Gene editing-based protocols for the ex vivo correction of Recessive Dystrophic Epidermolysis Bullosa

by

Jose Bonafont Aragó

A dissertation submitted by in partial fulfillment of the requirements for the degree of Doctor of Philosophy in

BIOMEDICAL SCIENCE AND TECHNOLOGY

Universidad Carlos III de Madrid

Advisors:

Fernando Larcher Laguzzi Marcela Del Rio Nechaevsky Rodolfo Murillas Angoiti

Tutor:

Fernando Larcher Laguzzi

July 2020

This thesis is distributed under license “Creative Commons Attribution – Non Commercial – Non Derivatives”.

A Francisca Climent Darás, Mi persona favorita.

Acknowledgments

Nunca pensé que llegaría este momento. Pero aquí estamos. Bueno, realmente no estamos, al menos físicamente… Este fin de tesis pilla con todo el país confinado en sus casas en estado de alarma. Para que digan que acabar una tesis no es para tanto… sumémosle tiempos de cuarentena históricos por COVID-19, el famoso Coronavirus. En este punto que estamos más proactivos que nunca, aprendiendo a cocinar, haciendo ejercicio en el salón de casa, juegos de mesa y aniquilando el catálogo de Netflix, aprovecho para agradecer a todos los que se han cruzado en mi camino hasta el final de esta etapa, que de alguna manera u otra han influido en el desarrollo de este trabajo, a nivel profesional, personal o, algunos kamikazes, en ambos.

Para empezar, dado que ser un tío práctico me ha caracterizado bastante, iré directo al final. Hacer la tesis ha sido probablemente una de las mejores decisiones de mi vida, y nunca podría haber caído en un sitio mejor. A nivel profesional he tenido la suerte de formar parte de esta superdivisión, referente en terapia génica en toda Europa. Hemos ido testando todos los formatos CRISPR habidos y por haber, juntos, en consenso, en equipo, haciendo todo mucho más productivo y eficiente. Pero ahora viene lo fuerte. La parte personal… Esto ha sido el detonante y el motor de que los experimentos funcionaran, de venir cada día con una sonrisa a enfrentarte a micoplasma, bacterias, bandas fantasmas, qPCR ‘subidas al árbol’ y demás amenazas contra el correcto funcionamiento de esta tesis. He encontrado personas inteligentes y encantadoras que me han apoyado, asesorado, estorbado, molestado, hecho reír y llorar, incluso de risa, disfrazarme, bailar, viajar y soñar. Llegué a Madrid con un ‘acentazo’ de valenciano tremendo y probablemente sin saber freír un huevo, limpiar la casa o descifrar los programas de la lavadora, y a día de hoy, no sé en qué medida ha cambiado esto… pero he crecido mucho, he cambiado mucho y a fin de cuentas, sigo vivo, mucho, con parámetros bioquímicos en sangre correctísimos (incluso subiendo cada día al comedor de este centro…). En fin… me he convertido en el tío que soy ahora y que por suerte o por desgracia muchos de los aquí citados tenéis que aguantar cada día, así que no hace falta que os diga más.

Ahora, paso a contar intimidades y cotilleos de todos. Cómo os gusta esta parte… El Sálvame Deluxe científico. Bueno, primero, remontándonos al origen de esta etapa, empezaré por nombrar a Marcela. Corría el año 2014

y cursaba el Máster en la UPV y llegaba el momento de encaminar un poco tu vida, dejando progresivamente los jueves universitarios y fin de semanas al estilo ‘valenciano’ que tanto nos caracteriza. Una tarde de primavera, llegó una clase que nos dejó sin palabras. Los niños mariposa. Cuando la Dra. Del Río terminó sus dos horas de clase, sentí que esa era mi opción uno de futuro. Era lo que quería. Definitivamente… Tras unos meses de avasallarla a emails y con una serie de coincidencias, fui galardonado con una beca para empezar la tesis en su grupo y me mudé a Madrid. Con la espontaneidad que caracteriza epitelios, el día antes de empezar, recibí una llamada de mi otro argentino, Fernando Larcher. Me dijo que apuntara la dirección del CIEMAT y que nos reuníamos el día siguiente para comer juntos. Y 4.5 años después, sigo comiendo en el mismo comedor… Muchas gracias a los dos por esta oportunidad. Marcela, gracias por asegurarnos siempre en el grupo y por ofrecer oportunidades de este calibre. Fernando, has estado siempre al pie del cañón conmigo, me he sentido muy apoyado por ti y considerado como parte del equipo en todo momento. Siempre has tenido la puerta de tu despacho abierta para escuchar mis locuras y experimentos locos, y me has dado rienda suelta, siempre, aunque eso te haya traído algún dolor de cabeza, pero bueno, no nos ha ido mal juntos tampoco… En este punto sigues al pie del cañón conmigo y siempre voy a estarte agradecido. Ha sido un placer jefe.

Hablando de jefazos, aquí llega mi pareja en campo de batalla. Al igual que Watson y Crick, Batman y Robin, Chino y Nacho, e innumerables parejas que han hecho de éste un mundo mejor, yo he tenido a Mr. Murillas, Rodolfo para los amigos. Madre mía tío… me acuerdo de empezar proyectos llenando toda la mesa con mapas de plásmidos en papel, mientras todos usaban SnapGene, y tu diseñabas estrategias ‘simples’ de cloning que sólo llevaban 145 pasos de cloning, con rellenos con la Klenow, cortes en romo, en Roma, en Berlín y en mil sitios. Has sido los dos hemisferios de mi cerebro al principio de esta tesis y me has dado las herramientas para ir creciendo como científico y empezar a pensar, de manera algo correcta. Me tendiste la mano para saltar al gene editing en EB, que ha dado lugar a todo esto. Has estado en todo momento para ayudarme, darme protocolos escritos cuando yo aún no existía en el mundo y enseñarme los trucos de la fosfatasa de gamba versus la de ternera. No bastaba con eso, probé contigo el mítico vermut madrileño en el Vinos II, metro Bilbao. Tu Bilbao… Eres una de las personas más inteligentes que conozco y uno de mis mayores descubrimientos en Madrid. Gracias por todo lo que has hecho y haces por mí. Incluso por pelearte con mi inglés

‘macarrónico’ y darle un poco de elegancia a esta tesis con tu influencia ‘Shakespereana’. Eres gigante jefe.

Y como esto no puede decaer en sus inicios, vamos al punto más alto. BLANCA DUARTE. Podría escribir 300 páginas de esta tesis de todo lo que he aprendido de ti desde que te conocí. Lo tuyo no tiene nombre. Eres el motor de epitelios. Nos alegras los días y tu ayuda es de otro planeta. Has estado y estás siempre dispuesta a echar un cable a quien sea, cuando sea. Aprendí que no hay que quedarse con las ganas de decir lo que uno siente o piensa, y por eso soy tan pesado que muchos días te digo lo que te quiero. Esto es una guerra constante con el pesado de Esteban, pero yo sé que a mí me quieres más. Que gracias… por ser como eres, porque hacen falta más personas como tú en esta vida y es una suerte para los que hemos dado contigo. Eres un ejemplo de mujer, en todos los aspectos que se le ocurran a nadie y yo espero que pase lo que pase la vida no me prive de ti. He aprendido muchísimo de ti y contigo, gracias por todos los consejos, por escuchar mis locuras, por estar mano a mano en esta batalla, por todos los cultivos que te he hecho sufrir e histologías, por los trasplantes, por las cervezas en el CienPorCien, por Copacabana y claqué. Que siempre te lo digo, que contigo a donde la vida nos quiera escupir. Te quiero jefa.

Saltamos de continente y me voy a… Costa Rica. Uf, la de dolores de cabeza que me das… Probablemente una de mis personas favoritas en la vida, aunque te haya llevado lo tuyo dar el salto de compañero de trabajo a amigo. Mi moderno de Malasaña favorito, amante del arte y de la ciencia, compañero de inicios de profesor, de malas y buenas tardes, de malas noches en Barceló y de paseos por Londres. Eres único. Tienes mil taras que te hacen ultra especial y quien te dedica algo de tiempo para conocerte (y tú le dedicas el tuyo, rebelde) acaba enamorado de ti. Eres un tío integro, inteligente, respetuoso, amable y digno de admirar. Somos tan diferentes pero tan complementarios que si algún día surge eso de montar algo juntos, seré el tío más encantado del mundo. Estebitan, te guste o no, esto es para siempre. Te quiero mucho Tico, gracias por todo amigo.

Corazón, Ángeles. Otra pieza clave de este puzle. Mi genetista favorita. Gracias por enseñarme una de las cosas más importantes en la vida de un científico en biología molecular: la PCR. Fácil decían… Gracias por todo el apoyo técnico y personal en esta etapa. La de cafés tontos que nos hemos sacado intentando arreglar nuestro mundo. Eres esencial en este equipo y es un placer contar contigo para todo. Gracias, de verdad.

Mi ancla al Ciemat, Vic. Gracias a tu magnífico expediente conseguiste la prestigiosa FPU, dejando un hueco para aquí un mundano. Eres una de las personas más asombrosas que he conocido. Tienes una sonrisa capaz de cambiar el mundo y capaz de hacer que los del comedor te mezclen los platos a tu antojo… Hemos compartido juntos todo el período de esta tesis y no te cambiaría por nada. He recibido cumplidos y toques de atención según mi aspecto físico del día, pero al final siempre tienes un abrazo que dar. No sé, tienes una salsa, bachata, merengue, llámalo X, que genera bienestar al que está a tu lado. Gracias por todo mi epi… Siempre, Marichocho.

Ahora paso a alguien que debería ser inventariable del CIEMAT, mi Garci. Martola. Nunca se conoció mujer, persona o ente que realizara más experimentos en un día. Eres una genia. Y encima todo sale. Muchas gracias por el chupóptero, los paseos por Dublín, las pérdidas de capital económico en el Hipódromo (qué pasada…) y por las cervezas juntos. Eres un ser maravilloso y ha sido un placer compartir tantos ratos contigo. Siempre nos quedará ‘Señorita’. Hablando de señoritas, la surfera rubia de ojos azules, Vero. La de conversaciones de música que han tenido lugar enfrente de tu mesa. Eres una tía encantadora y siempre dispuesta a dar un abrazo, pase lo que pase. Ha sido un placer compartir cada día contigo y matarnos a carcajadas. Por más muertes así. Mucha suerte, que tú eres la siguiente de nosotros. Te deseo lo mejor. Gracias.

Y hablando de personas especiales y ultra atractivas, aquí llega Nuria. ¿Qué te voy a decir a ti? Que gracias por cada día, por aguantarnos, por reñirnos, por querernos, por abrazarnos, por volvernos a reñir y por todo. Nos hemos reído juntos hasta llorar y hemos marujeado a partes iguales. Por no hablar de… sí… el salto más famoso de la historia del cine… Dirty Dancing. Fuimos la envidia del Morocco y eso estará para siempre en la memoria de Madrid. Gracias por cuidarnos tanto y traer todo lo que no quieren en tu casa para comer. Nos has tenido bien alimentados… Mira cómo ha acabado Esteban… Muchas gracias por todo Nuri.

Y como no hay dos sin tres, la tercera rubia, Laurita. Ha llovido desde que decidiste abandonarnos para mudarte a tierras alemanas, pero has sabido como quedarte de alguna manera con todos nosotros. Hater por excelencia pero amante de Zara, y eso… une. Eres una persona súper importante para mí y a día de hoy seguimos sumando experiencias locas por tu reino juntos. Que como sabes, para mí nunca es hora de que acaben… Muchas gracias

por formar parte de mi Madrid y picar alguna que otra colonia conmigo. Qué casualidad… en Colonia acabaste! Te quiero un montón.

Bueno, bueno, bueno, mi pre-postdoctoral favorita, Carretero. Compañera de poyata, aunque haya sufrido invasiones múltiples y algún que otro robo de puntas. Ha sido muy divertido estar a tu lado y aprender de ti y contigo. Ahora comprendo que me castigabas por invadirte haciéndole fotos a queratinocitos intentando migrar por la placa mil horas… te pillé. Muchas gracias por todo.

Y la alegría de esta cuarentena y de la vida en el CIEMAT, Maria, Marichurris. Eres una tía increíble. Vaya tela. Tienes la energía de una bomba atómica y eres capaz de reponerte y ser fuerte ante cualquier circunstancia. Por no hablar de tu baile… que nos vuelve locos. Eres un ente maravilloso.

Aunque su paso fue breve, fue una sorpresa, Marta Seco. Eres un tía 10. Amante de los minions y de los microRNAs a partes iguales. Qué risas, qué buenos ratos, qué cervezas en ‘La Pequeña Graná’ y qué alegría tenerte cerca. Gracias por traer ‘la terreta’ al lab.

A mi Adelita, que ella sí supo y se fue hacia el sur para no perder el norte. Al menos más. Mi compi de despacho y un encanto de persona. Gracias por los buenos ratos y por traer al mundo a ese ‘minion’ precioso. Siempre se te echó en falta.

A Mariajo. No a todo el mundo lo reconocen en un ascensor de un hotelazo de Londres... Gracias por los buenos ratos pasados y por lo aprendido. Gracias por tu preocupación por toda la familia EB y por intentar mejorar sus vidas.

Por Leganés se encuentra una maravilla, Sarita. Buah, un gracias gigante como tú. Me lo he pasado increíble contigo y me has ayudado muchísimo en esta etapa, jugando a ratos a ser profesor… Gracias por tendernos la mano siempre y ayudar incondicionalmente. Eres siempre un soplo de alegría y una fuerza que mueve cualquier montaña. De ti aprendí la valiosa filosofía del junco, capaz de hacerte sobrevivir ante numerosas amenazas. Será que Granada tiene cosas más maravillosas que la Alhambra.

Siguiendo por Leganés: Angélica, la risa asegurada. Qué buenas tardes de prácticas hemos pasado y cuantos lugares del mundo hemos visitado juntos

desde el laboratorio. Muchas gracias por el apoyo que ofreces, espectacular. Carlos, tío amable y buena gente donde los haya. Andrés, iniciamos este camino a la vez y todas las piedras que han hecho que tropezáramos juntos durante esta tesis han sido un placer. Eres gigante. Cristina, has sabido poner orden cuando los niños se nos descuidaban y ha sido una risa. Gracias por los buenos ratos. Luci, te he descubierto más hacia finales de la tesis y ha sido un verdadero placer. Gracias por todo.

Cerrando epitelios, apartado especial al guerrero más maravilloso que ha tenido Argentina, el Dr. Claudio Conti. La sabiduría personificada y el humor desbordante, a pesar de algún que otro achaque. Siempre le recordaré. Gracias por las palabras otorgadas en los momentos más necesarios. Espero que siga dando tanta guerra, esté en el paraíso que esté.

Y para los que dicen que familia es solo con quién compartes sangre… Estos de sangre saben un rato. Los hemato. Liderados por el grandísimo Juan Bueren, temido y querido por igual, se han convertido en uno de los grupos referentes de terapia génica en Europa. Para mí, mi favorito. Recuerdo cuando me enfrenté a mi primera charla científica, que para darle más emoción fue en el congreso internacional de terapia génica en Berlín, EN INGLÉS, cuando me subí al escenario temblando a intentar explicar qué intentaba hacerle a mis queratos, ahí estaban en las primeras filas ‘Los Bueren’ para dar un poco de aire fresco. Muchas gracias a todos.

Gracias Juan por montar esa bomba de relojería que has liado, que genera ciencia de la buena y que llega a las personas. Es una pasada teneros cada día y contar con vuestro apoyo. Paula, ejemplo a seguir. Me declaro y me he declarado siempre fan tuyo, por la profesionalidad, las ganas y el empeño que pones en hacer que las cosas funcionen. He aprendido muchísimo de ti y has estado apoyándome siempre desde mis inicios. Muchas gracias. Ha sido una pasada trabajar contigo. Jose Carlos, líder donde los haya. Gracias por toda la ayuda ofrecida, incluso en momentos de terror como conseguir que el señor Porteus me aceptara en su laboratorio. Es una pasada contar con referentes como tú. Guillermo Guenechea, quizás ‘espectacular’ sería una palabra apropiada para ti. Gracias por todo. Un tío divertidísimo, culto, amable… has hecho historia en los espectáculos de las tesis y espero que aún tengas un as guardado. Susana, la que me has liado fichando a ese par que tienes como equipo. Muchas gracias por cada rato que hemos coincidido en la vida. Óscar, siempre es un placer charlar contigo. Eres una brutalidad de conocimiento. Muchas gracias por todos los consejos y por compartir juntos el diagnóstico de COVID.

A todos los postdoc, Bego, Maria MSC, María Virgi, Marina, Mercedes, Jaco, etc, gracias. Y bueno, si hay que ponerse sentimentales, es el momento. Los PEQUEHEMATO. Madre mía… es que soy tantos, pero tan grandes… empezaré por mi mitad en la vida, Charito. Hace más de 10 años que hacemos historia juntos, y para colmo, nos mudamos juntos a Madrid y hacemos la tesis juntos. ¿Qué más podría pedir? Te quiero mucho y para siempre. Gracias por apoyarme siempre, escucharme, aconsejarme y reñirme. Gracias por hacerme feliz cada sábado en nuestro Teatro favorito, por las cenas, las copas, Reina Vic, Romeo, NYC, California… lo único que no he conseguido de ti, es el paseo en la barca de tu padre. Tiempo al tiempo. Te adoro.

Y ya que estamos, como una no camina sin la otra, el ser más especial que se ha conocido en la faz de la Tierra, nuestra ‘Vicky’ particular, Raqueliña. Yo no sé si Galicia es fascinante o no, porque no te has dignado a llevarme, pero cada día me das la vida. Recuerdo cuando empezamos a conocernos en Florencia, que me hiciste atragantarme de la risa cenando en el restaurante porque tú aceptas muchas cosas, pero ropa de la calle en cama, NO. ¿Qué te digo? Eres parte de mi ‘Madrid Me Mata’ y te voy a querer siempre. No pierdas nunca esa maravilla de acento.

Negrito ojos claros, pero pelo revisable… Yari. Mi compañero de batallas duras y viajes exóticos… la de cosas que hemos vivido juntos Negro. A la de sitios que me has llevado por no saber decirme que no. Eres un tío BRUTAL y dispuesto siempre a ayudar en lo que sea a todo el mundo. Da igual todo. Ha sido un placer compartir esta etapa contigo y espero compartir la vida muchos años más. Como tío de tus futuros hijos tengo algunas cosillas que enseñarles de la vida, para que no sean un coñazo como su padre. Muchas gracias amigo. Te quiero.

Y ya que estamos con el team Black, y más fan que yo no hay nadie, mi Manué. Yo no sé en qué estaba pensando Susana para traerte. Pero me dio la vida. Eres una maravilla traída de Cádiz y un pícaro de playa de cuidado. Siempre tienes una historia para cualquier detalle porque tú eres así, un romántico. Gracias por sumarte a mis locuras y sumarme a las tuyas. Si J Balvin te viera, estaría muy orgulloso de ti. Grandísimo.

Carlos-TÚ. Carliiitos. No sé si eres más cabrón que buen tío, o más buen tío que cabrón, pero eres único. Muchas gracias por todo Charls. Has estado puteándome y queriéndome desde el principio, incluso matándome a grasas saturadas con las toneladas de snacks que me traes. Eres el tío más

preparado del mundo y gracias por todos los cuidados. Cuando quieras volvemos a Málaga, campeón. Un abrazaco. Y como todo gran hombre se debe a una gran mujer, Patri. Gracias por ser como eres, por tu alegría, por quererme y por convertir a Charlis en un hombre decente, lo de antes no tenía explicación…

Tiene nombre de calle, de teatro, de avenida, porque tío más grande que él, ninguno. Elegancia, inteligencia, saber estar, amabilidad, simpatía y sex-appeal mezclados en un ser. Todos hemos pensado en ti ahora mismo: Francisco José Román. Esa espada que cortó hasta el FancA más imposible, guarda detrás a un verdadero caballero. Gracias Franki por todos tus consejos, tus ratos de crispeo conmigo, los debates, pero también las risas, las charlas profundas y las aventuras al estilo Gran Canaria. Eres una persona digna de admirar. Gracias por todo.

Y pegada a Franki, algo pequeño pero de un valor incalculable, mi papita, Laura. Nuestra historia se remonta a años anteriores al CIEMAT, unidos por la mala vida festiva, pero míranos, ahí aguantamos. Eres una trabajadora bestial y te mereces todo lo bueno que te pase en la vida. Es un placer compartir las barbacoas Vasca-style contigo y los ratos de tu querido CRISPR también. Llegarás lejos Papi. Gracias.

Mi rubio pequeñín, Sergi. Lo que te hemos echado de menos. Desde los inicios me acogiste y me bautizaste (cabrón!) para entrar a la familia CIEMAT. Eres un tío súper inteligente y siempre has estado ahí para ayudar, con toda tu locura por delante. Gracias por la vida compartida Sergi.

La vida necesita de guerreras y de mujeres que cambien la historia. Sara, mañita. De la mano juntos hasta el final. Admiro los principios y valores que tienes y que siempre defiendas tus ideas, pase lo que pase. Gracias por otorgarme la insignia de ‘Stanford Kid’ y por todos los consejos. Gracias por todas las risas juntos, las tertulias espontánea y los abrazos mañaneros. Veremos qué nos depara el futuro, pero ojalá sigamos estando ahí por muchos años.

Se la querían llevar a Milán, pero no la dejé. La reina de Almonte. Cristacho, mi melona. Eres un carácter incontrolable pero como se te puede apretar fuerte fuerte con un abrazo, uno empieza a quererte. Muchas gracias por todo y por traer al Rubio a nuestras vidas.

Fansito, el jefe. Desde el principio sucumbiste a los encantos de Guenechea y te convertiste en su pareja artística y científica, y a mí me flipáis. Gracias por todos los buenos ratos y las buenas fiestas juntos.

Oma (teratoma), la mujer que susurraba a los citómetros. Muchas gracias por toda tu ayuda, y disculpa por ser tan pesado para una triste GFP que tenía que ver. En verdad era por pasar tiempo juntos…

Rebeldía, tú te incluyes en los peques y lo sabes. La Rosalía del CIEMAT. Eres una máquina. Eres indispensable en este centro y encima es que molas nivel estratosférico. Gracias rubiales.

Virgi, mi salsa de la vida. Eres enorme. Mujer trabajadora e inteligente donde las haya. Sigue luchando, ¡qué esos fibros no se recombinan solos! Mucha suerte. Gracias bonita.

Y como van a haber viernes todas las semanas de mi vida, yo os quiero siempre: Las CHUCHES. Yo no sé cómo se las apañó el universo para que nacierais el mismo día en dos provincias colindantes de Andalucía, pero, la petó. No hay pareja más genial que vosotras. Chuchi, eres la alegría de la huerta, del mar y de donde sea, gracias por hacernos los días más felices. Merche, cariño, gracias por soportar a Chuchi 24/7, te mereces el cielo. Pero escucha, que no te quedas corta… otra genia. Gracias por los buenos ratos juntos. Esperemos que nos queden muchas locuras por vivir.

Andrea, JacoAndrea, Jandrea. Eres de las incorporaciones más recientes pero te has ganado tu sitio. Me encanta que nos descubramos canciones y que pongas orden a la pareja de mendrugos Yari-Manuel que tanta guerra te dan. ¡Mucha suerte!

Andrea Virgi, contigo viví el directazo de Bon Jovi en el Wanda, eso marca. Mucha suerte con esa tesis y gracias.

Mi bonita valenciana, Julia. Eres un descubrimiento increíble y una tía que se come el mundo. Fue un placer conocerte y una suerte mantenerte en mi vida. Bonica perque-sí. Y valenciano, pero del Norte, Jordi, gigante entre gigantes.

Mariela, la argentina más revolucionaria de la historia, y ya es decir. Gracias por todas tus locuras, tus experiencias y tu divertida forma de pasarte a todo el mundo por el… eres increíble. Aunque si lees esto será desde la otra parte del mundo, gracias por dar vida.

Y a continuación, luchando contra el cáncer y compartiendo labo, ‘Los Oncolocos’. Empezaremos por el ‘boss’, que es de cuidado. Jesus María Paramio, eres un jefe, del labo y de la vida. Ha sido un puntazo y un placer compartir tantos ratos juntos en el comedor. Estás atento a todo… sabiendo que me gusta la música latina nos regalaste aquel momentazo de Twerk que pasará a la historia. En verdad tenías un tirón de espalda, pero el momentazo fue el que fue. Lo siento Mister. Gracias.

Formando parte del equipo urinario, una de mis personas favoritas. Munereta, Ester. A ti ya te traía de Valencia pero hiciste de ‘enhancer’ de mi vida en Madrid. Siempre estás ahí, desde que te conocí, para las buenas y para las malas. Buah, pero en las buenas, la triunfamos juntos. Yo no sé la cantidad de bailes que han vistos los bares de Madrid y la de misterios por resolver que guardan. Sólo tú podías llenarme la mesa con 823576 post-its. Te quiero. Mucho. Para mucho tiempo. Eres el aire de la calle.

Ouch, mi canarión, el normopésico, pero que guarda algo muy grande en su interior. Gran Canario... Contigo empezaré por el ‘te quiero tío’, porque ya todo lo que pueda decir… Eres un genio, gracias por formarme en las qPCRs que empezaron ‘con altura’, por los buenos ratos, por los consejos, por escuchar (aunque implique callar), por cada día, por estar siempre ahí… pegado a tu celular. Eres oro para tu grupo y para quienes tienen la suerte de contar contigo. Me encanta que en algún momento rompiéramos filtros y diera paso a esta amistad. Eres BRUTAL. Espero no perder nunca la emoción de la vida para poder seguir taladrándote la cabeza. Te quiero más que las lapas al mojo verde.

Carolinska, esa bella plebeya que me taladraba la cabeza con ‘Supercalifrajilisticoespialidoso’ mientras intentaba descifrar el mundo de los ‘base editors’ o me cantaba Frozen mientras intentaba mantener un Skype. Eres única, y molas un montón. PD: Adoro los chorizos que me traes de tu pueblo, que no se pierdan las buenas costumbres. Gracias por toda la ayuda. Espero que siempre te acuerdes de mi ‘cara’ que tanto te gusta.

Jos, La Jose, mi Josefa Pilar, mi espejo de la poyata. Lo tuyo no tiene nombre. ¿Cómo sin tocarte se te puede querer tanto? Gracias por todo reina. La de risas que nos hemos pegado y las que quedan, en la Latina, en el lab o donde tú quieras hermosa mía.

Mi Raque. Reina, bella, guapa y de to. Orcasitas dio lugar a una crack que mezclaba productos químicos en la piscina y a ti, un ser maravilloso. Gracias por todas las risas, los abrazos y los bailes. Eres increíble.

Sarita, es una gozada trabajar contigo. Eres una persona súper amable y respetuosa y nos aguantas hasta el infinito. Muchas gracias por todo.

Miri, la emoción de la vida. Muchas gracias por animarme a hacer las cosas siempre y porque seamos tan fans el uno del otro. Es una alegría cada vez que nos juntamos.

Richi, aunque te pongas colorado cuando te miramos y cuando no, eres genial. Te has convertido en el superhéroe oficial del CIEMAT y no es para menos. Ánimo!

Cris, fan máxima de Tomorrowland. Gracias por hacer de Bricomanía un programa mejor.

A todos los otros oncos, Iris, Flipi, Raquel, Esther, Gala, Laura, Karla… gracias por los buenos ratos.

A la sala más guay de todas: Pedidos. Disculpadnos por creer que a veces esto es Aliexpress y podéis traernos de todo. Muchas gracias por todo el esfuerzo en pelear contra las malísimas casas comerciales. Sergio, Mamen, Sole, Aurora, gracias. De verdad. Sole, como te gusta subirnos la calefacción de cultivos para que soltemos prenda. Aurora, todavía recuerdo cuando te vi en San Francisco en el Pier 39… qué alegría. Fue como ‘casa’.

To my Stanford friends: Rosa, Annalisa, Sriram, Giulia, Jolanda, Francesco. Thank you so much for that amazing experience. Matthew, thanks for giving me the opportunity of joining your awesome team and for being so kind. Wai thank you for helping me every day. Adrián, gracias por ser mi compañero de batalla en una de las experiencias más importantes de mi vida. Fue un placer ganarte para siempre.

Dejando el CIEMAT, quería agradecerle a mi mejor amigo y compañero de piso toda esta etapa, Toni. Lo que has tenido que aguantar… Gracias por hacer de casa, casa, y por aguantar todo el CRISPR y las batallas de CIEMAT cada día. Vinimos siendo mejores amigos y ya has pasado a ser mi familia. Te quiero. A los restantes integrantes de ‘Madrid me mata’. Miriam, nos unió un curso en Irlanda en 2009, y ya son unos años dando guerra. Eres de las personas más espectaculares e inteligentes que me he topado por el camino y nos queda mucha vida juntos. Y muchos bailes. Pable, que aunque el inicio fue un poco seco, mira dónde hemos llegado. Gracias por todo amigo, por las aventuras, las charlas, las risas y la vida. Jose Rubio, mi tocayo

favorito. Gracias por formar parte de esta aventura y por subirte a mis hombros donde haga falta. Cristina, la cámara que controla que este grupo no se desmadre, y si lo hace, que lo asuma. Gracias por cuidarnos y salvarnos del mal, en la medida de lo posible. Y mi persona favorita de la vida, que no formaba parte de mi familia cuando llegué a Madrid, pero ahora es el motor del 90% de mis locuras, mi Carmencita. Una fiesta de disfraces en el ‘barri’ nos unió en diciembre de 2015, y luego te uniste a la familia CIEMAT… y a la mía. Eres un ser arrasador, que vive la vida al límite, disfrutándola, bailándola y saboreándola. Quitas la respiración a todo aquel que te conoce y no dejas indiferente a nadie. Para mí es una suerte que seas mi ‘hand-to-hand’ de la vida, porque juntos declaramos guerra donde sea. Gracias por estar siempre ahí, pero de verdad. No de decirlo por decir, sino que estás, da igual lo que sea, como sea y cuando sea. No hay palabras suficientes para lo nuestro. Love you more than carbonara.

Gracias a todos vosotros, porque me habéis hecho increíblemente feliz en Madrid. En este grupo pero también perteneciente al siguiente, empezaré por Norberto, para hacer mención a mis amigos, a los de siempre, a los que debemos las mejores y las peores historias vividas. LMC. Norbertín, gracias por sumarte con fuerza a Madrid y llevarlo a otro nivel. La de noches tontas que hemos vivido amigo… Fede, mi psicólogo de confianza y amigo de los buenos. Gracias por ser un líder de este rebaño y por ser un tío tan íntegro. A pesar de la distancia, siempre has tenido tiempo para ver que todo está bajo control. Eric, uno de mis favoritos de siempre. Gracias ‘medio-amigo’ por todo lo vivido y lo que viene. Tomi, mi pelado argentino mala influencia liante que me lleva por el camino del mal pero que le acompaño encantado. Gracias por darme vida amigo (mamacha). Jaume, grande entre los grandes. Sergio, tío fuerte donde los haya y compañero de fiestas desde años inmemorables. Rubenete, nunca una barca tuvo mejor marinero. Gracias a esta panda de sinvergüenzas por hacerme tan feliz y por crecer juntos, porque de eso va la vida.

Y en los ladrillos de este camino, a mis amigos de la universidad. Inés… la de guerra que hemos dado. Supongo que es típica amistad que daría para una serie de Netflix de bastantes temporadas. Siempre estás ahí y sabemos cómo disfrutar la vida a base de risas y locura. Demasiada. Siempre has sido y serás ‘mi Biotec UV’. Te quiero pequenia. Olwi, mi venezolana-valenciana-dominicana favorita, que decidiste mudarte a la isla tropical porque tú siempre has sido de VIVIR, creo que por eso nos hicimos tan amigos. Aunque haya miles de km de distancia, siempre estás. Luis, mi

pollito. La de batallas que hemos librado juntos y la faena que me das… es un placer. Nacho, el tío más liante con quien compartir universidad y vida. Paquito, éste que nunca aparece pero sí. Laura, viniste arrasando Valencia desde Valladolid y yo que soy amante del riesgo, me alié contigo, hasta en Madrid… Patri, Elva, Sandra, Sara, Pau, Bea, Javi, Rebeca… Gracias a todos por ayudarme a sacar Biotecnología adelante.

Por último, a mi familia. La parte más importante de todo esto. La gente va alardeando que tiene familias guay y tal, pero quien los conoce, lo sabe. Esta es la mejor. A mi hermana Tamara, una de las personas más inteligentes del mundo. Al menos del mío. Es un orgullo ser tu hermano pequeño. El juego de los pies nos unió y ahora yo no puedo vivir sin ti. Eres mi pequeña de ojos azules favorita. Te quiero con locura. A Josete Padre, el rey de la sabana. Siempre has dado todo por nuestra familia y nos has sacado adelante, costara lo que costara. Gracias por la educación recibida y el cariño. Es una pasada ser tu hijo. Te quiero papá. Y todo rey, se debe a una reina. Loles. Mi madre. Lo tuyo sí que no tiene palabras. Eres mi pareja de equipo en casa y mi defensora, contra quien sea. Sé que te causo disgusto por no parar quieto por el mundo y mudarme a Madrid, que aún lo llevamos regular. Siempre me has protegido, incluso de hacerme una tortilla, porque tú sabías que tendría tiempo para hacérmela yo mismo. Mientras tanto, preferías cuidarnos tú. Eres la persona más luchadora y fuerte que conozco. Te quiero muchísimo. No cambiaría por nada del mundo ser tu pequeño.

A mis tíos. En especial a mi tía Paqui y Jesús. Los más grandes como algunos sabéis. Gracias por tratarme como a un hijo más y por malcriarme. Siempre estáis y quiero que siempre lo estéis. Os quiero. A mi prima favorita, Clarisa, nuestra hermana mayor. Te quiero infinito y siempre has sido mi modelo, la farmacéutica. Sólo que al final, me desvié un poco. Gracias a ti y a mi nuevo primo, Kike, por formar una familia tan guay. Yo creo que algún día se le dará bien hacer un buen ‘cremaet’. Os quiero. Por otro lado, a mi tía Mari, y a mis primos Carla y Pablo, por el grupo que tenemos que es genial. Siempre han sido parte de mi familia favorita. Al resto de la familia, gracias a todos también por preocuparos de si sobrevivía en Madrid y alegraros por lo que iba consiguiendo.

Supongo que podría seguir enumerando a muchas personas que han contribuido a esta locura… Así que: Usted, que está leyendo esto, GRACIAS por aportar su granito de arena.

Y para cerrar una gran etapa de mi vida, esta tesis va dedicada en esencia a ella. Yo creo que la mujer que me robó el corazón y se lo quedará en propiedad para siempre. Mi abuela, Francisca Climent Darás. Creo que tu preocupación incesante de si había curado alguien ya, fue el motivo de no perder esperanza en esta tesis. Yo creo que nunca podré querer a nadie como te quise y te quiero a ti. Ni nadie me querrá jamás como me quisiste tú. En los inicios de esta aventura te fuiste, pero solo físicamente, porque para mí siempre estarás presente. Que te fueras supuso el golpe más fuerte de mi vida, y sigue doliéndome a rabiar a día de hoy, pero también fue el motor para querer convertirme en un chico que valga la pena. Sigo a trompicones abuela, pero yo creo que voy en camino. Gracias por malcriarme, por cuidarme como tu niño pequeño y por tenerme siempre en tus brazos. Eres lo que más feliz me ha hecho en la vida y no sabes lo que daría porque siguieras aquí. Te sigo echando de menos como el primer día. Y no sé si algún día pasará. Para ti. Por ser la mujer más grande en la faz de la tierra y el amor de mi vida, te dedico esta tesis.

Published and submitted content

• Bonafont J., Mencía A., Srifa W., Vaidyanathan S., Romano R., Garcia M., Hervas- Salcedo R., Ugalde L., Duarte B., Porteus MH., Del Rio M., Larcher F. and Murillas M (2020). Selection-free Homology Directed Repair-based COL7A1 gene correction in primary cells as therapeutic option for RDEB. Submitted to Molecular Therapy.

- This publication has been fully included in Chapter 3

• Bonafont, J., A. Mencia, M. Garcia, R. Torres, S. Rodriguez, M. Carretero, E. Chacon-Solano, S. Modamio-Hoybjor, L. Marinas, C. Leon, M. J. Escamez, I. Hausser, M. Del Rio, R. Murillas and F. Larcher (2019). Clinically Relevant Correction of Recessive Dystrophic Epidermolysis Bullosa by Dual sgRNA CRISPR/Cas9- Mediated Gene Editing. Mol Ther 27: 986-998. doi: 10.1016/j.ymthe.2019.03.007.

- This publication has been fully included in Chapter 2

• Mencia, A.*, C. Chamorro*, J. Bonafont, B. Duarte, A. Holguin, N. Illera, S. G. Llames, M. J. Escamez, I. Hausser, M. Del Rio, F. Larcher and R. Murillas (2018). Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells. Mol Ther Nucleic Acids 11: 68-78. doi: 10.1016/j.omtn.2018.01.009

- This publication has been fully included in Chapter 1

References to these publications appear throughout the entire thesis.

Other research merits

Publications

• Gálvez V., Chacón-Solano E., Bonafont J., Mencía A., Di WL , Murillas R., Llames S., Vicente A., Del Rio M., Carretero M.* and Larcher F.* 2020. Efficient CRISPR/Cas9-mediated gene ablation in human keratinocytes to recapitulate genodermatoses: Modeling of Netherton Syndrome. In press (Accepted in Molecular Therapy - Methods & Clinical Development).

