Implication de ”Liver X Receptors” dans la physiopathologie des gonades Salwan Maqdasy
To cite this version:
Salwan Maqdasy. Implication de ”Liver X Receptors” dans la physiopathologie des gonades. Sciences agricoles. Université Blaise Pascal - Clermont-Ferrand II, 2016. Français. NNT : 2016CLF22713. tel-01967605
HAL Id: tel-01967605 https://tel.archives-ouvertes.fr/tel-01967605 Submitted on 1 Jan 2019
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ! ! !
UNIVERSITE BLAISE PASCAL UNIVERSITE D'AUVERGNE N° D.U. 2713 ANNEE : 2016 ! ! ! ! ! ! ! ECOLE DOCTORALE SCIENCES DE LA VIE, SANTE, AGRONOMIE, ENVIRONNEMENT N° d’ordre : 693
Thèse Présentée à l’Université Blaise Pascal Pour l’obtention du grade de
DOCTEUR D’UNIVERSITE
Spécialité : Génétique et Physiologie Moléculaire (Endocrinologie moléculaire et cellulaire)
Soutenue publiquement par
Salwan MAQDASY
le 04 Juillet 2016
Implication de « Liver X Receptors » dans la physiopathologie des gonades
Président du jury Pr. Claude Dubray, Université d’Auvergne Examinateurs Pr. Paolo Parini, Karolinska Institutet-Stockholm Pr. Igor Tauveron, Université d’Auvergne Rapporteurs Pr. Sophie Christin-Maître, Université de Paris Dr. Hervé Guillou, Université de Toulouse Directeur Dr. Silvère BARON, Université Blaise Pascal
Laboratoire GReD : UMR CNRS 6293-INSERM U1103 Université Clermont Auvergne, France
! ! ! !
UNIVERSITE BLAISE PASCAL UNIVERSITE D'AUVERGNE D.U. No. 2713 Year: 2016 ! ! ! ! ! ! ! !
DOCTORAL SCHOOL of LIFE SCIENCES, HEALTH and ENVIRONMENT Order number: 693 ! Thesis
! Presented to Blaise Pascal University In fulfillment of the requirements for the Degree of
PHILOSOPHIÆ DOCTOR (PhD)
In molecular Physiology and Genetics (Molecular and cellular Endocrinology)
Defended in July 4th, 2016 By
Salwan MAQDASY
Implication of «Liver X Receptors» in the physiopathology of gonads
President of jury Pr. Claude Dubray, University of Auvergne Examiners Pr. Paolo Parini, Karolinska Institute-Stockholm Pr. Igor Tauveron, University of Auvergne Reporters Pr. Sophie Christin-Maître, University of Paris Dr. Hervé Guillou, University of Toulouse Thesis director Dr. Silvère BARON, University of Blaise Pascal
GReD Lab : UMR CNRS 6293-INSERM U1103 Université Clermont Auvergne, France
! ! ! !
!"#"!$%"#"&'() ) ) !"# $"%"$&'"# (')&*$"%")+# ,"# -$.('/")+# "+# ,"(# %"%0$"(# /1# 21$3# /"# %4567'$# 85'+# ,497))"1$# /45&&"-+"$#/"#21:"$#&"#+$565',;#!"#$"%"$&'"#-5$+'&1,'*$"%")+#<5/5%"#,"#=$;#>7-9'"#?9$'(+')@<5A+$"#"+# <7)('"1$#,"#=$;#?,51/"#B10$53#/4567'$#5&&"-+.#/"#&7)('/.$"$#%"(#+$5651C#")#+5)+#D1"#%"%0$"(#/1# &7%'+.#/"#+9*("#"+#%"%0$"(#/1#21$3;#<"$&'#-71$#67(#&7)("',(#D1'#%47)+#-"$%'(#/45%.,'7$"$#,5#D15,'+.# /"#&"#+$565',;## E#F71,/#,'G"#+7#+95)G#+9"#=$;#=57,7#=5$')'#87$#5&&"-+'):#5)/#"C5%')'):#+9'(#+9"('(;#H95)G#371# 87$#:'6'):#%"#+9"#97)7$#78#371$#-$"(")&"#')#+9"#21$3;## !"#$"%"$&'"#.:5,"%")+#,"#B$;#I"$6.#J1',,71#D1'#5#5&&"-+.#/4K+$"#,41)#/"(#$5--7$+"1$(#/"#&"++"# +9*("L#%"$&'#-71$#,4.65,15+'7)#"+#,4')6"(+'(("%")+#/7)+#+1#85'+#-$"16"#/5)(#,4.65,15+'7)#/"#&"#+$565',;## !"#$"%"$&'"#-5$+'&1,'*$"%")+#,"#=$;#E:7$#H516"$7)#"+#2"#+'")(#M#,1'#"C-$'%"$#%5#$"&7))5'((5)&"L# (5)(#671(#2"#)4")#("$5'#-5(#5$$'6.#,M;#!"#671(#$"%"$&'"#/"#%4567'$#5&&"-+.#"+#87$%.#/5)(#67+$"#("$6'&"# "+#/"#%4567'$#/7)).#,47--7$+1)'+.L#,"#(71+'")#"+#,"#+"%-(#/4"88"&+1"$#&"++"#+9*(";# !"#(7195'+"#$"%"$&'"$#&95,"1$"1("%")+#%7)#/'$"&+"1$L#,"#B$#>',6*$"#N5$7)L#D1'#%45#")&5/$.L# &7)("',,.# "+# ")&71$5:.# -")/5)+# +71+"(# &"(# 5))."(# /"# $"&9"$&9";# !"# +"# $"%"$&'"# -71$# +5# 6'65&'+.L# &7)6'6'5,'+.L#+5#$':1"1$#"+#+7)#(71+'");## !"#$"%"$&'"#,"#=$;#!"5)#<5$&#O705&&5$7#D1'#%45#5&&1"',,'#/5)(#(7)#.D1'-"#"+#D1'#5#")#-5$+'"# /'$':.#&"++"#+9*(";#!"#+"#$"%"$&'"#-71$#,5#07))"#91%"1$L#,45%'+'.#"+#,"#(71+'")#(5)(#,'%'+"#D1"#+1#)71(# 788$"(;## <"$&'#M# +71(# ,"(# %"%0$"(# /"# )7+$"# .D1'-"# P#,'-'/(L# )1&,"5$# $"&"-+7$(# 5)/# %5,"# /'(7$/"$(#Q# -71$#,"1$#&7)("',(L#,"1$#/'(-7)'0','+.#"+#,"1$#5%'+'.R#S%5,'5L#B56'/L#T$5)U7'("L#T,7$")&"L#V%%5)1",,"L# S1$.,'"L# S)+97)3L# S,,5)L# W5/5L# O51$'5))"L# N"++3L# O51$5L# >5)/$5L# X,'6'"$L# <5$')"L# !1,'"L# V%",'"# "+# I1:1"(;# <"$&'#M#,4.D1'-"#/4")/7&$')7,7:'"#51#?IYR#N.5+$'&"L#<5$'"L#T$5)U7'("L#?7$')5L#,"#=$;#H9'"0,7+L# "+#+71(#,"(#')+"$)"(#D1'#%47)+#P#(1--7$+.#QL#5--$'(#,"#PT$5)U5'(Q#"+#(71+")1#+71+"(#&"(#5))."(;## <"$&'# M# +71(# ,"(# &7,,*:1"(# "+# ,"(# 5%'(# /1# ,507$5+7'$"# JZ"B#R# ='"$$"L# O51$")+L# ?,51/"L# !"5)@ ?9$'(+7-9"L# S)+7')"L# S))"# <5$'"L# T50$'&"L# S395)L# V%','"L# <'G"L# ?7$5,'"L# I7/5L# H3-95)'"L# <5$27$'"L# I5)5"L#S):.,'D1"L#!"5)#=51,L#>5)/$')"L#=9','--"#"+#[9'$$"/')";# !
! ! ! "#$%&!'&!()**+,#(-%#),$! ! !
!"#$#%&'&()%$*)"'+#$* * (,-./,0-12,03*4* !" #$%&'%(%)*+',&-+'&+./,*%'+0,&)1'*2(2)1*%&23&*$%&)1'1('23%&134&%34+('23%&4210+56%&72*$23& *$%&*%,*2,"& 5067089*$8&9+00%&:;8<%'+3&=8&>+?1((1'+&@AB&134&C1'+3&D"& E*$&FGHI&D/J)+,26J8&K+J?'18&L+'*65108&MN!E"& M" H./,*%'+0,&134&+<1'/8&1&,*+'/&+-&$+J%+,*1,2,&(+3*'+0"& 5067089*$8*A1'*23+*&F8&>+?1((1'+&@AB&134&:0/2,*$;* E*$&FGHI&D/J)+,26J8&K+J?'18&L+'*65108&MN!E"& O" H./,*%'+0,8&>2<%'&P&I%(%)*+',&134&A10%&I%)'+46(*2+3"&& 5067089*$;* O'4&FGHI&D/J)+,26J8&D713,%18&QR8&MN!O"&&
%0-12,03*4* E" >PI& 413,& 0%,& (%0060%,& 4%& 5'1360+,1& %,*& 2342,)%3,1?0%& )+6'& 63%& )$/,2+0+52%& +<1'2%33%& 3+'J10%"& 5067089* $8& #16<%'+3& =8& C'653+3& S8& >+?1((1'+& @A>8& C1'+3& D"& PPP===TJ%& K+35'T,& 4%& 01& D+(2U*U&S'13V12,%&4WF34+('23+0+52%8&C+'4%16.8&S'13(%8&MN!X"& Y" G+3Z(01,,2(10&-63(*2+3,&+-&>2<%'&P&'%(%)*+',&23&'%)'+46(*2+3"&& 5067089*$<&9+00%&:;8<%'+3&=8&>+?1((1'+&@AB&134&C1'+3&D"&& @+6'3U%,&4%,&IU(%)*%6',&G6(0U12'%,8&D*'1,?+6'5&[=\CAK]8&S'13(%8&MN!E"&& X" K1'1(*U'2,1*2+3&46&'^0%&4%,&'U(%)*%6',&4%,&+./,*U'+0,&[>PI,]&413,&0%&*%,*2(60%"&& 5067089*$<&C1)*2,,1'*&A8&9+00%&:;8<%'+3&=8&>+?1((1'+&@AB8&C1'+3&D"& PPPTJ%&K+35'T,&4%&01&D+(2U*U&S'13V12,%&4WF34+('23+0+52%8&L1'2,8&S'13(%8&MN!O"& _" >PI&?%*1&%,*&2J)02`6U&413,&01&)$/,2+0+52%&4%&01&(%0060%&4%&D%'*+02"& 5067089*$;* PP9===TJ%&K+35'T,&4%&01&D+(2U*U&S'13V12,%&4WF34+('23+0+52%8&K0%'J+3*ZS%''1348&S'13(%8& MN!!"&&
+2=03*4* a" >%,&'U(%)*%6',&4%,&+./,*U'+0%,&%*&01&'U5601*2+3&4%,&-+3(*2+3,&%34+('23%&%*&%.+('23%&4%,& 5+314,"& 5067089*$;& @+6'3U%,&4bU(+0%&4+(*+'10%8&K0%'J+3*ZS%''1348&S'13(%8&MN!E"& c" >2<%'&P&'%(%)*+',&134&+<1'/&)$/,2+0+5/d&4%%)&2J)1(*;& 5067089*$;&@+6'3U%,&4%&\I%:&K0%'J+3*ZS%''1348&S'13(%8&MN!E"& !N" K$+0%,*U'+0&%*&-%'*202*U&d&0b23(+336&4%,&'U(%)*%6',&36(0U12'%,&>PI,"&& 5067089*$"&A1'42&\I%:8&K0%'J+3*ZS%''1348&S'13(%8&MN!M"&
&
! ! ! "#$%&#! !
!"#$%"& & !"#$%&'()(%&#"**+,%+#-#)./+0'+#",%0+))+#1'2$#3+#456789#3+$#,:01)+$#+%#$"#1'&;")+<,+#+$%# +<#1':='+$$(:<#3+10($#>0"%'+#-#,(<>#3&,+<<(+$?#@+%%+#1':='+$$(:<#&;:)0+#1"'"))2)+A+<%#-#)"# 1'&;")+<,+# 3+# ).&1(3&A(+# 3.:B&$(%&# +%# 3+# $C<3':A+# A&%"B:)(>0+# 3"<$# )+# A:<3+?# D+# A0)%(1)+$# "'=0A+<%$# 1/C$(:):=(>0+$# +%# &1(3&A(:):=(>0+$# ,/+E# ).F:AA+# $:0%(+<<+<%# )./C1:%/2$+# 3+# ).(<*)0+<,+# 3+# )./:A&:$%"$(+# 3+$# )(1(3+$# $0'# )"# *:<,%(:<# =:<"3(>0+?# G<# 1"'%(,0)(+'H#)+#,/:)+$%&':)#+$%#0<#*",%+0'#,)+*#3"<$#)"#'&=0)"%(:<#3+#)"#$%&':I3:=+<2$+#+%#3+#)"# ="A&%:=+<2$+?# J(+<# >0+# )+$# "%%+(<%+$# =:<"3(>0+$# $+AB)+<%# A0)%(*",%:'(+))+$H# )+$# A&,"<($A+$#A:)&,0)"('+$#'+$%+<%#A&,:<<0$#3"<$#)"#A"K:'(%+$#,"$?#!+$#!"#$%&'&%$($)*+%,# L!MNO#+%#PQ#$:<%#3+$#'&,+1%+0'$#<0,)&"('+$#",%(;&$#1"'#)+$#:RC$%&':)$H#,+#$:<%#,)"$$(>0+A+<%# 3+$#'&=0)"%+0'$#30#A&%"B:)($A+#)(1(3(>0+?# S)0$(+0'$#&%03+$#:<%#3&A:<%'&#).(A1:'%"<,+#3+# ,+$#'&,+1%+0'$#3"<$#)"#1/C$(:):=(+#3+$#=:<"3+$?## @+# %'";"()# (3+<%(*(+# )+$# 'T)+$# A0)%(1)+$# 3+$# !MN$# 3"<$# )+# A"(<%(+<# 3+# )"# *+'%()(%&# A"$,0)(<+#+%#*&A(<(<+H#+%#3&,'(%#).+**+%#3+#)./:A&:$%"$(+#30#,/:)+$%&':)#$0'#)"#A"%0'"%(:<#3+$# ,+))0)+$# =+'A(<")+$# 3"<$# )+# %+$%(,0)+# +%# ).:;"('+?# @+# %'";"()# $+# ,:<,+<%'+# $0'# )."<")C$+# ,:A1"'"%(;+#3.0<+#)(=<&+#3+#$:0'($#'&6+R1'(A"<%#!MNP#L!-%./0102345!-%/Q#$:0$#,:<%'T)+#3+# 1':A:%+0'#3.UVF#/0A"(<#L+R1'+$$(:<#$1&,(*(>0+#3"<$#)+$#,+))0)+$#3+#W+'%:)(#3"<$#)+#%+$%(,0)+# +%#)+$#,+))0)+$#3+#='"<0):$"#3"<$#).:;"('+Q#$0'#0<#*:<3#=&<&%(>0+#3+#$:0'($#!-%./010?# !."B$+<,+# 3.0<# ($:*:'A+# 3+# !MN# "B:0%(%# -# 3+$# 3&*"0%$# $1&,(*(>0+$# 3"<$# 0<# %C1+# ,+))0)"('+#30#%+$%(,0)+?#X&"
! ! ! "#$%&'(%! ! !
!"#$%!&$' ' !"#$%&%"'()**#+",(-./(0*(1$#2+3(4045&)"%02()26(%",(4$#7)+#(%,(4$04)8)"%28(,%2+#(*05$( 0$( *%7#( 6#+)6#,9( :)2'( 35;)2( 43',%0&08%+)&( )26( #4%6#;%0&08%+)&( )$85;#2",( ,5440$"( "3#( %;4)+"( 0*( &%4%6( 30;#0,"),%,( 02( "3#( 802)6,<( %26##6=( +30&#,"#$0&( %,( )( >#'( $#85&)"0$( 0*( ,"#$0%608#2#,%,( )26( 8);#"08#2#,%,9( ?#7#$"3#&#,,=( "3#( ;0&#+5&)$( ;#+3)2%,;,( $#;)%2( 3%66#29(@%7#$(A($#+#4"0$,()&43)()26(B#")(C@ADE()26(FG(B#&028("0("3#(,54#$*);%&'(0*(25+&#)$( $#+#4"0$,( )26( )$#( )+"%7)"#6( 5402( B%26%28( "0( 0H',"#$0&,9( @AD,( )$#( ;)%2&'( %;4&%+)"#6( %2( +30&#,"#$0&( 30;#0,"),%,9( I2+$#),%28( B5&>( 0*( &%"#$)"5$#( %6#2"%*%#6( "3#,#( 202J,"#$0%6( 25+&#)$( $#+#4"0$,(),(;)K0$($#85&)"0$,(0*("3#(802)6(43',%0&08'9( L3%,( M0$>( 52+07#$,( 4$#7%05,&'( 52%6#2"%*%#6( 45")"%7#( $0&#,( 0*( @AD,( )26( )B%&%"'( 0*( +30&#,"#$0&(#H+#,,("0()&"#$(;)&#()26(*#;)&#(8#$;(+#&&(;)"5$)"%029(N#$#%2=(M#()2)&',#()(2#M( ;05,#( ,"$)%2( C!"#$%&'&()*+!"#%G( $#J#H4$#,,%28( @ADF( 526#$( +02"$0&( 0*( O:N( 4$0;0"#$( C,4#+%*%+("0(!#$"0&%(%2("#,"%,()26(8$)25&0,)(+#&&,(%2(07)$'G(%2()(B)+>8$0526(0*(!"#$%&'&,;05,#9( P5$( $#,5&",( %6#2"%*'( @AD,( ),( 4$%;0$6%)&( "0( ;)%2")%2( ;)&#( )26( *#;)&#( *#$"%&%"'9( L3#'( 3)7#( 4�"$04%+( Q202J+&),,%+)&R( $0&#,( $)28%28( *$0;( &%4%6( 30;#0,"),%,( "0( "3#( $#85&)"%02( 0*( 8#$;(+#&&(;)"5$)"%02()26(B%J6%$#+"%02)&(+02"$0&(0*(,"#$0%6(,'2"3#,%,9( I*("3#(+#&&5&)$(6#*#+",(%2("3#()B,#2+#(0*(@AD,(M%"3%2("3#("#,"%,()$#(,%82%*%+)2"=("3#'()$#( 8#2#$)&&'(+0;4#2,)"#6()26(+02,#S5#2"&'=(,%28&#(+#&&(+0;4)$";#2"(%,("0&#$)"#69( T2&%>#( "3#( "#,"%,=( @ADF( %2( "3#( 8$)25&0,)( +#&&,( %,( Q"3#( $#85&)"0$R( 0*( ;5&"%4&#( ;#+3)2%,;,( #,,#2"%)&( *0$( *0&&%+&#( ;)"5$)"%02=( 00+'"#( ,5$7%7)&( )26( *0$( +02"$0&( 075&)"%029( @ADF( %,( "3#$#*0$#( )( 40"#2"%)&( ")$8#"( "0( $#85&)"#( *#;)&#( *#$"%&%"'( )26( "0( 4$#7#2"( 07)$%)2( 3'4#$,"%;5&)"%02(,'26$0;#9( P5$( $#,5&",( 04#2( "3#( 4#$,4#+"%7#,( *0$( "3#( %6#2"%*%+)"%02( 0*( 2#M( 6%)820,"%+( )26U0$( 4$0820,"%+(;)$>#$,(%2(B0"3(;)&#()26(*#;)&#(%2*#$"%&%"'9' ( (
! ! ! "#$%&'()'*+,!
!"#$%&!'&()*+ !+ !"#$ $ !%&'()*+)*,$-.//0110$12.*/342102/$ !"&$ $ .*+24,0*$()*+)*,$32410)*$ !#!%$ $ .-56'#4!7$-8460/10246$.-5612.*/902./0$ !##$ $ .-0156'#4!$-.2(4:56./0$ !;!<$$ .*+24,0*$+)990-)0*-5$49$.,)*,$=.60$ !>;$ $ +04:52)(4*?-60)-$.-)+$ !@$ $ .-1)A.1)*,$9?*-1)4*$ ! ! ! ! ! ! "#$%&'()'*+,! !!"#$%& '())*+,)-.&'),*/&01*(2*2"-+3*4-3*56&231.()& !78& & '1.3*)*9-3*(5&*5&4*3.(& !:;<& & '(.=>1-/&?(@&;<& !%A& & '())*+)1&23*0,)-3*56&>(.0(51& !BC& & '-.512(*/&B&.1+1D3(.& & !" EF!& & 6.(G3>&/*''1.153*-3*(5&'-+3(.& EFH!& & 6.(G3>&/1.*41/&51.'&'-+3(.& E;IJ& & 6),+(21&3.-52D(.31.& E5CA& & 6(5-/(3.(D*5&.1)1-21&>(.0(51& EC& & 6),+(+(.3*+(*/&.1+1D3(.& EKL-21& 6),+(21&K"D>(2D>-3-21& & #" >ME& & >,0-5&+>(.*(5*+&6(5-/(3.(D*5& AF$M& & >*23(51&/1-+13N)-21& AF;& & >*6>"/152*3N&)*D(D.(31*52O&& A#E"M($& P">N/.(@N"P"013>N)(6),3-.N)"+(159N01&$& AL;& & >1D-3*+&)*D-21& ACQ& & >(.0(51&.12D(521&1)101532& A%F& & >N/.(@N231.(*/&/1>N/.(615-21& & $" 7M%7& & *53.-&+N3(D)-20*+&2D1.0&*5R1+3*(5& 7F;& & *531.01/*-31&/152*3N&)*D(D.(31*5& 7F:;& & */,+*?)1&/16.-/(.&('&3>1&;F;&.1+1D3(.& 7;"S!& & *531.)1,=*5"S!& 7;"K& & *531.)1,=*5"K&& 7#M& & *5/*+1&/1&0-221&+(.D(.1))1&T?(/N&0-22&*5/1@U& *H:%& & *5/,+*?)1&5*3.*+&(@*/1&2N53>-21& 7CS& & *541.21&.1D1-3& & %" ;VF& & )*6-5/&?*5/*56&/(0-*5& ;M$J& & )1+*3>*5W&+>()1231.()&-+N)3.-52'1.-21& ;F;& & )(G"/152*3N&)*D(D.(31*52& ;A& & ;,31*5*9*56&>(.0(51& ;ACA& & ;,31*5*9*56&>(.0(51&.1)1-21&>(.0(51& ;L;& & )*D(D.(31*5&)*D-21& ;L%& & )*D(D()N2-++>-.*/1& ;CA"S& & )*41.&.1+1D3(.&>(0()(6"S& ;BC& & )*41.&B&.1+1D3(.& ;BCQ& & )*41.&B&.1+1D3(.&.12D(521&1)10153& & &" #$%& & 01*(2*2&-+3*4-3*56&231.()& ! ! ! ! ! "#$%&'()'*+,! !"# # $%&'()*+,+(-%,+%.#(','/-+(# # !" 0,+)1# # &2,*')(#(','/-+(#,+),-%3)-+(# 045"# # &2,*')(#(','/-+(#,+6('/('77+(# 0869:# # &2,*')(#;),-+(69:# 0<4=>=# 0%'$)&&?<%,@#4=6*%@'#=# 0<<4# # &)-(%2('-%,#/'/-%.'#/(',2(7+(#4# 0"# # &2,*')(#(','/-+(# # #" 5ABB# # +3)(%)&#CD/'(7-%$2*)-%+D&.(+$'# 5<0# # +7-'+/+&-%&# # $" <45B# # /+*D,D7-%,#+3)(D#7D&.(+$'## ! ! ! ! ! "#$%&'()'*+,! !" !"#$ $ %&'%()*+,-$./'0&1&'('$'/1.-23&$ !4567$ $ %-,1')-(8%(21,+$3&.(,%2-'9(1%&-3&.(,-/$:,)%2-$7$ !;<$ $ !2++6+(=&$-&)&8%2-'$ !6>?#$$ %&'%&'$3&(2'('6,)%(@,%(10$'%&-2+$ !A5!$ $ %*32-$1&)-2'(':,)%2-6!$ !<$ $ %B/-2(.$B2-321&$-&)&8%2-$ $ #" CDE5$ $ @,')*+,-$&1.2%B&+(,+$0-2F%B$:,)%2-$ C"<$ $ @(%,3(1$"$-&)&8%2-$ C;";$ $ @&-/6+2F6.&1'(%/$+(828-2%&(1'$ $ $" GH6I$ $ J21,$2))+*.&1'$ $ K) ! ! ! ! ! "#$$%&'(! !"##$%&'( )*+,-(./+-0(&12*13(45(6*-1+/-7+1(8888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888(9( !"#$%&'()')*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-+ :;/.*-+1(%(.+/0"1(+2+3141'%)(*+5/236+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7+ -,+ /1*+(841'%19(*+:94;8#0(1*+.+<8$8(#;0%8*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7+ 7,+ /0"1(+2+3141'%)(*+=/23*>+.+<8$8(#;0%8*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?+ ?,+ /23*+.+@A'(1**0)$+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?+ B,+ C%(94%9(1+1%+D)E1+EF#4%0)$+E1*+/23*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+G+ G,+ /1*+;0<#$E*+E1+/23*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+H+ I,+ 3J;1*+'KL*0);)<0M91*+E1*+/23*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+N+ ++!&+ /23*+1%+;1+D8%#O);0*D1+;0'0E0M91+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+N+ ++P&+ /23*+1%+0$Q;#DD#%0)$+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-7+ ++R&+ /#+';#41+E1*+/23*+E#$*+;#+'KL*0)'#%K);)<01+E9+E0#OS%1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-?+ ++T&+ /23*+1%+;1+D8%#O);0*D1+;0'0E0M91+48(8O(#;+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-G+ ++@&+ /23*+1%+;F#$<0)<1$S*1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-G+ ++U&+ /23*+1%+;1+*L*%SD1+1$E)4(0$01$+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-I+ :;/.*-+1(%%+.+3J;1*+E1*+/23*+E#$*+;#+'KL*0);)<01+1%+;1*+'#%K);)<01*+E1*+<)$#E1*+,,,,,,,,,,,+-H+ ++V,+ /#+(1'()E94%0)$+D#*49;0$1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-H+ -,+ /F#$#%)D01+1%+;FK0*%);)<01+E9+%1*%049;1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-H+ 7,+ /#+'KL*0);)<01+%1*%049;#0(1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-H+ !,+ /#+*'1(D#%)<1$S*1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-H+ P,+ /1*+41;;9;1*+E1+C1(%);0+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+-W+ R,+ /1*+41;;9;1*+E1+/1LE0<+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7?+ ?,+ /#+D#%9(#%0)$+')*%+%1*%049;#0(1+E9+<#DS%1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7I+ B,+ /FKL')<)$#E0*D1+1%+;1*+;0'0E1*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7H+ G,+ /23*+1%+(1'()E94%0)$+D#*49;0$1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7W+ !,+ /23*+1%+;#+*'1(D#%)<1$S*1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+7W+ P,+ /23*+1%+;#+*%8()XE)<1$S*1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?7+ R,+ 3J;1+E1*+/23*+E#$*+;1*+'#%K);)<01*+<)$#E0M91*+4K1Y+;FK)DD1+,,,,,,,,,,,,,,,,,,,,,,,+?7+ T,+ 3J;1+E1*+/23*+E#$*+;#+D#%9(#%0)$+')*%&%1*%049;#0(1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?B+ ++VV,+ /#+(1'()E94%0)$+Q8D0$0$1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?G+ -,+ C%(94%9(1+1%+'KL*0);)<01+E1+;F)"#0(1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?G+ !,+ /#+Q);;049;)<1$S*1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+?G+ P,+ /1*+41;;9;1*+E1+;#+<(#$9;)*#+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+BZ+ R,+ /1*+41;;9;1*+E1+;#+%KSM91+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+B7+ 7,+ [()9O;1*+E1+;#+Q1(%0;0%8+1%+;0'0E1*+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+B?+ ?,+ \()4(8#%0)$+]8E04#;1D1$%+!**0*%81+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+BG+ B,+ /23*+1%+(1'()E94%0)$+Q8D0$0$1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+BH+ !,+ @A'(1**0)$+1%+;0<#$E*+E1*+/23*+E#$*+;F)"#0(1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+BH+ P,+ 3J;1*+E1*+/23*+E#$*+;F)"#0(1+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+BN+ R,+ 3J;1*+E1*+/23*+E#$*+;F9%8(9*+1%+;#+';#41$%#+,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,+GZ+ !1<4=>(?/+-0(!<*1=-*5*<(<4=-1@-(A(&1,1/+<;(.+4B1<-(888888888888888888888888888888888888888888888888888888888888(CD( !,+ 31<9;#%0)$+)Q+%K1+%1*%049;#(+'KL*0);) ! ! ! ! ! "#$$%&'(! !"# $%&'(#)%*(+'#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#,-# ."# /01'#23(#425(6((7(3'#24289'5#(9*%:389(#*8'3&75%3'#;<&77+"#!358:+(#=>#"""""""""""""#,?# @"# @+898:2+#:%9'8*(3258%9'#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#,A# B"# 1%+(#%C#/01'#89#5D(#%E23829#7DF'8%725D%+%4F#"""""""""""""""""""""""""""""""""""""""""""""""""""""""#G-# !"# $%&'(#)%*(+'#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#G-# ."# @+898:2+#:%9'8*(3258%9'#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#GH# ####I(9(32+#:%9:+&'8%9'#""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#GG# ####1(E8(J#!358:+('#""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#G?# ####<&77+()(9523F#2358:+('#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#GA# .8K+8%4327DF#""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#?-# # # ! ! ! ! ! ! ! ! ! ! ! ! "#$%&!'($&)!*+,#+-!./!0#&+$(&1$+! 23('&+$!4)!"#$%&!'!(%)%*+,&-!.!"'(-!/!! 23('&+$!44)!(,0%-!,1!"'(-!#2!+3%!*34-#,0,54!627!*6+3,0,54!,1!+3%!5,267-! ! ! ! 45! 860%!&%*&,79)+#,2! 445! :%;60%!&%*&,79)+#,2! ! ! ! !"#$%&"'()*+',-&./ (=>?',+'@?(AB'C.-:D':$%2&'%&9%&8&3,8'/&%0.",1'&2+.$0+3'"3'!%-3:&B' !"#$%&'()'*+,-.'/&%0.",1'%-,&'&2+.$0+3'"3',4&'5+%.6'-36'7+%&'89&:";:-..1'"3'<$%+9&'/%+7' !"#$%&'()*%+#,&-$#(&./()&0"1$23& !"#$%&'()*%+#,&-$#(&./()&0"1$23& '01'23#33&4#&3 '&%'#.1'567/-*. '8&9'':;<=1' ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()')*+ !"#$%&'()(%&#*+#,-.'#"//+*%+#0'1$#2+#345678#2+$#*-.0)+$9#:))+#+$%#2;-'(<(=+#>"$*.)(=+# 2"=$#)"#?78#2+$#*"$@#/&>(=(=+#2"=$#?78#2+$#*"$#+%#*->A(=&+#2"=$#0'1$#2+#678#2+$#*"$9#:=# <&=&'")@# +))+# +$%# 0'(=*(0")+>+=%# 2.+# B# .=+# "%%+(=%+# 0'(>(%(C+# 2+$# <-="2+$# D3@6E9# !"# 0'&C")+=*+#2+#)"#$%&'()(%&#+$%#+=#0'-<'+$$(-=#2+0.($#F."%'+#B#*(=F#2&*+==(+$#GH(<.'+#3I#DJE9# K+%%+# 0'-<'+$$(-=# &C-).+# 0"'"))1)+>+=%# B# )"# 0'&C")+=*+# 2+# );&0(2&>(+# 2+# );-A&$(%&# +%# 2.# $L=2'->+# >&%"A-)(F.+# 2"=$# )+# >-=2+# D?@4E9# M+# >.)%(0)+$# "'<.>+=%$# 0NL$(-)-<(F.+$# +%# &0(2&>(-)-<(F.+$# *N+O# );P->>+# $-.%(+==+=%# );NL0-%N1$+# 2+# );(=/).+=*+# 2+# );N->&-$%"$(+# 2+$#)(0(2+$#$.'#)"#/-=*%(-=#<-="2(F.+9#:=#+//+%@#0"'>(#)+$#)(0(2+$@#)+#*N-)+$%&'-)#+$%#.=#/"*%+.'# *)+/#2"=$#)"#'&<.)"%(-=#2+#)"#$%&'-Q2-<+=1$+#+%#2+#)"#<">&%-<+=1$+9#M+#0).$@#2+$#&%.2+$#-=%# '+)(&+$# 2L$)(0(2&>(+@# );-A&$(%&# +%# )"# $%&'()(%&# DR@SE9# K->>+# ()).$%'"%(-=@# )+# $L=2'->+# 2+$# -C"('+$#0-)LTL$%(F.+$#+%#);NL0-<-="2($>+#>"$*.)(=#"//+*%+=%#0).$#/'&F.+>>+=%#)+$#0"%(+=%$# -A1$+$#"C+*#$L=2'->+#>&%"A-)(F.+#+%#(=$.)(=-#'&$($%"=*+#DU@VE9# W(+=# F.+# )+$# "%%+(=%+$# <-="2(F.+$# $+>A)+=%# >.)%(/"*%-'(+))+$@# 2"=$# )"# >",-'(%&# 2+$# *"$@#)+$#>&*"=($>+$#>-)&*.)"('+$#'+$%+=%#>&*-==.$#D37E9## :=# '"($-=# 2+$# >&*-=="($$"=*+$# 2+$# >&*"=($>+$# >-)&*.)"('+$# 2+# )"# $%&'()(%&@# );"=%(*(0"%(-=#2+$#*N"=*+$#2+#'&.$$(%+#2+$#0'-%-*-)+$#2;"$$($%"=*+#>&2(*")+#B#)"#0'-*'&"%(-=# GXYZI#+$%#2(//(*()+#D33E9#X(=$(@#(2+=%(/(+'#2+$#>"'F.+.'$#>-)&*.)"('+$#0'&2(*%(/$#2+#$.**1$#2+# /&*-=2"%(-=#+$%#+$$+=%(+)9## M+0.($# .=+# C(=<%"(=+# 2;"==&+$@# )+$# '&*+0%+.'$# =.*)&"('+$# -'0N+)(=$# $-=%# 2&*'(%$# *->>+#&%"=%#2+$#'&<.)"%+.'$#2+#)"#0NL$(-0"%N-)-<(+#<-="2(F.+@#2-=%#);"*%(C(%&#+$%#$+=$(A)+#B# );+=C('-==+>+=%# +%9# K+'%"(=$# 2+# *+$# '&*+0%+.'$# $-=%# (>0)(F.&$@# 2('+*%+>+=%# -.# (=2('+*%+>+=%#2"=$#);N->&-$%"$(+#)(0(2(F.+9## Z"'>(#+.[@#)+$#!(C+'#\#'+*+0%-'$#G!\]$I#$-=%#2+$#'&*+0%+.'$#=.*)&"('+$#"*%(C&$#0"'#)+$# -[L$%&'-)$@# *+# $-=%# *)"$$(F.+>+=%# 2+$# '&<.)"%+.'$# 2.# >&%"A-)($>+# )(0(2(F.+@# +%# $-=%# )"'<+>+=%# (>0)(F.&$# 2"=$# )"# 0NL$(-0"%N-)-<(+# 2.# $L=2'->+# >&%"A-)(F.+# +%# 2+$# 2L$)(0(2&>(+$#D36^3SE9#K+$#'&*+0%+.'$#$-=%#(>0)(F.&$#2"=$#)"#0NL$(-)-<(+#<-="2(F.+#D3U^66E9# X*%.+))+>+=%@# 0).$(+.'$# &%.2+$# $+# $-=%# (=%&'+$$&+$# B# )+.'# '_)+# 0NL$(-0"%N-)-<(F.+# 2"=$# )"# /+'%()(%&9#`)$#0-.''"(+=%#a%'+#2+$#>&2("%+.'$#0-%+=%(+)$#'+)("=%#)+#$L=2'->+#>&%"A-)(F.+#+%#$+$# *-=$&F.+=*+$#$.'#)"#/+'%()(%&@#+%#a%'+#(>0)(F.&$#2"=$#)"#0+'%.'A"%(-=#+=2-*'(=(+==+#(=2.(%+# 0"'#2+$#/"*%+.'$#+=C('-==+>+=%".[#D33@6JE9# ! -! ! ! ! ! ! ! ! !?@ABCD?E# )@AFGE@# ;CFIJ?# CEBEFGACH# CEBEFGACH# CEBEFGACH## "1"#$%&%,-# !"#$%&'# (()"#$%&%,-# 5367# ("'# #2"867# #21"#$%&-# )"'# 31"-# 0)167# *"'# 58(# (1"-# +"'## 4)"#-# .21# ")"#$%&%,-# (9"# ."#$%&-# 9*36:69#$%&%,# /0"-# 2AL#JM?DGN#2DFD@H# ";"#$%&%,# !""#$%&%,# "/"#$%&%,# 5GECAD@#IACKA?EH# *493# ."#<%=# '#8AKA@DKEC# 8936=# -8EGECA@DKEC#LDGI#"1"# 4;>(6.3#$%&%,# >?O?AL?#PDQJ?@# 3DQRCE# !"#$%&'()*)+),%-(').)/(0($&1'2)3,./4) !" #$%&'()$*+$,'%&-,).(/0'$%&1&2(3('/.0+(%& !"#$ %&'"()"*%#$ +*',&-.%"#$ /01#2$ #3+)$ 4"#$ 5-')"*%#$ 4"$ )%-+#'%.().3+$ .6(,.7*&#$ 4-+#$ 4.8"%#"#$ -').8.)&#$ 9.3,3:.7*"#$ %&:*,-+)$ "+)%"$ -*)%"$ ,"$ 4&8",3(("6"+);$ ,"$ 6&)-93,.#6";$ ,<.+5,-66-).3+;$")$,-$%"(%34*').3+=$>.+#.;$,"#$01#$#3+)$.6(,.7*&#$4-+#$,-$(?@#.3(-)?3,3:."$4"#$ 6-,-4."#$6&)-93,.7*"#;$4&:&+&%-).8"#;$.+5,-66-)3.%"#;$")$+&3(,-#.7*"#$ABCDBEF=$!-$(,*(-%)$ 4"$ '"#$ %&'"()"*%#$ 3+)$ &)&$ 4&'%.)#$ '366"$ G3%(?",.+#H$ -*$ 636"+)$ 4"$ ,"*%#$ .4"+).5.'-).3+;$ -8-+)$7*"$,"*%#$,.:-+4#$+"$#3."+)$'3++*#$AIJF=$K"$,L;$G$,<"+43'%.+3,3:."$%"8"%#"$H$-$5-.)$#3+$ -((-%.).3+=$>*$,."*$4<.4"+).5."%$,$'"$M3*%;$CN$01#$3+)$&)&$.4"+).5.&#$'?"O$, !"#$%&'()!"#$%&#'()%*+%,'&#-./-+#*0%#2340-1&#)/--,&"#5.0)+363+(#73/2/438,%#1%#)%&# '()%*+%,'&# %&+# 1(*%-10-+%# 1%# 2%,'# -36%0,# 1.%9*'%&&3/-# %+# 1%# 20# *'(&%-)%# 1%&# )/: 0)+360+%,'&"# ;2# %&+# 01<3&# 8,%# 2%,'# */)=%# %&+# 0)+36(%# )/-&+3+,+3/--%22%<%-+# *0'# 2%# '%*23%<%-+#1.04/-3&+%&#>/'+&#=?1'/*=/7%,3#<3<%-+#20#*'(&%-)%#1.,-#2340-1"#$%&# '()%*+%,'&# */,''03%-+# @+'%# (402%<%-+# 3<*238,(&# 10-&# 20# '(4,20+3/-# */&3+36%# /,# -(40+36%#1%#2.0)+363+(#1.0,+'%&#AB&"## # 5%&#AB&#*/,''03%-+#&%#*'(&%-+%'#&/3+#%-# !" #$%&'()(*&+&,-.'/(0#)*/1(2(3454'67$-4/( 5%&#'()%*+%,'MAU#DBAIHSL#RSVT#%+#5MAW#DBAIHVL#RSSFSXT#&/-+#1()/,6%'+%*,3&# *2,%#63-4+#1.0-&#RSYT"#50#>/-)+3/-#8,3#2%,'#0603+#(+(#0++'37,(%#0,#1(7,+#(+03+#20#'(4,20+3/-# 1%# 2.=/<(/&+0&3%# 1,# )=/2%&+('/2# %+# 20# &?-+=C&%# 1%&# 0)31%&# 4'0&# RSZT"# Q.0,+'%&# '[2%&# *=?&3/2/438,%&#-%#)%&&%-+#1.@+'%#<3&#%-#(631%-)%"#5.%9*'%&&3/-F#2%#/-)+3/--%<%-+# %+#2%&#'[2%%MA&#&%'/-+#1(+0322(&#*0'#20#&,3+%"# 8" #)*/(2(9:,'&//$.5( Q%,9# 4C-%&# )/1%-+# 1%,9# 3&/>/'<%&# 13&+3-)+&# 1%&# 5MA&\# 5MAU# DBAIHSL# %+# 5MAW# DBAIHVL"#Q%*,3&#V]]YF#Y#3&/>/'<%&#DI:YL#1%#5MA*#%+#,-#3&/>/'<%#1%#5MA+#&/-+#1()'3+%&#)=%^# 2.H/<<%#RS_FS`T"#50#*2,*0'+#1%&#+3&&,&#%9*'3<%-+#,-.U(/),-.U0)%&+#%9*'3<(#,-38,%<%-+#0,# -36%0,#+%&+3),203'%#+0-13,%#,-.U1)#0#,-#+'C&#>0372%#-36%0,#1.%9*'%&&3/-"## $=%^#2.H/<<%F#2%#4C-%#)/10-+#5MAU#D2.(31L#%&+#&3+,(#&,'#2%#)='/ -! ! ! ! ! ! ! ! LXR! ! LXR" ! Figure 3: A-Northen blot analysis of tissue distribution of LXR! and LXR" in the adult mouse. Cyclophilin is included as a comparative control. Adapted from Repa and Mangelsdorf 2000. B-Expression profile of mRNA transcript for mouse LXR! and LXR" in two mouse strains. Adapted from Bookout et mangelsdorf 2003, 2006. ! ! "#$%#!&#!'())*+,)%+#! !"# $%"&'(%)*$)+&# ,-# ./&0# (+,"&$# !123# 0'$# )&,-)$0# *"%# 4567839# -&# :"($0-%# ,0# $%"&'(%)*$)+&9#(+;"($)<"$0-%#=-)#'0#:)>0#"-#*%+?+$0-%#,0#!12#@ABCD## 4E0F# GHI+??09# G0# ./&0# (+,"&$# !"#3#0'$#"-$+%J.-GJ#"-# &)<0"-# $%"&'(%)*$)+&&0GG0# *"%#G"#*%+$J)&0#0GG0#?K?0#L!"#3$#@MN9MOCD#P0#*G-'9#G0#./&0#!%&3#0'$#*+')$)<0?0&$#%J.-GJ#*"%# G0'# 88Q2# L88Q23# ,"&'# G0# :+)0# 0$# 88Q2R! ,"&'# G0'# ?"(%+*E".0'S# @MT9MACD# 6&:)&9# ,H"-$%0'# %J(0*$0-%'# $0G'# =-0# 62U# 0$# V2# *+-%%")0&$# J."G0?0&$# )&,-)%0# G"# $%"&'(%)*$)+&# ,0# !12UD# !"# %J.-G"$)+&#,0#$%"&'(%)*$)+&#,0#!"##L!%&S#'0?WG0#,+?)&"&$0#'-%#!"#3#L!%&3$#'-..J%"&$#=-0#G"# $%"&'(%)*$)+&#,0#!12U#0'$#(+&'$)$-$)+&&0GG0#LX"WG0#OSD# !"# *%+$J)&0# !123# 0'$# (+?*+'J0# ,0# MMY# "(),0'# "?)&J'# LMAZPS9# $"&,)'# =-0# !12U# 0'$# (+&'$)$-J# ,0# M[N# "(),0'# "?)&J'# L\NZPSD# 40'# ,0-># %J(0*$0-%'# *"%$".0&$# -&0# E+?+G+.)0# ,0# 'J=-0&(0# ,0# YY]# @AT9AACD# 6&# .J&J%"G9# !12U# 0'$# 0>*%)?J# ,0# :"^+&# -W)=-)$")%0# $"&,)'# =-0# GH0>*%0'')+&#,0#!123#'0#G)?)$0#"-#&)<0"-#,0'#$)''-'#+_#G0#?J$"W+G)'?0#G)*),)=-0#0'$#)?*+%$"&$# L:+)09# )&$0'$)&9# $)''-# ",)*0->9# $)''-# (J%JW%"G9# ?"(%+*E".0'9# %0)&'S# 0$# "-# &)<0"-# ,0'# $)''-'# '$J%+`,)0&'#L'-%%J&"G0'9#0$#.+&",0'S#@MM9M\C#La).-%0#ASD# !0'# ,0-># )'+:+%?0'# *0-<0&$# "<+)%# ,0'# %bG0'# *Ec')+G+.)=-0'# ,)::J%0&$'# 0$# &+&# %0,+&,"&$'#,"&'#-&#?K?0#$)''-D#40$$0#(+&(-%%0&(0#0'$#(+&'$"$J0#G+%'#,0#GH"&"Gc'0#,0'#'+-%)'# ,J:)()0&$0'# '-%# -&# )'+:+%?0# ?")'# 0>*%)?"&$# GH"-$%0# )'+:+%?0# L!%&3'(') +-) !%&U'('$*) P"&'# G0'# $)''-'# +_# G0'# ,0-># )'+:+%?0'# '+&$# *%J'0&$'9# GH"W'0&(0# ,H"($)<)$J# ,0# !12U#*+-%%")$# K$%0# (+?*0&'J0# *"%# !1239# ?")'# !12U# 0'$# *0-# %J.-GJ# *"%# G0'# <+)0'# (0GG-G")%0'# 0$# &0# *0-$# (+?*0&'0%#G0#%bG0#,0#!123D#!123#0'$#,+&(#,+?)&"&$#0&#$0%?0#,H"($)<)$J#*Ec')+G+.)=-0#,"&'# G0'#$)''-'#+_#G0'#,0->#)'+:+%?0'#'+&$#0>*%)?J'9#(+??0#(H0'$#G0#("'#"-#&)<0"-#EJ*"$)=-0D#8"%# 0>0?*G09# GH)&<"G),"$)+&# ,-# ./&0# !%&+# (+&,-)$# d# -&0# '$J"$+'0# EJ*"$)=-0# (E0F# G0'# "&)?"-># &+-%%)'# "<0(# -&# %J.)?0# %)(E0# 0&# (E+G0'$J%+G# @M[C*) 40# *EJ&+$c*0# 0'$# ,e# d# -&0# "W'0&(0# ,H)&,-($)+&#,-#./&0#,-./019#-&#./&0#()WG0#,)%0($0#,0#!123#(E0F#G"#'+-%)'D#!H)'+:+%?0#WK$"#"-# &)<0"-#EJ*"$)=-0#&H0'$#*"'#("*"WG0#d#(+?*0&'0%#(0$#0::0$D#f&<0%'0?0&$9#!123#&0#*0-$#*"'# 0?*K(E0%#G0#*EJ&+$c*0#-$J%)&#(E0F#G"#'+-%)'#!%&2'(')@MYC*#fG#0>)'$0#,+&(#,0'#?+,0'#,H"($)+&# ,)'$)&($'#*+-%#(0'#,0->#%J(0*$0-%'D#8"%#")GG0-%'9#G0'#,0->#)'+:+%?0'#*0-<0&$#"<+)%#,0'#%bG0'# %0,+&,"&$'g# G"# *%J'0&(0# ,H-&# ,0'# ,0-># )'+:+%?0'# 0?*K(E0# GH"**"%)$)+&# ,H-&# *EJ&+$c*0# *"%$)(-G)0%9# (+??0# (H0'$# G0# ("'# ,"&'# GH+<")%0# +_# G0'# '+-%)'# !%&+'(') 34) !%&+2'(') &H+&$# "-(-&# *EJ&+$c*0D# -! ! ! ! ! ! ! ! !"#$%&'(%))*+,$-+./012+,$ 3,4(%1)%$ 5%4(%1)%$ !!"#$% &'% !!"#(% )*+,+,-./011203*45% 67/8-*7% 6)9:;%<=>?$% 6)?9@% AB*40CD5%/E35//% )*+*4%+53,B*40C,7%+3,481E/% )F#%0G,7*/E/%HAB./E53,-/;%/.7E25C1I% )F#$%H08E,?35G8-0C,7I% 6+)787(1,)012+,10$-+./012+,$+9$!"#$142:*7;$ 3,4(%1)%$ 5%4(%1)%$ 1"J!% !2,/+2,3.-0C,7%K.%+3,E5*7%L*70/5/% =#%1,M+5CC,7%N,3%#F#%H#"#;%OP#;%<#;%>F#I% =,7?N871C,70-%1,M+-5B%Q*E2%!!"#$% % <1=0%$>?$!"#$%&'(%))*+,$-+./012+,$+,$7(1,)4(*'2+,10$1,.$'+)787(1,)4(*'2+,10$0%:%0)@$=,E5%E20E% )F#$%35G8-0E5/%,7-.%*E/%,Q7%G575R% !"#$%&'()*+,-./01'23#.4*(+0(56.41'<=>?$?<8M,3%7513,/*/%N01E,3?$%S%789#:.*,;.4'8'+(<(=*/+1'9>9#+(?4/.<',<.-' +(<(=*/+1' @9#*AB+/.-' A/+;/4(' +(<(=*/+1' CC>9#' =(+/D.)/;(' =+/0.E(+,*/+#, B6' B6' 8@8' ($ P$ M*.:$N.?#7$ L#0*9$>$ L#0*9$E$ <=>$ C$I,9$2*+:7*H*.13#+$3"#$7#+5,.+#$#0#H#.3@$$ '&'$%()$ %&'$%()$ )$I,9$;,7H$1$2*H#7*O1F,.$*.3#7;1:#@$$ !"#$%&' ()' *+,-.&/01-' "22$34%0156' 57' 89*+' 06:' 2"#06:+;"6:"6#' :5/0"63' 57' <=>?' @+8@8' "3' -56314$4&:' 57' 4A5' B"6-' .&2"C' 4DE&' FG+FG?' F+HI&%022' 34%$-4$%&' 57' 4.&' <=>JK>=>L' <@8+ .&4&%5:"/&%?'!"#$%&'$%()$*+$+",-.$*.$/#00,-$1.2$3"#$'&'4$%()$*.$56750#8$#9:#53$;,7$<=>$"#0*:#+$ -"*:"$17#$2#5*:3#2$*.$?7##.@$A'BCDE$5#5F2#+$17#$:,0,7#2$7#2@$G#0#:3#2$+#:,.217/$#0#H#.3+$17#$ 1..,313#2$-*3"$.6HI#7+$5,+*F,.#2$13$3"#*7$JD3#7H*.10$#.2+@$!"#$%&"'()*+',-&.//*.'&%'#01'2334' 5678'91' ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'$&%()($)*+,(),-.'$/+0),(1)2341) !"# $%&'(%'&)# *+,+&"-)# ./',# 01# )$%# (2342$+)# .)# 4-'$5)'&$# .23"5,)$6# 7",$# -)# $),$# 1%)&89%)&:# $)# %&2';)# ',# .23"5,)# ./"(%5;"%52,# <2,(%52,,)--)# =>?8@A:# ',# .23"5,)# .)# -5"5$2,# ";)(#-/>71#=7B7A:#',#.23"5,)#(C"&,5D&)#E#C5,*)#F#)%#',#.23"5,)#.)#-5"5$2,#";)(#-)#-5*",.# =!B7A#G'5#42&%)#+*"-)3),%#',#.23"5,)#./"(%5;"%52,#<2,(%52,,)--)#=>?8HA6#!)$#01$#)I)&(),%# -)'&#"(%5;5%+#.)#<"(%)'&#.)#%&",$(&54%52,#),#$)#<5I",%#$'&#-/>71#4"&#-)#7B7#$'&#.)$#$+G'),()$# $4+(5<5G')$# ,233+)$# J0K# !"#$%#&'( )'*+#&*'( ,-'%'&.*A6# K,# *+,+&"-:# -"# 4&+$),()# ./',# -5*",.#4)&3)%%&"5%#-)#&)(&'%)3),%#.)#(28"(%5;"%)'&$#)%#"(%5;)#-"#4&2%+5,)#LMNO6## !"#$ %&'()*#$ %+(,-).(-)&*$ /&*,-)&**#0$ 123!45# )$%# ',# .23"5,)# 4)&3)%%",%# -)# &)(&'%)3),%#.)$#(28"(%5;"%)'&$#$5%'+$#.'#(P%+#18%)&35,"-#.)#-"#4&2%+5,)6#!/>?8@#)$%#-"#4"&%5)# -"#4-'$#;"&5"Q-)#.)#-"#<"35--)#.)$#01$#)%#42'&&"5%#R%&)#.5<<+&),%)#./',)#()--'-)#S#',)#"'%&):# 4)&3)%%",%#./"$$'&)&#',)#"(%5;5%+#$4+(5<5G')#S#(C"G')#&+()4%)'&#.",$#(C"G')#%5$$'6#!/>?8@# 4)&3)%# -/"(%5;"%52,# %&",$(&54%52,,)--)# ),# <2,(%52,# .'# 4&232%)'&# .)# *D,)# (5Q-)# )%# 42'&&"5%# $/"$$2(5)&#S#.)$#(2<"(%)'&$#$4+(5<5G')$#4)&3)%%",%#',)#.5;)&*),()#.",$#-)$#&P-)$#.)#(C"G')# 5$2<2&3)#=?5*'&)#T>A6# !"#$ %&'()*#$ %#$ 0)()6&*$ (.#,$ 0+278:# -)# 7B7:# )$%# -)# .23"5,)# G'5# .+%)&35,)# -/"44"&%),",()#S#-"#<"35--)#.)$#01$6#U-#$)#<5I)#$'&#',)#$+G'),()#$4+(5<5G')#./>71#=+-+3),%#.)# &+42,$)A6# !)# 7B7# )$%# (2342$+# .)# .)'I# .25*%$# .)# V5,*# .)# %W4)# 9H9H# ("4"Q-)# .)# -5)&# -)$# +-+3),%$#.)#&+42,$)#"'I#!X0$#=!X0KA#LMHO#=?5*'&)#TBA6# 7)$# 35--5)&$# ./+-+3),%$# .)# &+42,$)# )I5$%),%# 42'&# (C"G')# &+()4%)'&6# !X0Y# )%# !X0Z# 42'&&"5),%# 5,%)&"*5&# ";)(# .)$# +-+3),%$# .)# &+42,$)# $4+(5<5G')$# S# (C"G')# 5$2<2&3)6# !)$# +-)3),%$# .)# &+42,$)# (-"$$5G')$# (2,,'$# 42'&# !X0$# $2,%# .)$# 70T# =!X0KA6# 9)$# 70T# $2,%# (2342$+$#.)#.)'I#$+G'),()$#./C+I",'(-+2%5.)$#=>[[\9>A#),#&+4+%5%52,#.5&)(%)#)%#$+4"&+)$# 4"&#T#Q"$)$#.)#,'(-+2%5.)$#=>[[\9>,,,,>[[\9>A#LMHO:#G'5#$)#%&2';),%#-)#4-'$#$2';),%#.",$# -)$#4&232%)'&$#.)#-"#4-'4"&%#.)$#*D,)$#(5Q-)$#.)#!X0$#LHT:M]:T^:T_O6# !X0$# 42'&&"5),%# 5,%)&"*5&# ";)(# ./"'%&)$# $+G'),()$6# !X0Q#)$%# +*"-)3),%# ("4"Q-)# S#$)#-5)&#"'I# +-+3),%$# .5&)(%$# 70@# =>[[\9>,>[[\9>A6# 9)$# +-+3),%$# $2,%# .)$# $5%)$# .)# -5"5$2,$#./"'%&)$#&+()4%)'&$#,'(-+"5&)$#=``>0#)%#0>0A6#`-'$#&"&)3),%:#!X0#4)'%#$)#<5I)&#$'&# .)$#+-+3),%$#5,;)&$)$#=U0@A:#G'5#$2,%#.)$#+-+3),%$#(-"$$5G')$#.)$#?X0$#LaNO6# >'#<5,"-:#.)#4"&%#-)'&#$4+(5<5(5%+#./5$2<2&3)#)%#-)'&#$4+(5<5(5%+#%5$$'-"5&):#()%%)#.5;)&$5%+# .",$#-)$#!X0K$#(2,<5)#',)#*&",.)#"(%5;5%+#4CW$52-2*5G')#"'I#!X0$6# -! ! ! ! ! ! ! ! Z[CR.% E#CR% [#GZR% \#[R% KECN% QLKC% F7:304<367%' BAC'#% EF#?% ?@A' A@A' ?@A' A@A' L#O% L#O% Z'+%GG% ?(.6$;(,5<'6% '&%?.(-0/%-060% X97$/0('+% Y?@A/?#0<6',;%.;,2% !"#$%&'()'*+',&-.'/01&2340'",,$56%347+'78',"#3+9:9&;&+9&+6'6%3+50%";47+'304<347+'=>'?@AB' !"#$%&'()%'*+,-./0%10/0('2,)0($%3,/1%#"#4%50().606/+7%8902%'6%!"#:%3,/1%6'%/(.6$;(,5<'6.+%.;<=,/7%,6% /10%.*$06;0%'&%/10%+,-.62>%?(.6$;(,5<'6.+%(05(0$$,'6%,$%(0-@+./02%*7%(0;(@,/)06/%'&%/10%;'A(05(0$$'($%BA C'#%.62D'(%EF#?>%G6%/10%5(0$06;0%'&%0,/10(%!"#%'(%#"#%+,-.62%H50(),$$,=0%2,)0(I4%/10%;'A.;<=./'($%.(0% (0;(@,/02%.62%/10%;'A(05(0$$'($%2,$5+.;02>%?10%/(.6$;(,5<'6%,$%;'6$0J@06/+7%.;<=./02>%?10%/(.6$;(,5/$% H)#BK%'(%),#BKI%'&%/.(-0/%-060$%090(/%*,'+'-,;.+%.;<'6$%.$%2'36$/(0.)%&.;/'($%'&%/10%B#A)02,./02% $,-6.+,6-%5./13.7!"#$%&'($")*+,"-%.$%/0"('"%1!""2345!" *+' %"#16.' 970C"+#' 78' 7D>56&%7,5' "+67' 61&' ,"#3+9:="+9"+#' ;70C&6' 78' ?@AE>% L';M,6-% '&% .-'6,$<;% '97$/0('+$% $@--0$/$% .% ;'))'6% *,62,6-% '&% /10,(% NNA4% NOA% '(% NPA172('97+% -('@5% /'% QONR% .62% SOOT% U090)5+,802%*7%NNH6IAQC%NO4NVA:C%.62%NPAQCW4%,6/0(.;<'6$%/1./%;.66'/%*0%&'()02%*7%/10%.6/.-'6,$<;% '97$/0('+%NNH7IAQC%2@0%/'%$/0(,;%1,62(.6;0>"#$%&'($")*+,"78(9//+9"('"%1!"233:";-<=">!" %' ! ! "#$%#!&#!'())*+,)%+#! !"#$ %&'()*#$ +,(-*).-#! "#$! #%$&'! "($)"! *"! +,+! "$! *"! -,+.! /"! 0123%("! 4")2"$! *3! )1$3$%1(! 0&! )'5"4$"&)! "$! *3! *%3%#1(! 36"5! &(! '*'2"($! 0"! )'41(#"! 0%)"5$"! 1&! %(6")#"! "$! *7"(5)38"!0"#!519)'4)"##"&)#!"(!3:#"(5"!0"!*%83(0!;<=>.!/"!0123%("!"#$!4*&#!*1(8!03(#!-?@A! B&"!03(#!-?@C.!D*!43)$%5%4"!'83*"2"($!03(#!*3!#4'5%E%5%$'!0"!5F3B&"!)'5"4$"&)!8)G5"!3&!5F1%H! 07&(!'*'2"($!0"!)'41(#"!43)$%5&*%").!$ !"#$ %&'()*#$ %#$ /)()0&*$ (1#+$ /#$ /)2(*%$ 3"456!"#$!&("!415F"!#4'5%E%B&"!FI0)14F1:"! %0"($%E%3($! &("! #$)&5$&)"! 3**1#$')%B&"! J*"! *%83(0K.! L**"! "#$! #%$&'"! 0&! 5M$'! /9$")2%(3*"! 0"! *3! 4)1$'%("N!"$!4")2"$!07%0"($%E%")!&(!*%83(0!#4'5%E%B&"!"$!&(!0%2O)"!#4'5%E%B&".!+O#!*1)#!B&"!*"! *%83(0!#"!E%H"!03(#!*3!415F"!FI0)14F1:"N!&(!0123%("!0735$%63$%1(!JPQ9RK!4)'#"($!S!5M$'!0"! -,+!J*7F'*%H"!T=R!0&!-,+KN!3##&)"!&("!210%E%53$%1(!0"!*3!51(E1)23$%1(!%(0&%$"!43)!*"!*%83(0! "$! 4")2"$! 0"! E")2")! *3! 415F"! 0"! -,+! "$! 0'4*35")! *"#! 51)'4)"##"&)#.! /"$$"! 51(E1)23$%1(! 4")2"$!0"!4%'8")!*"!*%83(0!03(#!*3!415F"!FI0)14F1:"!"$!*"!)"5)&$"2"($!0"#!51935$%63$"&)#N! (1$322"($! U@/9=N! 4=VW! "$! XY/9=C!41&)! *"#! 4*&#! 51((&#! ; -! ! ! ! ! ! ! ! B$+&,"E(?-K-5B$+(5B$+&,"E(?- !"#$'&& C>D"E(?- !"#$%&& *$F5,(65+$- 23%&& *$F5,(65+$GH- I5'6$)&,GHH- '('& )4J5,$6$- '()&& ./0"(32#()45,$6$- ./01../.0"#2(32#()45,$6$- .789:/.;"$<(3&,56()+$'(,- $*+,-&& .7/.;"#2%&#'("==">?9- !!"#$%& .789:/.;"$<(3&-==">?9- .!$%-/&&&& .7/.;"#2%&#'("@">?9- '"#$%& .789:/.;"$<(3&-@">?9- .7/.;"#2%&#'(3A&*()+$'(,- ;8+,*-).,/& .789:/.;"$<(3&A&*()+$'(,- !"#$%&#'(B%(,$)+$'(,-- !"#$%&#'(#$)*()+$'(,- .789:/.;"$<(3&,5+%()+$'(,- .!$%0&& .789:/.;"$<(3&"!"#$%&#'(B%(,$)+$'(,- B%(,$)+$'(,- .!$%1/&& ()*+,*-).,/& $*+104-&& 012%3405")6,789:,/)*-).,/& .!"%&#'(3&B%(,$)+$'(,- !<=>.)& ?@& A:,/)*-).,/& ()& B,C,& D<,*8B-:)*<*E& L$B(M62A$#- NOL- 5M(62)+)- 5'$- <'$)$6+$#- (6- 5- P'(Q6- P5BRM'(J6#S-- !"#$%&'()*+,-.*('(/01)*232415,*2(6-078*/09 :9 ,0+4615;0<9 =>=&;?4520709;*71)5;0<9=>@&;?4520709 0A-.B+5;0<9 C!$%DE('F()*+,-.*;10,-29 GDE(,0+4615;0<9 $HIJK(257-;10,-29 KE5(+0/01)*25;0<9 C!$%KE&;10,-29 KE5(,0+4615;0<9C!$%L&L(+0)*+,-6)-20;10,-29,0+4615;0M9 ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'()*+,%&,$&#-.%& !"#$ %&'#()*%+#$ #%,($ -"#$ -)*./)#$ 0'-*%&'+)#$ -1$ 20%+"#()*%+3$ 4"#$ 5%+)21+"#$ #%,($ -"#$ .,("*5)-.6.*"#$-6,#$+6$/%."$-"$#',(07#"$"($-1$26(68%+.#5"$-1$20%+"#()*%+9$+6$#',(07#"$-"#$ 62.-"#$8.+.6.*"#$"($-"#$#()*%:-"#$;<=9>?@3$4"#$5%+)21+"#$#%,($26*62()*.#)"#$A6*$1,"$%&'-6(.%,$ #1*$+6$206.,"$+6()*6+"$-1$#()*%+9$B1.$+"#$*",-$26A68+"$-C62(./"*$!DE$;>F@3$!"#$%&'#()*%+#$#%,($ .5A+.B1)#$ -6,#$ +C0%5)%#(6#."$ -1$ 20%+"#()*%+$ "($ .+#$ #%,($ -"$ A+1#$ ",$ A+1#$ 1(.+.#)#$ 2%55"$ 56*B1"1*#$ -"$ A6(0%+%G."#$ ,"1*%$ -)G),)*6(./"#$ ;>H@3$ I+#$ %,($ 1,"$ 62(./.