182189 12.33 6.00

Transducin-like enhancer of split 1, homolog of Drosophila U61362 6.89 3.60 http://www.jimmunol.org/ E (spl) ISL1 transcription factor, LIM/homeodomain (islet-1) AJ132765 6.27 18.46 Forkhead box C2 AV251191 6.24 27.70 Gastrulation brain homeobox 2 Z48800 5.87 9.10 Early B cell factor 3 U92702 5.64 9.00 Ets variant gene 5 AW214004 4.85 4.31 GATA binding protein 6 AA667100 4.67 8.55 Homeobox C9 X55318 4.63 7.31 Heart and neural crest derivatives expressed transcript 2 AI661148 4.14 3.66 Myelocytomatosis oncogene L00039 3.20 2.72 Early growth response 2 M24377 2.70 4.01

Molecule possessing ankyrin-repeats induced by LPS AA614971 2.53 4.24 by guest on September 24, 2021 Homeobox only domain AW123564 2.34 7.78 TAF7 RNA polymerase II, TATA box binding protein AA763469 2.23 19.04 (TBP)-associated factor Extracellular proteins Matrix metalloproteinase 8 U96696 70.90 5.61 Nephroblastoma overexpressed gene Y09257 21.74 40.97 Reelin U24703 17.02 23.49 Amylase 2, pancreatic X02578 12.57 216.76 Wingless-related MMTV integration site 11 X70800 12.46 21.67 Collagen triple helix repeat containing 1 AI847474 11.67 15.90 Microfibrillar associated protein 5 AW121179 11.53 11.05 Pancreatic lipase related protein 1 AA674409 8.12 3.64 Retinol binding protein 4, plasma U63146 8.08 5.64 Angiopoietin 2 AF004326 5.94 18.19 Tetranectin (plasminogen binding protein) X79199 4.61 9.57 Intracellular proteins H1 histone family, member 4 L04141 50.81 a Rap guanine nucleotide exchange factor (GEF) 5 AI413822 24.83 8.09 Death-associated protein kinase 1 AI853387 18.63 8.05 Odd-skipped related 1 (Drosophila) AW049181 10.67 18.45 A disintegrin and metallopeptidase domain 22 AI854032 9.37 13.77 Cysteine dioxygenase 1, cytosolic AI854020 9.03 41.90 Neuron navigator 3 AA681750 8.48 11.07 B cell translocation gene 1, antiproliferative Z16410 2.80 2.34 Plasma membrane proteins Cytochrome P450, 1b1, benz͓a͔anthracene inducible X78445 345.84 413.40 Superiorcervical ganglia, neural specific 10 AI840972 43.83 9.90 Angiotensin II receptor, type 2 U04828 40.32 57.20 Potassium voltage-gated channel, Shal-related family, member 3 AW045978 21.79 25.94 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/ AI317360 11.16 5.99 Elo3, yeast)-like 2 Potassium voltage-gated channel, Isk-related subfamily, gene 4 AW214619 9.78 25.84 Annexin A1 AV003419 8.95 13.20 Protocadherin 21 AI852446 3.17 3.79

a The fold change could not be calculated, because no signal was detected in PP organizer cell populations. genes that we have detected in the previous section were also included was described to a significant extent by the gene ontology in Mouse in these lists, they may represent to a significant extent the difference Genome Informatics website (http://www.informatics.jax.org/) were of two cell populations. From these lists, genes whose functional role extracted and categorized in Tables II and III. 808 DISTINCT ACTIVITIES OF STROMAL CELLS IN PLT ORGANOGENESIS

Table III. Genes expressed in PP organizer cells Ͼ2-fold increase than in MLN organizer cells