• Montoro, A., N. Sebastia, D. Hervas, V. Esteban, J. Bonafont, J. F. Barquinero, M. Almonacid, J. Cervera, E. Such, G. Verdu, J. M. Soriano and J. I. Villaescusa 2016. Analysis of the Possible Persistent Genotoxic Damage in Workers Linked to the Ardystil Syndrome. Genet Test Mol Biomarkers 20: 94-97. doi: 10.1089/gtmb.2015.0177

Conferences

2020 – Oral Communication and Poster: World Congress EB2020. “CRISPR/Cas9-based gene editing strategies for clinically-relevant ex vivo correction of Recessive Dystrophic Epidermolysis Bullosa”. J. Bonafont, A. Mencía, W. Srifa, S. Vaidyanathan, R. Romano, M. Garcia, MJ. Escamez, B. Duarte, MH. Porteus, M. Del Rio, R. Murillas and F. Larcher

2019 – Poster: XXVII European Society of Gene and Cell Therapy Annual Congress en Barcelona (Spain). “Highly efficient gene-editing strategies for clinically- relevant ex vivo correction of Recessive Dystrophic Epidermolysis Bullosa in primary patient cells.” J. Bonafont, A. Mencía, W. Srifa, S. Vaidyanathan, R. Romano, M. Garcia, MJ. Escamez, B. Duarte, MH. Porteus, M. Del Rio, R. Murillas and F. Larcher

2018 – Poster: 2018 Cold Spring Harbor meeting: Genome Engineering: The CRISPR/Cas Revolution. Cold Spring Harbor Laboratory (NY, USA). “Novel efficient CRISPR/Cas9-based gene editing strategies for Recessive Dystrophic

Epidermolysis Bullosa.” J. Bonafont, A. Mencía, B. Duarte, M. Garcia, S. Llames, MJ Escamez, R. Torres, I. Hauser, M. del Rio, R. Murillas, F. Larcher.

- Poster: International Investigative Dermatology 2018. Orlando (Florida, USA). “Highly efficient, permanent ex vivo correction of RDEB via non-viral CRISPR/Cas9 excision of COL7A1 Exon 80 bearing a prevalent mutation”. J. Bonafont, A. Mencia, M. Del Rio, M. Escamez, R. Torres, I. Hauser-Siller, R. Murillas, F. Larcher.

- Oral Communication: 9th Biennial Congress of the Spanish Society for Gene and Cell Therapy. Palma de Mallorca, Spain, 14-16 March 2018. “CRISPR/Cas9- based gene editing approaches for the efficient correction of Recessive Dystrophic Epidermolysis Bullosa patient derived-epidermal stem cells”. J. Bonafont, A. Mencía, B. Duarte, M. Garcia, S. Llames, MJ Escamez, R. Torres, I. Hauser, M. del Rio, R. Murillas, F. Larcher.

2017 - Oral Communication: XXV European Society of Gene and Cell Therapy Annual Congress en Berlin (Alemania). “Gene editing-mediated excision of mutation- bearing exon 80 of COL7A1 gene for the efficient correction of Recessive Dystrophic Epidermolysis Bullosa patient derived-epidermal stem cells”. J. Bonafont, C. Chamorro, A. Mencía, B. Duarte, D. Ortega-Cruz, R. Torres, M. del Rio, S. Llames, F. Larcher, R. Murillas.

2016 - Poster: XXIV European Society of Gene and Cell Therapy Annual Congress en Florencia (Italia). “Development of new models and therapeutic approaches for Congenital Generalized Lipodistrophy”. J. Bonafont, R. Murillas, B. Duarte, F. Larcher.

- Poster: 47th Annual European Society for Dermatological Research Meeting en Salzburg (Austria). “Gene edition-mediated deletion of a mutation-containing COL7A1 exon 80 in epidermal stem cells of RDEB patients allows regeneration of normally adhesive skin”. A. Mencia, C. Chamorro, J. Bonafont, Á. Meana, A. Hernández, E. Baselga, C. Ayuso, M del Río, R.Murrillas, F.Larcher

Awards

2019 - Prize for the best presentation at 4º Ciclo de Seminarios de Investigación Predoctoral “Margarita Salas” at Instituto de Investigación Sanitaria Fundación Jiménez Díaz (IIS-FJD)

2018 – Travel Grant from the 9th Biennial Congress of the Spanish Society for Gene and Cell Therapy. Palma de Mallorca, Spain, 14-16 March 2018 (Awarded to the Top 6 highest scored abstracts submitted by PhD students and first post-doctoral Congress delegates)

Intellectual Property Orphan Drug Designation by European Medicines Agency (EMA) for Autologous skin equivalent graft composed of keratinocytes and fibroblasts genetically corrected by CRISPR/Cas9-mediated excision of mutationcarrying COL7A1 exon 80 for the treatment of epidermolysis bullosa. Orphan designation EU/3/20/2253 (28 February 2020).

No voy a sentirme mal Si algo no me sale bien. He aprendido a derrapar Y a chocar con la pared.

Fito y Fitipaldis

Contents Contents

CONTENTS ...... I ABBREVIATIONS ...... 1 ABSTRACT ...... 3 GENERAL INTRODUCTION ...... 5 1. THE SKIN ...... 5 1.1. Human skin structure ...... 5 A. Epidermis ...... 6 B. Dermis ...... 7 C. Hypodermis ...... 7 1.2. Dermal-epidermal junction (DEJ) ...... 7 2. Collagen VII ...... 9 2.1. Collagen VII and AF formation ...... 10 3. Epidermolysis bullosa ...... 11 3.1. Overview and classification of EB ...... 11 3.2. Recessive Dystrophic Epidermolysis Bullosa (RDEB) ...... 14 3.3. Therapeutic approaches for RDEB ...... 15 A. Recombinant protein therapy ...... 16 B. Cell therapy for RDEB ...... 17 C. Gene therapy ...... 19 4. Genome editing ...... 22 4.1. Genome editing tools ...... 22 A. Meganucleases ...... 23 B. Zinc-finger nucleases ...... 24 C. TALENs ...... 24 D. CRISPR/Cas9 ...... 25 E. DNA donor template delivery for HDR-based approaches ...... 26 4.2. Genome editing approaches for EB ...... 27 5. Summary ...... 29 6. References ...... 30 RESEARCH AIMS AND OBJECTIVES ...... 38

CHAPTER 1: DELETION OF A PATHOGENIC MUTATION-CONTAINING EXON OF COL7A1 ALLOWS CLONAL GENE EDITING CORRECTION OF RDEB PATIENT EPIDERMAL STEM CELLS ...... 43 1. ABSTRACT ...... 44 2. INTRODUCTION ...... 45 3. RESULTS ...... 47 3.1. Transduction of primary RDEB keratinocytes with Ad-Talens. Isolation and genotyping of keratinocyte clones carrying corrective indels in COL7A1 exon 80...... 47 3.2. Isolation and characterization of pure clones from clone 19 mixed population...... 51 3.3. In vivo skin regeneration with frame-restored clones: C7 deposition and functional analysis...... 56 4. DISCUSSION ...... 60 5. MATERIALS AND METHODS ...... 63 5.1. Culture of primary RDEB patient keratinocytes and transduction with Ad-TALENs T6/T7...... 63 5.2. Cel I (Surveyor) analysis...... 63 5.3. Genotyping for detection of indel carrying clones...... 64 5.4. Off-target analysis...... 64 5.5. COL7A1 transcription analysis by RT-PCR and qPCR...... 64 5.6. Western blot analysis...... 65 5.7. Immunofluorescence and immunohistochemical staining...... 65 5.8. Generation of skin equivalents and grafting onto immunodeficient mice...... 66 5.9. Electron Microscopy...... 66 6. ACKNOWLEDGEMENTS ...... 66 7. AUTHOR CONTRIBUTIONS ...... 67

I Contents

8. CONFLICT OF INTEREST ...... 67 9. REFERENCES ...... 68 10. SUPPLEMENTARY DATA ...... 71

CHAPTER 2: CLINICALLY-RELEVANT CORRECTION OF RECESSIVE DYSTROPHIC EPIDERMOLYSIS BULLOSA BY DUAL sgRNA CRISPR/CAS9-MEDIATED GENE EDITING 79 1. ABSTRACT ...... 80 2. INTRODUCTION ...... 81 3. RESULTS ...... 82 a. Delivery of dual sgRNA-guided Cas9 nuclease as a ribonucleoprotein complex to RDEB keratinocytes enables highly efficient targeted deletion of COL7A1 exon 80 ...... 82 b. Targeted COL7A1 E80 deletion produced a diversity of spliceable chimerical intronic variants ...... 84 c. Next Generation Sequencing analysis of on-target and off-target CRISPR-generated variants...... 85 d. COL7A1 transcription analysis after E80 deletion in c.6527insC patient cells ...... 87 e. De novo C7 expression after targeted deletion of E80 in RDEB keratinocytes ...... 88 f. Long-term engraftment of polyclonal populations of ΔE80 RDEB keratinocytes ...... 90 g. Non-viral CRISPR/Cas9 delivery targets the epidermal stem compartment...... 92 h. Blistering resistance assay of gene-edited skin grafts ...... 94 4. DISCUSSION ...... 95 5. MATERIALS AND METHODS ...... 98 a. Keratinocytes culture and isolation of clones ...... 98 b. CRISPR/Cas9 delivery ...... 98 c. Genotyping of gene-edited keratinocytes ...... 99 d. Genome editing off-target analysis by NGS ...... 99 e. COL7A1 transcription analysis by RT-PCR and RT-PCR...... 99 f. Western blot analysis...... 100 g. Immunofluorescence and immunohistochemical staining...... 100 h. Electron Microscopy...... 101 i. Generation of skin equivalents, grafting onto immunodeficient mice and graft analysis...... 101 j. In vivo skin fragility test ...... 102 6. ACKNOWLEDGEMENTS ...... 102 7. AUTHORS' CONTRIBUTIONS ...... 103 8. CONFLICT OF INTERESTS ...... 103 9. REFERENCES ...... 104 10. SUPPLEMENTARY DATA ...... 107

CHAPTER 3: SELECTION-FREE HOMOLOGY DIRECTED REPAIR-BASED COL7A1 GENE CORRECTION IN PRIMARY CELLS AS THERAPEUTIC OPTION FOR RDEB ...... 115 1. ABSTRACT ...... 116 2. INTRODUCTION ...... 117 3. RESULTS ...... 119 a. Highly efficient DNA nuclease activity in the vicinity of the c.6527insC mutation using CRISPR/Cas9 RNP complexes delivered into primary RDEB cells ...... 119 b. AAV transduction optimization and HDR-based gene correction in primary patient keratinocytes 121 c. C7 expression after HDR-based correction in RDEB primary keratinocytes ...... 122 d. Long-term skin engraftment and functional C7 correction of gene corrected RDEB keratinocytes125 e. HDR-based correction in RDEB patient cells with COL7A1 mutation in E79 ...... 126 f. Analysis of potential off-target sites ...... 127 g. HDR-based gene editing in CB-CD34+ cells and BM-MSC as potential cell sources for bone marrow transplantation approaches in EB ...... 128 4. DISCUSSION ...... 130 5. MATERIAL AND METHODS ...... 134 a. Keratinocyte cell culture and isolation of clones ...... 134 b. Donor containing-AAV6 production ...... 134 c. CRISPR/Cas9 delivery and AAV6 transduction ...... 135 d. Genotyping of gene-targeted keratinocytes ...... 135 e. Genome editing off-target analysis ...... 136 f. Western blot analysis ...... 136

II Contents

g. Immunofluorescence and immunohistochemical staining ...... 137 h. NGS COL7A1 transcriptional analysis ...... 137 i. Generation of skin equivalents, grafting onto mice and graft analysis ...... 138 6. ACKNOWLEDGEMENTS ...... 138 7. AUTHOR CONTRIBUTIONS ...... 138 8. DECLARATION OF INTEREST ...... 139 9. REFERENCES ...... 140 10. SUPPLEMENTARY DATA ...... 142

GENERAL DISCUSSION ...... 147 1. DISCUSSION ...... 147 2. FUTURE PERSPECTIVES ...... 152 3. REFERENCES ...... 154 CONCLUSIONS ...... 157

III

Abbreviations Abbreviations

AAV(s) Adeno-associated Virus Ad Adenovirus AF(s) Anchoring Fibrils AON Antisense Oligonucleotides BM Bone Marrow BMT Bone Marrow Transplantation BMZ Basement Membrane Zone C7 Type VII collagen CB Cord Blood cDNA Complementary Deoxyribonucleic acid Chr Chromosome CRISPR Clustered Regularly Interspaced Short Palindromic Repeats crRNA CRISPR RNA DAPI 4′,6-diamidino-2-phenylindole DEB Dystrophic Epidermolysis Bullosa DEJ Dermal-Epidermal Junction DMD Duchenne Muscular Dystrophy DMEM Dulbecco's Modified Eagle Medium DNA Deoxyribonucleic acid DSB Double Strand Breaks E80 Exon 80 EB Epidermolysis Bullosa EBS Epidermolysis bullosa Simplex ECM Extracellular Matrix EGF Epidermal Growth Factor EMA European Medicines Agency GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase GFP Green Fluorescent Protein H&E Hematoxylin and eosin stain

1 Abbreviations

HDR Homology-directed Repair HSCT Hematopoietic Stem Cell Transplantation IDLV Integration Defective Lentiviral Vector indel insertion / deletion iPSC(s) Induced Pluripotent Stem Cells ITR Inverted Terminal Repeats JEB Junctional Epidermolysis Bullosa Kda KiloDalton KS Kindler Syndrome MN Meganucleases MOI Multiplicity of Infection MSC(s) Mesenchymal stem cells NC Non-collagenous Domain NGS Next Generation Sequencing NHEJ Non-Homologous End Joining NMD Nonsense-mediated mRNA decay PAM Protospacer Adjacent Motifs PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction RDEB Recessive Dystrophic Epidermolysis Bullosa RNA Ribonucleic acid RNP Ribonucleoprotein complex SCC Squamous Cell Carcinoma sgRNA single guide RNA SIN Self-inactivating TALEN Transcription activator-like effector nuclease TBSA Total Body Surface Area tracrRNA Trans-activating CRISPR RNA ZFN Zinc-finger nucleases ZFP zinc-finger protein ΔE80 Exon 80 deletion

2 Abstract Abstract

The skin is the largest organ of the human body, covering an area of approximately 2 square meters in average. This organ is made up of three main layers: epidermis, dermis and hypodermis. The dermal-epidermal junction, called Basement Membrane Zone (BMZ), allows the physical attachment of dermis and epidermis. Within this BMZ, anchoring fibrils are structures necessary for attachment of the dermis to the basement membrane and are mainly composed of Type VII collagen (C7). The loss of C7 causes fragility of the skin. Epidermolysis Bullosa (EB) is a heterogeneous family of rare genetic skin disorders characterized by loss of dermal-epidermal adhesion, blistering of the skin, erosions and scar formation after minor trauma. Among the different subtypes described, the Recessive Dystrophic Epidermolysis Bullosa (RDEB) is the most severe subtype, with an increased risk of developing squamous cell carcinoma (SCC). Mutations causing RDEB have been found throughout the COL7A1 gene. A frame-shift mutation (c.6527insC) in the exon 80 of COL7A1 gene is present in 46% of the Spanish population of patients with RDEB. This mutation results in a premature termination codon (PTC) and when it is present in both COL7A1 alleles, it leads to the absence of this protein. C7 is primarily provided by keratinocytes, making this cell type the target of choice for gene therapy approaches. Despite efforts, there is currently no curative treatment for EB. Different pharmacological, cellular and genetic approaches have been tried showing promising results, but, until now, treatment has focused primarily on symptomatic relief such as daily wound care or pain reduction. Recently, precise gene modification technologies based on genomic nucleases have been developed, such as TALENs and CRISPR/Cas9. These nucleases can create double strand breaks (DSBs) in the DNA sequence that can be repaired by two main mechanisms: Non-homologous end joining (NHEJ), which introduces indels to modify the DNA sequence, and Homology-directed repair (HDR), which uses a donor template for accurate genetic correction. This thesis presents three different approaches based on genome editing with the aim of treating RDEB, focused on genetically corrected epidermal stem cells to achieve long-term healthy skin regeneration. The first strategy used TALENs and showed the feasibility of an exon deletion-based approach to correct RDEB epidermal stem cells as safe clonal therapy. Secondly, gene correction efficiency was improved by designing a dual-guide CRISPR/Cas9 system, capable of efficient deletion of the mutated exon, leading to a high proportion of cells expressing functional C7 (over 80%). Ex vivo gene-corrected bulk keratinocytes

3 Abstract achieved normal human skin regeneration upon transplantation onto immunodeficient mice, opening up the way for a polyclonal therapy scenario. Finally, in the third chapter, an HDR- based approach offers the most accurate way to correct the disease-causing mutations, with gene correction efficiencies above the threshold (30%) needed to sustain the dermal- epidermal junction of the skin. This marker-free HDR-based approach is based on a CRISPR/Cas9 system in combination with a donor template-carrying AAV. Taken together, the different approaches described show epidermal stem cells correction efficient enough to make skin equivalents with therapeutic potential for RDEB patients.

4 Introduction General Introduction

1. The skin

The skin is the largest organ of the human body representing approximately 15% of the total adult weight and covers an area of 1.5-2 square meters in an average adult 1. It is a highly complex organ (Figure 1) that acts as an external physical, biological, chemical and mechanical barrier between the environment and the human body, providing several vital functions, such as thermoregulation, immunological, metabolic and regulation of the water loss, playing a key role in the human body homeostasis 2, 3.

Figure 1. Overview of the skin. Anatomy of the human skin, demonstrating the three distinct layers, as well as skin appendages and cellular constituents. Image taken from MacNeil S., 20174.

1.1. Human skin structure

Skin can be divided in three different layers according to its anatomy, function and development: epidermis, dermis and hypodermis. Moreover, these three layers are constituted by different cellular types and they have structural and functional differences (Figure 2). All layers of the skin work together to offer structural integrity, strength and flexibility 3.

5 Introduction

A. Epidermis

The epidermis is a stratified squamous epithelium of ectodermal origin that constitutes the outermost layer of the skin. Its main function is protecting the human body from external aggression and preventing dehydration. This layer is continuously renewing. It is mainly composed of an epithelial cell type, the keratinocyte, while melanocytes, Merkel cells and Langerhans cells are present in a smaller quantity. Considering its structure, the epidermis can be divided in five different layers, starting from the bottom stratum: basal, spinosum, granulosum, lucidum and corneum; each representing a different degree of keratinocyte differentiation (Figure 2).

Figure 2. The epidermis structure. The epidermis can be divided in five layers from lower to higher degree of differentiation: stratum basale, stratum spinosum, stratum granulosum, stratum lucidum, and stratum corneum5.

During the epidermal differentiation process, keratinocytes localized at the basal layer migrate to upper stratums. It takes approximately one month for a keratinocyte to move from the basal stratum to the outer skin surface, a process known as epidermal renewal. Meanwhile, keratinocytes undergo morphological and biochemical changes reflecting gene expression changes. Thus, basal stratum keratinocytes have proliferative ability and remain adhered to the basal membrane until maturation, then migrating to the suprabasal layer 3, 6, 7. This transition is characterized by loss of contact with basal membrane, loss of

6 Introduction

proliferative capacity and substitution of keratins K5 and K14 expression by K1 and K10 8. Later, suprabasal keratinocytes undergo a process related to apoptosis, called terminal differentiation, in which the cells migrate to upper stratums, flatten and specialize their function to originate a dead keratinized cell layer, the stratum corneum. The process of terminal differentiation involves the expression of proteins like transglutaminase, involucrin, filaggrin and loricrin 9, 10. Epidermis is a nonvascular tissue and depends directly on the dermis for nutrients uptake and waste products removal by means of diffusion through the dermal-epidermal junction. B. Dermis

This layer, of mesodermal origin, is a complex structure that works as support and maintenance of the epidermal layer. Blood vessels, hair follicles, glands and nerve tissue are present in this layer. It confers tensile strength and elasticity to the skin, acts as a thermal regulator and contains sensory stimuli receptors. The dermis can be divided into three different layers: papillary, subpapillary and reticular layer. The main cell type in the dermis is the fibroblast, which produces and secretes procollagen and elastic fibers. Collagen, mainly type I (80-90%) and type III, constitutes 75% of the dermis weight and provides structural support to the skin, while elastic fibers, that represent less than 1%, have an essential function to provide resistance to deformation forces and maintenance of skin structure 11. C. Hypodermis

This layer is found between the dermis and the fascia. Hypodermis is mainly for a large fat storage, and is also called fatty tissue or subcutaneous layer (Figure 1). It offers protection from physical pressure, while also favoring heat generation and retention of humidity 3. The main cell type is the adipocyte.

1.2. Dermal-epidermal junction (DEJ)

The dermal-epidermal junction (DEJ) is a complex structure that joins the dermal and the epidermal layers of the skin (Figure 3). The DEJ allows physical attachment of both tissues and creates a necessary physiological link for the proper functionality of the skin 3, 12. The mechanical resistance of this junction is provided by the anchoring complex, a structure consisting of hemidesmosomes, anchoring filaments and anchoring fibrils (AFs) 13.

7 Introduction

Hemidesmosomes are specialized structures composed by plectin, BP230, Integrin α6β4, collagen XVII and tetraspanin/CD151, and link the basal keratinocytes to the basement membrane (Figure 3). They play a crucial role in skin homeostasis and cell signalling. Below the hemidesmosomes, the anchoring filaments constitute an interconnective network going through lamina lucida, composed by different isoforms of laminin (332, 311 and 511) and the extracellular part of Collagen XVII. Extending from lamina densa to papilar dermis, the anchoring fibrils, mainly composed of Collagen VII (C7), warrant dermal-epidermal cohesion in the lower part of the DEJ (Figure 3)14, 15. The lamina densa is mainly formed by Collagen IV, nidogen and perlecan. Mutations causing functional alterations of DEJ-forming proteins can disrupt the integrity of the DEJ complex and compromise dermal-epidermal adhesion, resulting in blistering disorders of the skin such as Epidermolysis Bullosa (EB).

Figure 3. Overview of the dermal-epidermal junction. Attachment complexes and molecules contributing to the integrity of keratinocyte cell-cell adhesion and junction of the epidermis and dermis at the cutaneous basement membrane zone are presented in this figure. Dermal-epidermal junction layers are indicated on the left. Imagen taken from Uitto J., 2019 16.

8 Introduction 2. Collagen VII

COL7A1 gene encodes the Type VII collagen protein (C7) that forms a key constituent of the anchoring fibrils that provide structural adhesion between dermis and epidermis. COL7A1 is located in the short arm of chromosome 3, at the 3p21.31 locus (Figure 4) 17, 18. This 32kb gene is composed of 118 exons coding for an mRNA transcript of 8.9kb19, 20. C7 protein is a homotrimer consisting of three pro-α1 polypeptide chains of 2944 amino acids. Each pro-α1 polypeptide chain consists of a central collagenous triple helical domain flanked by two non-collagenous domains (NC), that are the large amino-terminal NC1 domain and the small caboxy-terminal NC2 domain (Figure 4).

Figure 4. Chromosomal location and structural organization of COL7A1. Collagenous domain is flanked by two non-collagenous regions at the N and C terminus.

Exons 1-28 encode the NC1 domain (145 kDa), containing sub-domains that exhibit sequence homology to adhesive proteins such as fibronectin type III and cartilage matrix protein 21-24. Attachment of the AFs to the cutaneous basement membrane is mediated by the NC1 domain of COL7A1 gene. Immediately after this, the collagenous triple helical domain (145 kDa), spanning from exons 29-111 comprises series of Gly-X-Y repeats, which are disrupted 19 times by non-collagenous regions. The midpoint of the collagenous triple helical domain, at exon 71-72, is where the largest non-collagenous disruption is located, with 39 amino acids. It is known as the “hinge” region, and is extremely susceptible to proteolytic digestion by pepsin 25, 26. From exons 112-118, the small NC2 domain (30 kDa) works as a structural region since its conserved cysteine residues are involved in linking collagen VII homotrimers through disulphide bonds 22, 23, 27-29.

9 Introduction

The mentioned structural characteristic of the COL7A1 gene, with very short exons in the collagen triple helix-coding region, encoding Gly-X-Y aminoacid repeats beginning with intact codons for the glycine residues and arranged in frame, allows researchers to address the correction of disease-causing mutations in this gene by exon skipping or removal approaches. These approaches will be discussed in the next sections.

2.1. Collagen VII and AF formation

Collagens constitute a family of proteins, which are the major extracellular matrix (ECM) components in mammal tissues. A triple helical domain that offers structural integrity and stability to connective tissues is a common feature of all collagens. C7 is synthesized and secreted mainly by keratinocytes, but also by dermal fibroblasts 30-32. Although COL7A1 codes for identical pro-�1 polypeptide chains (295 kDa), three polypeptide monomers need to trimerize through its carboxy terminal ends and the collagenous section and fold into a triple helical configuration 33, 34. Then, these molecules are secreted into the extracellular milieu where they follow antiparallel formation and dimerize. At this point, a section of the NC2 domain is proteolytically removed to stabilize the dimers through disulphide bond formation 24, 35. After this, aggregation of multiple dimers occurs, resulting in formation of the AFs (Figure 5). Given the structural integrity that these AFs confer to the skin by attaching the dermis to the BMZ, pathogenic mutations in the gene which encodes for its main component, collagen VII, lead to Dystrophic Epidermolysis Bullosa (DEB), a devastating disorder.

Figure 5. Assembling of collagen VII monomers into AFs. Highly organized lateral aggregation of multiple dimers follows, resulting in formation of the AFs. Image taken from Bruckner-Tuderman, L., 200936.

10 Introduction

Mutations in the COL7A1 gene result in both dominant and recessive forms of DEB. A large number of disease-causing mutations throughout the entire COL7A1 gene have been identified in the DEB population. By molecular cloning, a linkage analysis in families with DEB can be done to study the inheritance pattern of the disease32. Over the last decade, with the advancement in molecular diagnostics and the arrival of next generation sequencing (NGS), more and more mutations in COL7A1 are being identified, with more than 700 different mutations described to the present, including missense, nonsense, splicing mutations, and small insertions and deletions 35, 37. In the generalized severe subtype, mutations result in premature termination codons (PTCs) on both alleles of COL7A1. This leads to nonsense-mediated mRNA decay or the formation of a truncated polypeptide for C7 that cannot be assembled into a functional AF, thus leading to the phenotypic skin fragility characteristic of DEB 23, 24. Several mutations have been found with higher prevalence in particular populations. Importantly, the c.6527insC frame-shift mutation, located at COL7A1 exon 80 was found to be highly prevalent in Spanish RDEB patients, accounting for 46% and 42% of the Spanish and Chilean RDEB populations, respectively 22, 38-41. Due to its size, exon 73 carries the largest number of mutations overall in DEB, 10.74%, and given its location directly after the “hinge” region, mutations here could disrupt AF function 23, 34, 42. Also, exon 13 within the NC1 domain is one of the most commonly found to contain mutations, resulting in impaired attachment of the AF to the basement membrane 43.

3. Epidermolysis bullosa

3.1. Overview and classification of EB

Epidermolysis Bullosa (EB) is a genetically and clinically heterogeneous family of rare inherited blistering disorders characterized by epithelial tissue separation, skin blistering and scar formation after minor trauma24, 44, 45. First described in 1886 by Kobner and colleagues, and later classified by Pearson in 1962, reclassified by Fine46 in 2014 and recently, by Has and colleages47 in 2020. Classification of the EB types has been established regarding to two main characteristics: the structural level of the skin where blistering formation occurs and mutational spectrum. Clinically, EB displays phenotypic heterogeneity ranging from mild topical blistering, to whole body affectation, and sub- classification of EB extends to over 30 clinical subtypes associated with close to 20

11 Introduction

pathogenic mutation affected genes 48, 49. At this moment, EB is classified into four main subtypes based on the level in which blistering occurs at the BMZ: EB simplex (EBS), junctional EB (JEB), dystrophic EB (DEB) and Kindler syndrome 50-52 (Table I). - EB simplex (EBS) typically presents an autosomal dominant inheritance pattern. The cleavage plane of the skin is located at the intraepidermal level within the basal layer of the epithelium (‘Epidermolytic’). EBS is the most common EB type 47. Clinical manifestations of EB simplex go from mild to severe and it can lead to death in rare variants. Among EBS patients, two main subtypes can be identified with differences in the cleavage and affected genes: Suprabasal EBS, in which Plakophilin-1 (PKP-1) and desmoplakin (DSP) are mutated, and Basal EBS, in which keratin-5 (KRT5), keratin-14 (KRT14), plectin (PLEC1) or α6β4 integrin genes are mutated. - Junctional EB (JEB) presents skin blistering at the intra-lamina lucida level (‘lamina lucidolytic’) and wound healing resulting in atrophy scarring and granulation tissue development. JEB can be divided into two different subtypes: severe JEB and intermediate JEB 53. It is heritance pattern is typically autosomal recessive and different genes have been reported as relevant for the Junctional type including genes encoding for laminin 332 subunits in the severe JEB and these genes or COL17A1 in the intermediate JEB type (Table I). - Dystrophic EB (DEB) presents skin blistering within the sublamina densa (‘dermolytic’), severe scarring and nail dystrophy. Mutations related to this subtype have been described throughout the COL7A1 gene. The pattern of inheritance distinguishes between Dominant Dystrophic EB (DDEB) and Recessive Dystrophic EB (RDEB) and generally, RDEB is more severe than DDEB 47. - Kindler EB (KEB) is considered an autosomal recessive skin disorder with, unlike other subtypes, multiple ultrastructural blistering sites. KEB is a rare type of EB with about 250 patients reported worldwide since it was described in 1954 54. Clinical manifestations also include poikiloderma and photosensitivity. Mutations in FERMT1, the gene coding for kindlin-1, causes this condition.

Diagnosis of patients with EB is currently performed using a combination of molecular, clinical, ultrastructural and immunohistochemical features. Moreover, this group of diseases is also genetically heterogeneous, with both autosomal dominant and recessive inheritance occurring, and affects both males and females equally 45, 46, 55. Incidence of EB

12 Introduction

is estimated in approximately 1 in 50.000 live births, affecting approximately 500.000 people worldwide, which classifies EB as a rare inherited disorder 48. After mutational analysis in a large cohort of patients, genes that encode structural proteins have been related to different EB subtypes. Findings reported from mutational analyses of different EB patients are summarized in Table 1.

Type of EB Mutated Protein Inheritance Associated Phenotypes Genes

EBS DSP Desmoplakin AR EB, lethal acantholytic PKP1 Plakophilin AR Ectodermal dysplasia/skin fragility syndrome JUP Plakoglobin AR Skin fragility, palmoplantar keratoderma and woolly hair, with or without cardiomyopathy KRT5 Keratin 5 AD 75% of all EBS cases KRT14 Keratin 14 AD, AR PLEC1 Plectin AR (AD) EBS, EBS-PA, EBS-MD, EBS-Ogna DST BPAG1 AR EXPH5 Exophilin 5 AR TGM5 Transglutaminase 5 AR Acral peeling skin syndrome KLHL24 Kelch-like protein 24 AD EBS generalized, with scarring and hair loss JEB LAMA3 Laminin-332 AR 9% of all JEB cases LAMB3 AR 70% of all JEB cases LAMC2 AR 9% of all JEB cases COL17A1 Collagen XVII AR 12% of all JEB cases ITGA6 α6β4 integrin AR A few reported cases ITGB4 AR (AD) ITGA3 Integrin α3 subunit AR Cases reported with congenital nephrotic syndrome and interstitial lung disease DEB COL7A1 Collagen VII AR, AD 100% of all DEB cases KEB FERMT1 Kindlin-1 AR 100% of all KEB cases KEB-like CD151 Tetraspanin CD151 AR EB with nephropathy

Table 1. Molecular heterogeneity of Epidermolysis Bullosa. EB classification based on the structural level of the skin where blistering formation occurs and mutational spectrum, including most frequent mutated genes for each type of the disease. Adapted from Uitto et al, 2018 56.

13 Introduction

3.2. Recessive Dystrophic Epidermolysis Bullosa (RDEB)

DEB is one of the different subtypes of EB, with an incidence rate of 2-6 per million births 46, 55. It has been estimated that about 5% of the EB patients present a clinically- severe Recessive Dystrophic Epidermolysis Bullosa (RDEB). The pattern of inheritance of this condition is autosomal recessive and is caused by mutations within the COL7A1 gene coding for C7, a key element of the AFs, which are located at the DEJ and are essential to sustain the junction between the epidermal basement membrane and the dermis. RDEB is commonly caused by bi-allelic loss-of-function due to nonsense, missense or splice-site mutations, insertions or deletions disrupting the synthesis, secretion and polymerization of the C7 protein. The loss of C7 results in blistering formation and skin fragility 45, 53. The total absence of C7 expression with no detectable AFs in the BMZ leads to the most severe degree of this disease. Clinical manifestations and complications caused by RDEB depend on the degree of this condition, but common characteristics have been found among all the RDEB population. A key aspect in RDEB is the blistering formation in the skin after minor trauma. Pain is also present in these patients and it is due to the skin blistering formation, wound healing, the pain associated to procedures, gastrointestinal tract and affected organs. RDEB patients also suffer from skin itching or pruritus57 from the wound healing process and inflammation. Other affectations related to oral care are found such as dental abscesses and periodontal problems. Moreover, other common complication in these patients is pseudosyndactyly 58, caused by scarring of the skin of the extremities resulting in fusion of digits and toes. On the other hand, infection control is necessary for these patients. Bacterial growth is very frequent because of the accumulation of serum and moisture in affected skin zones, which increases the risk of infection. However, the most severe complication of RDEB is the Squamous Cell Carcinoma development (SCC) that is very frequent in zones of non- healing chronic wounds, blister formation and scarring and is the main cause of death in RDEB patients 59. The majority of generalized-severe RDEB patients will eventually succumb to metastatic SCC, accounting for up to 90% of deaths among RDEB patients by their mid-fifties 60, 61. Severe and recurrent skin ulcers that fail to heal in RDEB patients could lead to significant tissue dysfunction and reorganization, as well a chronic inflammatory microenvironment which would aid carcinoma development 33, 60, 61.

14 Introduction

Blistering Skin erosions

Pseudosyndactyly Squamous Cell Carcinoma

Figure 6. Clinical features of RDEB. RDEB is a complex disease with severe clinical manifestations. In this figure, the most common clinical manifestations are presented: blistering and erosions, pseudosyndactyly and squamous cell carcinoma. Modified from Cuadrado-Corrales, N. et al. 2011 (DOI: 10.1159/000330331).

Recently, diverse studies highlighted different potentially relevant findings to understand Squamous Cell Carcinoma development in EB patients, including the APOBEC family- driven mutagenic process in response to chronic wounds 62, the NOTCH1 mutations/NOTCH pathway role in SCC formation 63, the effect of inflammation-related molecules, specially IL-6, in tumor progression and metastasis 64 and the impact infections and immunity in tumor formation 65. Also, they discussed about using extracellular-vesicles and molecules in circulation as minimally-invasive factors for prognosis and diagnosis of the pathology 66. SCC therapies include surgery to remove the affected tissue, radio- and chemotherapy and amputation.

3.3. Therapeutic approaches for RDEB

There are currently no definitive treatments for RDEB with the main principle of care focused on daily wound management, infection control pain and itch relief 45. Symptomatic treatment for patients is pivotal given the negative impact that pain and itch have on quality of life. Given the multiple comorbidities in these patients, skillful multidisciplinary treatment

15 Introduction management is needed 35. Prevention of new blister formation and ulcers are aspects of main concern. Bacterial infections are also a relevant problem for RDEB patients, where large areas of denuded skin are exposed enabling moisture and serum accumulation promoting bacterial growth at wound sites 67, 68. Moreover, poor wound healing and pruritus complicates blisters and wounds as scratching leads to additional skin damage 45, 51, 69-71. To date, there is no registered curative treatment for RDEB despite intense research with very different approaches. Current therapeutic strategies are based on C7 restoration using protein, cell and gene-based approaches. A combination therapy aiming at disease phenotype amelioration and restoration of skin adhesion could be an optimal therapeutic option for RDEB.

A. Recombinant protein therapy

In 1982, insulin was approved as a recombinant protein therapy and since then, more than 120 recombinant proteins have been tested and proved to be a real therapeutic option 72. In the case of RDEB, protein therapy involves the administration of recombinant C7 into patients, locally or systemically (Figure 7). This approach is completely independent of the RDEB-causing mutation within COL7A1 and therefore this therapy could be useful for all RDEB patients. Preclinical studies in mouse models successfully showed the deposition of C7 stably at the DEJ after intradermal injection 73. Later investigations by Remington et al, treating COL7A1 null mice with repeated intravenous injection of recombinant C7 demonstrated successful AF formation and amelioration of RDEB phenotype resulting in significantly prolonged survival 36, 74. The mechanism whereby recombinant C7 injected into the skin migrates to affected zones only and is present in the BMZ has yet to be fully elucidated 75, 76.

Despite the promising preliminary results, there are some concerns about the use of recombinant proteins as therapy. Firstly, therapeutic effects are transient because of protein degradation over time, needing lifelong repeated injections 35, 36, 75, which leads to concerns about immune tolerance. Consistently, circulating anti-human C7 antibodies were induced in response to injection of the recombinant protein. However, these antibodies did not attach to the BMZ or prevent the formation of AFs, and a CD40L monoclonal antibody can inhibit their production 74. Secondly, as small-scale doses are used in the animal models, a scaling up of a clinically relevant-effective therapeutic dose for human must be done. Large-scale production of the recombinant C7 under GMP conditions and the establishment of product standards are also a current challenge for

16 Introduction

industry35, 36, 75. In this context, Phoenix Tissue Repair Inc., a biotechnology company working in treatments for RDEB has recently started recruiting RDEB patients for a phase I/II clinical trial. This trial will test the therapeutic benefit of PTR-01, a systemically applied recombinant C7 treatment for RDEB.

Figure 7. Advanced therapies for the treatment of RDEB. EB treatment is based on daily wound management, infection control and pain relief, with no curative treatment available. Different advanced therapies have been developed aiming to cure EB. Recent gene and cell therapies proposed to treat EB are summarized in this figure.

B. Cell therapy for RDEB

Similar strategies to those used for the treatment of burn patients using epidermal skin grafts to wound sites were the initial cell-based approaches for RDEB. The finding in 1975 that human skin cells could be grown with the presence of irradiated fibroblast feeder layer opened up the fast and large scale production of epidermal keratinocyte sheets 77, 78. In RDEB, cell-based therapies have been focused on C7 restoration to wound sites (Figure 7).

Different studies focused on allogeneic or autologous derived epidermal keratinocyte sheets. The outcome of both approaches has been poor. On one hand, healthy human skin allogeneic grafts expressing normal levels of C7 but can initiate an immunological response leading to impaired skin grafting 79. On the other, autologous grafts from intact

17 Introduction

skin areas, avoid the immune response but only provide a transient amelioration as the cause of the disease, usually reduced or null C7 expression, remains80.