()$ 8.%+%G.B1"$ A+1#$ .5A%*(6,("$B1"$+"$20%+"#()*%+$;><@3$ J.KK)*",(#$ K%*5"#$ -"#$ %&'#()*%+#$ "&.#(",($L$ FMNOPQ0'-*%&'20%+"#()*%+9$ FFNEPQ 0'-*%&'20%+"#()*%+9$ F -!/%0' ()%#*+' ()*%,"' 45678' 123/*0%' )-./*&0' !"#$%&'()'*+&,"-./'01%$-1$%&'23'0451+&6-'789'.#25"010:' !"#'9:;'()%#*+'9<='>?='@AB>'CB=;'DEF9:;BG'-!/%0'9:;'()*%,"'9<='HBBC='BI=JEKJG' 1EF9:;'9L:E>M'EB'@A<='E@IA<>9:>'>?9:'>?=':9>C<9D'DEF9:;B'N$"/&'5'OB'$"/+'5P!'"#$%&'#( )*+,(-.'//+.0('&($1!(234(5677(( ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'( )*+( ,)( -.)/0).( 12340*+)( 5+0,0*6( 714*( 54)( 6+57)( 8,04095)( 7)( -:1*)( ;<( !)*( .6*5,+1+*( )4( +)./)( 75( /6+1=3,0*/)( ,0-07095)( 6+10)4+( 04+6.)**14+*( /10*( ,>6+57)( 1( 6+6( 04+)..3/-5)(7)?14+(7)*()@@)+*(*)834710.)*(4)5.3,32095)*(0/-3.+14+*(ABCDB;E(FG025.)(BH<( !>18+0?0+6(+.14*8.0-+034),,)(7)*(!"#*()*+(621,)/)4+(/370@06)(!"#$%&'$"()"*+(,')&'<(!)*( @3./)*(*5,@1+6)*(7)(:I7.3JI$8:3,)*+6.3,()+(7)*(1807)*(2.1*(-3,I04*1+5.6*(-)5?)4+(=,395).(35( 04:0=).(,>18+0?0+6(7)(8)*(.68)-+)5.*<(!>)J0*+)48)(7)(,1(@3./)(*5,@1+6)(K$L)+3$8:3,)*+6.3,()+(M$ 6-3JI$8:3,)*+6.3,(714*(,)*(-,195)*(7>1+:6.3/)(*522N.)4+(,)5.()@@)+(04:0=0+)5.(*5.(!"#D()+(-1.( 834*695)48)(,>1885/5,1+034(75(8:3,)*+6.3,(AB'E<(O)+()@@)+()*+(-.3750+(-1.(,1(@0J1+034(7)(8)*( /3,685,)*(714*(,)*(-38:)*(7)(!PQ(75(.68)-+)5.<( !" #$%&'()*+',-%-.,/0&'(1&'(23#'(( 45 23#'(&6(%&(7869:-%,'7&(%,),1,/0&( !)(8:3,)*+6.3,()*+(54)(/3,685,)(*+.58+5.1,)(+.N*(0/-3.+14+)(714*(,)*(8),,5,)*<(R,(@10+( -1.+0)(7)(,1(83/-3*0+034(7)*(/)/=.14)*(8),,5,10.)*<(R,(04+).?0)4+(621,)/)4+(714*(,1(*I4+:N*)( 7)(*+6.3S7)*D(7>3JI*+6.3,*D(7>1807)*(=0,010.)*()+(7)(,1(?0+1/04)(Q<(T4)(-1.+0)(75(8:3,)*+6.3,( -.3?0)4+(7)(,1(*I4+:N*)()4732N4)(F%&$(+-+H(-1.(,1(?30)(/6?1,341+)(AB&E<(U.N*(7)(&CC$MCC(/2( 7)(8:3,)*+6.3,(*34+(1--3.+6*(-1.(,)(.)-1*(+35*(,)*(V35.*<(!)(8:3,)*+6.3,(1=*3.=6(-1.(,>04+)*+04D( )*+(70*+.0=56(714*(,>3.2140*/)(-1.(,)*(,0-3-.3+604)*<(!>)J8N*(75(8:3,)*+6.3,()*+(*+38L6(*35*( @3./)(7)(?6*085,)*(7>)*+).*(7)(8:3,)*+6.3,D(6,0/046(-1.(3JI71+034(35(+.14*@3./6()4(1807)*( =0,010.)*(15(40?)15(75(@30)()+()J8.6+6(15(40?)15(7)(,>04+)*+04<(T4)(=1,148)(+.N*(76,081+)()J0*+)( -35.(6?0+).(,)(*+38L12)()J8)**0?)(75(8:3,)*+6.3,(950(-35..10+(W+.)(+3J095)(A&%DBXYB%EZ(8),,)$80( @10+(04+).?)40.(,>1=*3.-+034D(,)(+.14*-3.+D(,1(*I4+:N*)(%&$(+-+.(,)(*+38L12)()*+(,>6,0/041+034(75( 8:3,)*+6.3,(ABKDBBE(FG025.)([\H<( U,5*0)5.*(.68)-+)5.*(458,610.)*(*34+(0/-,0956*(714*(8)++)(.625,1+034D(43+1//)4+(]#D( ^#D(G"#D(UU\#()+(!"#<( !>)J8N*(7)(8:3,)*+6.3,(-)5+(*>1885/5,).(714*(,)*(-1.30*(7)*(1.+N.)*D(76?),3--14+(7)*( ,6*034*( 1+:6.3/1+)5*)*<( !>1+:6.3*8,6.3*)( )*+( )4( -1.+0)( .)*-34*1=,)( 7)( ,1( *5.?)45)( 7)*( /1,170)*( 81.703?1*85,10.)*D( 83//)( ,>1423.D( ,>[email protected]+5*( 7)( /I381.7)D( ,>18807)4+( ?1*85,10.)( 86.6=.1,(35(,>1.+6.03-1+:0)(-6.0-:6.095)<(( \5(40?)15(8),,5,10.)D(,)(8:3,)*+6.3,(-.3?0)4+(*30+(7>54)(?30)(7)(*I4+:N*)(%&$(+-+$F,1( ?30)( /6?1,341+)( 70.026)( -.0480-1,)/)4+( -1.( ,)( @18+)5.( 7)( +.14*8.0-+034( _#]PU'( F')&#+/$ #&*0/")+#1$ &/&2&()$ 3,(%,(*$ !#+)&,(HD( *30+( 7>54)( 81-+1+034( 75( 8:3,)*+6.3,( 1--3.+6( -! ! ! ! ! ! ! ! %7$#%7$# %7$# %7$# %7$# .+('/# (0123453612# %&'%($ %&')($ $"!# !"!# *!+,$ !"#$ ,!,"$ 78)'"$ )!*+,-# 9':;<$ 879$# %&'(!# $7$# %4025/6$'.%$ '-./01203./$ 879$# *:;141<3# ,()=># $7$!# ?@AB63# >C# .D)E453<@F# F0123453612# <35GH12@4<# G:;# !"!I$"!# GFJK@5EL# +D(322B2G6# F0123453612# <35GH12@4 !"#$%#!&'()($*+!&"+'&+'#!,!",*-#$(+./.+0!"#$%&'()*+$!),",-"*&)'12+/34+56(+'(4+%,$%($*"&*#,$4+ 76+ %8,'(4*-",'+ &69)($*($*:+ '(6"4+ 7-"#;-4+ 8<7",=<'-4:+ '(4+ ,=<4*-",'4:+ &%*#;($*+ '(4+ .>?42+ @(4+ 7("$#("4+ &69)($*($*+ 'A(BB'6=+ 76+ %8,'(4*-",'+ 9"C%(+ D+ 'A#$76%*#,$+ 7(4+ !",*-#$(4+ EF@4+ 0./0$ 1)'%)'2$34((&**&56$.(+%8,'(4*-",'+(4*+($46#*(+%&!*-+!&"+'&+'#!,!",*-#$(+G/.:+(*+*"&$4!,"*-+&6+ B,#(:+,H+#'+(4*+%,$;("*#+($+&%#7(4+I#'#&#"(4+(*+-'#)#$-+7&$4+'A#$*(4*#$+JKLM2+N'+(4*+#)!,"*&$*+7(+ $,*("+56(+'(+%8,'(4*-",'+(4*+4*,%O-+&6+$#;(&6+%(''6'&#"(+(*+*"&$4!,"*-+!&"+'(4+'#!,!",*-#$(4+ 4,64+B,")(+(4*-"#B#-(2+.A(4*-"#B#%&*#,$+(4*+(BB(%*6-(+!&"+E@EP+043+!78".743+!$*-4'(9&-4(&5+&6+ $#;(&6+ %(''6'&#"(+ (*+ .@EP+ 0!&3)*:)'&$ 3:"!&(*&-+!$ &(*&-$ *-4'(9&-4(&1+ "(*",6;-+ 46"+ '&+ 46"B&%(+ 7AG/.2+.(+%8,'(4*-",'+(4*+'#I-"-+4#+I(4,#$+!&"+'&+@QG+03:"!&(*&-"!$&(*&-$:+%-";+!4(&1+JLRSLTM+ 0U#96"(+LE12+ .(4+ .>?4+ 4,$*+ %'&44#56()($*+ 7-%"#*4+ %,))(+ "-96'&*(6"4+ #$*"&+ %(''6'&#"(4+ 76+ %8,'(4*-",'2+ N'4+ -;#*($*+ 4,$+ &%%6)6'&*#,$+ #$*"&%(''6'&#"(:+ (*+ !&"+ %,$4-56($*:+ #'4+ 4,$*+ %,$4#7-"-4+%,))(+7(4+B&%*(6"4+8?X+(4*+'(+93$(+8<0=.>+ 56#+ %,$*"Y'(+ !"# $%&'()$*# +*$# ",-+*$# .-!-"-/*$+ JWZM2+ .(4+ 4,6"#4+ ?;-X7@7$ 4,64+ "-9#)(+ "#%8(+ ($+ %8,'(4*-",'+7-;(',!!($*+6$+B,#(+4*-&*,4#56(+%&"&%*-"#4-+!&"+6$(+&%%6)6'&*#,$+(=%(44#;(+7(4+ (4*("4+ 7(+ %8,'(4*-",'+ JWZM2+ @(+ !8-$,)3$(+ (4*+ '#-+ D+ 'A&I,'#*#,$+ 7(+ 'A#$76%*#,$+ 7(+ 8+,=.>$ $-%(44&#"(+!,6"+-'#)#$("+'A(=%34+7(+%8,'(4*-",'+4,64+B,")(+7(+I#'(2+@8([+'AG,))(:+#'+$A(=#4*(+ !&4+7(+.>?Q+7&$4+'(+!",),*(6"+7(+8+,=.>:+7,$%+%(**(+),76'&*#,$+$A&+!&4+-*-+"(*",6;-(+JL\M+ (*+'&+4<$*834(+7A&%#7(4+I#'#&#"(4+(4*+7-!($7&$*(+7(4+"-%(!*(6"4+.?G]^+(*+U>?+J\R:LZM2+/(+!'64:+ .>?X+ (4*+ #)!'#56-+ 7&$4+ '&+ %,$_69,$+ 7(4+ &%#7(4+ I#'#&#"(4+ !&"+ '&+ 4*#)6'&*#,$+ 7A`aP^EV+ 02!A3A-"'"(+!$*-4'(9&-4(&$>B$,"!+,&,*)%&$C1+%,))(+'A&+7-),$*"-+F&"I#("+(*+4!6+($+TRRL+JLbM2+ @(+93$(+%,7(+6$(+($[<)(+"(4!,$4&I'(+7(+'&+9'6%6",$,]%,$_69,$+7(4+&%#7(4+I#'#&#"(42++ .(4+ .>?4+ 4,$*+ 7(4+ "-96'&*(6"4+ 76+ '/"&$01/'# -&2*/$*# +3# ,(1!*$'4/1!# 76+ *#446+ !-"#!8-"#56(+;("4+'(+B,#(2+@(%#+(4*+9"C%(+D+'&+"-96'&*#,$+7#"(%*(+7(+*"&$4%"#!*#,$+7(4+93$(4+ %,7&$*+ '(4+ !",*-#$(4+ )()I"&$&#"(4+ c$./0$ 1)'%)'2$ 34((&**&($ D.E8(5$d+ *(''(4+ 56(+ 'A.134>B$ .132>B$ .132F@G+ !&"+ .>?4+ JLKS^RWM2+ EF@E^+ (4*+ %'&44#56()($*+ #)!'#56-+ 7&$4+ 'A(BB'6=+ 76+ %8,'(4*-",'+&6+$#;(&6+%(''6'&#"(2+.(4+'#9&$74+7(+.>?+#$76#4($*+'A(=!"(44#,$+7A.134>$7&$4+'(4+ )&%",!8&9(4+)6"#$4+(*+7A.132>+7&$4+'A&,"*(+!(")(**&$*+'A(BB'6=+76+%8,'(4*-",'+Jbb:^R\M2+@(*+ (BB(*+(4*+-9&'()($*+"(*",6;-+%8([+'&+4,6"#4+4&6;&9(+*"&#*-(+&;(%+76+PRL2+@(**(+#$76%*#,$+(4*+ &I4($*(+%8([+'&+4,6"#4+?;-Xe7@7$J^RRM+0U#96"(+LF12++ -! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'(")(#*+,$-,./#0(#)1-0('2&%-0#3#04#'-%25(#*(#04#)(0060(#'(%4#5")-%$-%&#*4"'#0('# 789# (2# 2%4"'$-%2&# 46# :-5(;# 9+4)25<425-"# *+,=>,.# 46?@("2(# *-")# 0('# 246A# *+789# -6# !"#!$ %&'(")*$+",-,.-)&"'$B05$-$%-2&5"('#%5)1('#("#,$-,/#,$->#(2#,$-!C#:4<-%5'4"2#6"(#$%-2()25-"# )4%*5-<4')6045%(# D.EFG.EHI;# >(2# (::(2# ('2# &?40(@("2# :4<-%5'&# $4%# 04# %&?60425-"# $-'525<(# *(# /!-+&()&.*+$&()&.$).0'(1&.$,.-)&"'#B>!JKC#$4%#9LM'#)1(N#0+7-@@(#D.EOI;#,=>P.#('2#&?40(@("2# 6"(#)5Q0(#*5%()2(#*('#9LM'#D.EH/..FI;#,=>P.#("#'R"(%?5(#4<()#,=>,./#$-2("25405'(#0+(::06A#*6# )1-0('2&%-0# (2# $%&<5("2# 0+4))6@60425-"# *6# )1-0('2&%-0# %(2%-6<&(# )1(N# 0('# '-6%5'# 23/#4STS# D...I;## ,5"'5/# 0(# PUVOFW# 4# *&@-"2%&# '-"# (::5)4)52&# 4"25S421&%-?X"(# *4"'# *('# @-*X0('# @6%5"'# 4<()# 421&%-')0&%-'(# B2,-5676$ &)$ 8%+.6769:$ >(2# 4?-"5'2(# *(# 9LM# %&*652# 04# $04Y6(# *+421&%-@(#*(#$%X'#*(#WEZ#?%[)(#3#0+4)25<425-"#*+,=>,.#(2#,=>P.#*4"'#0('#@4)%-$14?('#(2# 0('#)(0060('#("*-21&0540('#*(#0+4-%2(;#84"'#6"(#462%(#&26*(/#>1("#(2#0+:#("#\E.\#-"2#*&@-"2%&# Y6(# JEO# 4# 0('# @]@('# (::(2'# '6%# 0('# '-6%5'# 2,-5676;# 4<()# 46?@("2425-"# *('# 246A# *(# 789/# %&*6)25-"#*(#246A#*(#989/#(2#<4'-*5042425-"#$4%#0+5"2(%@&*545%(#*(#04#$1-'$1-%R0425-"#*6#^_`# ("*-21&0540#D..\I;## 9LM'# @-*60("2# &?40(@("2# 0(# %&)($2(6%# *(# 789/# 0(# `MS=.# D..VI# (2# 04# 05$-$%-2&5"(# 05$4'(#B9K9C#D..aI#Y65#:5"405'("2#0(#2%4"'$-%2#5"<(%'(#*6#)1-0('2&%-0#(2#0+1R*%-0R'(#*('#('2(%'# *6#)1-0('2&%-0#46#"5<(46#1&$425Y6(#$-6%#&05@5"(%#0('#05$-$%-2&5"(';# 9LM'#%&?60("2#&?40(@("2#04#!"#$%&!'()'!(*+,-.+,+/,$0.#'!/#5@$05Y6&('#*4"'#0+(::06A# *6# )1-0('2&%-0# 46# "5<(46# *('# @4)%-$14?('/# '-"# 2%4"'$-%2# 5"<(%'(# (2# *4"'# 04# )045%4")(# 1&$425Y6(#*('#05$-$%-2&5"(';#,$-!#('2#5"*5'$("'4Q0(#*4"'#0(#@&24Q-05'@(#*('#05$-$%-2&5"('# "-24@@("2# *4"'# 0+&05@5"425-"# *('# )1R0-@5)%-"'/# *('# b989# (2# *('# c89# D..WI;# c0# $%-@(2# 0+5")-%$-%425-"#*6#)1-0('2&%-0#*4"'#0('#789#0-%'#*(#0+(::06A#)(006045%(;#,$->#('2#6"#)-:4)2(6%# *(#9K9#Y65#1R*%-0R'(#0('#2%5?0R)&%5*('#(2#4))($2(6%#*6#)1-0('2&%-0#46#"5<(46#*('#05$-$%-2&5"('# D..FI;# 9('# '-6%5'# 2,-5676# '-"2# )4%4)2&%5'&('# $4%# 6"(# *R'05$5*&@5(# 4<()# 6"(# 421&%-')0&%-'(# D..dI;#9LM'#'25@60("2#04#'R"21X'(#*(#,$-!#(2#,$->Sc/#cc#(2#cb#*4"'#0('#@4)%-$14?('#16@45"'# (2#@6%5"'#?%[)(#3#04#%()-""45''4")(#*('#9LM!#$%&'("2'#*4"'#0(#$%-@-2(6%#*('#?X"('#)-*4"2# 2,-5# (2# 2,-<# D..HI;# 9+(A$%(''5-"# '(@Q0(# ]2%(# %&?60&(# $4%# 0('# *(6A# 5'-:-%@('# *(# 9LM# )4%# 6"5Y6(@("2#0('#'-6%5'#8=.efSTS#-"2#6"(#*5@5"625-"#*('#246A#*+4$-05$-$%-2&5"('#D..H/..OI;# 9('#05?4"*'##*(#9LM#'-"2#)4$4Q0('#3#%&*65%(#0+421&%-')0&%-'(#)1(N#*('#'-6%5'#2,-5676$Ddd/.\EI;## 1'!( 2'--3-'!( .#$'!$.#*-'!# )--%*-""("2# ?%[)(# 46A# 9LM'# 0+4Q'-%$25-"# *(# WEZ# *6# )1-0('2&%-0# 405@("245%(;# 9('# 9LM'# *5@5"6("2# 0('# "5<(46A# *(# ^K>.9./# %('$-"'4Q0(# *(# -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()*&+, -., /0&!1%)2'&!3, 41, /0&!1%)2'&!, #$%&'$2, 1%), )'#+%52'2, #.6, 784, 9':/1, ;, !"<=>FGH<=>FI,@?AAJ?AGB3,FKLMNO,1%),.+,#9&+*%)1,%(2/*5*P.1,-1,4CD,*+)1%)*+#!,1E(Q/0#+), !"#$%&'()*&+,-.,/0&!1%)2'&!,RS*9.'1,T !"#$ %&'()#$ &'*+')"!#,$ "*$ -&.#$ !"#$ /&0'(%1&2"#3$ 4).#),$ !"#$ !)2&.-#$ -"$ 567$ %"'/"**'&)".*$ !&$ %'+8".*)(.,$ !&$ '+#('%*)(.$ -"$ !&$ %!&9:"$ &*1+'(/&*":#"$ "*$ -(.0$ !&$ %'+8".*)(.$ -"#$ /&!&-)"#$ 0&'-)(8�:!&)'"#$;<=,<>,?>,??,<@@,<=@,<>AB<>CD3$$ ! "#$! "%&$! $'()! *+,-#.#()! -/0'+*(/12#$,$&:2/".*&.*$!&$#E.*1F#"$-"#$&0)-"#$2'&#$"*$ -"#$ *')2!E0+')-"#$ G#+0'+*)(.$ -"$ H5I5$ &:$ .)8"&:$ 1+%&*)9:"J$ %&'$ !"$ 0(.*'K!"$ *'&.#0')%*)(.."!$ -"#$2F."#$L7MNOP<0$; !" #$%&'()'*+,-.//.)*0+' M.$ %!:#$ -"$ !U&00:/:!&*)(.$ -"#$ !)%)-"#,$ !U).V!&//&*)(.,$ #(:8".*$ %'+#".*"$ -&.#$ !"$ #E.-'(/"$/+*&](!)9:",$^(:"$:.$'K!"$)/%('*&.*$-&.#$!"$-+8"!(%%"/".*$-"$!U&*1+'(#0!+'(#"$ "*$ -"#$ /&!&-)"#$ 0&'-)(8�:!&)'"#3$ 5U&0*)8&*)(.$ -"#$ 567#$ &$ :.$ "VV"*$ &.*)P).V!&//&*()'"$ ;AQ, -.! ! ! ! ! ! ! ! !"#$%"&'((')*+,-./.0)1-*2-3451- 6788+.11%*"-*2-0,)*9%".1- !"#$%& '($)*& '($+& ,$-.#& 6788+.11%*"-*2-0:.(*9%".1- /-0$)&123&/-0$4& ;"<,(.-+.=7>'#*"- -56$7& 0,8.$)& 9"5.& /05& ?')+%@-(.)'>>*8+*).'1.1- //0$:& 50"& !07).-8:'1.-8+*).%"1- -;0& .<0& 6#(7>'#*"-*2-'"#$%"&'((')*+,- =.".1- <=>921?@&''& <39AB2@CD2&=@C@AEB=?& A'B>.- CD- 67(('+,- *2- )'+=.)- =.".1- 0*E%"=- ."<,(.1- '"E- 0,)*9%".1- %(8>%0').E- %"- %"&'(('#*"F-3451-'+.-'"#$%"&'((')*+,-8+*).%"1F- !"#$!%&'()*+,*-.'(#$!/&!"#0%'()*+,*-.'(#0&/&'123%'(4-5'6,*&(')+'5&78'4*&9:();<9*/&1=#>?&%(-5,*<+&@<5)7+#>?/& 2A1%79)*7B7(C(/&D23%+*<5CE*&78:F*(&9B*5'*9/&GDA#G#D*<5CE*&B+7)*'(/&HHA#H<)+'8&H*)<,,7B+7)*<9*/& G2I#G:5,778:F*(<9*/&HGA%J7(75:)*&5;*J7 !"!#$%&'()#'*+,-.!#/%0,),#!'0!'123'!.'&4-')$.,4-'0,#!$.!'&5#'*!'(#4/4.!5#'0!'6728'9:;<=>'?!&' 04--%!&'!"(*,@5!-.'*!'(*5&'A),B*!'#,&@5!'0!'/)*)0,!&'$)#0,4C)&$5*),#!&'$D!E'*!&'A!//!&'!-' (%#,40!'0+)$.,C,.%'F%-,.)*!'()#'#)((4#.')5"'D4//!&'9:;G=>'H-C!#&!/!-.I'0)-&'5-'$4-.!".!' 0+DJ(!#$D4*!&.%#4*%/,!I'*+)$$5/5*).,4-'0!'KLMDJ0#4"J$D4*!&.%#4*'45'!"#$%&'(&)*$+,-*./0+"1' ,-05,.' 5-' &,.5).,4-' (#4M,-A*)//).4,#!' $4-05,&)-.' N' *+).D%#4&$*%#4&!' ()#' *+,-D,B,.,4-' 0!' *+)$.,C,.%'0!'128'9:OP=>' 6+)$.,C,.%')-.,M,-A*)//).4,#!'0!&'672&',-.!#C,!-.'%F)*!/!-.'0)-&'*)'0,AA%#!-.,).,4-'0!' *+%(,0!#/!>'6!5#')$.,C).,4-'()#'0!&'4"J&.%#4*&'#%05,.'*+%(),&&!5#'0!'*+%(,0!#/!'!.'A)C4#,&!'*)' $,$).#,&).,4->'6!&'&45#,&'2,03MQM'4-.'5-'%(,0!#/!'(*5&'A,-'9:O:=>'?D!E'*!&'/40R*!&'0!'&45#,&' )C!$' 0!#/).,.!I' 672&' &.,/5*!-.' *)' 0,AA%#!-.,).,4-' !.' *!' 0%C!*4((!/!-.' 0!' *+%(,0!#/!>' S-' .#),.!/!-.' ()#' 0!&' )F4-,&.!&' -).5#!*&' 0!&' 672' )((*,@5%' &5#' $!&' /40R*!&' #%05,.' *+,-A*)//).,4-' 0!' /)-,R#!' 672M0%(!-0)-.!>' ?!.' !AA!.' &+!"(*,@5!' ()#' *+,-D,B,.,4-' 0!' H6M:' !.' TUV8I'$J.4W,-!&' (#4' ,-A*)//).4,#!&' ,/(*,@5%!&' 0)-&' *)' (DJ&,4().D4*4F,!' 0!' *)' 0!#/).,.!' 9:O:I:OK='XT)B*!'KY>'' ?!&' #Z*!&' DJ(4$D4*!&.%#4*%/,)-.&' !.' )-.,M,-A*)//).4,#!&' 0!&' 672&' (4.!-.,)*,&!-.' *!5#&' !AA!.&' )-.,).D%#4FR-!&' !.' *!&' ,0!-.,A,!-.' $4//!' 0!&' $,B*!&' (4.!-.,!**!&' (45#' *!' .#),.!/!-.'0!&'0J&*,(,0%/,!&'!.'0!'*+).D%#4&$*%#4&!'9:KI;[ILLI:\:I:;;I:O\I:O;=>' !" #$%&'$()%*)+%#,-+%*$.+%'$%&/0+12&$3/2'241)%*5%*1$673)% 6!'0,)BR.!')AA!$.!';M:P]'0!'*)'(4(5*).,4-'4$$,0!-.)*!'9:\[=>'6)'(DJ&,4().D4*4F,!'!&.' $)#)$.%#,&%!'()#'*+,-&5*,-4'#%&,&.)-$!''X0,)BR.!'.J(!'KY'!.Q45'*+,-&5*,-4(%-,!'X0,)BR.!'.J(!':' !.'KY'9:OO=>'6!'0,)BR.!'0!'.J(!'K'XGP]'0!'0,)BR.!Y'!&.'$)#)$.%#,&%'()#'5-!',-&5*,-4'#%&,&.)-$!I' )&&4$,%!' N' 0!&' 0%A)5.&' 0!' &%$#%.,4-'0+,-&5*,-!'),-&,'@5+N' 0!&' (D%-4/R-!&' ,-A*)//).4,#!&' $D!E'0!&'().,!-.&'&45C!-.'!-'&,.5).,4-'0!'&J-0#4/!'/%.)B4*,@5!'!.'0+4B%&,.%'9:O[I:OL=>'' ?4//!'*!&'672&'&4-.'0!&'(#4.%,-!&')-.,M,-A*)//).4,#!&I'*!5#&'#Z*!&'0)-&'*!'0,)BR.!'4-.'%.%' %.50,%&>' 6!' A4,!I' *!' ()-$#%)&I' *!&' /5&$*!&' !.' *!' .,&&5' )0,(!5"' &4-.' A4-0)/!-.)*!/!-.' ,/(*,@5%&'0)-&'*)'(DJ&,4().D4*4F,!'05'0,)BR.!>' !"#$%&'%()*'+'*+,-&5*,-!',-D,B!'*)'-%4F*5$4F!-R&!>'6728',-D,B!'*+!"(#!&&,4-'0!'FR-!&' $40)-.'*)'34+*34+#5+"3-0'(&.#$6&07+,-8)5&*#'X^1^?_Y'!.'*!'9"'6+*#:;:34+*34&.&*#<'!.'()#' $4-&%@5!-$!' *)' -%4F*5$4F!-R&!' 9:;I:O<`:[:=>' ?!.' !AA!.' !&.' ,-0,#!$.' !.' &+!"!#$!' ()#' *+,-.!#/%0,),#!' 0!' a21b^:$' !.' ==>?@M6+&6.)(&.+0:A&"34&' X^c?M:8Y' 9:[KI:[\=>' d,-&,I' *+)$.,C).,4-'0!&'672&')'*!'/e/!'!AA!.'@5!'*+,-&5*,-!')5'-,C!)5'D%().,@5!'9LKI:[;=>'f!'(*5&I' -.! ! ! ! ! ! ! ! &* % &( ( &(# (($&( !! ( ) ( ) ! ! !"#$%&'()*'+,-.'%&#$/01&'#/$23.&'435&3.10.".'067'"6.$/"6'.&6."89"1:;'!"#$%&'!()*+,-.'%&/' 0123,-24+4-.$%5' 6789&' :;)*,-.' +(4<-2,(+.(5' 6$/24-.&' 6;)*,-.$/$23,-234+4-.5' =>?&' 3@A(,B@-+.(,1A' A.3@A(,:.<4-.5' #6C$%4&' ##DEF' *,4*GH4+,($%45' #I#CJ&' 23,-23,.<,;2@()H4+.' *4(0,B@K1<4-.5'>EI"#%*&'-+.(,;'(.:);4+,(@'.;.L.<+$01 !"#$% &'()*+&)'')'(% ,-'$% .-% $(&/0.-(&1'% ,)% .-% .&213)'4$)% )'% *521'$)% 6% .7892)*3.9:5/&);% !1*$<0)%.)%(-0=%,)%3.0:1$)%-03/)'()%,-'$%.)$%:)..0.)$%852-(&<0)$>%)..)%$(&/0.)%.-%.1:-.&$-(&1'% '0:.5-&*)% ,70'% ?-:()0*% ,)% (*-'$:*&2(&1'>% @8#ABC% D!"#$%&'(#")*+ #*,-%.,*+ */*0*.)+ $1.(1.2+ -#%)*1.E% 2)*/)((-'(% .-% (*-'$:*&2(&1'% ,)% 3",.+ FGHI>GHHJ;% !)% KLM% $(&/0.)% .-% (*-'$:*&2(&1'% ,)% @8#ABC>%.7&,)'(&?&-'(%:1//)%34')%:&N.)%,&*):(%,)%!"#%FGHOJ;% !"# $%&'("# )"# *($+,-(./% .)$% ,)0=% &$1?1*/)$% $1'(% )=2*&/5)$%,-'$%.)$%:)..0.)$%BP(-% D$):*5(-'(% .7&'$0.&')E% )(% -.28-% D$):*5(-'(% .)% 3.0:-31'E% ,)$% Q.1($% ,)% !-'3)*8-'$% /0*&'$% )(% 80/-&'$% FRI>GHSJ;% !7-:(&+-(&1'% ,)% !"#% )$(% &,)'(&<0)% 6% .7)??)(% ,)% .7892)*3.9:5/&)% $0*% .)$% :)..0.)$%N)(-%T%)..)%$(&/0.)%.-%$5:*5(&1'%,7&'$0.&')%FGHS>GHMJ;%!)$%$10*&$%45#UV676%,5+).122)'(% 0'%,&-N4()%,-'$%.-%/1&(&5%,)$%:-$>%$):1',-&*)%6%0')%&'$0.&'125'&)%!"#VW,52)',-'()%FGOLX GOYJ;%@)$%,1''5)$%*)'?1*:)'(%.)%*Z.)%-'(&,&-N5(&<0)%,)%!"#;% !"# $%&'("# )'.# 0%..".# *-,%*1-,%2"'.%D.)$%/0$:.)$%)(%.)%(&$$0%-,&2)0=E>%.)%3.0:1$)%)$(% :-2(5%210*%<07&.%$1&(%/5(-N1.&$5%10%$(1:[5%FGO\J;%!7&'$0.&')%<0&%2)*/)(%.7)'(*5)%,0%3.0:1$)% ,-'$%.)$%:)..0.)$%,)%:)$%1*3-')$%3*]:)%-0%(*-'$21*()0*%^!_KR%FGOR>GOIJ;%^!_KR%)$(%0'%34')% :&N.)%,)%!"#$%:8)`%.7a1//)%)(%:8)`%.-%$10*&$%FGR>GOHJ;%b1'%)=2*)$$&1'%)$(%-:(&+5)%2-*%,)$% -31'&$()$%,)%!"#%FGR>GHY>GOOXGOMJ;%!7-:(&+-(&1'%,)%!"#%-/5.&1*)%,1':%.7&'$0.&'1%*5$&$(-':)%)(% 2)*/)(%.-%:-2(-(&1'%,0%3.0:1$)%2-*%.)$%(&$$0$%25*&285*&<0)$%FGSLJ;%@8)`%.)$%$10*&$%,Nc,N>%<0&% 1'(%0')%1N5$&(5%35'5(&<0)%-+):%0')%&'$0.&'1%*5$&$(-':)>%.)%KLM%)$(%:-2-N.)%,)%'1*/-.&$)*%.-% 3.9:5/&)%FGR>GSGJ%Dd&30*)%GLE;% @8)`% .7a1//)>% 0')% 5(0,)% ,0% (&$$0% -,&2)0=% ,)% ?)//)$% 1N4$)$% -+):% 0'% ,&-N4()% 3)$(-(&1'').% :1/2-*-(&+)/)'(% 6% ,)$% ?)//)$% ,)% 21&,$% '1*/-.% -% /1'(*5% 0')% ,&/&'0(&1'% ,7)=2*)$$&1'%,)%!"#U%)(%b#ABCG:%FGSYJ;%e8'%)(%"/8%1'(%/1'(*5%0')%:1**5.-(&1'%$&3'&?&:-(&+)% )'(*)%.7)=2*)$$&1'%,)%!"#-%)(%.7-::0/0.-(&1'%.&2&,&<0)>%.7&'?.-//-(&1'%)(%.-%?&N*1$)%:8)`%,)$% 2-(&)'($%-+):%0')%$(5-(1$)%852-(&<0)%'1'W-.:11.&<0)%FGS\J;%_')%+&'3(-&')%,)$%bfC$%,-'$%.)% 34')% ,)% !"#V%1'(% 5(5% &,)'(&?&5$% ,-'$% 0'% 2)(&(% '1/N*)% ,)% 2-(&)'($% -+):% 0'% $9',*1/)% /5(-N1.&<0)% D'gSHE;% h)$% 5(0,)$% )??):(05)$% $0*% ,)$% )??):(&?$% 2.0$% 3*-',$% Da_fKWY% 210*% .)% ,&-N4()>%ijfk@e%)(%aA!Afe%210*%.71N5$&(5E%1'(%&,)'(&?&5)$%0'%bfC%,-'$%.)%34')%,)%!"#V%.&5% -0%,&-N4()%,)%(92)%Y%)(%6%.71N5$&(5%D*$GO\O\LSLE%FGSRXGSOJ;%@)$%*5$0.(-($%,5/1'(*)'(%<070'% .&)'%)'(*)%.)$%$&(0-(&1'$%,7&'$0.&'1%*5$&$(-':)%)(%.-%+1&)%!"#%)=&$();% -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'()'*('+,)-./*0&+('*0102034('5,6,.6-*' !"#$%&'"()*+&'#,&-"#-.#+/'"#012&+)3.)#43.(#'3#2%5(0&'&60"#4-#(5()71"#."+8"-9#$&11"# $&12&(3.)# ()+-$)-+"'# 4"(# ."+:(;# 4-# )0((-# 4"# (&-)0".# ")# 4"(# ."-+&)+3.(1"))"-+(# <=>>?@# !A012&+)3.$"# 4"(# !BC(# 3# *)*# *8&D-*"# ("$&.430+"1".)# E# '3# 4*$&-8"+)"# 4"# '0".(# ".)+"# 'A%&1*&()3(0"# 4-# $%&'"()*+&'# ")# 4"(# 13'340"(# ."-+&# 4*6*.*+3)08"(# $&11"# '3# 13'340"# 4AF'G%"01"+#<=>H?@#I"(#23)0".)(#)&-$%*(#23+#$"))"#13'340"#&.)#4"(#)3-9#$0+$-'3.)(#2"+)-+J*(# 4"#KLMNOP%54+&95P$%&'"()*+&'#")#-."#3-61".)3)0&.#4-#)3-9#4"#JQ)3#315'&R4"@#KLMNOP%54+&95P $%&'"()*+&'#"()#'"#'063.4#2+0.$023'#4"(#!BC(#43.(#'"#$"+8"3-#<=HS?@## !BC(# 3'2%3# ")# JQ)3# (&.)# "92+01*(# 43.(# '"# $"+8"3-# 130(# !BCT# "()# 'A0(&:&+1"# 2+*4&10.3.)"@# U"))"# 4"+.07+"# "()# "92+01*"# 43.(# '"(# ."-+&."(# ")# '"(# 3()+&$5)"(@# F8"$# '"# 80"0''0(("1".);# '"(# (&-+0(# !"#$%PVP# &.)# 4"(# 3.&13'0"(# $*+*J+3'"(# ("# )+34-0(3.)# 23+# -."# 4010.-)0&.# 4-# 8&'-1"# $*+*J+3';# -."# 3$$-1-'3)0&.# "9$"((08"# 4-# $%&'"()*+&';# -."# 4*6*.*+"($".$"# 4"(# ."-+&."(# ")# -."# 3-61".)3)0&.# 4"# .&1J+"# 4"(# 3()+&$5)"(# <=WL?@# U"(# 3.&13'0"(# (&.)# 3((&$0*"(# E# -."# 4010.-)0&.# 4"(# )3-9# 4"# )+3.($+0)(# 4"(# 67."(# $0J'"(# !BC(# M&'()*+, &'(-.+, &'(-/, 01, !23#O@# I"(# 1&47'"(# 1-+0.(# 4"# 13'340"# 4AF'G%"01"+# )+30)*(# 23+# XYWHZ[# ".# 3((&$03)0&.# E# -."# 6'0)3G&."# M3.3'&6-"# 4"# \\FC]O# 2+*(".)".)# 4"(# )3-9# *'"8*(# 4AF2&^;#13+D-"-+#4"#J&.#2+&.&()0$#4"#'3#13'340"#D-0#+"40()+0J-"#'"#$%&'"()*+&'#")#*80)"#(&.# 3$$-1-'3)0&.;#30.(0#D-A-."#4010.-)0&.;#E#'3#:&0(;#4"#'A3$$-1-'3)0&.#4"#'3#(-J()3.$"#315'&R4"# ")#4"(#2%*.&17."(#0.:'3113)&0+"(#<=H=?@## 7" #$%&'()'*8-9:0/:(9;&(' 4)5(63)#,07281903:)3,-#8;19,<)(18##M_^X`O#"()#-."#2+&)*0."#:38&+0(3.)#'A3.60&6".7("@# ^''"# "()# :&+)"1".)# 3$$-1-'*"# 43.(# '"(# )-1"-+(# (&'04"(# ")# (-+"92+01*"# 43.(# '"# 2+&$"((-(# 4A0.:'3113)0&.;#4A%52&9*10"#")#4"#)-1&+06".7("#<=HK?@,40-<#"()#04".)0:0*#$&11"#67."#$0J'"# 40+"$)#4"(#!BC(#<=HW?@#!"(#4"-9#0(&:&+1"(#+*6-'".)#'3#)+3.($+02)0&.#4"#40-<@#!"#aSH;#$%"G#'"(# (&-+0(#(3-836"(;#3-61".)"#'3#2&-(("#4"(#$"''-'"(#".4&)%*'03'"(#")#4010.-"#'A3.60&6".7("#")# '3#$+&0((3.$"#4"(#)-1"-+(#2-'1&.30+"(@#b*3.1&0.(;#'A"::")#4"(#!BC(#("1J'"#10."-+#E#'A*)3)# J3(3'c#'"(#(&-+0(#!"#dT=>=,.A&.)#23(#4"#4*:3-)#4A3.60&6".7("@#!A3$)083)0&.#4"#!BC#3#23+#$&.)+"# -.#"::")#3.)0P3.60&6*.0D-"@#!A3$)083)0&.#4"#!BC#23+#aSH#+*4-0)#'3#(06.3'0(3)0&.#4"#+*$"2)"-+# 4"#_^X`#M_^X`CKO#")#23+#$&.(*D-".$"#'3#2+&'0:*+3)0&.#")#'3#106+3)0&.#$"''-'30+"#<=HL??,U")# "::")#2&-++30)#Q)+"#0.)*+"((3.)#43.(#'"#$34+"#4"#'A0.%0J0)0&.#4"#'3#)-1*+06".7("#")#'"#2&-8&0+# 1*)3()3)0D-"#4"(#)-1"-+(@# -.! ! ! ! ! ! ! ! Endocrine tissue Target genes Physiological effects !"#$%&'()*+,-.( /012()'%34$56789:&%4.( B4@$59C5'(!DE!F($9:&%( ;,<=>?@()9@:&A9:&%4.( >&:7&:9$#()*+,-.( >0GH()9@:&A9:&%4.( ;:&K789:5'(LH!JE687@%@%$:&@%&'( ;,<=>?@()9@:&A9:&%4.( C5@$5:&%4( ??IJ;/1?()'%34$56789:&%4.( ( ( ( L'$5498(6894'()*+,-.( */*1,M(;,1=?M(L=HL?M(LN% !"#$%&'(&)*++",-&./&01-23.$.435"$&,.$%2&./&6782&39&:1%&%9;.5,39%&2-2:%+<& !"#$%&"'()*+',#-"#./'&%'#01',!,'23451' ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'()'*('&+&),-('(./0123.3(.' !"#$% $&'(% )'*)$+,'$-./,$% *-'$% /,% 0&'1()&'',2,'(% *3% $4$(52,% ,'*&16)'),'7% 8/$% 69:3/,'(%/-%$(96&;*&:,'5$,%$3669'-/),'',%,(%:&'-*)<3,%=>?@AA@>BCD@%,(%/,%29(-.&/)$2,%*,$% :/31&1&6()1&;*,$%,(%*,$%E&62&',$%(E46&;*),'',$%=>BC@>FC@>FGD7%!"#$%69:3/,'(%9:-/,2,'(%/,% $4$(52,%69')',H-':)&(,'$)',%%=>FI@>FJ@>F?D%,(%/,%29(-.&/)$2,%&$$,3K%=>FF@ALLD7%% M,$%,00,($%+E4$)&/&:)<3,$%',%$,6&'(%+-$%*9(-)//9$%*-'$%1,%1E-+)(6,N%)/$%&'(%0-)(%/O&.P,(% *O3',%6,Q3,%+3./)9,%*-'$!"#$%&'$()!*+,%&-+!#.!"%/0&01%!!"#$%#&'()*%+,#-./'RS-./,%BT7'' !O)2+/)1-()&'% *,$% !"#% *-'$% /-% $(96&;*&:,'5$,% ,(% *-'$% /-% 0&'1()&'% :&'-*)<3,% ,$(% *)$13(9,%,'%*9(-)/$%*-'$%/,$%+6&1E-)'$%1E-+)(6,$%R88%,(%888T7%% U3% (&(-/@% !"#$% $&'(% *,$% 1)./,$% (E96-+,3()<3,$% )'(96,$$-'(,$% *-'$% +/3$),36$% +-(E&/&:),$%RS-./,%IT7% % % -.! ! ! ! ! ! ! ! I/726+JK+?;&&/$>+%E+12')'1/2+'((;6(+$62/068+0%+,-.(L+ !"#$%&'(')*+,-.+/*%)'(0+12')'1/2+'&32'1/4%)(+ + ++++++560/7%2'1+8'(%$86$(+ !!!!!!!!!"!#$%!&'()*(!+,#!'-.-'! !!!!!!!!!"!,/(0-1-)!*-''/12)! !!!!!!!!!"!3/-*(4456/78!19&-!:!;/)-()-! ++++++9/$8'%:/(1;2/$+8'(6/(6(+ !!!!!!!!!"!<1=->$)7'->$)/)! !!!!!!!!!"!?-)1-4$)/)!(@->!(4A/$&'()19! ++++++<)=/&&/0%$>+/)8+/;0%'&&;)6+8'(%$86$(+ !!!!!!!!!"!?=-2*(1$/;!(>1=>/B)! !!!!!!!!!"!<)1=*(C!:D6,! !!!!!!!!!"!E-&)/)F! ++++++?@')+8'(6/(6(+ !!!!!!!!!"!<''->A/7!;->*(BB)! !!!!!!!!!"!G&/;->*$&(1=9!$H!&>-*(12>/19! !!!!!!!!!"!6)$>/()/)! ++++++96)0$/2+)6$:%;(+(>(06&+ !!!!!!!!!!"!<'I=-/*->J)!;/)-()-! !!!!!!!!!!"!6(>8/4)$4J)!;/)-()-! !!!!!!!!!!"!K2'B&'-!)7'->$)/)! ++++++A0B6$+1%)8'4%)(+ !!!!!!!!!"!L4H->B'/19! !!!!!!!!!"!L*&(/>-;!21->/4-!7$41>(7B'/19! !!!!!!!!!"!:(47->! !!!!!!!!!"!+-&(1$5&>$1-7B$4!/4!)-.->-!7=$'-)1()/)! C"#%06)4/2+('86+6D610(+%E+,-.+/*%)'(0(+ !!!!!!!!!"!+9&->1>/A'97->/;-*/(!(4;!-'-.(B$4!$H!#,#! !!!!!!!!!"!#/.->!)1-(1$)/)!(4;!;(*(A-! !!!!!!!!!"!M(1!)1$>(A-!/4!(;/&$)-!B))2-!N! !!!!!!!!!"!#/&$1$O/7/19! !!!!!!!!!"!6(47>-(B7!P57-''!;(*(A-! !!!!!!!!!"!L47>-()-;!>-4/4!)941=-)/)! !!!!!!!!!"!?-;27-;!/4.()/.-4-))!$H!791$1>$&=$0'()1!7-'')!Q&>--7'(*&)/(R! !!!!!!!!!"!?-;27-;!=:S!&>$;27B$4! F"G'(6/(6(+')+HB'1B+,-.+/)0/*%)'(0(+&/>+76+B623E;2+ !!!!!!!!!"!+9&->1>/A'97->/;-*/(! !!!!!!!!!"!#/.->!)1-(1$)/)! !!!!!!!!!"!<;>-4$'-28$;9)1>$&=9! !"#$%&' (()' *+,&' #&-".+,' .%+/.' 0".1' 2"/%34/35"/' +-6' 4/1&2+7/' ",,$4.%+73-' 38' .&47/$,+%' 1"4.3,3#9' +-6' 45&%2+.3#&-&4"4:' !"#$ %&'()*(+,"$ -").-$ -#%&/&0#()1-$ 21314#-$ -1(()1/5#5$ 36$ ')//#'78#$ 7--1#$ 9:!;<$ ')/2+&/&/*$ %+/6$ 4+(*#$ ()1/5#5$ )($ ,)46*)/+4$ =#65&*$ )($ &/2#(-77+4$ '#44-$ 9>:;$ -#'(#7/*$ +/5()*#/-?$ >%%#5&+2#46$ -1(()1/5&/*$ #+'"$ 21314#$ +(#$ @+A#/#5$ %6)&5$ '#44-$ 9B;<$ ."&'"$ ')/2(+'2$2)$"#4,$%)8#$-,#(%$)12$)0$2"#$21314#<$+/5$4+6#(-$)0$C3()34+-2-$9D;?$>/-&5#$/#+($2"#$3+-#%#/2$ %#%3(+/#$+(#$%+/6$,()%&/#/2$-,#(%+2)*)/&+$9EF;<$-%+44$'#44-$."&'"$5&8&5#$%&2)7'+446$312$*&8#$(&-#$2)$ +$,),14+7)/$2"+2$#/2#(-$%#&)-&-?$!"#$%#&)7'$'#44-$*().$+/5$1/5#(*)$'"()%)-)%+4$-6/+,-&-$2)$3#')%#$ ,(&%+(6$-,#(%+2)'62#-$9GE;<$+((#-2#5$0)($H$.##I-$&/$,(),"+-#$)0$2"#$C(-2$%#&)7'$5&8&-&)/$51(&/*$."&'"$ (#')%3&/+7)/$ )''1(-?$ G(&%+(6$ -,#(%+2)'62#-$ +(#$ 2"#$ 4+(*#-2$ -,#(%+2)*#/&'$ '#44-$ +/5$ +(#$ 1-1+446$ +31/5+/2$ +2$ +44$ 4#8#4-$ 3#2.##/$ 2"#$ 3+-#%#/2$ %#%3(+/#$ +/5$ 2"#$ 41%#/?$ J+'"$ 5&8&5#-$ 2)$ 0)(%$ 2.)$ -#')/5+(6$-,#(%+2)'62#-<$."&'"$+(#$-#45)%$-##/$&/$-#'7)/-$3#'+1-#$2"#6$1/5#(*)$2"#$-#')/5$%#&)7'$ 5&8&-&)/$ +4%)-2$ &%%#5&+2#46$ 2)$ 0)(%$ 2.)$ "+,4)&5$ -,#(%+75-?$ K#.46$ 0)(%#5$ ()1/5$ -,#(%+75-$ 9LE;$ 5&M#(#/7+2#$ +/5$ 4)-#$ 8)41%#$ &/$ 3#')%&/*$ 4+2#$ -,#(%+75-$ 9=E;$ +/5$ C/+446$ %)74#<$ "&*"46$ -,#'&+4&N#5$ -,#(%$'#44-?$O44$-2+*#-$)0$-,#(%+2)*#/#-&-$+/5$-,#(%&)*#/#-&-$)''1($.&2"$2"#$'#44-$&/7%+2#46$+--)'&+2#5$ .&2"$2"#$-1(0+'#-$)0$+5P+'#/2$E#(2)4&$'#44-$9E:;$."&'"$,#(0)(%$-#8#(+4$-1,,)(78#$01/'7)/-?$ !"#$%&"' ()*+',&-./&)'!01'23453&6)#7-'8#-6.'96-%*0*:;<'=>%/'?"6@*4A' ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()**)+),-.(/)0(/)12,/)0#3/).#)$"4/%5.56%()(&).(/)$#&"5.56%(/)0(/)653#0(/) *7 1#)'($'5089&%53):#/98.%3() !" #$%&%'()*+,+',-$.*/'(-(0*+,12,'+/'*32-+, !"# $"%$&'()"# "%$# *+*$,-&.("-"+$# %(/0&1&%2# "+# 0"# +,-/3"(4# $(/"%# %2-&+&563"%7# )"%.(")%# %,+$# $*8&%%2%# 8*3# )"%# '"))()"%# 9"3-&+*)"%# :;<=># "$# )"%# '"))()"%# 0"# ?"3$,)&# :<=>@# A"%# 0"3+&63"%#%,($&"++"+$#)"#021"),88"-"+$#"$#)*#0&5523"+$&*$&,+#0"%#'"))()"%#9"3-&+*)"%@#B&+%&7# 'C*.("# '"))()"# 0"# ?"3$,)&# 5,3-"# 0"%# ',++"'$&,+%# *1"'# 8)(%&"(3%# '"))()"%# 9"3-&+*)"%# D# 0&5523"+$%# %$*0"%# 0"# -*$(3*$&,+@# !"%# $(/"%# %,+$# "+$,(32%# 8*3# )"%# '"))()"%# -(%'()*&3"%# 823&$(/()*&3"%@# E+$3"# )"%# $(/"%# %2-&+&563"%7# )"# $&%%(# &+$"3%$&$&")# ',-8,3$"# (+# 3&'C"# 32%"*(# '*8&))*&3"#"+$,(3*+$#)"%#'"))()"%#0"#!"F0&9#GHIJK@# B#)L*8"4#0(#$"%$&'()"7#)"%#'*+*(4#0"%#$(/"%#%2-&+&563"%#5,3-"+$#(+#32%"*(#*88")2#)"# !"#"$#"%#&%@#!"%#'*+*(4#83,1"+*+$#0(#!"#"$#"%#&%$%"#3"M,&9+"+$#"$#5(%&,++"+$#8,(3#02/,('C"3# 0*+%#)L28&0&0F-"#:N&9(3"#JJ>@# 4" #%,5.6/*(-(0*+,'+/'*32-%*7+, !"#-&'3,"+1&3,++"-"+$#$"%$&'()*&3"#"%$#',-8,%2#0"#'"))()"%#C*($"-"+$#%82'&*)&%2"%# .(&#',--(+&.("+$#"+$3"#"))"%#8*3#0"%#5*'$"(3%#8*3*'3&+"%#"$#*($,'3&+"%7#,3'C"%$32%#8*3#)"# %F%$6-"#"+0,'3&+&"+@#!*#5,+'$&,+#0"#'"%#'"))()"%#"%$#&+5)("+'2"#8*3#0"%#5*'$"(3%#92+2$&.("%# "$# "+1&3,++"-"+$*(4# GHIHOHI ;7 1#)/$(':#&56(3 -.! ! ! ! ! ! ! ! )&',($'<<(+'#';-<( !"#"$%&'( )*'+,-&"."#/-(0( !#.$%#%& )*'+,-&"."#/-(1( 2345( )*'+,-&"$%&'(6(2745( !"#$%#%&'& !"#$%#%&'& )*'+,-&"$%&'(66( 2345( !"#$%#%&''& !"#$%#%&''& )*'+,-89( 245( ()"*+#$,"-"%#%& ()"*+#$,"-"%#%& )*'+,-&":"-( 245( /#,0*"&123&(45"+674&*")*"%"-.67$-&$8&%)"*+6.$,"-"%#%&9#.5&#.%&%)"4#:4&%.")%&;+#.$%#%<& +"#$%#%& '& 6-=& ''<& 6-=& %)"*+#$,"-"%#%>& )*'+,-&"."#/-( 0( +'#';( *'+,-#'#&<%( &='( >#9/?'+'#8-&'9(.'+,($'<<(@&"$A(B%(*+".=( @*'+,/".'#'@/@(2<"@@("C($%&"*<-@,(-#9(J40($",*-$8"#5(-#9(9'D'<"*(&"(@*'+,-&":"-E((( ! ! "#$%#!&#!'())*+,)%+#! !"##$#"%& '()#*+,"%-& #"%& %)"./(0*1*+,"%2& 3"%& ,".45".%& )*.0"40& ,"%& 546*./(05*4%& 7848059$"%& ,*40&#:54087.508&,*50&;0."&*)05/(#"&(654&,:(%%$.".&$4"&,"%!"4,(4!"&<%(54"=2&& >$.(40& #"$.& /(0$.(05*4-& #"%& !"##$#"%& 7"./54(#"%& %$?5%%"40& )#$%5"$.%& /*,565!(05*4%& #5)5,59$"%&"0&).*0859$"%&)*$.&%"&."4,."&%$665%(//"40&/*?5#"%&"0&6".05#"%2&@##"%&8#5/54"40&,"%& ,8?.5%&!"##$#(5."%-&A&!*/).5%&,"%&"%0".%&,"&!'*#"%08.*#-&)*$.&%"&0.(4%6*./".&"4&$4"&!"##$#"& !*/)."4(40&$4"&0;0"&"0&$4&4*A($&!*4,"4%8&BC57$."&DEF2&& G(&%)"./(0*7"4H%"&%"&,8.*$#"&,(4%&#"&0$?"&%8/5456H."&IEJKL2&M&N&O*$.%&,"&P5"&!'"1&#(& %*$.5%& "0& Q& #(& )$?".08& !'"1& #:'*//"-& #(& %)"./(0*7"4H%"& ,8?$0"2& G"%& !"##$#"%& ,"& R".0*#5& )".,"40&#"$.&!()(!508&,"&).*#568.(05*4-&"0&(!9$5H."40&#"$.&/*.)'*#*75"&/(0$."&IEDJL2&3"00"& /*,565!(05*4&"%0&545058"&)(.&#:($7/"40(05*4&,"&#:(/)#50$,"&"0&,"&#(&6.89$"4!"&,"&%8!.805*4&,"& #(& CRS& B!"##$%#&' ()$*+#,)$-.' /"0*"-&F& %"!.808"& ,"& /(45H."& )$#%(05#"2& 3"00"& 7*4(,*0.*)'54"& "%0&%)8!5659$"&,"%&!"##$#"%&,"&R".0*#5&"0&"%0&%"!.808"&)(.&#:(408'A)*)'A%"&%*$%&!*40.T#"&,"&#(& U4VS& B."-,1")0"2$-' 0&#&,(&' /"0*"-&34' GS& "%0& %"!.808& ,"& /(45H."& !*4O*540"& Q& #(& CRS& "0& 54,$50&#(&%A40'H%"&,"&0"%0*%08.*4"&)(.&#"%&!"##$#"%&,"&G"A,57&,H%&#(&)$?".082&#"%&!"##$#"%&,"& R".0*#5& "W).5/"40& #"& .8!")0"$.& ($W& (4,.*7H4"%& )"./"00(40& #:(!05*4& 54,5."!0"& ,"& #(& 0"%0*%08.*4"& %$.& #(& %)"./(0*7"4H%"& IEDDL2& >"& #Q-& #(& )."/5H."& P(7$"& ,"& %)"./(0*7"4H%"& ,8?$0"&(P"!&,"%&!"##$#"%&7"./54(#"%&."40.(40&"4&,5668."405(05*4&IEDEL2&G(&,$.8"&0*0(#"&,:$4& !A!#"&,"&%)"./(0*7"4H%"&"%0&,"&XY&O*$.%&!'"1&#(&%*$.5%&"0&NZ&O*$.%&!'"1&#:'*//"2& G(&%)"./(0*7"4H%"&%"&,8.*$#"&%$.&0*$0"&#:8)(5%%"$.&,$&0$?"&%8/5456H."&"4&)#$%5"$.%& 80()"%&BC57$."&DEF&[& • G(& )."/5H."& 80()"& B).*#568.(05P"F& ,"& #(& %)"./(0*7"4H%"& "%0& $4"& !"#$%&& ,"%& %)"./(0*7*45"%& ,"& 0A)"& M& B!"##$#"%& %*$!'"%& ,5)#*+,"%& 54,5668."4!58"%F2& 3"%& !"##$#"%& %*40& %50$8"%& ).H%& ,"& #(& /"/?.(4"& ?(%(#"& 9$5& "40*$."& #"%& 0$?"%& %8/5456H."%& IEDX-EDZL2& @##"%& !*4%050$"40& #"& %0*!\& )"./(4"40& ,"%& !"##$#"%& 7"./54(#"%& )*$.& (%%$.".& #"%& !A!#"%& ,"& #(& %)"./(0*7"4H%"& 0*$0& ($& #*47& ,"& #(& P5"2& ]$"#9$"%& %)"./(0*7*45"%& M& %"& ,5668."4!5"40& "4& %)"./(0*7*45"%&^2&3"%&!"##$#"%&%$?5%%"40&$4"&,".45H."&/50*%"&)*$.&,*44".&4(5%%(4!"&Q&,"%& %)"./(0*!A0"%&).5/(5."%&B%)"./(0*!A0"%&_F&0*$0&"4&).*7."%%(40&P".%&#(&#$/5H."&,"%&0$?"%2&& • G"%& %)"./(0*!A0"%& ).5/(5."%& %$?5%%"40& "4%$50"& $4"& ,"$W5H/"& 80()"& !*.."%)*4,(40&Q&#(&!'"$%&()9$5&)"./"0&#(&).*,$!05*4&,"&%)"./(0*!A0"%&%"!*4,(5."%&)$5%&,"& %)"./(05,"%&'()#*+,"%&IEDYL2&G(&/85*%"&%"&,8.*$#"&"4&,"$W&80()"%&%)8!5659$"%&($W&!"##$#"%& 7"./54(#"%& )"4,(40& #"%9$"##"%& #"& /(08.5"#& 7848059$"& ,*$?#"& (P(40& ,"& ,*44".& 4(5%%(4!"& Q& ,"$W&!"##$#"%&'()#*+,"%&B%)"./(0*!A0"%&%"!*4,(5."%F2&`"4,(40&#(&/85*%"-&$4"&."!*/?54(5%*4& -.! ! ! ! ! ! ! ! !"#$%&' ()*' +",#%,-' .&/"012#'34&'-,56%'-6%/4676#"0,7'04,2#&8'34,3' 600$%' 9"34"2' 8/&%-,1.8',8'34&:' $2.&%#6'34&'.";&%&21,162' /%60&88<' 0,77&.' 8/&%-"6#&2&8"8=' !"#$% &#'()#% "*+",$% -.#'*/,*0#1% -.#2)% '#,,-3% !"#-#% '"/4+#-% *45(,5#% 6/7#4*4+% (8% 9"#% 4:',#:-;% 8(2)/<(4%(8%/4%/'2(-()#%="*'"%2#-#)&,#-%/%,/2+#%,$-(-()#;%+2(=9"%(8%/%6/+#,,:)%>9/*,?% 82()% 9"#% &/-/,% &(1$;% 2#(2+/4*0/<(4% (8% 9"#% )*9('"(412*/% *4% 9"#% )*1.*#'#% 2#+*(4;% /41% -"#11*4+%(8%:44##1#1%'$9(.,/-)%/-%/%2#-*1:/,%&(1$3% !"#$%&"'()*+',&-./&)'!01'23453&6)#7-'8#-6.'96-%*0*:;<'=>%/'?"6@*4A' ! ! "#$%#!&#!'())*+,)%+#! !"#"$"%&'(')*(+'),"-)./$'(01&-(23!.-%'(0'(#.*2+4'$(%2-2*45&'('-*+'(0'&6(3!+"#")"#')( .,,.+42)7(8($.(94-:($.(0'&64;#'(2*.,'(')*($.(04<4)4"-(#4*"*45&'(0')(),'+#.*"3=*')(>>('-(0'&6( ),'+#.*40')(+"-0')(?@4%&+'(ABC7(( • D-94-:($.(*+"4)4;#'(2*.,'(3"++'),"-0(E($.(!"#$%&'(#)*!#+,-.+"/0!#!12(31')*FEF04+'( $.(*+.-)9"+#.*4"-(#"+,!"$"%45&'(01&-'(),'+#.*40'(+"-0'(?,!.)')(AFGC(HBAIJ('-(),'+#.*40'( .$$"-%2'( ?,!.)')( GFAAC( ,&4)( '-( ),'+#.*"K"L0'( ?,!.)')( AAFAIC( HBAM:BAGJ7( N'( ,+"3'))&)( ')*( 3.+.3*2+4)2( ,.+( $.( 3"-0'-).*4"-( 0&( -"=.&( ?,!.)')( AAFAOC( .<'3( .++P*( 0'( $1.3*4<4*2( *+.-)3+4,*4"--'$$':(,'+*'(0'($.(#.Q'&+'(,.+*4'(0&(3=*",$.)#':('*(9"+#.*4"-(01&-(.3+")"#'('*( 01&-(9$.%'$$'(?,!.)'(AOFAIC7(R'-0.-*($.(),'+#4"%'-;)':($')(!4)*"-')(.))"342')(E($18ST()'+"-*( +'#,$.32')(,.+($')(,+"*.#4-')(,'+#'**.-*($.(3"#,.3*4"-(018ST('*($.(,+"*'3*4"-(#.64#.$'( 0')(0"--2')(%2-2*45&')(HBAUJ(?@4%&+'(AVC7( • W')(),'+#.*"K"L0')()"-*('-)&4*'(02*.3!2)(0.-)($.($+'(0')(*&/')()2#4-49;+')( ?!"#$%&03&')C("X(4$)(#4%+'-*(<'+)($12,4040=#'(,"&+(3"#,$2*'+($'&+(#.*&+.*4"-(?"/*'-*4"-(0'( $.(#"/4$4*2('*(0&(,"&<"4+(923"-0.-*+HBBY:BBAJ7(N'()*.0'(')*(02,'-0.-*(0')(3'$$&$')(0'(Z'+*"$4( 5&4(9.34$4*'-*($.(04))"34.*4"-(0')(),'+#.*"K"L0')(,'+#'**.-*($'&+(+'$.+%.%'7( ( W1.3*4<4*2(0'($.(),'+#.*"%'-;)'(<.+4'(0'(#.-4;+'(3=3$45&'(01&-(*&/'()2#4-49;+'(E(&-( .&*+'7( N!'K( $1!"##'( $'( 3=3$'( ')*( $4#4*2( E( [>( )*.0'):( *.-04)( 5&'( 3!'K( $.( )"&+4)( E( \>>( )*.0')( ?@4%&+'(AOC7(N!.5&'()*.0'(3"++'),"-0(E(&-'(.))"34.*4"-(&-45&'('-*+'($')(3'$$&$')(%'+#4-.$')( E( 0')( )*.0')( ,+234)( 0'( #.*&+.*4"-( '*( $.( 3'$$&$'( 0'( Z'+*"$47( W'( )*.0'( [>>>( 3!'K( $.( )"&+4)( ')*( #.+5&2( ,.+( $.( ,+2)'-3'( 0')( ),'+#.*40')F),'+#.*"K"L0')( ,+P*)( ,"&+( $.( ),'+#4.*4"-7( 8&( )*.0'( \>>:( 0')( ),'+#.*"3=*')( '-*+.-*( '-( 0'&64;#'( 04<4)4"-( #24"*45&'( )"-*( ,+2)'-*)( ?*+.-)4*4"-(,.3!=*;-'F),'+#.*40'(+"&-0(ZAC7( 45 6#!+7#8898#!+:#+;#$3'8&+ W')( 3'$$&$')( 0'( Z'+*"$4( )"-*( 0')( 3'$$&$')( )"#.*45&')( !.&*'#'-*( ,"$.+4)2')7( D$$')( 9"+#'-*(&-'(#"-"3"&3!'()4*&2'(.&()'4-(0')(*&/')()2#4-49;+')()&+(*"&*'($.(!.&*'&+(0'($'&+( 2,4*!2$4(D$$')()"-*(,")2')()&+($.(#'#/+.-'(/.).$'(0&(*&/'()2#4-49;+'7(N','-0.-*:('$$')( -'(+',+2)'-*'-*(5&'(]FAY^(0')(3'$$&$')(0&(*&/'(HBBBJ7(W')(3'$$&$')(0'(Z'+*"$4(.))&+'-*($'(+_$'( '))'-*4'$(0'(-&*+4*4"-(0')(3'$$&$')(%'+#4-.$')7(D-('99'*:(3!.5&'(3'$$&$'(')*('-($4.4)"-(.<'3(OY(E( ]Y(3'$$&$')(%'+#4-.$')('-(#"='--'7(D$$')($')()"&*4'--'-*(*"&*(.&($"-%(0'($'&+(04992+'-34.*4"-( '-()'3+2*.-*(0')(,+"*24-')(0'(*+.-),"+*:(0')(!"+#"-'):($18`R(?!"#$%&'"()*"#*"&(+$%,'*"C:( -.! ! ! ! ! ! ! ! !"#$%&'(()( *"#$%&'(()))( +"#$%&'((,( /"#$%&'((,)))( -"#$%&'((.( 0"#$%&'((.))( 01&23'( 456( 7-( 8$%1919&( 1:%&'8( ;!"0<( 19( :=28'( 8':191>'3=28( $2?2@'8( 8A=B19&( 8C'3:%$=&'9'818( DED@'8(%$(F%31=28(8$%&'8!"#$%&'('%)*)'+'",%'&-.)*/0)',"12344$2344456"7$('%)*)'+'",%'&-.)*/0)',"1248$ 856"9$:0;*)'+'",%'&-.)*/0)',"1284$84456"#$%./<0)'+'",%'&-.)*/0)',"124$2856"=$-'>*?/"@>A>,>*+"1234" B*&")<'"C&,)".+@"2844"B*&")<'",'/*+@"@>A>,>*+5!"" D*)'" )<.)" ,).;'" 3444" /*+).>+," 2%'&-.)*:*." 12EF5" >!'!" ,%'&->*;'+',>," >," >+" >)," (.)',)" ,)'%" 1,)'%," *B" ,%'&->*;'+',>,G"2E")*"2EF5!" !"#$%&"'()*+',*-.*'/&)#"#'&%'#01'2&$)*".34*5'67871'' )'*+#,%-%.$/( !"#$"#%&'( 1#$ !"#$ AB7C00D>2&E$ 10KD=J$&0LL$ %$ 6;<=>=;$ '&?@=;$ &'()$ )%"($ '*)$ "H0+I2-.J.;=2$ !+,&-./0$ "0+-.L=$&0LL$ 12&-2-0$ 3+.F-<$ 345!$ (=-./=/$ 63!78$ (0=./=/$ 9-&:$ "H0+I2?D$ AB7C00D>2&E$G$ ';D+.J0;$+0&0H-.+$ %$ %0/-./-0+.;0$ 0"1$&2(345(67,2.%87(&2*&2/29#%8+9(+:(62&#+-"(72--(*,'/"+-+1';(M;D0+$!"#$2;D$-0/-./-0+.;0$ /?I,L2?.;N$2D,L-$"0+-.L=$&0LL/$H+.D,&0$H2+2&+=;0$C2&-.+/$O'*)N$C+,&-./0:0-&P$-.$/,HH.+-$J0+I$&0LL$ J+.F-<$2;D$D=Q0+0;?2?.;R$%<0K$H+.D,&0$0;D.&+=;0$C2&-.+/$-.$+0J,L2-0N!"#$!2$C00D>2&E$I0&<2;=/IN$ !"#$/0&+0?.;R$%&'($)*+,-.)!/#)*#)-!0+,1.#)2!'345(0.+#16/67$+!89,,1:!968;7. !"#$ #%&#'()'#$ *+"(,*'-.%"#/$ 0)$ 1)'(-2"$ "3'()2"00%0)-("/$ !"#$ 4(5'*-+"#$ !"$ #'(%2'%("$ "'$ !"#$ 6)2'"%(#$ !"$ 2(5-##)+2"$ 7889/88:;<$ =$ 4)('-($ !"$ 0)$ 4%&"('*/$ 0)$ 4(5!%2'-5+$ !"$ >?@$ 4)($ 0ABC454BC#"/$ !"$ 25+2"('$ )D"2$ 0"#$ )+!(5,E+"#$ '"#'-2%0)-("#/$ #'-1%0"$ '5%'"#$ 0"#$ )2'-D-'*#$ !"$ 2"00%0"#$ !"$ ?"('50-/$ 4"(1"'')+'$ )-+#-/$ !"$ #5%'"+-($ 0)$ #4"(1)'5,"+E#"$ 7888;<$ F"#$ 4(-+2-4)0"#$ 65+2'-5+#$#"('50-"++"#$255(!5++*"#$4)($2"#$#*2(*'-5+#$#5+'$!*')-00*"#$2-G!"##5%#$H$ -< FA)3"$,5+)!5'(54"$ $ =$0)$4%&"('*/$0ABC45'B)0)1%#$#"2(E'"$!"$0)$I+J@$!"$1)+-E("$4%0#)'-0"$.%-$4"(1"'$!"$ #'-1%0"($0)$#*2(*'-5+$!"$F@$K!"#$%&%'%&()*+,-+&$L$"'$!"$>?@$4)($0"#$2"00%0"#$,5+)!5'(54"#$!"$ 0A)+'*BC454BC#"$ K>-,%("$ MNL<$ F)$ >?@$ #'-1%0"$ 0"#$ 2"00%0"#$ !"$ ?"('50-$ 4)($ 0"$ &-)-#$ !"$ #5+$ (*2"4'"%($K>?@JL<$O"0%-G2-/$25%40*$)%3$4(5'*-+"#$I/$%+"$65-#$#'-1%0*/$!*20"+2B"$0"#$D5-"#$-+'()$ 2"00%0)-("#$ 4)($ 0A)22%1%0)'-5+$ !A=PQ2$ "'$ !"$ 2)02-%1$ 788N;<$ =D)+'$ 0)$ 4%&"('*/$ >?@$ "#'$ -140-.%*"$ !)+#$ 0)$ 4(50-6*()'-5+$ !"#$ 2"00%0"#$ !"$ ?"('50-$ -11)'%("#/$ "'$ !*'*(1-+"$ 4)($ 25+#*.%"+2"$0"%($+51&("$!*6-+-'-6$!E#$.%"$2"##"$0)$4(50-6*()'-5+$R$0)$4%&"('*$7889;<$=4(E#$0)$ 4%&"('*/$0"$(S0"$!"$0)$>?@$"#'$4(-15(!-)0$45%($15!%0"($0)$65+2'-5+$!"$0)$2"00%0"$!"$?"('50-$"'$ #5%'"+-($0)$#4"(1)'5,"+E#"<$O"''"$5&#"(D)'-5+$"#'$("+65(2*"$4)($0A*'%!"$!"$()'#$)C)+'$#%&-'$ %+"$ BC454BC#"2'51-"$ 788T;$ 5%$ !"#$ #5%(-#$ )D"2$ %+"$ -+D)0-!)'-5+$ #4*2-6-.%"$ !"$ >?@J$ 788U;$ !)+#$ 0"#$ 2"00%0"#$ !"