Fold Change

Gene Name Accession No. Expt. 1 Expt. 2

Cell adhesion molecules Contactin 1 AI425965 17.93 31.63 Cadherin 17 AA796757 17.58 39.46 TGF, ␤ induced, 68 kDa L19932 13.44 12.81 Thrombospondin 4 AI324871 13.28 25.88 Contactin 1 X14943 6.77 7.85 Kit ligand M57647 4.32 4.65 EGF-like repeats and discoidin I-like domains 3 AW123298 4.28 5.84 Spondin 2, extracellular matrix protein AW050296 3.98 3.84 Scavenger receptor class B, member 2 AB008553 2.96 2.75 Elastin microfibril interfacer 1 AW229038 2.60 3.56 Mucosal vascular addressin cell adhesion D50434 2.52 3.08 molecule 1 Laminin, ␣2 U12147 2.21 2.60 ␣ Integrin 8 AI447669 2.18 3.34 Cytokines Chemokine (C-C motif) ligand 21b AF035684 2.54 2.78 Downloaded from Transcription factors Dachshund 1 (Drosophila) AI182278 29.04 13.07 Transcription factor 21 AF035717 8.90 22.10 Foxq1 AV238618 8.12 82.24 Forkhead box F2 Y12293 8.11 37.87 Placentae and embryos oncofetal gene M32484 4.13 6.84

Homeobox A2 AV368345 3.67 5.20 http://www.jimmunol.org/ Pre-B cell leukemia transcription factor 3 AF020199 3.65 2.76 Dead ringer homolog 1 (Drosophila) U60335 3.62 2.63 T-box 3 AW121328 3.43 6.47 Pre-B cell leukemia transcription factor 3 AF020200 2.70 2.65 Basic helix-loop-helix domain containing, class B2 Y07836 2.67 2.78 Cellular metabolism Fructose bisphosphatase 2 D42083 10.72 3.87 Phosphoenolpyruvate carboxykinase 1, cytosolic AF009605 6.35 6.96 Fibroblast growth factor receptor 2 M23362 3.40 6.55 Protein kinase C␨ M94632 3.08 4.61 Extracellular proteins by guest on September 24, 2021 Decysin AJ242912 101.17 880.73 Creatine kinase, mitochondrial 1, ubiquitous Z13969 44.29 16.68 Serine protease inhibitor, Kazal type 3 X06342 28.80 10.82 Amnionless AA929443 12.27 3.88 TNFR superfamily, member 11b (osteoprotegerin) U94331 4.96 3.66 Bone morphogenetic protein 4 X56848 4.52 2.57 PG-endoperoxide synthase 1 AV230409 3.95 3.99 Sema domain, Ig domain (Ig), short basic domain, Z80941 3.90 2.68 secreted, (semaphorin) 3E Stanniocalcin 2 AF031035 3.66 7.50 Fibroblast growth factor 8 D12483 3.14 4.05 Intracellular proteins Hydroxyacid oxidase (glycolate oxidase) 3 AI648067 39.37 3.41 Purinergic receptor P2Y, G-protein coupled, 14 AI448454 33.14 112.11 Expressed sequence R74645 AI839662 11.67 294.36 Ornithine transcarbamylase X07092 9.77 3.05 Sialyltransferase 8 (␣-2, 8-sialytransferase) D X86000 9.16 7.24 Ankyrin repeat domain 56 AV299354 8.22 7.27 Apoptotic chromatin condensation inducer in the AV310546 7.16 9.08 nucleus Myosin, light polypeptide kinase AA688911 6.16 2.79 Plasma membrane proteins Claudin 7 AF087825 146.59 16.59 Ag p97 (melanoma associated) identified by AB024336 20.20 3.54 monoclonal Abs 133.2 and 96.5 Tumor-associated calcium signal transducer 1 M76124 20.07 5.90 IL-10R, ␣ L12120 11.60 3.01 Transmembrane protein 46 AI646253 8.49 28.44 Solute carrier family 39 (iron-regulated transporter), AI255982 7.72 6.26 member 1 Delta-like 1 (Drosophila) X80903 6.46 8.02 Syntaxin 3 D29797 3.72 2.33 Patched homolog 2 AB010833 3.67 3.21 Patched homolog 1 AW123386 3.58 3.22 Growth hormone receptor U15012 3.21 5.15 Parathyroid hormone receptor X78936 2.47 2.91 The Journal of Immunology 809