Keratinocytes are the main producers of C7 in the skin, but dermal fibroblasts also synthesize and secrete C7, although at a smaller rate. In addition, fibroblasts are more robust cells and easier to culture than keratinocytes, making them a better cell target for use in cell therapy 24, 45, 81-84. Intradermal injections of allogeneic fibroblasts in murine models for RDEB demonstrated increased C7 deposition leading to wound healing 81, 85. Following this, an initial pilot study was performed to test a single intradermal injection of allogeneic fibroblasts into five RDEB patients as a therapy. No detection of donor fibroblasts was found two weeks post administration. However C7 expression levels not only increased but were maintained for three months 83, 86. This demonstrated that allogeneic fibroblasts offer a potential therapeutic option for cell therapies for RDEB. However, further studies are needed to elucidate the long-term effects of repeated administration.

Since RDEB is a systemic disorder affecting the whole body, and injection of cells at wound sites is problematic given the need for painful injections at different sites, multiple cell-based therapies for RDEB have been focused on the development of a systemic approach, by means of bone marrow transplantation (BMT) or mesenchymal stem cells (MSCs) administration. BMT has previously been used in clinics to treat a large number of hematological disorders 87. These cells have been found to migrate to wounds and damaged tissues. Based on preclinical studies, the first clinical trial using allogeneic BMT was finished in 2010. Despite the promising results in mouse model, BMT is a very invasive and risky procedure that needs pre-conditioning of patients using high doses of chemotherapy before cell transplantation. Two of seven RDEB patients treated with BMT died because of complications associated with the transplantation procedure, and the other five showed improvements such as reduced skin blistering and fewer erosions 88- 90. Later, between May 2014 and October 2017, two RDEB patients were treated with HSCT in Netherlands, in a clinical trial designed to treat 11 RDEB-gen-sev patients, but they died because of HSCT-related complications. The study was prematurely closed 91.

Due to these safety concerns and risks of HSCT, many researchers have changed to the use of allogeneic MSCs transplantation. These cells are able to migrate to affected areas and promote wound healing. These cells offer a notable safety profile compared to BMT therapy, since there is no need for pre-transplant chemoablation. In other studies, Ganier et al. showed RDEB phenotype correction after using BM-MSCs in mice model 92. In

18 Introduction

patients, Conget et al. demonstrated that intradermal injection of allogeneic MSCs in two RDEB patients did not show any significant adverse effects, and resulted in improved wound healing by increased C7 at the BMZ which lasted for four months 45, 93. A clinical trial study by Petrof et al. using intravenous infusions of allogeneic MSCs into ten RDEB patients, confirmed no severe adverse effects. Clinical improvements in terms of reduced itching and skin redness were found, although no detectable C7 or AFs were found two months after MSCs infusion 94. Our research group has recently started a clinical trial in RDEB patients with haploidentical bone marrow derived-MSCs injected systemically (NCT04153630), but no results are available yet.

Altogether, cell therapy shows remarkable potential for RDEB treatment, but further preclinical studies and clinical trials are needed to clarify the full potential of BMT and MSCs in the RDEB phenotype amelioration.

C. Gene therapy

Gene therapy enables the treatment of disorders at the genetic level and is contributing to the establishment of new curative therapies. Gene therapy involves the addition or modification of genetic material into target cells to treat genetic diseases 95. RDEB is a monogenic genetic disease that could be a perfect candidate for gene therapy approaches, with more than 700 known mutations described within the COL7A1 gene 96, 97. In addition, the skin is one of the most easily accessible organs of the body making it an ideal target for this type of therapy. For RDEB treatment, ex vivo and in vivo gene therapy approaches can be considered. Ex vivo strategies are based on the use of keratinocytes (epidermal stem cells) or fibroblasts isolated from RDEB patients, which undergo genetic correction and then are grafted back onto the patient 98. Viral vectors have been the first option for RDEB because of their ability to deliver efficiently a transgene into the cells and promote integration into host genomic DNA. However, safety concerns on viral systems such as insertional mutagenesis, immune response or vector stability within the host are present 99-102. On the other hand, non-viral gene delivery systems such as electroporation or polymer-mediated transfection have shown promising results and provide an attractive alternative to viral systems103, 104.

For RDEB, the delivery of the full-length COL7A1 cDNA into RDEB patient keratinocytes or fibroblasts has been the first classical gene therapy approach (Figure 7). The large size of the COL7A1 cDNA, nearly 9 kb, difficult its delivery into cells for

19 Introduction

several viral based systems 105-107. Lentiviral systems are the most commonly used vectors in RDEB gene therapy due to their relatively large viral packaging capacity (>9kb), ability to transduce both dividing and non-dividing cells with high efficiency and long-term transgene expression. Chen et al. demonstrated successful long-term C7 expression restoration after delivery of COL7A1 cDNA by self-inactivating (SIN) lentiviral vector in primary patient keratinocytes and fibroblasts. Furthermore, after grafting onto immunodeficient mice, anchoring fibrils formation at the BMZ was observed 108. Further studies by Woodley et al. demonstrated that intradermal injection of lentiviral particles for C7 expression into immunodeficient mice and human skin grafts on mice, produced long- term C7 expression and also AF formation. In addition, a single injection showed stable C7 expression at the BMZ for up to 3 months, demonstrating the potential of this gene therapy approach for RDEB 109.

In order to reduce oncogenic risk related to previous viral approaches, Titeux et al. developed a SIN-retroviral vector for COL7A1 cDNA delivery, showing efficient ex vivo genetic modification in primary RDEB keratinocytes and fibroblasts 110. This promising pre-clinical study demonstrating long-term C7 expression paved the way for the phase I/II clinical trial in RDEB patients (NCT04186650), using genetically corrected autologous cells. Recently, other phase I clinical trial with 4 RDEB patients conducted in Stanford University in 2016 (NCT01454687), highlighted the complexity of using autologous corrected keratinocytes grafts in clinics. In this study, COL7A1 cDNA was delivered via retroviral vector into RDEB keratinocytes and skin equivalents were made and grafted back onto RDEB patients. Wound healing was observed in grafted sites, but significant outcome variability was found among RDEB treated patients. In addition, RDEB phenotype amelioration decreased over time 111. Further studies evaluating long- term correction and larger patient cohorts will be necessary to confirm the therapeutic potential of retroviral vector-based approaches.

As an alternative to skin grafting, SIN lentiviral vector-based strategies have been used for COL7A1 gene replacement therapy in RDEB fibroblasts with the aim to directly inject them into RDEB patients as in vivo gene therapy 112, 84. Recently, McGrath Lab and colleagues showed the results of a clinical trial to test lentiviral fibroblast gene therapy in 5 adults, evaluated after 1 year of treatment (NCT02493816) 113. 6 out of 12 skin sites injected with autologous transduced fibroblasts showed increased C7. These preclinical and clinical data support initiation of further clinical trials with gene corrected fibroblasts.

20 Introduction

In addition to ex vivo gene therapy approaches, a current ongoing phase I/II clinical trial conducted by Krystal Biotech is testing the in vivo therapeutic benefit of a non-integrating Herpes Simplex Virus (HSV-1) carrying the COL7A1 cDNA, named as KB103, topically delivered to the skin for RDEB (NCT03536143).

Several other approaches involving integrative permanent gene modifications and pharmacological strategies to restore C7 are being considered 114, 115 although their description exceeds the length of this introduction. The most relevant therapies that have reached the clinical stage are summarized in Table 2.

Table 2. Currently recruiting clinical trials for the treatment of different epidermolysis bullosa subtypes. Table taken from Bruckner-Tuderman, 2020 114.

Taken together, the use of viral vectors is showing promising results and clinical translation of gene therapy for RDEB. However, although safety concerns related to insertional mutagenesis and immunogenicity have been reduced, the use of viral systems still poses important regulatory and technical hurdles regarding production of the vectors in clinical grade conditions99-102.

21 Introduction 4. Genome editing

4.1. Genome editing tools

Classical gene therapy is based on introducing a functional copy of a gene into somatic cells of patients in order to overcome the effect of disease-causing, gene-inactivating mutations. Although gene addition has led to important medical advances, it has limitations derived from the barely controlled effects of the introduced genetic modifications, including genotoxicity from random integration of the viral vectors and inappropriate or non-permanent therapeutic transgene expression. Over the past two decades, technologies for precise gene modification have been developed to offer more accurate gene therapy techniques. These approaches are based on new tools called genomic-targeted nucleases, including meganucleases, zinc finger nucleases, TALENs and CRISPR/Cas9 (Figure 8). This new field is known as genome editing.

Figure 8. Genome editing by zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs) and CRISPR/Cas9 system. Modified from Molina, R. et al, 2011116.

All these nucleases create double strand breaks (DSB) in the target DNA sequence which the cell machinery will then repair using one of two pathways 117: Non-homologous end joining (NHEJ) or Homology-directed repair (HDR) (Figure 9).

22 Introduction

- NHEJ: Occurs without the use of a repair template. The largest proportion of DSBs is repaired via end joining, which is rapidly activated, in all phases of the cell cycle. After the DSB created by the nuclease, NHEJ results in an insertion or deletion (indel), resulting in a sequence that is essentially random and impossible to control. Due to this, NHEJ is known as an error prone pathway 117. When indels take place in the coding region of a gene, frame-shift mutations can occur, disrupting gene expression. This is the reason why NHEJ is commonly used for gene knock-out. - HDR: Utilizes a repair template that contains homology to the sequences proximal to the DSB. HDR occurs exclusively during the S and G2 phases of the cell cycle in proliferating cells 118. This DNA repair mechanism allows for precise control of the resulting gene modification, but requires additional DNA donor templates to be transfected, and is often less efficient than the NHEJ repair pathway. These repairing events can be used to correct point mutations, insert sequences or create precise deletions.

Figure 9. Mechanisms of DNA double-strand break repair. NHEJ and HDR represent the main DSB repair mechanisms exploited for gene modification approaches. Image taken from Maeder and Gersbach, 2016 117.

All of these approaches can be used in a wide variety of cell types to modify specific DNA sequences. In this section the different nucleases used for genome editing are described in detail.

A. Meganucleases

Meganucleases are sequence-specific endonucleases that use large (12-45 bp) recognition sites to generate accurate DSBs. In contrast to other systems, DNA binding and cleavage

23 Introduction

functions are performed by the same domain, so meganucleases can only target the region where the restriction site is present. Their recognition sites are extremely rare and in a mammalian-sized genome, only a few such sites will exist at most 119. Despite hundreds of different natural meganucleases have been identified, and some chimeric ones have been engineered, few target sites within the human genome are available, which limits their application in human gene therapy 120, 121.

B. Zinc-finger nucleases

Zinc-finger nucleases (ZFN) are chimeric proteins comprised of a DNA binding domain composed of a zinc-finger protein (ZFP) domain that mediates DNA binding selectivity and an endonuclease domain derived from the FokI restriction enzyme. Zinc fingers are approximately 30 amino acids that can bind to a limited combination of 3-bp DNA sequences. Usually, between 3 and 6 ZFPs are used to increase specificity, generating a single ZFN subunit that binds to DNA sequences of 9-18 bp. As the endonucleolytic domain of FokI only has activity when there is dimerization, two ZFNs monomers are required to form an active nuclease. By using a combination of different zinc fingers, a unique DNA sequence within the genome can be targeted. Dimerization increases specificity, as it doubles the length of recognition sites, which must be separated by 5-7 bp122. Although latest designs have improved this type of nucleases, ZFN cannot be engineered to target any desired site in the genome due to the fact that the ZFPs collection available and their design requires arduous computational analysis and selection, making their production costly and time expensive 123.

C. TALENs

Transcription activator–like effector nucleases (TALENs) are modular enzymes used as dimers like ZFN, and also composed of a DNA binding domain attached to the FokI nuclease. Their DNA-binding domain is a repetitive motif known as transcription activator-like effector (TALE), derived from the plant-pathogenic bacterium Xanthomonas. TALEs are composed of tandem arrays of 33–35 amino acid repeats, each of which recognizes a nucleotide in the major groove of the DNA 124. Amino acids at positions 12 and 13 determine the specificity of each repeat, and are called repeat-variable di-residues (RVDs). They can be engineered to target almost any given DNA sequence, but a limitation is the requirement for a Thymine at the 5ʹ end of the target sequence.

24 Introduction

Their dimeric structure and relatively long recognition motifs generate a remarkable specificity, showing very rare off-target effects 125. Moreover, structural modifications have been conducted to reduce the risk of unspecific activity as much as possible 123. However, construction of new TALEN protein pairs for each target sequence is time- consuming and requires significant expertise.

D. CRISPR/Cas9

The discovery of clustered regularly interspaced short palindromic repeats (CRISPR) along with the CRISPR associated (Cas) proteins is the most recent development in genome editing. This genome editing tool comes from CRISPR systems, adaptive immune mechanisms present in many bacteria and archaea, that provide sequence- specific protection against foreign DNA or, in some cases, RNA. A CRISPR locus consists of a CRISPR array, comprising short direct repeats which are separated by unique ‘spacers’ of short variable length, flanked by diverse cas (crispr associated) genes126- 128. The CRISPR/Cas9 technology is a three-component system consisting of an endonuclease (Cas9), a sequence-specific targeting element, the CRISPR RNA (crRNA), and another RNA that links Cas9 with the crRNA, the trans activating CRISPR RNA (tracrRNA)129 (Figure 8). The crRNA recognizes and pairs with a sequence of 20 nucleotides in length within the targeted genome. Since the targeting specificity in this system is provided by an RNA molecule that can be easily synthesized, it results in a simpler and faster methodology to develop than TALENs and ZFNs. CRISPR/Cas9 is now widely used in multiple organisms, both in vitro and in vivo. The effector enzyme most commonly used to date is Cas9 from the type II CRISPR/Cas system from Streptococcus pyogenes. In 2012, type II CRISPR system present in Streptococcus pyogenes was adapted for in vitro application. crRNA, tracrRNA and Cas9 nuclease components were demonstrated as sufficient to create targeted DSB in DNA sequences homologous to the crRNA region, that needs to be adjacent to the 5’-NGG-3’ PAM sequence from S. pyogenes Cas9. These PAMs sequences (Proto-spacer Adjacent Motifs), are critical and unique to the Cas9 proteins isolated from different species. The RNA component was further simplified by fusing crRNA and tracrRNA elements into a single chimeric RNA molecule (sgRNA) 130 and was proposed as an efficient genome editing tool. From that point, CRISPR/Cas9 technology has revolutionized molecular biology research. The simplicity of this system allows multiple delivery possibilities, such as plasmid DNA131, mRNA132, adenoviral vectors 133, gamma-retroviral and lentiviral

25 Introduction

vectors 134, 135 , adeno-associated viruses136, 137and ribonucleoprotein (RNP) complexes138 transduction,. Furthermore, the high efficacy and specificity of this genome editing platform, and the feasibility and affordability of its implementation in a clinical grade format makes CRISPR/Cas9 the system of choice for genome editing clinical translation, showing promising results in preclinical studies but also reaching clinical stage139, 140 (NCT03745287).

Alternative endonucleases such as the type V Cpf1 exist and utilize different PAM motifs for targeting 141, thus broadly extending the ability to modify the genome with an unprecedented efficacy. While the requirement for a PAM motif in the target genome is a limitation of this technique, it is estimated that every gene harbors multiple potential target sites, allowing disruption of practically any gene.

Additional potential for the CRISPR/Cas9 technology derives from its great versatility. In effect, the sgRNA directs the endonuclease to a specific site in the genome. By attaching functional domains to Cas9, it is possible to target any functionality to a specific genomic location, including promoter sites and introns. Similarly, systems for gene repression, histone modification and epigenetic alterations have been created 142-144.In addition, the system can be used to specifically tag sequence regions with a fluorescent protein 145, 146.

For precise correction based on homology-directed repair-based genome editing approaches, a donor DNA template delivery is required. Adeno-associated viruses- carrying donor template DNA have shown remarkable performance in different studies and are therefore a powerful tool to be used in combination with CRISPR to reach high gene editing frequencies.

E. DNA donor template delivery for HDR-based approaches

In combination with nucleases, Adeno-associated viral vector (AAVs) have shown very good results in terms of donor template delivery and they have been established as the state-of-the-art technology for HDR-based genome editing protocols 147-150. AAVs consist of small (25 nm) non-enveloped icosahedral capsids containing a linear ssDNA genome of 4.7 kb 151.They are able to naturally transduce dividing and non-dividing broad range of cell types. Its minimalist genome facilitates its modification and their capsid organization

26 Introduction

enables customization of the tropism and efficiency of transduction, offering a versatile gene delivery system 152. AAVs are non-integrative, avoiding the risk of insertional mutagenesis, and low immunogenic, displaying an excellent safety profile.

4.2. Genome editing approaches for EB

A large variety of mutations along COL7A1 cause Recessive Dystrophic EB. Gene editing approaches can be tailored to specific mutations, especially in the case of highly prevalent mutations, or can be aimed at correcting a spectrum of mutations in specific regions. 153. The simplest and most efficient genome editing approaches are based on NHEJ repair aimed at gene disruption 154-157 and gene reframing 40, 158, 159. As these strategies do not require a DNA donor template, concerns about undesired integrations and DNA- associated toxicity are avoided. Recently, our lab and colleagues have been exploring exon deletion approaches for highly efficient gene reframing strategies that could be used to treat a large cohort of mutations in non-patient-specific fashion103, 104. In addition, HDR- based protocols for precise correction of genes harboring EB-causing mutations can be considered once the limited efficiency inherent to HDR repair is overcome by optimizing gene editing tools. . The most important approaches aiming at correcting EB are summarized in the following table (Table 3). These approaches will be discussed in the next chapters of this thesis.

27 Introduction

Table 3. Genome editing approaches aiming to treat EB. Mutation, gene and disease context-dependent strategies for efficient genome editing in different types of skin disorders. Modified from March, O.P. et al, 2020 153.

28 Introduction

5. Summary

Mutations in COL7A1, the gene encoding the anchoring fibrils-forming type VII collagen, cause RDEB, a skin fragility disease characterized by recurrent skin blistering, scarring and risk of squamous cell carcinoma development, the main cause of death in these patients. A frameshift mutation in exon 80 of COL7A1 was described as highly prevalent in the Spanish patient population. Currently there is no curative treatment available. In this thesis, we propose different genome editing-based approaches in order to offer a therapeutic solution for RDEB. In the first chapter, we will present a TALEN-based strategy to restore C7 expression by deleting mutation-containing exons. A similar, but more efficient approach is described in Chapter 2, in which we demonstrate that a one- step NHEJ-based correction protocol using dual gRNA/Cas9 RNPs delivered to patient keratinocytes by electroporation allows highly efficient restoration of Collagen VII expression by removing mutation-bearing COL7A1 exon 80 .A higher standard of precise correction is explored in chapter 3, in which a marker free HDR-based approach for RDEB correction using a modified sgRNA combined with a donor template-carrying AAV is described. This template encompasses 10 exons of COL7A1 gene, potentially enabling precise HDR-based correction for a large cohort of RDEB patients. On the whole, this thesis offers novel, therapeutically useful and clinically feasible approaches to be considered as gene therapy for the treatment of RDEB.

29 Introduction

6. References

1. Iwai, I. et al. The human skin barrier is organized as stacked bilayers of fully extended ceramides with cholesterol molecules associated with the ceramide sphingoid moiety. J Invest Dermatol 132, 2215-2225 (2012). 2. Lundborg, M. et al. Human skin barrier structure and function analyzed by cryo-EM and molecular dynamics simulation. J Struct Biol 203, 149-161 (2018). 3. Kanitakis, J. Anatomy, histology and immunohistochemistry of normal human skin. Eur J Dermatol 12, 390-399; quiz 400-391 (2002). 4. MacNeil, S. Progress and opportunities for tissue-engineered skin. Nature 445, 874-880 (2007). 5. Rice-University Anatomy and Phisiology. (BCcampus, OpenStax). 6. Fuchs, E. Epidermal differentiation. Curr Opin Cell Biol 2, 1028-1035 (1990). 7. Watt, F.M. Terminal differentiation of epidermal keratinocytes. Curr Opin Cell Biol 1, 1107-1115 (1989). 8. Fuchs, E. & Green, H. Changes in keratin gene expression during terminal differentiation of the keratinocyte. Cell 19, 1033-1042 (1980). 9. Dale, B.A., Holbrook, K.A., Kimball, J.R., Hoff, M. & Sun, T.T. Expression of epidermal keratins and filaggrin during human fetal skin development. J Cell Biol 101, 1257-1269 (1985). 10. Mehrel, T. et al. Identification of a major keratinocyte cell envelope protein, loricrin. Cell 61, 1103-1112 (1990). 11. Uitto, J. The role of elastin and collagen in cutaneous aging: intrinsic aging versus photoexposure. J Drugs Dermatol 7, s12-16 (2008). 12. Ko, M.S. & Marinkovich, M.P. Role of dermal-epidermal basement membrane zone in skin, cancer, and developmental disorders. Dermatol Clin 28, 1-16 (2010). 13. Villone, D. et al. Supramolecular interactions in the dermo-epidermal junction zone: anchoring fibril-collagen VII tightly binds to banded collagen fibrils. J Biol Chem 283, 24506-24513 (2008). 14. Sakai, L.Y., Keene, D.R., Morris, N.P. & Burgeson, R.E. Type VII collagen is a major structural component of anchoring fibrils. J Cell Biol 103, 1577-1586 (1986). 15. Van Agtmael, T. & Bruckner-Tuderman, L. Basement membranes and human disease. Cell Tissue Res 339, 167-188 (2010). 16. Uitto, J. Toward treatment and cure of epidermolysis bullosa. Proc Natl Acad Sci U S A (2019). 17. Parente, M.G. et al. Human type VII collagen: cDNA cloning and chromosomal mapping of the gene. Proc Natl Acad Sci U S A 88, 6931-6935 (1991). 18. Ryynänen, M. et al. Genetic linkage of type VII collagen (COL7A1) to dominant dystrophic epidermolysis bullosa in families with abnormal anchoring fibrils. J Clin Invest 89, 974-980 (1992). 19. Christiano, A.M., Anhalt, G., Gibbons, S., Bauer, E.A. & Uitto, J. Premature termination codons in the type VII collagen gene (COL7A1) underlie severe, mutilating recessive dystrophic epidermolysis bullosa. Genomics 21, 160-168 (1994).

30 Introduction

20. Christiano, A.M., Greenspan, D.S., Lee, S. & Uitto, J. Cloning of human type VII collagen. Complete primary sequence of the alpha 1(VII) chain and identification of intragenic polymorphisms. J Biol Chem 269, 20256-20262 (1994). 21. Christiano, A.M. et al. A missense mutation in type VII collagen in two affected siblings with recessive dystrophic epidermolysis bullosa. Nat Genet 4, 62-66 (1993). 22. Hovnanian, A. et al. Characterization of 18 new mutations in COL7A1 in recessive dystrophic epidermolysis bullosa provides evidence for distinct molecular mechanisms underlying defective anchoring fibril formation. Am J Hum Genet 61, 599-610 (1997). 23. Dang, N. & Murrell, D.F. Mutation analysis and characterization of COL7A1 mutations in dystrophic epidermolysis bullosa. Exp Dermatol 17, 553-568 (2008). 24. Shinkuma, S. Dystrophic epidermolysis bullosa: a review. Clin Cosmet Investig Dermatol 8, 275-284 (2015). 25. Burgeson, R.E. Type VII collagen, anchoring fibrils, and epidermolysis bullosa. J Invest Dermatol 101, 252-255 (1993). 26. Woodley, D.T., Hou, Y., Martin, S., Li, W. & Chen, M. Characterization of molecular mechanisms underlying mutations in dystrophic epidermolysis bullosa using site-directed mutagenesis. J Biol Chem 283, 17838-17845 (2008). 27. Hovnanian, A. et al. Genetic linkage of recessive dystrophic epidermolysis bullosa to the type VII collagen gene. J Clin Invest 90, 1032-1036 (1992). 28. Dunnill, M.G. et al. Genetic linkage to the type VII collagen gene (COL7A1) in 26 families with generalised recessive dystrophic epidermolysis bullosa and anchoring fibril abnormalities. J Med Genet 31, 745-748 (1994). 29. Dunnill, M.G. et al. Clinicopathological correlations of compound heterozygous COL7A1 mutations in recessive dystrophic epidermolysis bullosa. J Invest Dermatol 107, 171-177 (1996). 30. Stanley, J.R., Rubinstein, N. & Klaus-Kovtun, V. Epidermolysis bullosa acquisita antigen is synthesized by both human keratinocytes and human dermal fibroblasts. J Invest Dermatol 85, 542-545 (1985). 31. Woodley, D.T. et al. Epidermolysis bullosa acquisita antigen, a major cutaneous basement membrane component, is synthesized by human dermal fibroblasts and other cutaneous tissues. J Invest Dermatol 87, 227-231 (1986). 32. Chung, H.J. & Uitto, J. Type VII collagen: the anchoring fibril protein at fault in dystrophic epidermolysis bullosa. Dermatol Clin 28, 93-105 (2010). 33. Varki, R., Sadowski, S., Uitto, J. & Pfendner, E. Epidermolysis bullosa. II. Type VII collagen mutations and phenotype-genotype correlations in the dystrophic subtypes. J Med Genet 44, 181-192 (2007). 34. Turczynski, S. et al. Targeted Exon Skipping Restores Type VII Collagen Expression and Anchoring Fibril Formation in an In Vivo RDEB Model. J Invest Dermatol 136, 2387-2395 (2016). 35. Soro, L., Bartus, C. & Purcell, S. Recessive dystrophic epidermolysis bullosa: a review of disease pathogenesis and update on future therapies. J Clin Aesthet Dermatol 8, 41-46 (2015).

31 Introduction

36. Bruckner-Tuderman, L. Can type VII collagen injections cure dystrophic epidermolysis bullosa? Mol Ther 17, 6-7 (2009). 37. Vahidnezhad, H. et al. Dystrophic Epidermolysis Bullosa: COL7A1 Mutation Landscape in a Multi-Ethnic Cohort of 152 Extended Families with High Degree of Customary Consanguineous Marriages. J Invest Dermatol 137, 660- 669 (2017). 38. Escamez, M.J. et al. The first COL7A1 mutation survey in a large Spanish dystrophic epidermolysis bullosa cohort: c.6527insC disclosed as an unusually recurrent mutation. Br J Dermatol 163, 155-161 (2010). 39. Rodríguez, F.A. et al. Novel and recurrent COL7A1 mutations in Chilean patients with dystrophic epidermolysis bullosa. J Dermatol Sci 65, 149-152 (2012). 40. Chamorro, C. et al. Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes. Mol Ther Nucleic Acids 5, e307 (2016). 41. Mencía, Á. et al. Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells. Mol Ther Nucleic Acids 11, 68-78 (2018). 42. van den Akker, P.C. et al. The international dystrophic epidermolysis bullosa patient registry: an online database of dystrophic epidermolysis bullosa patients and their COL7A1 mutations. Hum Mutat 32, 1100-1107 (2011). 43. Bornert, O. et al. Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy. Mol Ther 24, 1302-1311 (2016). 44. Sawamura, D., Nakano, H. & Matsuzaki, Y. Overview of epidermolysis bullosa. J Dermatol 37, 214-219 (2010). 45. Rashidghamat, E. & McGrath, J.A. Novel and emerging therapies in the treatment of recessive dystrophic epidermolysis bullosa. Intractable Rare Dis Res 6, 6-20 (2017). 46. Fine, J.D. et al. Inherited epidermolysis bullosa: updated recommendations on diagnosis and classification. J Am Acad Dermatol 70, 1103-1126 (2014). 47. Has, C. et al. Consensus reclassification of inherited epidermolysis bullosa and other disorders with skin fragility. Br J Dermatol (2020). 48. Uitto, J., Christiano, A.M., McLean, W.H. & McGrath, J.A. Novel molecular therapies for heritable skin disorders. J Invest Dermatol 132, 820-828 (2012). 49. Kiritsi, D. & Nystrom, A. Recent advances in understanding and managing epidermolysis bullosa. F1000Res 7 (2018). 50. Pearson, R.W. Studies on the pathogenesis of epidermolysis bullosa. J Invest Dermatol 39, 551-575 (1962). 51. McGrath, J.A. Recently Identified Forms of Epidermolysis Bullosa. Ann Dermatol 27, 658-666 (2015). 52. Has, C. & Fischer, J. Inherited epidermolysis bullosa: New diagnostics and new clinical phenotypes. Exp Dermatol 28, 1146-1152 (2019). 53. Fine, J.D. et al. The classification of inherited epidermolysis bullosa (EB): Report of the Third International Consensus Meeting on Diagnosis and Classification of EB. J Am Acad Dermatol 58, 931-950 (2008). 54. Kindler, T. Congenital poikiloderma with traumatic bulla formation and progressive cutaneous atrophy. Br J Dermatol 66, 104-111 (1954).

32 Introduction

55. Fine, J.D. Inherited epidermolysis bullosa: recent basic and clinical advances. Curr Opin Pediatr 22, 453-458 (2010). 56. Uitto, J., Bruckner-Tuderman, L., McGrath, J.A., Riedl, R. & Robinson, C. EB2017-Progress in Epidermolysis Bullosa Research toward Treatment and Cure. J Invest Dermatol 138, 1010-1016 (2018). 57. van Scheppingen, C., Lettinga, A.T., Duipmans, J.C., Maathuis, C.G. & Jonkman, M.F. Main problems experienced by children with epidermolysis bullosa: a qualitative study with semi-structured interviews. Acta Derm Venereol 88, 143-150 (2008). 58. Marin-Bertolin, S., Amaya Valero, J.V., Neira Gimenez, C., Marquina Vila, P. & Amorrortu-Velayos, J. Surgical management of hand contractures and pseudosyndactyly in dystrophic epidermolysis bullosa. Ann Plast Surg 43, 555-559 (1999). 59. Mellerio, J.E. et al. Management of cutaneous squamous cell carcinoma in patients with epidermolysis bullosa: best clinical practice guidelines. Br J Dermatol 174, 56-67 (2016). 60. Fine, J.D., Johnson, L.B., Weiner, M., Li, K.P. & Suchindran, C. Epidermolysis bullosa and the risk of life-threatening cancers: the National EB Registry experience, 1986-2006. J Am Acad Dermatol 60, 203-211 (2009). 61. Montaudie, H., Chiaverini, C., Sbidian, E., Charlesworth, A. & Lacour, J.P. Inherited epidermolysis bullosa and squamous cell carcinoma: a systematic review of 117 cases. Orphanet J Rare Dis 11, 117 (2016). 62. Cho, R.J. et al. APOBEC mutation drives early-onset squamous cell carcinomas in recessive dystrophic epidermolysis bullosa. Sci Transl Med 10 (2018). 63. Sans-DeSanNicolas, L. et al. Genetic Profiles of Squamous Cell Carcinomas Associated with Recessive Dystrophic Epidermolysis Bullosa Unveil NOTCH and TP53 Mutations and an Increased MYC Expression. J Invest Dermatol 138, 1423-1427 (2018). 64. Esposito, S. et al. Autoimmunity and Cytokine Imbalance in Inherited Epidermolysis Bullosa. Int J Mol Sci 17 (2016). 65. Nystrom, A. et al. Impaired lymphoid extracellular matrix impedes antibacterial immunity in epidermolysis bullosa. Proc Natl Acad Sci U S A 115, E705-E714 (2018). 66. Condorelli, A.G., Dellambra, E., Logli, E., Zambruno, G. & Castiglia, D. Epidermolysis Bullosa-Associated Squamous Cell Carcinoma: From Pathogenesis to Therapeutic Perspectives. Int J Mol Sci 20 (2019). 67. Pope, E. et al. A consensus approach to wound care in epidermolysis bullosa. J Am Acad Dermatol 67, 904-917 (2012). 68. Kirkorian, A.Y., Weitz, N.A., Tlougan, B. & Morel, K.D. Evaluation of wound care options in patients with recessive dystrophic epidermolysis bullosa: a costly necessity. Pediatr Dermatol 31, 33-37 (2014). 69. Bruckner-Tuderman, L., McGrath, J.A., Robinson, E.C. & Uitto, J. Progress in Epidermolysis bullosa research: summary of DEBRA International Research Conference 2012. J Invest Dermatol 133, 2121-2126 (2013). 70. Uitto, J. et al. Progress toward Treatment and Cure of Epidermolysis Bullosa: Summary of the DEBRA International Research Symposium EB2015. J Invest Dermatol 136, 352-358 (2016).

33 Introduction

71. Cianfarani, F., Zambruno, G., Castiglia, D. & Odorisio, T. Pathomechanisms of Altered Wound Healing in Recessive Dystrophic Epidermolysis Bullosa. Am J Pathol 187, 1445-1453 (2017). 72. Dingermann, T. Recombinant therapeutic proteins: production platforms and challenges. Biotechnol J 3, 90-97 (2008). 73. Woodley, D.T. et al. Injection of recombinant human type VII collagen restores collagen function in dystrophic epidermolysis bullosa. Nat Med 10, 693-695 (2004). 74. Remington, J. et al. Injection of recombinant human type VII collagen corrects the disease phenotype in a murine model of dystrophic epidermolysis bullosa. Mol Ther 17, 26-33 (2009). 75. Hovnanian, A. Systemic protein therapy for recessive dystrophic epidermolysis bullosa: how far are we from clinical translation? J Invest Dermatol 133, 1719-1721 (2013). 76. Woodley, D.T. et al. Intravenously injected recombinant human type VII collagen homes to skin wounds and restores skin integrity of dystrophic epidermolysis bullosa. J Invest Dermatol 133, 1910-1913 (2013). 77. Rheinwald, J.G. & Green, H. Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell 6, 331-343 (1975). 78. Green, H., Kehinde, O. & Thomas, J. Growth of cultured human epidermal cells into multiple epithelia suitable for grafting. Proc Natl Acad Sci U S A 76, 5665- 5668 (1979). 79. Verplancke, P., Beele, H., Monstrey, S. & Naeyaert, J.M. Treatment of dystrophic epidermolysis bullosa with autologous meshed split-thickness skin grafts and allogeneic cultured keratinocytes. Dermatology 194, 380-382 (1997). 80. McGrath, J.A. et al. Cultured keratinocyte allografts and wound healing in severe recessive dystrophic epidermolysis bullosa. J Am Acad Dermatol 29, 407-419 (1993). 81. Woodley, D.T. et al. Normal and gene-corrected dystrophic epidermolysis bullosa fibroblasts alone can produce type VII collagen at the basement membrane zone. J Invest Dermatol 121, 1021-1028 (2003). 82. Goto, M. et al. Fibroblasts show more potential as target cells than keratinocytes in COL7A1 gene therapy of dystrophic epidermolysis bullosa. J Invest Dermatol 126, 766-772 (2006). 83. Wong, T. et al. Potential of fibroblast cell therapy for recessive dystrophic epidermolysis bullosa. J Invest Dermatol 128, 2179-2189 (2008). 84. Jacków, J. et al. Gene-Corrected Fibroblast Therapy for Recessive Dystrophic Epidermolysis Bullosa using a Self-Inactivating COL7A1 Retroviral Vector. J Invest Dermatol 136, 1346-1354 (2016). 85. Kern, J.S. et al. Mechanisms of fibroblast cell therapy for dystrophic epidermolysis bullosa: high stability of collagen VII favors long-term skin integrity. Mol Ther 17, 1605-1615 (2009). 86. Uitto, J. Cell-based therapy for RDEB: how does it work? J Invest Dermatol 131, 1597-1599 (2011). 87. Grunebaum, E. et al. Bone marrow transplantation for severe combined immune deficiency. JAMA 295, 508-518 (2006).

34 Introduction

88. Wagner, J.E. et al. Bone marrow transplantation for recessive dystrophic epidermolysis bullosa. N Engl J Med 363, 629-639 (2010). 89. Tolar, J. & Wagner, J.E. Allogeneic blood and bone marrow cells for the treatment of severe epidermolysis bullosa: repair of the extracellular matrix. Lancet 382, 1214-1223 (2013). 90. Tamai, K. & Uitto, J. Stem Cell Therapy for Epidermolysis Bullosa-Does It Work? J Invest Dermatol 136, 2119-2121 (2016). 91. Gostynska, K.B. et al. Allogeneic Haematopoietic Cell Transplantation for Epidermolysis Bullosa: the Dutch Experience. Acta Derm Venereol 99, 347- 348 (2019). 92. Ganier, C. et al. Intradermal Injection of Bone Marrow Mesenchymal Stromal Cells Corrects Recessive Dystrophic Epidermolysis Bullosa in a Xenograft Model. J Invest Dermatol 138, 2483-2486 (2018). 93. Conget, P. et al. Replenishment of type VII collagen and re-epithelialization of chronically ulcerated skin after intradermal administration of allogeneic mesenchymal stromal cells in two patients with recessive dystrophic epidermolysis bullosa. Cytotherapy 12, 429-431 (2010). 94. Petrof, G., Martinez-Queipo, M., Mellerio, J.E., Kemp, P. & McGrath, J.A. Fibroblast cell therapy enhances initial healing in recessive dystrophic epidermolysis bullosa wounds: results of a randomized, vehicle-controlled trial. Br J Dermatol 169, 1025-1033 (2013). 95. Kaufmann, K.B., Büning, H., Galy, A., Schambach, A. & Grez, M. Gene therapy on the move. EMBO Mol Med 5, 1642-1661 (2013). 96. Krueger, G.G. et al. Genetically modified skin to treat disease: potential and limitations. J Invest Dermatol 103, 76S-84S (1994). 97. Gorell, E., Nguyen, N., Lane, A. & Siprashvili, Z. Gene therapy for skin diseases. Cold Spring Harb Perspect Med 4, a015149 (2014). 98. Pfützner, W. & Vogel, J.C. Advances in skin gene therapy. Expert Opin Investig Drugs 9, 2069-2083 (2000). 99. Scheller, E.L. & Krebsbach, P.H. Gene therapy: design and prospects for craniofacial regeneration. J Dent Res 88, 585-596 (2009). 100. Chira, S. et al. Progresses towards safe and efficient gene therapy vectors. Oncotarget 6, 30675-30703 (2015). 101. Cox, D.B., Platt, R.J. & Zhang, F. Therapeutic genome editing: prospects and challenges. Nat Med 21, 121-131 (2015). 102. Lundstrom, K. Viral Vectors in Gene Therapy. Diseases 6 (2018). 103. Wu, W. et al. Efficient in vivo gene editing using ribonucleoproteins in skin stem cells of recessive dystrophic epidermolysis bullosa mouse model. Proc Natl Acad Sci U S A 114, 1660-1665 (2017). 104. Bonafont, J. et al. Clinically Relevant Correction of Recessive Dystrophic Epidermolysis Bullosa by Dual sgRNA CRISPR/Cas9-Mediated Gene Editing. Mol Ther 27, 986-998 (2019). 105. Nayerossadat, N., Maedeh, T. & Ali, P.A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res 1, 27 (2012). 106. Cutlar, L. et al. Highly Branched Poly(β-Amino Esters): Synthesis and Application in Gene Delivery. Biomacromolecules 16, 2609-2617 (2015). 107. Hardee, C.L., Arévalo-Soliz, L.M., Hornstein, B.D. & Zechiedrich, L. Advances in Non-Viral DNA Vectors for Gene Therapy. Genes (Basel) 8 (2017).