$ ?"('50-/$ .%-$ 4(*#"+'"+'$ %+$ )((V'$ !"$ #4"(1)'5,"+E#"$ !)+#$ 0"#$ #')!"#$ 4(*252"#$ !"$ 1*-5#"<$ W*)+15-+#/$ 0)$ >?@$ 15!%0"$ #%('5%'$ 0"#$ 4("1-E("#$ *')4"#$ !"$ 0)$ #4"(1)'5,"+E#"$ X%#.%AR$ 0)$ 1*-5#"$ 788Y;<$ O"#$ "66"'#$ 5+'$ 0-"%$ ,(Z2"$ R$ 0)$ 15!%0)'-5+$ !A%+$ ,()+!$ +51&("$ !"$ ,E+"#$ 25!)+'$ 45%($ 0"#$ +%'(-1"+'#/$ 0"#$ 6)2'"%(#$ !"$ 2(5-##)+2"$ "'$ !"#$ 4(5'*-+"#$ !"$ #'(%2'%("$ '"00"#$ .%") .$/) .01#0#$/2) .3456) 70&8,+($&) 5%&8%&() 6,+#$%&92) .34,2) .34,+-0#0/$2).0)!8*2).3:(;<=2).0)>8&;2).0)?$(;2)@"5".%&$2)A+..0(B&$2)!0-%&%&$2).0)C -.! ! ! ! ! ! ! ! )+,-$"&)& !"#$%$"&)& !"#$%$"&()& !"#$%$"&'& !"#$%$"&()& !"#$%$"&()& )+,-$"&)*& !"#$%$"&()& !"#$%$"&(*& !"#$%$"&*& )+,-$"&*& !"#$%$"&'& !"#$%$"&(*& !"#$%$"&(*& !"#$%$"&(*& .$/012& 345& 6+#278,"& 12912:2";8,<"&<=&)+,-$"&8">&!"#$%$"& #<7<>$721:?& 981;& <=& ;18":=<17$"/&/1<@;#&=8+;<1&%2;8&ABC.DEF&=87$GH&<=&+H; !"#$%&"#!$'$()*!%+*%,%!"(!%(#'$)!%*$%-.'!!*#$%/-0%1-%2"'*%3456%"#$%(#%*77*$%/1(!%8-09()%!(0% 1-%!)&0)$'"#%+*%:3;%9(*%<;%=,>?@A% ''A 4-'#$'*#%+*%1-%E-00'N0*%D)8-$"S$*!$'&(1-'0*%FG;TH% % <*!%&*11(1*!%+*%3*0$"1'%U"(*#$%(#%0V1*%/0"$*&$*(0%!(0%1-%1'.#)*%.*08'#-1*%2'!SWS2'!%+(% !P!$N8*% '88(#'$-'0*J% .0X&*% W% 1-% 8'!*% *#% /1-&*% +*% U"#&$'"#!% )$0"'$*!% *#$0*% 1*!% &*11(1*!% +*% 3*0$"1'% +B(#*% /-0$J% *$% *#$0*% 1*!% &*11(1*!% +*% 3*0$"1'% *$% 1*!% &*11(1*!% .*08'#-1*!% +B-($0*% /-0$% =,>YJ,Z[@A%<-%G;T%/*08*$%1-%!(02'*%+*!%&*11(1*!%.*08'#-1*!%1"0!%+*%1-%+'77)0*#$'-$'"#%=,ZL@A% O11*% 0*!$0*'#$% 1*% /-!!-.*% +*!% 8"1)&(1*!% '88(#'$-'0*!% *$% +*!% $"K'9(*!% 2*0!% 1*!% &*11(1*!% *#% /D-!*%+*%8)'"!*%*$%1-%1(8'N0*%+(%$(E*%!)8'#'7N0*%=,>Y@A%O#%/1(!%+*%!"#%0V1*%+*%/0"$*&$'"#J%1-% G;T% /*08*$% +B-!!(0*0% 1*!% E*!"'#!% #($0'$'"##*1!% +*!% &*11(1*!% .*08'#-1*!% -(K% !$-+*!% 8)'"$'9(*!A%\"(0%&*&'J%1*!%&*11(1*!%+*%3*0$"1'%+)2*1"//*#$%+*!%'#$*0-&$'"#!%7"0$*!J%D-($*8*#$% 0).(1)*!%*#$0*%3*0$"1'S3*0$"1'%*$%3*0$"1'S.*08'#-1*A%% % <-%G;T%*!$%&"#!$'$()*J%+B(#*%/-0$J%"#$%&'()*&'+$+#,,-#+%&"#!$0('$*!%/-0%1B'#$*08)+'-'0*% +*% /0"$)'#*!% $*11*!% 9(*% 1B"&&1(+'#*J% 1*!% &1-(+'#*!% FLSRHJ% 1*!% %.'()*&'!/$ !"0#+*&'$ 1&/#(./#+$ F]54H%*$%1*!%/0"$)'#*!%-!!"&')*!^%2&'!$3((/."#'+45%*$%,%F_`SL%*$%_`S,H%*$%+B-($0*%/-0$J%"#$ %&'()*&'+$!"0-,#')#+%.0X&*%W%1-%/0)!*#&*%+*%/0"$)'#*!%$*11*!%9(*%1*!%&-+D)0'#*!%F:'.(0*%L?HA% 6#+$ %&'()*&'+$ (&11.'*(!')#+J% /0)!*#$*!% *#$0*% 1*!% &*11(1*!% +*% 3*0$"1'% *$% 1*!% &*11(1*!% .*08'#-1*!J% 7"#$% ).-1*8*#$% /-0$'*% +*% &*$$*% E-00'N0*% *$% !"#$% &"#!$'$()*!% +*% /0"$)'#*!% &"##*K'#*!J%/*08*$$*#$%1B)&D-#.*%+*%8"1)&(1*!%+*%/*$'$*%$-'11*%=,Z[J,Z,J,Z>@A%a*!%U"#&$'"#!% '#$*0-.'!!*#$%/DP!'9(*8*#$%*$%7"#&$'"##*11*8*#$%/"(0%!"($*#'0%1-%!/*08-$".*#N!*A%% % aD*b%1B-+(1$*J%1*!%&*11(1*!%+*%3*0$"1'%!*%+'77)0*#&'*#$%/"(0%7"08*0%1*!%U"#&$'"#!%!*00)*!% -(%2"'!'#-.*%+*%1-%8*8E0-#*%E-!-1*%9('%*#$"(0*%1*!%$(E*!%!)8'#'7N0*!A%a*!%U"#&$'"#!%!"#$% D-($*8*#$%+P#-8'9(*!%-2*&%(#*%"(2*0$(0*S7*08*$(0*%!P#&D0"#'!)*%/*08*$$-#$%1*%/-!!-.*% +*!%!/*08-$"&P$*!%/0)S1*/$"$N#*!%1"0!%+*%1-%8)'"!*%=,ZZJ,Zc@A%% -.! ! ! ! ! ! ! ! E!K" @6:1416,6"5:67>(14.A16" @6A*+/".6''" !" #$%" &'()*+," -..')*+," <:67>(3*" <:67>(14B4(" ?6.3," $.3," &(*067+," !+/01"2),.34,5" $*0676,5"2),.34,5"89(:+.('";<=" &4>>),+.(3,/"2),.34,5" $,*74/6,"76.6:147" !" !651451674,6" !"#$%&' ()*' +,-&./0,' %&1%&2&34/053' 56' 7&./4584&20,$9/%' :/%%"&%' ;7<=>?' C,*67" D ! "#$! %&'()*&'$! +,-./#')#$! $&')! /.0+/)*#$! $1/! )&1)! 23.0*)-.2*14! $.4*'*56/#! /#2*+')! 2#$! (#2212#$! ,#! 7#/)&2*! +8#(! 2#$! $0#/4+)&9&'*#$:! $0#/4+)&(;)#$! #)! $0#/4+)*,#$! /&',#$+$+2#$! &1! +0*(+2#$+$+2#$! $&')! +$$&(*.#$! +1?! %&'()*&'$! $#//.#$! @ABCD! )+',*$! E1#! 2#$! +0*(+2#$! $&')!*402*E1.#$!,+'$!2+!$0#/4*&9#'6$#!FG!0+/)*/!,#!2+!0-+$#!HI!0#/4#))+')!1'#!0&2+/*$+)*&'! ,#$!$0#/4+)*,#$!+22&'9.#$!#)!2#$!$0#/4+)&J&K,#$!@ABLD!FM*91/#!NOI*2*$#/! 2+! SRT:! )+',*$! E1#! 2#$! (;)&U*'#$! #)! 2#$! 4.)+22&0/&).+$#$! ,.$)+>*2*$#')! (#$! 0&')$!@AVW:AVND*2*$+)*&'!,#$!%&'()*&'$! *')#/(#2212+*/#$! 0#1)! (&',1*/#! G! 1'#! +2)./+)*&'! ,#! 2+! 5#/)*2*).! (&'$.(1)*8#! G! 1'#! 0#/)#! ,#$! (#2212#$! 9#/4*'+2#$! @AVA:AVOD ***< ]()*8*).!,#!0-+9&(;)&$#! ! "#$! (#2212#$! ,#! 7#/)&2*! &')! .9+2#4#')! 0&1/! /^2#! ,3.2*4*'#/! 2#$! (#2212#$! 9#/4*'+2#$! +0&0)&)*E1#$! #)! 2#$! /.$*,1$! (#2212+*/#$! 0/&8#'+')! #$$#')*#22#4#')! ,#! 2+! $0#/4*&9#'6$#&'! 5&'()*&''#4#')! ,#! 23.0*)-.2*14! $.4*'*56/#/#!$*9'*5*(+)*5!,#!(#2212#$!#'!+0&0)&$#:!)/6$!0#1!,#!(#$! (#2212#$!$&')!,.)#()+>2#$!+1!$#*'!,#$!)1>#$!$.4*'*56/#$!#'!/+*$&'!,#!2+!0/.$#'(#!,31'#!5&/)#! +()*8*).! ,#! 2+! 0-+9&(;)&$#! $#/)&2*#''#*#'!*,#')*5*.$ --! ! ! ! ! ! ! ! 636) 136) 1.* 78/9:) !859* .8>32* 57!* 5?%'B$/)!#5) !"#$%&'%(#$) .8>3/* /'!2* 34566!6* 4,;#2$<&=>?)(%@?A$A=) 3145) -./01)2(%+,%,#$#,%) *(%+,%,#$#,%) C/E) 6?@AB* !"#$%&'("(#)%"(* -./01)2(#+%&'%(#,%) *(#+%&'%(#,%) C/D) 6?-./0* +(&'%&'($%"(* 3456=* :&'$;#)%<* +(&'%&'($%"(* 3456=* :&'$;#)%<* DFE$(#F9';&(* 0.+* G)HF$(*6IG)!#F<'*1(C#)H*9(<<*&'($%)#*&C"'J(&)&K*!"#$%&'%(#$)>&)%>'"%()&A22$>%;)HB)$>2#2(#'%>,&)I636)<,;) 136J)#()&B,'"%&>K%;)HB)6%B;>+)?%$$&L)*$%<&%),#'%)'"<')C/E)2<'"M !"#$%& '()& *+'& ,-.)/0+'& 01,203*/'& 45+(& 25& ()-*6)*-5)0.+& 4*& 67).(3*'2'))'& 2.-(& 4'& 25& ,859.67).(':&6.+()0)*5+)&*+&6.1,2';'&5<'6&*+'&5*)-'&,-.)/0+':&=$>?%@&>'&6.1,2';'&04'+)0A0'& 25& ,8.(,85)'472& (/-0+':& *+& 20,04'& ';)'-+520(/& (*-& 25& 1'1B-5+'& 4'(& 6'22*2'(& 9'-10+52'(& 5,.,).)03*'(&')&2'(&-/(04*(&4'&25&(,'-10.9'+C('&DEFGH@&"'(&(.*-0(&!"#$%&'&&,-/('+)'+)&*+'& 566*1*25)0.+& 4'& 6'22*2'(& 9/5+)'(& 1*2)0I+*62//(& '+& 5,.,).(':& 3*0& )/1.09+'& 4J*+& 47(A.+6)0.++'1'+)&4'(&,-.6'((*(&20/(&K&2'*-&/2010+5)0.+&DEFLH@&& !" #$%&'$(()($%&*$&#$+*,-& M*&('0+&4'&2J'(,56'&0+)'-()0)0'2:&6'-)50+(&A0B-.B25()'(&,/-0I<5(6*250-'(&('&40AA/-'+60'+)& 68'N&2J54*2)':&'+&6'22*2'(&4'&"'7409@&>'(&6'22*2'(&';,-01'+)&2'&-/6',)'*-&4'&25&"O&P"OQR&DESTH@& "'(&6'22*2'(&4'&"'7409&(7+)8/)0('+)&*+'&(/-0'&4J'+N71'(&3*0&5((*-'+)&25&()/-.U4.9'+C(':&<.0'& 1/)5B.203*'& -'(,.+(5B2'& 4'& 25& ,-.4*6)0.+& 4J5+4-.9C+'(& K& ,5-)0-& 4'& 68.2'()/-.2@& >'))'& (7+)8C('&6.+()0)*'&LFV&4'&25&,-.4*6)0.+&4'(&5+4-.9C+'(@&"5&()/-.U4.9'+C('&4/B*)'&,5-&2'& )-5+(,.-)& 4*& 68.2'()/-.2& '+)-'& 2'(& 4'*;& 1'1B-5+'(& 10).68.+4-052'(& 9-W6'& K& 25& ,-.)/0+'& ()*+$,-$.*/,01203)*1+*.3"2)$+4&PX)MQR@&"'&)-5+(,.-)&'()&()01*2/&,5-&2J56)0<5)0.+&4*&-/6',)'*-& K& 25& "O& P-/6',)'*-& 6.*,2/& 5*;& ,-.)/0+'(& YR& DES%H@& >'))'& /)5,'& '()& 2010)5+)'& ,.*-& 25& ()/-.U4.9'+C('&9.+5403*'&DESE:ESZH@&!+(*0)':&2'&68.2'()/-.2&'()&620[\%%M%&P\]FT(66R&2.6520(/'&45+(&25&1'1B-5+'&0+)'-+'&4'(&10).68.+4-0'(@&\*0(&2'(& -/56)0.+(& 1'+/'(& ,5-& 2'(& '+N71'(& 874-.;7()/-.U4'(& 4/(874-.9/+5('(& Z^OX=:& %_`& 874-.;725('& P>[\%_R& ')& %_^OX=& ,'-1'))'+)& 4'& ,-.4*0-'& 25& )'().()/-.+'& 5*& +0<'5*& 4*& -/)06*2*1& '+4.,25(103*'& 4'& 25& 6'22*2'& 4'& "'7409@& "J';,-'((0.+& 4'& 2J'+('1B2'& 4'(& 9C+'(& 01,203*/(&45+(&25&()/-.U4.9'+C('&'()&(.*(&25&4/,'+45+6'&4'&25&"O&,-.4*0)'&,5-&2J87,.,87('& DET_:ETGH@&& a2&';0()'&,2*(0'*-(&<.0'(&4'&(7+)8C('&4'(&5+4-.9C+'(@&>8'N&2J8.11':&25&<.0'&4'2)5&F& '()& ,-/A/-'+)0'22':& A50(5+)& 0+)'-<'+0-& 25& >[\%_& ,.*-& 25& ,-.4*6)0.+& 4'& 25& =O!M& P4/874-./,05+4-.()/-.+'R& K& ,5-)0-& 4'& ,-/9+/+.2.+'& ')& %_I$O& ,-/9+/+.2.+'@& "5& Z^OX=& ')& %_^OX=&<.+)&(*66'((0<'1'+)&6.+<'-)0-&=O!M&'+&5+4-.()C+'40.+'&')&25&)'().()/-.+'@&"5&<.0'& 4'2)5&]&'()&40-'6)'&b&'22'&'1,2.0'&25&,-.9'()/-.+'&,-.4*0)'&K&,5-)0-&4'&25&,-/9+/+.2.+'@&"5& ,-.9'()/-.+'&('-5&6.+<'-)0'&,5-&25&(*0)'&K&%_I$O&,-.9'()/-.+'&,*0(&2J5+4-.()C+'40.+'@&>'))'& 4'-+0C-'&'()&)-5+(A.-1/'&'+&)'().()/-.+'&,5-&25&%_^OX=&DES]H&Pc09*-'&%GR@&& "J56)0<0)/& 5+4-.9/+03*'& '()& ';'-6/'& ,5-& 2'& B050(& 4*& -/6',)'*-& 5*;& 5+4-.9C+'(& MQ@& =*-5+)& 2'& 4/<'2.,,'1'+)& Ad)52:& '22'& '()& -'(,.+(5B2'& 4*& 4/<'2.,,'1'+)& 4'(& .-95+'(& -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()$#%*+#*,)*%)*(%*+#*,-).)/&)0'1*+%"2)/&)%*,%3,%"+3#*)*,%)#"4*,,&$+*)03'+)/5&00&+$%$3#) 6*,) 4&+&4%7+*,) ,*('*/,) ,*43#6&$+*,) 8&,4'/$#,) 9:$+$/$,&%$3#;) <=>?@-) A&) %*,%3,%"+3#*) &$#,$) 0+36'$%*) 0*+8*%) 65$#$%$*+2) 6*) 8&$#%*#$+) *%) 6*) +"!'/*+) /&) ,0*+8&%3!*#7,*) %*,%$4'/&$+*-) B#*) 8'%&%$3#) 6') !7#*) 436&#%) 03'+) /*) +"4*0%*'+) &'() +3!7#*,) *,%) +*,03#,&1/*) 65'#*) $#,*#,$1$/$%") 0&+%$*//*) 3') 4380/7%*) &'() +3!7#*,) &:*4) 8&#$C*,%&%$3#,) :&+$&1/*,) 65'#*) 6D,!"#",$*)%*,%$4'/&$+*)&:*4)8$4+3)0"#$,2)ED03,0&6$&,2)F',G'5H)'#)0E"#3%D0*)4380/7%*8*#%) C"8$#$#-)I*,)8'%&%$3#,)6*)!7#*,)436&#%)!"#$%!&'$%(#)'*%+,%'*J-!./%03'++&$*#%)0+36'$+*) '#) 0E"#3%D0*) 4380&+&1/*) H) /5$#,*#,$1$/$%") 0&+%$*//*) &'() +3!7#*,-) K*0*#6&#%) 4*) 0E"#3%D0*)*,%)6L)H)'#)6"C&'%)6*),D#%E7,*)0/'%M%)G'*)65&4%$3#)6*,)+3!7#*,)<=>>@-) .')#$:*&')/34&/2)4*)+"4*0%*'+)#'4/"&$+*)*,%)*(0+$8")&')#$:*&')6*,)4*//'/*,)6*)N*+%3/$2) A*D6$!)*%)6*,)4*//'/*,)!*+8$#&/*,)<=>O2=>P@-)A5$803+%*)6*,)+3!7#*,)6&#,)/&)C3#4%$3#) %*,%$4'/&$+*)&)"%")6"83#%+")6&#,)6*,)6$CC"+*#%,)8367/*,)&#$8&'()0+",*#%&#%)'#)6"C&'%)6*) 0+36'4%$3#) 6*) %*,%3,%"+3#*) 9ED030ED,*4%38$*2) $#:&/$6&%$3#) 6') !7#*) 436&#%) 0123$% 4356% <=>Q2=OR@% 3') 6*) ,3#) &4%$3#) 9$#:&/$6&%$3#) 6') !7#*) 436&#%) 72;-) A5&1,*#4*) 6*) /&) ,$!#&/$,&%$3#) +3!"#$G'*) ,*) 8&#$C*,%*) 0&+) '#*) &030%3,*) 6*,) 4*//'/*,) !*+8$#&/*,) *%) /5&++S%) 6*) /&) ,0*+8&%3!*#7,*)&'),%&6*)8"$3%$G'*)<=>P@-)T"S$#,2)4*)0E"#3%D0*),*81/*)6"0*#6&#%)6*) /5*(0+*,,$3#)65.U)6&#,)/*,)4*//'/*,)6*)N*+%3/$-)V#)*CC*%2)'#*)$#:&/$6&%$3#),0"4$C$G'*)6572%6&#,) 4*,)4*//'/*,)*,%)+*,03#,&1/*)65'#)6"C&'%)6*)6":*/300*8*#%)6*,)4*//'/*,)6*)N*+%3/$2)65'#)&++S%) 6*) /&) ,0*+8&%3!*#7,*) *%) 65'#*) ,%"+$/$%"-) K*) 0E"#3%D0*) ,*) 8&#$C*,%*) "!&/*8*#%) 0&+) 6*,) 6"C&'%,)6&#,)/&)8$,*)*#)0/&4*)*%)/*)C3#4%$3##*8*#%)6*)/&)WXY) !"#$"#%&'( %#$ !"#$ 0&*123& 0&*123& $4&&(51+6$ $4&&(51+6$ %#789$ !"#9$ %&'()*$+&,,$"&-./,)$+&,,$ 34/#+/#4&+14( 01,"2"1( 56( 7"8$&4( 9:;( <48$-%=+1( +>( 8+1%?+#&+*"1( /4@&4=+1( 2'( #,4( #4/=/A( !"#$%&#'()*+,-./01 2345#2.//-6/'1 (789/+7:;1<.*8.:'1*'6'=).*01>4?@#>9)'-:-A-:;1<.*8.:'#6<.*-.:-61;.:+,.)*.=-:1*'6'=).*B1 ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()(!%* +$* ,"-."%&/!* 0(* 12* 3$.* 4!* (55(%* ,4.* +(* 3./)/%(4.* 04* #6!(* -/0$!%* !"#$ 3$.* +7&!%(.)"0&$&.(*0($%&'($89:;<=*>"$!)/&!,?*+(4.*(55(%*,4.*+$*,"-."%&/!*0(*@A2*(,%*+&)&%"=* 1$* %(,%/,%"./!(* ."#4+(* "#$+()(!%* &!0&.(-%()(!%* +(,* 5/!-%&/!,* %(,%&-4+$&.(,* 3$.* +(,* (,%./#6!(,=* 17/(,%.$0&/+* /4* B9* (,%* +7(,%./#6!(* 3.&!-&3$+* &,,4* 0(* +7$./)$%&,$%&/!* 0(* +$* %(,%/,%"./!(* 3$.* +7(!CD)(* $./)$%$,(=* 1(* #6!(* )*+(,* (,%* .(,3/!,$E+(* 0(* +7(F3.(,,&/!* 0(* +7$./)$%$,(*G*&+*(,%*(F3.&)"*0$!,*+(*%(,%&-4+(*(%*+(,*%&,,4,*3".&3H".&I4(,?*!/%$))(!%*+(*%&,,4* $0&3(4F*89::<=*J$!,*+(*%(,%&-4+(?*+7$./)$%$,(*(,%*(F3.&)"*0$!,*+(,*-(++4+(,*0(*1(D0&#*(%*+(,* -(++4+(,*#(.)&!$+(,*K,%$0(,*%$.0&5,L*89:M<=** 17B9* (F(.-(* ,/!* $-%&/!* 3$.* +7&!%(.)"0&$&.(* 0(,* ."-(3%(4.,* !4-+"$&.(,* BNO* (%* P=*QH(C*+$*,/4.&,?* BNO* (,%* (F3.&)"* 0$!,* +(,* -(++4+(,* 0(* 1(D0&#* (%* A(.%/+&?* %$!0&,* I4(* -H(C* +7H/))(?*+7(F3.(,,&/!*(,%*+&)&%"(*$4F*-(++4+(,*#(.)&!$+(,*89:MR9MS<=* 17&)3/.%$!-(* 0(* +$* '/&(* /(,%./#"!&I4(* 0$!,* +$* 5/!-%&/!* %(,%&-4+$&.(* $* "%"* 0")/!%."(* 3$.* +7"%40(*0(,*,/4.&,*)*+(,'-'$(%*./O'-'0*1(,*3.()&6.(,*/!%*4!(*$+%".$%&/!*0(*+$*,3(.)$%/#(!6,(* $'(-*4!(*$3/3%/,(*$--.4(*0(,*,3(.)$%&0(,*(%*$!/)$+&(,*0(*+7$-./,/)(?*$'(-*,%".&+&%"*%$.0&'(* T*+7U#(*0(*4!*$!*89MV<=*1(,*,/4.&,*./O'-'$3.",(!%(!%*4!(*,%".&+&%"*T*+7U#(*0(*W*)/&,*04(*T*0(,* 0"5$4%,*0(*."$E,/.3%&/!*0(*+&I4&0(*0$!,*+(,*%4E(,*,")&!&56.(,?*0/!-*3.",(!%$!%*0(,*%4E(,* ,")&!&56.(,* 0&+$%",* 89M9<=* X$.* $&++(4.,?* BNP*,()E+(* ,$!,* &!5+4(!-(* )$Y(4.(* ,4.* +$* 5/!-%&/!* %(,%&-4+$&.(*-H(C*+$*,/4.&,=*1(,*,/4.&,*./P'-'$*.(,%(!%*5".%&+(,*89MZ<*)$&,*$'(-*$4#)(!%$%&/!*04* !/)E.(*0(,*,3(.)$%/#/!&(,*89MW<=** B9* $* 4!* (55(%* 0(* ."3.(,,&/!* 0&.(-%(* ,4.* +(,* (!CD)(,* 0(* +$* ,%"./[0/#(!6,(* 89M9?9M\?9M;<=* ]&!,&?* +(,* ,/4.&,* ./O'-'$ /!%* 0(,* %$4F* 0(* %(,%/,%"./!(* $4#)(!%",=* B!* (55(%?* BNO*."3.&)(*Q^XV:*3$.*+7&!%(.)"0&$&.(*04*."-(3%(4.*A2X*89M:<=*Q(%*(55(%*(,%*-/!,%$%"*-H(C* +7H/))(* (F3/,"* $4* E&,3H"!/+* ]?* )$&,* (!* '4(* 0(* +7$E,(!-(* 07(F3.(,,&/!* 0(* BNO* 0$!,* +(,* -(++4+(,*0(*1(D0&#*H4)$&!(,*89MS"$!)/&!,?*,/!*(55(%*,4.*+$*,"-."%&/!*0(*@A2*(,%*+&)&%"*K@.(*VaL=* X$.*$&++(4.,?*3+4,&(4.,*$4%.(,*."-(3%(4.,*!4-+"$&.(,*."#4+(!%*,/&%*3/,&%&'()(!%*K%(+*I4(* A@bV*(%*1N2bVL*/4*!"#$%&'()(!%*KJ]cbV*(%*A2XL*+$*,%"./[0/#(!6,(*3$.*+(4.*(55(%*0&.(-%*,4.*+(,* 3./)/%(4.,* 0(,* #6!(,* -/0$!%* 3/4.* +(,* (!CD)(,* 0(* +$* ,%"./[0/#(!6,(* !/%$))(!%* %12/3$ -.! ! ! ! ! ! ! ! S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 35 Fig. 2. Involvement of lipidic nuclear receptors in testis. (A) Main regulator of steroidogenesis is the hypothalamo-pituitary axis through LH secrecretion and then via PKA pathways. This LH secretion is in part regulated by LXRs. In the Leydig cells, steroids synthesis results from transformation of cholesterol originating from either endogenous production or uptake of exogenous cholesterol. Interestingly, PPARs could interfere with these pathways and mainly in the context of exposure! to endocrine disrupters. Regarding the expression of steroidogenic genes, they!"#" have been$ demonstrated to be regulated%"&&'&()$&*+(&,-(.,*# by several nuclear receptors$ responding to lipidic stimulus. Positif effects were shown for SF-1, LRH-1 and LXRa. In contrast steroidogenesis$$ is negatively controlled by PPARs, Dax-1,/0'&.$."-.,- SHP and FXR$ and also by the estrogen receptors. All these data suggest that there could be some negative feedback involving several nuclear receptors such as FXR-SHP and LHR-1/SF-1. (B) Sertoli cells are supportive structure for normal spermatogenesis. This role is stimulated by testosterone$$ and FSH. Lipid homeostasis1"20,3 play$ an important4").*&, role$ in Sertoli!")5$+"&&- cell functions$ as highlighted by the LXRb or the RXRb knock-out mice. Alteration of genes involved in the maintenance of cholesterol homeostasis led to abnormal storage of cholesterol esters which is supposed to altere Sertoli- germ cell communication. (C) Regarding germ-cells,167($897:;<= eventhough$ both LXRs and>> LRH-1$ have been reported?$ to be expressed>$ in some steps of spermatogenesis, their roles remain unknown. The role of RXRb has been well defined in the spermiation process. SHP has also been clearly involved the decision of germ cells to enter in meiosis and progress through spermatogenesis. 167@$897:;A=$ ?$ >>$ >$ BB/7C$897:%:=$ >$ >$ >$ in Dax-1 KO, the re-expression of Dax-1BB/7 specificallyD$897:%A= in$ Leydig re->$ 2.3.3. Liver>$ X receptors LXRa?and$ LXRb (NR1H3 and NR1H2) sults in improved fertility. Although testicular size was not re- 2.3.3.1. Physiological functions. The LXRs belong to the subclass of stored, Cyp19 expression was backBB/7 to normalE$897:%<= levels,$ and spermF$ nuclearF receptors$ that formF$ obligate heterodimers with the production was increased (Meeks et al.,17; 2003?:$897G/A=). $ >$ retinoid receptors?$ RXR and> are$ activated by oxysterols (Repa and Mangelsdorf, 2002). The heterodimer could be activated by both li- 2.3.2.4. Involvement in Sertoli cell functions.4;B$897HIA=(Fig. 2):$ It was shown>$ gands. LXRs?$ have been identified?$ as players of many physiological that the cAMP-signaling pathway inducedJ67$897:;K= by FSH leads$ to a potent>$ functions?$ (Baranowski, 2008;?$ Zhu et al., 2012)). Human LXRa (447 amino acids) and LXR (460 amino acids) share 77% sequence down-regulation of Dax-1 expression! in cultured Sertoli cells (Ta- b mai et al., 1996). homology in their DBD and LBD (Lobaccaro et al., 2001). In parallel,! "#$%&'! Sertoli ()*! cell-specific +,-./-'0',1! expression .2!of a /#3#4#5Dax-1 transgene!,%5/'6&!&'5'31.&7!#,!1'7879!If LXRb is ubiquitously expressed,!"#$%&' LXR ()'a *+,-.$/&,'is mostly present in is sufficient01+*2%32,+&+0%0 to partially rescue4' 5"#$%&'the primary ()' testicular *+,-.$/&,' defect of 6+*12.%'tissues 7+..' with active 89:0%2.2,:4' metabolism. ;"()' LXR are %<8.%7$/2&' involved in key %&' functions the male Dax-1-KO (Jeffs et al., 2001). Fertility was completely re- in the control of cholesterol metabolism and lipogenesis (Zhang stored. However,08+*<$12,+&+0%04'=9+'1$>.+' there is only a modest improvement0-<<+*%?+0 in testicular'19+'+@8*+00%2&'2A'et al., 2012; Korach-Andre.%8%3%7'&-7.+$*'*+7+812*0'%&'19+' et al., 2011a,b). In the liver, these ef- morphology.$3-.1'<$.+'*+8*23-7/B+'0:01+<4' The rescue of fertility may be attributed!"#$%&'#!()*+! to a combi- fects,$-#$./ are mediated!'&!$01!,23!4567! by LXRa. It was first demonstrated that LXR nation of differences in the production and functional capacity of control the expression of the rate limiting step of bile acid synthe- spermatozoa (Jeffs et al., 2001). sis, cytochrome 7a1 (Cyp7a1) (Peet et al., 1998). Then, they were These data suggest that following FSH effect on DAX-1, it could also demonstrated to increase cholesterol reverse transport in be involved in the regulation of genes encoding paracrine factors intestine and macrophage regulating the ATP Binding Cassett that will be primordial for germ cells. ! ! "#$%#!&#!'())*+,)%+#! !"#$$!$%& '"()*%& +,& !"#$-#$ %&'$ &((&)'$ '*+)$ ,-)!.//-'$ ,!+'$ !"#$"%& '()$*+",-& 012/.-&$ ,!+'$ ./0+12034&35*&1+002034&+5*/1465/0/7"&34.516&$7898& $ :1$(.+!/;$/&'$<&//1/&'$,&$=&>,.5$*+)$1+$6?/&$06.@*6,.!/$,!+'$/!$012&6)-$&)$/!$(&6)./.)-#$=!$ )&')*')-6*+&$&')$.+,.'0&+'!2/&$A$/!$@-.*'&$,&'$<&//1/&'$5&6@.+!/&'$&)$&@0/*.&$,&'$B*.&'$,&$ '*1).&+$!00*6)-&'$0!6$/&'$<&//1/&'$,&$C&6)*/.#$D&$0/1';$/!$)&')*')-6*+&$E1F&//&'$06*,1.'&+)$&')$ .@0*6)!+)&$0*16$/!$0G>'.*/*5.&$,&$/F-0.,.,>@&$&)$/&'$B-'.<1/&'$'-@.+!/&'#$H//&$&')$-5!/&@&+)$ .+,.'0&+'!2/&$0*16$/!$/.2.,*#$DF1+$!1)6&$0*)G!/!@*MG>0*0G>'!.6&$0*16$6-51/&6$/F!N&$5*+!,*)6*0&#$ !" #$%&$'()$'*+,%-+.'%'/.'*0(1$*)/%2(%3$&4'/% $ =&'$'0&6@!)*O*J,&';$A$/&16$'*6).&$,1$)&').<1/&;$'*+)$G!1)&@&+)$,.((-6&+<.-&'$@!.'$+&$ '*+)$ +.$ @*2./&'$ +.$ (-<*+,!+)'#$ P/'$ ,*.B&+)$ '12.6$ ,.((-6&+)&'$ @*,.(.)&#$=&16'$@*,.(.@&$Q7RST#$=&$@!.6&$&')$1+$)12&$,&$U$@$,&$/*+5$ -.! ! ! ! ! ! ! ! <"=%*/*/8'#>")-'=+$/&' ;22' 122' '5265&6/%3:26' B0"44"267E04' D1&%0 2' 1@B2' 1@A2' 1@@2' I' ?"()'+,'#(->%"'=+%%"=6+/' C/=)"(#*/8'D'+,'#$7,")6%"'-"/' ' G2' 71&%0 ' ;G' <"/. 2' F'0&6' 1@;2' 1@E2' ''' 1@A2' 1@F2' 5265&6/%3:26'GHI'0"44"267E04' ' H' E84C' 6# 'B /&7/27/&%26& -2/34' +#&'B;&3%7C' !"#$%&'()*'+,'-.&'/&012%34'5.36#&'"6'71&%0'52$6/'368'"69&%:4"/;'7.2<"6#'3'4"6&3%'%&#%&77"26'29' 71&%0' 52$6/=' !"#$%&#' ()"' *##$"' +,' (' -"&(.(/(%0#*#' +,' 121' #&$3*"#4' !"#$%&"' ()*+' ,-#)$&' &%' #./' 0123'4&$/'56754' >,' ?%$8&' 0&36' /2/34' /&7/27/&%26&' 5265&6/%3:267' <"/.' 526@8&65&' A3687' B!"#$!% &'($)C4' 5#6-(&"#' ()"' +7&(*/"3' ,)+-' (' 8"/")(%*9"3' (33*6:"' -+3"%4' !"#$%&"' ()*+' 8)#9:;*<' &%' #./' =>01' 566?/' ' ! ! "#$%#!&#!'())*+,)%+#! !"#"!$%"%$&'()*$(+,*-(#,-.,%(#"-(*',(.&/$+$%0(!$-!*+"$-,(,%(#-&1-,22$3,(4,(-,!&''"5%-,(,%(4,( 2,(6$7,-(2*-(+"(8&',(#,++*!$4,(&3&!9%"$-,:( !" #$%&'()(*+,-./0102130.13-'-,0.1 ;<"8&&2#,-.$,( ="/2,'!,( 4,( 2#,-."%&8&>4,2( 4"'2( +<0?"!*+"%@( ,%( 4<"*%-,2( "'&."+$,2( "66,!%"'%( +,( '&./-,A( +"( .&-#B&+&1$,A( ,%( +"( .&/$+$%0( 4,2( 2#,-."%&8&>4,2A( 2&'%( !&'2$40-0,2( !&..,(+,2(!"*2,2(+,2(#+*2(6-0)*,'%,2(4,(+"(2%0-$+$%0()*$("66,!%,(CDEFDG(4,2("4*+%,2(HCDI:(J,2( "'&."+$,2( #,*3,'%( K%-,( "22&!$0,2( L( *',( B9#&( "'4-&10'$,( =B9#&1&'"4$2.,@:( M"+1-0( +<"*1.,'%"%$&'( !,2( 4,-'$N-,2( "''0,2( 4,( +"( #-03"+,'!,( 4,( +"( 2%0-$+$%0A( +,2( .0!"'$2.,2( .&+0!*+"$-,2(-,2#&'2"/+,2(4<*',(49210'02$,(&*(4<*',("%%,$'%,(%,2%$!*+"$-,(=B9#&1&'"4$2.,( B9#,-1&'"4&%-&#,@(-,2%,'%(+"-1,.,'%(.0!&''*2(HFOPQFORI:(( ;<"*1.,'%"%$&'(4,(+"(#-03"+,'!,(4,(+"(2%0-$+$%0(4<&-$1$',(."2!*+$',(,2%(L(.,%%-,(,'( #"-"++N+,("3,!(+<"*1.,'%"%$&'(4,2(!"2(4,(29'4-&.,(.0%"/&+$)*,(=#-02,'!,(4,(492+$#$40.$,A( 4$"/N%,( 4,( %9#,( F( ,%( B9#,-%,'2$&'( "-%0-$,++,( !B,8( 4,2( #"%$,'%2( &/N2,2@( 4"'2( +,2( #"92( &!!$4,'%"*7:( S+*2$,*-2( 0%*4,2( &'%( 4&'!( 2*110-0( )*<*'( +$,'( "!!-*( ,'%-,( +"( 6,-%$+$%0( ,%( +,( !B&+,2%0-&+(,7$2%,(HTAUAVAFORAFOOI(=W$1*-,(FC@:( X*( #&$'%( 4,( 3*,( #B92$&+&1$)*,A( +,( %$22*( %,2%$!*+"$-,( ,2%( !"-"!%0-$20( #"-( *'( .0%"/&+$2.,(+$#$4$)*,($.#&-%"'%:(;,(!B&+,2%0-&+(,2%($'4$2#,'2"/+,("*(Y%*-'&3,-Z(!,++*+"$-,( +&-2( 4,( +"( 2#,-."%&1,'N2,([( $+( ,'-$!B$%( +"( .,./-"',( 2#,-."%$)*,:( \"( -0#"-%$%$&'( ,2%( 2#0!$6$)*,( ,%( 3"-$"/+,( 2,+&'( +]0%"#,( 4,( +"( ."%*-"%$&'( 4,2( 2#,-."%&8&>4,2:( X$'2$A( +,( !B&+,2%0-&+( #,-.,%( +"( 2%"/$+$%0( .,./-"'"$-,( H^DDI:( ;<,7!N2( #&*--"$%( ,'%-"5',-( *',( -$1$4$%0( .,./-"'"$-,A("+&-2()*<*'(406"*%("*1.,'%,(+"(6+*$4$%0(#&*3"'%(4&'!("66,!%,-(+"(.&/$+$%0A(+"( !"#"!$%"%$&'( ,%( +"( -0"!%$&'( "!-&2&.$)*,( 4,2( 2#,-."%&8&>4,2A( 0%"#,2( $'4$2#,'2"/+,2( L( +"( 60!&'4"%$&':( _,( #+*2A( +,( !B&+,2%0-&+( ,2%( +,( 2*/2%-"%( #-$'!$#"+( 4,( +"( 2%0-&>4&1,'N2,( H^DCI( =W$1*-,(FF@:(( _*(#&$'%(4,(3*,(#"%B&+&1$)*,A(!B,8(+,(+"#$'A(*',("+$.,'%"%$&'(!B"-10,(,'(!B&+,2%0-&+( $'4*$%(*',((4$.$'*%$&'(4,(+"(!&'!,'%-"%$&'(,%(4,(+"(.&/$+$%0(4,2(2#,-."%&8&>4,2:(`'(&/2,-3,( 01"+,.,'%( *',( 4$.$'*%$&'( 4,2( 6&'!%$&'2( 4,2( !,++*+,2( 4,( \,-%&+$( ,%( ;,94$1:( X$'2$A( +,2( !&'!,'%-"%$&'2(4,(W\a(2&'%(#&2$%$3,.,'%(!&--0+0,2("3,!(+,2(%"*7(4,(!B&+,2%0-&+(H^DFI:(b',( "*%-,( 0%*4,( !B,8( +"( 2&*-$2( "( 40.&'%-0( )*<*',( "+$.,'%"%$&'( -$!B,( ,'( !B&+,2%0-&+( $'4*$%( *'( ,66,%( %-"'2E10'0-"%$&'',+( "3,!( +<"+%0-"%$&'( 4,( +"( 6,-%$+$%0( =4$.$'*%$&'( 4,( +"( .&/$+$%0( ,%( 4*( #&*3&$-(60!&'4"'%(4,2(2#,-."%&8&>4,2A(,%("*1.,'%"%$&'(4,(%"*7(4,(-"4$!"*7(+$/-,2@(!B,8(+"( -.! ! ! ! ! ! ! ! H##&)15+'&?IJK&%"77'A& V+-17&-"'-+'-")+,"&?,*+7T7A& LMNBJ& OPQ& <+#F&*1''&4,#"R&?S2T*UA& !"#$"%"&'()*+' !"#$",%"&'-.+',)&'/+' B"%<%' ."$C;@:'#"@@' ("$D'#"@@' /"5&:E'#"@@' !"#$%"#&'(")*&%+$,-& 64(4#&1%%$*$715+,& ./0*12"& !"#$%"#&-"'-+'-")+,"& !"#$%"#&4,8494,& 3(42","5%& 0)#$",%"&'12'3456789':)',&:6;%"'<%%="' *"&=#"&'.+>('?5'@:A"$' -:E=$"'22F'*"@,<;)%G:6'?"CH"")'D"C,?;@:#'%5)&$;D"',)&'D,@"'I"$<@:C5J'0:0''+%415+,& 9"-;"",& <=>& 1,#& '(")*& 1,+*174"'& ?+742+@++'(")*41&+)&1@++'(")*41AB& <:0''+%415+,& 9"-;"",&<=>&1,#&-"'-+'-")+,"&7"C"7'B&D:E8F'4+(1-8+7+2F&+G&8F(+2+,1#4'*&4,&*",&;4-8& *"-19+74%&'F,#)+*"B&& !"#$%&"'$#(%)*'+(,-'.&(-,/"#"&'&%'#)0'12-'3&$(,"'4$"#%&'56780' ! ! "#$%#!&#!'())*+,)%+#! !"#$"%!&%$"'()"#("**"+#(#,%+(-./#(0&12/3#(.,1#2/"(.&(!"#$"%!&%$"("#+("4-,#3"(&/(050"( 13670"( 89:9;'( <"( -./#=( /%( +1&7+"0"%+( -&1( #70>&#+&+7%"( $?"@( !"#( 1&+#( -13>7"%+( ."#( "**"+#( !3.3+A1"#(7%!/7+#(-&1(!"#(+&/4(3.">3#(!"($?,."#+31,.(B!707%/+7,%(!"(.C7%!"4(!"(.&(*"1+7.7+3("+(!/( >,./0"(+"#+7$/.&71"=(&/60"%+&+7,%(!/(%,0D1"("+(!/(-,/1$"%+&6"(!"#(*,10"#(&%,10&."#(!"#( #-"10&+,@,E!"#F(89:G;'(( )?"@(.C?,00"=(."(#H%!1,0"(03+&D,.72/"("+(.C,D3#7+3(#,%+(&##,$73#(I(/%"(?H-,*"1+7.7+3( "+(/%(?H-,6,%&!7#0"(2/7(#,%+(0/.+7*&$+,17".#(8G=JKL=JKK;'(M%"(3+/!"(13$"%+"(B!"#$%&'()*F=( $,%!/7+"(#/1(N:O($,/-."#("%(!3#71(!C"%*&%+#(&/4(P+&+#(M%7#=(&(!30,%+13(/%(.7"%("%+1"(."(+&/4( !"($?,."#+31,.(!"(.C?,00"#(,/(!"(.&(*"00"("+(."(!3.&7(!C,D+"%+7,%(!"(.&(61,##"##"=(!,%$(.&( *3$,%!7+3( 8Q;'( )"( +&/4( !"( $?,."#+31,.( "#+( $,113.3( I( .CRS)'( )"++"( 050"( 3+/!"( &( 36&."0"%+( !30,%+13( /%( .7"%( "%+1"( .C,D3#7+3( "+( .C&.+31&+7,%( !"#( -&1&0A+1"#( !/( #-"10,61&00"( B!707%/+7,%(!/(>,./0"(!"(.C3T&$/.&+("+(."(!/(%,0D1"(!"#(#-"10&+,@,E!"#F(8U;'( -.! ! ! ! ! ! ! ! !%4@D-$".& 789& FA%(53>;%4& !".,%3& D5?;".3?%(3& %:;.%44+5(& 95$%& !"#$%&%'( ,%(%4& 2%.35$+&D%$$& !"#5% !&/&1%<6(-6'7)'&'% ?@%)33B(B+)C6*% HI?HJ% K-'76'7-06*-% !6D% 87)#% !"#$% 7%>)+,&D%$$& ',*7<-'&'% 7-'76'7-06*-% L5M8N% !"#$% H/6/76'&'%OO% 8/-0()762-*-'&'% QQQ% G%.?&D%$$& !"#5% P06+&E-0)C6*%::% !%43543%.5(%" 789$& 75<&!%43543%.5(%& $%B%$4& 789!" 789!" 7I" 7I" 789$5& 789!" 2I" H!H" 2I" G%.?&D%$$&$544& IJ&"DD-?-$"@5(& )*+,(-./0( "#$%$%&%( !"#$%&'&"()&*+,-.%&/01&2+3%4&56&789&%:;.%44+5(&+(&<+$)=3>;%&?5-4%&3%4@4&"()&;A%(53>;%4& 5#4%.B%)& +(& 7:.=)%CD+%(3& ?+D%E& !"#$% &'% ()&*+,% -./0-''-1% &*% !-,1&2% )*1% 2-0(% 3-++'4% )*1% !"#5%-./0-''&6*%&'%16(&*)*7%&*%8-076+&%)*1%2-0(%3-++'9%!"#$:;:%(&3-%<)=-%3<6+-'7-0,+%-'7-0% >?@A% )33B(B+)C6*% &*% 8-076+&% 3-++'4% D&7<% +6D-0% 2-0(% 3-++% /06+&E-0)C6*9% !"#%&;:% )0-% 3<)0)37-0&F-1% G,% +6D% 7-'76'7-06*-% +-=-+'% D&7<% <&2<% 2-0(% 3-++% )/6/76'&'9% !"#%'$:;:% (&3-% '<6D%*B(-06B'%7-'C3B+)0%)*6()+&-'%+-)1&*2%76%'7-0&+&7,9%(()*+",--+#,.+/'*&*&)*#+/01+/2** 3/,4.+/*5#67*8699+*+.*,92*:;;<2* ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'()'*(+*,-./)0,1'23&/.401(' !"#$ %&#$ #'()$ *+,-*./0#$ 12(#$ -2$ 3"4)*-*)0$ ,24$ -"/4$ 45-"$ 12(#$ -2$ 6''41*(2)*'($ 1"$ -2$ #,"4+2)'7"(8#"$")$1"$-2$#)04'91'7"(8#":$!"#$406",)"/4#$6-2##*./"#$0)/1*0#$1",/*#$,-/#*"/4#$ 106"((*"#$ #'()$ -"#$ 406",)"/4#$ ;%$ ")$ <%:$ !"/4$ *+,'4)2(6"$ "#)$ 10+'()40"$ 12(#$ -"#$ ,242742,="#$ ,40601"()#:$ &02(+'*(#>$ 1?2/)4"#$ 406",)"/4#>$ @$ 6'+,4*#$ !A%#>$ B'/"()$ /($ 45-"$ 12(#$-2$407/-2)*'($1"$-2$,=@#*'-'7*"$1"#$6"--/-"#$1"$C"4)'-*>$7"4+*(2-"#>$")$!"@1*7:$DEFGH:$!"#$ %&#$ '4,="-*(#$ 3'4+"()$ /($ 40#"2/$ #',=*#)*./0$ ,'/I2()$ #"$ 407/-"4$ +/)/"--"+"():$ !"#$ %&#$ "J,4*+0#$ 12(#$ -"$ )"#)*6/-"$ #'()$K$ !A%#>$ !"#$%&'%() *) +,-,./'#$ LMA%N>$ %A%#>$ +,/%$'%-) 0-%() +,-,./'#&$ L%<%#N>$ 1,#'2%&'3,) 1#'4%5,#"/'#) 0-/%6"/,() +,-,./'#&$ LOO<%#N>$ 73"44) 8,/,#'(%3,#) 1"#/$,#$ LCPON>$ 9'&":,;&,$&%/%6,) &,2) #,6,#&"4<) 0(#,$"4) =>.'.4"&%") -#%/%-"4) #,:%'$) '$) -=#'3'&'3,)*$LQ ./ 01!2&")&+'&23"(4')56"782"& !"#$1"/J$*#'$3'4+"#>$!A%Z$")$!A%[>$#'()$"J,4*+0"#$2/$#"*($1/$)*##/$)"#)*6/-2*4":$!A%Z$ "#)$-?*#'3'4+"$+2B"/4"$12(#$-"#$6"--/-"#$1"$!"@1*7$")$!A%[$12(#$-"#$6"--/-"#$1"$C"4)'-*>$)2(1*#$ ./"$-"#$1"/J$#'()$"J,4*+0"#$12(#$-"#$6"--/-"#$7"4+*(2-"#$LM*7/4"$VE>$\2T-"$]N:$ 0"2& *"++9+"2& :"& ;"()5+$$ #'()$ 1"#$ 407/-2)4*6"#$ ,4*(6",#$ 1/$ 6='-"#)04'->$ ")$ #'()$ "($ 06=2(7"$ 1*4"6)"$ 2I"6$ -2$ 6*46/-2)*'(>$ 74^6"$ _$ -"/4$ 406",)"/4$ 2/$ PQ!$ LC%R`FN:$ ;($ "33")>$ 1"#$ ./2()*)0#$*+,'4)2()"#$1"$6='-"#)04'-$#'()$(06"##2*4"#$,'/4$-2$#,"4+2)'7"(8#":$S"#$6"--/-"#$ 2##/4"()$1'(6$/($(*I"2/$#2)*#32*#2()$1"#$-*,*1"#$2/J$-"#$6"--/-"#$7"4+*(2-"#$,24$-"/4$62,26*)0$ 1"$62,)27"$1/$6='-"#)04'-$_$,24)*4$1"#$PQ!$DEFaH:$!"#$6"--/-"#$1"$C"4)'-*$'()$072-"+"()$/("$ 62,26*)0$ 1"$ #@()=8#"$ (,) $'6'$ 1/$ 6='-"#)04'-$ +2*#$ ./*$ "#)$ 32*T-":$ Q"$ ,-/#>$ -"$ 6='-"#)04'-$ ,24I*"()$ 072-"+"()$ 1"$ -2$ ,=27'6@)'#"$ 1"#$ 6"--/-"#$ 7"4+*(2-"#$ 2,',)')*./"#$ ")$ 1"#$ 6'4,#$ -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'(#) $##&#) %') (*) #+'!,$-.'/0#'1) 2*) 3*+*3$4") %&) #4-35*.') %&) 36-('#4"!-() '#4) %-/3) #$./$7$3*4$8'9)3')%'!/$'!)'77'34&*/4)#-&#)7-!,')%:'#4'!#)%')36-('#4"!-()%*/#)%'#).-&44'('44'#) ($+$%$;&'#)*&)#'$/)%')3<4-+(*#,')#'!4-($'/1)='#).-&44'('44'#)#-/4)*&)3-/4*34)*8'3)%$77"!'/4'#) >-/34$-/#)%')(*)?@A1)) B$)(:*33&,&(*4$-/)($+$%$;&')'#4)'C3'##$8'9)$()#'!*)"($,$/").!D3')E)(:*C')2FGHI?=IJH@K2) ;&$)7*8-!$#')(')4!*/#+-!4)!'8'!#')%&)36-('#4"!-(1)='),"3*/$#,')"8$4')(:'C30#)%')36-('#4"!-() %*/#)(*)3'((&(');&$)+-&!!*$4)L4!')4-C$;&'9)M(-;&*/4)(*)+6<#$-(-.$')#'!4-($'//')'4)%"#4*M$($#*/4) (*)?@A1)N/)'77'49)('#)3'((&('#)%')B'!4-($)'C+!$,'/4)I?=IJ)3-%")+*!)(').0/')!"#$%9)&/')3$M(') %$!'34')%')2FGO9)(:$#-7-!,'),*>'&!)%*/#)('#)3'((&('#)%')B'!4-($)36'P)(*)#-&!$#)QJR9SJTU1)) 2'#)#-&!$#)&'()*+,+-'4)&'(*+,+)+!"#'/4'/4)%-/3)E)&/')*33&,&(*4$-/)'C3'##$8')%'#)'#4'!#) %')36-('#4"!-()*&)/$8'*&)%')(*)3'((&(')%')B'!4-($1)='44')*33&,&(*4$-/)($+$%$;&')'#4)*##-3$"')E) &/')8*3&-($#*4$-/)'4)&/')%"#4!&34&!*4$-/)+!-.!'##$8')%'#)4&M'#)#",$/$70!'#1)=')+6"/-4<+') '#4)+!"3-3')'4)*++*!*$4)8'!#)J9V),-$#)QJRWXYU1)='44')*33&,&(*4$-/)-M#'!8"')36'P)(*)#-&!$#) &'()*+,+-'#4)'C+($;&"')+*!)&/')*M#'/3')%')3-/4!Z(')%:'C+!'##$-/)%&).0/')!"#$%-[!./01230/- 4(3561256$7/- 830.309- :$22/77/- !%\) '/) !"+-/#') *&C) -C<#4"!-(#1) 2') ,L,') +6"/-4<+') '#4) -M#'!8")36'P)('#)#-&!$#)!"#$%+,+);&$)+!"#'/4'/4)&/')*33&,&(*4$-/)'C3'##$8')%'#)'#4'!#)%') 36-('#4"!-() %*/#) ('#) 3'((&('#) %') B'!4-($) '4) &/') 6<+-) */%!-."/$') ($"') E) (*) !"%&34$-/) %') %$#+-/$M$($4")%&)36-('#4"!-()+-&!)('#)3'((&('#)%')2'<%$.)[+*!)(:$/4'!,"%$*$!')%')@K2\)QSJTU1) )) ]*!)*$(('&!#9)('#)+!$/3$+*&C).0/'#)3-%*/4)('#)+!-4"$/'#)!".&(*/4)(*)8-$')%'#)*3$%'#).!*#) #-/4) %"!".&("#) [;(/"5%#<- =$20<- ;#.%>) QJRU1) ^"*/,-$/#9) ('#) 4*&C) %'#) 4!$.(<3"!$%'#) #',M('/4) L4!')+'&),-%$7$"#)QXYU1) B$) (') !Z(') %'#) 2FG#) %*/#) ('#) 3'((&('#) %') B'!4-($) *) M$'/) "4") "4&%$"9) ('#) %-//"'#) 3-/3'!/*/4)('&!)!Z(')*&)/$8'*&)%'#)!"##$#"%&'"()*+,#"%&#-/4),-$/%!'1)2:'C+!'##$-/)%'#)%'&C) $#-) 7-!,'#) %') 2FG) 3!"') &/) ";&$($M!') %*/#) (*) M*(*/3') +!-($7"!*4$-/_*+-+4-#') %'#) 3'((&('#) .'!,$/*('#1) ='44') M*(*/3') '#4) !-,+&') 36'P) ('#) #-&!$#) &'()*+,+?- N(('- '#4) $,+-!4*/4') +-&!) *##&!'!) (') !'/-&8'((','/4) %'#) 3'((&('#) .'!,$/*('#) '4) (*) 3-/4$/&$4") %') (*) #+'!,*4-.'/0#'1) 2:*+-+4-#')%')3'#)3'((&('#)'#4)*&.,'/4"')36'P)('#)#-&!$#)&'()+,+)'4-&'()*+,+<-#&.."!*/4);&') 2FG`)>-&')&/)!Z(')3('7)%*/#)3')+!-3'##)K'),L,'9)(*)+!-($7"!*4$-/)%'#)3'((&('#).'!,$/*('#) '#4)%$,$/&"')%*/#)(')4'#4$3&(')%'#)#-&!$#)&'(*+,+)'4-&'()*+,+<)$/%$;&*/4)*$/#$);&')2FGO)'#4)&/) !".&(*4'&!) %') (*) +!-($7"!*4$-/) .'!,$/*('1) 2') %"#";&$($M!') %') 3'44') M*(*/3') 36'P) ('#) #-&!$#) $/8*($%"'#)+-&!)('#)%'&C)$#-7-!,'#)'/4!*$/')&/')+'!4')+!-.!'##$8')'4)/-/)3-,+'/#"')%')(*) ($./"').'!,$/*(');&$)3-/3-&!4)*&)+6"/-4<+')%')#4"!$($4")QJRU1)^"*/,-$/#9)$()#',M(');&')('#) -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$% &'(% )(*+"'% ,&"-.% !"'% */0"'% 1(+203+"-.,&*"'4% 1,*% 0"'% '(#*&'% &-5,0&!3"'% 2(#*% 06#-% (#% 06,#.*"%&'()(*+"%-6(-.%2,'%!"%!3),#.'%2,*.&1#0&"*'%35&!"-.'%78&9#*"%:;4%<,=0"%>?@%% A,% 2"*."% 2*(9*"''&5"% !"'% 1"00#0"'% 9"*+&-,0"'% "'.% *"'2(-',=0"% !"% 0,% '.3*&0&.3% B#&% ,22,*,C.%.,*!&5"+"-.%5"*'%06D9"%!"%E%+(&'%FGH4GIJ@%K"2"-!,-.4%1"'%"))".'%'#*%0,%2*(0&)3*,.&(-% ".%06,2(2.('"%2(#**,&"-.%L.*"%&-!&*"1."+"-.%0&3'%M%!"'%M%!"'%,-(+,0&"'%!"%0,%'.3*(N!(9"-O'"4% *39#03"% 2,*% APQR% %!,-'%0"'%1"00#0"'%!"%A"S!&94% ".% !"% '(#.&"-% M% 0,% 2*(0&)3*,.&(-% !"% 1"00#0"'% 9"*+&-,0"'%"$"*13%2,*%0"'%1"00#0"'%!"%'"*.(0&%7APQT?@%% U% 1"% V(#*4% ,#1#-"% 3.#!"% -6,% !3+(-.*3"% 0"#*% */0"% !#*,-.% 0,% !&))3*"-.&,.&(-% !"'% '2"*+,.(9(-&"'4%0,%+3&('"%".%'2"*+&(93-O'"@%W,&'4%!"'%3.#!"'%2(#**,&"-.%'#993*"*%#-%*/0"% !"'% APQ% !,-'% 0,% !&))3*"-.&,.&(-% !"% 1"'% 1"00#0"'4% -(.,++"-.% 2,*% 06&+20&1,.&(-% !"'% QPQ'% 72,*."-,&*"'%(=0&9,.(&*"'%!"%APQ?%".%!"%1"*.,&-'%'.3*(0'%!,-'%0"%1,!*"%!"%0,%+3&('"%F:X4:XIJ@% Y-% "))".4% 06"))".% !"'% *3.&-(N!"'% '#*% 0,% '2"*+,.(9"-O'"4% -(.,++"-.% 0,% '2"*+&(9"-O'"% "'.% !32"-!,-.%!6"$2*"''&(-%!"%QPQT%!,-'%0"'%1"00#0"'%!"%Z"*.(0&@%["'%'(#*&'%+D0"'%!"#T$%$%'(-.% '.3*&0"'% M% 1,#'"% !6#-"%(0&9(\,'.]3-(\.3*,.('2"*+&"4% !3),#.'% !"% *"0,*9,9"% !"'% '2"*+,.&!"'4% ,''(1&3"% ,5"1% #-"% ,11#+#0,.&(-% !"'% "'."*'% !"% 1](0"'.3*(0% !,-'% 0"'% 1"00#0"'% !"% Z"*.(0&4% #-% 2]3-(.S2"%'"*.(0&"-%&!"-.&B#"%,#%2]3-(.S2"%!"'%'(#*&'%&"#RT$%$%F:X4;GIJ@%% [6#-%,#.*"%1/.34%0"'%,9(-&'."'%-,.#*"0'%!"'%APQ'%(#%0"'%'.3*(0'%!,-'%0"%."'.&1#0"%'(-.% 1(--#'%1(++"%WUZ'()*+,-+-$./0+1.0+23'-0*#,4-5@%^,*+&%"#$4%<\WUZ%".%!"'+('.3*(0%'(-.%0"'% 2*&-1&2,#$% ($S'.3*(0'% 1,2,=0"'% !6,1.&5"*% 0"'% APQ'% !,-'% 0"% ."'.&1#0"% ".% 0"'% '2"*+,.(_(N!"'% F:XI4;:XJ@%<\WUZ%&-!#&.%+2'1+0#,%06"-.*3"%"-%+3&('"%!"'%1"00#0"'%9"*+&-,0"'%&-!&))3*"-1&3'%!"% 0,% '(#*&'% F;:GJ@% ["% 20#'4% !"'% 3.#!"'% 1]"_% 0"% *,.% (-.% +(-.*3"'% B#6#-"% ,11#+#0,.&(-% &+2(*.,-."%!"%1".."%'.3*(0%!,-'%0"%."'.&1#0"%'"%2*(!#&.%M%2,*.&*%!"%0,%2#="*.3%F:XIJ@%% A,%2*(!#1.&(-%!"%<\WUZ%"'.%!32"-!,-.%!"%06,1.&5&.3%!"%06"-_S+"%K`^>G%(#%4.2,-06#,4$ 78.$96)60:;4.-*'78&9#*"%a?@%K".."%"-_S+"%"'.%"$2*&+3"%),&=0"+"-.%!,-'%0"'%'2"*+,.(1S."'% 2*&+,&*"'% ".% '(-% "$2*"''&(-% "'.% +,$&+,0"% !,-'% 0"'% '2"*+,.&!"'% ".% 0"'% 1"00#0"'% !"% A"S!&9@% b3,-+(&-'4%#-"%&-5,0&!,.&(-%'231&)&B#"%!"%KS2>G%!,-'%0"'%1"00#0"'%9"*+&-,0"'%,%+(-.*3%#-"% =,&''"% !#% .,#$% !"% <\WUZ% +,&'% ,5"1% #-"% +(*2](0(9&"% ."'.&1#0,&*"% 2*3'"*53"4% 0,&'',-.% '#22('"*% B#"% !6,#.*"'% '.3*(0'% 2(#**,&"-.% &-!#&*"% 0,% +3&('"% ."0'% B#"% 0"% 0,-('.3*(04% 0,-.]('.3*(0%".%0"%!3'+('.3*(0%F;::J@% -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'()'*+'&),-./0.1(23&(' !"#$ %"&&'&"#$ ("$ !")(*+$ ,-##.("/0$ '/"$ %1,1%*02$ 1%%3'"$ ("$ #)/04.#"5$ %1,01+"$ "0$ #0-%61+"$ ('$ %4-&"#023-&5$ "/$ 7'"$ ("$ &"'3$ 1%0*7*02$ ("$ #023-8(-+"/.#"$ 9:;<5=:=>?$ @'$ /*7"1'$ !")(*+*"/5$!AB15$&C*#-D-3E"$E1F"'3"$(1/#$&"#$%"&&'&"#$("$!")(*+$E-('&"$&1$#023-8(-+"/.#"?$G/$ "DD"05$&"#$+./"#$!"#$$"0$%H&'($#-/0$("#$%*I&"#$031/#%3*,0*-//"&&"#$(*3"%0"#$("$!ABJ?$K"#$#-'3*#$ #1'71+"#$031*02#$,13$'/$1/1&-+'"$#)/0420*L'"$("$!AB$MN;OP=P 4" %5*('0(&'#$%&'0+2&'*(&'6+)7.*.18(&'1.2+089:(&';7(<'*=7.>>(' @$ %"$ F-'35$ ,"'$ (C*/D-3E10*-/#$ "R*#0"/0$ %-/%"3/1/0$ &"#$ */0"31%0*-/#$ "/03"$ &"$ E201I-&*#E"$ &*,*(*L'"$ "0$ !AB$ (C'/$ %b02$ "0$ &1$ #,"3E10-+"/.#"$ ("$ &C1'03"$ %b02?$ K"#$ +-'00"&"00"#$&*,*(*L'"#$1'$#"*/$("$%"&&'&"#$("$c"30-&*$-/0$202$(2%3*0"#$%4"U$("#$,10*"/0#$1)1/0$ '/"$4),-$#,"3E10-+"/.#"$9=:d>?$V"#$+-'00"&"00"#$,131*##"/0$,&'#$*E,-301/0"#$L'"$%4"U$("#$ 4-EE"#$ D"30*&"#$ "0$ ,-'331*"/0$ #'++23"3$ #-*0$ '/"$ ,41+-%)0-#"$ "R1%"3I2"$ ("#$ %"&&'&"#$ +"3E*/1&"#$1,-,0-0*L'"#$#-*0$'/$(2D1'0$#"30-&*"/$17"%$32('%0*-/$("$&C"DD&'R$('$%4-&"#023-&?$ -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$ %&'((")"(("#$ #&*($ +"$ ,)'#$ "*$ ,)'#$ *&-./"'#"#$ 01"2$ )34%"5$ /"6)7(0*($ '*"$ 0)(7/0(8&*$ +"#$ -720*8#-"#$ +"$ +76"*#"$ 8+"*(89'"#$ :$ 2"))"#$ &.#"/17"#$ +0*#$ )0$ ,/&%/"##8&*$ +"$ )30(;7/)7/&#"$<=>?5=>@AB$ C$)3;"'/"$02('"))"5$?$8#&6&/-"#$DEF?G$+"$HIJ!$"($'*$8#&6&/-"$+"$HIJ"$#&*($+72/8("#$0'$ #"8*$ +'$ ("#(82')"$ ;'-08*$ <=K5=LAB$ M*"$ 7('+"$ +"$ *&(/"$ 79'8,"$ 0$ 0*0)N#7$ )"#$ .8&,#8"#$ ("#(82')08/"#$ +"$ >>$ ,0(8"*(#$ 01"2$ 0O&&#,"/-8"$ *&*$ &.#(/'2(81"$ D#&8($ 01"2$ '*"$ ;N,&F #,"/-0(&%"*P#"5$ '*$ 0//Q($ +"$ -0('/0(8&*$ &'$ #$%&'()* +$((* ',(-G$ "($ )"#$ 0$ 2&-,0/7"#$ 01"2$ ?$ ,0(8"*(#$01"2$'*"$0O&&#,"/-8"$&.#(/'2(81"$2&--"$(7-&8*#B$!"(("$7('+"$0$-&*(/7$9'"$)"#$ )"#$8#&6&/-"#$D./0!12324*$&*"5*#&*($"R,/8-7#$2;"O$)3;&--"$<=>KAB$H38--'*&$)&20)8#0(8&*$+"$ HIJ!$0$-&*(/7$#&*$"R,/"##8&*$,/8*28,0)"$0'$#"8*$+"$)3"#,02"$8*("/#(8(8")$D2"))')"#$+"$H"N+8%GB$$ H"$,/"-8"/$%/&',"$+"$,0(8"*(#$D0O&&#,"/-8"$*&*$&.#(/'2(81"G$0$'*"$+8-8*'(8&*$+'$ (0'R$+"#$(/0*#2/8(#$+"#$./06*"($+"$)0$,/&(78*"$HIJ"B$!"(("$.08##"$/"6)P("$)0$+8-8*'(8&*$+"$)0$ ,&,')0(8&*$ 2"))')08/"$ %"/-8*0)"$ ,0/$ /0,,&/($ :$ )30O&&#,"/-8"$ &.#(/'2(81"$ )08##0*($ #'%%7/"/$ 9'"$HIJ#$#&*($"R,/8-7#$+0*#$)"#$2"))')"#$%"/-8*0)"#B$!"$2&*#(0($"#($2&*68/-7$,0/$'*"$.08##"$ +"#$ (/0*#2/8(#$ #,728689'"#$ +"#$ 2"))')"#$ %"/-8*0)"#$ D7.892* 70:;<=>?