FIGURE 4. Quantitative RT-PCR analyses of genes expressed in orga- nizer cells. The expression levels of genes that are known to be expressed in organizer cells were compared be- tween DPhigh populations from E17.5 and P4 mesenteries and intestines. A, Relative expression level compared with that of GAPDH is shown. B, The expression level of cytokines, chemo- Downloaded from kines, and transcription factors that were significantly overexpressed in MLN by microarray analyses was confirmed. http://www.jimmunol.org/ by guest on September 24, 2021 Expression of molecules involved in the cell-cell interaction DPhigh population of MLN than that of PP. In contrast, the expres- Using the lists, we first focused on the difference in two organizer sion level of homeostatic chemokines, including CXCL13, populations in terms of the expression of genes involved in the CCL19, and CCL21 was higher in PP than in MLN (Fig. 4A) (24, cell-cell interaction, including cell adhesion molecules, cytokines, 25). Other cytokines were also expressed in a higher level in the high chemokines, and other proteins. Of note, MLN expressed signifi- DP population of MLN than that of PP (Fig. 4B). cantly higher levels of a variety of cytokines and chemokines than The difference in the expression levels of genes mentioned PP, including RANKL, IL-6, IL-7, CCL7, CXCL1, and CCL11. In above could be simply due to the difference in the developmental contrast, only CCL21 was expressed higher in PP than in MLN. stage of both organs, because MLN start to develop earlier than PP Considering previous studies showing that some ILs and chemo- in the embryo. To address this question, we FACS-sorted DPhigh kines are induced in mesenchymal cells particularly by inflamma- population of MLN and PP from postnatal day 4 (P4) mice and tion, the feature of MLN organizer cells suggests that they are at compared the expression levels of genes by quantitative RT-PCR the activated state (17–19). analyses. The expression levels of RANKL and IL-6 mRNA were In addition, MLN organizers expressed molecules that have maintained higher in DPhigh population of MLN than that of PP; been shown to be expressed inducibly during the differentiation of however, the expression of IL-7 and other cytokines was compa- various mesenchymal cell lineages. Matrix metalloproteinase 8 rable between these two populations (Fig. 4). These results suggest and tetranectin are implicated in the tissue remodeling process that the expression levels of genes of cell adhesion molecules and such as the bone formation, nephroblastoma overexpressed gene is cytokines became comparable in a later stage of development of implicated as immediate-early protein involved in cell growth reg- both organs, but there are also genes whose expression levels re- ulation, and retinol binding protein 4 is a secretory protein induced main higher in MLN. in adipocytes (20–23). This observation is also consistent with the notion that MLN organizer represents a more active state in some ways than peripheral LN organizer. Expression of transcription regulators To confirm this observation from the microarray analysis, we performed quantitative RT-PCR analyses of those molecules. As The above results strongly suggest that organizer populations are expected, both VCAM-1 and ICAM-1 were expressed in either distinct between PP and MLN. We next compared two organizer DPhigh population. However, although its surface expression could populations in terms of the expression of transcription regulators. not be detected, a low level of RANKL mRNA expression was We could not notice a specific signature in the function of genes detected in DPhigh population of PP by RT-PCR, even though its that were expressed higher in PP organizer cells. In contrast, the expression level was lower than that in the DPhigh population of list of genes that are expressed higher in MLN organizers contains MLN. Interestingly, IL-7 expression was significantly higher in the some interesting features. Many genes listed such as Meox2, 810 DISTINCT ACTIVITIES OF STROMAL CELLS IN PLT ORGANOGENESIS