35 Introduction

108. Chen, M. et al. Restoration of type VII collagen expression and function in dystrophic epidermolysis bullosa. Nat Genet 32, 670-675 (2002). 109. Woodley, D.T. et al. Intradermal injection of lentiviral vectors corrects regenerated human dystrophic epidermolysis bullosa skin tissue in vivo. Mol Ther 10, 318-326 (2004). 110. Titeux, M. et al. SIN retroviral vectors expressing COL7A1 under human promoters for ex vivo gene therapy of recessive dystrophic epidermolysis bullosa. Mol Ther 18, 1509-1518 (2010). 111. Siprashvili, Z. et al. Safety and Wound Outcomes Following Genetically Corrected Autologous Epidermal Grafts in Patients With Recessive Dystrophic Epidermolysis Bullosa. Jama 316, 1808-1817 (2016). 112. Georgiadis, C. et al. Lentiviral Engineered Fibroblasts Expressing Codon- Optimized COL7A1 Restore Anchoring Fibrils in RDEB. J Invest Dermatol 136, 284-292 (2016). 113. Lwin, S.M. et al. Safety and early efficacy outcomes for lentiviral fibroblast gene therapy in recessive dystrophic epidermolysis bullosa. JCI Insight 4 (2019). 114. Bruckner-Tuderman, L. Skin Fragility: Perspectives on Evidence-based Therapies. Acta Derm Venereol 100, adv00053 (2020). 115. Prodinger, C., Reichelt, J., Bauer, J.W. & Laimer, M. Epidermolysis bullosa: Advances in research and treatment. Exp Dermatol 28, 1176-1189 (2019). 116. Molina, R.M., G. and Prieto, J. in Encyclopedia of Life Sciences (2011). 117. Maeder, M.L. & Gersbach, C.A. Genome-editing Technologies for Gene and Cell Therapy. Mol Ther 24, 430-446 (2016). 118. Lomova, A. et al. Improving Gene Editing Outcomes in Human Hematopoietic Stem and Progenitor Cells by Temporal Control of DNA Repair. Stem Cells 37, 284-294 (2019). 119. Smith, J. et al. A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences. Nucleic Acids Res 34, e149 (2006). 120. Epinat, J.C. et al. A novel engineered meganuclease induces homologous recombination in yeast and mammalian cells. Nucleic Acids Res 31, 2952- 2962 (2003). 121. J., C. et al. in Assay Guidance Manual (2017). 122. Kim, H. & Kim, J.S. A guide to genome engineering with programmable nucleases. Nat Rev Genet 15, 321-334 (2014). 123. Pattanayak, V., Guilinger, J.P. & Liu, D.R. Determining the specificities of TALENs, Cas9, and other genome-editing enzymes. Methods Enzymol 546, 47- 78 (2014). 124. Deng, D. et al. Structural basis for sequence-specific recognition of DNA by TAL effectors. Science 335, 720-723 (2012). 125. Kim, Y. et al. A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31, 251-258 (2013). 126. Makarova, K.S. et al. An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol 13, 722-736 (2015). 127. Mojica, F.J.M., Diez-Villasenor, C., Garcia-Martinez, J. & Almendros, C. Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology 155, 733-740 (2009). 128. Wiedenheft, B., Sternberg, S.H. & Doudna, J.A. RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331-338 (2012).

36 Introduction

129. Jinek, M. et al. RNA-programmed genome editing in human cells. Elife 2, e00471 (2013). 130. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). 131. Ran, F.A. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308 (2013). 132. Wang, H. et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918 (2013). 133. Ding, Q. et al. Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circ Res 115, 488-492 (2014). 134. Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87 (2014). 135. Cheong, T.C., Compagno, M. & Chiarle, R. Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system. Nat Commun 7, 10934 (2016). 136. Razzouk, S. CRISPR-Cas9: A cornerstone for the evolution of precision medicine. Ann Hum Genet 82, 331-357 (2018). 137. Ran, F.A. et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature 520, 186-191 (2015). 138. Kim, S., Kim, D., Cho, S.W., Kim, J. & Kim, J.S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res 24, 1012-1019 (2014). 139. Baylis, F. & McLeod, M. First-in-human Phase 1 CRISPR Gene Editing Cancer Trials: Are We Ready? Curr Gene Ther 17, 309-319 (2017). 140. Bak, R.O., Gomez-Ospina, N. & Porteus, M.H. Gene Editing on Center Stage. Trends Genet 34, 600-611 (2018). 141. Zetsche, B. et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759-771 (2015). 142. Qi, L.S. et al. Repurposing CRISPR as an RNA-guided platform for sequence- specific control of gene expression. Cell 152, 1173-1183 (2013). 143. Larson, M.H. et al. CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat Protoc 8, 2180-2196 (2013). 144. Hilton, I.B. & Gersbach, C.A. Enabling functional genomics with genome engineering. Genome Res 25, 1442-1455 (2015). 145. Chen, B. et al. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491 (2013). 146. Ma, H. et al. Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A 112, 3002-3007 (2015). 147. Dever, D.P. et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature 539, 384-389 (2016). 148. Gaj, T. et al. Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery. Nucleic Acids Res 45, e98 (2017). 149. Porteus, M.H., Cathomen, T., Weitzman, M.D. & Baltimore, D. Efficient gene targeting mediated by adeno-associated virus and DNA double-strand breaks. Mol Cell Biol 23, 3558-3565 (2003).

37 Introduction

150. Martin, R.M. et al. Highly Efficient and Marker-free Genome Editing of Human Pluripotent Stem Cells by CRISPR-Cas9 RNP and AAV6 Donor-Mediated Homologous Recombination. Cell Stem Cell 24, 821-828 e825 (2019). 151. Balakrishnan, B. & Jayandharan, G.R. Basic biology of adeno-associated virus (AAV) vectors used in gene therapy. Curr Gene Ther 14, 86-100 (2014). 152. Hastie, E. & Samulski, R.J. Adeno-associated virus at 50: a golden anniversary of discovery, research, and gene therapy success--a personal perspective. Hum Gene Ther 26, 257-265 (2015). 153. March, O.P., Kocher, T. & Koller, U. Context-Dependent Strategies for Enhanced Genome Editing of Genodermatoses. Cells 9 (2020). 154. Aushev, M., Koller, U., Mussolino, C., Cathomen, T. & Reichelt, J. Traceless Targeting and Isolation of Gene-Edited Immortalized Keratinocytes from Epidermolysis Bullosa Simplex Patients. Mol Ther Methods Clin Dev 6, 112- 123 (2017). 155. Luan, X.R. et al. CRISPR/Cas9-Mediated Treatment Ameliorates the Phenotype of the Epidermolytic Palmoplantar Keratoderma-like Mouse. Mol Ther Nucleic Acids 12, 220-228 (2018). 156. Shinkuma, S., Guo, Z. & Christiano, A.M. Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa. Proc Natl Acad Sci U S A 113, 5676-5681 (2016). 157. March, O.P. et al. Gene Editing-Mediated Disruption of Epidermolytic Ichthyosis-Associated KRT10 Alleles Restores Filament Stability in Keratinocytes. J Invest Dermatol 139, 1699-1710 e1696 (2019). 158. Mencia, A. et al. Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells. Mol Ther Nucleic Acids 11, 68-78 (2018). 159. Takashima, S. et al. Efficient Gene Reframing Therapy for Recessive Dystrophic Epidermolysis Bullosa with CRISPR/Cas9. J Invest Dermatol 139, 1711-1721 e1714 (2019).

38 Research aims and Objectives

Research aims and Objectives

Despite the effort, there is no curative treatment available for RDEB patients. The aggressiveness of this disease and the high prevalence of a frame-shift mutation (c.6527insC) in the Spanish population justify the development of advanced and efficacious therapies for these patients.

For this reason, the main goal of this doctoral thesis is the development of efficient and safe gene therapy protocols for genetically-correct RDEB epidermal stem cells able to restore dermal-epidermal adhesion when transplanted onto patients.

This overall objective can be divided into three main strategies (corresponding to the three different chapters of this thesis):

1. Clonal gene editing-based strategy for c.6527insC correction in RDEB primary keratinocytes 1.1. TALENs optimization protocol for primary keratinocytes transduction 1.2. Epidermal stem cell clone isolation and genotyping 1.3. Functional characterization and evaluation of skin regeneration potential

2. Highly efficient gene editing-based approach for exon 80 deletion in RDEB primary keratinocytes 2.1. CRISPR/Cas9 system design and delivery optimization into primary cells 2.2. Functional characterization and biosafety profile 2.3. In vivo evaluation of the skin regeneration potential of a polyclonal gene edited- primary RDEB keratinocytes population

3. Precise gene-editing based approach for RDEB-causing mutations correction in RDEB primary keratinocytes 3.1. CRISPR/Cas9 system optimization and AAV design and production 3.2. Optimization of an HDR-based protocol for keratinocytes genome editing 3.3. Functional characterization of the bulk edited primary cells

39

40 Chapter 1

Chapter 1

Deletion of a pathogenic mutation-containing exon of COL7A1 allows clonal gene editing correction of RDEB patient epidermal stem cells

The data presented in the following chapter was published in Molecular Therapy – Nucleic Acids in January 2018 (DOI: 10.1016/j.omtn.2018.01.009)

Ángeles Mencía*, Cristina Chamorro*, Jose Bonafont, Blanca Duarte, Almudena Holguin, Nuria Illera, Sara G Llames, Maria José Escámez, Ingrid Hausser, Marcela Del Río, Fernando Larcher, Rodolfo Murillas

41

42 Chapter 1

Deletion of a pathogenic mutation-containing exon of COL7A1 allows clonal gene editing correction of RDEB patient epidermal stem cells

Ángeles Mencía*1,7, Cristina Chamorro*2,6, Jose Bonafont2,6, Blanca Duarte1,6,7, Almudena Holguin1,6,7, Nuria Illera1, Sara G Llames7, Maria José Escámez7, Ingrid Hausser5, Marcela Del Río2,6,7, Fernando Larcher1,2,6,7 , Rodolfo Murillas1,6,7 1Epithelial Biomedicine Division, Centro de Investigaciones Energéticas Medioambientales y Tecnológicas (CIEMAT), Madrid. Spain. 2Department of Biomedical Engineering, Carlos III University (UC3M) Madrid. Spain. 3Center for Molecular Medicine Cologne (CMMC), University of Cologne, Germany. 4Institute of Experimental Hematology, Hannover Medical School, Germany. 5Institute of Pathology, Universitätsklinikum Heidelberg, Germany. 6Instituto de Investigación Sanitaria de la Fundación Jiménez Díaz, Madrid. Spain. 7Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER) U714, Madrid. Spain.

*these authors contributed equally to this work

Correspondence: Dr R Murillas and Dr F Larcher, Epithelial Biomedicine Division, Cutaneous Disease Modelling Unit, CIEMAT-CIBERER (Centre for Biomedical Research on Rare Diseases) U714, Avenida Complutense 40, Madrid 28040, Spain. email: [email protected]; [email protected]

Short title: COL7A1 editing in epidermal stem cell clones.

43 Chapter 1

1. Abstract

Recessive dystrophic epidermolysis bullosa is a severe skin fragility disease caused by loss of functional type VII collagen at the dermal-epidermal junction. A frameshift mutation in exon 80 of COL7A1 gene, c.6527insC, is highly prevalent in the Spanish patient population. We have implemented gene editing strategies for COL7A1 frame restoration by NHEJ-induced indels in epidermal stem cells from patients carrying this mutation. TALEN nucleases designed to cut within the COL7A1 exon 80 sequence were delivered to primary patient keratinocyte cultures by non-integrating viral vectors. After genotyping a large collection of vector-transduced patient keratinocyte clones with high proliferative potential, we identified a significant percentage of clones with COL7A1 reading frame recovery and Collagen VII protein expression. Skin equivalents generated with cells from a clone lacking exon 80 entirely were able to regenerate phenotypically normal human skin upon their grafting onto immunodeficient mice. These patient- derived human skin grafts showed Collagen VII deposition at the basement membrane zone, formation of anchoring fibrils and structural integrity when analyzed twelve weeks after grafting. Our data provide a proof-of-principle for recessive dystrophic epidermolysis bullosa treatment through ex vivo gene editing based on removal of pathogenic mutation-containing, functionally expendable COL7A1 exons in patient epidermal stem cells.

44 Chapter 1

2. Introduction

Recessive dystrophic epidermolysis bullosa (RDEB) is a severe skin fragility disease caused by loss of function mutations in COL7A1, a gene expressed by keratinocytes and fibroblasts that encodes type VII collagen (C7), the main constituent of the anchoring fibrils necessary for adhesive connection between the dermis and the epidermal basement membrane zone (BMZ). C7 deficiency results in severe and recurrent blistering of the skin and other stratified epithelia, scarring and highly increased risk for development of metastatic squamous cell carcinoma.53 Ex-vivo gene therapy strategies for epidermolysis bullosa, including junctional epidermolysis bullosa and RDEB, based on transplantation of retroviral vector-modified keratinocyte sheets are already in a clinical stage with promising results.108, 156-158 Also, an approach using graftable bioengineered skin equivalents containing RDEB fibroblasts and keratinocytes corrected by means of a SIN- retroviral vector will soon be tested in patients.159 However, although gene addition tackles the wide range of disease-causing mutations, retroviral vector-based gene transfer poses biosafety concerns including inaccurate spatial-temporal gene expression and potential genotoxicity risks. Moreover, the efficacy of retroviral vectors for the long-term correction of autologous skin grafts is not clearly established yet.108 Thus, gene therapy protocols for monogenic disease correction are moving from retroviral vector–based gene replacement to more precise gene editing approaches for highly specific interventions on the defective gene at DNA and RNA levels. Experimental demonstrations of gene editing approaches for RDEB therapy have included protocols based on patient-derived iPS cells152, 160, 161 and direct correction of patient keratinocytes ex-vivo by homology directed repair (HDR)40, 162, 163 and non- homologous end joining (NHEJ) strategies.40 “Skipping” of pathogenic mutation- containing exons has been proven an efficient strategy for the correction of hereditary diseases caused by mutations in genes coding for proteins with long, repetitive structural domains. The best characterized case and proof of principle for exon skipping therapy is dystrophin gene reading frame recovery by modulation of its pre-mRNA splicing with synthetic antisense oligonucleotides (AON) in Duchenne muscular dystrophy (DMD) muscle cells. Truncated dystrophin proteins lacking the sequence encoded by the skipped mutation-containing exons are partially functional, thus having the potential to shift the phenotype from severe to mild.164 A similar AON-based exon-skipping approach has been recently described for recessive RDEB.43, 165-167 COL7A1 is especially amenable to

45 Chapter 1

exon-skipping correction strategies since all exons encoding the triple helix forming region, essential for the structural function of C7, are small, in frame and encode Gly-X-Y repeats. The functionality of internally deleted Collagen VII variants lacking sequences encoded by specific collagenous domain exons has been demonstrated.43, 166 However, despite advances to increase their stability and the feasibility of in vivo applications, AONs can only promote transient masking of splicing motifs and therefore allow for temporary correction of the genetic defect. Permanent exon skipping-mediated gene repair can be achieved by introducing changes in the DNA sequence to eliminate intron splicing motifs or exonic sequences altogether. Highly specific programmable nucleases are able to generate DNA double strand breaks in the proximity of the pathogenic mutation sequence, that are resolved by the NHEJ DNA repair system, frequently leading to the introduction of insertion and deletion (indel) mutations. This NHEJ-mediated strategy was originally implemented for the ex vivo correction of DMD patient muscular cells168, 169 and later demonstrated by our laboratory for the successful correction of RDEB patient-derived keratinocytes.40 It has also proved feasible for the in vivo correction of DMD170-172 and RDEB in experimental mouse models when CRISPR/Cas9 were delivered by AAV vectors or as RNP particles.100 Stringent biosafety standards, a necessary requirement for the implementation of gene therapy protocols, can be conceived by performing accurate genotyping and genomic characterization of gene-modified single epidermal stem cell clones with the potential to regenerate gene-corrected skin.173-175 The feasibility of clonal-based therapy with gene- targeted epidermal stem cells has been previously established by our laboratory with the demonstration that long-term skin regeneration from a human epidermal stem cell clone carrying a targeted integration of a marker gene at the AAVS1 locus can be attained.174, 175 However, although studies in immortalized RDEB keratinocytes showed the feasibility of the approach,40, 163 clonal therapy for RDEB based on isolation of epidermal stem cells modified by gene editing protocols to re-establish production of functional C7 has not yet been achieved. With the aim of developing a gene editing-based therapy specifically tailored to the c.6527insC mutation in exon 80 of the COL7A1 gene,22 highly prevalent in the Spanish RDEB patient population,38 we have previously delivered TALEN nucleases by adenoviral vectors able to introduce small deletions in the exon 80 of COL7A1 gene that resulted in exon 80 skipping.40 Using these tools, and after thorough analysis of a large collection of RDEB patient keratinocyte clones, we have now achieved long term skin

46 Chapter 1

regeneration from several NHEJ-mediated COL7A1 gene frame-restored clones, including a single epidermal stem cell clone with permanent exon deletion-based RDEB correction.

3. Results

3.1. Transduction of primary RDEB keratinocytes with Ad- Talens. Isolation and genotyping of keratinocyte clones carrying corrective indels in COL7A1 exon 80.

Primary keratinocytes from RDEB patients previously characterized as homozygous carriers for the highly prevalent c.6527insC COL7A1 mutation38 were infected with adenoviral vectors for the expression of TALEN nucleases T6/T7,40 specific for COL7A1 exon 80 (Figure. 1A). Different multiplicities of infection (MOI) were assessed to establish the optimal conditions for indel generation in primary RDEB keratinocytes, as determined by Cel I analysis. A MOI of 300 was the lowest to yield high indel generation (Figure 1B) without noticeable reduction in cell viability. Cells from two different patients (P1 and P2) infected at optimized conditions, were split at low density to isolate individual clones. Genotyping of clones was performed by sequencing a PCR amplicon spanning the nuclease target site. In the first experiment using cells from P1, 22 keratinocyte clones were isolated and genotyped, 2 of which (clones 11 and 40) carried a 1 nucleotide (guanine) deletion allele, c.6512delG (named as ΔG) at the TALENs target site, corresponding to the most frequent deletion detected in our previous editing experiments with immortalized RDEB keratinocytes40 using the same TALEN nucleases pair (Experiment 1, Figure 1C). The other 20 clones in this experiment were unmodified, presenting the c.6527insC allele sequence. Previously, we showed that the ΔG deletion resulted in a frame shift leading to frame restoration in c.6527insC COL7A1 mutation- bearing RDEB keratinocytes, causing the expression of a variant transcript encoding a four aminoacids substitution in C7.40 Transcripts encoding this C7 variant were also found in P1 clones 11 and 40 when COL7A1 expression was analyzed by sequencing RT- PCR products spanning exons 78 to 84 (Supplementary Figure S1A and B). When the experiment was repeated using cells from P2, a larger collection of keratinocyte clones were isolated and expanded, which allowed us to screen a broader spectrum of indels. In this experiment, 14 out of 125 clones analyzed carried indels and

47 Chapter 1

the ΔG one base-pair (bp) deletion was again the most commonly found (8 clones). In addition, one clone with a different frame-restoring 1 bp deletion, 4 clones carrying non- correcting mutations and one clone (clone 19) with a 114 bp deletion entirely encompassing exon 80 were identified (Experiment 2, Figure 1C). All the other clones were unmodified c.6527insC homozygous carriers.

Figure 1. Indel generation with TALEN nucleases in primary RDEB patient keratinocytes. (A) TALEN pair T6/T7 targets the 5’ region of COL7A1 exon 80 sequence (upper case) in the vicinity of the c.6527insC

48 Chapter 1

mutation (red arrowhead). TALEN spacer sequence is shaded. Intron sequences are in blue lower case. (B) The PCR product comprising the T6/T7 target site was analyzed with Surveyor (Cel I) mutation detection assay to establish optimal multiplicity of infection (MOI) in patient keratinocytes infected with adenoviral vectors for T6/T7 TALENs expression. Solid arrowhead indicates uncleaved DNA, arrowheads indicate cleavage fragments. Percentage of cleavage for each PCR product is shown at the bottom. M is IX molecular weight marker. (C) Indel spectrum in keratinocytes from RDEB patients 1 (experiment 1) and 2 (experiment 2) transduced with Ad-T6/T7 vectors. Two out 22 clones in experiment 1 and 14 out of 125 clones in experiment 2 carried indel alleles at the TALENs target site. The number of clones containing each indel is shown on the right. Intron sequences are in blue lower case letters. Double slash marks represent DNA sequences that are not shown.

Analysis of the sequence chromatograms of PCR products spanning the TALENs target site revealed that clone 11 carried one ΔG deletion allele while clone 40 was biallelically modified for this mutation (Figure 2A). A careful analysis of the chromatogram for clone 19 revealed multiple overlapping traces corresponding to different COL7A1 alleles. Therefore, the PCR product for clone 19 was TA-cloned and individual colonies were sequenced, revealing the presence of three alleles: c.6527insC (pathogenic mutation, unedited), c.6502-39_6537+46del113 (114 bp deletion, encompassing exon 80 entirely) and c.6503_6511del9 (9 bp deletion) (Figure 2B). The 9 bp deletion found in the c.6503_6511del9 allele was within the exon 80 sequence and not consistent with COL7A1 frame restoration. Immunofluorescence analysis of ΔG deletion-carrying clones 11 and 40 using an anti-human C7 monospecific polyclonal antibody43 showed strong and homogeneous C7 staining (Figure 2C upper panels). In contrast, and consistent with the presence of 3 different COL7A1 alleles, immunofluorescence analysis of clone 19 revealed the presence of C7-positive and negative cells (Figure 2C, lower right panel) in similar proportions, indicating that this clone may be comprised of a bi-clonal population. A clone from experiment 2 that did not contain any indels (clone 31) was used as a negative staining control (Figure 2C, lower left panel).

49 Chapter 1

Figure 2. Genotypes of RDEB patient keratinocyte clones carrying different frame-restoring indels and Collagen VII expression analysis. (A) Sanger sequencing chromatograms of PCR products spanning the TALENs target site show the 1 bp ΔG deletion in one COL7A1 allele (clone 11, upper chromatogram) or in both (clone 40, lower chromatogram). The exon 80 sequence is shown in the red box. (B) Chromatograms corresponding to individual colonies of the TA-cloned PCR product for clone 19 showed three different alleles: unedited (upper), 9 bp deletion (Δ9, middle) and 114 bp deletion (Δ114, lower). (C) Immunofluorescence staining with anti C7 antibody showed C7 expression in approximately half of the cells in clone 19 and in all cells from clones 11 and 40.

50 Chapter 1

3.2. Isolation and characterization of pure clones from clone 19 mixed population.

To isolate pure keratinocyte clones carrying the exon 80-excising 114 bp deletion allele, limiting dilution subculture of the clone 19-mixed population was performed. C7 immunofluorescence analysis showed that, in contrast to the mixed C7-positive and negative pattern found in parental clone 19 mixed population, all cells in each keratinocyte subclone were either completely positive or negative for C7 staining. Two C7-expressing clones with proliferative potential, named as 19.3 and 19.C, and one C7- negative clone, named as 19n, were expanded for further experimentation (Figure 3A). PCR analysis with primers spanning the 114 bp deletion revealed that, for clones 19.3 and 19.C, the higher and lower molecular weight bands, whose mobility corresponds to the undeleted (black arrowhead) and deleted (red arrowhead) alleles respectively, were of comparable intensity, unlike in the parental clone 19. For the C7-negative clone 19n only the higher molecular weight band was detected (Figure 3B). The intermediate molecular weight band detected in all C7-expressing clones (19, 19.3 and 19.C) most likely corresponds to heteroduplex DNA formation between deleted and undeleted alleles, as previously reported for PCR genotyping of cells carrying deletion alleles in other genes.176 177 Furthermore, the Sanger sequencing chromatogram of PCR products for clones 19.3 and 19.C showed overlapping traces corresponding exclusively to c.6527insC (unmodified) and c.6502-39_c.6537+46del113 (114 bp deletion, ΔE80) alleles. These PCR products were cloned in a plasmid vector and individual colonies were sequenced to unequivocally verify the presence of both alleles (Figure 3C). The c.6503_6511del9 (9 bp deletion) allele was not found in these clones, showing that this allele was present in the cellular sub-population that was segregated from clones 19.3 and 19.C by subcloning. Consistently, genotyping of C7-negative clone 19n revealed the presence of overlapping chromatograms for the c.6527insC (unmodified) and c.6503_6511del9 (9 bp deletion) alleles in these cells (Supplementary Figure S2).

51 Chapter 1

Figure 3. Isolation and characterization of pure clones from clone 19 mixed population. (A) C7 immunofluorescence analysis of subclones 19n, 19.3 and 19.C obtained by limiting dilution subculture of clone 19 mixed population. Scale bar: 20 µm. (B) PCR analysis for the detection of the 114 bp deletion in clone 19 and corresponding subclones 19.3, 19.C and 19n. Undeleted (black arrowhead) and deleted (red arrowhead) alleles could be detected using primers spanning the deletion region. P2 genomic DNA from patient 2 keratinocytes was used as a control for amplification of the unedited allele. (-) is a negative control without DNA. M is IX molecular weight marker (C) Sanger sequencing of TA- cloned PCR products demonstrated the presence of exclusively the unedited (upper chromatogram) and 114 bp deletion (Δ114, lower chromatogram) alleles in clones 19.3 and 19.C. Exon 80 sequence shown in red box. Black lines depict deletion boundaries.

52 Chapter 1

To assess the specificity of TALENs activity, we identified genomic sites with the potential for off-target cleavage by using the PROGNOS software that ranks sites according to number of mismatches relative to the intended target sequence and RVD- nucleotide binding frequencies. 178 The presence of indel mutations was assessed by performing CelI analysis of PCR products containing these putative off-target cleavage sites, amplified from genomic DNA of clones containing the 114 bp exon 80 deletion (19, 19.3 and 19.C). Thirteen of the highest scoring off-target sites, located in loci different to COL7A1 gene were analyzed. In addition, seven lower scoring sites located within the COL7A1 gene were scrutinized (Supplementary Table 1) because of the potential detrimental effect of mutations introduced at these sites on our gene repair strategy. No nuclease off-target cleavage activity was detected in this analysis (Supplementary Figure S3). Since the 114 bp deletion completely eliminates the exon 80 of COL7A1 gene, expression analyses were performed in mixed clone 19 and subclones 19.3 and 19.C to study the presence of gene transcripts lacking the exon 80-encoded sequence, and therefore with restored open reading frame. RT-PCR analysis of RNA samples from clones 19, 19.3 and 19.C produced bands with a molecular weight corresponding to the unedited (Figure 4A, black arrowhead) and exon 80-deleted (red arrowhead) alleles. In pure clones 19.3 and 19.C, the smaller molecular weight band corresponding to a shortened, frame-restored transcript lacking the exon 80 sequence was more intense than the higher molecular weight band corresponding to the out of frame transcript generated from the unedited allele, which might be due to increased stability of the exon 80-deleted transcript. To verify that the 114 bp deletion resulted in splicing of COL7A1 pre-mRNA such that exons 79 and 81 are joined together, the PCR products were TA-cloned and sequenced, revealing transcripts lacking the exon 80-encoded sequence (Figure 4B) in clones 19, 19.3 and 19.C. Transcripts containing the c.6527insC mutation encoded in the unedited allele were also found for all three clones. In addition, transcripts originating from the 9 bp deletion allele, that was not conducive to frame restoration, were found in mixed clone 19 but not in 19.3 and 19.C clones. To quantify the expression of edited and unedited alleles in these clones, quantitative Real-Time PCR (qPCR) was performed using two probes, one recognizing the COL7A1 exon 64 sequence (probe Ex64) and therefore detecting transcripts produced by both the edited and unedited alleles, and other recognizing exon 80 sequence that will detect only transcription from the unedited, exon 80 sequence-containing allele (probe Ex80). For all three clones, COL7A1 expression was

53 Chapter 1

higher with Ex64 probe than with Ex80 probe, proving that most of COL7A1 transcription in these gene edited clones originates from the edited allele lacking the exon 80 sequence (Figure 4C). C7 protein expression in keratinocyte clones was analyzed by Western blotting (WB) using an anti-human C7 monospecific polyclonal antibody.43 The amount of C7 in gene edited clones was comparable to that found in an unaffected patient sibling heterozygous for the null mutation (P2s) and somewhat lower than in normal human keratinocytes (Figure 4D). Interestingly, higher C7 expression was found in gene edited clone 61, isolated in the experiment with patient P2 cells and carrying the ΔG, 1 bp deletion allele that results in COL7A1 frame restoration but causes a predicted 4 aminoacid change (i.e. Gly-Pro-Arg-Gly to Val-Gln-Glu-Ala), disrupting the Gly-X-Y pattern characteristic of the triple helix forming domain.40 Similarly, increased amounts of C7, compared to normal human keratinocytes, were found in clones 11 (monoallelic for G deletion) and 40 (biallelic for ΔG deletion), isolated in the experiment with patient P1 cells, by Western blot (Supplementary Figure S1C). Increased C7 might be explained by intracellular retention of the protein due to hindered secretion caused by defective triple-helix formation.

54 Chapter 1

Figure 4. COL7A1 gene expression analysis in frame-restored clones. (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241 bp band (black arrowhead) corresponding to wild type/c.6527insC unedited transcripts was amplified from all RNA samples (left panel). In addition, a 205 bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3 and 19.C. M is IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (-), negative control without cDNA. GAPDH expression was analyzed as a loading control (right panel). (B) TA-cloned RT-PCR products from clones 19, 19.3 and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon-80 containing transcripts (Ex80).(D) Western blot

55 Chapter 1

analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114 bp deletion allele; 61, clone from P2 carrying the ΔG, 1 bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

3.3. In vivo skin regeneration with frame-restored clones: C7 deposition and functional analysis.

To evaluate the functional effect of C7 expression recovery either by COL7A1 frame restoration by a 1 bp deletion that resulted in a 4 aminoacids substitution (clones 11 and 40) (Figure 5A) or exon 80 deletion (clones 19 and 19.C) (Figure 6A), skin equivalents prepared with keratinocytes from the different clones and C7 null fibroblasts were grafted onto immunodeficient mice. The dermal-epidermal adhesion phenotype and C7 deposition at the BMZ was analyzed twelve weeks after grafting, a time point indicative of long-term skin regeneration. Skin engraftment occurred for the 4 clones and, macroscopically, the regenerated skin appeared normal (Figure 5B, C and Figure 6B). However, grafts from clones 11 and 40 showed marked fragility as epidermis was easily separated from the dermis upon mild pulling from the edge of an incision performed on the engrafted human skin using a scalpel (Figure 5D-E and Supplementary Figure S4). On the contrary, skin regenerated from both mixed clone 19 and clone 19.C showed mechanical resistance to the pulling test (Figure 6C).

56 Chapter 1

Figure 5. In vivo skin regeneration from frame-restored patient keratinocyte clones 11 and 40 expressing a C7 variant with a 4 aminoacids substitution. (A) COL7A1 cDNA and C7 aminoacid sequences for WT, c.6527insC (cytosine insertion underlined in red) and ΔG (1 bp deletion, red arrowhead) alleles. Aminoacid substitutions in c.6527insC and G variants are shown in red. (B, C) Macroscopic appearance of human skin (delineated by dotted line) regenerated from clones 11 (B) and 40 (C). (D, E) Dermal-epidermal adhesion test. Detachment of epidermis (blue arrows) occurred after pulling from the edge of an incision on human skin grafts generated from clones 11 (D) and 40 (E). (F, G, H, I) Immunofluorescence staining for the detection of human C7 (green) in grafts sections. In grafts from clones 11 (F) and 40 (G) C7 was retained

57 Chapter 1

within the cytoplasm of keratinocytes in the basal layer of epidermis. In contrast, grafts from normal human keratinocytes display C7 deposition in the BMZ (H). Grafts from unedited patient 2 keratinocytes were used as a negative control for staining (I). Cell nuclei were stained with DAPI (blue). Asterisks denote blisters formed between dermis and epidermis (F,G,I). Scale bar: 50µm.

Immunofluorescence analysis clearly showed C7 expression in grafts from all clones. Interestingly, in grafts from clones 11 (Figure 5F) and 40 (Figure 5G), C7 was not at the BMZ, the physiological location of this protein in skin grafts from normal human keratinocytes (Figure 5H), but it was instead retained within the cytoplasm of basal keratinocytes, indicating a faulty secretion of the C7 variant produced by these cells. In contrast, grafts from clones 19 and 19.C, showed correct C7 deposition at the BMZ zone (Figure 6F) with the same pattern as in grafts generated from normal human keratinocytes (Figure 6G). No C7 staining was found in grafts from unedited patient keratinocytes used as negative controls (Figures 5I and 6H). Blistering was evident in grafts from clones 11 and 40 and in the control graft from unedited patient keratinocytes (Figure 5F, G and I, asterisks). Grafts generated from the mixed clone 19 showed the presence of C7 negative patches likely corresponding to the cells carrying the non- correcting 9 bp deletion and matching blistering foci (Supplementary Figure S5). Epidermal-dermal adhesion and normal epidermal architecture of human skin grafts generated with gene-corrected patient keratinocytes from clone 19.C was verified by histological analysis (Figure 6D). Immunohistochemical staining using an antibody specific for human involucrin showed normal human epidermal differentiation in the skin graft (Figure 6E). Furthermore, ultrastructural analysis of grafts from clone 19.C showed the presence of mature anchoring fibrils (Figure 6I, arrowheads), demonstrating that not only is the C7 protein lacking exon 80-encoded sequence properly produced and secreted but it is also fit for anchoring fibril formation.

58 Chapter 1

Figure 6. In vivo skin regeneration from frame-restored patient keratinocyte clone 19.C expressing a C7 variant lacking the exon 80-encoded sequence. (A) COL7A1 cDNA and C7 aminoacid sequences for WT, c.6527insC and ΔE80 (114 bp deletion) alleles. Aminoacid substitutions in c.6527insC are shown in red. (B) Macroscopic appearance of a representative human skin (delineated by dotted line) regenerated from clone 19.C. (C) Demonstration of dermal-epidermal adhesion in patient skin regenerated from clone 19.C. Firm pulling from the edge of an incision did not cause dermal-epidermal detachment. (D) H&E staining of regenerated patient skin showing epidermal-dermal adhesion and normal epidermal architecture. Scale bar: 100µm. (E) Immunohistochemical staining using an antibody specific

59 Chapter 1

for human involucrin to show normal human epidermal differentiation of the gene-corrected patient skin graft at the mouse (Mo)-human(Hu) skin boundary. Scale bar: 100µm. (F,G,H) Immunofluorescence staining using an antibody specific for human C7 (red). Normal C7 deposition was found along the BMZ of a gene-corrected patient skin graft regenerated from clone 19.C keratinocytes (F) and in normal human keratinocytes positive control graft (G). No C7 staining was found in sections of a negative control graft regenerated from unedited patient 2 keratinocytes (H). Cell nuclei were stained with DAPI (blue). Asterisks denote blistering between dermis and epidermis. Scale bar: 50µm. (I) Electron microscopy analysis showed the presence of mature anchoring fibrils (arrowheads) at the dermal-epidermal junction of gene-corrected patient skin regenerated from clone 19.C keratinocytes. Scale bar: 200nm.

4. Discussion

To achieve the generation of persistent genetically corrected skin grafts with therapeutic potential, targeting epidermal stem cells is necessary. Our laboratory first demonstrated the feasibility of long-term skin regeneration from a single gene targeted epidermal stem cell clone.174 Here we have achieved the ex vivo correction of a genodermatosis by gene editing in patient epidermal stem cells. Previous experimental approaches by our laboratory40 and others160, 162, 163 had delineated protocols for recovery of C7 production in RDEB patient-derived keratinocytes using gene editing strategies. However, since studies based on selection of corrected clones have been performed either on immortalized keratinocyte cell lines,40, 163 patient- derived iPS cell lines160 or polyclonal populations without proven regenerative potential,162 they are still far from having clinical relevance. Moreover, most reported studies have relied on the use of drug selection to achieve correction by still highly inefficient HDR-based protocols.163 We recently established drug selection-free, NHEJ-based exon skipping strategies for highly efficient recovery of C7 expression in RDEB-derived keratinocytes.40 Building upon this foundation, we have generated human skin from a single RDEB patient epidermal stem cell with normal dermal-epidermal adhesion features after recovering the expression of a functional C7 protein variant, lacking the exon 80-encoded fragment, from the endogenous mutant COL7A1 gene. Although this protocol has been developed for RDEB cells harboring a frame-shift mutation in exon 80 of the COL7A1 gene, highly prevalent in the Spanish and latin American RDEB patient population,38, 179 the same strategy can be redeployed for mutations in other exons within COL7A1 collagenous domain. In fact, in vitro translated C7 protein lacking the exon 105-encoded fragment conserved functionality in biochemical assays and promoted skin stability when injected in DEB mice.43 Likewise, RDEB patient keratinocytes transduced with retroviral vectors for expression of C7

60 Chapter 1

variants lacking exons 73 and 80-encoded fragments secreted C7 homotrimers, and skin equivalents generated with these cells displayed restored C7 expression and dermal- epidermal adhesion.166 Although we have made use of previously established TALEN nucleases to facilitate locus-specific gene editing in our protocol, novel CRISPR/Cas9- based protocols will probably render remarkably increased editing efficiencies. This might permit working with polyclonal populations of corrected keratinocytes including gene edited epidermal stem cells, which would be advantageous for the generation of clinically useful skin grafts. Still, monoclonal cellular therapy affords added benefits such as precise genotyping and biosafety characterization of individual clones173, 175 prior to their use for generation of skin grafts, as shown here. However, challenging the proliferative capabilities of individual epidermal stem cells to generate monoclonal grafts adds significant complexity to preclinical protocols. To circumvent this limitation, we have resorted to adding a small molecule inhibitor of Rho- associated kinase (Y-27632) to our keratinocyte cell culture medium, which greatly facilitates isolation and expansion of keratinocyte clones with stem cell features.180 Although we are aware that the use of this reagent in clinical settings might raise some regulatory concerns, the keratinocytes stem cell clones isolated and characterized with our protocol did not display any sign of morphological transformation and rendered histologically normal skin grafts. Under these conditions, we were able to isolate and expand over 100 clones, of which eight per cent showed expression of C7 variants, a proportion similar to that previously found with the immortalized cell line.40 All clones selected for grafting (i.e. clones 11, 40 carrying a faulty COL7A1 frame-restoring indel and the biclonal population 19, carrying a COL7A1 exon 80 deleted allele) showed engraftment and persistence in vivo. Moreover, upon sub-cloning to obtain a monoclonal population with an exon 80-deleted variant (i.e. Clone 19.C), long-term skin regeneration was also achieved. Although different C7 variants can be produced by NHEJ repair leading to COL7A1 frame restoration, not all of them produce functional C7 protein. Skin grafts generated with keratinocytes carrying the 114 bp deletion allele that encoded an exon 80-lacking (ΔE80) variant displayed C7 deposition at the BMZ and dermal-epidermal adhesion. However, frame restoration by a smaller (1 bp) deletion that results in substitution of 4 aminoacids within the exon 80- encoded sequence led to retention of the C7 protein in the basal layer of the epidermis and blister formation in the skin grafts. This suggests that only variants maintaining the

61 Chapter 1

Gly-X-Y pattern in the C7 triple helix-forming domain are appropriately processed and secreted by the keratinocytes and fit for anchoring fibrils formation. Our multiple grafting experiments provide proof of the clinical potential of clonal gene therapy protocols based on the excision of exons containing pathogenic mutations. Conceivably, improved gene editing tools will bring the combined genetic and cellular approach to a higher feasibility level.