@* 3G5$ 0##&287"$ :$ '*"$ +8-8*'(8&*$ +'$ *&-./"$ +"$ 2"))')"#$ %"/-8*0)"#$ "*$ ,/&)867/0(8&*$ "($ '*"$ 0'%-"*(0(8&*$ +"$ )30,&,(&#"B$S0/$08))"'/#5$)"#$-0/9'"'/#$#"/(&)8"*#$D --! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'(&)'*+#)'(,-)'%,'.,/01,/23-'43)/5/&)/260%,21&' !"#$%&'%('$()*+&',%&'$%$-'./"(01023'$%#'%$0#(%#)%/04)&'$%#)%*"-"4&'$%3'%5'.()&)$'.%+#% 060*7('8% !+."#(% &"% /"(+."()0#% -0$(% ('$()*+&").',% +#% 9*:"#;'% 3'% &)-)3'$% '#(.'% &'$% $-'./"(01023'$% '(% &<9-)(:9&)+/% 9-)3)37/").'% '$(% #9*'$$").'% =>?@A8% B"% *"-"*)("()0#% '$(% *0/-&C('%D+"#3%&"%$-'./"(01023'%$'%/'(%'#%*0#("*(%"6'*%&"%/+D+'+$'%6";)#"&',%D+)%-'./'(% "+E% $-'./"(01023'$% 3<"*D+9.).% +#'% /04)&)(9% -'./'(("#(% +#'% -.0;.'$$)0#% ."-)3'% =>?FA8% B'% ."()0% *:0&'$(9.0&G3'$/0$(9.0&% 3<+#% *H(9% '(% $(9.0&$G-:0$-:0&)-)3'$% 3'% &<"+(.'% *H(9% '$(% (.C$% )/-0.("#(% -0+.% &"% /04)&)(9% 3'$% $-'./"(01023'$% '(% &"% 5&+)3)(9% 3'% &'+.% /'/4."#'% =?F?,?F>,>II,>>IA8%J'%$7$(C/'%$'/4&'%-'+%)#5&+'#*9%-".%&'%$("(+(%&)-)3)D+'%3'$%-"()'#($8%K#% '55'(,% 3'$% -"()'#($% :7-'.*:0&'$(9.0&9/)D+'$% 0+% $0+$% (.")('/'#(% -".% $("()#'% #<0#(% -"$% -.9$'#(9% 3<"#0/"&)'$% 3+'% -.05)&% &)-)3)D+'% 3'% &"% /'/4."#'% 3'$% $-'./"(01023'$% =>IL,>IM,>>NA8% B'$% 3'+E% )$050./'$% BOP!% '(% BOP"% $0#(% 'E-.)/9'$% "+% #)6'"+% 3'% &<9-)(:9&)+/% 9-)3)37/").'%#0("//'#(%3"#$%&'$%*'&&+&'$%"-)*"&'$%3'%&"%(Q('%3'%&<9-)3)37/'8%BOP"%$'/4&'% -.930/)#'#(%=>>?A8%J:'1%&"%$0+.)$%#$%!"&'&%0#%#0('%+#'%3'$(.+*()0#%3'%&<9-)(:9&)+/%3'%&"%(Q('% 3'%&<9-)3)37/'%'(%&<"**+/+&"()0#%3'$%'$('.$%3'%*:0&'$(9.0&%=>>>,>>RA,%D+)%'$(%&)9%S%&"%4")$$'% 3'$%#)6'"+E%3 -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !!" #$%&'(&)*+,-.)/%012././'% !" #$%&'$&%()($)*+,-./0/1.()2()03/45.%() !"#$%&'() (*+) ,-) #'.%-() (-/%0*,12) /#-*+&+,2) 3() 3(,4) 5#-(*)6) 1%) 5#-() /#'+&/%1() (+) 1%) 5#-()723,11%&'(8)!%)5#-()/#'+&/%1()/#-+&(-+)1(*)9#11&/,1(*)#$%'&(-*)*&+,2*)3%-*),-)*+'#7%8)!%) 5#-() 723,11%&'() (*+) /#-*+&+,2() 3",-) +&**,) /#-:#-/+&9) '&/;() (-) $%&**(%,4) *%-.,&-*8) <(-3%-+) 1"(-9%-/(=)1"#$%&'()%),-()%/+&$&+2);#'7#-%1()7#3(*+(8)>1)%,.7(-+()3()+%&11()?)1"@.()%3,1+()AB)?) C).)/;(5)1%)9(77(D)#E)&1)(4('/()%1#'*),-()9#-/+&#-)(-3#/'&-()(+)(4#/'&-(=)0,&*)&1)*"%+'#0;&()AFG H).D)?)1%)72-#0%,*(=)0#,')3($(-&'),-)+&**,)9&I'(,48)) JK*) 1"@.() %3,1+(=) 1"#$%&'() %) 3(,4) 9#-/+&#-*) 3&*+&-/+(*)6) 1%) 9#-/+&#-) (-3#/'&-() (+) 1%) .%72+#.(-K*(8)!%)9#-/+&#-)(-3#/'&-()%**,'2()0%')1%)*2/'2+&#-)3()FL!"M*+'%3)ANHD)(+)3() 0'#.(*+2'#-(=) 3(,4) ;#'7#-(*) &-3&*0(-*%I1(*) ?) 1%) 9#11&/,1#.(-K*(=) 1"#$,1%+&#-) (+) 1%) 0'20%'%+&#-) 3",-() 2$(-+,(11() .'#**(**(8) O(++() 9#-/+&#-) (*+) %**,'2() 0%') 1(*) /(11,1(*) 3() 1%) .'%-,1#*%)(+)1(*)/(11,1(*)3()1%)+;KP,()A/(11,1(*)*#7%+&P,(*D8)!%)9#-/+&#-)(4#/'&-()%**,'()1%) .%72+#.(-K*()/"(*+G?G3&'()1%)0'#3,/+&#-)3",-)#$#/Q+()7%+,'(8) 3" #$%0)44.,+4)5'/67'% !(*) 9#11&/,1(*) #$%'&(-*) '(0'2*(-+(-+) 1",-&+2) 9#-/+&#--(11() 3() 1"#$%&'(8) R,) /#,'*) 3() 32$(1#00(7(-+=) 1(*) /(11,1(*) .('7&-%1(*) 0'&7#'3&%1(*) *#-+) 0'2*(-+(*) 3%-*) 3(*) 9#'7%+&#-*) SQ*+&P,(*)A,-)*+#/S)3()/(11,1(*)01,'&0#+(-+(*D)(+)*,I&**(-+)3(*)3&$&*&#-*)7&+#+&P,(*)0(-3%-+) 1(*P,(11(*),-)-#7I'()*&.-&9&/%+&9)3()/(*)/(11,1(*)(-+'(-+)(-)%0#0+#*(8)J"%,+'(*)'2,**&**(-+)?) *,'$&$'(8)O(*)3('-&K'(*)*"(-.%.(-+)%1#'*)3%-*)1%)9#11&/,1#.(-K*(8)!(*)9#11&/,1(*)-#-)2$#1,+&9*) *,I&**(-+),-()32.2-2'%+&#-)%$%-+)(+)%0'K*)1%)0,I('+2=)+%-3&*)P,()1(*)9#11&/,1(*)2$#1,+&9*)*#-+) 3(*)9#11&/,1(*)329&-&+&9*)0('*&*+%-+):,*P,"?)1%)0,I('+2=)P,&)%**,'(-+)1%)9('+&1&+2)?)1"@.()%3,1+(8)R) /;%P,() /Q/1() #$%'&(-=) ,-) 9#11&/,1() A/;(5) 1%) 9(77(D) #,) I&(-) 01,*&(,'*) A/;(5) 1(*) '#-.(,'*D) 9#11&/,1(*)'2,**&**(-+)?)%++(&-3'()1%)7%+,'&+2)0#,')%I#,+&')?),-()#$,1%+&#-8)R)/;%P,()/Q/1() #$%'&(-=),-)/('+%&-)-#7I'()3(*)9#11&/,1(*)0'&7#'3&%,4)2$#1,(-+=)7%&*)*(,1=),-)9#11&/,1()%++(&-+) 1()*+%3()329&-&+&9)3()7%+,'%+&#-)A1()9#11&/,1()3()T'%%9D)(+)*,I&+),-()#$,1%+&#-8)>1)(4&*+()3#-/) 3(*)9#11&/,1(*)-#-)#$,1%+#&'(*)P,&)32.2-K'(-+)?)/;%P,()/Q/1(8)) R,) 9&-%1=) *(,1(7(-+) FUV) 3(*) #$#/Q+(*) /#-+(-,*) 3%-*) 1(*) SQ*+(*) *() 32$(1#00(-+) (-) 9#11&/,1()0'&7#'3&%18)!()'(*+()*,I&+),-()%0#0+#*(8)R&-*&=)?)1%)-%&**%-/(=)H)7&11&#-*)3"#$#/Q+(*) *#-+) 0'2*(-+*) /;(5) 1%) 9(77(=) *(,1(7(-+) WXX=XXX) %''&$(-+) ?) 1%) 0,I('+2) A2$#1,+&9*D) (+) ,-&P,(7(-+)WXX)*#-+)#$,1%+#&'(*8)) -.! ! ! ! ! ! ! ! +#"-5('/*-#1% 0-'',&'"% !"#$%&"''% +#,$-#,./'% +#,$/#1% 2"&-3./#1% 43*#/'% %&'()*"#% 0-'',&'"% 0-'',&'"% 0-'',&'"% 0-'',&'"% '()*"# !"# $%&# $6FO.0# Y0<.H.0#T# $6FO.0# '+&#-./012.0/# $%&# $%&# 34$# $07>(/=0# '+,# Y0<.H.0#$# 5607"# 589:;# IL';S4Y,S4Y,*# T%3:US$%&S# 16FO.0=# '+,S'+&AS Y0<.H.0# YI'AS*&A# *&A# *&# 62=% *&# ,<=61# I>10C2(-1# P(68?=# $%&S$6FO.0S.0<.H.0S $07>(/=0# IL';ST%3:US4Y,# 4Y,*# 6,7(#"%89:%+/#/&#,3"%#"7('/;-3%-0%-5/#,/3%0-'',&('-7"3"),)<%,<=612#6=22-#=)9>=--#*&#>=6=9?(>-#@*&AB# 6(C92=7#?(#?<=#D(>E1F(0#(D#107>(/=0-#?<1?#=)=>?#91>16>.0=#=G=6?-#.0#0=./ !"#$%&#'()*#+,--%.)-&#/012,$)-"3,%0&#&43#'%$%41#&*#5#/6"4&4#7#-"#4&*&4.&*.&#")#.,)04#'&# -"8)&--&#-&#+,--%.)-&#&43#%*'1/&*'"*3#'&4#9,*"',30,/6%*&4:#-"#.0,%44"*.&#;<=2'1/&*'"*3&:#&3# -"#>"3)0"3%,*#!=2'1/&*'"*3&#?55@AB#C%*4%:#&--&#'1/&*'#'&4#.,>>)*%."3%,*4#,$,.D3&2.&--)-&4# 'Z"*)-,4"#EFGH#&3#FG2.&--)-&4#'&#-"#36I8)&#EFJH#'()*#/"03:#&3#'&4#9,*"',30,/6%*&4#'(")30&# /"03# ?55K:55LAB# !"# +,--%.)-,9&*I4&# "%*4%# 8)&# -&# 0M-&# '&4# +".3&)04# /"0".0%*&4N&*',.0%*&4# O# .6"8)+"',*3#014)>14#'"*4#-"#+%9)0&#PQB# !&4#43"'&4#1$,-)3%+4#'&4#+,--%.)-&4#4,*3#-&4#4)%$"*347# • !"#$%&''()*'"#$+,(-&,.(/*0$ !"# +,--%.)-,9&*I4&# '1R)3&# -,048)&# '&4# .&--)-&4# 9&0>%*"-&4# %44)&4# '()*&# *%.6&# '&# .&--)-&4#/-)0%/,3&*3&4#E-+,.SH#4)0$%$&*3#")#.,)04#'()*#/0,.&44)4#'&#'%$%4%,*#&3#4(&*3,)0&*3# /"0# '&4# .&--)-&4# 4,>"3%8)&4# E.&--)-&4# '&# /01290"*)-,4"HB# F&# /0,.&44)4# "# -%&)# ')0"*3# -"# $%&# +T3"-&# &3# "R,)3%3# O# -"# +,0>"3%,*# '&4# +,--%.)-&4# /0%>,0'%")U# ?55VAB# F&33&# /0&>%I0&# 13"/&# '1>"00&#')0"*3#-"#$%&#%*30")310%*&#.6&W#-"#+&>>&#E-&#*,>R0&#&43#>"U%>"-#")#XI>&#>,%4#'&# 90,44&44&H#.6&W#-"#+&>>&#&3#O#YK:X#Z,)04#/,43#"..,)/-&>&*3#.6&W#-"#4,)0%4B#["*4#-&#+,--%.)-&# /0%>,0'%"-:# -(,$,.D3&# &43# &*3,)01# /"0# )*&# 4&)-&# .,).6&# '&# .&--)-&4# '&# 90"*)-,4"B# [I4# -(%*%3%"3%,*# ')# '1$&-,//&>&*3# ')# +,--%.)-&# /0%>,0'%"-:# -&4# +,--%.)-&4# 4(&*9"9&*3# '"*4# )*# /0,.&44)4#'&#>"3)0"3%,*#Z)48)(O#-(,$)-"3%,*#,)#R%&*#'191*I0&*3B#!"#.0,%44"*.&#+,--%.)-"%0&# /,)04)%3# Z)48)(O# -(1/)%4&>&*3# '&4# +,--%.)-&4# /0%>,0'%")U:# ")# >,>&*3# '&# -"# >1*,/")4&# E;%9)0&#PXHB# • !"#$%&''()*'"#$+,(-/(,"#$ !"# 30"*4%3%,*# ')# +,--%.)-&# /0%>,0'%"-# &*# +,--%.)-&# /0%>"%0&# *(%>/-%8)&# /"4# '&# /0,-%+10"3%,*# .&--)-"%0&B# !(,$,.D3&# ")9>&*3&# '&# 3"%--&:# -"# >,*,.,).6&# '&# FG# .6"*9&# '&# >,0/6,-,9%&:#'0)">&)4&4#O#.)R,\'&4#?5Q]AB#!"#30"*4%3%,*#/0%>,0'%"-2/0%>"%0&#&43#019)-1&# /"0# ;^_!P# E!"#$%&'() *"+) ,-H:# +".3&)0# '&# 30"*4.0%/3%,*# &U/0%>1# '"*4# -&4# .&--)-&4# 90"*)-,4"# ?5QY:5QPA# &3# G[;V:# E.#"/0%) (122&#&301'01"3) 2'40"#H# +".3&)0# '&# .0,%44"*.&# /0,')%3# /"0# -&4# ,$,.D3&4# ?5Q5AB# !(C`=# E6,0>,*&# "*3%2>a--10%&**&H# /0,')%3&# /"0# -&4# FG# '&4# +,--%.)-&4# 4&.,*'"%0&4# &3# /012"*30")U# "9%3# 4)0# -&4# FG# '&4# +,--%.)-&4# /0%>,0'%")U# &3# R-,8)&# -&)0# '%++1*.%"3%,*#?5QQ:5QXAB#!&4#4,)0%4#56%787).,*3%&**&*3#>,%*4#'&#+,--%.)-&4#/0%>,0'%")U:#>"%4# /-)4#'&#+,--%.)-&4#/012"*30")U#.)%#&U/,4&#O#)*#1/)%4&>&*3#'&4#43,.S4#/01.,.&#?5QXAB#C%*4%:# -&4#.,*.&*30"3%,*4#'(C`=#4,*3#.,001-1&4#/,4%3%$&>&*3#O#-"#014&0$&#,$"0%&**&#&*#3&0>&#'&# +,--%.)-&4#/0%>,0'%")U2/0%>"%0&4#.6&W#-"#4,)0%4#&3#.6&W#-"#+&>>&#?5Q@:5QKA#E;%9)0&#PQHB# # -.! ! ! ! ! ! ! ! @.'"=)($/".3% <"((+*('% ?'.0%*'((% @.+0".+,$(% @.+0$.3% :'*"#,$.3% A#/.$(% %*()1/'.% <"((+*('% <"((+*('% <"((+*('% <"((+*('% -)0)()1%""&2".)1% 42'*$%($3'.1% ""*3/'% B',)(($% -"."#$%.$,+$/$% -"./'C% !"#$%&'(()*+,$% 5+6).'%789%:*2'0$;*%$#,%2+1/"("6+*$(%.'&.'1'#/$;"#%"<%"=$.+$#%<"((+*)("6'#'1+1>%% !"#$% &'()"*+,% '-.)"% !/0% 12$'342#-,% 5#3367'3#8)-)161% 1*4"*1% 6-% *9)% #:4"64-% 7#"*);% <179)$427% ")&")1)-*42#-%#5%#:4"64-% 1)72#-=>% ?"6$#".643% *#% &"6$4"+% 5#33673)% 61% 794"47*)"6@).%(+%8"#A*9% 4-.% *"4-15#"$42#-% #5% 8"4-'3#14% 7)331% ! • !"#$%&''()*'"#$#")&+,-(."#$ "#!$%&'(&)*+!,+!-#!.#*&'#*)%/!0%--)1&-#)'+!+(*!.#'2&3+!$#'!-#!1'%)((#/1+!,+!-4%5%16*+7! -#! $'%-)03'#*)%/! ,+! 89! +*! -4#12&)()*)%/! ,+! 8:;! "+(! %5%16*+(! (+'%/*! +/*%&'3(! $#'! ,+&#&*%1')/+(!#((&'#/*!-#!1%..&/)1#*)%/!+/*'+!-4%5%16*+!+*!-+(!897!+*!)/,3$+/,#/*+! ,+!?%/#,%*'%$@)/+(;!A)/()7!1@+B!,+(!(%&')(!,30)1)+/*+(!+/!9/CD7!"D!%&!EFD!-#!1'%)((#/1+!,+(! 0%--)1&-+(!$'3G#/*'#&R)*! 1@+B! -#! (%&')(! (+! .#/)0+(*+/*! $#'! -4#''^*! ,+! -#! 0%--)1&-%?+/H(+! #&! (*#,+!$').#)'+!IJNNP;!:#/,)(!2&+!,+(!,30#&*(!,+!-#!()?/#-)(#*)%/!9ZE[!(+!.#/)0+(*+/*!$#'!&/! ]-%1#?+!#& !"#$%&'%()*+!),-".*'/!-01)-2.-')13/+4)-)!"-/*'/!5)*!.62)-5%1$-2.-7$%/!!.*7)-')-28%9%7:")-)"- 28%912."/%*;-- <)-'#9)2%55)4)*"-'1-=%22/712)-.*"$.2--4.$01)-1*-7>.*()4)*"-'.*!-2.-$#(12."/%*-')-2.- 4."1$."/%*- =%22/712./$)?- )22)- '#5)*'- '#!%$4./!- ')!- =.7")1$!- )3"$.@%9.$/)*!- A2.- BCDE;- <8.7"/9."/%*- ')- BCDF,- !"/412)- 28GHI7- )"- 2.- 9%/)- IJG,- 7)- 01/- .6%1"/"- K- 2.- "$.*!7$/5"/%*- ')- *%46$)13- (+*)!- 7/62)!- ")2!- 01)- !"#$%&#'#()*+ !",-.,/,-)- 0+ )'+ 1*+ 2.$*+ )"- ')!- =.7")1$!- ')- 7$%/!!.*7);-G/*!/,-2.-BCD-5$#9/)*"-28.5%5"%!)-')!-LM,-5)$4)"-2)1$-5$%2/=#$."/%*,-2.-5$%'17"/%*- ')-28NO-)"-28)35$)!!/%*-')- !"#$%&#''()*+!#+,-./+%01'+(2%)&34*35+#3+!)*6+64%470#+!#+2(#1$+&8%)*!&#+9+1*+*(:#41+%01'+ 74'+!#+,-.;+<*+%4&400=0#5+0"41>2#*343()*+!#+0"&Q6#+9+1*+%(6+!#+ '86&83()*+9+2(R6S60#;+A4+21343()*+!#+&'(+)1+&')+#'3+&#'%)*'470#+!"1*#+(*C#&3(0(38+4:#6+1*#+ C)00(610)>#*='#+70)E18#+41+'34!#+4*3&40+#3+!#'+!8C413'+!#+'S*3@='#+!#+0"T'3&4!()0+FGUV5GUWJ;+ X#*!4*3+ 0#'+ '34!#'+ 4*3&40RN&44C5+ 0#'+ P)*63()*'+ 6)221*(64*3#'+ Y6)*'3(318#'+ !#+ 6)**#$(*#'+ GU+ #3+ ZG[+ #*3&#+ 0#'+ MN+ #3+ 0"):)6S3#+ '"466&)(''#*35+ 6#+ E1(+ %#&2#3+ 9+ 0"):)6S3#+ !"#$#&6#&+')*+&B0#+!4*'+04+6&)(''4*6#+C)00(6104(&#+#3+04+'38&)\!)>#*='#+>&Q6#+9+')*+C463#1&+!#+ 6&)(''4*6#5+0#+N],I+FGU?J;++ • !"#!"#"$"%&''()'*"%* A#+!"#"$"%+4+%)1&+713+!"4&&^3#&+04+28()'#+!#'+):)6S3#'+#3+!#+%4&3(6(%#&+9+04+&8463()*+ (*C042243)(&#+0)&'+!#+0"):1043()*;+L0+'17(3+1*#+#$%4*'()*+4%&='+0#+%(6+!#+A.5+%&)!1('4*3+1*#+ 243&(6#+#$3&46#00104(&#;+A#+!"#"$"%+*"#$%&(2#+%4'+0#'+&86#%3#1&'+41$+>)*4!)3&)%@(*#'+#3+')*+ !8:#0)%%#2#*3+#'3+!8%#*!4*3+!#'+C463#1&'+!#+6&)(''4*6#+'#6&838'+%4&+0#'+MN+21&40#'+Y!#'+ +,-.$/01*_+ 2#3'/)14"$/51* 16* +3/)14"$/51[+ #3+ 0"):)6S3#+ YN],I[+ FGUG`GUHJ;+ M#'+ C463#1&'+ '3(210#*3+ 04+ 3&4*'6&(%3()*+ !#+ >=*#'+ 6)!4*3+ 78%9* :';8$")<585* %;56'8%1=>* ?64%9* :3)<%684$85@/51*%;56'8%1*<"*A !"#$%&' ()*' +,-&./0,' %&1%&2&34/053' 56' .&"50,' %&2$.1053' /37' 55,84&' /,09/053' :8' 6&%0;"' !"#$ %&'(#%$ '&$ )"*+"$ ,-*.'-/$ 0,-1,"'%#$ 23$ '45$ %#+145'-/$ 06223$ '--#%&$ '-#$ *45*+'9$ 81+/&#%$ *4*9'&#$ .#*1%*%$ 5:-*4($ ;#&'<$ 5#=#<1,.#4&$ '45$ #4&#-$ ,-*.'-/$ '--#%&$ '&$ &"#$ 5*,<1#$ %&'(#$ 1;$ ,-1,"'%#$ 2$ '-1:45$ &"#$ 9.#$ 1;$ >*-&"$ 041&$ *<<:%&-'$ "#-#37$ ?-1,"'%#$ 2$ '--#%&$ *%$ .'*4&'*4#5$ 5:-*4($ 11+/&#$ (-1)&"$ '45$ 5*@#-#49'9147$ ?-*1-$ &1$ 1=:<'914A$ .#*1%*%$ -#%:.#%A$ &"#$ 4:+<#'-$ #4=#<1,#$1;$&"#$(#-.*4'<$=#%*+<#$0BC3$5*%'%%#.><#%$DBC$>-#'E51)4$0BCFG3HA$'45$+"-1.1%1.#%$+145#4%#$ '45$'<*(4$14$&"#$I-%&$.#&',"'%#$,<'$G:-*4($&"#$I-%&$5*=*%*14A$"1.1<1(1:%$+"-1.1%1.#%$%#(-#('&#$'45$ &"#$I-%&$,1<'-$>15/$0?F3$*%$#J&-:5#5$0I-%&$?F$*4$'4',"'%#K&#<1,"'%#$237$!"#$-#.'*4*4($+"-1.1%1.#%$-#'<*(4$ 14$&"#$%#+145$.#&',"'%#$,<'&#$06223$;1<<1)#5$>/$%#+145'-/$'--#%&7$G:-*4($622$'--#%&A$&"#$I-%&$?F$1L#4$ 5#(-'5#%7$ 81+/&#%$ &"'&$ '-#$ 1=:<'$ +'4$ #J*&$ 622$ '--#%&$ '45$ +1.,<#&#$ .#*1%*%$ )"#4$ '+9='$ >/$ '$ ;#-9<*M*4($%,#-.7$84$'+9='914A$%*%&#-$+"-1.'95%$%#(-#('&#A$'45$&"#$%#+145$?F$*%$#J&-:5#5$0%#+145$?F$*4$ '4',"'%#K&#<1,"'%#$2237$!"#$'+9='$11+/&#$&"#4$,-1(-#%%#%$&1$,-14:+<#'-$%&'(#$'%$&"#$4:+<#'-$#4=#<1,#$ -#;1-.%7$ !"#$%&"'()*+',&-./#/%#0'&%'#/1'23!4'56781' ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'(&")*+#,-.&'+%&/0/12,+%&#+'(31+3,&'(&4-5/%+&%/)%&'6+77+,&8+&"51&8+&9:;&96/0/12,+& +3,#+& +3& 4-,("<(%+& =& +,& '5*$#+& '+& "#+45+#& >'/*)'+& "/'(5#+.& ")5%& '(& 4(,)#(,5/3& %6(##?,+& +3& 4-,("<(%+&==&@A5>)#+&BCD;&E+,&(##?,&+%,&4(53,+3)&>#F1+&G&'6(1,505,-&8+&H!IJ.&+,&'(&!"#$%"#&'() *%'!'#&(+) ,"-#'%) @HIA& /)& 18KLM121'53& ND& OPQRSPQBT;& 9(& 4-5/%+& #+"#+38#(& '/#%U)65'& 2& ()#(& 7-1/38(,5/3& "(#& )3& %"+#4(,/V/W8+.& >#F1+& G& '(& *(5%%+& 8+& '6(1,505,-& 8+& HI!J& +,& HIA.& G& '6()>4+3,(,5/3&8+%&,()X&8+&E(YB&+,&G&'6(1,50(,5/3&8+&'(&0/5+&Z[A&OPQPSPQ\T;& 9+%& E[& 4)#('+%& *'/U)+3,& '(& 4-5/%+& 8+& '6/0/12,+& "(#& '(& ]IIE& @."#%&$%/#&-) */*#&0/) *%/-$%1'%&2D&U)5&(>5,&%)#&%/3&#-1+",+)#&.345&+X"#54-&%)#&'+&-$!$6$1;&9653<5*5,5/3&+%,&8/31& 5385#+1,+& +,& (%%)#-+& >#F1+& ()& -$!$6$1) 86)3+& "(#,.& +,& "(#& '+%& E[& 4)#('+%& 86(),#+& "(#,& OPQC.PQ^T;&_3&/0/12,+&#+,5#-&8)&7/''51)'+&(0+1&'+&-$!$6$1&(##?,+&%"/3,(3-4+3,&'(&4-5/%+;& & 9/#%&8+&'6/0)'(,5/3.&'+&7/''51)'+&+X")'%+&)3&/0/12,+&%+1/38(5#+&("#$%&'(&"+#7/#(,5/3&8+& '(&"(#/5&8)&7/''51)'+&+,&8+&'6/0(5#+.&%)5,+&()&8-1'+31<+4+3,&86)3&"#/1+%%)%&537'(44(,/5#+!& _3&"51&8+&9:&8-1'+31<+&'6/0)'(,5/3;&E+,,+&8+#35$#+&+%,&(%%)#-+&>#F1+&G&)3+&#-(1,5/3& `8-4(,+)%+& 537'(44(,/5#+& (),/)#& 8)& 7/''51)'+& 8/453(3,;& Z''+& +%,& 8-"+38(3,+& 8+& '(& "#/8)1,5/3&8+%&"#/%,(>'(3853+%&+,&53,+#'+)K53+%;&9+%&=9&L&+,&B&%/3,&"#-%+3,+%&8(3%&'+&'5U)58+& 7/''51)'(5#+& +,& %,54)'+3,& '(& %23,<$%+& 8+%& "#/%,(>'(3853+%& ()& 1/)#%& 8)& "<-3/4$3+& 8+& '6/0)'(,5/3;&Z3&"<(%+&"#-a/0)'(,/5#+.&'+&"51&8+&9:&%6(11/4"(>3+&86)3+&%23,<$%+&86=9aL.&=9aLb7& +,&8+&7(1,+)#%&(3>5/>-35U)+%&1/44+&'+&cZ[A.&+,&'+%&"#/,-(%+%;&d6(),#+%&7(1,+)#%&,+'%&U)+& 121'/a/X2>-3(%+& @EefBD& +,& "!*8&%/+$6&(.& %/3,& 538)5,%& "(#& '+%& (38#/>$3+%.& 3/,(44+3,& ()& 4/4+3,&8+&"51&8+&9:.&+,&"(#&1/3%-U)+31+.&"(#,515"+3,&G&'6/0)'(,5/3&OPQQT;&!53%5.&'6/0/12,+&+%,& +X")'%-.&+3,/)#-&86)3+&1/)#/33+&8+&-$!$6$1&7/#4(3,&'(&-'%'(")%"0&"#";& 9+& #+%,+& 8)& 7/''51)'+& "/%,& /0)'(,/5#+& -0/')+& +3& )3+& >'(38+& +38/1#53+& ,+4"/#(5#+& (""+'-+&g&1/#"%&h()3+&i;&& "! #$%&'$(()($%&*$&(+&,-+.)(/%+&& 96/0/12,+& +%,& +3,/)#-& "(#& 8+%& 1+'')'+%& %/4(,5U)+%&j& '+%& E[& 1/3%,5,)+3,& '(& 1/)1<+& 53,+#3+&,(385%&U)+&'+%&Ek&7/#4+%&8+)X&1/)1<+%&+X,+#3+%&8+&1+'')'+%.&()&1/3,(1,+&(0+1&'+%&E[& @A5>)#+&B\D;&9+%&/0/12,+%&%/3,&8-"+38(3,%&8+&'(&351<+&1#--+&"(#&'+%&E[.&3-1+%%(5#+&"/)#&'+& %/),5+3& "<2%5U)+.& '(& %)#05+.& '(& 3),#5,5/3& +,& '+& 4-,(*/'5%4+;& ='%& "(#,(>+3,& 8+%& h/31,5/3%& 1/44)351(3,+%& (0+1& '+%& 1+'')'+%& 8+& >#(3)'/%(;& I(#(8/X('+4+3,.& '+%& /0/12,+%& #->)'+3,& '6(1,505,-&4-,(*/'5U)+&8+%&1+'')'+%&8+&>#(3)'/%(&"(#&'6+77+,&8+%&7(1,+)#%&"(#(1#53+%&OPQlT;& -.! ! ! ! ! ! ! ! 0+--"3$-%&(*,%/4( 8"9:3'3-4( 5$#4%-(*,%/4( )'*+#,%-%.$/( )'*+#,%-%.$/( )'*+#,%-%.$/( !"#$"#%&'( !"#$"#%&'( !"#$"#%&'( ,-' ,-' 01)( 5)( 56-' 56-' ./' ./' 67( >' 4' 2( 2( 2( 4' <#"= !"#$%&' 0)*#%&' 0)*#%&' 0)*#%&' (%)*%+' ,1213"' ,1213"' ,1213"' 0)*#%&' 78%(9:";' 0";$&4(7<=(13,4.%>3(&4*&4/4?#%>+?(+@(+A%&"%?(3'3-4B(?;')@*'A"((1B%(9#'$@9&*C'56-'$#*3"+1;9)*&' (*931;=' )"' A"((1B(*' =#"D)@' 9;3' ./' $#"3%B:";' A#"+' )@*' =#9;%("&9' B*((&>' ./' $#*$9#*&' )@*' %)*#1;*' *;3"+*)#1%+'A"#'9;'*8*;)%9('1+$(9;)9:";'"A'9'EF=")*>'?;'+13'BFB(*C'*GB*&&18*'./'$#"3%B:";'(*93&' )"' 9' $"&1:8*' A**329BH' ";' )@*' @F$")@9(9+"I$1)%1)9#F' 9G1&' (*931;=' )"' 9' $1B' "A' ,-' &*B#*:";' )@9)' 1;3%B*&' "8%(9:";>' ?;' )@*' (%)*9(' $@9&*C' )@*' B"#$%&' ,%)*%+' $#"3%B*&' $#"=*&)*#";*' 9;3' ./' )@9)' $#*$9#*')@*'%)*#%&'1A')@*'""BF)*'1&'A*#:(1E*3'9;3'1;@121)'56-'9;3',-'&*B#*:";>' ! ! "#$%#!&#!'())*+,)%+#! !"#$%&$'()$*("$+,*)"$-,.,-/)0$1"$1/2203"()/,)/'($!"#$45"6.3"##/'($1"#$30-".)"*3#$7$4,$ 89:;$ !:;$ <&8;$ =&8>?$ @*/$ #)/A*4"()$ -"#$ -"44*4"#B$ %"."(1,();$ 4"$ 30-".)"*3$ 15CD:$ /(+/E"$ 45,-)/F/)0$#)03'G1/"(("$1"$-"#$-"44*4"#B$ !,$ 2'(-)/'($ +'3A'(,4"$ 1"$ %&$ "#)$ A,3@*0"$ .,3$ 4,$ #H()+I#"$ 1"$ 45J#)3,1/'4$ ")$ 1"$ .3'K"#)03'("B$ !5 -.! ! ! ! ! ! ! ! 02<(( 18:;,( 645) 78'&+(.+"'&) )63,,5,( 345((((( )63,.( 9/012( ,$-"'(.+$+-/'$+)) 98+*#)*+&&) 78'&+(.+"'&) ,$-"'(.+$+-/'$+) 1758( 02<( )63,,5,( )*+,-( 18:;,( 9/012( 345( !"#$%&'( :"';+(.+"'$+)) ,./012( 2345) !"#$%&'(#)*+&&) 01) 2/;%"+)1<=)3*8+>#?*)"+@"+(+$.#?'$)'A)'B#"/#$)(.+"'/-';+$+(/()C/.8/$);"#$%&'(#)*+&&()D!7E)#$-) .8+*#)*+&&()D97EF)( ! ! "#$%#!&#!'())*+,)%+#! !"#$#%&'(#!"#$%&%$#%)*$+,-%."'*(/"#$01"2$&)"$%1&/0*(%)$3(4()&5"6$/(5"$7$/0$3(4()&*(%)$ 38"9-'"##(%)$3"$!:;$#&'$/"#$<=$")$-'5>%1&/0*%('"#$?@AB6@ACDE$ F)$ 3"+%'#$ 3"$ /"&'$ 02*(1(*5$ ")3%2'()"6$ /"#$ <=$ '5G&/")*$ /0$ .%//(2&/%G")H#"$ "*$ /0$ 2'%(##0)2"$3"$/8%1%2,*"$-0'$/8()*"'453(0('"$3"#$.02*"&'#$-0'02'()"#$IJ(*!6$KL=M6$=LNM6$O=M>P6$ Q%)2*(%)$ 2%44&)(20)*"#$ "*$ RS:T6$ /0$ 45(%#"$ INKK !" #$%&'$(()($%&*$&(+&,-./)$& !"#$ -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$#%&'(#$!"#$#$)'*#"+,"+,$&+$-*."/%))"0"+,$1%//(2&/3('"$03(#$&+"$45)%$1"',(/(,*6$7"$ )4*+%,5)"$ "#,$ "##"+,("//"0"+,$ -*)"+-3+,$ -"$ /8"9)'"##(%+$ -"$ :;$ -3+#$ /"#$ 2"//&/"#$ -"$ <'3+&/%#3=$3."2$0%(+#$-"$1%//(2&/"#=$0%(+#$-8%.%25,"#$%.&/*"#=$",$0%(+#$-"$)",(,#$)3'$)%',*"=$ -"$13>%+$#(0(/3('"$?$/8(+#&11(#3+2"$%.3'("++"$)'*03,&'*"$@ABCD6$E*3+0%(+#=$/"$+%0F'"$,%,3/$ -"#$1%//(2&/"#$)'(0%'-(3&9$'"#,"$#,3F/"6$ G%&#$2%+,'H/"$-"$/3$IGJ=$/"#$7K$)'%-&(#"+,$-8&+"$)3',$LKIM$",$(+4(F(+"=$",$-83&,'"$)3',$$ /"#$ 32,(.(+"#$ 23)3F/"$ '"#)"2,(."0"+,=$ -8(+-&('"$ %&$ -8(+4(F"'$ /3$ #5+,4N#"$ -"#$ 3+-'% !" #$%&'()*+,)+(-+.)$/0(0/1+)/+(020,)*+ `+"$-5#1%+2,(%+$%.3'("++"$"#,$1'*Q&"00"+,$%F#"'.*"$24"a$-"#$)3,("+,"#$)'*#"+,3+,$ &+$ #5+-'%0"$ 0*,3F%/(Q&"$ %&$ &+"$ %F*#(,*=$ ",$ "+$ /8%22&''"+2"=$ 2",,"$ 3/,*'3,(%+$ #"0F/"$ 3##%2(*"$ 3&9$ 3+%03/("#$ -&$ 0*,3F%/(#0"$ /()(-(Q&"$ @]MUD6$ !"$ 24%/"#,*'%/$ "#,$ /"$ #&F#,'3,$ )'(+2()3/$ )%&'$ /3$ #5+,4N#"$ -"#$ #,*'%b-"#6$ Z+$ "11",=$ J_!$ ",$ !_!$ 1%&'+(##"+,$ -"#$ "#,"'#$ -"$ 24%/"#,*'%/$)%&'$/"#$7K$",$7X=$3(+#($Q&"$)%&'$/"$2%')#$P3&+"=$+*2"##3('"#$?$/3$#5+,4N#"$-"#$ -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()"*+ ,(-$%&'()"+ )#+ -)+ .,+ /$%&)"#0$%()1+ 23045,(&)+ ")+ 6,7#+ /,$+ .)+ $04)/#)8$+ 9:;<=+ >?@AB1+235%C0%"#,"7)+-8+45%.)"#0$%.+)"#+0&,.)C)(#+4$847,.)+-,("+.)"+#$%/5%D.,"#)"+E/.,4)(#,F+ /%8$+.,+"8//.0C)(#,#7%(+-8+60#8"+)(+45%.)"#0$%.+)#+.,+"G(#5'")+-)+/$%&)"#0$%()+>?@?B1+ H5)I+.,+6)CC)*+.3%D0"7#0+C8.#7/.7)+.)+$7"J8)+-3,(%K8.,#7%(+)#+.,+"#0$7.7#0+)"#+C8.#7/.70)+ /,$+ A+ >?@LB1+ M)+ /.8"*+ .)"+ 45,(4)"+ -)+ $08""7#)+ )#+ .3%D#)(#7%(+ -38()+ &$%"")"")+ ,/$'"+ 8()+ /$%4$0,#7%(+C0-74,.)C)(#+,""7"#0)+ENOPF+"%(#+-7C7(80)"1+H)"+/,#7)(#)"+"%(#+$0"7"#,(#)"+,8Q+ &%(,-%#$%/57()"+ )#+ .,+ $0/%(")+ %K,$7)(()+ R+ .,+ "#7C8.,#7%(+ )"#+ "%8K)(#+ C0-7%4$)1+ 2)+ -G"6%(4#7%(()C)(#+%K,$7)(+45)I+-)"+6)CC)"+%D'")"+")+C,(76)"#)+0&,.)C)(#+/,$+-)"+#,8Q+ /.8"+ D,"+ -3POS+ )#+ -3=(57D7()+ <*+ -)8Q+ C,$J8)8$"+ -)+ 4)..8.)"+ -)+ .,+ &$,(8.%",+ J87+ $)6.'#)(#+ .3,4#7K7#0+%K8.,#%7$)+-)+.3%K,7$)+>?@T*?@UB1+23,(,.G")+-38(+$)&7"#$)+M,(%7"+"8$+/.8"+-)+?U*@@@+ 4%8/.)"+,+C%(#$0+8(+.7)(+)(#$)+.37(-74)+-)+C,"")+4%$/%$)..)+)#+.35G/%6)$#7.7#0+>?@VB1+M)+/.8"*+ .)"+#,8Q+-)+45%.)"#0$%.+.7D$)+"%(#+/%"7#7K)C)(#+4%$$0.0"+,8+-0.,7+C%G)(+-3%D#)(#7%(+-38()+ 4%(4)/#7%(+E0#8-)+!"#$F+>TB1+ 23%D0"7#0+ )#+ .)+ "G(-$%C)+ C0#,D%.7J8)+ "%(#+ 6$0J8)CC)(#+ .70"+ ,8+ "G(-$%C)+ -)"+ %K,7$)"+ /%.GWG"#7J8)"+ E9XNYF+ >?@Z*?[@B*+ )#+ 4%("#7#8)(#+ .,+ 4,8")+ .,+ /.8"+ 6$0J8)(#)+ -3,C0(%$$50)*+ #%845,(#+ /$'"+ -)+ [@;[L\+ -)"+ 6)CC)"+ >?[[]?[AB1+ =."+ /,$#,&)(#+ -)"+ /)$#8$D,#7%("+C0#,D%.7J8)"+4%CC8()"*+.70)"+,8+"8$/%7-"+)#+R+.37("8.7(%;$0"7"#,(4)+>?[?B1+^(+ )66)#*+.)+"G(-$%C)+C0#,D%.7J8)+)"#+/$0")(#+45)I+?A\+-)"+9XNY+"%7#+_+6%7"+/.8"+0.)K0+J8)+.,+ /%/8.,#7%(+&0(0$,.)*+)#+.3%D0"7#0+)Q7"#)+45)I+L@;U@\+-)"+6)CC)"+,K)4+8(+9XNY+>VB1++ 2,+/$0")(#,#7%(+4.7(7J8)+-)+4)+"G(-$%C)+$)"#)+#$'"+50#0$%&'()1+2)"+#$%7"+/$7(47/,.)"+ C,(76)"#,#7%("+"%(#+.3,(%K8.,#7%(*+.)"+%K,7$)"+/%.GWG"#7J8)"+)#+.35G/)$,(-$%&0(7)1+O,.&$0+",+ /$0K,.)(4)+,44$8)*+.30#7%.%&7)+-8+9XNY+$)"#)+C04%((8)1+237("8.7(%;$0"7"#,(4)+E=:F+")CD.)+8()+ /7"#)+ C,`)8$)+ -,("+ .,+ /5G"7%/,#5%.%&7)+ >?[LB1+ 23=:+ /)8#+ ,8&C)(#)$+ .,+ "G(#5'")+ -)"+ ,(-$%&'()"+ /,$+ .)"+ Ha*+ 7(6.8)(b,(#+ ,.%$"+ .,+ "#0$%c-%&)('")+ )#+ D.%J8,(#+ .30K%.8#7%(+ -)+ .,+ 6%..748.%&)('")+ >?_AB1+ 2)"+ /$%-87#"+ -)+ &.G4,#7%(+ .70"+ R+ .37("8.7(%+ $0"7"#,(4)+ )#+ .3%D0"7#0+ ,66)4#)(#+0&,.)C)(#+.)"+Hd+)(+C%-767,(#+.3,4#7%(+-)+.,+2S*+)#+)(+7(-87",(#+.,+"04$0#7%(+-)"+ C,$J8)8$"+7(6.,CC,#%7$)"1+H).,+4%(-87#+R+.37()6674,47#0+-)+.,+6%..748.%&)('")+)#+.3,.#0$,#7%(+ -)+%K8.,#7%(+>?[UB1+M)+/.8"*+.)"+%K%4G#)"+7""8"+-)"+6)CC)"+,K)4+8(+9XNY+"%(#+-)+/.8"+/)#7#"+ )(+#,7..)1+ e()+,(%C,.7)+-,("+.)+C0#,D%.7"C)+.7/7-7J8)+/)8#+-%(4+,.#0$)$+.,+6%(4#7%(+%K,$7)(()1+ e(+4%(#)Q#)+-3%D0"7#0*+7(-87#+/,$+8()+,.7C)(#,#7%(+$745)+)(+45%.)"#0$%.*+$0-87#+.3%K8.,#7%(+)#+ .,+J8,.7#0+%K%4G#,7$)+45)I+.,+"%8$7"+>?[VB1+2)"+6%..748.)"+-,("+.)"+%K,7$)"+-)+4)"+"%8$7"+"%(#+ --! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$% &!'!('()*#+$% ,-./01% 2+% $(3+$$% '456&()7% $+89"+% :(3+% ;<&"+8+=(% &#<8+=(;% 6&=$% "+$% '>'?5(+$%6+$%$'#3)$%'9@$+$%+=%")+=%&>+?%#=%6;7&#(%8)('?A'=63)&"%,-BC01% D#%=)>+&#%8'";?#"&)3+E%6+$%$'#3)$%7+8+""+$%!"#$%&%%FGH2%9&$$+I%!3;$+=(+=(%#=%6;7&#(% 6+%$(;3'J6'<+=@$+E%?&3&?(;3)$;%!&3%#=+%3;6#?()'=%6#%='893+$%6+%!+()($%!&3%!'3(;+%&)=$)%*#+% 6+$% &='8&")+$% !"&?+=(&)3+$% ,-B.01% H+% !"#$E% 6+$% $'#3)$% '(")%&%* $'=(% $(;3)"+$% &>+?% #=+% 6)8)=#()'=% 6+$% (% 6K+$(+3$% 6+% ?A'"+$(;3'"% 6&=$% "K'>&)3+E% 6+$% &='8&")+$% 6&=$% "K+8935'<+=@$+%+(%"K)8!"&=(&()'=%&>+?%?+!+=6&=(%#=%(%6+%!3'<+$(;3'=+%='38&"%,-BB01%L+$% &='8&")+$% $'=(% !3)=?)!&"+8+=(% ");+$% M% "K&#<8+=(&()'=% 6+% (% 6+% ?A'"+$(;3'"% ")93+% +(% $'=(% 3;>+3$)9"+$%"'3$*#+%?+$%(%$'=(%='38&")$;$1%N;?+88+=(E%#=+%;(#6+%&%8'=(3;%*#K#=%+4?@$% 6+%?A'"+$(;3'"%&77+?(+%"&%8;)'$+%6+$%'>'?5(+$%?A+O%"+$%$'#3)$%'(")%&%%'#%"+$%$'#3)$%$&#>&<+$% ='#33)+$% 6K#=% 3;<)8+% 3)?A+% +=% ?A'"+$(;3'"% ,-BP01% 2K'>'?5(+% 6+$% $'#3)$% '(")%&%% +$(% 3)?A+% +=% ?A'"+$(;3'"%+(%)"%;?A&!!+%M%"K&33:(%6+%"&%8;)'$+%F+=%8;(&!A&$+%QQI%+(%3+!3+=6%$!'=(&=;8+=(%"&% 8;)'$+% &>+?% "K+4!#"$)'=% 6#% 6+#4)@8+% <"'9#"+% !'"&)3+1% L+% 8;?&=)$8+% +4!")*#+% "&% $(;3)")(;% 6;>+"'!!;+%!&3%?+$%8'6@"+$1% LA+O%"&%7+88+E%"K&=&"5$+%6+$%!&()+=(+$%)=7+3()"+$%&%3;>;";%6+$%!'"58'3!A)$8+$%$#3%"+$% =#?";'()6+$%FRSTI%6+%RLDNU.%F'#$+,-.,(*(,#,/01(*#2$33*4*05/,6*?'=$'")6&=(%"+%")+=%+=(3+%"+% ?A'"+$(;3'"E% $'=% 3;?+!(+#3% +(% "&% 7+3()")(;1% H&=$% #=+% &#(3+% ;(#6+E% "+$% (% 6+% GH2% +(% DTVW.% 6&=$% "+% ")*#)6+% 7'"")?#"&)3+% 3+?#+)"")% "'3$% 6K#=+% XQY% F7;?'=6&()'=% 7-* +70(1I% $'=(% ?'33;";$% =;<&()>+8+=(%&#%6;>+"'!!+8+=(%+8935'==&)3+%!3;?'?+E%+(%6'=?%M%"&%*#&")(;%6+%"K'>'?5(+% ,-CP01% D#% 7)=&"E% "+$% ?'=(+4(+$% 8;(&9'")*#+$% &$$'?);$% M% "K'9;$)(;E% "&% 65$")!)6;8)+% +(% "+% $5=63'8+%8;(&9'")*#+%$'=(%+=%")+=%6)3+?(%&>+?%"&%!A5$)'!&(A'"'<)+%'>&3)+==+%+(%"+$%?A&=?+$% 6+% 7;?'=6)(;1% 2+$% 7+88+$% )=7+3()"+$% $'=(% !&37')$% &8+=;+$% M% $+% ('#3=+3% >+3$% "&% TZD% *#)% ?'=$()(#+%#=+%>;3)(&9"+%'!!'3(#=)(;%!'#3%"K'9(+=()'=%6K#=+%<3'$$+$$+1% !" #$%&$'()*%+,-'.*&(/010+),233*3)'0, [=% ?&$% 6+% $(;3)")(;% '#% &9$+=?+% 6+% <3'$$+$$+% $!'=(&=;+E% #=% 3+?'#3$% >+3$% "&% TZD% !+38+(% $'#>+=(% "K'9(+=()'=% 6+% <3'$$+$$+1% 2&% XQY% F89#1-:$071-* 7-* +70(1I% +(% "KQLRQ% F7-0($* #501/2$3;7<=,* 3/,(;* 7->,#071-I% $'=(% 6+$% !3'?+$$#$% =;?+$$)(&=(% #=+% $()8#"&()'=% '>&3)+==+% ?'=(3\";+E%!'#3%)=6#)3+%#=+%?3')$$&=?+%7'"")?#"&)3+%+(%!'#3%'9(+=)3%#=%='893+%$&()$7&)$&=(%6+% 7'"")?#"+$% 8&(#3+$% +(% !+38+((3+% &)=$)% #=+% ?'""+?()'=% 6K'>'?5(+$1% L+$% 7'"")?#"+$% $+3'=(% !'=?()'==;$%+=%$#)(+%!'#3%3+()3+3%"+$%'>'?5(+$E%*#)%$+3'=(%7;?'=6;$%!&3%6+$%$!+38&('O'J6+$% -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"# $!%&'!" #$%&'()*+" ,(-.%+/0+/" 1+" 2-3%4*,,%&%+/" .0/5.605.0+/" .%(0" %+.15/%" /(0+.6-(-" 20+." 4$1/-(1.",*1("4$5&,40+/0/5*+!"" #*(." 2%" 40" 789:" 40" (-,*+.%" ;*(&*+04%" 01<" =*+02*/(*,;5+%." %./" /(>." 30(50'4%" %/" 25665?54%"@",(-25(%!"A44%",%1/".$0??*&,0=+%("2$1+%"(-,*+.%".0/5.605.0+/%:"*1"'5%+"5+02-B10/%" *1"%+?*(%"2$1+%";),%(./5&140/5*+"(%.,*+.0'4%"2$1+".)+2(*&%"2$;),%(./5&140/5*+"*30(5%++%" CDEFFG!" " !"# $%&'()*"# '+,%-"(./0*123/0)&# 453(0"&&"" *1" DEFF" CD30(50+" E),%(" F/5&140/5*+" F)+2(*&%G".%"?0(0?/-(5.%",0("40"45'-(0/5*+"2%".1'./0+?%."30.*0?/53%."03%?"1+%"0+=5*=%+>.%" ./5&14-%:" 1+%" ,%(&-0'545/-" 30.?1405(%" 0??(1%:" 1+%" (-,*+.%" ;*(&*+04%" %/" 5+640&&0/*5(%" %<0?%('-%."HIJIKIJLM!"N(O?%"01"&*+5/*(0=%"-?;*=(0,;5B1%:"4%."2*.%."2%."=*+02*/(*,;5+%." .*+/"(-020,/-%."01"?*1(."2%"40"./5&140/5*+";*(&*+04%",*1("-35/%("1+"DEFF".-3>(%!"P0+."4%." ?0."%&%" =-+-(045.-" C0.?5/%:" -,0+?;%&%+/" ,4%1(04G:" %/" 1+" ?;*?" ?0(25*30.?1405(%" HIJIKIJLM!" 70(" 0544%1(.:" ?%" .)+2(*&%" %./" 0..*?5-" @" 40" &0/1(0/5*+" 2$1+" +*&'(%" 5&,*(/0+/" 2%" 6*445?14%." 03%?" 1+%" ;),%(T./(*=-+5%!" #%." .5=+%." ?45+5B1%." .*+/" 30(50'4%." .%4*+" 40" .-3-(5/-" 2%" 4$;),%(./5&140/5*+" 2%" 4$*3140/5*+:" 0440+/" 2$1+" /0'4%01" 4-=%(" U1.B1$@"40",;0.%"?(5/5B1%:"03%?"?*440,.1."?0(25*30.?1405(%:"?;*?"%/"(5.B1%"/;(*&'*%&'*45B1%:" .%,.5."%/"0()/;&5%!" #0" ,(-304%+?%" 2%" 4VDEFF" %./" %./5&-" @" W:XYZ[" %+" 987" HIJLM!" \-0+&*5+.:" ?%//%" ,(-304%+?%" +%" (%64>/%" ,0." 4%" (5.B1%" ,*/%+/5%4" 2$DEFF" ?0(" ?%(/05+%." ,0/5%+/%." *+/" 1+%" .1.?%,/5'545/-"0??(1%"@"40"./5&140/5*+"%/"1+"(5.B1%"0??(1"2%"2-3%4*,,%&%+/"2%"?%".)+2(*&%:" +*/0&&%+/" 2%." 6%&&%." ,(-.%+/0+/" 1+" .)+2(*&%" 2%." *305(%." ,*4)Y])./5B1%." CFD7^G:" 4%." 6%&&%."U%1+%."*1"?%44%."03%?"1+"5+25?%"2%"&0..%"?*(,*(%44%"C_8`G"'0."HIJaM!" b+"&*+5/*(0=%"2%"40"./5&140/5*+"2%"4$*3140/5*+"C-?;*=(0,;5%"2%."*305(%."%/".1535"2%." ;*(&*+%." ?5(?140+/%.G" %./:" @" ?%" U*1(:" 4%" .%14" &*)%+" 2%" ,(-3%+/5*+" ?0,0'4%" 2$-35/%(" ?%." ?*+.-B1%+?%." ,*/%+/5%44%&%+/" =(03%." HIJaM:" ,15.B1$01?1+" &0(B1%1(" ,(*+*./5B1%" +$%./" 25.,*+5'4%!"" #0",;).5*,0/;*4*=5%"2$DEFF"+$%./",0."?*++1%"@"?%"U*1(c"1+%"0??1&140/5*+"5&,*(/0+/%" 2%." ?)/*]5+%." 30.*0?/53%." /%4." B1%" _#YZ" %/" .*+" (-?%,/%1(" C_#YZd(G"%/"eANf" 20+." 4%" 45B152%" 6*445?1405(%"0"-/-"?*+./0/-%"HIJgKIhJM!"#%."0+04*=1%."2%"fFE"01=&%+/%+/"40".)+/;>.%"2%"._#Y -.! ! ! ! ! ! ! ! !"#$%&'!()*!+,-'./0,!&'1&'2'34/053!56!4-'!1-72#51/4-585$7!56!59/&#/3!-71'&20.%8/053! 273:&5.'! ;<=++>?! !"#$%%&'$( )*+( $",-%./$( ,/$0&%,-%$%( 1-( &2#/$3%$0( '3%-3#4'$( 320( &2536631-/7( #71-8&2$%9( :)$%$( 6$0&31-/%( &2#/$3%$( '3%#.;3/( ,$/6$3<&;&17( 320( 5.&09( =2( ,3/3;;$;( )7,$/%$2%&4'&17( 1-( >?@( &2#/$3%$%( 1)$( 2.6<$/( -A( 631./342B( A-;;&#;$%9( *-6<&2$0( 32-63;&$%(/$%.;1(&2(C@??9( !"#$%&"'()*+',-+#."#/'&%'#01'2&)%1'3%&).01'4565!! ( ! ! "#$%#!&#!'())*+,)%+#! !"!#$%&#'()#*+#,()#-(..()#/#0%12#&3)41(#,56788#(2#,%9)#'()#.:,;'()#,(#):1&3)#,56788<#=(# >:.$'(?(# @=A!B)@=A!"!# )(.C'(# %1D.(92(&# '()# 2%1?# ,(# EF+G# "#$ %"&'(# HIJKL<# M(# $'1)N# '5%>>1.1'%23:9#,(#EF+G#()2#&(2&:1OP(#,%9)#'()#*+#(2#'(#23))1#>:9Q:9>23-#HIJRNISSL<#*0(T#'%# -(..(N#'%#EF+G#)(.C'(#39,1>23C'(#$%�*+#(2#$&:,132#$%&#'()#*+#HISIL<## *()# %&D1.(92)N# %39)3# 41(# '53.$'3>%23:9# ,()# O:3()# @=A!# (2# EF+G# :&3D39%3&()# ,()# *+N# )1DD;&(92# 41(# >()# >(''1'()# ):92# ,()# &PD1'%2&3>()# $&39>($)# ,(# '%# &P$:9)(# %1?# D:9%,:2&:$039()<#UP%9.:39)N#'()#.P>%93).()#.:'P>1'%3&()#3.$'341P)#,%9)#'5%>23O%23:9#(2#'%# $&:,1>23:9#,(#>()#>V2:W39()#9(#):92#$%)#,P.:92&P)#XG3D1&(#JKY<# !" #$%&'()'*(+*,-./)0,1'2340101(' =()# &P>($2(1&)# 91>'P%3&()# :&$0('39)# ):92# 3.$'341P)# ,%9)# '%# &PD1'%23:9# ,(# '%# $0V)3:':D3(#:O%&3(99(<#="7AZN#8GZ#(2#M[\AZ#):92#'()#$'1)#P21,3P)<#8GAZ#(2#M[\AZ#&PD1'(92#'%# )2P&:],:D(9;)(#,%9)#'()#*+#HIS^_ISRL<#="7Z#()2#(?$&3.P#/#2:1)#'()#)2%,()#,(#'%#>&:3))%9>(# -:''3>1'%3&(N#(2#19341(.(92#,%9)#'()#*+N#%>23O%92#'%#)2P&:],:D(9;)()#=()#):1&3)#39O%'3,P()#$:1&# ="7AZ# )$P>3-341(.(92# ,%9)# '()# *+# $&P)(92(92# 19# ,P-%12# ,5(?$%9)3:9# ,1# *+,+-+.# (2# ,(# '5:O1'%23:9N#(2#19#(?>;)#,5`)2&%,3:'#$%&#'5%1D.(92%23:9#,(#'5%>23O32P#*V$ZK[Z#HSKKL<#*:..(# >()# "U)N# '()# =\")# :92# P2P# &%&(.(92# P21,3P)# C3(9# 4153')# Q:1(92# $:1&2%92# 19# &a'(# ,%9)# '%# )2P&:],:D(9;)(#(2#'539-'%..%23:9N#,(1?#$&:>())1)#39,3)$(9)%C'()#$:1(#:O1'%23:9<## [39)3N# '()# =\")# $:1&&%3(92# >:9)2321(&# 19# '3(9# .:'P>1'%3&(# )1$$'P.(92%3&(# (92&(# 19# >:92(?2(# .P2%C:'341(# $(&21&CP# (2# '%# )2P&3'32P# >0(T# '%# -(..(<# =(1&)# &a'()# ,%9)# '%# -:9>23:9# :O%&3(99(#)(&:92#,P2%3''P)#b## !" #$%&'(()*+,'-,.)/0+1(,1'(,234(,10+(,.5*60)&', c(1#,5P21,()#:92#PO%'1P#'53.$%>2(#,()#=\")#)1&#'%#$0V)3:':D3(#:O%&3(99(<#@')#)(.C'(92# Q:1(&# 19# &a'(# 3.$:&2%92# ,%9)# '%# )2P&:],:D(9;)(N# '(# ,PO(':$$(.(92# -:''3>1'%3&(# (2# '%# .%21&%23:9#,(#'5:O:>V2(<# =\"#!#(2#/#):92#(?$&3.P)#%1?#,3--P&(92)#)2%,()#,(#'%#.%21&%23:9#-:''3>1'%3&(#>0(T#'%# ):1&3)d#'()#,(1?#3):-:&.()#):92#(?$&3.P()#,%9)#'5:O:>V2(#%O(>#'%#$&P,:.39%9>(#,(#'53):-:&.(# Ce2%##HJZNJJL<#*(22(#(?$&())3:9#()2#9(22(.(92#$'1)#P'(OP(#41(#'5(?$&())3:9#,(#>(2#3):-:&.(# ,%9)#,5%12&()#:&D%9()#(2#>(''(#,(#'53):-:&.(#%'$0%#,%9)#'5:O%3&(<## *0(T# '%# -(..(N# '()# ,(1?# 3):-:&.()# ,(# =\"N# 9:2%..(92# =\"/N#):92#(?$&3.P)#,%9)#'()#*+<#*(22(#(?$&())3:9#()2#39,132(#$%�*+#(2#Q:1(#19#&a'(#,%9)#'%# )2P&:],:D(9;)(#HJJNISfL<#UP%9.:39)N#'5(?$&())3:9#,()#=\")#,%9)#'()#%12&()#>:.$%&23.(92)# -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$ %#&$ '('$ '()*+',-$ .#/$ #+00,)/&1$ 223456$ ,&($ &+7!+8+9#(+:,;,!($ #99);)0'$ *#!&$ 0,$ 0+<)+*,$ 8=00+9)0#+/,-$ >,$ &('/=0$ ,&($ )!$ 0+7#!*$ 9=!!)$ *,$ ?@A1$ ,($ 9,&$ 9=!9,!(/#(+=!&$ &=!($ 0#/7,;,!($ #)7;,!(',&$%#/$0#$&(+;)0#(+=!$%#/$0,&$7=!#*=(/=%B+!,&$CDEF1DDGH-$ !" #$%&'()&'(*+#'(),-'(%./0,12&( ?"'()*,$ ;,!',$ %#/$ &(,88,!&,!$ ,($ !"#$ #$ +*,!(+8+'$ <),$ 0,&$ &=)/+&$ %&'()*+*$ &=!($ BI%=8,/(+0,&$ #:,9$ )!$ !=;J/,$ /'*)+(&$ *,$ %,(+(&$ %#/$ %=/(',-$ >,$ %B'!=(I%,$ ,&($ %0)&$ ;#/<)'$ *#!&$0,&$&=)/+&$%&')*+*$,($$%&'()*+*$CKLH$#$$M'#!;=+!&1$0,$!=;J/,$*,&$8=00+9)0,&$,&($+!*+88'/,!($ ,($0,&$=:#+/,&$9=!(,!#+,!($*,&$9=/%&$N#)!,&$O$0"P7,$*,$Q$;=+&1$&)77'/#!($)!,$=:)0#(+=!-$?#$ J#+&&,$*,$0#$8,/(+0+('$%=)//#+($*=!9$R(/,$,S%0+<)',$%#/$*,&$*'8#)(&$*#!&$0#$/,%/+&,$*,$;'+=&,$ *,&$=:=9I(,&$CDDLH-$ M=/;#0,;,!(1$ 0,$ %+9$ *,$ ?T$ &(+;)0,$ 0#$ /,%/+&,$ *,$ 0#$ ;'+=&,$ *#!&$ 0,&$ =:=9I(,&$ %/'3 =:)0#(=+/,&-$ >,($ ,88,($ ,&($ +!*+/,9($ ,($ 8#:=/+&'$ %#/$ 0"+!(,/;'*+#+/,$ *,$ 223456$ %/=*)+($ %#/$ 0,$ ,-.-"-/$00120'-/-$U,$%0)&1$223456$,&($/,&%=!&#J0,$*,$0#$%/=;=(+=!$*,$0"+;%0#!(#(+=!$*,$ 0",;J/I=!$CDDLH-$223456$&(+;)0,/#+($*=!9$)!$/'9,%(,)/$&)/$0"=:=9I(,$%=)/$+!+(+,/$0#$;'+=&,$ ,($?@A($#$'('$&)77'/'$9=;;,$9#!*+*#($CDF1DDKH-$?,&$?@A&$%=)//#+,!($*=!9$R(/,$*,&$8#9(,)/&$ +!(,/;'*+#+/,&$%,/;,((#!($0"#9(+=!$+!*+/,9(,$*,&$7=!#*=(/=%B+!,&$&)/$0"=:=9I(,1$!=(#;;,!($ %,!*#!($0#$;'+=&,-$V!$,88,(1$W/=!*#B0$,($!"#$=!($(,&('$34$536'0$0#$/,%/+&,$*,$0#$;'+=&,$*,&$ =:=9I(,&$,!(=)/'&$%#/$0,$,-.-"-/$,!$)(+0+&#!($2234561$,($*"#)(/,&$0+7#!*&$%0)&$%)+&&#!(&$*,$ ?@A$ (,0&$ <),$ KKA3BI*/=SI9B=0,&(,/=01$ LX3BI*/=SI9B=0,&(,/=01$ KQ3BI*/=SI9B=0,&(,/=0$ ,($ KY3 BI*/=SI9B=0,&(,/=0-$?#$/,%/+&,$*,$0#$;'+=&,$!"#$%)$R(/,$+!+(+',$<)"#:,9$223456$CDDEH-$ >,%,!*#!(1$6(,88,!&,!$#$*';=!(/'$0#$9#%#9+('$*,$ZI;=&('/=0$[223456$"378\$,($26T$O$ +!+(+,/$0#$/,%/+&,$*,$;'+=&,$*,$8#]=!$?@A3*'%,!*#!(,$^$,!$0"#J&,!9,$*,$?@A1$0"#9(+:#(+=!$*,$0#$ ;'+=&,$*,&$=:=9I(,&$/'9)%'/'&$*,&$&=)/+&$%&'()*+*$%#/$0#$26T1$ZI;=&('/=0$=)$W_EFXQ$,&($ #J=0+$CKLH-$A,(+/'$*,$0#$&=)/+&$&#):#7,1$0,$9=;%0,S,$9);)0)&3=:=9I(,&$9)0(+:'$#:,9$26T$#$'('$ #&&=9+'$ O$ )!,$ /,%/+&,$ *,$ 0#$ ;'+=&,$ ,($ O$ 0"#9(+:#(+=!$ *,$ %&'($ [#)7;,!(#(+=!$ *,&$ (#)S$ *,$ (/#!&9/+(&$ *,$ %&'($,($*,$9:,!;<$ ;#+&$ 0,&$ (#)S$ *,$ (/#!&9/+(&$ *,$ %&')$ &=!($ /,&('&$ &(#J0,&\-$ U,$ %0)&1$W_EFXQ1$)!$#7=!+&(,$&%'9+8+<),$*,$?@A$,&($9#%#J0,$*"+!*)+/,$0#$/,%/+&,$*,$0#$;'+=&,$ *#!&$0,&$=:=9I(,&$&#):#7,&$;R;,$,!$0"#J&,!9,$*)$,-.-"-/<$&)77'/#!($#+!&+$<),$0",S%/,&&+=!$ *,$?@A$*#!&$0"=:=9I(,$,&($'7#0,;,!($!'9,&&#+/,$%=)/$0#$;#()/#(+=!$*,&$=:=9I(,&$CKLH#$>,&$ =J&,/:#(+=!&$*';=!(/,!($<),$26T$;,($,!$N,)$*,&$;'9#!+&;,&$*#!&$0,&$9,00)0,&$*,$,-.-"-/$ [&'9/'(+=!$*,$456$,($#9(+:#(+=!$*,$?@A\$9#%#J0,&$*"+!*)+/,$0#$;'+=&,$(#!*+&$<),$0#$W_$#$)!$ -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !""!#$%&'!(#$)*'$+,-.-(/#!0$1++!)$)*223'!4#$%-4($5*!$+,!""!#$%!$678$!)#$#-#9+!:!4#$%;?0$ @9'$ 9&++!*')A$ +,;#*%!$ :!4;!$ <9'$ 4-#'!$ ;5*&?)$<-*'$+9$:;&-)!$ %!)$ -.-(/#!)$ !#$ +9$ ';2*+9#&-4$ %!$ +9$ "-++&(*+-2!43)!$ -.9'&!44!$ )-*)$ (-4#'J+!$ %!)$ 2-49%-#'- -.! ! ! ! ! ! ! ! D%&'(# I0&.3"/&# B-58'24'&58!4&/3215&4! D%=0&7$"# ?@# I# D&51-5E8/24!#37/2#53! *+,=# F&'',8/.12#/! *+,H# B-58'24'&58!! C5.'524/2#2! /3@! B534&/,08#4?! J/3'=-# !"#$%&'!()*!+,-'./0,!&'1&'2'34/053!56!4-'!&'21',07'!&58'2!56!9:;<=!9:;>!#3!57/&?=!%4'&%2! /3@!18/,'34/!1-?2#585$#'2A!!"#$%&'()#*+,-#.$"/'$0#1$/2#3"4$.'5"3#&"4#36$.'5"3#&.7%573-8#9-# 5"45.&/34# 5"# /23# /36/)# *+,:43;.53".(# 5"# <5.3# 03&4-# /$# =/3'5"3# 4(-/$.5&# 4=3# /$# .2$03-/3'$0# &..=<=0&7$"#5"#/23#<($<3/'5=<)#&"4#25>2#?@#03%30-#A5/2#2(B3'-3"-57%5/(#/$#>$"&4$/'$B5"-# C#DEFFG8# !"#$%&"'()*+',*-.#%'&%'#/0',*/&1-/#)'#2"'3&//-/#)'42"*1)52*/*678'9:;<8' ! ! "#$%#!&#!'())*+,)%+#! !" #$%&'()&'(*+#'(),-'(%./012/'(&0(%,(3%,4&-0,( !"#$%&#'(')(*&%*+&)(*,#&(#-)(%.)-$#)//)(0&,'')'')(1(23+4#)(252/)(6)-'$&#)/(0&72)( +#8( +2$9,-'( :)'( 3,&6,-)'( ,.+&9)--)'( ;<'$&,0=-)'( )$( *&,0)'$%&,-)>( '#&( /")-:,6=$&)( ;/+( 2,#23)( 9-$)&-)( :)( /"#$%&#'>?( @)$$)( *&%*+&+$9,-( *)&6)$( /"96*/+-$+$9,-( :#( A50,$)( '9( #-)( B%2,-:+$9,-(+()#(/9)#?(C)(*/#'D(/")-:,6=$&)(2,-'$9$#)(/)('9=0)(:)(/"%23+-0)(B<$,E6+$)&-)/( *+&(/"9-$)&6%:9+9&)(:#(*/+2)-$+(;B#'9,-(:#($&,*3,F/+'$)D(/)($9''#(B<$+/D(+.)2(/")-:,6=$&)>?(!)( 65,6=$&)()'$(/+(2,#23)(6#'2#/+9&)(4#9('#F9$(:)'(2,-$&+2$9,-'(/,&'(:"#-(+22,#23)6)-$?( G+&69(/)'(*+$3,/,09)'()-(/9)-(+.)2(/",F%'9$%()$(/)('5-:&,6)(6%$+F,/94#)D(/+(:5'$,29)( ;:%B+#$'( :)( 2,-$&+2$9/9$%( #$%&9-)( *)-:+-$( /"+22,#23)6)-$>( +BB)2$)( '90-9B92+$9.)6)-$( /)( :%&,#/)6)-$(:)(/"+22,#23)6)-$()$(/+(6,&F9E6,&$+/9$%(*%&9-+$+/)(HIIIDIIJK?(!",F%'9$%(9-:#9$)( 23)A(/)(&+$(*+&(#-(&%096)(35*)&2+/,&94#)()'$(+'',29%)(1(/"+22#6#/+$9,-(:)'($&+-'2&9$'(2,:+-$( :)'(0=-)'(9-B/+66+$,9&)'()$(1(#-)(*)&$#&F+$9,-(:)'(0=-)'(/9*9:94#)'D(-,$+66)-$(@CLMD(!G!D( )$( NOEPQ( :+-'( /"#$%&#'( HIIMK?( !"+22#6#/+$9,-( /9*9:94#)( :+-'( /"#$%&#'( )$( /",.+9&)( +( %$%( %0+/)6)-$( 2,-'$+$%)( :+-'( /)'( 6,:=/)'( :)( ',#&9'( +.)2( ,F%'9$%( )$( '5-:&,6)( 6%$+F,/94#)( ;',#&9'( ,FR,F( )$( :FR:F>( HIISK?( !"+#06)-$+$9,-( :)'( $+#8( :)( 23,/)'$%&,/( :+-'( /)'( 2)//#/)'( 6#'2#/+9&)'( :)( 65,6=$&)( &%:#9$( /+( 2,-$&+2$9/9$%( #$%&9-)( HIITDIIUK?( C)( */#'D( 9/( )89'$)( #-)( &%'9'$+-2)(&)/+$9.)(1(/",25$,29-)(2,-'$+$%)(23)A(/)'(B)66)'(,F=')'(+.)2(:)'(:,')'(+22&#)'( :",25$,29-)(-%2)''+9&)'(1(/"9-:#2$9,-(:)(/"+22,#23)6)-$(HIJVK?