GATA6, Lhx8, Prrx1, Egr2 have been implicated in various set- the expression of IL-6 and IL-7 are higher in MLN than in PP. tings in which mesenchymal cell lineages play a role in the mor- Considering that these molecules are secreted upon stimulation, phogenesis (26, 27). Previous gene knockout studies indicated that these results suggest that the organizer of MLN is at a more acti- Meox2, Lhx8, and Prrx1 were involved in the development of vated state those in PP. We have shown that expression of VCAM skeletal tissues. Meox2 null mutant shows a severe defect in the and ICAM in the PP organizers is dependent on LT signal, indi- formation of skeletal muscles, and mutations of Lhx8 and Prrx1 cating that DPhigh organizer by itself represents an activated state resulted in cleft palate (28–31). This difference of gene expression (16). In addition to these adhesion molecules, expression of ho- profile was confirmed by quantitative RT-PCR (Fig. 4B). In em- meostatic chemokines such as CXCL13, CCL19, and CCL21 is bryo, Meox2, Lhx8, and Prrx1 were only expressed in DPhigh pop- induced in the organizer by LT and they are expressed in both of ulation of MLN. Although expression of these genes became de- tissues (24, 25). Thus, it is likely that additional signals are re- tectable in DPhigh population of PP over time, their expression sponsible for further activating the organizer cells of MLN. Be- levels remain significantly lower than that of MLN. cause the NF-␬B pathway is implicated in the induction of some of these molecules, it is plausible that MLN contains stimulants that Discussion induce NF-␬B pathway. What are then responsible stimuli in MLN How mesenchymal cells that look relatively homogeneous in mor- is totally obscure at present, but this difference may not be due to phology are able to be involved in enormously diverse processes of the presence of Ag stimulation because all of our comparisons morphogenesis is one of the most important questions in develop- were performed at embryonic stage. Of note is that most of these mental biology. A common mechanism unraveled by previous differences between PP and MLN vanished during neonatal devel- studies is the transformation of a limited portion of mesenchymal opment. Hence, it is likely that such an activated state is a result of Downloaded from cells to the activated state with the ability to regulate the subse- extrinsic signal. quent process of morphogenesis. One typical example of this pro- However, there is also a group of genes whose preferential ex- cess has been visualized as a mesenchymal cell condensation at the pression in MLN is maintained after birth. Interestingly, some of site of morphogenesis (32, 33). Development of various molecular those genes have been implicated in mesenchymal cell differenti- markers indicated that the condensed mesenchymal cells were in- ation to skeletal cells. One group consists of Spp1 (osteopontin)

deed distinct from surrounding cells. PLT are another example in and Egr2, which are known to be involved in osteogenesis, and http://www.jimmunol.org/ which the mesenchymal cells involved in organogenesis have been both of which are derived from mesenchymal cells (26, 37). An- distinguished by the expression of specific molecular markers. At other group consists of Lhx8, Meox2, and Prrx1, whose preferen- an early stage of PP organogenesis, we demonstrated that mesen- tial expression in MLN was confirmed by quantitative PCR. Al- chymal cells that are distinguished from surrounding cells by the though each gene has a unique role in embryogenesis, it is coexpression of VCAM-1 and ICAM-1 play the organizer role in interesting that cleft palate was found as the common phenotype of subsequent organogenic process (16). Likewise, DPϩ mesenchy- the null mutant mice of all three molecules. It is well established mal cells are also found in developing LN, indicating a common that mesenchymal condensation is a requisite process to complete mechanism for both PLT. This result thus strongly suggested the the formation of palate. Thus, it is plausible that a similar mech- involvement of the common mesenchymal subsets in the organo- anism is also operating in MLN. Because some mice survive to by guest on September 24, 2021 genesis of both PP and LN. To verify this possibility was the major term in all of these mutations, it would be interesting to examine aim of this study. these mice whether there is any defect in the LN development. The heterogeneity of mesenchymal cells in PLT has been sug- Taken together, all of these results suggest that DPhigh organizer gested by a previous study by Cupedo et al. (9). In this study, they cells in MLN are under additional stimuli other than LT signal. identified the existence of two mesenchymal populations, one ex- At this moment, the mechanism that renders DPhigh organizer pressing a medium level of VCAM-1 and ICAM-1 (DPdull) and the additionally activated in MLN but not in PP is unknown. The first other expressing a high level of both molecules (DPhigh). Although LN anlagen are thought to be generated in the area between vas- the proportion of the two DP populations markedly varies among cular and lymphatic systems when the lymphatic vessels bud from LN of different regions, not much difference was detected within the vein (38, 39). In contrast, our observation suggests that PP DPhigh populations. Interestingly, the proportion of DPdull popu- anlagen are generated irrespective of lymphatic systems, because lation is similarly low as those in the PLT in the study of Cupedo the lymphatic system in mouse intestine develops independently of et al. However, we think that this difference reflects the develop- PP formation (data not shown). Thus, it could be possible that this mental stage rather than the permanent feature of each PLT. As unique architecture that comprises venous and lymphatic vessels shown in Fig. 1, the proportion of DPdull population in PP in- may be responsible for the activation of the organizers in MLN. creases along with its postnatal development. Indeed, two distinct Nonetheless, this study clearly showed that DPhigh organizers in intensities of VCAM-1 staining are detected at P4, whereas MLN and PP are different. Further study will provide an insight VCAM-1 is expressed relatively homogeneously in the embryonic into the mechanism determining the differences in the organogen- PP anlagen. Thus, as suggested by a previous study of Cupedo et esis processes of LN and PP. al., it is likely that two mesenchymal components play distinct roles in PLT embryogenesis. Acknowledgment With respect to DPhigh population, our study demonstrated for We thank Dr. Toshio Kitamura of Tokyo University for providing anti- the first time the presence of diversity in the DPhigh organizers VCAM-1 M/K-2 clone. between PP and MLN. The most significant difference is the spe- cific expression of RANKL on MLN DPhigh organizers. This result Disclosures is consistent with the previous study by Cupedo et al. showing its The authors have no financial conflict of interest. expression in LN mesenchymal cells. Moreover, this may partly account for the specific requirement of RANK signaling in LN References organogenesis. In addition, the expression level of some inducible 1. Du Pasquier, L. 2005. Meeting the demand for innate and adaptive immunities during evolution. Scand. J. Immunol. 62(Suppl. 1): 39–48. chemokines such as CCL7, CCL11, or CXCL1 is markedly higher 2. Suniara, R. K., E. J. Jenkinson, and J. J. Owen. 2000. An essential role for thymic in DPhigh organizers in MLN than those in PP (34–36). Likewise, mesenchyme in early T cell development. J. Exp. Med. 191: 1051–1056. The Journal of Immunology 811