62 Chapter 1

5. Materials and methods

5.1. Culture of primary RDEB patient keratinocytes and transduction with Ad- TALENs T6/T7.

Patient keratinocytes were originally obtained from skin biopsies of two RDEB (RDEB- sev gen) patients carrying the c.6527insC homozygous mutation in the COL7A1 gene.38, 181 Clinical features of these patients have been previously described (patients 4 and 9 in Escamez et al).38 Skin biopsies were obtained from patients after approval from the Ethics Committee of the collaborating hospital upon informed consent. Primary human keratinocytes were cultured as previously described.174 Human primary RDEB keratinocytes (from patients P1 and P2) were plated onto lethally irradiated 3T3-J2 cells and cultured in keratinocyte growth cFAD medium, a Dulbecco’s modified Eagle’s medium and Ham’s F12 media mixture (3:1) containing fetal bovine serum (10%), penicillin–streptomycin (1%), glutamine (2%), insulin (5 µg/ml), adenine (0.18 mmol/l), hydrocortisone (0.4 µg/ml), cholera toxin (0.1 nmol/l), triiodothyronine (2 nmol/l), EGF (10 ng/ml) and Y-27632 ROCK inhibitor (Sigma) at 10µM. For viral transduction, cells were trypsinized and infected in suspension with the TALEN-expressing adenoviral vectors (MOI: 300) in the presence of polybrene (8 µg/ml) (Sigma, St Louis, MO). 1x106 transduced keratinocytes were then plated in a 35-mm dish without feeder layer in CnT- 57 (CellnTec, Bern, Switzerland) medium and cultured at 37oC for 24 hours followed by 48 hours at 30oC. Cells were then trypsinized and plated at low density in 100mm plates (103cells/plate) with 2x106 lethally irradiated 3T3 feeder cells per plate, to obtain isolated clones. Cell clones were then collected using polystyrene cloning cylinders (Sigma, St Louis, MO) and expanded for cryopreservation and genomic DNA extraction.

5.2. Cel I (Surveyor) analysis.

Genomic DNA was isolated by isopropanol precipitation of keratinocytes lysates (lysis buffer was Tris pH 8 100 mM, EDTA 5 mM, SDS 0.2%, NaCl 200 mM, 1mg/ml proteinase K (Roche Diagnostics, Mannheim, Germany)) and resuspended in TE buffer. Approximately 100 ng of genomic DNA were used for PCR amplification. PCR fragments spanning the TALENs’ target sites were generated with primers F1/R. F1: 5’- gtgagtggtggctgaagcac-3’; R: 5’-accccaccaaggaaactga-3’. PCR program TD 68-63 was: 94oC for 3 minutes, 5 cycles of 94oC for 30 seconds, 68oC for 30 seconds, 72oC for 45 seconds,

63 Chapter 1

decreasing annealing temperature 1oC every cycle, followed by 30 cycles of 94oC for 30 seconds, 63oC for 30 seconds, 72oC for 45 seconds, then 72oC for 7 minutes. PCR products were subjected to melting and reannealing to yield heteroduplex DNA, digested with Surveyor nuclease (IDT, Iowa, IA) at 42oC for 1 hr, resolved in 1.5% agarose gels and visualized by ethidium bromide staining.

5.3. Genotyping for detection of indel carrying clones.

Genomic DNA isolation and PCR amplification with primers F1/R were performed as described above. PCR products were treated with illustra™ ExoProStar™ (GE Healthcare, UK), sequenced using Big Dye Terminator V.1.1 Cycle Sequencing kit (Thermo Fisher, Waltham, MA), and examined on a 3730 DNA Analyser (Life Technologies, Carlsbad, CA). Chromatograms were analyzed using Sequencher (Gene Codes, Ann Harbor, MI) and Chromas (Technelysium, Australia) software.

5.4. Off-target analysis.

Potential off-target sites were predicted using the PROGNOS software to search the hg19 genome for the TALEN pair targeting the 5'- TGCCCTCTCTATGTAGGGT NN..NN AGGCCCCCCCTGGCCCA -3', using the following RVDs: left:01NN02HD03HD04HD05NG06HD07NG08HD09NG10NI11NG12NN13NG14 NI15NN16NN17NN18NG, right: 01NN02NN03NN04HD05HD06NI07NN08NN09NN10NN11NN12NN13NN14HD1 5HD16NG, allowing up to 6 mismatches in each nuclease half-site and spacing distances between 10 to 28 bp. Homodimers and heterodimers of the nucleases were included in the prediction. Predicted off-target sites (Supplementary Table 1) were PCR amplified using specific primer pairs (Supplementary Table 2) and PCR products were analyzed using the Surveyor kit as described above.

5.5. COL7A1 transcription analysis by RT-PCR and qPCR.

Total RNA was extracted from keratinocytes with miRNeasy Mini Kit (Qiagen, Hilden, Germany), and complementary DNA (cDNA) was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). The following primers: F: 5’- AGGGGTCAGGACGGCAAC -3’ and R: 5’-

64 Chapter 1

CAGCTCCAGTAGGTCCAGTCAG -3’, were used to amplify 241 (unedited) and 205 (exon 80 deleted) bp fragments spanning exons 78-84 of COL7A1. The PCR program was: 94oC for 3 minutes, 5 cycles of 94oC for 30 seconds, 68oC for 30 seconds, 72oC for 45 seconds, decreasing annealing temperature 1oC every cycle, followed by 25 cycles of 94oC for 30 seconds, 63oC for 30 seconds, 72oC for 45 seconds, then 72oC for 7 minutes. The human glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) was analyzed as a loading control with GAPDH-specific primers: F: 5´-accacagtccatgccatcac-3´ and R: 5´- tccaccaccctgttgctgt-3´. For the qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe) and Hs02758991_g1 (GAPDH probe, control). Amplification was performed using a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems).

5.6. Western blot analysis.

Keratinocytes were lysed in protein extraction buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% Nonidet P-40, 4 mM EDTA) containing proteinase inhibitors cocktail (Complete Mini, EDTA-free; Roche Diagnostics, Mannheim, Germany). Lysates were incubated for 30 minutes on ice and centrifuged at 15,000×g for 30 min at 4°C. Supernatants were collected and protein concentrations were measured using the Bradford assay (BioRad, Hercules, CA). For each sample, 40 µg of total protein was resolved on NuPAGE® Novex 3-8% Tris-Acetate gel electrophoresis (Invitrogen, Carlsbad, CA) and electrotransferred to nitrocellulose membranes (Invitrogen, Carlsbad, CA). For type VII collagen analysis, blots were probed with a monospecific polyclonal anti C7 antibody (a generous gift from Dr A. Nystrom). Antibodies against vinculin (Abcam) or α-tubulin (Sigma, St Louis, MO) were used as loading controls. Visualization was performed by incubating with HRP-conjugated anti-rabbit antibody (Amersham, Burlington, MA) and West Pico Chemiluminescent Substrate (Pierce, Rockford, IL).

5.7. Immunofluorescence and immunohistochemical staining.

For immunofluorescence detection of C7 in keratinocytes or in skin grafts sections, cells grown on glass cover slips or 7 µm frozen sections of grafted skin tissue were fixed in methanol/acetone (1:1) for 10 minutes at -20oC. After washing three times in phosphate- buffered saline (PBS) and once in PBS with 3% bovine serum albumin (BSA) (Sigma

65 Chapter 1

Aldrich, St Louis, MO) for 30 minutes, cells or cryosections were incubated with monospecific polyclonal anti C7 antibody (a generous gift from Dr A. Nystrom) at 1:5000 dilution. Secondary antibody (AlexaFluor488, Invitrogen, Carlsbad, CA) was used at 1:1000 dilution. After the final washing step in PBS, preparations were mounted using Mowiol (Hoechst, Somerville, NJ) mounting medium and 46-diamidino-2-phenyl indole (DAPI) 20 µg/m (Sigma) for nuclei visualization. Hematoxylin/Eosin (H/E) staining was performed on paraffin embedded skin samples. Immunoperoxidase staining for human involucrin was performed using rabbit SY5 monoclonal antibody (Sigma) using the ABC peroxidase kit (Vector) with diaminobenzidine as a substrate.

5.8. Generation of skin equivalents and grafting onto immunodeficient mice.

Keratinocytes were seeded on RDEB-containing fibrin dermal equivalents prepared as previously described 182. Bioengineered skin equivalents were grafted onto the back of immunodeficient nu/nu mice174. Twelve weeks after grafting, mice were sacrificed and grafts harvested for skin immunofluorescence, immunohistochemical and histological analysis and electron microscopy studies. Animal studies were approved by our institutional animal care and use committee according to all legal regulations.

5.9. Electron Microscopy.

Specimens of ca. 0.4 x 0.3cm were fixed for at least 2h at room temperature in 3% glutaraldehyde solution in 0.1M cacodylate buffer pH 7.4, cut into pieces of ca. 1mm3, washed in buffer, postfixed for 1 h at 4oC in 1% osmium tetroxide, rinsed in water, dehydrated through graded ethanol solutions, transferred into propylene oxide, and embedded in epoxy resin (glycidether 100). Semithin and ultrathin sections were cut with an ultramicrotome (Reichert Ultracut E). Ultrathin sections were treated with uranyl acetate and lead citrate, and examined with an electron microscope (JEM 1400) equipped with a 2k CCD camera (TVIPS).

6. Acknowledgements

The study was mainly supported by DEBRA International – funded by DEBRA Austria (grant termed as Larcher 1). Additional funds come from Spanish grants SAF2013-43475- R and SAF2017-86810-R 31 from Ministry of Economy and Competitiveness and

66 Chapter 1

PI14/009 from Instituto de Salud Carlos III, both co-funded with European Regional Development Funds (ERDF). Authors are indebted to Jesus Martínez and Edilia De Almeida for animal maintenance and care.

7. Author contributions

RM, AM and FL designed the experiments. RM, AM, CC and JB performed molecular and cellular studies. SGL, MJE and MDR provided reagents and ethical approval for the studies. AH, BD and NI performed animal experiments and histological analysis. IH performed the electron microscopy analysis. AM, FL and RM wrote the paper.

8. Conflict of interest

All authors declare no conflict of interest.

67 Chapter 1

9. References

1. Fine, JD, Bruckner-Tuderman, L, Eady, RA, Bauer, EA, Bauer, JW, Has, C, et al. (2014). Inherited epidermolysis bullosa: updated recommendations on diagnosis and classification. J Am Acad Dermatol 70: 1103-1126. 2. Mavilio, F, Pellegrini, G, Ferrari, S, Di Nunzio, F, Di Iorio, E, Recchia, A, et al. (2006). Correction of junctional epidermolysis bullosa by transplantation of genetically modified epidermal stem cells. Nat Med 12: 1397-1402. 3. Bauer, JW, Koller, J, Murauer, EM, De Rosa, L, Enzo, E, Carulli, S, et al. (2017). Closure of a Large Chronic Wound through Transplantation of Gene-Corrected Epidermal Stem Cells. J Invest Dermatol 137: 778-781. 4. Siprashvili, Z, Nguyen, NT, Gorell, ES, Loutit, K, Khuu, P, Furukawa, LK, et al. (2016). Safety and Wound Outcomes Following Genetically Corrected Autologous Epidermal Grafts in Patients With Recessive Dystrophic Epidermolysis Bullosa. Jama 316: 1808-1817. 5. Hirsch, T, Rothoeft, T, Teig, N, Bauer, JW, Pellegrini, G, De Rosa, L, et al. (2017). Regeneration of the entire human epidermis using transgenic stem cells. Nature. 6. Hennig, K, Raasch, L, Kolbe, C, Weidner, S, Leisegang, M, Uckert, W, et al. (2014). HEK293-based production platform for gamma-retroviral (self-inactivating) vectors: application for safe and efficient transfer of COL7A1 cDNA. Human gene therapy Clinical development 25: 218-228. 7. Osborn, MJ, Starker, CG, McElroy, AN, Webber, BR, Riddle, MJ, Xia, L, et al. (2013). TALEN-based gene correction for epidermolysis bullosa. Mol Ther 21: 1151-1159. 8. Webber, BR, Osborn, MJ, McElroy, AN, Twaroski, K, Lonetree, CL, DeFeo, AP, et al. (2016). CRISPR/Cas9-based genetic correction for recessive dystrophic epidermolysis bullosa. NPJ Regenerative medicine 1. 9. Shinkuma, S, Guo, Z, and Christiano, AM (2016). Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa. Proc Natl Acad Sci U S A 113: 5676-5681. 10. Izmiryan, A, Danos, O, and Hovnanian, A (2016). Meganuclease-Mediated COL7A1 Gene Correction for Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol 136: 872-875. 11. Chamorro, C, Mencia, A, Almarza, D, Duarte, B, Buning, H, Sallach, J, et al. (2016). Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes. Mol Ther Nucleic Acids 5: e307. 12. Hainzl, S, Peking, P, Kocher, T, Murauer, EM, Larcher, F, Del Rio, M, et al. (2017). COL7A1 Editing via CRISPR/Cas9 in Recessive Dystrophic Epidermolysis Bullosa. Mol Ther. 13. Niks, EH, and Aartsma-Rus, A (2017). Exon skipping: a first in class strategy for Duchenne muscular dystrophy. Expert Opin Biol Ther 17: 225-236. 14. Turczynski, S, Titeux, M, Pironon, N, and Hovnanian, A (2012). Antisense-mediated exon skipping to reframe transcripts. Methods Mol Biol 867: 221-238. 15. Turczynski, S, Titeux, M, Tonasso, L, Decha, A, Ishida-Yamamoto, A, and Hovnanian, A (2016). Targeted Exon Skipping Restores Type VII Collagen Expression and Anchoring Fibril Formation in an In Vivo RDEB Model. J Invest Dermatol 136: 2387- 2395. 16. Bremer, J, Bornert, O, Nystrom, A, Gostynski, A, Jonkman, MF, Aartsma-Rus, A, et al. (2016). Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa. Mol Ther Nucleic Acids 5: e379.

68 Chapter 1

17. Bornert, O, Kuhl, T, Bremer, J, van den Akker, PC, Pasmooij, AM, and Nystrom, A (2016). Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy. Mol Ther 24: 1302-1311. 18. Ousterout, DG, Kabadi, AM, Thakore, PI, Perez-Pinera, P, Brown, MT, Majoros, WH, et al. (2015). Correction of dystrophin expression in cells from duchenne muscular dystrophy patients through genomic excision of exon 51 by zinc finger nucleases. Mol Ther 23: 523-532. 19. Ousterout, DG, Perez-Pinera, P, Thakore, PI, Kabadi, AM, Brown, MT, Qin, X, et al. (2013). Reading frame correction by targeted genome editing restores dystrophin expression in cells from Duchenne muscular dystrophy patients. Mol Ther 21: 1718-1726. 20. Long, C, Amoasii, L, Mireault, AA, McAnally, JR, Li, H, Sanchez-Ortiz, E, et al. (2016). Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 351: 400-403. 21. Nelson, CE, Hakim, CH, Ousterout, DG, Thakore, PI, Moreb, EA, Castellanos Rivera, RM, et al. (2016). In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science 351: 403-407. 22. Tabebordbar, M, Zhu, K, Cheng, JK, Chew, WL, Widrick, JJ, Yan, WX, et al. (2016). In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 351: 407- 411. 23. Wu, W, Lu, Z, Li, F, Wang, W, Qian, N, Duan, J, et al. (2017). Efficient in vivo gene editing using ribonucleoproteins in skin stem cells of recessive dystrophic epidermolysis bullosa mouse model. Proc Natl Acad Sci U S A 114: 1660-1665. 24. Droz-Georget Lathion, S, Rochat, A, Knott, G, Recchia, A, Martinet, D, Benmohammed, S, et al. (2015). A single epidermal stem cell strategy for safe ex vivo gene therapy. EMBO Mol Med 7: 380-393. 25. Duarte, B, Miselli, F, Murillas, R, Espinosa-Hevia, L, Cigudosa, JC, Recchia, A, et al. (2014). Long-term skin regeneration from a gene-targeted human epidermal stem cell clone. Mol Ther 22: 1878-1880. 26. Larcher, F, Dellambra, E, Rico, L, Bondanza, S, Murillas, R, Cattoglio, C, et al. (2007). Long-term engraftment of single genetically modified human epidermal holoclones enables safety pre-assessment of cutaneous gene therapy. Mol Ther 15: 1670- 1676. 27. Hovnanian, A, Rochat, A, Bodemer, C, Petit, E, Rivers, CA, Prost, C, et al. (1997). Characterization of 18 new mutations in COL7A1 in recessive dystrophic epidermolysis bullosa provides evidence for distinct molecular mechanisms underlying defective anchoring fibril formation. Am J Hum Genet 61: 599-610. 28. Escamez, MJ, Garcia, M, Cuadrado-Corrales, N, Llames, SG, Charlesworth, A, De Luca, N, et al. (2010). The first COL7A1 mutation survey in a large Spanish dystrophic epidermolysis bullosa cohort: c.6527insC disclosed as an unusually recurrent mutation. Br J Dermatol 163: 155-161. 29. Anglani, F, Picci, L, Camporese, C, and Zacchello, F (1990). Heteroduplex formation in polymerase chain reaction. Am J Hum Genet 47: 169-170. 30. Ousterout, DG, Kabadi, AM, Thakore, PI, Majoros, WH, Reddy, TE, and Gersbach, CA (2015). Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat Commun 6: 6244. 31. Fine, EJ, Cradick, TJ, Zhao, CL, Lin, Y, and Bao, G (2014). An online bioinformatics tool predicts zinc finger and TALE nuclease off-target cleavage. Nucleic Acids Res 42: e42. 32. Rodriguez, FA, Gana, MJ, Yubero, MJ, Zillmann, G, Kramer, SM, Catalan, J, et al. (2012). Novel and recurrent COL7A1 mutations in Chilean patients with dystrophic epidermolysis bullosa. J Dermatol Sci 65: 149-152.

69 Chapter 1

33. Chapman, S, McDermott, DH, Shen, K, Jang, MK, and McBride, AA (2014). The effect of Rho kinase inhibition on long-term keratinocyte proliferation is rapid and conditional. Stem Cell Res Ther 5: 60. 34. Chamorro, C, Almarza, D, Duarte, B, Llames, SG, Murillas, R, Garcia, M, et al. (2013). Keratinocyte cell lines derived from severe generalized recessive epidermolysis bullosa patients carrying a highly recurrent COL7A1 homozygous mutation: models to assess cell and gene therapies in vitro and in vivo. Exp Dermatol 22: 601-603. 35. Llames, SG, Del Rio, M, Larcher, F, Garcia, E, Garcia, M, Escamez, MJ, et al. (2004). Human plasma as a dermal scaffold for the generation of a completely autologous bioengineered skin. Transplantation 77: 350-355.

70 Chapter 1

10. Supplementary Data

Supplementary Figure S1. COL7A1 gene expression in frame-restored P1 keratinocytes clones 11 and 40, containing a 1 bp ΔG deletion in one (clone 11) or both (clone 40) COL7A1 alleles. (A) left panel, RT-PCR analysis of COL7A1 expression from healthy human control (HK), P1 patient (P1), clone 11 and clone 40 keratinocyte RNA samples. (-), negative control without cDNA; M is IX molecular weight marker. Right panel, RT-PCR analysis of GAPDH expression, as a loading control. (B) Sequencing chromatograms for RT-PCR products. Frame-restored transcripts were found for the ΔG mutation-carrying clones 11 (monoallelically modified, overlapping chromatograms) and 40 (biallelically modified). (C) Western blot detection of C7 (ColVII) in COL7A1 frame restored clones 11 and 40. Note increased amounts of C7 in these clones, compared to normal human keratinocytes (HK). No expression was found in unedited P1 patient keratinocytes (P1). α-tubulin expression was used as a loading control (lower panel).

71 Chapter 1

Supplementary Figure S2. Clone 19n genotype. Sanger sequencing chromatogram of C7-negative clone 19n revealed the presence of overlapping chromatograms for the c.6527insC (unmodified, upper nucleotide sequence) and c.6503_6511del9 (9 bp deletion, lower nucleotide sequence) alleles.

72 Chapter 1

Supplementary Figure S3. PROGNOS-predicted off-target sites (Supplementary Table 1) for TALENs T6/T7 homo and heterodimers were PCR amplified using genomic DNA from keratinocyte clones 19, 19.3, 19.C and patient 2 (P2) keratinocytes, using specific primer pairs (Supplementary Table 2). PCR products were then screened for indels using the Surveyor (CelI) assay. COL7A1 exon 80 on-target site was included as a positive control for indel generation by T6/T7 TALENs (left side, upper panels).

73 Chapter 1

Supplementary Figure S4. Histological (H&E staining) analysis of a human skin graft regenerated from clone 11, expressing a C7 variant with a 4 aminoacids substitution. Consistent with the inability to promote epidermal-dermal attachment by this C7 variant, the epidermis separated from the dermis (not seen in the picture) during sample processing. Otherwise, basal cells of the epidermis and epidermal differentiation appear normal, suggesting that intracellular accumulation of C7 is not cytotoxic. Scale bar: 100 µm

Supplementary Figure S5. Immunofluorescence detection of C7 (red) on a section of a skin graft generated with mixed clone 19 keratinocytes. C7 deposition along the BMZ coincided with areas showing dermal-epidermal attachment. Blistering spots (asterisks) matched areas negative for C7, likely originating from uncorrected epidermal stem cells. Cell nuclei were stained with DAPI (blue). Scale bar: 50µm.

74 Chapter 1

genomic number of chromosome gene region Match type target sequence F target sequence R mismatches

Chr3 COL7A1 exon 80 L14R TGCCCTCTCTATGTAGGGT TGGGCCAGGGGGGGCCT 0 Chr3 COL7A1 exon 36 R10R TGGaCCActGGGGGaCc gaaGCCctGGGGGGCCa 11 Chr3 COL7A1 exon 56 R25R gGGaCCtGaGGGctCCT gGGtCCtGGGGGacCCT 12 Chr3 COL7A1 exon 58 R17R TGccaCAGGGaGaGCCT TGGGCCctcGaGGaCCc 11 Chr3 COL7A1 exon 67 R19R TtGGaCcccaGGGGCCT ctGGCCAGGaGGGcCCa 11 Chr3 COL7A1 intron 112 R21R TGGGCCtGGGaGGGCCT TGaGggAGGtaGGGCCc 8 Chr3 COL7A1 intron 112 R10R aGGGCCtGGGtGGGCCT TGaGggAGGtaGGGCCc 9 Chr3 UT-COL7A1 5´-UTR R27R TGctCCAGGtGGGGggc AGGCagCCCCTtcCCCc 11 Chr19 NFIX intron R22R cGGtggAGGcGGGGCCT TGGGCCcGGGGGGGCCT 6 Chr1 PROX1 intron R17R caGGggAGGGGaGGCCT TGGGCCAtGGGaGGCCT 7 Chr10 LOC100130539 intergenic R24R TaGcCaAGGGaaGcCCT TGGGCCAGaaGGcaCCT 10 Chr3 LRIG1 intron R16R TGGGCCcGGGGaGGCCT TGGGgaAGGGGaGcCCc 7 Chr1 ARHGEF19 intron R12R TGGGCagGGcaGGGGCT gGGtCCAGGGGGGGCCT 7 Chr20 GDF5 exon R17R caGGCCAGGattGGCCa cGGGCCAGGGGGGGCCT 7 Chr11 MOB2 intron R24R TGGGCCAGGGGGGcCCT ctGGCCAGtcGGGaCCa 7 Chr3 FAMD3 intron R28R TaGaCCAGGGaGGGCCc TGGGCCAGGctacaCCT 9 Chr22 LOC100128946 intergenic R13R caGcCCAGGGGGaGCCT TGGGCCcGGGGaaGCCT 7 Chr3 LRRC3B intergenic R17R TGGGCCAGGGaGaGCCT TGacCatGGGaGGGCCc 8 Chr12 TPCN1 intron R11R TGGGgCAGGaGGGGCCT TGGGagAGGaGGaGCCT 6 Chr19 TBCB intron R20R TGaGCtAGGaGGGcCCT TcaGCCAGaGGGaGCCT 8 Chr17 RBFOX3 intron R23R TGGaCCAGGGcctGCCT TGcGCCAGaaGaGGCCT 8 Supplementary Table 1. Potential off target sites predicted by PROGNOS software. Nucleotides mismatching TALENs-binding consensus sequences are shown in red.

Gene Forward primer Reverse primer Length (bp)

COL7A1 ex80 GTGAGTGGTGGCTGAAGCAC ACCCCACCAAGGAAACTGA 494 COL7A1ex34-36 CCCAGGGTTCTTCCACAGG CATGGTGAGGATGGGGGTAA 693 COL7A1ex54-56 GGAGGCATGGGGTGATGG CCCAAGTTCCCCGAAGCA 643 COL7A1ex56-60 GATCCCTGGAGCCCCTC CACCCTGTGGAAAATAGAGTGGTAA 633 COL7A1ex65-67 CACAGGCCATGCTCCAAGA GGCAGAACACAAAGGGGTCA 603 COL7A1EX111-112 AGCTCTGACTCCTGATCCCT GGGACTATGGTGAGACTGCA 508 UT-COL7A1 GCTGGAGGCAGTGAAGACCA TCCCAGCACCCTTTGAGAGA 452 NFIX CTAGGCTTGAGTGTCTGATGTGTG CAACTCCAATGGGGGAAGCC 357 PROX1 AGATGGGTGCAAACCTCACCTTC ATTTGGGCACAGGCGTCTGG 331 LOC100130539 CTGTCTCGATTGCGATCCAGG TGGTTAGACAATGGGTGCAGCC 325 LRIG1 TTCCAGGGAATGGGGGAAAGTG GGGAAAAACAGTGGTTATCAGCATGCATAG 357 ARHGEF19 GAGTTCCTCTGTCCTCTTCATGG ATTGTGCTGATCCCACCTTCCAGA 326 GDF5 CTGTGTCAGGCCTCCTGTCT CCAAACCAGAGGCACCTTTGCT 330 MOB2 AGAAGTGACCACTGGCAGGG CTGGAAGCCACCTAGCAAGC 345 FAM3D CTTTGGAGCAAAGCTGCAGGC GAAGGGGCACCTTTACCTACTC 343 LOC100128946 CTCCCTGAGCGGGTGCTTTT TGATGACGATGGCAGGGGCT 344 LRRC3B CTCATCTCTGCAGCTATCTGCTC TGCTCCCATCTCCAAGCAGG 326 TPCN1 AGGGGAGAGCTGTTTTGGGC AATCAAAGAGAACACGTGGCCGG 326 TBCB AGACACCTCAGGGTGTTCCTTG CAGCCTCCCAATGTACTGGGT 325 RBFOX3 AGTTCACCAGCCCTACGCAG GCTTTGGGCTTTGCCAAGGG 327 Supplementary Table 2. List of primers used for PCR amplification of potential off-target sites.

75

76 Chapter 2

Chapter 2

Clinically-relevant correction of Recessive Dystrophic Epidermolysis Bullosa by dual sgRNA CRISPR/Cas9-mediated gene editing

The data presented in the following chapter was published in Molecular Therapy in March 2019 (DOI: 10.1016/j.ymthe.2019.03.007)

Jose Bonafont, Ángeles Mencía, Marta García, Raúl Torres, Sandra Rodríguez, Marta Carretero, Esteban Chacón-Solano, Silvia Modamio-Høybjø, Lucía Marinas, Carlos León, María J Escamez, Ingrid Hausser, Marcela Del Río, Rodolfo Murillas* and Fernando Larcher*

77

Chapter 2

Clinically-relevant correction of Recessive Dystrophic Epidermolysis Bullosa by dual sgRNA CRISPR/Cas9-mediated gene editing

Jose Bonafont1,2,3, Ángeles Mencía2,3, Marta García1,2,3, Raúl Torres4, Sandra Rodríguez4, Marta Carretero2,5, Esteban Chacón-Solano1,2,3, Silvia Modamio-Høybjør1,2, Lucía Marinas1, Carlos León1,2,3, María J Escamez1,2,3, Ingrid Hausser6, Marcela Del Río1,2,3,5, Rodolfo Murillas2,3,5* and Fernando Larcher1,2,3,5*

Affiliations: 1. Department of Biomedical Engineering, Carlos III University (UC3M) Madrid. Spain. 2. Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER) U714, Madrid. Spain. 3. Fundación Instituto de Investigación Sanitaria de la Fundación Jiménez Díaz, Madrid. Spain. 4. Molecular Cytogenetics Unit. Spanish National Cancer Research Centre (CNIO) 5. Epithelial Biomedicine Division, Centro de Investigaciones Energéticas Medioambientales y Tecnológicas (CIEMAT), Madrid. Spain. 6. Institute of Pathology IPH, Heidelberg University Hospital, Heidelberg, Germany.

Correspondence to: Fernando Larcher ([email protected]) and Rodolfo Murillas ([email protected] ).

Running title: Clinically-relevant gene editing for RDEB

79 Chapter 2

1. Abstract

Gene editing constitutes a novel approach for precisely correcting disease-causing gene mutations. Frame shift mutations in COL7A1 causing Recessive Dystrophic Epidermolysis Bullosa are amenable to open reading frame restoration by non- homologous end joining repair-based approaches. Efficient targeted deletion of faulty COL7A1 exons in polyclonal patient keratinocytes would enable the translation of this therapeutic strategy to the clinic. In this study, using a dual sgRNA guided-Cas9 nuclease delivered as a ribonucleoprotein complex through electroporation, we have achieved very efficient targeted deletion of COL7A1 exon 80 in RDEB patient keratinocytes carrying a highly prevalent frameshift mutation. This ex vivo non-viral approach rendered a large proportion of corrected cells producing a functional collagen VII variant. The effective targeting of the epidermal stem cell population enabled long- term regeneration of a properly adhesive skin upon grafting onto immunodeficient mice. Safety assessment by NGS analysis of potential off-target sites did not reveal any unintended nuclease activity. Our strategy could potentially be extended to a large number of COL7A1 mutation-bearing exons within the long collagenous domain of this gene, opening the way to precision medicine for RDEB. Key words: CRISPR/Cas9 / Epidermal stem cells / Epidermolysis bullosa / gene therapy

80 Chapter 2

2. Introduction

Recessive Dystrophic Epidermolysis Bullosa (RDEB) is a severe skin fragility genodermatosis caused by loss-of-function mutations in the COL7A1 gene, encoding type VII collagen (C7). C7 deficiency results in generalized blistering of the skin and other stratified epithelia, scarring, fibrosis, mitten-like deformities of hands and feet and a high risk of developing metastatic squamous cell carcinoma 53. Ex vivo gene addition therapies based on transplantation of keratinocyte sheets modified by retroviral vectors are already at the clinical stage for epidermolysis bullosa forms including junctional epidermolysis bullosa (JEB) and RDEB, with encouraging results 108, 156-158. However, significant hurdles face the gene addition approach that include suboptimal viral gene delivery to the stem cell population, inaccurate spatial- temporal gene expression and potential insertional mutagenesis-derived adverse events, which are particularly relevant for RDEB patients given their high proneness to carcinoma development. Therefore, the implementation of gene therapy approaches for RDEB based on highly precise gene editing technologies is warranted and has been pursued by employing different types of nucleases, i.e. meganucleases, TALENs and CRISPR/Cas9, and target cells 40, 160-163. Since neither homology directed repair (HDR) nor non homologous end joining (NHEJ)-mediated gene editing strategies tested so far in patient cells have reached a sufficient level of efficacy to enable therapeutic C7 replacement by direct transplantation of cells treated in bulk, isolation of corrected cell clones has been necessary, either from patient-derived iPSCs and subsequent target cell derivation 160, 161 or from patient keratinocytes 40, 154, 163. Our laboratory previously demonstrated long-term skin regeneration from single, gene edited epidermal stem cell clones of primary RDEB patient keratinocytes 154. Our original approach involved the use of TALENs delivered by adenoviral vectors to induce NHEJ-mediated indels able to restore the reading frame of COL7A1 in patient cells carrying the frameshift mutation c.6527insC 22 located at exon 80, which is highly prevalent in the cohort of Spanish RDEB patients 38, 183. One of the edited patient keratinocyte clones described in this study carried a long deletion encompassing the whole exon 80 and showed restoration of C7 expression and persistent phenotypic correction in vivo upon transplantation to immunocompromised mice 154. The functionality of C7 variants lacking the amino acids encoded by specific exons within the collagenous domain (i.e. exons 73, 80 and 105) has been previously

81 Chapter 2

demonstrated 43, 166. Further, Wu et al. also showed that Col7a1 exon 80-skipped mice generated with the CRISPR/Cas9 system were indistinguishable from their wild type littermates 100. Building on these results, we sought more efficient and safe methods to achieve targeted deletion of mutation-carrying COL7A1 exon 80 using the CRISPR/Cas9 system in RDEB patient keratinocytes. In this study we show the remarkable efficacy and safety of a non-viral strategy employing a dual sgRNA-guided Cas9 nuclease delivered as a ribonucleoprotein complex by electroporation to precisely excise COL7A1 exon 80 carrying the c.6527insC mutation in RDEB patient keratinocytes. Moreover, we demonstrate the long-term skin regeneration ability of the corrected cells upon grafting of polyclonal and monoclonal populations of edited cells to immunodeficient mice, which is indicative of epidermal stem cell correction. This highly efficacious strategy would enable quick translation to clinical application.

3. Results

a. Delivery of dual sgRNA-guided Cas9 nuclease as a ribonucleoprotein complex to RDEB keratinocytes enables highly efficient targeted deletion of COL7A1 exon 80

The dual sgRNA CRISPR/Cas9 deletion strategy of COL7A1 exon 80 (E80) is shown in the scheme (Fig. 1A). Four different sgRNA pairs targeted to DNA sequences within introns 79 and 80 were designed (Fig. 1B) with the aim of generating deletions of different sizes covering E80 (Fig. 1C). RDEB keratinocytes from a homozygous carrier of the c.6527insC mutation were nucleofected with the CRISPR/Cas9 RNP complexes at two different electroporation pulse conditions (designated as A and B, Fig. 1D). Once treated keratinocytes reached confluence, genomic DNA was extracted and E80 deletion (ΔE80) was assessed by PCR amplification of a fragment spanning the sgRNA target sites (Fig. 1D). All sgRNA guide pairs led to E80 deletion as shown by the presence of smaller molecular weight bands with sizes congruent with the distance between Cas9 cutting sites. Electroporation condition B performed better for all sgRNA pairs. Differences in deletion efficacy were found among the different sgRNA pairs (i.e sg2+sg3 > sg1+sg3 > sg2+sg4 > sg1+sg4) (Fig. 1D). In keratinocytes treated with sg2+sg3, the most efficacious pair of guides, E80 deletions accounted for 66.5% of

82 Chapter 2

alleles as determined by densitometric quantitation of the PCR products (Fig. 1D). The presence of ΔE80 alleles in a ratio higher than 50% indicated that homozygous deletion of E80 was a frequent event.

Figure 1. COL7A1 E80 dual RNA guide CRISPR/Cas9 deletion strategy. A) Scheme of the strategy. Single CRISPR RNA guides were designed to induce Cas9-mediated DNA double strand breaks within selected COL7A1 intron sequences flanking exon 80 (U-Guides and D-Guides). NHEJ repair leads to intron-intron rejoining with concomitant E80 deletion and restoration of COL7A1 reading frame and truncated C7 expression. B) CRISPR guides design. sgRNA guides (sgRNA 1, 2, 3 and 4) sequences and alignment to E80 flanking sequences E80 is shown. The PAM motif is indicated in darker color. C) Predicted amplicon sizes for E80 deletions corresponding to each sgRNA pair combination. D) PCR

83 Chapter 2

analysis of genomic DNA from RDEB keratinocytes from patient P1 treated with the RNP complexes containing the different sgRNA guide pair combinations. Sg2+sg3 pair yielded the highest proportion of excised E80 according to the intensity of the lower 440 bp band. Deletion ratios assessed by densitometry are shown in each lane. A and B refer to the two different electroporation conditions tested.

b. Targeted COL7A1 E80 deletion produced a diversity of spliceable chimerical intronic variants

A variety of intron 79-intron 80 joining events after Cas9-mediated cleavage at sequences flanking E80 and subsequent NHEJ repair were expected to occur in a polyclonal cell population. The characterization of the DNA repair outcomes in RDEB keratinocytes from patient P1 treated with the most effective sgRNA pair (sg2+sg3) was initially performed by TA cloning of PCR products spanning both Cas9 cutting sites and Sanger sequencing of individual colonies (n=82). This analysis detected a spectrum of end joining repair variants, the majority of which (41 out of 82) corresponded to the fusion of the predicted sgRNA-targeted Cas9 cleavage sites plus the insertion of a T (Fig. 2). Other fusion events included small indels (both deletions and insertions) not affecting intron splicing signals and therefore not likely to disrupt the splicing of the resulting chimerical intron. The analysis also showed that, in addition to dual Cas9 cuts leading to the intended E80 deletion, which accounted for 84% of alleles, indels corresponding to DNA repair after single cuts (i.e. at either intron 79 or 80) were also present. Taking these into account, 95% of alleles had been edited (Fig. 2).