(( @)'( :,--%)'( '#00=&)-$( /"96*,&$+-2)( :)( /"3,6%,'$+'9)( /9*9:94#)( '#&( /)( B,-2$9,--)6)-$(:)(2)$(,&0+-)()$(%.,4#)(/+(*/+2)(:)'(!WX'(:+-'(/"#$%&#'?( !WX(!()$("(',-$()8*&96%'(:+-'(/")-:,6=$&)()$(/)(65,6=$&)?(!WX"()'$(96*/94#%(:+-'(/+( 2,-$&+2$9/9$%( :)( /"#$%&#'(Y( 9/'( &%0#/)-$( /)'( 0=-)'( 29F/)'(# $%&'(( )$# $%&)(( )$( *&%.9)-$( /"+22#6#/+$9,-(:)'()'$)&'(:)(23,/)'$%&,/(:+-'(2)$(,&0+-)?(!)'(',#&9'(*+,!"-.-()$(*+,"-.-(,-$( :,-2(#-)(+22#6#/+$9,-(96*,&$+-$)(:)'()'$)&'(:)(23,/)'$%&,/(:+-'(/)(65,6=$&)(+9-'9(4#)(:)'( +-,6+/9)'(:)(/"+22,#23)6)-$(:#)'(1(:)'(:%B+#$'(:)(2,-$&+2$9/9$%(#$%&9-)(;:5'$,29)(#$%&9-)>( +'',29%)'( 1( :)'( +-,6+/9)'( :)( &%*,-')( 1( /",25$,29-)( )$( 1( /"+-+/,0#)( :)( /+( *&,'$+0/+-:9-)( ;GZO[!>(HISK?(!WX()'$(:,-2(-%2)''+9&)(*,#&(%.9$)&(/"+22#6#/+$9,-(:)'(/9*9:)'(:+-'(/"#$%&#'()$( /)(&9'4#)(:)(:5'$,29)(#$%&9-)(;O90#&)(LV>?( ( !)(*/+2)-$+()'$(/",&0+-)(4#9(*)&6)$(/"%23+-0)(:)'(-#$&96)-$'D(:)'(3,&6,-)'()$(:)'( :%23)$'( )-$&)( /+( 6=&)( )$( /)( B<$#'D( )$( 2,-'$ $( #-)( F+&&9=&)( 2,-$&)( /)'( $,89-)'( *,#&( /)( *&,$%0)&?(C)(*/#'D(/)(*/+2)-$+()'$(#-(,&0+-)()-:,2&9-)(HIJ\K?(!)(23,/)'$%&,/()'$(-%2)''+9&)(1( -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"#$%&'()*(+,-.$,#/!"0,-%"1',#*2('1+1-,#3"%,'-,!!,4#5,#/!6$7#!,#08(!,$%&'(!#"9,0#*,$#"01*,$# +'"$#,$$,-%1,!$#$(-%#1-*1$/,-$":!,$#"6#*&9,!(//,3,-%#;<%"!7#,%#%'"9,'$,-%#*(-0#!"#:"''1.',# /!"0,-%"1',4# ="'31# !,$# /"%8(!(+1,$# 3&%":(!1>6,$# !1&,$# "6# /!"0,-%"7# !"# /'&?&0!"3/$1,# ,$%# 6-,# 0(3/!10"%1(-#>61#";;,0%,#@A#*,$#+'($$,$$,$#BC@DEF#,!!,#/,6%#&9(!6,'#9,'$#!2&0!"3/$1,#"9,0#6-,# 3('%"!1%&# ;(,%(?3"%,'-,!!,# "00'6,# BC@GE4# H"# /'&?&0!"3/$1,# "//"'"I%# $(69,-%# *"-$# 6-# 0(-%,J%,#3&%":(!1>6,#K*1":.%,7#(:&$1%&L#,%#$,#3"-1;,$%,#/"'#6-,#8M/,'%,-$1(-#"'%&'1,!!,#,%# 6-,#/'(%&1-6'1,#BC@C7C@@E4#H21-9"$1(-#*,$#%'(/8(:!"$%,$#*"-$#!2,-*(3.%',#,$%#1-*1$/,-$":!,# /(6'#!"#/!"0,-%"%1(-#,%#!2&910%1(-#*,#0,%%,#0(3/!10"%1(-4#H"#/'&?&0!"3/$1,#'&$6!%,#*26-#*&;"6%# *,# /!"0,-%"%1(-# (6# *213/!"-%"%1(-# *,$# 9"1$$,"6J# ,-%',# !2,-*(3.%',# ,%# !,$# %'(/8(:!"$%,$4# N,%%,# $1%6"%1(-# 1-*61%# 6-,# 9"$(0(-$%'10%1(-# ',$/(-$":!,# *28M/,'%,-$1(-# BC@OE4# P!!,# ,$%# $(69,-%#"$$(01&,#Q#6-,#"%8&'($,#"1+R,7#6-,#$1%6"%1(-#1*,-%1>6,#Q#!2"%8&'($0!&'($,#0!"$$1>6,# BC@SE4# 5,$#%"6J#*,#H5H#(JM*&,$7#>61#$(-%#/'&$,-%$#*"-$#!,#0"$#*,#$M-*'(3,#3&%":(!1>6,#'&*61$,-%# !21-9"$1(-#*,#0,$#9"1$$,"6J#BC@TE4#N,%%,#(:$,'9"%1(-#',-;('0,#!,#!1,-#$6++&'&#,-%',#!2(:&$1%&# ,%#0,%%,#0(3/!10"%1(-7#-&"-3(1-$7#"6#-19,"6#3(!&06!"1',7#!,#'U!,#*,#HVW#',$%,#Q#3,%%',#,-# &91*,-0,4# HVW!#,%#"#$(-%#,J/'13&$#%U%#*"-$#!,#/!"0,-%"#KS#X(6'$#/($%?0(1%63#08,Y#!"#$(6'1$7#O# $,3"1-,$# *,# +,$%"%1(-# 08,Y# !"# ;,33,L4# N,%%,# ,J/',$$1(-# "6+3,-%,# "6# 0(6'$# !"# +'($$,$$,# X6$>62Q# !"# ;1-# BC@Z7CO[E4# 5,# /!6$7# !,$# 0(-0,-%'"%1(-$# *2(JM$%&'(!$7# -(%"33,-%# !,# D@? 8M*'(JM08(!,$%&'(!# $,# 3"X(',-%# *"-$# !,# /!"0,-%"# BO@E4# \!# /,6%# "!('$# 0(-$%1%6,'# 6-,# $(6'0,# /(6'#!"#$%&'()*(+,-.$,4#5,#/!6$7#/!6$1,6'$#+.-,$#01:!,$#*,#HVW#K!,$#]^N$L#$(-%#13/!1>6&$#*"-$# !,#%'"-$/('%#3,3:'"-"1',#*6#08(!,$%&'(!#"6#-19,"6#*,$#%'(/8(:!"$%,$#BC[CE4#\!#,$%#/($$1:!,# >6,#!2"0%19"%1(-#*,$#HVW$#/"'%101/,#Q#!2&!131-"%1(-#*,$#(JM$%&'(!$#-(01;$4# 5"-$# !,# /!"0,-%"7# !2"0%19"%1(-# *,# HVW"# ',*61%#!"# *1;;&',-%1"%1(-# ,%# !_1-9"$1(-#*,$#%'(/8(:!"$%,$# BD@7CO`E4# H,# a[Z# ,%# !,$# H5H# (JM*&$# K'108,$# ,-# (JM$%&'(!$L# '&*61$,-%#$1+-1;10"%19,3,-%#0,%%,#1-9"$1(-#BC@TE4#b-,#&%6*,#$6'#!,#/!"0,-%"#863"1-#"#3(-%'&# >6,# #$%!& ,%# '()'*# $(-%# $6',J/'13&$# *"-$# !,$# /!"0,-%"# /'(9,-"-%# *,$# ;,33,$# "M"-%# /'&$,-%&# 6-,# /'&?&0!"3/$1,7# *,# /!6$7# !28M/(J&31,# /,6%# "0%19,'# #$%!# ,%# '()'*& BCO[E4# b-,# "6%',# &%6*,# "# 3(-%'&# 6-,# *131-6%1(-# *2,J/',$$1(-# *,# HVW"# *"-$# !,# /!"0,-%"# *,$# ;,33,$# $(6;;'"-%# *26-,# /'&?&0!"3/$1,# BCODE4# N,$# *(--&,$# $6++.',-%# !213/('%"-0,# *,$# *,6J# 1$(;('3,$#*"-$#!"#/8M$1(/"%8(!(+1,#*,#/'&?&0!"3/$1,4# -.! ! ! ! ! ! ! ! ! ! "#$%#!&#!'())*+,)%+#! !"# "$%&'(%# )*"'# +,-.'# /'# 012# 3.4'"/$).,"# $%# 56789:# (# ;<;# /;+=,<# /("># .'># <=$?@$-.(><'>A#+(?(-.'#/'#-.$B%'=#.'%=#?$%&$,=#,"&(>,C#DE9FAEGHIJ#5'#)*"'#'><#%"#KLMN!#B%,# '><#>%='O?=,P;#/(">#.(#?=;N;+.(P?>,'#DEGEIJ#2;+'PP'" -.! ! ! ! ! ! ! ! ! ! "#$#%&'(!)&*+#',! ! ! ! ! ! ! ! "#$%&'!()*+,!"$-#&+-.-$!$%&+#/+!0!1#2#)*$3!4*%5#$+!! ! -.! ! ! ! ! ! ! ! ! ! "#$#%&'(!)&*+#',! !"#$%&'()*+,'!#-"%+-.-#'#$%+"/+'0'1"2")*#3'4*$5"#+'' ! "#$%&'&#(!)**$+#,!-./!0*!1%$2+3!4045')#&02!)26!&#,!4%$7)'$2+$!&,!4%04)8)#&28!,&2+$!*05%! #0! *&7$! 6$+)6$,! 9:;$,&#(! )26! ?$#)>0'&+! ,(26%0?$! &,! &2! 4)%)''$'! 4%08%$,,&02!9@A.;$,&#(!)26!'&4&6!6&,0%6$%,!9EAF;'$!#0!%$85')#$!$$%!6&%$+#'(!0%!&26&%$+#'(!#3$! '&4&6! 30?$0,#),&,! )26! #$,#&+5')%! 43(,&0'08(! I4'$),$! %$*$%! #0! +3"' *"6-"7' )*+-#8"9:J%)2$!'&4&6!%$+$4#0%,!,5+3!),!KLMK-!)26!"NOL-!4')(!)2!&?40%#)2#! %0'$!&2!*$%#&'&#(!9:-EA@PPA@EE;'&8)#$! 4$%?&,,&7$! 3$#$%06&?$%! H! N$#&20&6! R! N$+$4#0%,! 0%! NRN,A! )26! >&26! SGK! ,$T5$2+$,! 0%! %$,402,$! $'$?$2#,!#3)#!)%$!4%$,$2#!&2!#3$!4%0?0#$%,!0*!#)%8$#!8$2$,%)2$!'&4&6!%$+$4#0%,!IKLMK-!)26!"NOL-J$! 45#)#&7$!?0'$+5')%!+)26&6)#$,!#0!+022$+#!+30'$,#$%0'!?$#)>0'&,?!#0!802)6!43(,&0'08(05#!#3$!%$,4$+#&7$!%0'$,!0*!$)+3!%$+$4#0%A!>5#!?)2(! )*+,--./2$$6!#0!>$!,0'7$6,$2+$!0*!)2!&,0*0%?!0*!QRN!&,!+0?4$2,)#$6!>(! #3$! 0#3$%! H! 20! $7&6$2#! 43$20#(4$! &2! #3$! #$,#&,! )26! #3$! 07)%(! 0*! !"#$'('! )26! !"#&'('0/ M02,$T5$2#'(A!#3$,$!?&+$!%$?)&2!*$%#&'$!9-XAP-; -.! ! ! ! ! ! ! ! ! ! "#$#%&'(!)&*+#',! !"#$ %&!!#'($ ()*!"#(+,#$ -./$ 0"+1"$ +($ *#1#((&')$ 23'$ 2#4&%#$ 23%%+15%36#*#(+($ &*7$ 331)!#$ 7#8#%394#*!:$ ;<=!$ 734+*&!#($ +*$ !"#(#$ !03$ 1#%%$ !)9#($ &*7$ !"#$ 9"#*3!)9#($ '#%&!#7$ !3$ +!($ &>(#*1#$(##4$%+9+7?13''#%&!#7$@AB/.A/CDBE:$ F3$5*7#'(!&*7$!"#$#G&1!$9")(+3%36+1&%$'3%#($32$;<=!$+*$!"#(#$1#%%(/$+!($9&'!+1+9&!+3*$+*$ !"#$4&+*!#*&*1#$32$2#'!+%+!)$&*7$+!($!"#$+49&1!$+*$!"#$(!#'+%+!)$32$4&%#$&*7$2#4&%#$"#$%!&'&$ 4+1#/$0#$&*&%),#7$&$!'&*(6#*+1$435(#$437#%$'#?#G9'#((+*6$;<=H$+*$!"#$I#'!3%+$&*7$6'&*5%3(&$ 1#%%($ +*$ 4&%#$ &*7$ 2#4&%#$ 4+1#$ '#(9#1!+8#%):$ F"+($ (!'&+*$ 0&($ 6#*#'&!#7$ >)$ &77+!+8#$ !'&*(6#*#(+(/$ &*7$ !"#$ (9#1+2+1$ #G9'#((+3*$ +*$ !"#(#$ !03$ 1#%%$ !)9#($ 0&($ 3>!&+*#7$ !"&*J($ !3$ "54&*$KLM$9'343!#'/$0"+1"$+($2'#N5#*!%)$5(#7$+*$4+1#$@COP/CQRE:$1STK$#*137+*6$;<=!$0&($ +(3%&!#7$ &*7$ 95'+2+#7:$ F"#$ KLM$ 9'343!#'$ (#N5#*1#$ 0&($ +*(#'!#7$ >#23'#$ ;<=!( (#N5#*1#$ (#9&'&!#7$>)$&*$+*!'3*$7#'+8#7$2'34$H?6%3>+*$(#N5#*1#:$U%&6$137+*6$(#N5#*1#$0&($+*(#'!#7$ 0+!"+*$!"#$!'&*(6#*#$!3$#*&>%#$+!($+7#*!+2+1&!+3*:$F"#$!'&*(6#*#$0&($!'&*(2#''#7$!3$&$43*3? 1#%%5%&'$ "#$%!&'&$ #4>')3$ >)$ 4+1'3+*V#1!+3*$ !"#*$ '#?+49%&*!#7$ +*$ 9(#573?9'#6*&*!$ 435(#$ 2#4&%#:$F"#$959($+((5#7$2'34$!"+($6#(!&!+3*$&'#$*&4#7$"#$%!&'&)*+,"#$!:$F"#)$("35%7$'#? #G9'#(($;<=H$0+!"+*$I#'!3%+$&*7$6'&*5%3(&$1#%%(:$$ F"+($435(#$437#%$+($32$9&'!+15%&'$+*!#'#(!$9#'4+!!+*6$!"#$(!57)$32$&*$+(323'4$32$;<=$+*$ &$(9#1+2+1$1#%%$!)9#$&6&+*(!$&$6%3>&%$7)(25*1!+3*&%$()(!#4$W$J*31J$35!$23'$;<=$X:$ !" #$%&'()*+,-+.-)/$-)$0)*1&'(2-3/40*+'+%4-54-67#!-8!2)*1'$-9:- F"#$(!57+#($2315(#7$3*$;<=($+*$!"#$!#(!+($134#$2'34$35'$&*7$!03$3!"#'$!#&4(:$F"#$ 2#0$95>%+("#7$&'!+1%#($+7#*!+2+#7$!"#$9'+*1+9&%$'3%#($32$;<=($+*$!"#$!#(!+15%&'$9")(+3%36):$;<=%$ +($&$7+'#1!$4375%&!3'$32$(!#'3+7$()*!"#(+($0"+%#$;<=!$4&+*%)$'#65%&!#($%+9+7$"34#3(!&(+($+*$ I#'!3%+$1#%%(:$F"#$!#(!+15%&'$9"#*3!)9#$32$"#$%!&'&(+($1'30*#7$>)$%&!#$(!#'+%+!)$75#$!3$6#'4$1#%%$ %3((:$Y3*(#N5#*!%)/$(!#'+%+!)$+($1349%#G$&*7$3'+6+*&!#($2'34$45%!+9%#$7)(25*1!+3*([email protected]:$$ I#'!3%+$ 1#%%$ +($ !"#$ [1#*!'&%$ 2+65'#\$ 32$ !#(!+15%&'$ (!'51!5'#$ 23'4+*6$ &$ *5'(+*6$ *+1"#$ !3$ (5993'!$ (9#'4&!36#*#(+(:$ ;+9+7$ &11545%&!+3*$ +*$ !"#(#$ 1#%%($ +($ !"#$ 2+'(!$ #8+7#*!$ 9"#*3!)9#$ 0+!"+*$!"#$!#(!#($32$-#$%!&'&(4+1#$]2'34$A:^$43*!"($3%7_:$;+9+7$&11545%&!+3*$9'36'#((#($&*7$ %#&7($!3$!"#$7#(!'51!+3*$32$!"#$(#4+*+2#'35($!5>5%#(:$`!$135%7$>#$!"5($!"#$+*+!+&!+8#$32$25'!"#'$ &*34&%+#(/$0"+1"$&99#&'$9'36'#((+8#%)/$#(9#1+&%%)$&*7'36#*$7#2+1+#*1)$&*7$6#'4$1#%%$%3((:$$ - ;/$-(*<0-+.-)/*0-3(2)-+.-=+2>-(,('4?*,%-)/2$$-<+&0$-<+@$'0A-=*'@-)43$A-"#$%!&'&() *+,)"#$%!&'&-./0"#$!()12$2)34B- --! ! ! ! ! ! ! ! ! ! "#$#%&'(!)&*+#',! 1. !"#$#!%&$'(&) %"&) &*+$&,,'-.) #./) 01.!%'-.) -0) !"#$% '.) 2&$%-3') !&33,) -0) !"#&$'(' )*+,!"#$4) 2. #.#35(&)%"&)$&613#%'-.)-0)3'+'/)"-7&-,%#,',)'.)2&$%-3')#./)6&$7)!&33,4)) 3. ,%1/5)/'00&$&.%)2&$%-3')!&33)01.!%'-.,4) 4. #.#35(&)%"&)+#$#!$'.&)$-3&)-0)2&$%-3')!&33,)-.)%"&)#/8#!&.%)6&$7)#./)9&5/'6)!&33,4) 5. ,%1/5)%"&)0&$%'3'%5)'.)!"#&$'(')*+,!"#$%7'!&4) ) :$'&035;)<&)!"#$#!%&$'(&/)%"&)&*+$&,,'-.)#./)+"5,'-3-65)-0)9=>?%<'%"'.)%"&)%&,%',)-0) %"&) .&<) 7-1,&) ,%$#'.4% -.% /0/1) #./) 0.% /02#1) #.#35,',) -0) 2&$%-3') !&33,) #0%&$) %$&#%7&.%) <'%") @ABACDCE) '/&.%'0'&/) %"&) 9=>) %#$6&%) 6&.&,) '.) %"',) !-7+#$%7&.%) %"#%) $&613#%&) 3'+'/) "-7&-,%#,',4) !34$) $&F&*+$&,,'-.) '.) 2&$%-3') !&33,) $&,%-$&,) %"&) ,%$1!%1$#3) '.%&6$'%5) -0) ,&7'.'0&$-1,) %1G13&,H)3'+'/)I#!1-3&,)/',#++&#$)#./)6&$7)!&33)/&6&.&$#%'-.)/'7'.',"&,4)J1$%"&$7-$&;)<&) '/&.%'05)%"#%)9=>$%',).&!&,,#$5)%-)7#'.%#'.)%"&)"&7#%-F%&,%'!13#$)G#$$'&$)#./)%-)$&613#%&)%"&) +'%1'%#$5)6-.#/#3)#*',)KJ2L),&!$&%'-.M4)) 9=>)'.)2&$%-3')!&33,)'.031&.!&,),%&$-'/),5.%"&,',)G5)#)+#$#!$'.&)&00&!%)-.)9&5/'6)!&33,4)-.% /0/1)#./)0.%/02#1)K!-F!13%1$&)-0)2&$%-3')#./)9&5/'6)!&33,M)'/&.%'0'&/)5$678%#,)#)%#$6&%)0-$)2&$%-3') !&33,4) @"&,&)+-,'%'I&)&00&!%,)-0)9=>$)<'%"'.)2&$%-3')!&33,),1++-$%)6&$7)!&33)+$-3'0&$#%'-.4) N&I&$%"&3&,,;) ,+&$7'-6&.&,',) /&0&!%,) +&$,',%) /&,+'%&) 9=>$% $&F&*+$&,,'-.) '.) 2&$%-3') !&33,4)@"&,&)/&0&!%,)#$&)!"#$#!%&$'(&/)G5)3'+'/)#!!1713#%'-.)<'%"'.)6&$7)!&33,;)&,+&!'#335)'.) %"&),+&$7#%'/,4)O.3'P&)2&$%-3')!&33,;)*9:;<),&&7,)%"&)%#$6&%)6&.&)'7+3'!#%&/)'.)!"-3&,%&$-3) "-7&-,%#,',)'.)%"&,&)!&33,4) J1$%"&$7-$&;)<&)/&,!$'G&)#)+"&.-%5+&)<'%"'.)%"&)+&$'F%1G13#$),7--%")71,!3&)!&33,4) Q%) ',) !"#$#!%&$'(&/) G5) 3'+'/) #!!1713#%'-.) <'%"'.) %"&,&) !&33,) <'%") #G.-$7#3) #!%'.) K2RSM) &*+$&,,'-.)3&#/'.6)%-)/&0&!%,)'.)%"&)!-.%$#!%'3'%5)-0),&7'.'0&$-1,)%1G13&,4)) T&,+'%&;) 9=>$% +-,'%'I&) $-3&,) <'%"'.) 2&$%-3') !&33,;) !"#&$'(')*+,!"#$% 7'!&) $&7#'.) ,%&$'3&=%@"&)+&$,',%&.!&)-0),%&$'3'%5),166&,%,)%"#%)9=>,)<'%"'.)6&$7)!&33,)',)'./',+&.,#G3&)0-$) .-$7#3)0&$%'3'%54) -.! ! ! ! ! ! ! ! ! ! "#$#%&'(!)&*+#',! !" #$%&'$(')*#+',-'./&'012-3%$42'5&%%4'671.,5%&'89' !"#$%#&'()*+$',-%./0#-%1&',)&2$1.+'1$'!(,,'%3'#'$#$+'41.*0%4#-%1&'15'61-$1*%&' 3-%./0#-%1&' *$1-14103' 2/$%&6' .+2%4#00)' #33%3-+2' *$14$+#-%1&7' 8-' %3' 49#$#4-+$%:+2' ;)' +<#66+$#-+2' %&50#..#-1$)' $+3*1&3+' =%-9' %&4$+#3+2' *$1>%&50#..#-1$)' 4)-1?%&+3' #&2' "#31#4-%"+' 3/;3-#&4+3' @ABACABDE7' F9+' 40%&%4#0' *$+3+&-#-%1&' %3' "#$%#;0+' 5$1.' .%02' -1' 3+"+$+' 51$.3'=%-9'#34%-+3G'*0+/$#0'+55/3%1&G'./0-%*0+'1$6#&'5#%0/$+G'-9$1.;1+.;10%4'41.*0%4#-%1&3' #&2'3914?'@ABACABDE7'H+3%2+3G'%-'%3'#3314%#-+2'=%-9'#'9%69'&/.;+$'15'.#-/$#-%&6'5100%40+3'#&2' %&4$+#3+2' +3-$#2%10' 0+"+037' 8-' %3' *$+"#0+&4+' %3' +3-%.#-+2' -1' I7J>KL' @ABDE7' M#-%+&-3' =%-9' *10)4)3-%4'1"#$)'3)&2$1.+'NMO!,P'#$+'-9+'.13-'+<*13+2'-1'-9%3'3)&2$1.+'@ABQE7' F9+' *9)3%1*#-91016)' 15' !(,,' %3' )+-' /&?&1=&7' 8R>KG' %-3' $+4+*-1$' N8R>KS!P'#&2'TUVW' #44/./0#-%1&'#$+'2+-+4-+2'%&'-9+'5100%4/0#$'50/%2'15'-9+3+'=1.+&'@ABXCAYBE7'F9+3+'4)-1?%&+3' #$+'.13-0)'1$%6%&#-%&6'5$1.'6$#&/013#'4+003'NVOP7' O910+3-+$10' +<4+33' %&2/4+3' 3*1&-#&+1/3' .+%13%3' $+3/.*-%1&' #&2' 0+#23' -1' 3-+$%0%-)7' F9%3' 3%-/#-%1&' %3' 40+#$0)' 2+.1&3-$#-+2' %&' "#$%&'&( .%4+' @ABYE7' Z+' 41/02' +<*+4-' -9#-' -9+' 9)*14910+3-+$10+.%4' $10+' 15' R[S3' 41/02' -9/3' *$+"+&-' 4910+3-+$10' #44/./0#-%1&' %&' -9+' 114)-+3' #&2' *$+"+&-' #;&1$.#0' .+%13%3' $+3/.*-%1&7' W/$-9+$.1$+G' W,(' #&2' R(' .12/0#-+' 5100%40+'.#-/$#-%1&'#&2'*$%.+'-9+'.+49#&%3.3'&++2+2'51$'114)-+'.#-/$#-%1&';)'-9+%$'#4-%1&' 1&'-9+'4/./0/3'11*91$/37'!&+'15'-9+'*$%&4%*#0'.+49#&%3.3'%3'WW>\],'3+4$+-%1&G'=9%49'%3'#' R[S'0%6#&27'F9/3G'R[S3'3++.'&+4+33#$)'51$'114)-+'.+%13%3'$+6/0#-%1&7'' 8&'-9+'#;3+&4+'15'R[S3G'.+%13%3'$+3/.*-%1&'15')*#&'&'114)-+3'#5-+$'3-%./0#-%1&';)'W,(G' :).13-+$10' NWW>\],' +,-.P' 1$' VZYXKJ' %3' #;10%39+2' @B^E7' F9%3' 9%690%69-3' -9+' .+49#&%3.' 15' 9)*15+$-%0%-)'%&'-9+3+'.%4+7'' \1$+1"+$G'R[S3'#$+'#&-%>%&50#..#-1$)'#&2'$+6/0#-+'3-+$1%2'3)&-9+3%3G'41&3+_/+&-0)G' -9+)'#$+'3#5+-)'"#0"+3'#6#%&3-'+<#66+$#-+2'1"#$%#&'$+3*1&3+'2/$%&6'1"/0#-%1&7')*#!/&'&'.%4+' #$+' 41&3+_/+&-0)' 3+&3%-%"+' -1' 61-$1*%&3' #&2' 2+"+01*' 1"#$%#&' 9)*+$3-%./0#-%1&' 3)&2$1.+'N!(,,P'@B^GBBE7' `+3*%-+'3%6&%5%4#&-'$10+3'15'R[S3'%&'-9+'1"#$%#&'*9)3%1016)G'%-'%3'&1-'?&1=&'=9+-9+$' -9+3+' *9+&1-)*+3' #$+' 2%$+4-0)' 0%&?+2' -1' 114)-+3' 1$' #$+' 2/+' -1' 6$#&/013#' 4+00' 2)35/&4-%1&7' V$#&/013#' 4+003' $+6/0#-+' UB' 3)&-9+3%3' #&2' .+%13%3' $+3/.*-%1&' -9#&?3' -1' -9+' 3+4$+-%1&' 15' 1<)3-+$103' @B^GAA^E7' W/$-9+$.1$+G' .13-' 15' -9+' %&50#..#-1$)' 4)-1?%&+3' &+4+33#$)' 51$' 1"/0#-%1&' *$14+33' 3/49' #3' %&-+$0+/?%&3' #&2' TUVW' #$+' 3+4$+-+2' 5$1.' -9%3' 41.*#$-.+&-' -.! ! ! ! ! ! ! ! ! ! "#$#%&'(!)&*+#',! !"#$%"&"'()*+,-%)./)-,00/-1)1+21)345-)67)1+/)0827,9:-2);/99-)28/)2;1:8-)67)1+/)?21,8216:7) :>)1+/)::;=1/-)27@)67)1+/)8/-A:7-/)1:)0:72@:18:A67-() *+/)-1,@=):>)?6;/)8/B/CA8/--670)345!)67)1+/)0827,9:-2);/99-)D"#$%!&'&()*+"#$!,-./0E) 6-)1+,-)671/8/-1670)1:)F/11/8);+282;1/86G/)1+/):86067):>)1+/):H28627)A+/7:1=A/-() !"#$"%&'("&)#*&+,-'&./&'(01&2.-3&01&*0-"$'"*&'.4& 1. ;+282;1/86G/)1+/)/CA8/--6:7)27@)>,7;16:7):>)345!,67)1+/)0827,9:-2);/99-() 2. 2729=G/)1+/)8/-A:7-/):>)1+/-/)?6;/)1:)0:72@:18:A67-)D86-<):>)IJKK)@/H/9:A?/71E()) 3. 6@/716>=)345)1280/1)0/7/-)67)1+6-);:?A281?/71() 4. -1,@=)1+/)8/0,9216:7):>)-1/8:6@)-=71+/-6-) 5. 2729=G/):>)1+/)A282;867/)8:9/):>)0827,9:-2);/99-)67)1+/)8/0,9216:7):>)?/6:-6-() 6. 2729=G/):>)1+/)8:9/):>)345)67)1+/);,?,9,-)::A+:8,-)27@)61-)8:9/)67)1+/):H,9216:7() 7. /H29,21/)1+/)>/816961=)67)1+/-/)?6;/() 8. -1,@=)1+/)/CA8/--6:7)27@)2;16H61=):>)345-)67)1+/)0827,9:-2)9,1/67);/99-):>).:?/7) ,7@/80:670) ?/@6;299=) 2--6-1/@) A8:;8/216:7() *+6-) .699) +/9A) 1:) ;:88/921/) 1+/) 345) /CA8/--6:7) 27@) 2;16H61=) 1:) 1+/) 86-<) :>) IJKK) @/H/9:A?/71) >8:?) :7/) -6@/) 27@) 1+/) ?/6:-6-)8/-,?A16:7)27@)/289=)/?F8=:0/7/-6-):7)1+/):1+/8)-6@/() , 12, /32/456.32%) ./) @/?:7-1821/) 1+/) A6H:129) 8:9/) :>) 345) 67) 1+/) 8/0,9216:7) :>) 1+/) LM) A+=-6:9:0=)27@)6?A2;1)1+/):H28627)>,7;16:7)2-).+:9/()N1)6-)7/;/--28=)>:8)::;=1/)-,8H6H29)27@) 7:8?29)>/816961=()N1)6-)?:-1)A8:F2F9=)1+/)-+,119/)8/0,921670)OKJ)2;16:7):7)::;=1/)?/6:-6-)27@) -,8H6H29()N7)1+/)2F-/7;/):>)345P%)?:-1):>)1+/)A282;867/)>2;1:8-):>)1+/)LM)28/)@/8/0,921/@)27@) 1+/)LM)2@2A1216:7)>:8)0:72@:18:A67-)-//?-);:?A8:?6-/@()O,81+/8?:8/%)345P)6-)7/;/--28=) >:8)7:8?29);,?,9,-)/CA27-6:7)27@):H,9216:7()345P)6-)29-:)8/Q,68/@)1:)8/0,921/)LM)27@)1+/;2) ;/99) -1/8:6@) -=71+/-6-R) 67@//@%) ?:-1) :>) 1+/) 0/7/-) 6?A96;21/@) 67) -1/8:6@:0/7/-6-) 27@) 28:?216-216:7):>)1/-1:-1/8:7/)28/)@/8/0,921/@)67)1+/):H28=):>)"#$%!&'&()) S/-6@/-%) 345P) /CA8/--6:7) A8/H/71-) IJKK) @/H/9:A?/71) 67) :,8) ?:,-/) ?:@/9() O,81+/8?:8/%) ./) 1+67<) 1+21) .:?/7) 21) +60+) 86-<) >:8) IJKK) +2H/) 9:./8) 345) 2;16H61=() *+/-/) A9/:18:A6;)8:9/-):>)345)67)1+/)LM)?2/?29/)>/816961=)27@)1:) A8/H/71)IJKK() -.! ! ! ! ! ! ! ! ! ! "#$%&'$()%*&+,-'+./$! ! ! "#$%&!'(%)*!+,-./)-!(0&!'.1/$2()$30-! ! 456%$7$0(/! 4%)$2/,! 8*! 9&,0)$:$2()$30! 3:! )#,! ;.02)$30-! 3:! <$=,%! >! +,2,?)3%5@! $0! A,%)3/$! B,//-! C-$07!(!"(%7,),&!DE?%,--$305+,-2.,!F3&,/G! "#$%#&'! ()! *+! ,#--#-.! /0)! 1#23.&+! ")! 5.6778.&! *)! 9:;6%%8:4! <)! 14:=787! /)! >48:&&87!<)!>#:?6487!@)!58++6!A)!B8C#DD#48!E")!1#487!(F!! *7%8D4.78+8='F!GHIJ!A6DK!IJLMIGNOPJPJQJRF! ! H56%$7$0(/!4%)$2/,!I*!<>+@!,E?%,--$30!$0!)#,!7%(0./3-(!2,//-!$-!,--,0)$(/!:3%!03%J(/!3=(%$(0! ?#K-$3/37KG! ! "#$%#&'!63!!"#!@7!2462#4#3.87F! ! B5+,=$,L! (%)$2/,58*!602,! (0&! :3%! (//M! <>+N! (0&! <>+@! (%,! 7(),O,,?,%-! 3:! )#,! ,0&32%$0,! -K-),JG! "#$%#&'!()!>48:&&87!<)!>#:?6487!@)!58++6!A,)!1#487!()!B8C#DD#48!E "8+!<&26D3&!"6%F!GHIL!<24!IPF!2..O!(HHSTQGSSRMIJNUHHIRQHF! ! P5+,=$,L!(%)$2/,5I*!B#3/,-),%3/!(0&!J(/,!:,%)$/$)K*!L#()!(13.)!3%?#(0-!(0&!(&3?),&!Q! "#$%#&'!()!1#23.&+!")!56=#!<)!1#487!()!B8C#DD#48!E")!58++6!A,F! "8+!V6++!*7%8D4.78+F!GHIU!<24!IHKULTMIQGNOUHQPLF! 01! ! ! ! ! ! ! ! ORIGINAL RESEARCH Identification of the Functions of Liver X Receptor- in Sertoli Cells Using a Targeted Expression-Rescue Model Salwan Maqdasy,* Fatim-Zohra El Hajjaji,* Marine Baptissart, Emilie Viennois, Abdelkader Oumeddour, Florence Brugnon, Amalia Trousson, Igor Tauveron, David Volle, Jean-Marc A. Lobaccaro, and Silvère Baron Department of Génétique Reproduction et Développement (GReD) (S.M., F.-Z.E.H., M.B., A.O., F.B., A.T., I.T., D.V., J.-M.A.L., S.B.), Université Blaise Pascal, Centre de Recherche en Nutrition Humaine d’Auvergne (S.M., F.-Z.E.H., M.B., A.O., F.B., A.T., D.V., J.-M.A.L., S.B.), and Department of Assistance Médicale à la Procréation (F.B.), CECOS, Centre Hospitalier Universitaire Clermont Ferrand, Centre Hospitalier Universitaire Estaing, F-63000 Clermont-Ferrand, France; Centre National de la Recherche Scientifique (S.M., F.-Z.E.H., M.B., A.O., F.B., A.T., I.T., D.V., J.-M.A.L., S.B.) and INSERM (S.M., F.-Z.E.H., M.B., A.O., F.B., A.T., I.T., D.V., J.-M.A.L., S.B.), Unité Mixte de Recherche 6293, GReD, F-63177 Aubiere, France; Center for Diagnostics and Therapeutics (E.V.), Georgia State University, Atlanta, Georgia 30302–4010; Veterans Affairs Medical Center (E.V.), Decatur, Georgia 30033; Service d’Endocrinologie, Diabétologie, et Maladies Métaboliques (S.M., I.T.), Hôpital Gabriel Montpied, F- 63003 Clermont-Ferrand, France; and Service de Médecine Nucléaire (S.M.), Centre Jean Perrin, F-63011 Clermont-Ferrand, France Liver X receptors (LXRs) are key regulators of lipid homeostasis and are involved in multiple tes- ticular functions. The Lxr/;Lxr/ mice have illuminated the roles of both isoforms in main- tenance of the epithelium in the seminiferous tubules, spermatogenesis, and T production. The requirement for LXR in Sertoli cells have been emphasized by early abnormal cholesteryl ester accumulation in the Lxr/ and Lxr/;Lxr/ mice. Other phenotypes, such as germ cell loss and hypogonadism, occur later in life in the Lxr/;Lxr/ mice. Thus, LXR expression in Sertoli cells seems to be essential for normal testicular physiology. To decipher the roles of LXR within the Sertoli cells, we generated Lxr/;Lxr/:AMH-Lxr transgenic mice, which reexpress Lxr in Sertoli cells in the context of Lxr/;Lxr/ mice. In addition to lipid homeostasis, LXR is nec- essary for maintaining the blood-testis barrier and the integrity of the germ cell epithelium. LXR is also implicated in the paracrine action of Sertoli cells on Leydig cells to modulate T synthesis. The Lxr/;Lxr/ and Lxr/;Lxr/:AMH-Lxr mice exhibit lipid accumulation in germ cells after the Abcg8 down-regulation, suggesting an intricate LXR-dependent cooperation between the Sertoli cells and germ cells to ensure spermiogenesis. Further analysis revealed also peritubular smooth muscle defects (abnormal lipid accumulation and disorganized smooth muscle actin) and spermatozoa stag- nation in the seminiferous tubules. Together the present work elucidates specific roles of LXRin Sertoli cell physiology in vivo beyond lipid homeostasis. (Endocrinology 156: 4545–4557, 2015) iver X receptors (LXR and LXR, NR1H3, and lular cholesterol homeostasis (1). Many physiological LNR1H2, respectively) belong to a subclass of nuclear roles have been discovered using the Lxr/;Lxr/ receptors that are activated after binding to their ligands, mice, from lipid homeostasis to the regulation of glucose the oxysterols. They are classically implicated in intracel- metabolism or immunity (for review see reference 2). Both ISSN Print 0013-7227 ISSN Online 1945-7170 * S.M. and F.-Z.E.H. contributed equally to this work. Printed in USA Abbreviations: ABCG8, ATP-binding cassette transporters G8; BTB, blood-testis barrier; Copyright © 2015 by the Endocrine Society LXR, liver X receptor; PLIN1, perilipin; PTSM, peritubular smooth muscle cells; RT-qPCR, Received April 30, 2015. Accepted September 18, 2015. real-time quantitative PCR; SMA, smooth muscle actin; SOX9, Sry-type high-mobility- First Published Online September 24, 2015 group box transcription factor 9. doi: 10.1210/en.2015-1382 Endocrinology, December 2015, 156(12):4545–4557 press.endocrine.org/journal/endo 4545 The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. 4546 Maqdasy et al Roles of LXR in the Testis Endocrinology, December 2015, 156(12):4545–4557 isoforms are expressed in the testis and play a crucial role nization. These new mice provide a relevant model for in fertility (3–5). During adulthood, each isoform is pre- deciphering the additional roles of LXRs in the testis. dominant in a specific testicular cell type: LXR in Leydig cells, LXR in Sertoli cells, and both isoforms in germ cells. The Lxr/ mice are characterized by the decreased Materials and Methods steroidogenic activity of Leydig cells and increased germ cell apoptosis; the Lxr/ mice display cholesteryl ester Animals / / accumulation in the Sertoli cells, which is associated with The Lxr ;Lxr mice were kindly supplied by labora- tory of Repa and Mangelsdorf (10) and were maintained on a a decreased germ cell proliferation rate. Mice deficient for / / / mixed strain background (C57BL/6:129Sv). The Lxr ; both isoforms, Lxr ;Lxr , exhibit progressive tes- Lxr/:AMH-Lxr mice were generated in the local transgenic ticular degeneration with hypogonadism, germ cell deple- facility of Génétique Reproduction et Développement. All tion. and definitive infertility by 7–9 months old (3, 5). strains were fed ad libitum with the Global diet 2016S from LXR and LXR have complementary and/or redundant Harlan and maintained on a 12-hour light, 12-hour dark cycle. roles in the testis because the absence of one isoform is For the experiments, some mice were gavaged with 25 mg/kg T0901317 (Sigma-Aldrich) or vehicle (methyl cellulose), as de- partially compensated by the other; thus, the single knock- scribed previously (3). Other mice were injected with 20 mg/kg out mice are fertile with few obvious defects (3, 6). busulfan and euthanized 4 or 8 weeks later (11). All of the pro- Sertoli cells represent the central cell type of the testis tocols and experiments were approved by the regional ethics that support germ cell differentiation and modulate the committee and have already been published (3, 11). androgens that are necessary for this purpose (7). LXR expression in Sertoli cells is presumed to be essential for Generation of transgenic mice / / normal testicular physiology. Indeed, lipid accumulation The Lxr ;Lxr :AMH-Lxr mice were generated by in Sertoli cells is the earliest phenotype and appears by 1.5 additive transgenesis. As described in Supplemental Figure 1A, the transgene construct was linearized by HindIII/XhoI digestion months of age in the Lxr/ and Lxr/;Lxr/ mice; and microinjected into Lxr/;Lxr/-fertilized mouse it has been suggested as the central dysfunction in the testis oocytes. The eggs were retrieved from 3-month-old Lxr/; of these mice (3, 4). Likewise, a study of men with non- Lxr/ females. Before the eggs were harvested, the females obstructive azoospermia showed a significant decrease of were superovulated using a 48-hour delayed stimulation with LXR expression within the testis, which was associated pregnant mare serum gonadotropin (7.5 IU) and human chori- with fewer proliferating germ cells; this study further sup- onic gonadotropin (5 IU) and mated with 3-month-old Lxr/;Lxr/ males. The purified DNA was microinjected ports the pivotal role of LXR within the testis (8). using the Zeiss Transgenesis station Zeiss AXIOVERT 135 M. To gain further insights into the roles of LXR in Sertoli The oocytes that were microinjected with the transgene construct cells, we generated a mouse line that reexpresses Lxr only were transferred into pseudopregnant DBA/2 females. Southern in Sertoli cells in the Lxr/;Lxr / mice, using the blotting was used to detect the transgenic founders and the copy human AMH promoter (antimullerian hormone) (9). This numbers of the transgene, as depicted in Supplemental Figure 1, strain of mice, named Lxr/;Lxr/:AMH-Lxr, was B and C. Two founders, F0–1 and F0–2, transmitted the AMH- Lxr transgene. Based on real-time quantitative PCR (RT- compared with the wild-type and Lxr/;Lxr/ mice. qPCR) and western blotting analyses for transgene expression, Here we note the various fundamental roles of LXR in the F0–1 line was selected for further phenotypic investigations. Sertoli cell physiology and its implication in the structural integrity and endocrine functioning of the testicular Histology, immunohistochemistry, and tissue. Reexpression of LXR in the Sertoli cells of the immunofluorescence Lxr/;Lxr/ mice restores the structural architecture Staining with hematoxylin/eosin, Oil red O (Sigma-Aldrich), of the seminiferous tubules; the large lipid vacuoles dis- Ki67, and Azure 2 dye (Sigma-Aldrich and Agar Scientific) was appear and the integrity of the blood-testis barrier is re- performed on semithin sections, as previously described (3). Briefly, the tissues were fixed using 4% paraformaldehyde (Sig- established. Furthermore, LXR expression in Sertoli cells ma-Aldrich) and embedded in paraffin. For semithin sections, exerts a paracrine function on androgen synthesis by the the testes were fixed and postfixed as previously described (3). Leydig cells. Together these beneficial effects support the Terminal deoxynucleotidyl transferase-mediated deoxyuridine germ cell population and only a few degenerated tubules triphosphate nick end labeling assays were performed as de- are found with aging. In addition, we show that germ cells scribed (3). Antibodies against Flag (clone M2, F1804; Sigma- display persistent lipid vacuoles in the later stages of dif- Aldrich), Sry-type high-mobility-group box transcription factor 9 (SOX9; AB5535; Millipore), Ki67 (SP6, M3064; Spring Bio- ferentiation, and thus, they require Abcg8 expression as an science), smooth muscle actin (SMA; M0851; DAKO), perilipin essential LXR target gene to reestablish lipid homeostasis. (GP29; Progen Biotechnik), and ATP-binding cassette transport- This mouse model also reveals a peritubular smooth mus- ers G8 (ABCG8; NB400–110B; Novus Biological) were used cle phenotype with lipid accumulation and actin disorga- according to the manufacturers’ recommendations. The exper- The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. A D HindIII XhoI AMH promoter Flag mNr1h2 -glob int BGH PA Southern probe +/+ B Genetic background Construct Founders ID Copy numbers Establishment of lines C57BL/6:129Sv AMH-Nr1h2 2 F0-1 7 yes Nr1h3-/-:Nr1h2-/- F0-2 4 yes -/- C  Nr1h2-/-: -/-: Nr1h2-/- -/-;Lxr -/-:  AMH-Nr1h2 Nr1h3 Lxr +/+ F0-1 F0-2 Nr1h3 Southern blot Nr1h2-/-: -/-: Nr1h2 Nr1h2-/- -/-: Nr1h3AMH- +/+ Nr1h3 F0-1 F0-2 Northern blot  -/-:AMH-Lxr  -/-;Lxr  Lxr Supplementary Data S1 doi: 10.1210/en.2015-1382 press.endocrine.org/journal/endo 4547 iments were performed at least twice, with five to six mice per scribed (3). The primer sequences are reported in the Supplemental group, except for the Azure 2 dye staining (n  3). Information (Supplemental Table 1). The RT-qPCR products were analyzed using the ⌬⌬cycle threshold method for relative quantifi- Blood-testis barrier (BTB) integrity assay cation. The values were normalized to the 36b4 gene levels. The integrity of the BTB was analyzed in the wild-type, Lxr/;Lxr/,andLxr/;Lxr/:AMH-Lxr mice by an Statistical analysis intratesticular infusion of a biotin tracer, as previously reported (11, The data are expressed as the means Ϯ SEM. A one-way 12). Briefly, the testes of anesthetized mice were injected with the ANOVA was performed to determine differences between the qualitative TJ functional tracer biotin (10 mg/mL; EZ-Link Sulfo- various groups, and statistical analysis is indicated as follows: *, NHS-LC-Biotin; Pierce) in a volume of 10% of the weight of the P Ͻ .05; **, P Ͻ .01; and ***, P Ͻ .001. testis. They were then removed 30 minutes after the injection and directly fixed in 4% paraformaldehyde (Sigma-Aldrich). The pen- etration of the biotin tracer into the seminiferous lumen was visu- alized by fluorescence microscopy using Alexa-488 streptavidin- Results horseradish peroxidase (Invitrogen). The total number of tubes Lxr is specifically expressed in the Sertoli cells of with biotin penetration into the lumen of the seminiferous tubules / / (defective tubes) and the number of tubes with biotin retained near Lxr ;Lxr AMH-Lxr mice the basement membrane (intact tubes) were counted in a cross- To examine the effect of rescued expression of Lxr in section of the entire testis (n  6/group). the Sertoli cells of the Lxr/;Lxr/ mice, Lxr/; Lxr/:AMH-Lxr transgenic mice were generated by Percentage of histological destruction additive transgenesis using a linear construct, which con- For each animal (n  6), a complete histological analysis of tains the Flag-tagged Lxr cDNA driven by the human three entire sections of the testis (9 mo old) was performed by AMH promoter (Supplemental Figure 1A). This promoter hematoxylin and eosin staining. Microscopic destruction in- cluded vacuolated tubules, thin seminiferous epithelium, empty has been already used to successfully target Sertoli cell- tubules, and spermatozoa stagnation and were quantified for specific expression (9). Despite the altered hormone stim- each genotype. The percentage of each anomaly was evaluated in ulation for egg retrieval in the Lxr/;Lxr/ females relation to the total number of tubules per section. (16), two transgenic mouse founders were engineered (Supplemental Figure 1B). One strain was selected based Lipid measurements on the criteria of successful construct insertion, Lxr re- The lipids were extracted as previously described (3). Briefly, expression, and transgene transmission (Figure 1A and lipid separation was performed by high-performance thin-layer chromatography using silica plates (Silica gel 60; Merck). The Supplemental Figure 1C). The subsequent analyses on the plates were analyzed by densitometry (Sigma Scan Pro; Sigma- second strain revealed the absence of the transgene ex- Aldrich) using standards and migration solutions. pression, and thus, these mice were no longer used for the phenotypic investigations. LXR expression and activity Hormone measurements was confirmed in the Lxr/;Lxr/:AMH-Lxr The steroids were extracted from the testes as previously de- mouse testis by the accumulation of the 55-kDa Flag- scribed (13). The intratesticular T levels were measured using tagged protein (Figure 1B) as well as by induced transcrip- commercial kits (Diagnostic Biochem). The plasma FSH and LH levels were measured by a Milliplex MAP mouse pituitary mag- tion of Srebp1c and Abca1 (known LXR target genes) in netic bead panel (96-well plate assay MPTMAG-49K) based on response to T0901317 treatment (a synthetic LXR ago- the Luminex xMAP technology as previously described (14). nist) (Figure 1C) (2, 17). The specific accumulation of LXR in Sertoli cells was verified by coimmunolocaliza- Western blot analysis tion of the Flag epitope and SOX9 (Figure 1D), a Sertoli The proteins were extracted using HEPES 20 mM, NaCl 0.42 cell-specific marker (18). A careful analysis of the immu- M, MgCl 1.5 mM, EDTA 0.2 mM, and Nonidet P40 1% sup- 2 nohistochemistry in the Lxr/;Lxr/:AMH-Lxr plemented with phenylmethylsulfonyl fluoride 1 mM (Sigma- Aldrich), Complete protease inhibitors 1ϫ (Roche Molecular testis sections demonstrated Flag-LXR-positive staining in many or all of the Sertoli cells, suggesting that LXR Biochemicals), NaF 0.1 mM, and Na2VO3 0.1 mM (Sigma-Al- drich). The lysates were subjected to 10% SDS-PAGE and blot- expression was completely restored in this cell compart- ted onto a nitrocellulose membrane (Amersham Pharmacia Bio- ment (Supplemental Figure 1D). Flag-LXR labeling was tech). Antibodies against FLAG, which were used to detect the restricted to the testis and ovary, consistent with the en- transgene (F7425, Sigma-Aldrich) or -actin (A2066; Sigma-Al- dogenous AMH promoter activity (Figure 1E). A devel- drich) were used as previously described (15). opmental analysis of transgene expression in the testis Quantitative PCR showed that it was expressed upon 14.5 days post coitum, The testis RNA was isolated using the RNeasy kit (QIAGEN) which was later than endogenous Lxr but was robustly and quantifications were performed by RT-qPCR as previously de- expressed (7 and 15 days post partum) and persisted The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. 