3. Anderson, G., and E. J. Jenkinson. 2001. Lymphostromal interactions in thymic of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189: development and function. Nat. Rev. Immunol. 1: 31–40. 403–412. 4. Nishikawa, S. I., H. Hashi, K. Honda, S. Fraser, and H. Yoshida. 2000. Inflam- 20. Iba, K., M. E. Durkin, L. Johnsen, E. Hunziker, K. Damgaard-Pedersen, mation, a prototype for organogenesis of the lymphopoietic/hematopoietic sys- H. Zhang, E. Engvall, R. Albrechtsen, and U. M. Wewer. 2001. Mice with a tem. Curr. Opin. Immunol. 12: 342–345. targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol. Cell Biol. 5. Pixley, F. J., and E. R. Stanley. 2004. CSF-1 regulation of the wandering mac- 21: 7817–7825. rophage: complexity in action. Trends Cell Biol. 14: 628–638. 21. Natarajan, D., E. Andermarcher, P. N. Schofield, and C. A. Boulter. 2000. Mouse 6. Yoshida, H., A. Naito, J. Inoue, M. Satoh, S. M. Santee-Cooper, C. F. Ware, Nov gene is expressed in hypaxial musculature and cranial structures derived A. Togawa, S. Nishikawa, and S. Nishikawa. 2002. Different cytokines induce from neural crest cells and placodes. Dev. Dyn. 219: 417–425. surface lymphotoxin-␣␤ on IL-7 receptor-␣ cells that differentially engender 22. Tsutsumi, C., M. Okuno, L. Tannous, R. Piantedosi, M. Allan, D. S. Goodman, lymph nodes and Peyer’s patches. Immunity 17: 823–833. and W. S. Blaner. 1992. Retinoids and retinoid-binding protein expression in rat 7. Yoshida, H., H. Kawamoto, S. M. Santee, H. Hashi, K. Honda, S. Nishikawa, adipocytes. J. Biol. Chem. 267: 1805–1810. ␣ ␤ 23. Van Lint, P., and C. Libert. 2006. Matrix metalloproteinase-8: cleavage can be C. F. Ware, Y. Katsura, and S. I. Nishikawa. 2001. Expression of 4 7 integrin defines a distinct pathway of lymphoid progenitors committed to T cells, fetal decisive. Cytokine Growth Factor Rev. 17: 217–223. intestinal lymphotoxin producer, NK, and dendritic cells. J. Immunol. 167: 24. Muller, G., U. E. Hopken, and M. Lipp. 2003. The impact of CCR7 and CXCR5 2511–2521. on lymphoid organ development and systemic immunity. Immunol. Rev. 195: 8. Adachi, S., H. Yoshida, K. Honda, K. Maki, K. Saijo, K. Ikuta, T. Saito, and 117–135. S. I. Nishikawa. 1998. Essential role of IL-7 receptor ␣ in the formation of 25. Okada, T., V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, and Peyer’s patch anlage. Int. Immunol. 10: 1–6. J. G. Cyster. 2002. Chemokine requirements for B cell entry to lymph nodes and 9. Cupedo, T., M. F. Vondenhoff, E. J. Heeregrave, A. E. De Weerd, W. Jansen, Peyer’s patches. J. Exp. Med. 196: 65–75. D. G. Jackson, G. Kraal, and R. E. Mebius. 2004. Presumptive lymph node 26. Grose, R., B. S. Harris, L. Cooper, P. Topilko, and P. Martin. 2002. Immediate organizers are differentially represented in developing mesenteric and peripheral early genes krox-24 and krox-20 are rapidly up-regulated after wounding in the nodes. J. Immunol. 173: 2968–2975. embryonic and adult mouse. Dev. Dyn. 223: 371–378. 10. Dougall, W. C., M. Glaccum, K. Charrier, K. Rohrbach, K. Brasel, T. De Smedt, 27. Maeda, M., K. Ohashi, and A. Ohashi-Kobayashi. 2005. Further extension of mammalian GATA-6. Dev. Growth Differ. 47: 591–600.