84 Chapter 2

Figure 2. Indel spectrum in COL7A1 E80 region. Sequences (Sanger) listed from higher to lower frequencies. 50% of rejoining events corresponded to the fusion between E80-flanking cutting sites plus the addition of a T (Δ55 + insT). 95.14% of all alleles had been edited and 84.16% presented E80 deletion.

c. Next Generation Sequencing analysis of on-target and off-target CRISPR-generated variants.

For in-depth characterization of repair events at the on-target region, and to analyze potential off-target cleavage activity at in silico predicted sites, we performed Next Generation Sequencing (NGS) of PCR amplicons spanning the corresponding sites. Genomic DNA samples from keratinocytes from two homozygous c.6527insC carrier patients, P1 and P2, treated in duplicate with RNPs (biological replicates BR1 and BR2) as well as control DNA samples from both patients were subjected to this analysis. On- target NGS analysis confirmed highly efficient deletion of E80 in Cas9 RNP-treated patient cells. Sequence variations within a 60 bp window centered on the midpoint between both cut sites were considered. The two most frequent repair variants, i.e. fusion of the Cas9 cleavage sites with (62.2%) or without (9.7%) the insertion of a T (Fig.S1), found in P1 (BR1), were also among the most frequently represented in the Sanger sequencing characterization (50.0 and 6.1% respectively) for this sample (Fig. 2). For less frequent repair variants, higher diversity was detected with NGS than with Sanger sequencing. Taking into account all variants resulting in E80 deletion, similar frequencies of deletion were found with either technique (84 vs. 87% for Sanger and NGS respectively) in P1 (BR1) patient keratinocytes. Patient P2 cells, analyzed by NGS only, showed 95% E80 deletion with a similar spectrum of allelic variants (Fig. S1). The lower frequency of E80 deletion estimated by PCR genotyping in patient P1 (66%), as compared with Sanger or NGS sequencing estimates, might be explained by heteroduplex DNA formation between deleted and undeleted alleles that results in decreased intensity of the lower molecular weight PCR band 177. To assess for potential off-target Cas9 cleavage activity, NGS was used to analyze PCR amplicons covering 278 in silico predicted sites, that included all off-target sites up to 3 mismatches, all sites with 1 or 2 base-pair bulges and the top 53 coding region sites with 4 mismatches for each guide. After establishing a 1000-read cut-off for sequencing depth, 244 amplicons were studied. The only sequence variations considered were insertions or deletions within a 6-bp window centered on the target site for each sgRNA.

85 Chapter 2

The threshold percentage for off-target activity was set at 0.52%, since this was the highest percentage of indel-containing reads (within the 6 bp window considered for the off-target evaluation) in unedited control samples. Thus, for each site, indel-containing reads below this percentage were considered as noise. For every off-target site analyzed, indel-containing reads represented less than 0.52% of the total (Fig. 3), except for five predicted sites. Although these sites showed indel-containing reads at a slightly higher frequency (0.52-0.6%) above the 0.52% threshold (Fig.S2), the sequence variations found were also present in both controls and edited samples, suggesting that these were not bona-fide Cas9 off-targets. We therefore conclude that our NGS analysis of 244 predicted off-target sites did not reveal any off-target event above the threshold of detection.

Figure 3. NGS assessment for presence of indels in potential off-target sites. PCR amplicons for 244 predicted off-target sites sequenced with at least 1000x depth, as well as the on-target region, were analyzed. X-axis: putative off-target sites arranged according to frequency of sequence variation. The 50 highest ranking sites are represented. The first point corresponds to the on-target site. Y-axis: Percentage of reads containing sequence variations within a 6-bp window centered on the target site for each sgRNA.

86 Chapter 2

d. COL7A1 transcription analysis after E80 deletion in c.6527insC patient cells

Our NHEJ correction strategy was designed to generate, upon E80 deletion, new functional introns with donor and acceptor splicing sequences corresponding to those from exons 79 and 81 respectively. Still, the potential generation of cryptic splicing sites could result in inappropriately spliced transcripts. To confirm proper reading frame restoration derived from the precise in-frame exon 79-exon 81 junction, we studied COL7A1 transcription by performing RT-PCR analysis. For all three sgRNA guide pairs suitable for E80 deletion, a smaller band consistent with amplification of transcripts lacking E80 was found (Fig. 4A). The intensity of the smaller band (Fig. 4A) was proportional to the efficiency of the deletion as detected by PCR analysis of genomic DNA (Fig. 1D). The RT-PCR products corresponding to cells treated with the best- performing sgRNA pair (sg2+sg3) were TA cloned (n=49) and Sanger sequenced. This analysis revealed only two types of transcripts: 47 colonies contained the proper exon 79-exon 81 junction (96% of transcripts), and 2 colonies (4%) contained the E80 sequence originating from the unedited (c.6527insC) allele (Fig. 4B). To further quantify the presence of E80-deleted and E80-containing transcripts in gene edited cells, RT-qPCR was performed using Taqman probes specific for exon 80 and exon 64 encoded sequences. The exon 64-specific probe detects transcripts originating from both edited and unedited alleles and the exon 80-specific probe detects only transcription from unedited E80 sequence-containing alleles. While in healthy donor control keratinocytes both probes detected similar expression levels, in the different RNP-treated pools of cells we observed higher expression with the exon 64 probe than with the exon 80 probe. The increased COL7A1 transcription detected with the exon 64 probe as compared to the exon 80 probe was proportional to the deletion efficacy of the guide combinations. This analysis was consistent with the RT-PCR product quantification and clearly demonstrated the prevalence of E80-lacking transcripts in edited cells, confirming sg2+sg3 guides as the best performing pair for E80 deletion (Fig. 4C).

87 Chapter 2

Figure 4. Collagen VII mRNA expression of ΔE80 gene edited RDEB keratinocytes. A) RT-PCR analysis of COL7A1 transcripts amplified with primers in exons 78 to 84. Wild type/c.6527insC unedited transcripts produced a 240/241 bp band (non-modified, n-m) found in all RNA samples. A smaller 205 bp band corresponding to transcripts lacking exon 80 was detected in samples from edited cells. M is IX molecular weight marker; HK, healthy human keratinocytes; P1, patient keratinocytes; (H2O), negative control without cDNA. B) Representative sequence chromatograms showing the two different resulting transcripts. Transcript frequencies shown on the left. C) COL7A1 expression quantification by Real time-qPCR using Taqman probes for two different COL7A1 regions: ex64, specific for all COL7A1 transcripts and Ex80 probe, for exon-80 containing transcripts.

e. De novo C7 expression after targeted deletion of E80 in RDEB keratinocytes

COL7A1 reading frame restoration by targeted deletion of mutant E80 and splicing of the resulting chimerical intron should result in C7 expression as we previously observed in a clone of RDEB keratinocytes containing a deletion that entirely encompassed COL7A1 E80 154. Previous studies from others had also shown that C7 null cells expressing a retrovirally transferred ΔE80 COL7A1 cDNA construct were able to produce a functional C7 variant 166. We therefore assessed C7 expression by immunofluorescence and Western blot in RDEB keratinocytes nucleofected with the

88 Chapter 2

three most efficient E80-deleting RNP combinations (sg2+sg4, sg1+sg3 and sg2+sg3). The number of C7-expressing cells detected by immunofluorescence analysis (Fig. 5A) matched the E80 deletion efficacy assessed at the DNA and mRNA level (Fig. 1D, Fig. 4A and Fig. S3A). In fact, quantification of C7 positive cells by flow cytometry using an specific anti-C7 antibody showed that 81% of patient keratinocytes treated with the sg2+sg3 RNPs expressed C7 (Fig. S3B). Accordingly, Western blot analysis further demonstrated the highest expression of C7 in patient keratinocyte samples treated with sg2+sg3 RNPs. The mobility of the C7 band detected in these samples was indistinguishable from that of the WT protein, as expected since the size difference between WT C7 and the variant lacking the 12 amino acids encoded by E80 cannot be resolved at the molecular weight range of C7 (290Kda) (Fig. 5B).

Figure 5. Collagen VII expression in E80 RDEB polyclonal keratinocytes. Keratinocytes were treated with the RNP complex containing the different CRISPR dual sgRNA combinations and C7 expression assessed by

89 Chapter 2

IF and Western blot. A) C7 IF analysis. Left, upper panel: control, untreated RDEB (c.6527insC) keratinocytes. Right, upper panel: RDEB keratinocytes treated with the sg2+sg4 pair. Left, lower panel: RDEB keratinocytes treated with sg1+sg3 pair. Right, lower panel: RDEB keratinocytes treated and sg2+sg3 pair. DAPI was used to stain nuclei. Bars: 50 µm. B) Western blot analysis of C7 expression in unedited and edited RDEB keratinocytes showing C7 bands intensities consistent with the IF data. The ΔE80 C7 in edited RDEB cells is indistinguishable from that of normal human keratinocytes.

f. Long-term engraftment of polyclonal populations of E80 RDEB keratinocytes

The high proportion of C7-expressing keratinocytes obtained with the non-viral CRISPR/Cas9 approach indicated that a C7 amount sufficient to restore epidermal- dermal adhesion would be attainable. To test this, polyclonal populations of edited RDEB cells, obtained with the different combinations of sgRNAs, and control unedited cells were used to produce bioengineered skin constructs that were subsequently grafted onto immunodeficient mice. Animals were monitored for engraftment and biopsies were obtained at different time points for histopathological analysis of regenerated skin and assessment of C7 expression. Macroscopic examination clearly showed human skin engraftment for the most efficient guide combination (sg2+sg3) (Fig.6, A and B). Routine histological analysis (H&E staining) of 12-week-old grafts showed normal skin architecture and uninterrupted dermal-epidermal attachment in grafts from these RDEB edited cells (Fig. 6C). On the contrary, epidermal-dermal separation was evident in grafts from non- edited cells (Fig. 6D). Both types of grafts showed proper suprabasal human involucrin expression indicating normal epidermal differentiation (Fig. 6 E, F). Immunoperoxidase staining clearly exhibited C7 expression with proper localization at the basement membrane zone (BMZ) exclusively in grafts from edited patient cells (Fig. 6G and H). Ultrastructural analysis by electron microscopy accordingly showed the presence of abundant anchoring fibrils in edited grafts (Fig. 6I) but not in control unedited grafts where dermal-epidermal separation was evident (Fig. 6J). Patient keratinocytes modified with the other sgRNA pairs able to induce alternative E80 deletions, albeit at lower efficiencies, were also tested for skin regeneration. Histological and immunohistochemical analysis 12 weeks after grafting showed full dermal-epidermal adhesion (Fig. S4D) and continuous C7 expression (Fig. S4F) at the BMZ in grafts of keratinocytes edited with sg1+sg3. In contrast, microblisters (Fig. S4A) and reduced and patchy C7 expression (Fig. S4C) were observed in grafts

90 Chapter 2

generated from cells treated with the less efficient sg2+sg4 RNP combination, suggesting that the C7 amount provided by these cells was not sufficient to sustain continuous dermal-epidermal adhesion. Human involucrin expression demonstrated normal epidermal differentiation of these grafts (Fig. S4, B and E).

Figure 6. Skin regeneration, collagen VII expression and ultrastructural analysis of grafts from CRISPR/Cas9 edited (ΔE80) polyclonal keratinocytes. A-B) Macroscopic view of engrafted areas 12 weeks

91 Chapter 2

after grafting of bioengineered skins containing gene edited (ΔE80) (A) or unedited RDEB keratinocytes (B). C-D) Histological analysis (H&E staining) of grafts from gene edited (ΔE80) (C) or unedited RDEB keratinocytes (D). The dermal-epidermal separation in grafts from control, unedited cells is indicated by the red asterisk. E-F) Human involucrin (h-inv) immunostaining (suprabasal expression) showing normal epidermal differentiation in grafts from ΔE80 keratinocytes (E) or unedited RDEB keratinocytes (F). G-H) C7 immunoperoxidase expression analysis showing the continuous and correct deposition of C7 at the BMZ in ΔE80 edited grafts (G) and its complete absence in unedited RDEB keratinocyte grafts (H). Bars: 100 µm. I-J) Electron microscopy analysis shows the presence of mature anchoring fibrils (arrows) at the dermal-epidermal junction of the gene-edited RDEB skin (I) and an “empty” electron lucent split area,, corresponding to a blister (red asterisk) in the unedited graft (J). Bars: 200 nm (I) and 6 µm (J).

g. Non-viral CRISPR/Cas9 delivery targets the epidermal stem compartment.

The very high efficiency of E80 deletion attained through our non-viral CRISPR/Cas9 RNP complex delivery, and the long-term skin regeneration achieved with a polyclonal population of corrected cells, suggested that targeting of the epidermal stem cell compartment had occurred. To confirm this, 11 clones from the bulk RDEB keratinocyte population edited with sg2+sg3 RNPs were isolated by limiting dilution. Genotype analysis revealed that all of these clones had been edited (fig. S5). Two clones, one monoallelic and the other biallelic for the E80 deletion (named as ΔE80/ΔE80 and ΔE80/mut), were assessed for in vivo skin regeneration performance. Keratinocytes from these clones were labeled with GFP by lentiviral transduction to facilitate the monitoring of graft persistence over time. Macroscopic analysis under white and blue (GFP) light illumination of grafts 20 weeks post-grafting, when several epidermal turnover cycles had occurred, revealed clearly distinguishable human skin morphological characteristics (Fig. 7, A and B). Grafts from both clones displayed normal histopathological features with continuous dermal-epidermal attachment (Fig. 7, C and D). As shown with the polyclonal ΔE80 RDEB keratinocytes population, and consistent with the epidermal-dermal attachment observed histologically, both C7 expression (Fig. 7, E and F) and anchoring fibrils (Fig. 7, G and H) were also clearly detectable in the monoallelic and biallelic ΔE80 clonal grafts. Appropriate epidermal differentiation was confirmed by human involucrin expression immunodetection (Fig. S6, B and E). In addition to graft endurance over time, a robust p63 immunostaining also indicated that a pool of keratinocytes with persistent regenerative functionality was maintained 184 (Fig. S6, C and F). Long-term clonal skin regeneration and persistence of the corrective

92 Chapter 2

effect, as determined by this stringent stemness in vivo test, indicated that the epidermal stem cell compartment has been effectively targeted.

Figure 7. Skin regeneration, C7 expression and ultrastructural analysis of grafts from CRISPR/Cas9 edited (ΔE80) stem cell clones. Keratinocyte clones, derived from the polyclonal population of cells treated with the sg2+sg3 combination, with monoallelic (ΔE80/mut) and biallelic (ΔE80/ΔE80) E80 deletions were

93 Chapter 2

used to generate bioengineered skin equivalents and grafted to immunodeficient mice. A-B) Top: Macroscopic view of a engrafted mice 20 weeks after grafting of ΔE80/mut clone (A) and ΔE80/ΔE80 clone (B), Bottom panels: Close up view of the grafts under white and blue (GFP) light showing engrafted areas. C-D) Histological analysis (H&E) of regenerated skin from ΔE80/mut clone (C) and ΔE80/ΔE80 clone (D) Note the clear dermal-epidermal adhesion in both types of grafts. E-F) C7 immunoperoxidase expression analysis in ΔE80/mut clone (E) and ΔE80/ΔE80 clone (F) grafts. Both types of grafts display robust and continuous C7 expression. Insets show C7 expression at the boundary human-mouse skin. Note that mouse C7 is not recognized at the dilution of the antibody used. Bars: 100 µm. G-H) Electron microscopy analysis shows the presence of well-developed anchoring fibrils (arrowheads) at the dermal-epidermal junction in grafts from both types of gene edited clones. Bars: 500 nm.

h. Blistering resistance assay of gene-edited skin grafts

Mechanical strength of human skin grafts regenerated from patient P1 cells was assessed by using a suction device able to exert precisely controlled negative pressure on circular areas of 3 mm diameter. A negative pressure of 10±2 kPa 185 was applied for 5 minutes on two different points of each graft. No blistering was apparent on 12-wks grafts from sg2+sg3 RNP treated patient keratinocytes (Fig. 8, A to C). Histological analysis showed dermal-epidermal detachment after suction in grafts from unedited cells (Fig. 8D). In contrast, uninterrupted dermal-epidermal adhesion (Fig. 8E), was found after suction in ΔE80 grafts. This assay therefore provides functional proof of cutaneous fragility correction in gene-edited patient skin grafts.

Figure 8. Blister formation resistance assay. A-C) Macroscopic view of a representative ΔE80 skin graft regenerated from sg2+sg3 RNP-treated RDEB (P1) cells before (A), during (B) and after (C) the suction procedure. Black

94 Chapter 2

dotted circle line shows the human skin area where suction was applied. D-E) Histological (H&E staining) characterization of skin sections corresponding to suctioned areas from unedited (D) and ΔE80 (E) grafts. Asterisk shows blistered area. Bars: 100 µm.

4. Discussion

To date, more than 650 different mutations causing the different subtypes of RDEB have been identified within COL7A1 42, 186. Severe generalized (sev-gen) RDEB, presenting complete absence or marked deficiency of C7, is the most devastating subtype. Mutations leading to a PTC, that is, nonsense mutations or out-of-frame insertions or deletions cause sev-gen-RDEB. A large proportion of these mutations occur within the coding region of the C7 collagenous domain encompassing exons 29 to 112 187. Although the majority of COL7A1 mutations are private, a limited number have been shown to be highly prevalent. This is the case of c.6527insC at E80, which is characteristic of the Spanish and some Latin-American RDEB cohorts 38, 179. To our knowledge, this is the most prevalent COL7A1 mutation. Thus, an advanced gene editing strategy tailored to this mutation can be beneficial for a large patient cohort. In silico and experimental evidence of C7 restoration by transient and permanent exon removal at mRNA and DNA level respectively, demonstrate that exons coding for parts of the collagenous domain can be skipped, thus producing functional internally deleted C7 fit for anchoring fibrils formation 43, 154, 166. Previous attempts by our laboratory using TALE nucleases designed to permanently restore the COL7A1 reading frame in homozygous c.6527insC carrier keratinocytes by NHEJ-mediated repair clearly proved that a deletion encompassing the whole of exon 80 restored COL7A1 reading frame, resulting in a functional C7 variant 40, 154 with healthy skin regeneration capacity. In spite of the increased efficacy with respect to HDR approaches, COL7A1 frame restoration by NHEJ with TALENs was only found in approximately 1% of the isolated, expanded and genotyped epidermal stem cell clones. Although this gene editing efficacy was yet not ready for clinical application, this proof-of-principle correction of primary patient cells by NHEJ, together with additional previous evidence from other laboratories showing the functionality of E80 C7 43, 165- 167, led us to seek a more efficient gene editing strategy based on precise targeted excision of E80. Our non-viral CRISPR/Cas9 delivery protocol resulted in C7 restoration in a very large percentage (close to 85%) of RDEB keratinocytes without noticeable toxicity,

95 Chapter 2

allowing us to overcome limitations in the use of gene editing tools in hard-to-transfect primary cells. Cas9 RNP delivery systems have previously been shown to provide fast action and short permanence in the nucleus, as well as increased efficiency derived from robust nuclease activity leading to the introduction of the desired modification in a high percentage of the cells 134, 188. This technology therefore provides increased safety by not using long-lasting expression from viral vectors (e.g. adenoviral or non-integrative lentiviral), which could maintain Cas9 cleavage activity for longer than desired, thus increasing the probability of off-target indel generation. Accordingly, assessment of the safety of the strategy by deep sequencing analysis of a large number of in silico predicted off-target sites did not reveal any undesired cleavage. Concurrently, the intended DNA deletion to remove the faulty exon 80 sequence while preserving appropriate splicing motifs in adjacent introns was effected in a precise and efficient fashion, as evidenced by the very high percentage of transcripts lacking exon 80 and the absence of aberrant transcripts derived from undesired splicing events. Gene correction protocols for RDEB cells using CRISPR/Cas9 have been tried before. Delivery of CRISPR/Cas9 components as plasmids by electroporation in primary fibroblasts 161 or by polymer-mediated transfection in an immortalized keratinocytes cell line 163 required drug or marker selection to achieve mutation correction in a significant percentage of cells. Wu et al. used CRISPR/Cas9 RNP to generate an E80-deleted mouse model, proving the functionality of a C7 variant lacking exon 80, and delivered CRISPR/Cas9 RNPs to mouse skin by electroporation to address in vivo correction of RDEB. However, gene correction protocols based on CRISPR/Cas9 RNPs delivered by electroporation to primary patient keratinocytes, the main source of C7 in the skin, have not been reported. We have now demonstrated that one such protocol using RNP in combination with electroporation affords the possibility of using the whole polyclonal gene-edited keratinocyte population capable of producing therapeutic C7 levels, without the need for drug selection and isolation of corrected clones, which will facilitate its translation to the clinic. Moreover, we have proved that functional correction of patient cells has been achieved with this protocol, not only by histological analysis showing the structural integrity of the gene-edited skin grafts and ultrastructural analysis demonstrating the presence of anchoring fibrils at the BMZ, but also by showing resistance to blister formation upon negative pressure application on these grafts.

96 Chapter 2

In the present study we provide evidence, through a rigorous in vivo skin regeneration test, that epidermal stem population has been targeted. A recent study involving the replacement of a large area of skin affected by JEB showed that engraftment occurred through a limited number of holoclones not isolated beforehand 158. Conceivably, a similar clinical outcome could be anticipated using isolated and characterized bonafide stem cells. Although the feasibility of epidermal stem clonal-based therapies with either added or edited genes has been previously established preclinically by us and others 154, 173-175 and herein accomplished again, in terms of clinical applicability the use of the RNP-edited bulk population containing long-term corrected stem cells represents a clear practical advantage. As discussed above, occurrence of RDEB-causing mutations within skippable or deletable COL7A1 exons encoding C7 collagenous domain is predominant. Although in this study we have focused on E80 as the host of a highly recurrent mutation in RDEB patients, our data provide strong proof-of-concept for a strategy which should be easily transferrable to other potentially dispensable exons. Furthermore, we establish CRISPR/Cas9 delivered as RNP by electroporation as the state of the art technology for genome editing in primary keratinocytes. Overall, our results provide compelling preclinical evidence of the efficacy and safety of a novel CRISPR/Cas9-based ex vivo polyclonal gene editing approach capable of correcting a highly prevalent mutation, opening up the way to feasible gene editing- based therapy for RDEB patients that can be easily translated to the clinic.

97 Chapter 2

5. Materials and methods

a. Keratinocytes culture and isolation of clones

Patient keratinocytes were originally obtained from skin biopsies of two RDEB (RDEB-sev gen) patients carrying the c.6527insC homozygous mutation in the COL7A1 gene. Clinical features of these patients have been previously described (patients 4 and 9) 38. Skin biopsies were obtained from patients after approval from the Ethics Committee of the collaborating hospital upon informed consent. Primary human RDEB and healthy donor keratinocytes were cultured as previously described 154, 174. Human primary RDEB keratinocytes from patients P1 and P2 154 were plated onto lethally irradiated 3T3-J2 cells and cultured in keratinocyte growth cFAD medium (KCa), a 3:1 mix of Dulbecco’s modified Eagle’s and Ham’s F12 media (GIBCO-BRL, Barcelona, Spain) containing fetal bovine calf serum (Hyclone, GE Healthcare, Logan, UT) (10%), penicillin–streptomycin (1%), glutamine (2%), insulin (5 g/ml; Sigma Aldrich), adenine (0.18 mmol/l; Sigma Aldrich), hydrocortisone (0.4 g/ml; Sigma Aldrich), cholera toxin (0.1 nmol/l; Sigma Aldrich), triiodothyronine (2 nmol/l; Sigma Aldrich), EGF (10 ng/ml; Sigma Aldrich) and Y-27632 ROCK inhibitor (Sigma Aldrich) at 10µM. To obtain isolated clones, cells were then trypsinized and plated at low density in 100 mm plates (103cells/plate) with 2x106 lethally irradiated 3T3 feeder cells per plate. Cell clones were then collected using polystyrene cloning cylinders (Sigma, St Louis, MO) and expanded for further analysis. Clonal keratinocytes were GFP labeled using a PGK-EGFP lentiviral vector as previously described 189 to allow better visualization and follow up of regenerated human skin after grafting.

b. CRISPR/Cas9 delivery

sgRNAs were designed using a CRISPR design online tool (http://crispr.mit.edu/). Synthetic RNAs and recombinant Cas9 were purchased from Integrated DNA technologies (IDT, Illinois) and RNP complexes were reconstituted according to manufacturer instructions and delivered to the RDEB patient primary keratinocytes by nucleofection using the Neon® Transfection System 10 µl Kit (Thermo Fisher Scientific). Primary cells were trypsinized and washed with PBS. 1.5 x 105 primary keratinocytes were resuspended in 10µl of Resuspension Buffer R for each reaction and RNP complexes were added to each sample (72.7 pmol crRNA(sgRNA):tracrRNA, 10.9

98 Chapter 2

pmol Cas9, 6.6:1 molar ratio). Two electroporation conditions were tested: 1150v/30ms/2 pulses (condition A) and 1700v/20ms/1 pulse (condition B). After electroporation, cells were seeded into 6-well plates containing feeder layer and pre- warmed KCa medium.

c. Genotyping of gene-edited keratinocytes

Genomic DNA was isolated by isopropanol precipitation of keratinocyte lysates (lysis buffer was Tris pH8 100 mM, EDTA 5 mM, SDS 0.2%, NaCl 200 mM, 1mg/ml proteinase K (Roche Diagnostics, Mannheim, Germany) and resuspended in TE buffer. Approximately 20-50 ng of genomic DNA were used for PCR amplification. PCR fragments spanning the nuclease target sites were generated with primers F1/R. F1: 5’- gtgagtggtggctgaagcac-3’; R: 5’-accccaccaaggaaactga-3’. PCR program TD 68-63 was: 94oC for 5 minutes, 5 cycles of 94oC for 30 seconds, 68oC for 30 seconds, 72oC for 30 seconds, decreasing annealing temperature 1oC every cycle, followed by 30 cycles of 94oC for 30 seconds, 63oC for 30 seconds, 72oC for 30 seconds, then 72oC for 7 minutes. PCR products were analyzed in 1.5% agarose gel. Molecular weight marker was IX (Sigma-Aldrich). For sequencing, PCR products were treated with illustra™ ExoProStar™( GE Healthcare, UK), sequenced using Big Dye Terminator V.1.1 Cycle Sequencing kit (Thermo Fisher, Waltham, MA), and examined on a 3730 DNA Analyser (Life Technologies, Carlsbad, CA). Chromatograms were analyzed using Sequencher (Gene Codes, Ann Harbor, MI) and Chromas (Technelysium, Australia) software. Bio- Rad Image Lab Software 6.0 was used for PCR band densitometry.

d. Genome editing off-target analysis by NGS

On-target and potential off-target sites were designed, sequenced and analyzed using the Thera-Seq(TM) genotyping services (Desktop Genetics). Sequencing libraries were prepared and subjected to paired-end sequencing on a MiSeq using Reagent Kit v2 (500- cycles) (Illumina).

e. COL7A1 transcription analysis by RT-PCR and RT-PCR.

Total RNA was extracted from keratinocytes with miRNeasy Mini Kit (Qiagen, Hilden, Germany), and complementary DNA (cDNA) was synthesized using the

99 Chapter 2

SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). The following primers: F: 5′- aggggtcaggacggcaac -3′ and R: 5′- cagctccagtaggtccagtcag -3′, were used to amplify 241 (unedited) and 205 (exon 80 deleted) bp fragments spanning exons 78-84 of COL7A1. The PCR program was 94oC for 5 minutes, 5 cycles of 94oC for 30 seconds, 68oC for 30 seconds, 72oC for 30 seconds, decreasing annealing temperature 1oC every cycle, followed by 25 cycles of 94oC for 30 seconds, 63oC for 30 seconds, 72oC for 30 seconds, then 72oC for 7 minutes. The human glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) was analyzed as a loading control with GAPDH- specific primers: F: 5´-accacagtccatgccatcac-3´ and R: 5´-tccaccaccctgttgctgt-3´. For the qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe) and Hs02758991_g1 (GAPDH probe, control). Amplification was performed using a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems).

f. Western blot analysis.

Keratinocytes were lysed in protein extraction buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% Nonidet P-40, 4 mM EDTA) containing proteinase inhibitors cocktail (Complete Mini, EDTA-free; Roche Diagnostics, Mannheim, Germany). Lysates were incubated for 30 minutes on ice and centrifuged at 15,000×g for 30 minutes at 4°C. Supernatants were collected and protein concentrations were measured using the Bradford assay (BioRad, Hercules, CA). For each sample, 40 µg of total protein was resolved on NuPAGE® Novex 3-8% Tris-Acetate gel electrophoresis (Invitrogen, Carlsbad, CA) and electrotransferred to nitrocellulose membranes (Invitrogen, Carlsbad, CA). For type VII collagen analysis, blots were probed with a monospecific polyclonal anti C7 antibody (a generous gift from Dr A. Nystrom; University of Freiburg). An antibody against GAPDH was used as a loading control. Visualization was performed by incubating with HRP-conjugated anti-rabbit antibody (Amersham, Burlington, MA) and West Pico Chemiluminescent Substrate (Pierce, Rockford, IL).

g. Immunofluorescence and immunohistochemical staining.

For immunofluorescence detection of C7 in keratinocytes, cells grown on glass coverslips were fixed in methanol/acetone (1:1) for 10 minutes at -20ºC. After washing

100 Chapter 2

three times in phosphate-buffered saline (PBS) and once in PBS with 3% bovine serum albumin (BSA) (Sigma Aldrich, St Louis, MO) for 30 minutes, cells were incubated with monospecific polyclonal anti C7 antibody at 1:5000 dilution. Secondary antibody (AlexaFluor488, Invitrogen, Carlsbad, CA) was used at 1/1000 dilution. After the final washing step in PBS, preparations were mounted using Mowiol (Hoechst, Somerville, NJ) mounting medium and DAPI 20µg/ml (Sigma Aldrich, St Louis, MO) for nuclei visualization. Immunoperoxidase detection of C7 in paraffin-embedded, formalin-fixed sections was carried out with proteinase K antigen retrieval as described 190. Immunoperoxidase staining for human involucrin and p63 was performed using rabbit SY5 monoclonal antibody (Sigma) and 4A4 monoclonal antibody respectively on paraffin sections without antigen retrieval. The ABC peroxidase kit (Vector) with Diaminobenzidine as a substrate was used to developing reagent.

h. Electron Microscopy.

Specimens of ca. 0.4 x 0.3cm were fixed for at least 2h at room temperature in 3% glutaraldehyde solution in 0.1M cacodylate buffer pH 7.4, cut into pieces of ca. 1mm3, washed in buffer, postfixed for 1 h at 4ºC in 1% osmium tetroxide, rinsed in water, dehydrated through graded ethanol solutions, transferred into propylene oxide, and embedded in epoxy resin (glycidether 100). Semi-thin and ultrathin sections were cut with an ultramicrotome (Reichert Ultracut E). Ultrathin sections were treated with uranyl acetate and lead citrate, and examined with an electron microscope (JEM 1400) equipped with a 2k CCD camera (TVIPS).

i. Generation of skin equivalents, grafting onto immunodeficient mice and graft analysis.

Animal studies were approved by our institutional animal care and use committee according to national and European legal regulations. CRISPR/Cas9 RNP treated keratinocytes (polyclonal or monoclonal populations) were seeded on fibrin dermal equivalents containing RDEB fibroblasts null for C7 expression prepared as previously described 182. Bioengineered skin equivalents were grafted onto the back of 7-week-old female immunodeficient mice (nu/nu, NMRI background) purchased from Elevage-Janvier (France) as previously described 174. Grafting was performed under sterile conditions and mice were housed in pathogen-free

101 Chapter 2

conditions for the duration of the experiment at the CIEMAT Laboratory Animals Facility (Spanish registration number 28079-21 A). Animals were housed in individually ventilated type II cages, with 25 air changes per hour and 10 kGy gamma irradiated soft wood pellets as bedding. All handling was carried out under sterile conditions, and all experimental procedures were according to European and Spanish laws and regulations. Grafts were monitored using a magnifying lens equipped with white and blue light to allow EGFP visualization. Mice were sacrificed at different time points post grafting and grafts harvested for skin histology, immunohistochemistry analyses and electron microscopy studies.

j. In vivo skin fragility test

A suction device developed in our laboratory was set up to exert a negative pressure of 10±2 kPa on a 3mm diameter area for 5 minutes to induce blister formation onto human skin grafts regenerated in immunodeficient mice 12 weeks after grafting. Two mice bearing grafts from unedited and two from sg2+sg3 RNP-treated keratinocytes were used. Suction was applied on two different sites for each graft. Before applying suction, to promote blister formation, an incandescent light bulb was set on top of the graft area approximately 2 cm away for 2 minutes 191. After that, the bulb was kept on for the entire duration of the experiment. The suctioned area was photographed 10 minutes after suctioning and excised for histological analysis.

6. Acknowledgements

The study was mainly supported by DEBRA International – funded by DEBRA Austria (grant termed as Larcher 1). Additional funds came from Spanish grants SAF2017-86810-R and PI17/01747, from Ministry of Economy and Competitiveness and Instituto de Salud Carlos III respectively, both co-funded with European Regional Development Funds (ERDF), ERA-NET E-RARE JTC 2017 (MutaEB) and CIBERER (grant termed as Murillas-TERAPIAS ER2017).. Authors are indebted to Blanca Duarte, Almudena Holguín and Nuria Illera for grafting experiments and to Jesus Martínez and Edilia De Almeida for animal maintenance and care.

102 Chapter 2

7. Authors' contributions

JB, AM, RM and FL designed the experiments. JB, AM, MG, RT, SR, ECS and SM performed molecular and cellular studies. MDR and MJE contributed to discussion of experimental results and provided reagents and ethical approval for the studies. MG, JB, FL performed animal experiments and histological analysis. MC and CL contributed to data analysis and critical review of the manuscript. IH performed the electron microscopy analysis. LM and MG developed the suction device and performed the in vivo skin fragility test. JB, AM, FL and RM wrote the manuscript.

8. Conflict of interests

The authors declare no conflict of interests.

103 Chapter 2

9. References

1. Fine, JD, Bruckner-Tuderman, L, Eady, RA, Bauer, EA, Bauer, JW, Has, C, et al. (2014). Inherited epidermolysis bullosa: updated recommendations on diagnosis and classification. J Am Acad Dermatol 70: 1103-1126. 2. Bauer, JW, Koller, J, Murauer, EM, De Rosa, L, Enzo, E, Carulli, S, et al. (2017). Closure of a Large Chronic Wound through Transplantation of Gene-Corrected Epidermal Stem Cells. J Invest Dermatol 137: 778-781. 3. Hirsch, T, Rothoeft, T, Teig, N, Bauer, JW, Pellegrini, G, De Rosa, L, et al. (2017). Regeneration of the entire human epidermis using transgenic stem cells. Nature. 4. Mavilio, F, Pellegrini, G, Ferrari, S, Di Nunzio, F, Di Iorio, E, Recchia, A, et al. (2006). Correction of junctional epidermolysis bullosa by transplantation of genetically modified epidermal stem cells. Nat Med 12: 1397-1402. 5. Siprashvili, Z, Nguyen, NT, Gorell, ES, Loutit, K, Khuu, P, Furukawa, LK, et al. (2016). Safety and Wound Outcomes Following Genetically Corrected Autologous Epidermal Grafts in Patients With Recessive Dystrophic Epidermolysis Bullosa. Jama 316: 1808-1817. 6. Osborn, MJ, Starker, CG, McElroy, AN, Webber, BR, Riddle, MJ, Xia, L, et al. (2013). TALEN-based gene correction for epidermolysis bullosa. Mol Ther 21: 1151- 1159. 7. Webber, BR, Osborn, MJ, McElroy, AN, Twaroski, K, Lonetree, CL, DeFeo, AP, et al. (2016). CRISPR/Cas9-based genetic correction for recessive dystrophic epidermolysis bullosa. NPJ Regenerative medicine 1. 8. Izmiryan, A, Danos, O, and Hovnanian, A (2016). Meganuclease-Mediated COL7A1 Gene Correction for Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol 136: 872-875. 9. Hainzl, S, Peking, P, Kocher, T, Murauer, EM, Larcher, F, Del Rio, M, et al. (2017). COL7A1 Editing via CRISPR/Cas9 in Recessive Dystrophic Epidermolysis Bullosa. Mol Ther. 10. Chamorro, C, Mencia, A, Almarza, D, Duarte, B, Buning, H, Sallach, J, et al. (2016). Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes. Mol Ther Nucleic Acids 5: e307. 11. Mencia, A, Chamorro, C, Bonafont, J, Duarte, B, Holguin, A, Illera, N, et al. (2018). Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells. Mol Ther Nucleic Acids 11: 68-78. 12. Hovnanian, A, Rochat, A, Bodemer, C, Petit, E, Rivers, CA, Prost, C, et al. (1997). Characterization of 18 new mutations in COL7A1 in recessive dystrophic epidermolysis bullosa provides evidence for distinct molecular mechanisms underlying defective anchoring fibril formation. Am J Hum Genet 61: 599-610. 13. Cuadrado-Corrales, N, Sanchez-Jimeno, C, Garcia, M, Escamez, MJ, Illera, N, Hernandez-Martin, A, et al. (2010). A prevalent mutation with founder effect in Spanish Recessive Dystrophic Epidermolysis Bullosa families. BMC Med Genet 11: 139. 14. Escamez, MJ, Garcia, M, Cuadrado-Corrales, N, Llames, SG, Charlesworth, A, De Luca, N, et al. (2010). The first COL7A1 mutation survey in a large Spanish dystrophic epidermolysis bullosa cohort: c.6527insC disclosed as an unusually recurrent mutation. Br J Dermatol 163: 155-161.