4.0 +/+ Lxr-/-;Lxr-/-:AMH-Lxr 4.0 3.0 +/+ Lxr-/-;Lxr-/-:AMH-Lxr 3.0 2.0 Nr1h2 relative expression 2.0 1.0 Nr1h2 relative expression 0 1.0 12.5dpc 14.5dpc 7dpp 15dpp 75dpp 0 12.5dpc 14.5dpc 7dpp 15dpp 75dpp Supplementary Data S2 Supplementary Data S2 4548 Maqdasy et al Roles of LXR in the Testis Endocrinology, December 2015, 156(12):4545–4557 are the predominant lipids that ac- A +/+ B Lxr-/-;Lxr-/- Lxr-/- cumulate inside the testicular tissue Lxr-/-;Lxr-/-:AMH-Lxr Lxr-/- Lxr-/- +/+ Lxr-/- AMH-Lxr (3, 4). Histological and biochemical 2 * / / Flag analyses of the Lxr ;Lxr :  ACTIN AMH-Lxr mice testis showed nor- mal cholesteryl ester levels (Oil 1.5 C Red-O Staining and thin-layer chro- * matography analysis) (Figure 2, A 4 / 1 and B) compared with the Lxr ; / 3 *** ** Lxr and wild-type mice. This / Relative expression phenotype occurs in the Lxr ; 2 * / 0.5 Lxr mice with aging. Here we showed that LXR expression was 1 sufficient to maintain cholesterol ho- *** *** Relative fold induction *** *** *** 0 0 meostasis in the Sertoli cells of the Nr1h3 Nr1h2 T09 -+-+-+ -+-+-+ Lxr/;Lxr/:AMH-Lxr mice Srebp1c Abca1 D and prevented even long-term cho- E lesteryl ester accumulations as shown in the 9-month-old mice +/+ Lxr-/-;Lxr-/-:AMH-Lxr (Supplemental Figure 3, A–C). The quantitative representation of the Sertoli cells in the testicular tissue re- Flag SOX9 mained unchanged in the Lxr/; / ovary uterus adrenal testis epididymis caput prostate liver lung brain testis epididymis cauda seminal vesicle kidney Lxr :AMH-Lxr mice com- Flag pared with the wild-type mice and / /  actin Lxr ;Lxr mice because the Sox9 transcript accumulation exhib- HE Flag SOX9 ited a similar profile (Figure 2C). This suggests that the excessive lipid Figure 1. LXR is specifically expressed in the Sertoli cells of the Lxr/;Lxr/:AMH-Lxr mice. A, The relative accumulation of the Lxr (Nr1h3)andLxr (Nr1h2)mRNAsinthe4-month-oldwild-type accumulation within the Sertoli cells (white bars), Lxr/;Lxr/ (black bars), and Lxr/;Lxr/:AMH-Lxr (gray bars) testis samples did not affect the number of Sertoli (n  6–9)werequantifiedbyRT-qPCR.B,Westernblotanalyseswereperformedontheprotein cells. One of the main functions of lysates from 4-month-old wild-type, Lxr/;Lxr/,andLxr/;Lxr/:AMH-Lxr mouse testes using antibodies against the Flag epitope (sequence incorporated with the Lxr transgene). -Actin the Sertoli cells in the testis is to was used as a loading control. C, The relative accumulation of the Srebp1c and Abca1 mRNAs in maintain the BTB to protect the germ testes extracts from 4-month-old mice of each genotype that were treated with vehicle cells from the immune system. This (methylcellulose) or T0901317 (25 mg/kg) were analyzed by RT-qPCR. D, Immunolocalization of the function is sustained by the presence Flag epitope and SOX9 (Sertoli cell specific marker) and HE staining of testes sections from 4-month- old Lxr /;Lxr/:AMH-Lxr mice. The arrowheads indicate the colocalization of both proteins in of a tight junction network between the Sertoli cells. The scale bar represents 100 ϫm. E, Immunoblot analyses from the wild-type and Sertoli cells. We postulated that the Lxr/;Lxr/:AMH-Lxr testes and other Lxr/;Lxr/:AMH-Lxr organs indicate that Flag- lipid droplet accumulation could / / LXR accumulation was restricted to the Lxr ;Lxr :AMH-Lxr testis and ovary. The data are mechanically impair the Sertoli cell expressed as the means ϫ SEM. Statistical analysis: *, P ⌬ .05,**, P ⌬ .01, ***, P ⌬ .001, compared with the wild-type mice. HE, hematoxylin/eosin. cytoskeleton by disrupting adjacent Sertoli-Sertoli junctions and Sertoli- germ cell adhesions and interfering throughout adulthood (75 dpp), the temporal window in with the paracrine actions of the Sertoli cells in the which the phenotype occurs (Supplemental Figure 2). To- Lxr/;Lxr/ mice (for review see reference 19). Bi- gether these results confirmed the specific expression of a otin EZ, a sensitive marker of barrier alterations/disrup- functional transgene within the Sertoli cells. tions, was used to study the BTB in vivo (11, 20). The wild-type seminiferous tubules efficiently prevented tracer Targeted expression of Lxr in the Lxr/; penetration, whereas the 4-month-old Lxr/;Lxr/ Lxrϫ/ϫ:AMH-Lxr mice restores lipid homeostasis mice had significant alterations of their BTBs (Figure 2D). in Sertoli cells Reexpression of Lxr abolished Biotin EZ penetration in Lipid accumulation in Sertoli cells is the hallmark of the the tubules of the Lxr/;Lxr/:AMH-Lxr mice, Lxr/;Lxr/ testicular phenotype; cholesteryl esters thus indicating a restoration of BTB integrity in these an- The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. A B +/+ +/+ Lxr-/-;Lxr-/- A B Lxr-/-;Lxr-/-:AMH-Lxr 4.0 *** +/+ +/+ Lxr-/-;Lxr-/- 3.0 -/- Lxr-/-;Lxr-/-:AMH-Lxr  4.0 C -/-;Lxr 1.5  *** 2.0 3.0 -/-  1 C Lxr  -/-;Lxr 1.5  Cholesterol esters (nmol/ng tissue) 1.0 -/-:AMH-Lxr 0.5 Relative expression 2.0  -/-;Lxr 1  *** Lxr Lxr  0 0 *** Cholesterol esters (nmol/ng tissue) Nr1h2 1.0 -/-:AMH-Lxr 0.5 Relative expression  -/-;Lxr  *** Lxr 0 0 *** Nr1h2 Supplementary Data S3 Supplementary Data S3 o:10.1210/en.2015-1382 doi: esrdb TqC.D iulzto fteBoi-Ztae n eaoyi/oi H)sann n uniiaino h T nert nthe in integrity BTB the of quantification and staining (HE) hematoxylin/eosin and tracer Biotin-EZ bars) the (white of wild-type Visualization D, RT-qPCR. by measured bars), (white wild-type old ebaewe h T sitc;boi ifso notesmnfru uue arwed)idctsadfcieBB cl a,100 bar, Scale BTB. defective a indicates (arrowheads) tubules seminiferous the into diffusion biotin intact; is BTB the when membrane eaoyi.Tergtpnlrpeet eihncosscin ftse tie ihAue2de h rohasidct h ii vacuoles lipid the indicate arrowheads The dye. 2 50 Azure bar, with Scale stained cytoplasm. testes cell of Sertoli cross-sections the semithin within represents panel right The hematoxylin. aaaeepesda h means the as expressed are data the in vacuoles RAi h idtp wiebars), (white wild-type the in mRNA 2. Figure itlgclscin f4mnhodwild-type, 4-month-old of sections Histological agtdepeso fLXR of expression Targeted The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. D A Lxr-/-;Lxr-/-: Lxr Lxr-/-;Lxr-/-: AMH-Lxr Lxr-/-;Lxr-/- +/+  Lxr-/-;Lxr-/-  AMH-Lxr +/+ / Lxr ,  ;Lxr  Lxr    / ORO   /  ;Lxr  :AMH-Lxr /  ϫ  ;Lxr  E.Saitclaayi:*, analysis: Statistical SEM. Lxr HE /      bakbr)and bars) (black nthe in  /   /  os ets h etvria ae ersnsfoe etossandwt i e- OO and (ORO) Red-O Oil with stained sections frozen represents panel vertical left The testis. mouse bakbr) and bars), (black ;Lxr Lxr ϫ Lxr  .B iceia esrmnso hlsey se C)acmlto ntetsi f4-month- of testis the in accumulation (CE) ester cholesteryl of measurements Biochemical B, m.    /    /  / bakbr) and bars), (black  ;Lxr Azur blue ;Lxr Lxr       Lxr / /  /   P :AMH-Lxr and ,  ;Lxr ⌬  /   0,***, .05, ;Lxr  Lxr Lxr /    :AMH-Lxr      / iersoe ii oesai n h T nSroicls A, cells. Sertoli in BTB the and homeostasis lipid restores mice / B   /  :AMH-Lxr ;Lxr P ;Lxr Biotin EZ ⌬ Cholesterol esters (nmol/ng tissue)   01 oprdwt h idtp mice. wild-type the with compared .001,   0 0.4 0.8 1.2 1.6 2.0  /  ga as ie itni eandna h basement the near retained is Biotin mice. bars) (gray /  :AMH-Lxr  :AMH-Lxr ga as ie ,Terltv cuuaino the of accumulation relative The C, mice. bars) (gray *** *** Lxr Lxr +/+    -/-;Lxr -/-;Lxr  etssoigtedsperneo lipid of disappearance the showing testes ga as os etssmls(n samples testis mouse bars) (gray   -/-:AMH-Lxr -/- press.endocrine.org/journal/endo Relative expression C 00.2 0.4 0.6 0.8 1.0 1.2  Percent 100 Sox9 20 40 60 80 0 BTB Integrit *  y ϫ –)was 6–9) .The m. Sox9 4549 +/+ Lxr-/-;Lxr-/- Lxr-/-;Lxr-/-:AMH-Lxr +/+ Lxr-/-;Lxr-/- Lxr-/-;Lxr-/-:AMH-Lxr Int Int Int Int Int Int PLIN1 PLIN1 PLIN1 PLIN1 PLIN1 PLIN1 Supplementary Data S4 Supplementary Data S4 4550 Maqdasy et al Roles of LXR in the Testis Endocrinology, December 2015, 156(12):4545–4557 imals (Figure 2D). These results indicate that rescued ex- ure 3A). This effect was evident in the mating capacity of pression of a functional LXR in the Lxr/;Lxr/ these males (Figure 3B). Sertoli cells in vivo corrects abnormal cholesteryl ester An analysis of the transcripts encoding steroidogenic accumulation, leading to a proper BTB. enzymes demonstrated the rescued regulation of Star and 3hsd expression after Sertoli cell-specific LXR expres- LXR expression in Sertoli cells participates in the sion (Figure 3C). The Srb1 transcript levels (Figure 3C) endocrine function of Leydig cells and perilipin (PLIN1) staining (Supplemental Figure 4) Leydig cells are responsible for T production, which is did not show anomalies in the Leydig cells, suggesting that necessary for germ cell differentiation, libido, and the cholesterol was available for T synthesis. Scavenger re- maintenance of secondary sexual characteristics (6). The Lxr/ and Lxr/;Lxr/ mice exhibit a defect in T ceptor I is involved in cholesterol supply for steroidogen- production, which underlies abnormal Leydig cell steroid- esis by high-density lipoprotein uptake PLIN1 and is a ogenesis (3). To decipher the specific role of LXR within marker of lipid droplet formation that is indirectly related Sertoli cells in the regulation of Leydig cell function, the to cholesterol storage in Leydig cells (21). We next inves- intratesticular T levels were measured in the wild-type, tigated the potential involvement of the hypothalamo-pi- / Lxr/;Lxr/, and Lxr/;Lxr/:AMH-Lxr tuitary axis in regulating T production in the Lxr ; mice. Although the T levels were significantly lower in the Lxr/:AMH-Lxr mice. By monitoring of Lhr Lxr /;Lxr / mice, as already described, they were expression in the testis, we identified an equivalent situ- restored in the Lxr/;Lxr/:AMH-Lxr mice (Fig- ation with a minor but persistent up-regulation of the ex- A 0.35 B 100 C 0 . Testicular steroidogenesis 2 0.30 80 * +/+ Lxr-/-;Lxr-/- 0.25 Lxr-/-;Lxr-/-:AMH-Lxr 60 0.20 * Percent 0.15 1.0 40 * Testosterone (ng/mg) Testosterone * 0.10 Relative expression 20 0.05 0 0 0 0.6 1.5 Testosterone Vaginal Srb1 Star Cyp11a1 Hsd3b1 Cyp17 plugs D *** E F Pituitary 2 0 . 0 2 * 1 2 14 1 1 12 1.0 100 100 10 ** * p=0.11 ** p=0.055 ** 2 ** *** Relative expression 40 Relative expression 1 Plasmatic FSH (% of control) Plasmatic LH (% of control) 0.2 0.6 0.8 20 60 80 20 60 80 0 0.4 0 40 0 0 Lhr Fshb Lhb Figure 3. LXR expression within the Sertoli cells assists in regulating the endocrine function of the Leydig cells. A, Intratesticular T levels from the testes of 4-month-old wild-type (white bars), Lxr/;Lxr/ (black bars), and Lxr/;Lxr/:AMH-Lxr (gray bars) mice (n  10). B, The mating capacity of 6- to 7-month-old mice was evaluated by the percentage of vaginal plugs. Twelve matings per group were performed in two independent experiments. C, The relative expression levels of the genes involved in the steroidogenesis pathway within the testis was analyzed by RT-qPCR. D, The relative Lhr mRNA levels within the testis were quantified by RT-qPCR. E, Plasma LH and FSH levels in the blood from each genotype. F, The relative Fshb and Lhb mRNA levels in the pituitary gland of 4-month-old male mice was quantified by RT-qPCR. The data represent the relative expression between the 4-month-old wild-type (white bars), Lxr/;Lxr/ (black bars), and Lxr/;Lxr/:AMH-Lxr (gray bars) mice (n  6–9). The data are expressed as the means ϫ SEM. Statistical analysis: *, P ⌬ .05, **, P ⌬ .01, ***, P ⌬ .001, compared with the wild-type mice. The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. S5 doi: 10.1210/en.2015-1382 press.endocrine.org/journal/endo 4551 pression of this gene in the Lxr/;Lxr/:AMH-Lxr control of Leydig cell steroidogenesis by LXR expression mouse testis (Figure 3D) compared with the wild-type and in Sertoli cells is independent of the hypothalamo-pitu- Lxr/;Lxr/ mice. Given that Lhr expression is di- itary axis and did not involve the regulation of pituitary rectly influenced by the plasma levels of LH, we monitored LH secretion. Thus, it could be hypothesized that LXR the plasma LH levels and showed that the Lxr/; expression in Sertoli cells regulates the production of para- Lxr/ mice exhibited a decrease in circulating LH that crine factors that modulate the production of steroids in is not restored to the wild-type levels in the Lxr/; Leydig cells. Together we demonstrated that LXR ex- Lxr/:AMH-Lxr mice (Figure 3E). In contrast, the pression in Sertoli cells participated in an intratesticular decrease in the plasma FSH concentrations in the Lxr/ paracrine factor network to sustain T production. / ;Lxr mice was partially restored in the transgenic mice (Figure 3E), consistent with changes in the Fshr and Lipid homeostasis in germ cells is independent of Inh transcript levels in the mouse testis from each geno- LXR expression in Sertoli cells type (Supplemental Figure 5). Previous Lxr/;Lxr/ testicular phenotype inves- In line with the plasma FSH and LH levels, the Fshb tigations highlighted lipid inclusion in spermatids, sug- levels were reduced in the Lxr/;Lxr/ mice and re- gesting an alteration during spermiogenesis. It still unclear stored in the Lxr/;Lxr/:AMH-Lxr mice, sup- whether the initiation of this phenotype is cell autono- porting the hypothesis that the Sertoli cell-mediated reg- mous. Given that germ cells are known to express both ulation of inhibin is enough functional in the transgenic LXR isoforms in the wild-type mice, we took advantage of mice to drive endocrine Sertoli cell regulation (Figure 3F). the Sertoli cell-specific LXR expression in the Lxr/; The Lhb levels remained altered (Figure 3F). The persis- Lxr/:AMH-Lxr mice to address this question. We tent central defect in LH production in the Lxr/; investigated the presence of lipid accumulation in the germ Lxr/:AMH-Lxr mice clearly demonstrated that the cells by semithin histology analysis (Azur blue) (Figure 4A) A +/+ Lxr-/-;Lxr-/- Lxr-/-;Lxr-/-:AMH-Lxr B +/+ Lxr-/-;Lxr-/- Lxr-/-;Lxr-/-:AMH-Lxr Int Tub Int Tub Tub Tub Tub Int Tub Int Tub Tub +/+ Tub Lxr-/-;Lxr-/- Tub Lxr-/-;Lxr-/-:AMH-Lxr 120 ** ** 100 80 60 PLIN1 PLIN1 PLIN1 40 % of Perilipin-positive spermatids 20 0 Figure 4. Lipid homeostasis in germ cells is independent of LXR expression in Sertoli cells. A, Azure 2-stained semithin cross-sections from the wild-type, Lxr/;Lxr/, and Lxr/;Lxr/:AMH-Lxr mouse testes exhibited persistent lipid accumulation in the germ cells (black squares and arrowheads) in the Lxr/;Lxr/ and Lxr/;Lxr/:AMH-Lxr genotypes. B, PLIN1 immunostaining of wild-type, Lxr/;Lxr/, and Lxr/;Lxr/:AMH-Lxr mouse testis sections. The dashed lines separate the seminiferous tubules (Tub) from the interstitial tissue (Int). The white open arrowheads indicate PLIN1-positive staining in the Leydig cells, the white filled arrowheads indicate PLIN1-positive staining of spermatids, and the white empty arrowheads indicate the spermatocyte-negative staining. C, Quantification of the PLIN1-positive staining for spermatids in each genotype. Scale bar, 50 ϫm. The data are expressed as the means  SEM. Statistical analysis: **, P ϫ .01. compared with the wild type mice. The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. 4552 Maqdasy et al Roles of LXR in the Testis Endocrinology, December 2015, 156(12):4545–4557 and PLIN1 immunolocalization (Figure 4B), which stains spermiogenesis. Hence, germ cell lipid homeostasis ap- the lipid droplet surface. As already described by Chen et peared to be independent of LXR activity in Sertoli cells. al (21), we showed that Leydig cells were significantly To further investigate this phenomenon, we wondered stained, which represented strong lipid metabolic activity which of the altered genes in the LXR target gene panel that is consistent with their steroidogenic activity. Inter- could explain these observations. Nonexhaustive screen- estingly, Leydig cells exhibit constitutive perilipin stain- ing of the LXR target genes involved in both fatty acid ing, regardless of genotype (Figure 4B and Supplemental synthesis and cholesterol metabolism revealed that Abcg8 Figure 4). We observed persistent lipid inclusions (Figure exhibited a persistent down-regulation in either the 4A) as well as PLIN1 staining (Figure 4B) in both the Lxr/;Lxr/ or Lxr/;Lxr/:AMH-Lxr Lxr/;Lxr/ and Lxr/;Lxr/:AMH-Lxr mouse testes (Figure 5, A and B). Experiments using busul- mouse germ cells, particularly in the spermatids within the fan treatment were performed to demonstrate germ cell tubules (Figure 4B). The PLIN1 staining in the Lxr/; Abcg8 expression in vivo. Busulfan is an alkylating agent Lxr/ and Lxr/;Lxr/:AMH-Lxr mouse germ that results in a reversible loss of germ cells. At 4 weeks cells appeared to be restricted to the spermatid differen- after treatment, the pool of germ cells disappears, but it tiation stage and suggested this deregulation could impact regenerates after 8 weeks (11). The Sox9 and Smad6 ac- Cell compartment 1.4 A B C 14.0 Fatty acid synthesis Cholesterol metabolism +/+ ** Control 2 . 1 Lxr-/-;Lxr-/- 10.0 4 weeks Busulfan 2 . 2.5 *** Lxr-/-;Lxr-/-:AMH-Lxr 1 8 weeks Busulfan 6.0 1.0 1.0 2.0 * 2 2 . . 1 1 1.0 1.0 * ** * ** Relative expression Relative Relative expression Relative expression Relative Relative expression Relative 0.4 0.2 0.6 0.8 0.2 0.6 0.8 0.2 0.6 0.8 0.2 0.6 0.8 ** *** 0 0.4 0 0.4 0 0.4 0 Srebp1c Fasn Scd1 Scd2 Abca1 Abcg1 Abcg8 Sox9 Smad6 Abcg8 D +/+ Lxr-/-;Lxr-/- Lxr-/-;Lxr-/-:AMH-Lxr ABCG8 ABCG8 ABCG8 ABCG8 Figure 5. LXR-dependent expression of Abcg8 is coordinated by the germ cells in the seminiferous tubules. A and B, Relative mRNA levels of the LXR target genes involved in fatty acid synthesis and cholesterol metabolism, respectively, in the 4-month-old wild-type (white bars), Lxr/;Lxr/ (black bars), and Lxr/;Lxr/:AMH-Lxr (gray bars) testes. C, Relative expression of the mRNA levels of known Sertoli cell- and germ cell-specific genes (Sox9 and Smad6, respectively) and Abcg8 in the testes of wild-type mice (n  6–7) treated with busulfan; at 4 weeks after the busulfan treatment, there was a 90% loss of germ cell mass as confirmed by the low Smad6 levels and high Sox9 levels. At 8 weeks after the busulfan treatment, the germ cells were regenerated, as demonstrated by the restored Smad6 and Sox9 levels. D, ABCG8 immunostaining analyses performed on wild-type (white bars), Lxr/;Lxr/ (black bars), and Lxr/;Lxr/:AMH-Lxr (gray bars) testis sections. ABCG8 staining in the wild-type testis exhibited canonical Sertoli cell (left panel) as well as germ cell staining (right panel). The white arrowheads indicate constitutive ABCG8 accumulation in Leydig cells. Scale bar, 20 ϫm. The data are expressed as the means ϫ SEM. Statistical analysis: *, P ⌬ .05, **, P ⌬ .01, ***, P ⌬ .001, compared with the wild-type mice. The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. doi: 10.1210/en.2015-1382 press.endocrine.org/journal/endo 4553 cumulation profiles allow us to follow the enrichment of with the busulfan experiments and allows us to conclude Sertoli cells and the depletion of germ cells, respectively that Abcg8 was expressed in germ cells but that ABCG8 (11, 18). Busulfan exposure in wild-type mice prompted us accumulation in Sertoli cells was highly dependent on to conclude that Abcg8 was mainly expressed in germ cells germ cells. Thus, we proposed that the LXR-driven ex- because its expression profile mimics Smad6 expression pression of Abcg8 in the seminiferous tubules is essential (Figure 5C). Unexpectedly, the immunolocalization of for lipid homeostasis in the later stages of spermatogenesis ABCG8 in testis sections revealed an accumulation in of germ cells. germ cells but also in Leydig and Sertoli cells (Figure 5D). Moreover, the Sertoli and germ cell accumulation of Rescue of LXR expression in Sertoli cells reveals ABCG8 was clearly decreased in both the Lxr/; an accumulation of neutral lipids in the myoid Lxr/ and Lxr/;Lxr/:AMH-Lxr mice, with- peritubular cells that is correlated with abnormal out any change in Leydig cell staining, regardless of ge- spermatozoa transit notype (Figure 5D). These results are in agreement with The Lxr/;Lxr/ mouse testis has been described the Abcg8 mRNA accumulations that were decreased in to develop progressive testicular degeneration that is char- the Lxr/;Lxr/ and Lxr/;Lxr/:AMH-Lxr acterized by vacuoles and thin desquamated epithelium mice (Figure 5B). Both tubule cell types exhibited de- that could progress to empty seminiferous tubules (Figure creased accumulation in the Lxr/;Lxr/ and 6A) (3). An evaluation of seminiferous tubules in Lxr/;Lxr/:AMH-Lxr mice. This observation 9-month-old Lxr/;Lxr/:AMH-Lxr mice showed demonstrated that LXRs control Abcg8 expression in this a global improvement of histological integrity that is char- compartment and that the rescued expression of LXR in acterized by the disappearance of vacuoles, fewer thin ep- Sertoli cell is not sufficient to restore Abcg8 expression. ithelial tubules, and normalized testicular weight (Figure Together these observations suggest that the LXR-depen- 6B and Supplemental Figure 6A). Strikingly, in mice that dent expression of Abcg8 in the seminiferous tubules oc- reexpress LXR, an additional phenotype appears with curred primarily in germ cells. This last idea is in accord aging, which is characterized by stagnant spermatozoa in A Normal Vacuoles Thin epithelium Empty Stagnation spz B percent (%) C 020 40 60 80 100 +/+ Normal Stagnation spz Lxr-/-;Lxr-/- Vacuoles Lxr-/-;Lxr-/-:AMH-Lxr Thin ep. / Empty D E F HE TUNEL Ki67 Figure 6. Rescue of Lxr expression in Sertoli cells suppresses seminiferous epithelium degeneration and reveals abnormal spermatozoa transit. A, Microscopic histological alterations (vacuolated tubules, thin seminiferous epithelium, empty tubules, and spermatozoa stagnation) were identified in HE staining of the wild-type, Lxr/;Lxr/, and Lxr/;Lxr/:AMH-Lxr testes. B, Relative quantification of the histological alterations in each genotype. C, The macroscopic image represents the entire testis and shows the whitish seminiferous tubules filled with stagnating spermatozoa in the Lxr/;Lxr/:AMH-Lxr testis. The hematoxylin/eosin (HE) (D), terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling (TUNEL) (E) and Ki67 immunostaining (F) analyses of corked tubules demonstrated apoptotic spermatozoa in the Lxr/;Lxr/:AMH-Lxr testis. The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. 4554 Maqdasy et al Roles of LXR in the Testis Endocrinology, December 2015, 156(12):4545–4557 the lumen of the seminiferous tubules (Figure 6C,D). Mac- tion is tightly associated with disorganized SMA depo- roscopically, these tubules appear as whitish, thick tubules sition in the PTSM, as manifested by an enlarged smooth (Figure 6C); microscopically, they are surrounded by a muscle layer in the Lxr/;Lxr/ and Lxr/; thick peritubular layer, they lose their epithelial structure Lxr/:AMH-Lxr mice (Figure 7C). The stagnation and are filled with a large accumulation of spermatozoa was rarely present in the Lxr/;Lxr/ mouse testis (Figure 6D). The spermatozoa within these tubules even- due to the degeneration of seminiferous epithelium and the tually become apoptotic (Figure 6E), and the bulk of the loss of spermatogenesis. In contrast, seminiferous epithe- luminal cells do not proliferate (Figure 6F). lium maintenance, which is rescued in the Lxr/; In light of this unexpected phenotype, we raised two Lxr/:AMH-Lxr mice, allows germ cell differentia- hypotheses: either a distal obstruction or an impaired tu- tion and spermatozoa production and would unmask the bular motility could lead to spermatozoa stagnation in the motility defects of the PTSM. Together the rescued Lxr Lxr/;Lxr/:AMH-Lxr mice. We carefully exam- expression in the Lxr/;Lxr/:AMH-Lxr mice re- ined the rete testis (Figure 7A), which did not reveal any stored the seminiferous epithelium thickness, revealing obstructions because they harbored spermatozoa in their / lumen. We next investigated the layer surrounding the PTSM defects, a masked phenotype of the Lxr ; / seminiferous tubules. We noticed lipid accumulations in Lxr mice. The question of whether the spermatozoa this layer, as shown by semithin Azure 2 dye and PLIN1 transit defect is the cause or the consequence of such phe- staining (Figure 7B). The peritubular smooth muscle cells notype persists. In addition to abnormal lipid accumula- (PTSM) surrounding the tubules are necessary for tubular tion within the germ cells (defective spermiogenesis), the contractility and spermatozoa propulsion. SMA is a spe- defective PTSM phenotype could also participate in the cific differentiation marker of these cells (22). In the persistent infertility in the Lxr/;Lxr/:AMH-Lxr Lxr/;Lxr/:AMH-Lxr mice, spermatozoa stagna- male mice (Supplemental Figure 6, B–D). A Nr1h3-/-:Nr1h2-/-: C Amh-Nr1h2 Proximal +/+ Distal spz HE SMA Nr1h2-/- Distal -/-: rete testis HE SMA Nr1h3-/-:Nr1h2-/-: B Azur blue Amh-Nr1h2 HE SMA Perilipin Nr1h2-/-: HE -/-: Amh-Nr1h2 Nr1h3 Nr1h3 HE SMA +/+ Nr1h3-/-:Nr1h2-/-:Amh-Nr1h2 Figure 7. Description of an LXR-linked phenotype of the peritubular cells. A, hematoxylin/eosin (HE) and SMA immunostaining of the rete testis of the Lxr/;Lxr/:AMH-Lxr mice confirmed the presence of spermatozoa in rete testis distal region. B, Semithin cross-sections of 6-month- old wild-type and Lxr /;Lxr/:AMH-Lxr testes stained with Azure 2 dye; the white arrowheads indicate lipid accumulations. PLIN1 staining confirmed the presence of lipid accumulations (white arrowheads) within the PTSM. C, HE and SMA immunostaining of wild-type, Lxr/;Lxr/ / /  and Lxr ;Lxr :AMH-Lxr testicular tubules exhibited spermatozoa stagnation. The high-magnification image emphasizes the thickness of the perimuscular cell layer surrounding seminiferous tubules. The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. doi: 10.1210/en.2015-1382 press.endocrine.org/journal/endo 4555 Discussion that one of the reasons for the lipid accumulation could be the absence of Abcg8 regulation. Indeed, our data show / / By generating an Lxr ;Lxr :AMH-Lxr mouse, that this gene is expressed in both germ cells and Sertoli we provided an original in vivo model to decipher the cells. Interestingly, the Abcg8/ mice have a very low physiological roles of LXR in Sertoli cells. LXR regu- fertility rate (27). Observations of the Lxr/;Lxr/: lates the levels of lipids in Sertoli cells by controlling the AMH-Lxr testes support the idea that the intrinsic ex- activation of specific genes. Interestingly, LXR is funda- pression of LXRs in germ cells plays a pivotal role in final mentally required in Sertoli cells to maintain a functional processes of spermiogenesis, which are necessary to obtain and effective BTB and to sustain the germ cell pool. In fully competent spermatozoa. The intrinsic germ cell de- addition, it modulates the endocrine activity of Leydig fects would affect germ cell maturation and even later cells. stages of capacitation, which take place in an apparently As expected, LXR reexpression in Sertoli cells re- abnormal epididymis in the Lxr/;Lxr/ mice (28). stored lipid homeostasis. This is due in part to the in- Moreover, Abcg8 is expressed in Sertoli cells and is not creased ATP-binding cassette transporter A1/ABCG1 lev- under the control of LXR in this compartment because els. This increased gene expression promotes the prompt the Lxr/;Lxr/:AMH-Lxr mice exhibited lower export of cholesterol from Sertoli cells, preventing vacuole levels of this transcript compared with the wild-type mice. / formation. Moreover, Abca1 mice exhibit lipid accu- The results obtained from the immunolocalization of / / mulation similar to that of the Lxr ;Lxr mice ABCG8 (Figure 5D) in the three genotypes as well as the (23). Many other mouse models targeting genes that en- busulfan experiments (Figure 5C) suggested that LXR reg- code nuclear receptors or proteins that are implicated in ulation in germ cells was essential for the expression of lipid metabolism suffered from altered fertility with aging, Abcg8 in the entire tubule, even in Sertoli cells. Consistent / / / such as the Abca1 , Rxr and Ncoa2 mice, for with the idea that ABCG8 is important during spermio- which explanations have been rarely found (4, 5, 23–25). genesis, we observed that different patterns of accumula- It could be supposed that the large lipid vacuoles alter tion of this protein (Figure 5D) from one tubule to another Sertoli cell physiology due to deformations. Indeed, lipid could suggest that Abcg8 expression is associated with droplet accumulation could mechanically impair the Ser- waves of spermatogenesis across the seminiferous tubules. toli cell cytoskeleton by disrupting adjacent Sertoli-Sertoli Together these results encourage the development and junctions and Sertoli-germ cell adhesion and interfere with analysis of new mouse models with germ cell-specific de- the paracrine actions of Sertoli cells (for review see refer- letions of LXRs to decipher the role of LXR in ence 19). Notably, BTB alterations were found in the spermiogenesis. Lxr/;Lxr/ mice but not in wild-type and Our in vivo strategy using the Lxr/;Lxr/ mice Lxr/;Lxr/:AMH-Lxr mice. The BTB is formed instead of the Lxr/ mice to restore Lxr expression by tight junctions between neighboring Sertoli cells and was motivated by the opportunity to identify the role of protects the germ cells in meiosis from the immune system. Sertoli cell-specific expression of Lxr regarding the other The rupture of this barrier could lead to altered spermato- testicular cell types. This approach leads us to identify the genesis and infertility (for review see reference 26). We essential role of LXR in Sertoli cells to control steroid- demonstrated the necessity of LXR within Sertoli cells to ogenesis in Leydig cells. We previously showed that LXR maintain BTB integrity in vivo. This effect could be ex- could activate T synthesis in Leydig cells by modulating plained by the disappearance of lipid vacuoles and im- the star and 3hsd levels (3). The Lxr/;Lxr/: proved T levels within the testis because this barrier is AMH-Lxr strain demonstrated that LXR expression sensitive to androgens. within the Sertoli cells is able to regulate T synthesis During maturation, many modifications in the lipid through a putative paracrine effect on Leydig cell steroid- and protein contents of germ cells occur to render them ogenesis. Indeed, both star and 3hsd expressions are re- easily motile and fertile. When spermatozoa are released stored in the Lxr/;Lxr/:AMH-Lxr mouse testis. from the seminiferous epithelium, they are believed to be The secreted mediator of Sertoli cells that is able to regu- highly loaded with cholesterol, and a progressive loss late steroidogenesis under the control of LXR needs to be takes place to acquire the typical membrane fluidity of identified. The Lxr/;Lxr/:AMH-Lxr mice pro- spermatozoa. Therefore, the regulation of cholesterol me- vide a unique in vivo model to answer this question. tabolism in germ cells represents a critical step in sperma- Finally, one of the most striking facts is an unexpected tozoa differentiation. Volle et al (3) have previously de- phenotype that was revealed in both the Lxr/;Lxr/ scribed putative inclusions in the germ cells of the and Lxr/;Lxr/:AMH-Lxr mice. This phenotype Lxr/;Lxr/ mouse testis. We have demonstrated is characterized by PTSM defects due to lipid accumula- The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. 4556 Maqdasy et al Roles of LXR in the Testis Endocrinology, December 2015, 156(12):4545–4557 tion and smooth muscle actin disorganization. Interest- This work was supported by the Fondation pour la Recherche ingly, PTSM defects have been associated with altered Ser- Médicale (to J.-M.A.L.) and Région Auvergne “Nouveau Cher- toli cell functions and oligoazoospermia or even cheur” (to S.B.). Disclosure Summary: The authors have nothing to disclose. azoospermia and infertility (7, 29). This phenotype re- mained hidden in the Lxr/;Lxr/ mice, which may be explained by the quantity of germ cells to be propelled References because germ cells are scarce in Lxr/;Lxr/ mice testis. This observation could be correlated to cholesteryl 1. Peet DJ, Turley SD, Ma W, et al. Cholesterol and bile acid metab- ester accumulation, as previously described in the muscle olism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell. 1998;93(5):693–704. compartment of the myometrium from females lacking 2. Tontonoz P, Mangelsdorf DJ. Liver X receptor signaling pathways LXR, who display contractility defects (30). in cardiovascular disease. Mol Endocrinol. 2003;17(6):985–993. In conclusion, we present further evidence supporting 3. Volle DH, Mouzat K, Duggavathi R, et al. Multiple roles of the nuclear receptors for oxysterols liver X receptor to maintain male the critical roles of LXR in Sertoli cells beyond lipid ho- fertility. Mol Endocrinol. 2007;21(5):1014–1027. meostasis. As previously postulated by Volle et al (3), the 4. Mascrez B, Ghyselinck NB, Watanabe M, et al. Ligand-dependent Lxr/;Lxr/:AMH-Lxr mouse model confirmed contribution of RXR to cholesterol homeostasis in Sertoli cells. / / EMBO Rep. 2004;5(3):285–290. that the defective function of the Lxr ;Lxr mouse 5. Robertson KM, Schuster GU, Steffensen KR, et al. The liver X re- testis resulted from a combination of phenotypes that ceptor- is essential for maintaining cholesterol homeostasis in the emerged from distinct compartments of this gland. The testis. Endocrinology. 2005;146(6):2519–2530. 6. Maqdasy S, Baptissart M, Vega A, Baron S, Lobaccaro J-MA, Volle / / focus on Sertoli cell activity in the Lxr ;Lxr : DH. Cholesterol and male fertility: what about orphans and ad- AMH-Lxr mice demonstrated that paracrine and endo- opted? Mol Cell Endocrinol. 2013;368(1–2):30–46. crine signals from these cells actively participate in Leydig 7. Wang R-S, Yeh S, Tzeng C-R, Chang C. Androgen receptor roles in spermatogenesis and fertility: lessons from testicular cell-specific and germ cell homeostasis. This model allowed us to dis- androgen receptor knockout mice. Endocr Rev. 2009;30(2):119– cover a new role for LXRs in the PTSM compartment. 132. 8. Rondanino C, Ouchchane L, Chauffour C, et al. Levels of liver X receptors in testicular biopsies of patients with azoospermia. Fertil Steril. 2014;102(2):361–371.e5. Acknowledgments 9. Lécureuil C, Fontaine I, Crepieux P, Guillou F. Sertoli and granulosa cell-specific Cre recombinase activity in transgenic mice. Genesis. We warmly thank Dr Jean-Yves Picard and Dr Charlotte Lécu- 2002;33(3):114–118. 10. Repa JJ, Mangelsdorf DJ. The liver X receptor gene team: potential reuil for their helpful discussion and AMH promoter plasmid new players in atherosclerosis. Nat Med. 2002;8(11):1243–1248. construct. We thank Dr David Mangelsdorf (Howard Hughes 11. Baptissart M, Vega A, Martinot E, et al. Bile acids alter male fertility Medical Institute, Department of Pharmacology and Biochem- through TGR5 signaling pathways. Hepatology. 2014;60(3):1054– istry, University of Texas Southwestern Medical Center, Dallas, 1065. 