E. Daro, J. Smith, M. E. Tometsko, C. R. Maliszewski, et al. 1999. RANK is Downloaded from essential for osteoclast and lymph node development. Genes Dev. 13: 2412–2424. 28. Jin, J. Z., and J. Ding. 2006. Analysis of Meox-2 mutant mice reveals a novel postfusion-based cleft palate. Dev. Dyn. 235: 539–546. 11. Kim, N., P. R. Odgren, D. K. Kim, S. C. Marks, Jr., and Y. Choi. 2000. Diverse 29. Mankoo, B. S., N. S. Collins, P. Ashby, E. Grigorieva, L. H. Pevny, A. Candia, roles of the tumor necrosis factor family member TRANCE in skeletal physiol- C. V. Wright, P. W. Rigby, and V. Pachnis. 1999. Meox2 is a component of the ogy revealed by TRANCE deficiency and partial rescue by a lymphocyte-ex- genetic hierarchy controlling limb muscle development. Nature 400: 69–73. pressed TRANCE transgene. Proc. Natl. Acad. Sci. USA 97: 10905–10910. 30. ten Berge, D., A. Brouwer, J. Korving, M. J. Reijnen, E. J. van Raaij, F. Verbeek, 12. Kong, Y. Y., H. Yoshida, I. Sarosi, H. L. Tan, E. Timms, C. Capparelli, W. Gaffield, and F. Meijlink. 2001. Prx1 and Prx2 are upstream regulators of S. Morony, A. J. Oliveira-dos-Santos, G. Van, A. Itie, et al. 1999. OPGL is a key sonic hedgehog and control cell proliferation during mandibular arch morpho- regulator of osteoclastogenesis, lymphocyte development and lymph-node orga-