104 Chapter 2

15. Bornert, O, Kuhl, T, Bremer, J, van den Akker, PC, Pasmooij, AM, and Nystrom, A (2016). Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy. Mol Ther 24: 1302-1311. 16. Turczynski, S, Titeux, M, Tonasso, L, Decha, A, Ishida-Yamamoto, A, and Hovnanian, A (2016). Targeted Exon Skipping Restores Type VII Collagen Expression and Anchoring Fibril Formation in an In Vivo RDEB Model. J Invest Dermatol 136: 2387- 2395. 17. Wu, W, Lu, Z, Li, F, Wang, W, Qian, N, Duan, J, et al. (2017). Efficient in vivo gene editing using ribonucleoproteins in skin stem cells of recessive dystrophic epidermolysis bullosa mouse model. Proc Natl Acad Sci U S A 114: 1660-1665. 18. Ousterout, DG, Kabadi, AM, Thakore, PI, Majoros, WH, Reddy, TE, and Gersbach, CA (2015). Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat Commun 6: 6244. 19. Pellegrini, G, Dellambra, E, Golisano, O, Martinelli, E, Fantozzi, I, Bondanza, S, et al. (2001). p63 identifies keratinocyte stem cells. Proc Natl Acad Sci U S A 98: 3156-3161. 20. Petrof, G, Lwin, SM, Martinez-Queipo, M, Abdul-Wahab, A, Tso, S, Mellerio, JE, et al. (2015). Potential of Systemic Allogeneic Mesenchymal Stromal Cell Therapy for Children with Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol 135: 2319- 2321. 21. van den Akker, PC, Jonkman, MF, Rengaw, T, Bruckner-Tuderman, L, Has, C, Bauer, JW, et al. (2011). The international dystrophic epidermolysis bullosa patient registry: an online database of dystrophic epidermolysis bullosa patients and their COL7A1 mutations. Hum Mutat 32: 1100-1107. 22. Wertheim-Tysarowska, K, Sobczynska-Tomaszewska, A, Kowalewski, C, Skronski, M, Swieckowski, G, Kutkowska-Kazmierczak, A, et al. (2012). The COL7A1 mutation database. Hum Mutat 33: 327-331. 23. Stenson, PD, Mort, M, Ball, EV, Evans, K, Hayden, M, Heywood, S, et al. (2017). The Human Gene Mutation Database: towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Hum Genet 136: 665-677. 24. Rodriguez, FA, Gana, MJ, Yubero, MJ, Zillmann, G, Kramer, SM, Catalan, J, et al. (2012). Novel and recurrent COL7A1 mutations in Chilean patients with dystrophic epidermolysis bullosa. J Dermatol Sci 65: 149-152. 25. Turczynski, S, Titeux, M, Pironon, N, and Hovnanian, A (2012). Antisense- mediated exon skipping to reframe transcripts. Methods Mol Biol 867: 221-238. 26. Bremer, J, Bornert, O, Nystrom, A, Gostynski, A, Jonkman, MF, Aartsma-Rus, A, et al. (2016). Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa. Mol Ther Nucleic Acids 5: e379. 27. Kim, S, Kim, D, Cho, SW, Kim, J, and Kim, JS (2014). Highly efficient RNA- guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res 24: 1012-1019. 28. Seki, A, and Rutz, S (2018). Optimized RNP transfection for highly efficient CRISPR/Cas9-mediated gene knockout in primary T cells. J Exp Med 215: 985-997. 29. Droz-Georget Lathion, S, Rochat, A, Knott, G, Recchia, A, Martinet, D, Benmohammed, S, et al. (2015). A single epidermal stem cell strategy for safe ex vivo gene therapy. EMBO Mol Med 7: 380-393. 30. Duarte, B, Miselli, F, Murillas, R, Espinosa-Hevia, L, Cigudosa, JC, Recchia, A, et al. (2014). Long-term skin regeneration from a gene-targeted human epidermal stem cell clone. Mol Ther 22: 1878-1880.

105 Chapter 2

31. Larcher, F, Dellambra, E, Rico, L, Bondanza, S, Murillas, R, Cattoglio, C, et al. (2007). Long-term engraftment of single genetically modified human epidermal holoclones enables safety pre-assessment of cutaneous gene therapy. Mol Ther 15: 1670- 1676. 32. Di Nunzio, F, Maruggi, G, Ferrari, S, Di Iorio, E, Poletti, V, Garcia, M, et al. (2008). Correction of laminin-5 deficiency in human epidermal stem cells by transcriptionally targeted lentiviral vectors. Mol Ther 16: 1977-1985. 33. Niskanen, J, Dillard, K, Arumilli, M, Salmela, E, Anttila, M, Lohi, H, et al. (2017). Nonsense variant in COL7A1 causes recessive dystrophic epidermolysis bullosa in Central Asian Shepherd dogs. PLoS One 12: e0177527. 34. Llames, SG, Del Rio, M, Larcher, F, Garcia, E, Garcia, M, Escamez, MJ, et al. (2004). Human plasma as a dermal scaffold for the generation of a completely autologous bioengineered skin. Transplantation 77: 350-355. 35. Hatje, LK, Richter, C, Blume-Peytavi, U, and Kottner, J (2015). Blistering time as a parameter for the strength of dermoepidermal adhesion: a systematic review and meta- analysis. Br J Dermatol 172: 323-330.

106 Chapter 2

10. Supplementary Data

Supplementary Figure 1. Next Generation Sequencing of PCR amplicons spanning the double cleavage site for in depth characterization of repair events at the on-target region. Percentage of reads corresponding to the most frequent indel variants common to all samples are shown. Total percentage of variants lacking E80 (ΣΔE80) are indicated below.

Supplementary Figure 2. Frequencies of indel detection for the 50 highest ranking off-target sites. Percentages of indel-containing NGS reads are shown for each site and sample. Frequencies above the 0.52% threshold are highlighted in red. On-target NGS frequencies are shown in grey (top row).

107 Chapter 2

Supplementary Figure 3. Immunodetection of C7 in primary RDEB patient P1 keratinocytes treated with different RNP combinations. A) Double immunofluorescence C7/K14 staining showing the extent of C7 expressing cells after treatment with the different RNPs. Keratin-14 (green) was used to distinguish keratinocytes. B) Percentage of C7-expressing RNP-treated keratinocytes detected by flow cytometry after immunolabeling with anti-C7 antibody.

108 Chapter 2

Supplementary Figure 4. Histopathological and immunohistochemical analysis of grafts produced with keratinocytes modified with additional RNP combinations. (A, D) H&E staining of 12-week-old grafts from RDEB keratinocytes modified with sg2+sg4 (A) and sg1+sg3 (D) RNP pairs. (B, E) h-Involucrin immunohistochemical detection in grafts from polyclonal keratinocytes treated with sg2+sg4 (B) and sg1+sg3 (E). (C, F) C7 immunoperoxidase detection in grafts from polyclonal keratinocytes treated with sg2+sg4 (C) and sg1+sg3 (F) treated RDEB keratinocytes. Grafts generated with RDEB keratinocytes treated with the combination sg2+sg4 show scattered microblisters (arrows) (A, C) concomitant with the lower and patchy C7 expression (C). Grafts generated with the combination sg1+sg3 (D, F) do not show blistering signs (D) and display continuous C7 expression (F). Hu and Mo correspond to human and mouse tissue, respectively. Bars: 100 µm.

109 Chapter 2

Supplementary Figure 5. DNA, RNA and protein characterization of mono-allelically and bi- allelically E80-deleted clones. (A) PCR genotype of the 11 isolated E80-deleted clones, showing alleles lacking E80 (lower band). (B) RT-PCR of variants of transcripts present in the two clones. Biallelically modified clone showed only shorter ΔE80-transcripts. (C) COL7A1 alleles revealed by Sanger sequencing in each edited clone (D) Immunofluorescence detection of C7 expression in both edited clones Bars: 50 µm. (E) qPCR quantification of COL7A1 expression with two different exon-specific probes. (F) Western Blot protein expression quantification of the sg2+sg3 pool and the two isolated clones.

110 Chapter 2

Supplementary Figure 6. Additional phenotypic characterization of clonal mono and bi-allelic ΔE80 grafts. (A, D), Histology (H&E staining). (B, E) human involucrin expression and (C, F) p63 expression at the Human (Hu), mouse (Mo) boundary. These markers demonstrate that clonal grafts maintain normal features of epidermal differentiation and long-term skin regenerative performance. Top panels: Monoallelic correction (ΔE80/mut) clone. Lower panels: Biallelic correction (ΔE80/ ΔE80) clone. Bars: 100 µm.

Supplementary Figure 7. Cleavage plane analysis in suction-induced blisters in control and gene edited RDEB grafts. Immunofluorescence of C7 (A, B) and C4 (C, D) was performed in blisters induced in normal human (A, C) and ΔE80 RDEB (B, D) keratinocyte grafts. C7 (A, B) and C4 at the floor of the blister demonstrates cleavage between basal keratinocyte and lamina lucida. The asterisks indicate dermal-epidermal separation. Bars: 50 µm.

111

112 Chapter 3

Chapter 3

Selection-free Homology Directed Repair-based COL7A1 gene correction in primary cells as

therapeutic option for RDEB

Jose Bonafont, Angeles Mencía, Wai Srifa, Sriram Vaidyanathan, Rosa Romano, Marta Garcia, Rosario Hervás, Laura Ugalde, Esteban Chacón, Blanca Duarte, Matthew H Porteus, Marcela Del Rio, Fernando Larcher and Rodolfo Murillas

113

114 Chapter 3

Selection-free Homology Directed Repair- based COL7A1 gene correction in primary cells as therapeutic option for RDEB

Jose Bonafont1,2,3, Angeles Mencía2,3, Wai Srifa4, Sriram Vaidyanathan4, Rosa Romano4, Marta Garcia1,2,3, Rosario Hervás3, Laura Ugalde3, Esteban Chacón1,2,3, Blanca Duarte2,3,5, Matthew H Porteus4, Marcela Del Rio1,2,3,5, Fernando Larcher1,2,3,5 and Rodolfo Murillas2,3,5

Affiliations: 1. Department of Biomedical Engineering, Carlos III University (UC3M) Madrid. Spain. 2. Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER) U714, Madrid. Spain. 3. Fundación Instituto de Investigación Sanitaria de la Fundación Jiménez Díaz, Madrid. Spain. 4. Department of Pediatrics, Stanford University, Stanford, California, USA. 5. Epithelial Biomedicine Division, Centro de Investigaciones Energéticas Medioambientales y Tecnológicas (CIEMAT), Madrid. Spain.

Correspondence to: Fernando Larcher ([email protected]) and Rodolfo Murillas ([email protected]).

Running title: Homology-directed Repair-gene editing for RDEB

115 Chapter 3

1. Abstract

Genome editing technologies allow the introduction of precise changes into DNA sequences and have the potential to give rise to a new class of treatments for genetic diseases. Epidermolysis bullosa is a group of rare genetic disorders characterized by the loss of skin adhesion. The Recessive Dystrophic subtype of EB (RDEB) is caused by mutations in COL7A1, target for many gene and cell therapies that have been proposed. Here, we report an efficient and versatile gene editing approach for ex vivo homology- directed repair-based (HDR) gene correction using the CRISPR/Cas9 system, delivered as a ribonucleoprotein complex (RNP), in combination with an Adeno-associated viral vector (AAV)-delivered donor template. This protocol provided relevant gene correction efficiencies in RDEB primary keratinocytes containing different mutations along the COL7A1 gene, and also, in healthy cord blood-derived CD34+ cells and mesenchymal stem cells (MSCs). These results showed a proof-of-concept for gene correction in other cell types with therapeutic potential. HDR correction frequencies over 40% were achieved in primary RDEB keratinocytes, an efficacy sufficient to reach therapeutic benefits and amelioration of the disease phenotype. Type VII collagen expression was observed in regenerated skin grafts from edited bulk RDEB keratinocytes population, with normal skin structure and differentiation. Therefore, this gene therapy approach offers a clinically relevant solution for precise regenerative medicine therapies focused on EB treatment.

116 Chapter 3

2. Introduction

Epidermolysis Bullosa is a group of rare genetic diseases characterized by devastating skin fragility. The recessive dystrophic subtype, RDEB, displays a very severe phenotype, with clinical manifestations including skin and mucous blistering formation, pseudosyndactyly and a high risk of metastatic squamous cell carcinoma development. Mutations along COL7A1, the gene encoding Type VII collagen (C7), are present in all DEB patients, making this gene a target for precision medicine therapies in RDEB192. In recent years different site-specific nucleases able to perform DNA double strand breaks, such as meganucleases (MN), zinc-finger nucleases (ZFNs), transcriptor activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR/Cas9), have been used as tools to induce gene sequence modification. Genome-editing-based approaches take advantage of cellular DNA repair mechanisms triggered by nuclease-induced DSBs to introduce indels in the gene sequence (NHEJ) or to precisely correct it by means of a donor DNA template sequence (HDR). NHEJ is the most common DNA repair mechanism, but recent molecular tool advances have increased the efficiencies of HDR-based gene correction strategies143, 146, 193. Skin keratinocytes and fibroblasts have been highlighted as the main cellular targets for EB gene therapy. HDR-based protocols using TALENs and oligonucleotide donors (ODN) demonstrated gene correction in RDEB patient-derived fibroblasts, although with limited efficacy (2%)160. Similar approaches using meganucleases 162 or minicircle- based CRISPR/Cas9 delivery 163 achieved comparable success. Higher COL7A1 editing rates have recently been reported using integration-deficient lentiviral vectors for both CRISPR/Cas9 and donor template delivery to correct a mutation in exon 2 194, showing 11% and 15.7% of corrected COL7A1 transcripts with no antibiotic selection, in keratinocytes and fibroblasts respectively. Recently, efficient HDR-based COL7A1 correction has been achieved in induced pluripotent stem cells (iPSC) derived from RDEB patient-cells, showing bi-allelic correction in close to 60% of the treated cells195. Restoration of LAMB3 expression in Junctional Epidermolysis Bullosa (JEB) immortalized keratinocytes has also been attempted by HDR using an adenoviral vector carrying-Cas9/guide RNA (gRNA) tailored to the intron 2 of LAMB3 gene and an integration defective lentiviral vector (IDLVs) bearing a promoterless quasi-complete LAMB3 cDNA flanked by homology

117 Chapter 3

arms196. Despite the fact that these approaches represent significant contributions toward establishing HDR-based preclinical protocols, gene correction within useful therapeutic ranges in primary cells available already in the clinic, has not been reported yet. Our group recently achieved NHEJ-based C7 restoration by deleting a mutation- containing exon in primary RDEB keratinocytes (close to 85%) using the CRISPR/Cas9 system delivered as RNP by electroporation101. Although our NHEJ-based approach has clear clinical translation potential for RDEB patients carrying mutations in small exons within COL7A1 collagenous domain101, HDR–based protocols offer more precise correction of the gene sequence. In addition, a single set of gene editing tools allows the correction of a wider number of mutations, as long as they are within the length of the designed donor template, thus being potentially useful for a larger cohort of RDEB patients. In this context, AAVs have taken the lead as vectors for donor template delivery offering higher efficiencies than IDLVs and increasing HDR ratios, but without compromising biosafety. Thus, the combination of AAVs with CRISPR/Cas9 can be considered as an optimal genome editing tool kit for HDR correction in primary patient cells. Due to the extensive multiorgan effect in EB patients, clinical protocols complementary to therapeutic approaches focused solely on the skin have been pursued. Allogenic bone marrow transplantation (BMT) has shown therapeutic benefit in RDEB patients86, 87, 185, 197-199, although the mechanisms underlying symptomatic relief have not yet been elucidated. Furthermore, BMT with subsequent infusions of systemic MSCs has demonstrated amelioration of the RDEB phenotype with acceptable safety for the recipients 197. Remarkably, some of the patients undergoing this medical protocol presented gain of primitive anchoring fibrils (AF) and increased C7 immunostaining. Although the potential C7-producing bone marrow component is not well defined, Fujita and collaborators suggested a possible role of CD34+ cells in the expression of human skin proteins, such as Col17198, and it is known that MSCs contribute to healing and could support C7 production200. Thus, given the potential therapeutic value of CD34+ and MSC cells in EB management, we have also explored HDR-based gene editing in these cell types, achieving high gene correction rates comparable to those demonstrated in primary keratinocytes. Altogether, this study proves the feasibility of efficient ex vivo marker-free HDR-based gene correction of different cell types relevant to RDEB treatment.

118 Chapter 3

3. Results

a. Highly efficient DNA nuclease activity in the vicinity of the c.6527insC mutation using CRISPR/Cas9 RNP complexes delivered into primary RDEB cells

Since HDR is greatly enhanced by generating double strand breaks near target sites, we tested the DNA cutting efficiency of CRISPR/Cas9 RNPs with an RNA guide, sg2, which was previously validated in our NHEJ-based exon deletion strategy 101 with respect to efficiency and biosafety. For this purpose, we employed a chemically- modified, single molecule guide RNA (sgRNA) rather than the dual component crRNA:tracrRNA used in our previous study. This guide targets intron 79 from 7 bp to the pathogenic exon 80 (Figure 1A). To avoid NHEJ-induced indels and rearrangements after HDR-mediated gene correction, we eliminated the DNA sequence of intron 79 from our donor template design, thus removing the CRISPR target sequence from recombinant alleles. Sg2-RNPs were delivered by electroporation into primary RDEB keratinocytes and NHEJ-mediated indel generation was assessed by TIDE analysis of Sanger sequencing chromatograms of PCR amplicons spanning the target region. This analysis showed that up to 85% of COL7A1 alleles carried indels at the intended position in primary keratinocytes electroporated with RNPs (experiment performed in duplicate, 72.6% and 85.6% of sequences were estimated to contain indels in each technical replicate; figure 1B).

119 Chapter 3

Figure 1. CRISPR/Cas9-based design targeting intron 79 of COL7A1. A) HDR-based strategy for precise COL7A1 correction. AAV6-delivered donor template in combination with CRISPR/Cas9 as a gene editing strategy. CRISPR/Cas9-induced ds-breaks in the proximity of pathogenic mutations trigger HDR repair. Yellow ray indicates RNP electroporation delivery. LHA is Left Homology Arm and RHA is Right Homology Arm. B) TIDE analysis of indel generation within intron 79 of COL7A1 in primary keratinocytes nucleofected with CRISPR/Cas9 RNPs. Estimated percentage of sequences carrying insertions or deletions is shown. Each graph shows one independent experiment.

120 Chapter 3

b. AAV transduction optimization and HDR-based gene correction in primary patient keratinocytes

To assess the most suitable AAV serotype for patient keratinocyte transduction with donor template DNA, we evaluated the efficiency of a wide array of AAV serotypes (AAV 1,2,5,6,7,8,9 and DJ; figure 2A) to transduce human keratinocytes with a construct for GFP expression. Flow cytometry analysis revealed that AAV6 was the most effective serotype and it was therefore used to package our HDR constructs. Once the electroporation and transduction conditions had been set, RDEB primary keratinocytes were electroporated with the sg2 RNP and then transduced with AAV6 vectors carrying the HDR donor templates. Two different donor template designs were tested: one with symmetric (Sym) and the other with asymmetric (Asym) homology arms, spanning COL7A1 exons E74 to E84 and E77 to E88 respectively. For both designs, homology arms flanked a fusion of exons 79 and 80, so that the recombinant allele would lack intron 79, thus avoiding the appearance of indels at the recombinant allele and providing a simple genotyping strategy (Figure 1A). Treated keratinocyte DNA was analyzed by PCR, cloning and Sanger sequencing, which showed that close to 40% of COL7A1 alleles had been corrected for the c.6527insC mutation in E80 (Figure 2B). No significant difference in gene correction efficacy was observed between the two donor templates analyzed (Figure 2B).

121 Chapter 3

Figure 2. A) Transduction efficacy of different AAV serotypes in primary keratinocytes. We evaluated 8 different serotypes of AAV, with AAV6 showing the highest transduction rate (39.7%). B) PCR genotyping in primary RDEB keratinocytes. Uncorrected (upper band; red arrow) and corrected (lower band; green arrow) alleles were found in cells treated with AAV and CRISPR/Cas9.

c. C7 expression after HDR-based correction in RDEB primary keratinocytes

Highly efficient COL7A1 gene correction should lead to C7 expression in a significant proportion of patient cells within the edited keratinocytes bulk population. To verify C7 restoration after our gene editing procedure, we analyzed C7 expression by immunofluorescence and western blot in RDEB keratinocytes treated with the sg2 RNP and transduced with the two different AAV6-delivered donor templates. The number of C7-expressing cells detected by immunofluorescence analysis (Figure 3A) was consistent with the observed HDR-mediated gene correction frequency shown by PCR and Sanger sequencing (approximately 40%) (Figure 2B). Accordingly, western blot analysis from

122 Chapter 3

cellular extracts further demonstrated C7 expression with both donor templates in a manner similar to the healthy donor keratinocytes sample. This suggests we could use both donor templates to treat RDEB primary cells, thus increasing the population of RDEB patients that could potentially benefit from this gene therapy treatment strategy. To study gene expression more in depth, we analyzed COL7A1 transcripts by RT- PCR and NGS from all the samples, and we observed high expression of precisely corrected COL7A1 transcripts in all the CRISPR/Cas9-treated samples, with over 60% of corrected transcripts frequencies (Figure 3C). This frequency is higher than DNA gene correction ratio as determined by PCR (figure 2B), probably because corrected transcripts are more stable than non-corrected ones, which are degraded by cellular control mechanisms such as Nonsense-mediated mRNA decay (NMD). Our analysis also revealed the presence of transcripts lacking exon 80 (ΔE80) as a consequence of the high sg2 guide indel generation activity in the proximity of the exon (7 bp from the exon), which resulted in indels that can be affecting the acceptor site of the splicing. C7- lacking E80 molecules are also contributing to total C7 protein expression. Thus, all the treated samples showed at least 85% of transcripts leading to functional C7 protein variants (Figure 3C). The regenerative capacity of gene-corrected RDEB keratinocytes was tested by means of a colony-forming efficiency assay. We found that the proposed genome editing protocol did not impair the proliferative capacity of edited keratinocytes compared to non-treated ones from RDEB P1 (Figure S1).

123 Chapter 3

Figure 3. Collagen VII expression in gene corrected RDEB polyclonal keratinocytes population. RDEB primary keratinocytes were treated with CRISPR/Cas9 and donor template containing-AAV6 and C7 expression restoration was assessed by immunofluorescence and western blot from cellular extracts. A) C7 immunofluorescence analysis. Left, upper panel: Positive control, healthy donor keratinocytes. Right, upper panel: Untreated RDEB P1 keratinocytes, showing lack of C7 expression. Left, lower panel: AAV6-symmetrical donor plus RNP treated RDEB keratinocytes. Right, lower panel: AAV6-asymmetrical donor template plus RNP treated RDEB keratinocytes. Bars: 50 µm. B) Western blot analysis o f C7 restoration in untreated, healthy and treated RDEB patient cells, showing C7 expression consistent with the immunofluorescence images. C) NGS analysis of COL7A1 transcripts in gene edited-

124 Chapter 3

keratinocytes populations. Precisely-corrected transcripts (Corrected) are the most abundant in all the treated samples. Transcripts lacking E80 (ΔE80) are also present due to the effect of the highly efficient indel generation activity of sg2 guide.

d. Long-term skin engraftment and functional C7 correction of gene corrected RDEB keratinocytes

The high percentage of cells expressing C7 after RNP and AAV6 treatment should be sufficient to achieve skin adhesion restoration. To assess this, in vivo skin regeneration assays were performed. Healthy, non-treated and gene edited bulk keratinocyte population, combined with C7 null RDEB fibroblasts from the same RDEB patient, were used to generate skin equivalents that were transplanted onto immunodeficient mice. Histological analysis showed normal skin architecture in grafts from healthy and gene edited keratinocytes (Figure 4C, E), while blisters were observed in grafts from untreated patient 1 (Figure 4A). Immunohistochemical analysis did not detect C7 in regenerated tissue from non-treated keratinocytes from RDEB Patient 1 (Figure 4B). Conversely, skin grafts from edited RDEB keratinocytes (P1 HDR) revealed C7 expression at the BMZ of the regenerated skin (Figure 4D), in a manner similar to skin grafts regenerated from healthy donor keratinocytes (Figure 4F). All the tissue samples showed human involucrin expression, thus demonstrating human skin regeneration (insets in Figure 4A, C, E).

125 Chapter 3

Figure 4. Histological appearance and C7 expression of gene corrected grafts. Left panels: Hematoxylin/Eosin (H&E) staining of sections from representative grafts generated with cells from: A) uncorrected RDEB (P1); C) HDR- corrected RDEB (P1 HDR) and E) Healty donor control (Co). Insets at the right, bottom show the immunoperoxidase detection of human involucrin in grafts. Right panes: C7 expression in grafts as in left panels. B) Uncorrected RDEB P1); D) HDR-corrected RDEB P1 and E) Healty donor control (Co). The asterisk in panels A, B and inset indicate the epidermal-dermal separation in uncorrected grafts. Bar: 100µm.

e. HDR-based correction in RDEB patient cells with COL7A1 mutation in E79

The different donor templates designed cover a large amount of exons within COL7A1 gene, which enables gene correction for different RDEB-causing mutations.

126 Chapter 3

Therefore, after showing relevant correction efficiency in exon 80-bearing mutation patient cells (Patient 1, P1), we tested the exon 79-80 fusion strategy to correct cells from an RDEB patient carrying a mutation in E79 in homozygosis (Patient 2; P2). In this case, we only tested AAV6 vector delivering the symmetric donor template. PCR genotyping showed HDR-based correction ratios similar to those in treated P1 (Figure 5) cells. Also, we assessed C7 expression restoration by immunofluorescence, which showed a significant percentage of C7 positive cells in the bulk-edited population. This result demonstrated that this strategy could be applied to mutations different than C.6527insC in E80.

Figure 5. Gene editing frequencies and C7 expression assessment in P2 RDEB treated keratinocytes. A) PCR genotyping of P2 RDEB cells treated with RNP plus donor template. Similar ratios of gene correction were observed in cells from the two RDEB patients. B) Immunofluorescence for C7 expression detection. P2 was null for C7 expression. After treatment, C7 expression is restored in a significant number of cells. Sg2 sample showed some C7-positive cells due to exon 80-skipping events because of NHEJ activity of sg2 RNP close to the acceptor site of splicing.

f. Analysis of potential off-target sites

CRISPR/Cas9 system could lead to undesired changes in DNA as a consequence of guide complementarity to other regions of the genome. Therefore, we assessed off- target site indel generation activity for biosafety testing of this proposed gene therapy

127 Chapter 3

strategy. In our previous work101, potential off-target nuclease activity in cells treated with CRISPR/Cas9 RNPs containing the sg2 sgRNA was evaluated by Next Generation Sequencing in more than 200 in silico predicted sites, and no activity was observed. To further validate sgRNA2, we have used COSMID software to identify potential off- target sites. We chose two sites within gene coding regions: one locus was in chromosome 9, within the POMT1 gene, and the other was in chromosome 15 within the MEGF11 gene. Regions of these genes containing the potential Cas9 cutting site were amplified by PCR and Sanger sequenced. TIDE (Tracking of Indels by Decomposition) software was then used to identify off-target activity frequencies. We used two technical replicates from two RDEB patients and found frequencies between 0.1% and 2.8% for MEGF11 gene, and from 0% to 4% between samples for POMT1 gene (Supplementary figure S2). In this analysis, we included amplification of the on- target site as a positive control for indel generation, which showed frequencies between 74.4% and 79% for RDEB patient P1, and 91.1% to 94.3% frequencies were found for patient P2. Therefore, although no remarkable off-target activity was found by TIDE analysis, POMT1 should be studied in-depth as potential off-target site.

g. HDR-based gene editing in CB-CD34+ cells and BM-MSC as potential cell sources for bone marrow transplantation approaches in EB

Allogenic HSCT has been considered as a therapeutic option for EB treatment. Although HSCT could offer benefits for symptom amelioration, it is a high risk procedure with a high probability of severe complications. However, autologous HSCT using gene corrected cells could offer a safer therapeutic alternative to treat EB systemically. Since CD34+ cells and MSCs are the main stem cell types in the bone marrow, we decided to target cord blood-isolated CD34+ and MSC cells from three healthy donors with the CRISPR/Cas9 plus AAV6 treatment strategy to test the potential of the proposed approach on these clinically-relevant cell types for RDEB treatment. Five days after RNP plus AAV6 treatment, gene correction in CD34+ cells was assessed by PCR amplification. Similar gene correction frequencies to those found for treated keratinocytes cells were observed, reaching gene editing efficiencies of 48% allele modification (Figure 6A). For CD34+ cells, two different AAV6 MOIs were tested, 5K

128 Chapter 3

and 10K, in three healthy donors, and no difference in HDR-based correction efficiency was observed, showing close to 48% HDR correction in all the treated samples analyzed. In a similar manner, MSCs from three healthy donors were also analyzed and all the treated samples showed precise correction percentages close to 50% when a MOI of 30K is used. No remarkable gene editing efficacy difference was observed between different cell donors, thus supporting the sturdiness of this genome editing approach. Therefore, this study provides a proof-of-concept that bone marrow-derived stem cells are amenable to HDR-gene correction treatments following the strategy proposed.

A

B

Figure 6. Gene editing efficacy of RNP plus AAV6 treatment of CB-CD34+ cells and BM- MSC from three different donors. A) CD34+ HDR-based gene editing frequencies in three healthy donors, showing HDR percentages of 48-49% in all the samples, similar to P1 corrected keratinocytes (C+ HK P1). B) MSC HDR-based gene editing frequencies in three healthy donors, with efficiencies of 50%, similar to the corrected keratinocyte reference (C+ HK P1).

129 Chapter 3

4. Discussion

Genetically modified stem cells offers new therapeutic solutions for currently untreatable genetic diseases. Ex vivo genetic manipulation and subsequent grafting of CD34+ cells from patients to regenerate their hematopoietic system has shown great benefits in clinics for the treatment of severe blood disorders201-203. Recently, new gene modification techniques based on customized genomic nucleases, also provide additional strategies for genetic disease correction that are currently reaching clinical trials stage (ClinicalTrials.gov Identifier: NCT03745287), which could presage a revolution in modern medicine. Moreover, MSC-based cell therapy shows benefits at clinical stage for wound healing defects and inflammatory disorder treatment, which offers a new cell therapy approaches for a wide array of conditions204, 205. Regarding skin disorders, keratinocytes and fibroblasts are the main cell sources for these therapies and many approaches in genodermatoses are being developed aiming at clinical translation. Epidermolysis bullosa is one of the most devastating rare skin diseases and the RDEB-subtype, with complete absence of C7 expression, is considered one of the most severe skin disorders. A large number of COL7A1 gene mutations have been described in these patients, making this gene the most prominent target for EB gene therapy. Recently, a phase I clinical trial showed benefits in patients transplanted with skin equivalents containing autologous epidermal stem cells treated with gamma- retroviral vectors for COL7A1 expression, a classical gene replacement approach. Patients showed wound healing amelioration and C7 deposition and anchoring fibril formation108, 206, 207. Nevertheless, new gene editing tools are opening the way for more precise gene correction therapies. In fact, previous work from our group 101 described a highly efficient gene editing-based approach for COL7A1 E80 correction in RDEB patient cells. This work established CRISPR/Cas9 delivered as RNP as the most efficient tool for genome editing in primary keratinocytes, a cell type considered hard to transfect. The therapy proposed is specific for E80, which contains a highly prevalent mutation in the Spanish RDEB patients cohort, and although similar approaches aiming at exon removal are transferable to other exons within the collagenous domain, a unique set of tools able to genetically correct a larger amount of exons would be desirable. In this context, the HDR-based gene correction presented in this study constitutes an interesting therapeutic option to treat a large number of mutations within COL7A1,

130 Chapter 3

independent of the location of the exon in the gene structure. The approach, which consists of an AAV vector to deliver the donor template DNA plus a CRISPR/Cas9 system delivered by electroporation as RNP, has been tried before in other cell types143, 144, 193. In keratinocytes, previous studies showed AAV2 with engineered capsids as an efficient serotype in terms of cell transduction181, 208. Here, we tested a large collection of AAV serotypes to determine the most efficient transduction conditions in primary keratinocytes, and found that AAV6 serotype performed best. Similar HDR-based correction ratios were found for the two different homology donor designs tested in primary keratinocytes. In our study, the symmetrical donor covers from E74 to E84 and asymmetrical donor template from E77 to E88, so each design could cover a wide number of mutations within COL7A1. Furthermore, a large collection of AAVs containing different gene regions of COL7A1 could be developed, aiming to precisely correct any mutation throughout the gene. This is an important advantage against the previous NHEJ-based approach proposed 101 because some exons are not amenable to exon removal strategies, including exons 1, 2, 3, 24, 27 or 113, among others43, and correction of these would require precise HDR-mediated gene modification. Beyond EB treatment, this approach could be transferred to any genome editing application in primary keratinocytes to treat mutations causing other skin diseases or knock-in genes (reporters, therapeutic molecules) to create models of skin pathologies. Previous work from our group 181 demonstrated the feasibility of achieving HDR- correction in a patient-derived keratinocyte cell line by means of delivering TALENs with adenoviral vectors together with AAV2 for delivery of homology donor DNA flanking selection cassettes. After selection treatment, 32 out of 34 keratinocyte clones isolated were genetically corrected. However, although it demonstrated the feasibility of C7 restoration by HDR in a RDEB keratinocyte cell line, drug selection and clone isolation were necessary, which makes its translation into the clinic very difficult. However, Izmiryan et al.194 demonstrated in exon 2-containing mutation RDEB keratinocytes indel generation frequencies close to 30% by means of integration- deficient lentivirus-guide delivery. In addition, the use of the guide in combination with donor template delivery by same type of vectors, achieved 11% and 15% COL7A1 corrected transcripts in RDEB cells, keratinocytes and fibroblasts respectively. When transplanted onto mice, 19% correction ratio was found, which was enough to allow AF formation with no dermal-epidermal separation. Moreover, a recent study in RDEB

131 Chapter 3

patient-derived iPSCs showed bi-allelic correction efficiencies close to 60% by means of an HDR-based protocol195. Although this approach has shown unprecedented gene editing correction in RDEB iPSCs, cell reprogramming carries some risks such as genetic instability and tumorigenic potential. In addition, there is so far no definitive evidence that epidermal stem cells able to support long-term skin regeneration can be derived from iPSCs. Thus, primary keratinocytes are still the most suitable cell type for skin regeneration in terms of clinical translation. In this study we overcome the limitations of previously reported protocols and implement a marker-free, highly efficient approach in primary keratinocytes, with gene correction efficiencies over 40% in RDEB primary keratinocytes and precise corrected transcripts accounting for more than 60% of total COL7A1 transcription. Edited bulk keratinocytes were able to achieve normal human skin regeneration with restoration of dermal-epidermal adhesion when transplanted onto nude mice. In fact, using a polyclonal population makes translation into the clinics easier, as it avoids time-consuming and laborious epidermal stem cell clone isolation and maintains the proportion of different holoclones within the bulk population able to sustain long-term skin regeneration. Therefore, we propose CRISPR/Cas9 RNP electroporation in combination with AAV6-mediated delivery of donor template DNA as a highly efficient tool for keratinocyte genome editing.

Cell types different to keratinocytes might also be relevant therapeutic targets. In the last decade HSCT has been considered as a valid option for EB 86 although the mechanisms explaining the benefits of BMT have yet to be fully elucidated. Recently, Ebens et al. 197 showed that HSCT followed by MSC infusions could ameliorate RDEB phenotype. Also, MSCs have an immunoregulatory role in wound healing and they can express C7, which contributes to decreased inflammation and dermal-epidermal adhesion restoration 209. Currently, transplantation of allogeneic MSCs is at the clinical stage 205. However, allogeneic HSCT poses a high risk for complications like graft- versus-host disease (GVHD) that autologous HSCT could overcome. Therefore, autologous HSCT with genetically modified MSCs and CD34+ cells could complement genetically corrected skin transplantation, which could ameliorate blistering in areas such as internal mucosa that skin graft transplantation cannot reach. Here, we showed significant gene editing efficiencies in both CD34+ cells and MSCs from three different healthy donors, with close to 50% allele correction, which shows that COL7A1 can be also modified in these cell types which would be of interest for RDEB management.

132 Chapter 3

Conceivably, bone marrow from EB patients could be isolated and treated with this gene editing approach, which would offer a real new advantage on disease management. On the whole, our study offers evidence of an ex vivo effective genome editing platform enabling gene correction of various relevant cell types, which will provide a source to develop different cell therapies aiming at EB cure. A wider spectrum of EB mutations is covered by this technology, thus paving the way for clinical benefits for a large cohort of EB patients.