12. Meng J, Holdcraft RW, Shima JE, Griswold MD, Braun RE. An- Texas) for his fruitful collaboration and the availability of LXR- drogens regulate the permeability of the blood-testis barrier. Proc deficient mouse models. We also thank Dr Ivan Wawrzyniak for Natl Acad Sci USA. 2005;102(46):16696–16700. the semithin sections and Professor Vincent Sapin for the go- 13. Volle DH, Duggavathi R, Magnier BC, et al. The small heterodimer nadotropin measurements. This study has been performed with partner is a gonadal gatekeeper of sexual maturation in male mice. Genes Dev. 2007;21(3):303–315. the assistance of Christelle Damon-Soubeyrand for her histology 14. Pitetti J-L, Calvel P, Zimmermann C, et al. An essential role for technical assistance using the “Anipath” Platform and Sandrine insulin and IGF1 receptors in regulating sertoli cell proliferation, Plantade, Keredine Ouchen, and Philippe Mazuel for the animal testis size, and FSH action in mice. Mol Endocrinol. 2013;27(5): facilities and transgenesis facilities. 814–827. 15. Pommier AJC, Dufour J, Alves G, et al. Liver x receptors protect from development of prostatic intra-epithelial neoplasia in mice. Address all correspondence and requests for reprints to: Sil- PLoS Genet. 2013;9(5):e1003483. vère Baron, PhD, Génétique Reproduction et Développement, 16. Mouzat K, Volat F, Baron S, et al. Absence of nuclear receptors for 24 Avenue des Landais, F-63177 Aubiere, France. E-mail: oxysterols liver X receptor induces ovarian hyperstimulation syn- [email protected]. drome in mice. Endocrinology. 2009;150(7):3369–3375. 17. El-Hajjaji F-Z, Oumeddour A, Pommier AJC, et al. Liver X recep- Author contributions include the following: S.M. and F.- tors, lipids and their reproductive secrets in the male. Biochim Bio- Z.E.H. performed in vivo studies and molecular investigations. phys Acta. 2011;1812(8):974–981. M.B. assisted with the blood-testis barrier investigation and per- 18. Koopman P, Bullejos M, Bowles J. Regulation of male sexual de- formed the busulfan treatment. E.V. and A.O. assisted with the velopment by Sry and Sox9. J Exp Zool. 2001;290(5):463–474. 19. Pelletier R-M. The blood-testis barrier: the junctional permeability, molecular investigations. F.B., A.T., D.V., and I.T. contributed the proteins and the lipids. Prog Histochem Cytochem. 2011;46(2): to the data analyses and the experimental design. J.-M.A.L. and 49–127. S.B. conceived the study. S.M. and S.B. wrote the paper. 20. McCabe MJ, Allan CM, Foo CFH, Nicholls PK, McTavish KJ, Stan- The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. doi: 10.1210/en.2015-1382 press.endocrine.org/journal/endo 4557 ton PG. Androgen initiates Sertoli cell tight junction formation in the from those of SRC-1 and p/CIP. Mol Cell Biol. 2002;22(16):5923– hypogonadal (hpg) mouse. Biol Reprod. 2012;87(2):38. 5937. 21. Chen M, Wang H, Li X, Li N, Xu G, Meng Q. PLIN1 deficiency 26. Lui W-Y, Mruk D, Lee WM, Cheng CY. Sertoli cell tight junction dynamics: their regulation during spermatogenesis. Biol Reprod. affects testicular gene expression at the meiotic stage in the first wave 2003;68(4):1087–1097. of spermatogenesis. Gene. 2014;543(2):212–219. 27. Solca C, Tint GS, Patel SB. Dietary xenosterols lead to infertility and 22. Tung PS, Fritz IB. Characterization of rat testicular peritubular loss of abdominal adipose tissue in sterolin-deficient mice. J Lipid myoid cells in culture: -smooth muscle isoactin is a specific differ- Res. 2013;54(2):397–409. entiation marker. Biol Reprod. 1990;42(2):351–365. 28. Frenoux JM, Vernet P, Volle DH, et al. Nuclear oxysterol receptors, 23. Selva DM, Hirsch-Reinshagen V, Burgess B, et al. The ATP-binding LXRs, are involved in the maintenance of mouse caput epididymidis cassette transporter 1 mediates lipid efflux from Sertoli cells and structure and functions. J Mol Endocrinol. 2004;33(2):361–75. 29. Welter H, Kampfer C, Lauf S, et al. Partial loss of contractile marker influences male fertility. J Lipid Res. 2004;45(6):1040–1050. proteins in human testicular peritubular cells in infertility patients. 24. Kastner P, Mark M, Leid M, et al. Abnormal spermatogenesis in Andrology. 2013;1(2):318–324. RXR  mutant mice. Genes Dev. 1996;10(1):80–92. 30. Mouzat K, Prod’homme M, Volle DH, et al. Oxysterol nuclear re- 25. Gehin M, Mark M, Dennefeld C, Dierich A, Gronemeyer H, Cham- ceptor LXR regulates cholesterol homeostasis and contractile bon P. The function of TIF2/GRIP1 in mouse reproduction is distinct function in mouse uterus. J Biol Chem. 2007;282(7):4693–4701. The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 April 2016. at 15:39 For personal use only. No other uses without permission. . All rights reserved. Supplemental figure 1: (A) Schematic representation of the transgenic construct that was injected into fertilized LxrD-/-;LxrE-/- mouse eggs to establish the LxrD-/-;LxrE-/-:AMH-LxrE strain. The Lxrȕ cDNA was fused with Flag tag and is under the control of human AMH promoter, as previously described (11). The ȕ-globin intron was inserted 5' of the coding sequence and the BGH (Bovine Growth Hormone) polyadenylated sequence was inserted in the 3' region. The transgene was linearized and purified before microinjection using HindIII/XhoI digestion. (B) The table summarizes the number of founders, copy number (determine by Southern blot) and transgene transmission. Nr1h3-/-;Nr1h2-/- was named LxrD-/-;LxrE-/- and Nr1h3-/-;Nr1h2-/-:AMH-Nr1h2 was named LxrD-/- ;LxrE-/-:AMH-LxrE in the manuscript (C) Southern (upper panel) and Northern (lower panel) blots of the wild type, LxrD-/-;LxrE-/- and LxrD-/-;LxrE-/-:AMH-LxrE tail and testis extracts using the ȕ- globin probe, as indicated in A for Southern blot, or using the LxrE cDNA probe for the Northern blot. The white arrow indicates the full-length transgene fragment and the black arrow represents the insertion fragments. As indicated, two strains, F0-1 and F0-2, were obtained and tested for Lxrȕ rescue. (D) Immunohistochemistry of testis sections from 4-month-old of wild type, LxrD-/-;LxrE-/- and LxrD-/-;LxrE-/-:AMH-LxrE (strain F0-1) mice using antibodies against the Flag epitope. The scale bar represents 100 µm. Supplemental figure 2: (A) Relative mRNA expression of Lxrȕ (Nr1h2) in the wild type and LxrD-/- ;LxrE-/-:AMH-LxrE mouse testis at 12.5dpc, 1245dpc, 7dpp, 15dpp and 75dpp. Supplemental figure 3: (A) Frozen sections of 9-month-old wild type, LxrD-/-;LxrE-/-and LxrD-/- ;LxrE-/-:AMH-LxrEmice testes were stained with Oil Red-O (ORO). The scale bar represents 200 µm (B) Biochemical measurement of cholesteryl ester (CE) accumulation in the testis of 9-month-old wild type, LxrD-/-;LxrE-/-and LxrD-/-;LxrE-/-:AMH-LxrEmice using High Performance Thin Layer Chromatography. (C) Relative LxrE (Nr1h2) expression level in the testis of 9-month-old wild type, LxrD-/-;LxrE-/-and LxrD-/-;LxrE-/-:AMH-LxrEmice. ***: p<0.001. Supplemental figure 4: Representative immunofluorescence detection of PLIN1 in the testicular interstitial tissue (Int) of each genotype. Scale bar, 10 µm. Supplemental figure 5: Relative mRNA expression of Sertoli cell-specific endocrine markers in the testes of the wild type, LxrD-/-;LxrE-/- and LxrD-/-;LxrE-/-:AMH-LxrEmice. Supplemental figure 6: (A) Relative testis weight from 4-, 6- and 9-month-old wild type, LxrD-/- ;LxrE-/ -and LxrD-/-;LxrE-/-:AMH-LxrEmice (n=6/9). (B) The percentage of mating efficiency was ! "! measured by vaginal plugs after overnight matings between 6-month-old wild type, LxrD-/-;LxrE-/- and LxrD-/-;LxrE-/-:AMH-LxrE male mice and wild type females. (C) The number of pups per litter resulting from the matings between 6-month-old wild type, LxrD-/-;LxrE-/- and LxrD-/-;LxrE-/-:AMH- LxrEmale mice and wild type females (n=12 per group). (D) Percentage of wild type female mice that delivered a litter after separation from the 6-month-old wild type, LxrD-/-;LxrE-/- and LxrD-/-;LxrE-/- :AMH-LxrEmale mice. *: p<0.05, **: p<0,01, ***: p<0,001. Supplemental Table 1: qPCR primer sequences Gene name Sequence 5' to 3' 36b4 Fw GTCACTGTGCCAGCTCAGAA Rv TCAATGGTGCCTCTGGAGAT Abcg1 Fw GCTGTGCGTTTTGTGCTGTT Rv TGCAGCTCCAATCAGTAGTCCTAA Abca1 Fw CGTTTCCGGGAAGTGTCCTA Rv GCTAGAGATGACAAGGAGGAGGA Abcg8 Fw TGCCCACCCTTCCACATGTC Rv ATGAAGCCGGCAGTAAGGTAGA AR Fw AATGAGTACCGCATGCACAA Rv GGAGCTTGGTGAGCTGGTAG Cyp11a Fw CTGCCTCCAGACTTCTTTCG Rv TTCTTGAAGGGCAGCTTGTT Cyp17 Fw CCAGGACCCAAGTGTGTTCT Rv CCTGATACGAAGCACTTCTCG Fas Fw GCTGCGGAAACTTCAGGAAAT Rv AGAGACGTGTCACTCCTGGACTT Fshb Fw CTGGTGCTGGAGAGCAATCT Rv TGAGCAGCCTAACCTTGTGG Fshr Fw GTGCTCACCAAGCTTCGAGTCAT Rv AAGGCCTCAGGGTTGATGTACAG Inha Fw TCCTGGTAGCCCACACTAGG Rv GAAACTGGGAGGGTGTACGA Lhr Fw AGCTAAATGCCTTTGACAACC Rv GATGGACTCATTATTCATCC Lhb Fw AGAGAATGAGTTCTGCCCAG Rv CTACAGGAAAGGAGACTATGG /[UĮ Fw TGCCATCAGCATCTTCTCTG Rv GGCTCACCAGCTTCATTAGC /[Uȕ Fw CGCTACAACCACGAGACAGA Rv TGTTGATGGCGATAAGCAAG Nanog Fw TACTGAGATGCTCTGCACAG Rv GACTGGTAGAAGAATCAGGG Scd1 Fw CCGGAGACCCCTTAGATCGA Rv TAGCCTGTAAAAGATTTCTGC Smad6 Fw TATTCTCGGCTGTCTCCTCC Rv AGTGATGAGGGAGTTGGTGG Sox9 Fw CCTAATGCTATCTTCAAGGCGC Rv GCTCAGTTCACCGATGTCCACG Srebp1c Fw GGAGCCATGGATTGCACATT Rv GGCCCGGGAAGTCACTGT ! "! Srb1 Fw CCTTCGTGGAGAACCGCAGCC Rv CCCATGGTGACCAGCGCCAA Star Fw TGTCAAGGAGATCAAGGTCCTG Rv CGATAGGACCTGGTTGATGAT Scd2 Fw TTCCTCATCATTGCCAACAAC Rv GGGCCCATTCATACACGTCA ȕKVG Fw ATGGTCTGCCTGGGAATGAC Rv ACTGCAGGAGGTCAGAGCT Tbp Fw GCTACTGAACTGCTGGTGGGTCA Rv GTGATGTGAAGTTCCCTATAAGGCT ! ! "! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! "#$%&'&()*!+%,&-*.!/0!1234!.56%.77&8(!&(!,9.!'%)(:*87)!-.**7!&7!.77.(,&)*!;8%!(8%<)*!8=)%&)(! 69>7&8*8'>?! ! "#$%#&'!()!!"#!*+!,-(,#-#)./+0! ! LXR expression in the granulosa cells is essential for normal ovarian physiology Salwan Maqdasy1,2,3,4,5, Amalia, Trousson1,2,3,4,6, Aurélie VEGA1,2,3,4,6, Florence Brugnon1,2,3,4,6, Igor Tauveron 1,2,3,4,5, David Volle 1,2,3,4, Jean Marc Lobaccaro1,2,3,4, Silvère Baron*1,2,3,4 1Université Blaise Pascal, Génétique Reproduction et Développement, BP 10448, F63000 CLERMONT-FERRAND, France 2CNRS, UMR 6293, GReD, F-63177 AUBIERE, France 3INSERM, UMR 1103, GReD, F-63177 AUBIERE, France 4Centre de Recherche en Nutrition Humaine d’Auvergne, F-63000 CLERMONT-FERRAND, France 5Service d'Endocrinologie, Diabétologie et Maladies Métaboliques, Hôpital Gabriel Montpied, F-63003 CLERMONT-FERRAND, France 6Assistance Médicale à la Procréation, CECOS, CHU Clermont Ferrand, CHU Estaing, place Aubrac, F-63000 CLERMONT-FERRAND, France. Abbreviated title: Roles of LXR! in the ovary. Keywords: Liver X receptors, granulosa cells, ovulation, ovary, ovarian hyperstimulation Number of words (text): Number of words (abstract): 248 Number of figures: 5 Number of supplemental tables: 1 Corresponding author and person to whom reprint requests should be addressed: *Silvère Baron, PhD GReD 24, Avenue des Landais F-63177 AUBIERE, France Tel:+334 73 40 74 12 Fax: +334 73 40 70 42; E-mail: [email protected] Disclosure statement: The authors have nothing to disclose. ABSTRACT Liver X receptors are nuclear receptors regulating cholesterol balance, inflammation and steroid synthesis, thus are suggested to influence the ovarian function. Both isoforms, and their ligand, the follicular fluid-meiosis activating sterol, are expressed in the ovary. To date, few studies analysed the in vivo roles of LXRs in the ovary. Lxr!-/-;Lxr"-/- mice develop ovarian hyperstimulation syndrome (OHSS) in response to gonadotropin stimulation. Indeed, granulosa cells (GC) are major supporting cells promoting oocyte maturation and ovulation in response to gonadotropins. Thus, LXR in the GC could be the primum movens driving normal ovarian physiology. Both LXR! and LXR" are expressed in the GC with a relative predominance of the second isoform. In order to decipher the roles of LXR in the GC, we generated Lxr!-/-;Lxr"-/-:AMH- Lxr" mice. This transgenic line re-expresses LXR" under the control of human AMH promoter (specific GC expression) in a background of Lxr!-/-;Lxr"-/- mice. Lxr!-/-;Lxr"-/- mice develop late sterility due to abnormal oocyte maturation and increased oocyte atresia. GC paracrine factors, cumulus expansion are compromised and estradiol levels are deregulated. LXR" re-expression in Lxr!-/-;Lxr"-/-:AMH-Lxr" restores these defects. Furthermore, LXR" in the GC regulates ovarian response to gonadotropins and prevents OHSS. Women at high risk for OHSS undergoing medically assisted procreation, have a significant reduction in the LXR" expression in the granulosa-lutein cells. These results demonstrate that LXR" in the GC is a regulator of multiple mechanisms essential for follicle maturation, oocyte survival and for ovulation. LXR" is therefore a potential target to regulate female fertility and to prevent OHSS. INTRODUCTION Liver X receptors (LXR! and ", NR1H3 and NR1H2, respectively) belong to a subclass of nuclear receptors, which are activated upon binding to their ligands, the oxysterols. They were first described as cellular cholesterol sensors (Peet et al., 1998) before the discovery of their importance in the physiopathology of atherosclerosis, diabetes, inflammatory diseases and cancer (for review (Tontonoz and Mangelsdorf, 2003)). Being implicated in the regulation of cholesterol balance (Peet et al., 1998), steroid synthesis (Cummins et al., 2006; Maqdasy et al., 2015; David H Volle et al., 2007) and in inflammation (Poli et al., 2013; Vejux and Lizard, 2009), processes necessary for follicular growth and ovulation, one can suggest that LXRs could regulate ovarian physiology. To date, few studies analysed the in vivo roles of LXRs in the ovary. Indeed, both isoforms are expressed in the ovary, with the predominance of LXR" in the oocytes and the granulosa cells (GC) (Mouzat et al., 2009; Steffensen et al., 2006). Furthermore, FF-MAS (follicular fluid-meiosis activating sterol), a known LXR ligand, is one of the major sterols in the ovarian follicle. FF- MAS is implicated in the resumption of oocyte meiosis, serving as an intermediate between gonadotropins and the oocyte (Grøndahl, 2008; Grøndahl et al., 1998; Leonardsen et al., 2000; Marín Bivens et al., 2004). Steffensen et al. first identified that LXR" was necessary for normal ovulation. Indeed, Lxr!-/- and Lxr"-/-;Lxr!-/- are hypofertile beyond 5 month old (Steffensen et al., 2006). Ex vivo analyses showed that meiosis resumption under the influence of FSH or zymosterol (FF-MAS like) is LXR-dependent. Moreover, GW3965, a specific LXR ligand, induces meiosis resumption in wild type oocytes (Steffensen et al., 2006). LXRs are also key regulators of the ovarian response to gonadotropin stimulation. Indeed, induction of ovulation in Lxr"-/-;Lxr!-/- mice is associated with an exaggerated ovarian response manifested by increased number of the ovulated oocytes, massive ovarian enlargement, excessive inflammatory reaction, increased vascular permeability and elevated E2 levels, a phenotype similar to ovarian hyperstimulation syndrome (OHSS) (Mouzat et al., 2009). Indeed, most of the genes encoding steroidogenesis enzymes (Star, Cyp11A1, Cyp19), inflammatory cytokines (interleukines, VEGF), and oocyte maturation (FF-MAS, Kitl) are expressed in the GC (Byskov et al., 2002; Drouineaud et al., 2007; Kamat et al., 1995; Mouzat et al., 2009; Packer et al., 1994; Wang et al., 2006; Wei et al., 2013). Moreover, study of human GC identified LXR! as the major isoform in this compartment, regulating ABCA1, ABCG1, APOE, SR-B1 expression (Drouineaud et al., 2007). Thus, LXR! in the GC could be the primum movens driving normal oocyte maturation and ovulation. In order to gain further insight into the roles of LXR! in the GC, we investigated the ovarian phenotype of a mouse line re-expressing LXR! only in this compartment in a background of Lxr!-/-;Lxr"-/- mice. We used human AMH (anti-müllerian hormone) promoter (Lécureuil et al., 2002; Maqdasy et al., 2015) to target GC-specific expression. This strain of mice, named Lxr!-/-;Lxr"-/-:AMH-Lxr" (Maqdasy et al., 2015), was compared with wild type and Lxr!-/-;Lxr"-/- mice. MATERIALS and METHODS Animals Lxr!-/-;Lxr"-/- mice have been kindly supplied by Mangelsdorf’s laboratory (Repa and Mangelsdorf, 2002) and were maintained on a mixed strain background (C57BL/6:129Sv). Lxr!-/-;Lxr"-/-:AMH-Lxr" mice have been generated in the local transgenesis platform of GReD. All strains were fed ad libitum Global-diet 2016S from Harlan and maintained in 12h light/dark cycles. All the protocols and experiments were approved by the Regional Ethics Committee and already published (Maqdasy et al., 2015; Mouzat et al., 2009). Macroscopic, Histology, Immunohistochemistry and Immunofluorescence Ovaries were collected, carefully examined for follicular haemorrhage, fixed and then embedded in partaffin. Hematoxylin/eosin staining was performed as described previously (David H Volle et al., 2007). Fertility tests Wild type, Lxr!-/-;Lxr"-/- and Lxr!-/-;Lxr"-/-:AMH-Lxr" female mice of 8-10 month- old mate 2-3 month old wild type male mice (2 females with one male in a cage) for breeding. Only females with a vaginal plug were followed up for eventual gestation and birth. Females with an efficient plug gave birth, and the number of pups per litter was counted. Stimulation with gonadotropins 8-10 month old Female mice (wild type, Lxr!-/-;Lxr"-/-, Lxr!-/-;Lxr"-/-:AMH-Lxr") were treated with gonadotropins according to superovulation protocol as previously described (Mouzat et al., 2009). Briefly, mice received an intraperitoneal injection of 7.5 UI of Pregnant mare’s serum gonadotropin (PMSG), followed by 5UI of human chorionic gonadotropin (hCG), with an interval of 46 hours between two injections. Ovaries for histology or molecular analyses were obtained 40 hours after hCG injection. Oocytes with their cumulus were retrieved from the oviduct of the uterine tract 16 hours after hCG injection. They were cultured in DMEM (Invitrogen, Cergy Pontoise, France), supplemented with 20% fetal calf serum and antibiotics. Oocytes were separated from the cumulus thanks to incubation with 0.3% hyaluronidase (Sigma-Aldrich) for 10 minutes and were examined under dissecting microscope. Viability was evaluated according to the presence or absence of a polar body, zona pellucidae, or any other anomalies. FSH and LH Measurements Serum FSH and LH levels were measured by Milliplex® MAP mouse pituitary magnetic bead panel (96-Well Plate Assay MPTMAG-49K) based on the Luminex® xMAP® technology. Western Blot Analysis Proteins were extracted using HEPES 20 mM, NaCl 0.42 M, MgCl2 1.5 mM, EDTA 0.2 mM and NP40 1% supplemented with PMSF 1 mM (Sigma-Aldrich), Complete 1X (Roche Molecular Biochemicals, Meylan, France), NaF 0.1 mM and Na2VO3 0.1 mM (Sigma-Aldrich). Lysates were subjected to 10% SDS-PAGE and blotted onto a nitrocellulose membrane (Amersham Pharmacia Biotech, Orsay, France). Antibodies raised against FLAG to detect the transgene (F7425, Sigma-Aldrich) were used as previously described (Pommier et al., 2013). Study of human granulosa Lutein cells In women who underwent a controlled ovarian stimulation for ICSI (male factor sterility), the retrieved oocytes with their cumulus were treated according to the protocol of the university hospital of Clermont-Ferrand and the oocytes were fertilized with spermatozoa. Cumulus cells were collected and treated for the molecular study (RT-qPCR). Ethical issues The animal analyses are authorized by the local committee of ethics and animal protection. Human sample collection and analyses are authorized by the national committee of ethics and human protection (CPP number…). The university hospital of Clermont-Ferrand is the promoter of the project. qPCR Ovary RNA was isolated using the RNeasy kit (Qiagen, Courtaboeuf, France) and quantifications were performed by RT-qPCR as described previously (Maqdasy et al., 2015). Primer sequences are reported in the supplementary Informations (Table S1). RT-qPCR amplifications were analysed using the !!CT method for relative quantification. Values were normalized to the !-Actin gene expression. Statistical Analysis Data are expressed as the means ± SEM. One-way ANOVA was performed to determine differences between various groups and statistical analysis indicated as: *, p<0.05; **, p<0.01; ***, p<0.001. Wild type 1.0 A 8 B *** Lxr!-/-;Lxr"-/- 6 Lxr!-/-;Lxr"-/-:AMH-Lxr" 0.5 4 ** ** 2 *** * 0 *** *** *** 0 Nr1h3 Nr1h2 Abca1 Abcg1 Srebp1c 60% 100! Living oocyte C D 5 E F 50% 80! 4 40% ***µ! 60! 30% 3 2 40! 20% ** Atretic oocyte 10% 1 20! *** *** 0% 0 0! % efficient Litter size % Living vaginal plugs oocytes G CL CL CL CL Lxr!-/-;Lxr"-/- Lxr!-/-;Lxr"-/- Lxr!-/-;Lxr"-/-:AMH-Lxr" Figure 1. LXR! expression in the granulosa cells is necessary for normal fertility. A. The relative accumulation of the Lxr! (Nr1h3) and Lxr" (Nr1h2) mRNAs in the 8-10 month-old wild-type (white bars), Lxr!#/#;Lxr"#/# (black bars), and Lxr!#/#;Lxr" #/#:AMH-Lxr" (gray bars) ovary samples (n = 10), quantified by RT-qPCR. B. The relative accumulation of the mRNAs coding LXR target genes in ovary extracts from 8-month-old mice of each genotype analysed by RT-qPCR. C. Percentage of efficient vaginal plugs in the 8-10 month-old wild-type (white bars), Lxr!#/#;Lxr"#/# (black bars), and Lxr!#/#;Lxr"#/#:AMH-Lxr" (gray bars). D. Mean number of pups per litter for each genotype after breeding with a wild type mouse. E. Mean percentage of living oocytes retrieved in the oviduct after a protocol of ovarian stimulation in the 8-10 month-old mice. F. Dissecting microscope photograph demonstrating a living versus atretic oocyte lacking zona pellucidae and polar bodies. G. H/E histological examination of ovary sections of the 8-10 month-old mice showing normal corpus Luteum formation in wild-type and Lxr!#/#;Lxr"#/#:AMH-Lxr" strains. The data are expressed as the means ± SEM. Statistical analysis: ***, P < .001, compared with the wild-type mice. RESULTS 1) LXR! expression in the GC is necessary for fertility. In order to better characterise the role of LXR! rescue in physiology of the ovary, Lxr!-/- ;Lxr"-/-:AMH-Lxr" mice were generated by additive transgenesis as characterized in the male mice as already described (Maqdasy et al., 2015). LXR! expression and activity was confirmed by the detection of Lxr" with its target genes (Figure 1 A). The classical ones are normalised when LXR! is re-expressed in the GC (Lxr!- /-;Lxr"-/-:AMH-Lxr" mice). Surprisingly, Abcg1 levels were highly expressed within the ovaries of Lxr!-/-;Lxr"-/- mice (Figure 1 B). When subjected to breeding, wild type, Lxr!-/-;Lxr"-/- female mice were sterile by age of 8 month old with no litters born despite a vaginal plug. Wild type and Lxr!-/-;Lxr"-/-:AMH- Lxr" mice were fertile (Figure 1 C and D). The sterility in Lxr!-/-;Lxr"-/- mice was concordant with a drastic reduction of the percentage of living oocytes in these mice (18% of the total number) which is restored with LXR! re-expression (Figure 1 E and F). Furthermore, histological examination of ovary sections reveals multiple corpora lutea in Lxr!-/-;Lxr"-/-:AMH-Lxr" mice, suggesting a restoration of the normal ovulation. These results indicate that adult mice lacking LXR in the GC develop sterility due to oocyte death and abnormal corpus luteum development. 2) LXR! is necessary for the granulosa cell physiology Granulosa cells form a nursing niche for the oocytes during the follicular maturation. They secrete paracrine factors modulating oocyte growth and maturation (AMH, KitL) (Durlinger et al., 1999; Parrott and Skinner, 2000) (Winterhager and Kidder, 2015) and theca cell steroid synthesis (Inh!, Ar, estradiol) (Hillier, 2001; Lubahn et al., 1993; Sen et al., 2014) using micro channels (Cnx43) to exchange nutrients, and autocrine factors implicated in cumulus expansion and steroid synthesis (Lrh-1) (Duggavathi et al., 2008). Absence of LXR! is responsible for the deregulation of most of these factors in the basal (Figure 2 A) and post- gonadotropin stimulation (Figure 2 B) situations, indicating its necessity for a normal GC physiology. Specialized GC form the cumulus oophorus that surround the oocyte. The cumulus secretes extracellular matrix leading to its expansion and stimulates meiosis resumption in the oocytes just before ovulation. Ptgs2 and Tnfaip6 are known to encode proteins implicated in cumulus expansion. The expression of these markers is significantly altered in the absence of LXR! in the GC (Figure 2 C and D). These anomalies are completely restored in Lxr!-/-;Lxr"-/-:AMH-Lxr" mice. Overall, GC physiology is greatly ** 2.5 A 2 1.5 1 * * 0.5 ** ** 0 Cnx43 Inh! KitL Lrh-1 Ar 1.5 B 1 * ** * * *** 0.5 *** 0 Cnx43 Inh! KitL Lrh-1 Ar 2 C D !"* * Wild type 1 Lxr!-/-;Lxr#-/- Lxr!-/-;Lxr#-/-:AMH-Lxr# 0 Ptgs2 Tnfaip6 Figure 2. LXR! is necessary for the granulosa cell physiology and preovulation remodeling. A. The relative accumulation of mRNA of different granulosa cell markers in the 8-10 month-old wild-type (white bars), Lxr!"/";Lxr#"/" (black bars), and Lxr!"/";Lxr#"/ ":AMH-Lxr# (gray bars) ovary samples (n = 5-10 per group), quantified by RT-qPCR. B. The relative accumulation of mRNA of cumulus oophorus markers, implicated in cumulus expansion during ovulation, in the 8-10 month-old wild-type (white bars), Lxr!"/";Lxr#"/" (black bars), and Lxr!"/";Lxr#"/":AMH-Lxr# (gray bars) ovary samples (n = 5-10) quantified by RT-qPCR. C. H/E of a Graafian follicle showing defective cumulus expansion after hormonal stimulation; left-to-right: normal vs defective expansion respectively. D. The relative accumulation of mRNA of different granulosa cell markers in the 8-10 month-old wild-type (white bars), Lxr!"/";Lxr#"/" (black bars), and Lxr!"/";Lxr#"/ ":AMH-Lxr# (gray bars) ovary samples (n=5-10) after hormonal stimulation (PMSG and hCG), quantified by RT-qPCR. The data are expressed as the means ± SEM. Statistical analysis: ***, P < .001, compared with the wild-type mice. dependent on LXR!. These defects participate actively in the poor quality of the oocytes and consequently on the fertility. 3) The endocrine activity of the ovary is regulated by LXR! expression in the GC. Follicle growth, oocyte maturation, cumulus expansion and the paracrine activity of the GC are modulated by androgens and estradiol (Dubois et al., 2016). Both GC and theca cells (TC) reciprocally cooperate to optimise the synthesis and secretion of oestrogens, progesterone and androgens by the ovary (Figure 3A). Indeed, GC influence TC for androgen production, and aromatize it to oestrogens. Furthermore, they regulate, by retro control mechanisms, the gonadotropin levels. All the mRNA of genes encoding steroid synthesis are drastically reduced in Lxr!-/-;Lxr"-/- mice (Figure 3B). Plasma FSH and LH levels are also decreased (Figure 3C). Moreover, Transcripts of Fshr, Lhr, Cyp19 and Er! have the same pattern (Figure 3D and E). These anomalies are restored in Lxr!-/-;Lxr"-/-:AMH-Lxr" mice. Thus, absence of LXR! is associated with a complete deregulation of the pituitary-ovarian axis and the ovarian steroidogenic activity. Such a molecular profile with low gonadotropin levels suggests an enhanced bioavailability of basal estradiol. 4) LXR! expression in the GC is necessary to regulate the ovarian response to gonadotropins. Ovaries from Lxr!-/-;Lxr"-/- mice are characterized by an exaggerated response to gonadotropins developing an OHSS. Nevertheless, the origin this phenotype is not well explained. In Lxr!-/-;Lxr"-/-:AMH-Lxr" mice, LXR! re-expression in the GC restored the ovarian response upon stimulation by gonadotropins. The ovary weight is normalized (Figure 4A) and the homorrhagic follicles disappeared (Figure 4 B, C). Hormonal stimulation induced an abnormal ovulation of atretic oocytes in the absence of LXR! (Figure 4 D,E). One of the explanations is low Amh transcript in the ovary (Figure 4 F). Indeed, AMH is secreted by the GC of the advanced stages of folliculogenesis and inhibits follicle transition. Low AMH could remove the negative feedback exerted by GC leading to an excessive folliculogenesis. Exploration of the inflammatory profile in the ovary by RT-qPCR reveal an exaggerated response to gonadotropins by an excessive accumulation of transcripts of Pedf (pigment epithelium-derived factor) and Vegf (vascular endothelial growth factor) and a decrease of sIl6r! (Soluble IL-6 receptor alpha) (Wei et al., 2013) in Lxr!-/-;Lxr"-/- mice. The profile of Lxr!-/-;Lxr"-/-:AMH-Lxr" mice seems identical to wild type mice. LHR Cholesterol A STAR PKA CYP11A1 !!"#$% C 200 Androstenedione TC Cholesterol GC Androstenedione 100 STAR * Cyp19 * CYP11A1 ** 3!HSD PKA levels % Plasma Estrone Wild type 0 Progesterone 17BHSD1 FSH LH Lxr!-/-;Lxr#-/- FSHR E2 Lxr!-/-;Lxr#-/-:AMH-Lxr# B 2 1.5 1 0.5 * *** *** *** 0 Star Hsd3b Cyp11a1 Cyp17 Hsd17b E 2 2 D 1.5 1 1 * 0.5 ** ** * 0 0 Fshr Lhr Cyp19 Er! Figure 3. LXR! regulates the endocrine activity of the ovary. A. Schematic representation of steroidogenesis in the granulosa and theca cells. B. The relative accumulation of mRNA of genes coding the the steroidogenic enzymes in the 8-10 month-old ovary samples (n =5-10) of 8-10 month-old wild-type (white bars), Lxr!"/";Lxr#"/" (black bars), and Lxr!"/";Lxr#"/":AMH-Lxr# (gray bars) ovary samples (n =5-10) quantified by RT-qPCR. C. Plasma FSH and LH concentrations for the three respective mouse strains. Results expressed as % of the wild type levels. D. The relative accumulation of mRNA of genes coding the gonadotropin receptors in the 8-10 month-old wild-type (white bars), Lxr!"/";Lxr#"/" (black bars), and Lxr!"/ ";Lxr#"/":AMH-Lxr# (gray bars) ovary samples (n =5-10) of the three respective mouse strains quantified by RT-qPCR. E. The relative accumulation of mRNA of aromatase and oestrogen receptor ! in the 8-10 month-old ovary samples (n =5-10) of the three respective mouse strains quantified by RT-qPCR. The data are expressed as the means ± SEM. Statistical analysis: ***, P < .001, compared with the wild-type mice. Overall, Lxr!-/-;Lxr"-/-:AMH-Lxr" mice regain a normal ovarian morphology after the hormonal stimulation. LXR! in the GC prevents excessive defective oogenesis, restores normal ovulation and inhibits an excessive inflammatory response. Thus, LXR! is a gatekeeper against OHSS. 5) LXR! expression and activity are downregulated in the granulosa lutein cells of women at high risk for OHSS. To explore the role of LXR in the development of OHSS in women, we analysed the expression of LXRs and their target genes in the granulosa lutein cells of women at high risk for OHSS (10 patients). Briefly, granulosa lutein cells of women who underwent controlled hormonal stimulation for medically assisted procreation were collected for molecular analyses. LXR" and less significantly LXR! transcript levels were reduced in women with high number of oocytes (high risk of OHSS). 8 A B C *** * 7 16 *** 6 14 5 12 10 1cm 4 8 3 6 2 4 Number of hemorrhagic follicles follicles of hemorrhagic Number 1 2 Ovary weight (mg) post-stimulation post-stimulation (mg) Ovary weight 0 0 100 25 D E F 80 *** 20 60 Wild type 15 1 Lxr!-/-;Lxr"-/- 10 40 * % oocyte atresia atresia % oocyte 20 Lxr!-/-;Lxr"-/-:AMH-Lxr" Oocyte number number Oocyte 5 0 0 0 3 Amh G 2 ** * *** 1 ** 0 - + - + - + - + - + - + - + - + - + Pedf Vegf sIl6R Figure 4. LXR! expression in the granulosa cells prevents ovarian hyperstimulation. A. Ovary weight (mg) in the 8-10 month-old wild-type (white bars), Lxr!#/#;Lxr"#/# (black bars), and Lxr!#/#;Lxr"#/#:AMH-Lxr" (gray bars) (n = 40 per group) after hormonal hyperstimulation (PMSG then hCG). B. H/E of ovarian sections of the three strains demonstrating normal wild-type and Lxr!#/ #;Lxr"#/#:AMH-Lxr" mice) vs exaggerated response to gonadotropins (Lxr!#/#;Lxr" #/# mice). C. The mean number of haemorrhagic follicles in the ovaries (n=10/group) of the three strains after the hormonal hyperstimulation. D. The relative accumulation of mRNA of the gene coding antimullerian hormone in the ovary of the 3 strains, quantified by RT-qPCR. E. The relative accumulation of mRNA of the genes coding inflammatory cytokines involved in the ovarian hyperstimulation syndrome, quantified by RT-qPCR. The data are expressed as the means ± SEM. Statistical analysis: ***, P < .001, compared with the wild-type mice. <15 oocytes $#!" >15 oocytes $!!" * #!" !" NR1H3 NR1H2 Figure 5. LXR expression and activity are downregulated in the granulosa lutein cells of women at high risk for OHSS. A. The relative accumulation of mRNA of genes coding LXR! and LXR" hormone in the granulosa cells of women undergone ovarian stimulation during medically assisted procreation, quantified by RT-qPCR. Comparison between women with (>15 oocytes) or without (<15 oocytes) exaggerated ovarian response to gonadotropins. The data are expressed as the means ± SEM. Statistical analysis: ***, P < .001, compared with the wild-type mice. DISCUSSION In this article, we analysed a new mouse strain re-expressing LXR! specifically in the granulosa cells in Lxr!-/-;Lxr"-/- background. Herein, we demonstrate the pivotal role of LXR! in the regulation of the GC physiology and impact the ovarian function as whole. It is necessary for normal follicle maturation and oocyte survival, ovulation and steroid synthesis. Moreover, LXR! prevents OHSS development in our mouse model. Furthermore, we demonstrate that women at high risk for OHSS have lower LXR expression and activity. This study was motivated by the increasing body of literature describing novel biological roles of LXRs in the regulation of steroid synthesis and inflammation, two processes necessary for follicle maturation and ovulation (Cummins et al., 2006; Joseph et al., 2003; Maqdasy et al., 2015; Mouzat et al., 2013, 2009; David H Volle et al., 2007). Both LXR ! and " are expressed in the cumulus and oocytes of mice with the predominance of beta isoform (Steffensen et al., 2006). Nevertheless, it was not known whether LXR in the GC or oocytes is the master regulator of oocyte maturation. Indeed, the GC are the nursing niche supporting growth and maturation of the oocytes and permitting the effect of gonadotropins on oocyte meiosis resumption and ovulation. Steffensen et al. demonstrated that LXR activation by GW3965 induced meiosis resumption only in naked oocytes in vitro. This remains controversial, as Grøndahl et al. did not identify this effect. Indeed, they treated oocytes with different oxysterols including FF-MAS, and only FF-MAS induced oocyte meiosis resumption. Our results minimize the effect of oocyte-related LXR and guide the scoop on the GC-LXR. We identify LXR in the GC as necessary for oocyte survival and maturation, thus, important for normal fertility. Indeed, LXR could be the intermediate to modulate FSH effects on oocyte maturation and survival. This is supported by the evidence that FSH activates Lxr! and Abca1 in oocyte-cumulus complex retrieved from wild type ovaries, and that meiosis resumption with FSH stimulation is abolished in Lxr!