genesis. Development 128: 2929–2938. http://www.jimmunol.org/ nogenesis. Nature 397: 315–323. 31. Zhao, Y., Y. J. Guo, A. C. Tomac, N. R. Taylor, A. Grinberg, E. J. Lee, S. Huang, 13. Mebius, R. E. 2003. Organogenesis of lymphoid tissues. Nat. Rev. Immunol. 3: and H. Westphal. 1999. Isolated cleft palate in mice with a targeted mutation of 292–303. the LIM homeobox gene lhx8. Proc. Natl. Acad. Sci. USA 96: 15002–15006. 14. Adachi, S., H. Yoshida, H. Kataoka, and S. Nishikawa. 1997. Three distinctive 32. Aguila, H. L., and D. W. Rowe. 2005. Skeletal development, bone remodeling, steps in Peyer’s patch formation of murine embryo. Int. Immunol. 9: 507–514. and hematopoiesis. Immunol. Rev. 208: 7–18. 15. Hashi, H., H. Yoshida, K. Honda, S. Fraser, H. Kubo, M. Awane, 33. Olsen, B. R., A. M. Reginato, and W. Wang. 2000. Bone development. Annu. A. Takabayashi, H. Nakano, Y. Yamaoka, and S. Nishikawa. 2001. Compart- Rev. Cell Dev. Biol. 16: 191–220. mentalization of Peyer’s patch anlagen before lymphocyte entry. J. Immunol. 34. Baggiolini, M., B. Dewald, and B. Moser. 1997. Human chemokines: an update. 166: 3702–3709. Annu. Rev. Immunol. 15: 675–705. 16. Honda, K., H. Nakano, H. Yoshida, S. Nishikawa, P. Rennert, K. Ikuta, 35. Kim, K. S., K. Rajarathnam, I. Clark-Lewis, and B. D. Sykes. 1996. Structural M. Tamechika, K. Yamaguchi, T. Fukumoto, T. Chiba, and S. I. Nishikawa. characterization of a monomeric chemokine: monocyte chemoattractant pro-

2001. Molecular basis for hematopoietic/mesenchymal interaction during initia- tein-3. FEBS Lett. 395: 277–282. by guest on September 24, 2021 tion of Peyer’s patch organogenesis. J. Exp. Med. 193: 621–630. 36. Janatpour, M. J., S. Hudak, M. Sathe, J. D. Sedgwick, and L. M. McEvoy. 2001. 17. Dejardin, E., N. M. Droin, M. Delhase, E. Haas, Y. Cao, C. Makris, Z. W. Li, Tumor necrosis factor-dependent segmental control of MIG expression by high M. Karin, C. F. Ware, and D. R. Green. 2002. The lymphotoxin-␤ receptor endothelial venules in inflamed lymph nodes regulates monocyte recruitment. induces different patterns of gene expression via two NF-␬B pathways. Immunity J. Exp. Med. 194: 1375–1384. 17: 525–535. 37. Yoshitake, H., S. R. Rittling, D. T. Denhardt, and M. Noda. 1999. Osteopontin- 18. Matsumoto, M., K. Iwamasa, P. D. Rennert, T. Yamada, R. Suzuki, deficient mice are resistant to ovariectomy-induced bone resorption. Proc. Natl. A. Matsushima, M. Okabe, S. Fujita, and M. Yokoyama. 1999. Involvement of Acad. Sci. USA 96: 8156–8160. distinct cellular compartments in the abnormal lymphoid organogenesis in lym- 38. Karkkainen, M. J., P. Haiko, K. Sainio, J. Partanen, J. Taipale, T. V. Petrova, photoxin-␣-deficient mice and alymphoplasia (aly) mice defined by the chimeric M. Jeltsch, D. G. Jackson, M. Talikka, H. Rauvala, et al. 2004. Vascular endo- analysis. J. Immunol. 163: 1584–1591. thelial growth factor C is required for sprouting of the first lymphatic vessels from 19. Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, D. S. Riminton, embryonic veins. Nat. Immunol. 5: 74–80. M. D. Cooper, J. L. Browning, J. D. Sedgwick, and J. G. Cyster. 1999. Lym- 39. Wigle, J. T., and G. Oliver. 1999. Prox1 function is required for the development photoxin ␣/␤ and tumor necrosis factor are required for stromal cell expression of the murine lymphatic system. Cell 98: 769–778.