133 Chapter 3

5. Material and Methods

a. Keratinocyte cell culture and isolation of clones

Patient keratinocytes were originally obtained from skin biopsies of three RDEB (RDEB-sev gen) patients bearing mutations in the COL7A1 gene. Skin biopsies were obtained from patients after approval from the Ethics Committee of the collaborating hospital upon informed consent. Primary human RDEB and healthy donor keratinocytes were cultured as previously described154, 174. Human primary RDEB keratinocytes from the three patients were plated onto lethally irradiated 3T3-J2 cells and cultured in keratinocyte growth cFAD medium (KCa), a 3:1 mix of Dulbecco’s modified Eagle’s and Ham’s F12 media (GIBCO-BRL, Barcelona, Spain) containing fetal bovine calf serum (Hyclone, GE Healthcare, Logan, UT) (10%), penicillin–streptomycin (1%), glutamine (2%), insulin (5 µg/ml; Sigma Aldrich), adenine (0.18 mmol/l; Sigma Aldrich), hydrocortisone (0.4 µg/ml; Sigma Aldrich), cholera toxin (0.1 nmol/l; Sigma Aldrich), triiodothyronine (2 nmol/l; Sigma Aldrich), EGF (10 ng/ml; Sigma Aldrich) and Y-27632 ROCK inhibitor (Sigma Aldrich) at 10µM.

b. Donor containing-AAV6 production

Homology arms were amplified by PCR from wild-type genomic DNA. The symmetric donor is a fusion of exon 79 and exon 80, missing intron 79, where sg2 cuts. Thus, left homology arm (LHA) is 1008 bp from the end of exon 79 to 5’ of COL7A1 gene and right homology arm (RHA) is 798 bp from the beginning of exon 80 to 3’ of this gene. Asymmetric donor follows same strategy, but LHA is 556 bp and RHA 1461 bp. Thereafter, both arms were assembled with an AAV backbone plasmid by Gibson assembly technology. For donor template containing-AAV6 production, backbone vector plasmids were grown in E. coli and isolated by means of Endotoxin-Free Maxi Plasmid Purification Kit (Invitrogen, Cat# A33073). Subsequently, 293 cells in five 15cm2 dishes were transfected using 120uL 1 mg/mL PEI per plate (MW 25K)(Polysciences) mixed with 6 mg ITR-containing plasmid and 22 mg pDGM6 (which carried AAV6 cap, AAV2 rep, and adenoviral helper genes)(gift from D. Russell). 72h after transfection vectors were purified using a Takara AAVpro Purification Kit (Cat. 6666) following manufacturer’s

134 Chapter 3

protocol. Vector titer was assessed by ddPCR using probes on the ITRs region of the AAV vector.

c. CRISPR/Cas9 delivery and AAV6 transduction

Sg2 gRNA was previously described. The sequence of this guide is: 5’- CCTGCAGACCCTACATAGAG-3’. In this approach, instead of crRNA:tracrRNA system, sg2 was a single guide RNA and chemically modified (Synthego, CA, USA). 1.6 µg of sgRNA mixed with 6 µg of Cas9 protein were delivered by electroporation in each reaction for 1x105 primary keratinocytes (Integrated DNA Technologies, IA, USA). Electroporation platform used for the delivery of the RNP was 4D-NucleofectorTM System (Lonza Bioscience, Switzerland), electroporation code CM137. After electroporation, cells were transduced in suspension for 1 hour with the donor containing-AAV6 (MOI 30K) in a final volume of 50 µl with Opti-MEM (ThermoFisher Scientific). Then, cells were plated onto feeder layer-containing plates. For MSC and CD34+ cells, 3.2 µg of sgRNA and 6 µg of Cas9 were used. The electroporation code used for MSC electroporation was CM119 and DZ100 was the one used for CD34+ cells transfection. For transduction, MSCs were incubated with the AAV6 for 15 minutes in suspension and then they were plated on media. In the case of CD34+ cells, AAV6 was added directly to the well.

d. Genotyping of gene-targeted keratinocytes

Six days post-treatment, genomic DNA was isolated by isopropanol precipitation of keratinocyte lysates (lysis buffer was Tris pH8 100 mM, EDTA 5 mM, SDS 0.2%, NaCl 200 mM, 1mg/ml proteinase K (Roche Diagnostics, Mannheim, Germany) and resuspended in TE buffer. Approximately 50 ng of genomic DNA were used for PCR amplification. PCR fragments spanning the target region were generated with primers S1 F/R, outside the homology arms. F: 5’- CACCAGCATTCTCTCTTCC-3’; R: 5’- GTTCTT GGG TAC TCACCA C-3’. PCR program was: 98oC for 1 minute, 5 cycles of 98oC for 30 seconds, 68oC for 30 seconds, 72oC for 45 seconds, decreasing annealing temperature 1oC every cycle, followed by 30 cycles of 94oC for 30 seconds, 63oC for 30 seconds, 72oC for 45 seconds, then 72oC for 10 minutes. PCR products were analyzed in 1.5% agarose gel. Molecular weight marker was IX (Sigma-Aldrich). For sequencing, PCR products were treated with illustra™ ExoProStar™ (GE Healthcare, UK),

135 Chapter 3

sequenced using Big Dye Terminator V.1.1 Cycle Sequencing kit (Thermo Fisher, Waltham, MA), and examined on a 3730 DNA Analyser (Life Technologies, Carlsbad, CA). Chromatograms were analyzed using Sequencher (Gene Codes, Ann Harbor, MI). Bio-Rad Image Lab Software 6.0 was used for PCR band densitometry.

e. Genome editing off-target analysis

Gene edited keratinocytes were tested for off-target indel generation predicted for sgRNA sg2 by COSMID tool (https://crispr.bme.gatech.edu/). COSMID is a web- based tool for identifying CRISPR/Cas9 off-target sites and it offers a collection of primers for off-target site PCR amplification. We analyzed two off-target sites with cutting site in coding regions, one in Chr9, POMT1 gene, and another one in Chr15, MEGF11, both with significant probability in the in silico prediction (1.2 and 3.7 of score, respectively). We also analyzed the on-target site under same conditions as a positive control for indel generation detection. In order to assess indel generation, we performed PCR using FastStart™ Taq DNA Polymerase (Sigma-Aldrich) and then we sequenced by Sanger technology. TIDE software was used to identify indel frequencies using Sanger sequences obtained previously of the edited and non-edited RDEB keratinocytes (Brinkman et al., 2014). Primers used: POMT1-F: 5’-CCTTGGCCTCCCAAAGTGCT-3’; POMT1-R: 5’- TCAGAACCAGCCCTGGGTAG-3’; MEGF11-F: 5’- AGGGTCTCGTTCTGTTGCCTAG-3’; MEGF11-R: 5’- CCCTATCAGGCACACAAGAGC-3’.

f. Western blot analysis

Keratinocytes were lysed in protein extraction buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% Nonidet P-40, 4 mM EDTA) containing proteinase inhibitors cocktail (Complete Mini, EDTA-free; Roche Diagnostics, Mannheim, Germany). Lysates were incubated for 30 minutes on ice and centrifuged at 15,000×g for 30 minutes at 4°C. Supernatants were collected and protein concentrations were measured using the Bradford assay (BioRad, Hercules, CA). For each sample, 40 µg of total protein was resolved on NuPAGE® Novex 3-8% Tris-Acetate gel electrophoresis (Invitrogen, Carlsbad, CA) and electrotransferred to nitrocellulose membranes (Invitrogen, Carlsbad, CA). For type VII collagen analysis, blots were probed with a monospecific polyclonal

136 Chapter 3

anti C7 antibody (a generous gift from Dr A. Nystrom of University of Freiburg). An antibody against Vinculin was used as a loading control. Visualization was performed by incubating with HRP-conjugated anti-rabbit antibody (Amersham, Burlington, MA) and West Pico Chemiluminescent Substrate (Pierce, Rockford, IL).

g. Immunofluorescence and immunohistochemical staining

For immunofluorescence detection of C7 in keratinocytes, cells grown on glass coverslips were fixed in methanol/acetone (1:1) for 10 minutes at -20ºC. After washing three times in phosphate-buffered saline (PBS) and once in PBS with 3% bovine serum albumin (BSA) (Sigma Aldrich, St Louis, MO) for 30 minutes, cells were incubated with monospecific polyclonal anti C7 antibody at 1:5000 dilution. Secondary antibody (AlexaFluor488, Invitrogen, Carlsbad, CA) was used at 1/1000 dilution. After the final washing step in PBS, preparations were mounted using Mowiol (Hoechst, Somerville, NJ) mounting medium and DAPI 20µg/ml (Sigma Aldrich, St Louis, MO) for nuclei visualization. Immunoperoxidase detection of C7 in paraffin-embedded, formalin-fixed sections was carried out with proteinase K antigen retrieval as described175. Immunoperoxidase staining for human involucrin was performed using rabbit SY5 monoclonal antibody (Sigma) and 4A4 monoclonal antibody respectively on paraffin sections without antigen retrieval. The ABC peroxidase kit (Vector) with Diaminobenzidine as a substrate was used.

h. NGS COL7A1 transcriptional analysis

Primers with NGS adapters used for the PCR amplification were F: 5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGGGTCAGGACGGCAAC -3’ and R: 5’- GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGCTCCAGTAGGTCCAG TCAG-3’. Amplicons were measured by Qubit technology. Next Generation Sequencing was performed on Illumina 2x250bp configuration, with coverage of 50000X. Data analysis was conducted with NGS Genotyper v1.4.0. From the data obtained, aberrant sequences also observed in the non-treated sample were removed from the treated samples.

137 Chapter 3

i. Generation of skin equivalents, grafting onto mice and graft analysis

Animal studies were approved by our institutional animal care and use committee according to national and European legal regulations. HDR-based corrected polyclonal keratinocytes were seeded on fibrin dermal equivalents containing RDEB fibroblasts null for C7 expression prepared as previously described 182. Bioengineered skin equivalents were grafted onto the back of 7-week-old female immunodeficient mice (nu/nu, NMRI background) purchased from Elevage-Janvier (France) as previously described 174. Grafting was performed under sterile conditions and mice were housed in pathogen-free conditions for the duration of the experiment at the CIEMAT Laboratory Animal Facility (Spanish registration number 28079-21 A). Animals were housed in individually ventilated type II cages, with 25 air changes per hour and 10 kGy gamma irradiated soft wood pellets as bedding. All handling was carried out under sterile conditions, and all experimental procedures were according to European and Spanish laws and regulations. Mice were sacrificed after 12 weeks post grafting and grafts were harvested for skin histology and immunohistochemistry analyses.

6. Acknowledgements

This study was supported by DEBRA International – funded by DEBRA Austria (grant termed as Larcher 1). Additional funds came from Spanish government grants SAF2017-86810-R and PI17/01747, from Ministry of Economy and Competitiveness and Instituto de Salud Carlos III respectively, both co-funded with European Regional Development Funds (ERDF), ERA-NET E-RARE JTC 2017 (MutaEB) and CIBERER (grant termed as Murillas-TERAPIAS ER2017). Authors are indebted to Blanca Duarte, Almudena Holguín and Nuria Illera for grafting experiments and to Jesus Martínez and Edilia De Almeida for animal maintenance and care.

7. Author Contributions

JB, AM, WS, SV, MHP, FL and RM designed the experiments. JB, AM, WS, RR and BD performed molecular and cellular studies. MDR contributed to experimental results discussion and provided reagents and ethical approval for the studies. JB, MG, BD, EC and FL performed animal experiments and histological analysis. JB, RH and LU

138 Chapter 3

performed cord-blood-derived cell isolation and targeting experiments in HSC. JB, FL and RM wrote the manuscript.

8. Declaration of interest

The authors declare no conflict of interest.

139 Chapter 3

9. References

1. Has, C., South, A. & Uitto, J. Molecular Therapeutics in Development for Epidermolysis Bullosa: Update 2020. Mol Diagn Ther (2020). 2. Dever, D.P. et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature 539, 384-389 (2016). 3. Gomez-Ospina, N. et al. Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I. Nat Commun 10, 4045 (2019). 4. Martin, R.M. et al. Highly Efficient and Marker-free Genome Editing of Human Pluripotent Stem Cells by CRISPR-Cas9 RNP and AAV6 Donor-Mediated Homologous Recombination. Cell Stem Cell 24, 821-828 e825 (2019). 5. Osborn, M.J. et al. TALEN-based gene correction for epidermolysis bullosa. Mol Ther 21, 1151-1159 (2013). 6. Izmiryan, A., Danos, O. & Hovnanian, A. Meganuclease-Mediated COL7A1 Gene Correction for Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol 136, 872- 875 (2016). 7. Hainzl, S. et al. COL7A1 Editing via CRISPR/Cas9 in Recessive Dystrophic Epidermolysis Bullosa. Mol Ther (2017). 8. Izmiryan, A. et al. Ex Vivo COL7A1 Correction for Recessive Dystrophic Epidermolysis Bullosa Using CRISPR/Cas9 and Homology-Directed Repair. Mol Ther Nucleic Acids 12, 554-567 (2018). 9. Jackow, J. et al. CRISPR/Cas9-based targeted genome editing for correction of recessive dystrophic epidermolysis bullosa using iPS cells. Proc Natl Acad Sci U S A (2019). 10. Benati, D. et al. CRISPR/Cas9-Mediated In Situ Correction of LAMB3 Gene in Keratinocytes Derived from a Junctional Epidermolysis Bullosa Patient. Mol Ther 26, 2592-2603 (2018). 11. Bonafont, J. et al. Clinically Relevant Correction of Recessive Dystrophic Epidermolysis Bullosa by Dual sgRNA CRISPR/Cas9-Mediated Gene Editing. Mol Ther 27, 986-998 (2019). 12. Ebens, C.L. et al. Bone marrow transplant with post-transplant cyclophosphamide for recessive dystrophic epidermolysis bullosa expands the related donor pool and permits tolerance of nonhaematopoietic cellular grafts. Br J Dermatol (2019). 13. Fujita, Y. et al. Bone marrow transplantation restores epidermal basement membrane protein expression and rescues epidermolysis bullosa model mice. Proc Natl Acad Sci U S A 107, 14345-14350 (2010). 14. Iinuma, S. et al. Transplanted bone marrow-derived circulating PDGFRalpha+ cells restore type VII collagen in recessive dystrophic epidermolysis bullosa mouse skin graft. J Immunol 194, 1996-2003 (2015). 15. Petrof, G. et al. Potential of Systemic Allogeneic Mesenchymal Stromal Cell Therapy for Children with Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol 135, 2319-2321 (2015). 16. Tamai, K. & Uitto, J. Stem Cell Therapy for Epidermolysis Bullosa-Does It Work? J Invest Dermatol 136, 2119-2121 (2016). 17. Tolar, J. & Wagner, J.E. Allogeneic blood and bone marrow cells for the treatment of severe epidermolysis bullosa: repair of the extracellular matrix. Lancet 382, 1214-1223 (2013). 18. Alexeev, V., Uitto, J. & Igoucheva, O. Gene expression signatures of mouse bone marrow-derived mesenchymal stem cells in the cutaneous environment and therapeutic implications for blistering skin disorder. Cytotherapy 13, 30-45 (2011).

140 Chapter 3

19. Ferrua, F. et al. Lentiviral haemopoietic stem/progenitor cell gene therapy for treatment of Wiskott-Aldrich syndrome: interim results of a non-randomised, open- label, phase 1/2 clinical study. Lancet Haematol 6, e239-e253 (2019). 20. Kohn, D.B. et al. Lentiviral gene therapy for X-linked chronic granulomatous disease. Nat Med 26, 200-206 (2020). 21. Rio, P. et al. Successful engraftment of gene-corrected hematopoietic stem cells in non-conditioned patients with Fanconi anemia. Nat Med 25, 1396-1401 (2019). 22. Lamo-Espinosa, J.M. et al. Intra-articular injection of two different doses of autologous bone marrow mesenchymal stem cells versus hyaluronic acid in the treatment of knee osteoarthritis: long-term follow up of a multicenter randomized controlled clinical trial (phase I/II). J Transl Med 16, 213 (2018). 23. Rashidghamat, E. et al. Phase I/II open-label trial of intravenous allogeneic mesenchymal stromal cell therapy in adults with recessive dystrophic epidermolysis bullosa. J Am Acad Dermatol (2019). 24. Eichstadt, S. et al. Phase 1/2a clinical trial of gene-corrected autologous cell therapy for recessive dystrophic epidermolysis bullosa. JCI Insight 4 (2019). 25. Marinkovich, M.P. & Tang, J.Y. Gene Therapy for Epidermolysis Bullosa. J Invest Dermatol 139, 1221-1226 (2019). 26. Siprashvili, Z. et al. Safety and Wound Outcomes Following Genetically Corrected Autologous Epidermal Grafts in Patients With Recessive Dystrophic Epidermolysis Bullosa. Jama 316, 1808-1817 (2016). 27. Gaj, T. et al. Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery. Nucleic Acids Res 45, e98 (2017). 28. Chamorro, C. et al. Keratinocyte cell lines derived from severe generalized recessive epidermolysis bullosa patients carrying a highly recurrent COL7A1 homozygous mutation: models to assess cell and gene therapies in vitro and in vivo. Exp Dermatol 22, 601-603 (2013). 29. Sallach, J. et al. Tropism-modified AAV vectors overcome barriers to successful cutaneous therapy. Mol Ther 22, 929-939 (2014). 30. Bornert, O. et al. Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy. Mol Ther 24, 1302-1311 (2016). 31. Petrova, A. et al. Human Mesenchymal Stromal Cells Engineered to Express Collagen VII Can Restore Anchoring Fibrils in Recessive Dystrophic Epidermolysis Bullosa Skin Graft Chimeras. J Invest Dermatol 140, 121-131 e126 (2020). 32. Duarte, B. et al. Long-term skin regeneration from a gene-targeted human epidermal stem cell clone. Mol Ther 22, 1878-1880 (2014). 33. Mencia, A. et al. Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells. Mol Ther Nucleic Acids 11, 68-78 (2018). 34. Larcher, F. et al. Long-term engraftment of single genetically modified human epidermal holoclones enables safety pre-assessment of cutaneous gene therapy. Mol Ther 15, 1670-1676 (2007). 35. Llames, S.G. et al. Human plasma as a dermal scaffold for the generation of a completely autologous bioengineered skin. Transplantation 77, 350-355 (2004).

141 Chapter 3

10. Supplementary data

Figure S1. Colony-forming efficiency assay on untreated RDEB keratinocytes and HDR-based gene corrected RDEB keratinocytes from P1. Cells were plated at a density of 500 cells in 10-cm Petri dishes coated with a feeder layer, stained with Rodamine B.

142 Chapter 3

A

B

C

Figure S2. TIDE analysis for predicted off-target site indel generation evaluation. D1 is a RDEB patient containing mutation in E80 and D2 is a RDEB patient with mutation in E79. A) On-target analysis as a

143 Chapter 3

positive control for indel generation assessment. D1 showed frequencies of indel generation over 90% and D2, frequencies over 74%, showing a significant indel activity due to the CRISPR/Cas9 system. B) Off-target indel activity in gene MEGF11. Frequencies ranged from 0.1% to 2.4%. C) Off-target indel activity evaluation in gene POMT1. Frequencies obtained using TIDE showed 0% to 4% depending on the sample.

144

Recuerda que cada discusión tiene, Al menos, tres puntos de vista: El tuyo, el del otro y el de los demás.

Napoleón Hill

145

146 General Discussion General discussion

1. Discussion

The main goal of this thesis is to develop new genome editing-based advanced treatments for Recessive Dystrophic Epidermolysis Bullosa. Epidermolysis Bullosa is a rare group of skin disorders characterized by loss of dermal-epidermal adhesion causing severe blistering after minor trauma1. The Recessive Dystrophic subtype is the most severe form of the disease. RDEB patients have an increased risk of metastatic squamous cell carcinoma development that is frequently fatal. The severity of this disease has led to the search for innovative therapies, including high risk medical procedures such as bone marrow transplantation 2-4. Despite the efforts, only palliative treatments are available5. Different attempts have been made to develop safer and more efficacious treatments for RDEB based on gene therapy approaches. Although the large size and repetitive nature of COL7A1 gene sequence, together with the genotoxicity and mutagenesis risk inherent to insertional vectors use 6-8, have posed a significant hurdle for retroviral-based replacement gene therapy, significant success has been recently attained and multiple clinical trials pursuing this strategy are currently underway9. However, recent advances in genome editing allow us to propose novel, more precise alternatives to modify primary cells from RDEB patients. Genome editing-based treatments have opened new avenues in gene therapy. Genome editing tools can modify a gene sequence to introduce modifications leading to the correction of the molecular defects underlying genetic pathologies. Since engineered nucleases were discovered, genome editing tools performance has been improved and they can now offer feasible alternatives for genetic disease treatment 10-12. In 1996, zinc finger nucleases appeared as a tool able to modify the human genome and they have now reached clinical trial stage to be approved as a gene therapy (ClinicalTrials.gov Identifier: NCT02702115). In 2010, TALEN nucleases appeared, offering a simpler modular design and greater sequence specificity and efficacy than Zinc Finger nucleases 13. Later, in 2012, the CRISPR/Cas9 system combined the efficacy of TALENs with ease of design and construction, making it the tool of choice for precise genome engineering 14. CRISPR/Cas9 is a versatile, easy and powerful tool to create double strand breaks in the DNA that are then repaired causing gene reframing, exon deletion or gene knockout, and thus provide an efficient approach to restore, activate or block

147 General discussion

gene expression15. This technology is speeding up the translation of genome editing protocols into clinics (ClinicalTrials.gov Identifier: NCT03745287 and NCT03399448) and has started showing real benefits in patients 16. Hence, the first approach in this thesis, described in Chapter 1, was based on the use of TALENs to achieve gene reframing and restore C7 expression. A previous study from our lab 17 described the first exon reframing-based genome editing approach to treat RDEB. A TALEN pair targeting the proximity of Exon 80 was designed. The system was delivered by adenoviral vectors and tested in immortalized RDEB patient- derived keratinocytes. Over 70% of modified keratinocytes showed C7 expression restoration, with the majority of the indels generated being a 1 bp deletion that resulted in recovery of the gene reading frame. Due to the success of this approach targeting COL7A1, at the beginning of this thesis we implemented this technology in primary patient keratinocytes 18. After protocol optimization, we were able to efficiently transduce primary RDEB keratinocytes with the adenoviruses containing expression vectors for TALENs tailored to the proximity of pathogenic mutation. C7 protein restoration was observed in a significant percentage of cells (close to 10%). We found several clones containing the 1 bp deletion, as observed in the previous work 17, but when these clones were transplanted into immunodeficient mice for skin regeneration and adhesion assessment, abnormal localization of C7 and reduced mechanical resistance were observed. Over 100 clones were isolated, genotyped and assessed for C7 expression. One of them, named as clone 19C, contained a bigger deletion encompassing the whole E80, leading to mutated exon skipping and resulting in a shorter but functional protein18. After regenerating human skin transplanted onto immunodeficient mice from this clone, this C7 variant lacking E80 displayed normal deposition at the BMZ and conferred mechanical resistance to the human skin, proving the feasibility of the pathogenic-exon removal approach to correct the RDEB phenotype. This was the proof-of-concept that a primary keratinocytes population expressing a variant of C7 lacking E80 could restore dermal-epidermal adhesion. Despite the promising result, this strategy needed to be improved in terms of clinical translation. The feasibility of clonal gene therapy was previously demonstrated as a safe gene and cell therapy approach when normal human skin regeneration was achieved from a single epidermal stem cell clone 19 and feasible replacement gene therapy in single epidermal stem cell clones by means of a retroviral vector expressing C7 was later reported 20.

148 General Discussion

However, precise gene editing-based correction in RDEB epidermal stem cells had not been attained. Based on our TALEN-based previous strategy17, C7 expression restoration was achieved in a primary RDEB epidermal stem cell clone, able to sustain healthy skin regeneration and normal adhesion (Chapter 1). Nonetheless, epidermal stem cell clone isolation is an expensive and time-consuming work, which makes translation to the clinics difficult. Other labs demonstrated gene editing correction in RDEB patient-derived iPSC 21, 22, but although differentiation into keratinocytes was feasible 23, protocols able to generate epidermal stem cells able to sustain long-term skin regeneration have not been stablished yet. In addition, concerns about the tumorigenic potential of these cells when transplanted make this approach unsuitable for the clinic. Then, aiming to reach clinical stage, gene editing in primary epidermal stem cells, that have demonstrated long-term skin regeneration ability and a proven long-term safety record, is mandatory. Therefore, as described in Chapter 2, we developed a new design based on the CRISPR/Cas9 platform, consisting on a dual-guide approach flanking COL7A1 E80, aiming to efficiently delete the pathogenic mutation-containing exon 24. Furthermore, we changed from a viral delivery system to a new non-viral protocol, using CRISPR/Cas9 as a ribonucleoprotein (RNP) delivered by electroporation, which allowed us to reach very high editing efficiencies. A previous study by Wu et al. demonstrated the functionality of a C7 variant lacking E80, generated after in vivo delivery of CRISPR/Cas9 RNPs by direct skin electroporation 25. A similar approach would therefore lead to precisely delete the E80-containing mutation in a high percentage of primary cells, thus avoiding the need for clone isolation. Thus, we obtained 95% of indel generation at the intended COL7A1 E80 locus in a bulk RDEB keratinocytes population. 85% of these indel-carrying alleles were the E80 deletion sought after24. When we assessed for C7 expression by immunofluorescence and flow cytometry, more than 80% of cells showed C7 protein restoration, without selection24. This high gene editing efficacy and consequent C7 restoration in a polyclonal primary population make exon deletion a clinically-relevant option for RDEB treatment. This approach showed the highest reported efficiency in genome editing for keratinocytes. Therefore, with these results, we establish CRISPR/Cas9 RNPs delivered by electroporation as the state-of-the-art technology for keratinocytes genome editing. The biosafety of this approach was assessed by performing NGS analysis of more than 200 in silico predicted potential off-target sites for the CRISPR/Cas9 guides used. This

149 General discussion

study did not reveal any off-target activity. Further biosafety studies will be done to rule out genomic structural changes such as big chromosomal rearrangements using cCGH array techniques. In addition, the potential for tumorigenesis of gene-edited keratinocytes and their ability for dissemination to other organs will be assessed as part of the preclinical studies necessary before launching a clinical trial of our gene editing protocol for RDEB correction. Regeneration of entire human epidermis in RDEB patients is feasible, as Michele De Luca lab showed in a successful intervention for a Junctional EB patient 26.They were able to replace the whole epidermis in a seven-year-old child after epidermal stem cells were genetically modified with a retroviral vector expressing the full-length 3.6-kb LAMB3 cDNA. At the moment of the first surgery, the patient had complete epidermal loss on approximately 80% of the total body surface area. This study showed the feasibility of a gene and cell therapy for full body treatment of EB. A similar approach based on our gene editing protocol for E80-bearing mutation patients could be envisioned. In this context, the proposed therapy in Chapter 2 has now been favorably considered for European Medicines Agency (EMA) approval to be designated as Orphan Drug. Gene editing by homology-directed repair (HDR) offers precise modification of gene sequences when a donor template DNA is present. Although attempts aiming at correction of COL7A1 by HDR have been made 17, 21, 27-29, NHEJ still remains the most feasible gene correction approach 30. However, recent optimizations in genome engineering tools and protocols for HDR have now enabled the possibility to pursue therapeutic approaches based on this precise gene correction option 10, 31. In this context, we described in Chapter 3 of this thesis an efficient method for precise COL7A1 gene correction based on homology directed repair. Previous attempts from our lab and others have reported correction efficiencies with limited success 21, 27, 32. Izmyrian et al. proposed a strategy based on delivery of the CRISPR/Cas9 system and the DNA donor template by integration-defective lentiviral vectors (IDLVs) in RDEB cells, resulting in 11% of C7 expression restoration without the use of antibiotic- or fluorescence-based selection 28. Although this approach showed remarkable efficiency, it is still unsuitable for therapeutic use. Our HDR editing approach, based on the use of RNPs in combination with an AAV-containing DNA donor template, reached considerably higher HDR correction rates in primary RDEB keratinocytes, achieving more than 40% of precisely corrected alleles. This result is promising in terms of

150 General Discussion

therapeutic benefit, since C7 expression levels higher than 30% of normal are sufficient to correct the RDEB phenotype, restoring skin attachment. When transplanted onto nude mice, skin regenerated from patient keratinocytes corrected in bulk using this HDR protocol showed normal structure and correct C7 deposition at the BMZ. This approach offers efficiency without the need for selection markers to enrich the corrected population, what makes it more interesting for clinical translation. Furthermore, this approach opens up the possibility to cover a wider number of RDEB- causing mutations with the same gene editing tools, as we demonstrated with the correction of a mutation in COL7A1 exon 79 in RDEB patient cells (Chapter 3). The potential for correction of a wide spectrum of mutations along the length of the homology arms enables to extend the use of the same gene editing tools and protocols to a larger cohort of patients. In terms of biosafety, more in-depth studies need to be performed. Chemical modifications to increase stability of the RNA guides cell and new Cas9 proteins improvements are likely to reduce off-target effects, but a complete safety profile assessment needs to be done before going on to clinics. The feasibility of extending our HDR correction protocol to cell types different to skin keratinocytes was also studied in Chapter 3. HDR-based editing was highly efficient in mesenchymal stem cells (MSCs) and CD34+ hematopoietic stem cells, with correction rates comparable to those achieved in skin keratinocytes. These cell types have been involved in cellular therapies for RDEB. Wild-type MSC infusions are showing benefits in clinical trials in RDEB patients 4, 33, ameliorating the inflammatory phenotype and thus increasing quality of life. Allogenic BMT is appearing as a new therapeutic option to treat RDEB, although it has severe complications and mortality risk 2 and the mechanisms underlying BMT benefits for RDEB patients are not yet elucidated. The use of autologous gene-corrected patient-derived MSCs or CD34+ hematopoietic stem cells might improve the efficacy of these cellular therapy protocols for EB management. In this thesis, three different genome editing-based approaches for RDEB treatment have been explored, to advance towards clinically-relevant protocols. Different options could be useful for different RDEB patients, so the most suitable therapy needs to be chosen according to mutation, gene and disease context.

151 General discussion

2. Future perspectives

Recessive Dystrophic Epidermolysis Bullosa is a complex disorder characterized by skin blistering upon minor trauma, with complications including pseudosyndactyly, dental abscesses, infections and squamous cell carcinoma development 34, 35. Skin replacement in the most affected areas of the RDEB patients, while not a definitive cure for this devastating disease, could represent a remarkable improvement in patients’ quality of life. EB needs a combination of different therapies to be properly managed such as anti-inflammatory drugs, fibrosis modulators and surgery together with skin replacement to offer the best results to the RDEB phenotype improvement. As the main objective of this thesis, different protocols have been proposed to achieve the genetic correction of epidermal stem cells of these patients, with the goal of manufacturing skin equivalents useful to perform skin replacement. The NHEJ-based approach described in Chapter 2 is the best suited for clinical translation. This strategy could be useful for all RDEB patients with mutation in E80 in COL7A1, accounting for 46% of Spanish RDEB population. In addition to the epidermal stem cell (keratinocytes) correction described fibroblasts gene correction could be also useful in terms of skin attachment, offering the possibilities of directly injecting gene-corrected autologous fibroblasts in wound sites or including them in graftable skin equivalents. For this reason, we have now established in our lab an efficient protocol to genetically- correct primary RDEB fibroblasts. We have achieved gene editing efficiencies close to 80% of exon deletion with CRISPR/Cas9 RNPs with no apparent toxicity. These cells will be included in skin equivalents with genetically-corrected RDEB keratinocytes and evaluated for skin adhesion and biosafety. The inclusion of both, keratinocyte and fibroblasts, corrected skin cell types in skin equivalents is likely to improve skin adhesion over time. The COL7A1 exon 80 gene editing -based approach reached Orphan Drug designation by European Medicines Agency (EMA) on 28 February 2020 (Orphan designation EU/3/20/2253). The next step of this work is to complete the biosafety profile evaluation of this genome editing protocol and establish risks and benefits of this therapy. The final goal will be to start a clinical trial for RDEB patients in Spain carrying the E80 mutation, treating the most affected areas. CRISPR/Cas9 components, sgRNA and Cas9, are now available in GMP-manufacturing conditions. The gene editing protocol established will be performed with these clinical grade reagents to make the

152 General Discussion

translation of this approach into the clinics feasible. At this moment, we are also evaluating different devices such as Maxcyte’s system, with GMP-like electroporation conditions. On the other hand, further characterization needs to be done also for the HDR- approach described in Chapter 3 to be proposed as candidate for EB treatment. Analysis of any possible chromosomal rearrangement by Comparative Genomic Hybridization (CGH) and potential off-target site evaluation will be useful to determine the biosafety of this approach. sgRNA and Cas9 are GMP-manufacturing available and AAV6 production in large-scale is feasible at this moment, so hopefully, this therapy covering a wider spectrum of RDEB-causing mutations could reach clinical trials stage in future years.

153 General discussion

3. References

1. Rashidghamat, E. & McGrath, J.A. Novel and emerging therapies in the treatment of recessive dystrophic epidermolysis bullosa. Intractable Rare Dis Res 6, 6-20 (2017). 2. Wagner, J.E. et al. Bone marrow transplantation for recessive dystrophic epidermolysis bullosa. N Engl J Med 363, 629-639 (2010). 3. Tolar, J. & Wagner, J.E. Allogeneic blood and bone marrow cells for the treatment of severe epidermolysis bullosa: repair of the extracellular matrix. Lancet 382, 1214-1223 (2013). 4. Ebens, C.L. et al. Bone marrow transplant with post-transplant cyclophosphamide for recessive dystrophic epidermolysis bullosa expands the related donor pool and permits tolerance of nonhaematopoietic cellular grafts. Br J Dermatol (2019). 5. Uitto, J., Bruckner-Tuderman, L., McGrath, J.A., Riedl, R. & Robinson, C. EB2017-Progress in Epidermolysis Bullosa Research toward Treatment and Cure. J Invest Dermatol 138, 1010-1016 (2018). 6. Hacein-Bey-Abina, S. et al. Insertional oncogenesis in 4 patients after retrovirus- mediated gene therapy of SCID-X1. J Clin Invest 118, 3132-3142 (2008). 7. Hacein-Bey-Abina, S. et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302, 415-419 (2003). 8. Wu, X., Li, Y., Crise, B. & Burgess, S.M. Transcription start regions in the human genome are favored targets for MLV integration. Science 300, 1749-1751 (2003). 9. Siprashvili, Z. et al. Safety and Wound Outcomes Following Genetically Corrected Autologous Epidermal Grafts in Patients With Recessive Dystrophic Epidermolysis Bullosa. Jama 316, 1808-1817 (2016). 10. Dever, D.P. et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature 539, 384-389 (2016). 11. Bak, R.O., Gomez-Ospina, N. & Porteus, M.H. Gene Editing on Center Stage. Trends Genet 34, 600-611 (2018). 12. Baylis, F. & McLeod, M. First-in-human Phase 1 CRISPR Gene Editing Cancer Trials: Are We Ready? Curr Gene Ther 17, 309-319 (2017). 13. Christian, M. et al. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186, 757-761 (2010). 14. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). 15. Pickar-Oliver, A. & Gersbach, C.A. The next generation of CRISPR-Cas technologies and applications. Nat Rev Mol Cell Biol 20, 490-507 (2019). 16. Stadtmauer, E.A. et al. CRISPR-engineered T cells in patients with refractory cancer. Science 367 (2020). 17. Chamorro, C. et al. Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes. Mol Ther Nucleic Acids 5, e307 (2016). 18. Mencia, A. et al. Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells. Mol Ther Nucleic Acids 11, 68-78 (2018). 19. Larcher, F. et al. Long-term engraftment of single genetically modified human epidermal holoclones enables safety pre-assessment of cutaneous gene therapy. Mol Ther 15, 1670-1676 (2007). 20. Droz-Georget Lathion, S. et al. A single epidermal stem cell strategy for safe ex vivo gene therapy. EMBO Mol Med 7, 380-393 (2015).

154 General Discussion

21. Osborn, M.J. et al. TALEN-based gene correction for epidermolysis bullosa. Mol Ther 21, 1151-1159 (2013). 22. Sebastiano, V. et al. Human COL7A1-corrected induced pluripotent stem cells for the treatment of recessive dystrophic epidermolysis bullosa. Sci Transl Med 6, 264ra163 (2014). 23. Itoh, M., Kiuru, M., Cairo, M.S. & Christiano, A.M. Generation of keratinocytes from normal and recessive dystrophic epidermolysis bullosa-induced pluripotent stem cells. Proc Natl Acad Sci U S A 108, 8797-8802 (2011). 24. Bonafont, J. et al. Clinically Relevant Correction of Recessive Dystrophic Epidermolysis Bullosa by Dual sgRNA CRISPR/Cas9-Mediated Gene Editing. Mol Ther 27, 986-998 (2019). 25. Wu, W. et al. Efficient in vivo gene editing using ribonucleoproteins in skin stem cells of recessive dystrophic epidermolysis bullosa mouse model. Proc Natl Acad Sci U S A 114, 1660-1665 (2017). 26. Hirsch, T. et al. Regeneration of the entire human epidermis using transgenic stem cells. Nature (2017). 27. Izmiryan, A., Danos, O. & Hovnanian, A. Meganuclease-Mediated COL7A1 Gene Correction for Recessive Dystrophic Epidermolysis Bullosa. J Invest Dermatol 136, 872- 875 (2016). 28. Izmiryan, A. et al. Ex Vivo COL7A1 Correction for Recessive Dystrophic Epidermolysis Bullosa Using CRISPR/Cas9 and Homology-Directed Repair. Mol Ther Nucleic Acids 12, 554-567 (2018). 29. Webber, B.R. et al. CRISPR/Cas9-based genetic correction for recessive dystrophic epidermolysis bullosa. NPJ Regen Med 1 (2016). 30. March, O.P., Kocher, T. & Koller, U. Context-Dependent Strategies for Enhanced Genome Editing of Genodermatoses. Cells 9 (2020). 31. Ousterout, D.G. et al. Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat Commun 6, 6244 (2015). 32. Hainzl, S. et al. COL7A1 Editing via CRISPR/Cas9 in Recessive Dystrophic Epidermolysis Bullosa. Mol Ther (2017). 33. Webber, B.R. et al. Rapid generation of Col7a1(-/-) mouse model of recessive dystrophic epidermolysis bullosa and partial rescue via immunosuppressive dermal mesenchymal stem cells. Lab Invest 97, 1218-1224 (2017). 34. Varki, R., Sadowski, S., Uitto, J. & Pfendner, E. Epidermolysis bullosa. II. Type VII collagen mutations and phenotype-genotype correlations in the dystrophic subtypes. J Med Genet 44, 181-192 (2007). 35. Marin-Bertolin, S., Amaya Valero, J.V., Neira Gimenez, C., Marquina Vila, P. & Amorrortu-Velayos, J. Surgical management of hand contractures and pseudosyndactyly in dystrophic epidermolysis bullosa. Ann Plast Surg 43, 555-559 (1999).

155

Conclusions Conclusions

Overall, in this thesis, we establish different approaches to genetically-modify RDEB primary keratinocytes, aiming to offer a clinically relevant therapeutic solution for RDEB patients. Our work demonstrates the feasibility of different gene-editing based protocols to restore C7 deficiency and thus repair the skin adhesion defect.

Altogether, the conclusions of this thesis are as follows:

1. The TALEN-based approach demonstrated that a deletion encompassing the whole exon 80 in COL7A1 results in a functional C7 protein variant able to restore dermal-epidermal adhesion. This study opened up the way for an efficient exon deletion-based therapy in primary keratinocytes.

2. The design of a dual-guide CRISPR/Cas9-based approach aiming to create highly efficient precise exon deletion, delivered by electroporation into primary RDEB keratinocytes, resulted in very high gene editing efficiencies. This new highly efficient approach offers the possibility to genetically-correct bulk primary RDEB keratinocytes populations paving the way to clinical translation. This protocol obtained Orphan Drug designation by EMA in February 2020.

3. A homology-directed repair-based protocol allowed precise gene correction restoring the wild-type version of the defective protein. This approach is more versatile and can cover a wider spectrum of mutations with efficiencies high enough to achieve RDEB phenotype amelioration. New designs will be done to cover other prevalent mutations in a similar fashion and offer a set of gene tools able to efficiently treat RDEB patients depending on mutation and disease context.

Therefore, relevant advances have been done within this thesis regarding EB treatment. Combination of different approaches such as genetically-corrected autologous epidermal stem cells transplantation, MSC infusions and anti-fibrotic therapy will likely be used in the future care of EB patients.

157

THE END

‘Porque al fin y al cabo, todo fin también es un principio.’

159