-/- ;Lxr"-/- mice (Steffensen et al., 2006). We demonstrate that most of the paracrine factors originating from the GC in the Lxr!-/-;Lxr"-/- mice are deregulated even post gonadotropin stimulation confirming this hypothesis. LXRs are thus necessary for FSH signaling in the ovary. Oocyte meiosis is greatly dependent on FF-MAS signaling and cholesterol levels. Defects in the accumulation of FF-MAS under FSH stimulation (Grøndahl, 2008; Leonardsen et al., 2000) or abnormal free cholesterol levels (Yesilaltay et al., 2014) could be present in Lxr!-/-;Lxr"-/- mice, as LXR target genes implicated in cholesterol and fatty acid metabolism are disturbed. Thus, our results identify LXR in the GC as the mediator of the effect of FSH and oxysterols on oocyte maturation (Yding Andersen et al., 1999). Beyond oocyte maturation, Lxr!-/-;Lxr"-/- mice have ovulatory defects. Nevertheless, they seem to be late. This is supported by the reduction of the number of corpora lutea in the ovaries of these mice. Indeed, ovulation is a pro-inflammatory process stimulated by gonadotropin surge in mid-cycle on the cumulus cells leading to the rupture of the mature follicle (Smolikova et al., 2012). We found that mRNA abundance of Lrh-1, Ptgs2 (Cox2) and Tnfaip6 (granulosa cell specific markers) to be substantially deregulated in Lxr!-/-;Lxr"-/- mice and normalised in Lxr!-/-;Lxr"-/-:AMH-Lxr" mice. This reveals a potential mechanism for failure of cumulus expansion (Duggavathi et al., 2008; Lim et al., 1997). Inversely, ovulation will be associated with an excessive inflammatory response and haemorrhage in the absence of LXR. This is in line with the role of LXRs as anti-inflammatory receptors (Joseph et al., 2003). The ovary synthesizes steroid hormones from cholesterol, which is delivered by SR- BI. TC synthesize androgens under the influence of LH that stimulates CYP11A1, HSD3B2 and CYP17. The androgens diffuse to the GC to be aromatised to estradiol by CYP19, which is drived by FSH. Estradiol synthesis is thus a coordinated process employing a paracrine dialogue between the GC and theca cells from one side, and the gonadotropin secretion from the pituitary gland on the other side. Enhanced estradiol is associated with lower LH and FSH levels blocking follicle growth, cumulus expansion and ovulation. In the absence of LXR, estradiol concentrations are supposed to be increased. Thus, LXRs in the GC seem to be a gatekeeper against uncontrolled steroidogenesis. This should be confirmed by the measurement of E2 levels in the plasma and the ovary. Ovulation is an inflammatory reaction (Richards et al., 2008). OHSS is characterized by an exaggerated response to gonadotropins with ovarian enlargement, massive inflammatory reaction and increased capillary permeability leading to life threatening complications (Humaidan et al., 2010). Indeed, many studies demonstrated the implication of the inflammatory, angiogenic and anti-angiogenic factors such as interleukins, VEGF and PEDF in the physiopathology of OHSS (Artini et al., 2002; Bar-Joseph et al., 2016; Chen et al., 2000; Chuderland et al., 2013; Miller et al., 2015; Wei et al., 2013). Although, VEGF levels and increased IL-6 signaling are linked to OHSS, no molecular driver is yet identified. Indeed, VEGF increment and vascular permeability is the main manifestation of OHSS. As LXRs are suggested anti-inflammatory receptors and inhibitors of the downstream of VEGF signaling, they are potentially implicated in the prevention of OHSS (Beyer et al., 2015; Joseph et al., 2003; Noghero et al., 2012; Nunomura et al., 2015). Moreover, most of these cytokines originate from the GC in the ovary, suggesting a premium role of these cells in the physiopathology of OHSS. We have previously demonstrated that Lxr!-/-;Lxr"-/- mice develop OHSS. Herein, we demonstrate that GC is the central figure in the physiopathology of OHSS. Re-expression of LXR! in this compartment prevents OHSS development and restores the ovarian response to gonadotropins. LXR! regulates the secretion of the inflammatory cytokines from GC. These cytokines will influence the endothelial cells increasing vascular permeability of the interstitial compartment. It has recently been reported that IL-6 is not the major player in OHSS physiopathology and the IL-6 trans-signaling through soluble 1L-6 receptor (sIL-6R") which is expressed in the GC, stimulated by gonadotropins and modulates VEGF secretion (Wei et al., 2013). Our mouse model supports these data, as sIL-6R" mRNA levels are increased in Lxr!-/-;Lxr"-/- mice and persist after hormonal stimulation. This is associated with an excessive Vegf transcription after gonadotropin stimulation. Besides, sIL-6R" is a marker of GC apoptosis (Maeda et al., 2007). Thus, high basal sIL-6R" mRNA levels could point out a higher number of apoptotic GC in Lxr!-/-;Lxr"-/- mice. The latter could participate in the defects of oocyte maturation and ovulation. Female reproduction is a complex process, largely affected by the weight variations and the rate of metabolism which are altered in Lxr!-/-;Lxr"-/- mice. Besides, they are characterized by myometrial dystocia and placenta anomalies. All these factors could affect the fertility in these mice. Nevertheless, these anomalies are minimal as they are presumed to persist in Lxr!-/-;Lxr"-/-:AMH-Lxr" mice. In conclusion, these results demonstrate that LXR in the GC is a pleiotropic regulator of multiple mechanisms essential for follicle maturation, oocyte survival and for controlled ovulation. LXR is therefore a potential target to regulate female fertility and to prevent OHSS. REFERENCES Artini, P.G., Monti, M., Fasciani, A., Battaglia, C., D’Ambrogio, G., Genazzani, A.R., 2002. Vascular endothelial growth factor, interleukin-6 and interleukin-2 in serum and follicular fluid of patients with ovarian hyperstimulation syndrome. Eur. J. Obstet. Gynecol. Reprod. Biol. 101, 169–174. Bar-Joseph, H., Ben-Ami, I., Ron-El, R., Shalgi, R., Chuderland, D., 2016. Pigment epithelium-derived factor regulation by human chorionic gonadotropin in granulosa cells. Reprod. Camb. Engl. 151, 179–185. doi:10.1530/REP-15-0478 Beyer, C., Huang, J., Beer, J., Zhang, Y., Palumbo-Zerr, K., Zerr, P., Distler, A., Dees, C., Maier, C., Munoz, L., Krönke, G., Uderhardt, S., Distler, O., Jones, S., Rose-John, S., Oravecz, T., Schett, G., Distler, J.H.W., 2015. Activation of liver X receptors inhibits experimental fibrosis by interfering with interleukin-6 release from macrophages. Ann. Rheum. Dis. 74, 1317–1324. doi:10.1136/annrheumdis-2013-204401 Byskov, A.G., Andersen, C.Y., Leonardsen, L., 2002. Role of meiosis activating sterols, MAS, in induced oocyte maturation. Mol. Cell. Endocrinol. 187, 189–196. Chen, C.D., Chen, H.F., Lu, H.F., Chen, S.U., Ho, H.N., Yang, Y.S., 2000. Value of serum and follicular fluid cytokine profile in the prediction of moderate to severe ovarian hyperstimulation syndrome. Hum. Reprod. Oxf. Engl. 15, 1037–1042. Chuderland, D., Ben-Ami, I., Kaplan-Kraicer, R., Grossman, H., Ron-El, R., Shalgi, R., 2013. The role of pigment epithelium-derived factor in the pathophysiology and treatment of ovarian hyperstimulation syndrome in mice. J. Clin. Endocrinol. Metab. 98, E258–266. doi:10.1210/jc.2012-3037 Cummins, C.L., Volle, D.H., Zhang, Y., McDonald, J.G., Sion, B., Lefrançois-Martinez, A.- M., Caira, F., Veyssière, G., Mangelsdorf, D.J., Lobaccaro, J.-M.A., 2006. Liver X receptors regulate adrenal cholesterol balance. J. Clin. Invest. 116, 1902–1912. doi:10.1172/JCI28400 Drouineaud, V., Sagot, P., Garrido, C., Logette, E., Deckert, V., Gambert, P., Jimenez, C., Staels, B., Lagrost, L., Masson, D., 2007. Inhibition of progesterone production in human luteinized granulosa cells treated with LXR agonists. Mol. Hum. Reprod. 13, 373–379. doi:10.1093/molehr/gam019 Dubois, S.L., Wolfe, A., Radovick, S., Boehm, U., Levine, J.E., 2016. Estradiol Restrains Prepubertal Gonadotropin Secretion in Female Mice via Activation of ER! in Kisspeptin Neurons. Endocrinology en20151923. doi:10.1210/en.2015-1923 Duggavathi, R., Volle, D.H., Mataki, C., Antal, M.C., Messaddeq, N., Auwerx, J., Murphy, B.D., Schoonjans, K., 2008. Liver receptor homolog 1 is essential for ovulation. Genes Dev. 22, 1871–1876. doi:10.1101/gad.472008 Durlinger, A.L., Kramer, P., Karels, B., de Jong, F.H., Uilenbroek, J.T., Grootegoed, J.A., Themmen, A.P., 1999. Control of primordial follicle recruitment by anti-Müllerian hormone in the mouse ovary. Endocrinology 140, 5789–5796. doi:10.1210/endo.140.12.7204 Grøndahl, C., 2008. Oocyte maturation. Basic and clinical aspects of in vitro maturation (IVM) with special emphasis of the role of FF-MAS. Dan. Med. Bull. 55, 1–16. Grøndahl, C., Ottesen, J.L., Lessl, M., Faarup, P., Murray, A., Grønvald, F.C., Hegele- Hartung, C., Ahnfelt-Rønne, I., 1998. Meiosis-activating sterol promotes resumption of meiosis in mouse oocytes cultured in vitro in contrast to related oxysterols. Biol. Reprod. 58, 1297–1302. Hillier, S.G., 2001. Gonadotropic control of ovarian follicular growth and development. Mol. Cell. Endocrinol. 179, 39–46. Humaidan, P., Quartarolo, J., Papanikolaou, E.G., 2010. Preventing ovarian hyperstimulation syndrome: guidance for the clinician. Fertil. Steril. 94, 389–400. doi:10.1016/j.fertnstert.2010.03.028 Joseph, S.B., Castrillo, A., Laffitte, B.A., Mangelsdorf, D.J., Tontonoz, P., 2003. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat. Med. 9, 213–219. doi:10.1038/nm820 Kamat, B.R., Brown, L.F., Manseau, E.J., Senger, D.R., Dvorak, H.F., 1995. Expression of vascular permeability factor/vascular endothelial growth factor by human granulosa and theca lutein cells. Role in corpus luteum development. Am. J. Pathol. 146, 157–165. Lécureuil, C., Fontaine, I., Crepieux, P., Guillou, F., 2002. Sertoli and granulosa cell-specific Cre recombinase activity in transgenic mice. Genes. N. Y. N 2000 33, 114–118. doi:10.1002/gene.10100 Leonardsen, L., Wiersma, A., Baltsen, M., Byskov, A.G., Andersen, C.Y., 2000. Regulation of spontaneous and induced resumption of meiosis in mouse oocytes by different intracellular pathways. J. Reprod. Fertil. 120, 377–383. Lim, H., Paria, B.C., Das, S.K., Dinchuk, J.E., Langenbach, R., Trzaskos, J.M., Dey, S.K., 1997. Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91, 197–208. Lubahn, D.B., Moyer, J.S., Golding, T.S., Couse, J.F., Korach, K.S., Smithies, O., 1993. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc. Natl. Acad. Sci. U. S. A. 90, 11162– 11166. Maeda, A., Goto, Y., Matsuda-Minehata, F., Cheng, Y., Inoue, N., Manabe, N., 2007. Changes in expression of interleukin-6 receptors in granulosa cells during follicular atresia in pig ovaries. J. Reprod. Dev. 53, 727–736. Maqdasy, S., El Hajjaji, F.-Z., Baptissart, M., Viennois, E., Oumeddour, A., Brugnon, F., Trousson, A., Tauveron, I., Volle, D., Lobaccaro, J.-M.A., Baron, S., 2015. Identification of the functions of Liver X Receptor ! in Sertoli cells using a targeted expression-rescue model. Endocrinology en20151382. doi:10.1210/en.2015-1382 Marín Bivens, C.L., Lindenthal, B., O’Brien, M.J., Wigglesworth, K., Blume, T., Grøndahl, C., Eppig, J.J., 2004. A synthetic analogue of meiosis-activating sterol (FF-MAS) is a potent agonist promoting meiotic maturation and preimplantation development of mouse oocytes maturing in vitro. Hum. Reprod. Oxf. Engl. 19, 2340–2344. doi:10.1093/humrep/deh436 Miller, I., Chuderland, D., Ron-El, R., Shalgi, R., Ben-Ami, I., 2015. GnRH Agonist Triggering Modulates PEDF to VEGF Ratio Inversely to hCG in Granulosa Cells. J. Clin. Endocrinol. Metab. 100, E1428–1436. doi:10.1210/jc.2015-2312 Mouzat, K., Baron, S., Marceau, G., Caira, F., Sapin, V., Volle, D.H., Lumbroso, S., Lobaccaro, J.-M., 2013. Emerging roles for LXRs and LRH-1 in female reproduction. Mol. Cell. Endocrinol. 368, 47–58. doi:10.1016/j.mce.2012.06.009 Mouzat, K., Volat, F., Baron, S., Alves, G., Pommier, A.J.C., Volle, D.H., Marceau, G., DeHaze, A., Déchelotte, P., Duggavathi, R., Caira, F., Lobaccaro, J.-M.A., 2009. Absence of nuclear receptors for oxysterols liver X receptor induces ovarian hyperstimulation syndrome in mice. Endocrinology 150, 3369–3375. doi:10.1210/en.2008-1519 Noghero, A., Perino, A., Seano, G., Saglio, E., Lo Sasso, G., Veglio, F., Primo, L., Hirsch, E., Bussolino, F., Morello, F., 2012. Liver X receptor activation reduces angiogenesis by impairing lipid raft localization and signaling of vascular endothelial growth factor receptor-2. Arterioscler. Thromb. Vasc. Biol. 32, 2280–2288. doi:10.1161/ATVBAHA.112.250621 Nunomura, S., Okayama, Y., Matsumoto, K., Hashimoto, N., Endo-Umeda, K., Terui, T., Makishima, M., Ra, C., 2015. Activation of LXRs using the synthetic agonist GW3965 represses the production of pro-inflammatory cytokines by murine mast cells. Allergol. Int. Off. J. Jpn. Soc. Allergol. 64 Suppl, S11–17. doi:10.1016/j.alit.2015.03.001 Packer, A.I., Hsu, Y.C., Besmer, P., Bachvarova, R.F., 1994. The ligand of the c-kit receptor promotes oocyte growth. Dev. Biol. 161, 194–205. doi:10.1006/dbio.1994.1020 Parrott, J.A., Skinner, M.K., 2000. Kit ligand actions on ovarian stromal cells: effects on theca cell recruitment and steroid production. Mol. Reprod. Dev. 55, 55–64. doi:10.1002/(SICI)1098-2795(200001)55:1<55::AID-MRD8>3.0.CO;2-L Peet, D.J., Turley, S.D., Ma, W., Janowski, B.A., Lobaccaro, J.M., Hammer, R.E., Mangelsdorf, D.J., 1998. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93, 693–704. Poli, G., Biasi, F., Leonarduzzi, G., 2013. Oxysterols in the pathogenesis of major chronic diseases. Redox Biol. 1, 125–130. doi:10.1016/j.redox.2012.12.001 Pommier, A.J.C., Dufour, J., Alves, G., Viennois, E., De Boussac, H., Trousson, A., Volle, D.H., Caira, F., Val, P., Arnaud, P., Lobaccaro, J.-M.A., Baron, S., 2013. Liver x receptors protect from development of prostatic intra-epithelial neoplasia in mice. PLoS Genet. 9, e1003483. doi:10.1371/journal.pgen.1003483 Repa, J.J., Mangelsdorf, D.J., 2002. The liver X receptor gene team: potential new players in atherosclerosis. Nat. Med. 8, 1243–1248. doi:10.1038/nm1102-1243 Richards, J.S., Liu, Z., Shimada, M., 2008. Immune-like mechanisms in ovulation. Trends Endocrinol. Metab. TEM 19, 191–196. doi:10.1016/j.tem.2008.03.001 Sen, A., Prizant, H., Light, A., Biswas, A., Hayes, E., Lee, H.-J., Barad, D., Gleicher, N., Hammes, S.R., 2014. Androgens regulate ovarian follicular development by increasing follicle stimulating hormone receptor and microRNA-125b expression. Proc. Natl. Acad. Sci. U. S. A. 111, 3008–3013. doi:10.1073/pnas.1318978111 Smolikova, K., Mlynarcikova, A., Scsukova, S., 2012. Role of interleukins in the regulation of ovarian functions. Endocr. Regul. 46, 237–253. Steffensen, K.R., Robertson, K., Gustafsson, J.-A., Andersen, C.Y., 2006. Reduced fertility and inability of oocytes to resume meiosis in mice deficient of the Lxr genes. Mol. Cell. Endocrinol. 256, 9–16. doi:10.1016/j.mce.2006.03.044 Tontonoz, P., Mangelsdorf, D.J., 2003. Liver X receptor signaling pathways in cardiovascular disease. Mol. Endocrinol. Baltim. Md 17, 985–993. doi:10.1210/me.2003-0061 Vejux, A., Lizard, G., 2009. Cytotoxic effects of oxysterols associated with human diseases: Induction of cell death (apoptosis and/or oncosis), oxidative and inflammatory activities, and phospholipidosis. Mol. Aspects Med. 30, 153–170. doi:10.1016/j.mam.2009.02.006 Volle, D.H., Duggavathi, R., Magnier, B.C., Houten, S.M., Cummins, C.L., Lobaccaro, J.- M.A., Verhoeven, G., Schoonjans, K., Auwerx, J., 2007. The small heterodimer partner is a gonadal gatekeeper of sexual maturation in male mice. Genes Dev. 21, 303–315. doi:10.1101/gad.409307 Volle, D.H., Mouzat, K., Duggavathi, R., Siddeek, B., Déchelotte, P., Sion, B., Veyssière, G., Benahmed, M., Lobaccaro, J.-M.A., 2007. Multiple roles of the nuclear receptors for oxysterols liver X receptor to maintain male fertility. Mol. Endocrinol. Baltim. Md 21, 1014– 1027. doi:10.1210/me.2006-0277 Wang, C., Xie, H., Song, X., Ning, G., Yan, J., Chen, X., Xu, B., Ouyang, H., Xia, G., 2006. Lanosterol 14alpha-demethylase expression in the mouse ovary and its participation in cumulus-enclosed oocyte spontaneous meiotic maturation in vitro. Theriogenology 66, 1156– 1164. doi:10.1016/j.theriogenology.2006.01.065 Wei, L.-H., Chou, C.-H., Chen, M.-W., Rose-John, S., Kuo, M.-L., Chen, S.-U., Yang, Y.-S., 2013. The role of IL-6 trans-signaling in vascular leakage: implications for ovarian hyperstimulation syndrome in a murine model. J. Clin. Endocrinol. Metab. 98, E472–484. doi:10.1210/jc.2012-3462 Winterhager, E., Kidder, G.M., 2015. Gap junction connexins in female reproductive organs: implications for women’s reproductive health. Hum. Reprod. Update 21, 340–352. doi:10.1093/humupd/dmv007 Yding Andersen, C., Leonardsen, L., Ulloa-Aguirre, A., Barrios-De-Tomasi, J., Moore, L., Byskov, A.G., 1999. FSH-induced resumption of meiosis in mouse oocytes: effect of different isoforms. Mol. Hum. Reprod. 5, 726–731. Yesilaltay, A., Dokshin, G.A., Busso, D., Wang, L., Galiani, D., Chavarria, T., Vasile, E., Quilaqueo, L., Orellana, J.A., Walzer, D., Shalgi, R., Dekel, N., Albertini, D.F., Rigotti, A., Page, D.C., Krieger, M., 2014. Excess cholesterol induces mouse egg activation and may cause female infertility. Proc. Natl. Acad. Sci. U. S. A. 111, E4972–4980. doi:10.1073/pnas.1418954111 ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%##"&'()'*(+,-#.,$/"0,#( !"#$%&'#()*+#,$%-$)"*,$.%/0$.#/#$)%$,)123$)"#$/%4#$%-$5678!*9$)"#$:%9;2$<"3,*%4%:3=$ >#$ 2#?%9,)/;)#$ )";)$ 5678$ ";,$ ?14)*<4#$ /%4#,$ .*)"*9$ @#/)%4*$ ;92$ 5#32*:$ (#44,A$ &1)$ /#B #C !" #$%&'()&*+,*-./0'1&234,-52'*350564& 12 3&%#,(4&*,5#( D9$%1/$,)123A$.#$2#?%9,)/;)#2$)"#$*?<%/);9(#$%-$5678$*9$)"#$<"3,*%4%:3$%-$@#/)%4*$ (#44,=$5678$*,$*92*,<#9,;&4#$)%$/#:14;)#$4*<*2$"%?#%,);,*,$*9$)"*,$(%?<;/)?#9)$&3$ 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%&'()* "++")#* &+* #,"* '(-(.* /$)0&'"1* &2* #,"* (2#"3)"''0'$3* 402)#(&215* 6"1#&3$#(&2* &+* #,"* %$33("3* 10--&3#1* #,"* 3&'"* &+* '&)$'* +$)#&31* 3$#,"3* #,$2* "7#3(21()* &2"1* 10),* $1* #,83&(.* ,&3!&2"19*:3&;#,*+$)#&31*<=>?@AB*&3*$2.3&:"21*;,(),*)&0'.*$++")#*#,"*%$33("3*$2.*10--&1".* #&*%"*$'#"3".*(2*!"#$%&'&()*+!"#%,!()"*CDEAF5** =2* &3."3* #&* .")(-,"3* #,"* 3"'$#(&21,(-* %"#;""2* '(-(.* /$)0&'"1* $2.* GHG9* ;"* 10::"1#* 1#0.8(2:* #,"* '"/"'* &+* "7-3"11(&2* &+* #,"* -3&#"(21* )&21#(#0#(2:* #,"* GHG* !"#"$%&"'"(()*+"$%,'-*."''*/&"0,%1/"*-(*0,%*(233-.-"0%*%,*"4/'5-0*%&"*(%"$-'-%16*7"(/-%"* %&"* 0,$85'-95%-,0* ,3* 8,(%* ,3* +"$%,'-* ."''* 320.%-,0(* -0* !"#$%&'&()*+!"#%, 8-."-, %&"1* (%-''* $"85-0*(%"$-'"6*."#/0123&'&*8-."*:(/".-3-.*;<=*-0#5'->5%-,0*,0*?@?%A*5$"*.&5$5.%"$-(">*B1*'-/->* 5..282'5%-,0*-0*+"$%,'-*."''(*B2%*%&"1*$"85-0*3"$%-'"6*<2$%&"$8,$")*!"#%&'&*8-."*/$"("0%*C-%&* .&,'"(%"$1'*"(%"$*5..282'5%-,0*C-%&,2%*501*,B#-,2(*>"3".%(6*D&"("*5$E28"0%(*(2EE"(%*%&5%* %&"* +"$%,'-* ."''* /&"0,%1/"* -(* 0,%* (233-.-"0%* 50>* ,%&"$* /&"0,%1/"(* .,F"4-(%* '"5>-0E* %,* %&"* (%"$-'-%1*GHIJ)HIKL6* * • !"#$%&'("))'*+#,%-)-&#.' !"#$%&'&, 8-."* 5$"* 5'(,* .&5$5.%"$-9">* B1* ',C* %"(%,(%"$,0"* '"#"'(* 3$,8* H* 8,0%&(* ,'>* GMN)MOL6* D&-(* /&"0,%1/"* .,2'>* 5'(,* /5$%-.-/5%"* -0* %&"* (%"$-'-%1* ,3* %&"("* 8-."6* P,''"* "%* 045, >"(.$-B">* %&-(* /&"0,%1/"* 5(* Q@?$F>"/"0>"0%)* C&-.&* -(* %&"* 85R,$* -(,3,$8* -0* Q"1>-E* ."''(6* Q@?S,-(*/5$%*,3*02.'"5$*$"."/%,$(*%&5%*$"E2'5%"*(%"$,->*(10%&"(-(*:;?)*T?)*+ *+,-./.0*+,1./.% *+,-./.0*+,1./.2345.*+,1% '" " (" '!" &#$" (" 3'456" +*.*+2 &$" &" "=&" +*.*+2 &!" " %#$" 3/@A" ?@ %$" "> /)01 %" (" %!" !#$" $" 789:,9*2-;<+,:* )*+,-.*" !" !"#$ %"&'$ !" !"#$%&'!()*!+,-&.$'/!,#$/01#/$!#/!-2'!-',3,!.4!5#16!-78'9!()"#*+*,()"-*+*!0/6! ()"#*+*,()"-*+*./01*()"-2" 0B9*" 9C,9" *+,-./.0*+,1./.% /D;*" C,.*" /)01" ?:BE+*" 2<@@*2-8@" ," FG2H<8;-B8,+"=:I"JD9C"+BJ"+*.*+2"BH"K)=5","L8BJ8"9,:@*9"BH"*29:B@*8":*;*?9B:M"=&"+*.*+2",:*" CD@C*:" D8" 9C*" 9*2-2" BH" *+,-./.0*+,1./.% /D;*M" NC*2*" +*.*+2" ,:*" 8B:/,+D2*F" JD9C" OP)Q" :*R *S?:*22DB8"D8"T*:9B+D";*++2M"NCD2"2<@@*292","?:BU,U+*",:B/,9,2*",;-.D9G":*@<+,-B8"UG"OP)QM"" ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%&'()*'((+,%-.%#/.01213%0/%04$5$%!/6$75*%7"8"6%50/#9%".%:$36";%#$775%/<%!"#$%&'&(!"#$%5$$!5% 81$5$1=$6%>?$1"7"88".%502".".;*%@10"#7$%)A,%% )*( +,-( ./,-#( ,01./,-232( 4.567( 8-( /,-( -99-4/( .9( ."02/-#.62( .:( !-073;( 4-662<% :/B% C'DE 4361/F3#4/7$50$1/7% 2.6% C(E4361/F3#4/7$50$1/7% ".% 04$% 0$50$5% /<% !"#%&'&( =:7( !"#$%&'&( B25% 1$8/10$6% &)G+,% -.% 1205*% CHE4361/F3#4/7$50$1/7*% #/I76% ".6I#$% 0$50/50$1/.$% 53.04$5"5*% ".6$8$.6$.0% 0/% :J% &'(K+,% L$% 5I;;$50% 0420% :MN%( 1$E$F81$55"/.% ".% !"#$%&'&>?@A!"#%% !"#$% ./1!27"O$5% /F350$1/7% 7$=$75% 2.6% ".<72!!20/13% #30/9".$5% P$5"6$5% 04$% ./1!27"O20"/.% /<% #4/7$50$137%$50$15,% Q$=$104$7$55*% 04$% 8212#1".$% <2#0/1>5A% 1$!2".>5A% 0/% P$% "6$.0"<"$6,% -.% ="01/% 50I6"$5% /.% D$10/7"% #$775% B"04% 6"=$15% P"/#4$!"#27% 2.6% !/7$#I721% 0$505% #/I76% 4$78% 0/% "5/720$% 8I020"=$% !/7$#I7$5%0420%".<7I$.#$%:$36";%#$77%8435"/7/;3,% !"#%!"#$$#%&'()&*+,-.*,-/"&/0&1,$2/-#&13",4$1-1&-1&+/"0-25$#&/"63&-"&*+7,$&1-,7*,-/"8%-0% "5% ./0% 9./B.% B4$04$1% #41/."#% :MN% 2#0"=20"/.*% 5I#4% 25% ".% 5"0I20"/.5% /<% #4/7$50$1/7% $F#$55*% #/I76%42=$%2%8/5"0"=$%/1%2%.$;20"=$%$<<$#0,%R$50/50$1/.$%7$=$75%".%!$.%B"04%6357"8"6$!"2%21$% 7/B$1%&S)C*'(G+,%-.%5I#4%#/.6"0"/.5*%/F350$1/7%2##I!I720"/.%2.6%#41/."#%:MN%2#0"=20"/.%#/I76% $F"50,%R4I5*%B$%5I;;$50%0/%50I63%3:(B3/#.(!/I5$%:$36";%#$775%$F8/5$6%0/%#4/7$50$1/7E$.1"#4$6% #I70I1$%!$6"I!,%R4$%7$=$75%/<%/F350$1/75%2.6%04$"1%".<7I$.#$%/<%:$36";%#$77%="2P"7"03*%50$1/"6% 53.04$5"5%2.6%:MN%2#0"="03%#/I76%2.5B$1%04"5%TI$50"/.,% "#&9:&13",4$1-1%P3%04$%0$50$5%/<%6"#$%&'&("5%6$1$;I720$6C(-.6$$6*%D#$(012.5#1"80%7$=$75% 21$%".#1$25$6%B"04%6$#1$25$6%E#-8F(7$=$75*%2.%UN$%021;$0%;$.$%>V";I1$%SCA,%R4$5$%1$5I705%21$% 255/#"20$6% B"04% ".#1$25$6% ".012E0$50"#I721% 7$=$75% /<% UC,% R4"5% 6$<$#0% "5% 6$8$.6$.0% /.% :MN%( $F81$55"/.%".%D$10/7"%#$775,%R4$5$%1$5I705%5I;;$50%0420%:MN%(#/I76%1$;I720$%04$%012.5#1"80"/.27% 2#0"="03%/<%D#$(2.6W/1%21/!2025$%&'KX+,%R4"5%1$;I720"/.%#/I76%8210"#"820$%".%04$%!/6I720"/.%/<% 50$1/"6%53.04$5"5%P3%:$36";%#$775,% -.6$$6*% UC% 1$81$55$5% 0$50/50$1/.$% 53.04$5"5% P3% "05% 6"1$#0% ".4"P"0/13%$<<$#0%/.%50$1/"6%53.04$5"5%$.O3!$5%&CKC*CKH*CKY+,%VI104$1!/1$*%"05%5I81$55$5%:J% 5$#1$0"/.% &CKG+,% R4I5*% $F#$55% $50126"/7% #/I76% 8210"#"820$% ".% 04$% ".4"P"0"/.% /<% 0$50/50$1/.$% 53.04$5"5,% % U501/;$.% 53.04$5"5% 1$;I720"/.% "5% ".0$1$50".;% 0/8"#% ".% !$.,% -0% ".<7I$.#$5% 58$1!20/;$.$5"5% 2.6% #/I76% 2<<$#0% 81/5020$% #21#"./;$.$5"5% &CK'*'K)+,% UF#$55"=$% $501/;$.5% #/I76%8210"#"820$%".%04$%8435"/8204/7/;3%/<%81/5020$%#21#"./;$.$5"5%".%6"#$%&'&(!"#$%&'KC+,% L$%5I;;$50%I5".;%3:(B3/#.%2.6(3:(B3B.(!/6$75%0/%$=27I20$%G01FH(2.6%D#$(1$;I720"/.%P3%:MN,% % 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$% &'&(")% *+$% ,$-.('/0$1&*$.% 2+$"3*-2$% (4% ("4566(#($"*% *3% #3721$*$1-% $821&("% *+$% 4*$0(1(*-% ("% *+$4$% 7(#$9% :;$"% *+35'+)% <$% +&;$% "3*(#$.% *+&*% !"#$%&'&()*+!"#%, 7&1$% 7(#$, (7203;$.%*+$(0%#3521("'%<(*+%<(1.%*-2$%6$7&1$49%=5*)%4*$0(1(*-%2$04(4*4%("%*+$4$%7(#$9%>+(4%(4% 4(7(1&0%*3%!"#$&'&%7(#$%2+$"3*-2$%<+$0$%*$4*34*$03"$%1$;$14%&0$%13<)%?5*%*+$4$%7(#$%0$7&("% 4*$0(1$9%%% % • !"#$%&"''(%)*+%(,"#$)-./"*"(0(1% @"1(A$% !"#$%&'&, 7(#$), !"#$&'&, -./, !"#%&'&, 7(#$% +&;$% $(*+$0% ,$-.('% 30% B$0*31(% #$11% .$6$#*4%0$42$#*(;$1-)%?5*%*+$-%0$7&("%6$0*(1$9%C$07%#$11%#372$"4&*(3"%0$7&("4%*+$%20("#(2&1% #372&0*7$"*%630%6$0*(1(*-%20$4$0;&*(3"9%D6%'$07%#$11%&232*34(4%(4%("#0$&4$.)%(*%(4%#372$"4&*$.% ?-%&"%$8&''$0&*$.%'$07%#$11%2031(6$0&*(3"%0$$4*&?1(4+("'%2031(6$0&*(3"E&232*34(4%?&1&"#$%&".% 20$;$"*("'%'$07%#$11%13449% C$07%#$11%1344%(4%&%20("#(2&1%2+$"3*-2$%("%!"#$%&'&9%D*%(4%.5$%*3%&"%$8#$44(;$%&232*34(4% &".%0$.5#$.%'$07%#$11%2031(6$0&*(3"9%>+(4%2+$"3*-2$%(4%751*(6&#*30(&1F%(*%#351.%?$%.5$%*3%GH% 13<%*$4*34*$03"$%30('("&*("'%6037%,$-.('%#$11%.$6$#*4%&".%1$&.("'%*3%("#0$&4$.%&232*34(4%36% *+$%'$07%#$114)%IH%&%'$07%#$11%.$6$#*%&".E30%JH%B$0*31(%#$11%.$6$#*4%.5$%*3%$(*+$0%*+$(0%("&?(1(*-% *3%0$73;$%*+$%&232*3*(#%#$114%30%*3%1344%36%*+$(0%"5*0(*(3"&1%&".%+3073"&1%452230*%"$#$44&0-% 630%'$07%#$11%2031(6$0&*(3"%&".%7&*50&*(3"%K45#+%&4%21&*$1$*%.$0(;$.%'03<*+%6&#*300,L!>MN% 4('"&1("'%OPQJ)PQPRH)9% 23% !"#$%"#& '"()& %"**& +(,*-."(/0-,1% ("% !"#%&'&% &".% !"#$%&'&% 7(#$% .$2$".4% 3"% ?$*&% (436307%OGQR9%>+(4%(4%2+$"3*-2$%(4%0$61$#*$.%?-%+('+$0%SBN%1$;$14%("%*+$4$%7(#$)%45''$4*("'%&% B$0*31(%#$11%.$6$#*9%L$;$0*+$1$44)%*+$%7$#+&"(47%?-%<+(#+%,TU%%("%B$0*31(%#$114%(4%"$#$44&0-% 630% '$07% #$11% 2031(6$0&*(3"% (4% "3*% A"3<"9% !"#$%&'&()*+!"#%, 7(#$% &0$% #+&0&#*$0(V$.% ?-% &% "307&1% '$07% #$11% 2031(6$0&*(3"% 0&*$% ("% #372&0(43"% <(*+% !"#$%&'&, 7(#$1, >+54)% '$07% #$11% 2031(6$0&*(3"% (4% .$2$".$"*% 3"% ,TU% $820$44(3"% ("% B$0*31(% #$114% &".% "3*% ("% '$07% #$114F% ,TU% &?4$"#$% ("% *+$% '$07% #$114% 36% !"#$%&'&, 23, !"#$%&'&()*+!"#%, +&;$% "3% ("615$"#$% 3"% *+$% 2031(6$0&*(3"% 36% *+$% 42$07&*3'3"(&% &".% 42$07&*3#-*$49% L$;$0*+$1$44)% *+$% 731$#51&0% 7$#+&"(47%5".$01-("'%*+(4%2&0�("$%$66$#*%(4%"3*%-$*%(.$"*(6($.9%C$07%#$11%2031(6$0&*(3"%(4% (7203;$.%*+&"A4%*3%"307&1(V$.%45+,-./,32637632#7.2,689.-:8.9,8.,3;262,<2::6%&".%#29=:-387., 7>,?@?%$&4("'%$8#+&"'$%36%*+$%"5*0(*(;$%6&#*304%<(*+%'$07%#$114%OIGW)IPP)PQXR9%S50*+$0730$)% AB<:8.)C)% &% 42$#(6(#% 7&0A$0% 36% 7$(3*(#% #$114)% #351.% ?$% (721(#&*$.9% Y$% +&;$% "3*(#$.% *+&*% AB<:8.)C,7ULZ%1$;$14%<$0$%0$.5#$.%("%!"#$%&'&,7(#$%?5*%0$4*30$.%<(*+%,TU%,0$/$820$44(3"9% 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%&'()'%&*+$%,+-%.&'%/'+//.#%+-0,'1%-2'/3045+-.60&0/%/'+440/-'+&,'/-04%$%-"'789:;<'!"#$%&'() 5=>('$0*0$/'+40'+$/.'40,?#0,'%&'-0/-%#?$+4'@%.3/%0/'.A'50&'1%-2'/-04%$%-"'789B;<'' *+",-./0$,' +40' +$/.' %&-040/-%&6' -.' 0C3$+%&' 6045' #0$$' 34.$%A04+-%.&' 406?$+-%.&<' DEF(G' +&,',0/5./-04.$'+40'-20'34%&#%3+$'.C"/-04.$/'12%#2'+#-%*+-0'HI=/'%&'-20'-0/-%/'+&,'/30#%A%#+$$"' %&'/3045+-.J.+'7KLMNOKL;<'DEF(G'%&,?#0/'%&)1%-/0'0&-4"'%&'50%./%/'.A'-20'3$?4%3.-0&-'6045' #0$$/'7OK);<'' P&' .4,04' -.' %,0&-%A"' -20' 3+4+#4%&0' A+#-.4Q/R' %&A$?0&#%&6' 6045' #0$$' 34.$%A04+-%.&N' 10' /?660/-' /-?,"%&6' %&) 1%-/0' DLME-40+-0,' G04-.$%' #0$$/' %&' +' #.E#?$-?40' /"/-05' 1%-2' 6045' #0$$' $%&0+60'QS!E)R<'G%$0&#%&6'=>(/'#.?$,'@0'?/0,'+6+%&/-'+'3?-+-%*0'60&0'%&'.4,04'-.'#.&A%45'%-/' 4.$0'%&'6045'#0$$',%AA040&-%+-%.&<'' !!"! "#$%! &#''! ()*)+*,-,' 0$%5%&+-0/' #0$$/' -2+-' +40' %&+3-' -.' #.&-%&?0' A.4' A?4-204' 5+-?4+-%.&<'D2%/'34.#0//'$%5%-/'-2?/'-20'&?5@04'.A'60&0-%#+$$"'.4'5.432.$.6%#+$$"'+@&.45+$' #0$$/'7899;<'T?-N'+##0$04+-0,'+3.3-./%/'1%-2.?-'#.530&/+-%.&'1%$$'+AA0#-'-20'A%&+$'&?5@04'.A' /3045+-.J.+'+&,'$0+,/'-.'.$%6./3045%+'+&,'/-04%$%-"'789M;<'U?4-2045.40N'+3.3-.-%#'6045'#0$$' +##?5?$+-%.&'1%-2%&'-20'/05%&%A04.?/'-?@?$0/'%&,?#0/'+&'%&A$+55+-.4"'40+#-%.&'+53$%A"%&6' -20'+3.3-.-%#'34.#0//'+&,'%&A$?0&#%&6'-20'&0%[email protected]%&6'6045'#0$$/<' HI=V'/005/'0//0&-%+$'A.4'+3.3-./%/'340*0&-%.&'7)9;<'2+/3454'5%#0'+40'#2+4+#-04%J0,'@"' 6"7080&9:%,;N' @?-' -20' +3.3-./%/' +AA0#-/' 5+%&$"' -20' 34%5%-%*0' /-+60/' .A' /3045+-.60&0/%/' Q/3045+-.6.&%+N' +&,' 34%5+4"' /3045+-.#"-0/RN' 12%$0' 2"3.6.&+,%/5E40$+-0,' +3.3-./%/' Q5.?/0'5.,0$/'.A'+&,4.60&'40#03-.4'%&*+$%,+-%.&'1%-2%&'G04-.$%'#0$$/'.4''/,#454R'5+%&$"'+AA0#-' -20' $+-04' /-+60/' Q+@/0�' .A' 0$.&6+-0,' /3045+-%,/' 1%-2%&' -20' /05%&%A04.?/' -?@?$0R' 78ML;<' S045'#0$$'+3.3-./%/'304/%/-/'%&'-20'2+/3<454='>?2+/<)5%#0',0/3%-0'&.45+$%J0,'-0/-./-04.&0' $0*0$/@)D2%/'%/'%&'$%&0'1%-2'340*%.?/',+-+'Q?&3?@$%/20,R'.A'-20'-0+5'-2+-'/?33$050&-0,'2+/3<4 54) 5%#0' 1%-2' -0/-./-04.&0W' -2%/' -40+-50&-' ,%,' &.-' ,05.&/-4+-0' +&"' %534.*050&-) %&' -20' -0/-./-04.&0'40$+-0,'320&.-"30/<' HI=3E,030&,0&-'+3.3-./%/'%&'2+/3454A)2+/3<454A)9&:)2+/3<454='>?2+/<)5%#0'%/'-2?/'+&' %&-/%&,%#)B8./;)#.$$C)D9#-0/'12%#2'%/'&.-'#.530&/+-0,'1%-2'-20'340/0�'.A'HI=<@'P-'#.?$,'@0' 0C3$+%&0,'@"'+',0A0#-'%&'-20'6045'#0$$'/%6&+$%&6'-2+-'%&%-%+-0/'32+6.#"-./%/'34.#0//'@"'G04-.$%' #0$$/<' P&,00,N' +3.3-.-%#' 6045' #0$$/' 0C340//' 32./32+-%,"$/04%&0' .&' -20%4' /?4A+#0N' 12%#2' %&%-%+-0/' G04-.$%' #0$$' 50#2+&%/5/' -.' .3-%5%J0' -20' 32+6.#"-./%/<' P&,00,N' G04-.$%' #0$$/' +40' 40/3.&/%@$0'A.4'-20'0$%5%&+-%.&'.A'-20'+3.3-.-%#'6045'#0$$/'A4.5'-20'/05%&%A04.?/'-?@?$0/'@"' 32+6.#"-./%/<'' 01! ! ! ! ! ! ! ! ./01)2345) !"#$%&%'!"#(%&%) !"#$%&%'!"#(%&%*+,-%!"#() U! 2OPQR! V WWW!WWW! 2(#4 TMP! WW! W! !%,$%+,! (:! T! SMP! 0%,$%+#4 0&#/! BCD! BCD! 0&#/! 0&#/! S! BCD! !"#$%&'!(()!*+,-'./'&0-!'./'&!1*23!455%6%-47,8!#8!/+'!/'.7.!,9!:#-;!/0<'=!!"#$%&%'!"#(%&%! 48;!!"#$%&%'!"#(%&%)*+,%!"#(-4>'&!4!5+,:!,&!+#$+!94/!;#'/!9,&!?!:''@.!1A"B3.!"#$%!$&'$! !"#$%&%'!"#(%&%) ()*%! '+%! ,'$-+'$%.! /)$&! 01! '2.! 2#! 3-+$&%+! '**-(-4'5#2! #**-+6! 7)4.! $89%! ()*%! +%,),$! &):&! 3'$! .)%$! '2.! $&%! 01! 4%;%4,! +%(')2! 2#+('4! $&'2<,! $#! =>?! '*5;)$86! !"#$%&%'!"#(%&%*+,-%!"#()()*%!9+%,%2$!/)$&!,):2)@*'2$!01!'**-(-4'5#2!'A%+!BCD6!EF-+!G4-%! ,$')2)2:!,&#/,!$&'$!4)9).!'**-(-4'5#2!)2!H%+$#4)!*%44,!),!2#+('4!I=>?J!%K9+%,,)#2LM!N-$!$&%! :%+(!*%44,!I,9%+('$#*8$%,!'2.!,9%+('5.,L!'+%!N-+.%2!/)$&!4)9).!;'*-#4%,!,-::%,52:!$&'$! :%+(!*%44,!)2!$&%!'N,%2*%!#3!=>?!'+%!;-42%+'N4%!$#!%K*%,,);%!01!'**-(-4'5#26!!-! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !" #$%$&'" ()" '*$" !"#$%&'( )"&&( *+,-%).$%/'/" (+" ,$+-.)+(/0$" %.," +'$,(0('1" 2345634789" :,;)<0.=;'.<+" #$>$)$,;'(.)+" ?('*()" @$,'.0(" &$00+" ,$%0$&'()>" -*;>.&1'.+(+" #$%$&'+" ;,$" #$+&,(/$#"()"=$)"?('*"&,1-'.,&*(#(+=".,"@$,'.0("&$00AB)01"+1)#,.=$"234C89"D,;)+&,(-'"0$E$0+" .%"0&1%2(;)#"3%)425('?."@$,'.0("&$00"+-$&(%(&"=;,F$,+6";,$",$#<&$#"()"'*$"'$+'$+".%"67#89:;:( ,<=( 67#89:;:>?@A67#9( =(&$B" D*$+$" ,$+<0'+" +<>>$+'" '*;'" -*;>.&1'.+(+" (+" ;0'$,$#" ()" ;" GHI9: ()#$-$)#$)'"=;))$,9"D*(+"*1-.'*$+(+"+$$=+"'*<+6",$0;'$#"'."GHI8"$J-,$++(.)"()">$,="&$00+9" K)".,#$,"'."(#$)'(%1"'*$"-,(=;,1"#$%$&'"()"-*;>.&1'.+(+"L@$,'.0(".,">$,="&$00"#$%$&'M6" ?$" +<>>$+'" +'<#1()>" '<( C'$#%" @$,'.0(" &$00+" L<+()>" DN46" +(IO!" ;>;()+'" GHIPM" ?('*" ;-.-'.'(&" =.<+$" +-$,=;'(&" >$,=" &$00+" 0;/$00$#" ?('*" Q1-R$,S" L,$#" =;,F$,M9" B'*$,?(+$6" -*.+-*;'(#10+$,()$" $J-,$++(.)" .)" '*$" +<,%;&$" .%" ;-.-'.'(&" +-$,=;'.T.;" ./';()$#" %,.=" $('*$,"?(0#"'1-$".,"67#89:;:(=(&$"&.<0#";)+?$,"'*$"U<$+'(.)9" !!!"! "#$%&'()$*$+'+! ,$-$./+0" -*;>.&1'.+(+" (+" ;0+." ,$+-.)+(/0$" %.," '*$" $0(=();'(.)" .%" ,$+(#<;0"/.#($+";&&<=<0;'()>"#<,()>"+-$,=(.>$)$+(+B(GHI+";)#"'*$(,"0(>;)#+6"'*$".J1+'$,.0+" 0(F$"V!@6"+$$=")$&$++;,1"'."&.=-0$'$"=$(.+(+"2C7589"W0(=();'(.)".%"&*.0$+'$,10"$+'$,+"%,.=" +-$,=;'(#+" (+" (=-.,';)'" '." $0(=();'$" '*$" =;X.,('1" .%" &1'.-0;+=" %,.=" '*$+$" &$00+" ;)#" '." -,.#<&$"*(>*01"+-$&(;0(T$#"&$00+"L+-$,=;'.T.;M"'*;'";,$"&.=-.+$#"=;()01".%";"#$)+$")<&0$<+" ?('*.<'" ;" +<,,.<)#()>" &1'.-0;+=9" Y$" #$=.)+',;'$#" '*;'" 67#89:;:( ,<=( 67#89:;:>?@A67#9" -,$+$)'" ?('*" 0(-(#" ;&&<=<0;'(.)+" ?('*()" +-$,=;'(#+" +<>>$+'()>" #$%$&'(E$" +-$,=(.>$)$+(+9" D*$+$" #$%$&'+" ;0'$," +-$,=" >$,=" &$00" =;'<,;'(.)6" ?*(&*" (+" ;" 0.)>" -,.&$++" '*;'" &.)'()<$+" ?('*()" '*$" $-(#(#1=(+9" D*$" +-$,=;'.T.;" &.<0#" '*<+" /$" *$;E($,6" ?('*" 0.?$," =./(0('1" ;)#" #$%$&'(E$" &;-;&(';'(.)" .&&<,,()>" ()" ;)" ;--;,$)'01" ;/).,=;0" $-(#(#1=(+" 2CCC89" Z<,()>" $-(#(#1=;0"=;'<,;'(.)6"'*$"+-$,=;'.T.;"?(00"/$"=.,$"+$)+('(E$"'."%,$$",;#(&;0+";)#"'."0(-(#" -$,.J(#;'(.)"234389"Y$";0+."#$=.)+',;'$#"'*;'"?D)-E((+"=;X.,01"$J-,$++$#"?('*()">$,="&$00+" ;)#"0(''0$"()"'*$"@$,'.0("&$00+9"![Q:\"(+";"';,>$'">$)$".%"GHI";)#"&.<0#"/$"(=-0(&;'$#"()"'*$" +-$,=(.>$)$+(+" 2573634S89" ]<,'*$,=.,$6" ?$" *;E$" $J-.+$#" 67#89:;:( ;)#" 67#89:;:>?@A67#9( =(&$"'.";"&*.0$+'$,.0A,(&*"#($'"#<,()>"^"?$$F+9"Y$"*;E$"./+$,E$#";)"$J&$++(E$"&*.0$+'$,10" $+'$," ;&&<=<0;'(.)" ?('*()" 67#89:;:>?@A67#9( '$+'(+( ()" &.=-;,(+.)" '." ?(0#" '1-$" .)$9" D*$" ;&&<=<0;'(.)" ?;+" -,()&(-;001" ?('*()" >$,=" &$00+" L%(><,$" CCM9" K)'$,$+'()>016" ?D)-E:;:" =.<+$" =.#$0+"L+('.+'$,.0$=(;M";,$"+'$,(0$"234^89"D*<+6"'*$+$",$+<0'+"+<--.,'"'*$",.0$".%"GHI+"?('*()" >$,=" &$00+" '*;'" &.<0#" $J-0;()" +'$,(0('1" -$,+(+'$)&$" ()" '*$+$" =(&$9" O$?" =.<+$" =.#$0+" ?('*" +-$&(%(&" ;/0;'(.)" .%" GHI+" ?('*()" >$,=" &$00+" &.<0#" /$" ()'$,$+'()>" '." +'<#1" '*$" $J;&'" ,.0$" .%" '*$+$",$&$-'.,+"?('*()"'*$+$"&$00+9# 00! ! ! ! ! ! ! ! !%0869$"1& :;<& !"#+$%$'!"#,$%$-& !"1>%-& !"#+,$%$& 6,5/"1-5%+-& %=/1%004,+& ()*$!"#,& >%+%0& 01(JJ( M+$3*&(01( N90NO( 9:9(-#;#,")( M+$3*&(9:9( N90EO( ?%1-,$4&6%$$& FGHI( K5/%=%5(JJ( M+$3*&(K5/%=%5( ?/*6+,'"+)%)( ?/*6+,'"+)%)( -#;#,")(L( -#;#,")(L( !"*H( :%.34>&6%$$& FGHP( F+.("#)"+)"#$+5#( M+$3*&("#)"+)"#$+5#( QIR!S( N8+8"+)%)(JJ( N8+8"+)%)(JJ( FGHP( ?$+&%;#$*4+5TT( MD(?$+&%;#$*4+5( N90EU( @%15&6%$$& FGHI( !8#$3%+6#5#)%)( !8#$3%+6#5#)%)( 01(JJ( 01(JJ( )!AB& FGH(L( 01(JJ( 01JJ( LL( !"#$%&'(&)*%+,-./%0&,#0%12%3&4+&!"#!"$%$&"+3&!"#!"$%$'()*!"#"&546%&-%0-%07& !"#$%&%"'(%)(*))+,%*"#-(.%"/(01(*,,232&*4+5(%5(!#$"+&%(,#&&)(*5-(6#$3(,#&&)7($28"2$#-(9:97( $#-2,#-( 8$+&%;#$*4+5<*8+8"+)%)( =*&*5,#7( $#-2,#-( "#)"+)"#$+5#( *5-( %5,$#*)#-( %5/%=%5( &#>#&)7(*5-(?:!@(-#;#,")(A)3++"/(32),&#(*,45(-%)+$6*5%B*4+5(*5-(&%8%-(*,,232&*4+5)C(#$% &'(!")*)%3%,#D(&'(!")*)+,-.&'("%3%,#(/*>#(5+$3*&%B#-(3+)"(+;(!#$"+&%(,#&&(;25,4+5)7(&%8%-( /+3#+)"*)%)(*5-("#)"+)"#$+5#(&#>#&)D(E#$3(,#&&(*5-(?:@0(-#;#,")(.%"/()"#$%&%"'(8#$)%)"(%5( "/#)#(3%,#D( //0% 1'2331(2415+% ))0% (156715+% 890% 7:;<1=41(><% 1=41(=+% ,?80% ,@A% B#$5#$3% 72==1C1+% D4,E0% =41(;#5;31$#7% 27641% (136<24;(>% F(;41#$+% ?@?0% B<;;5% 41=G=% B2((#1(+% HI0% $;(J2<+% A@-80% F1(#46B6<2(%J6=7<1%71<<=I%% ,52F415%K(;J%-2L52=>%14%2 ! • !"#$%&'&()#*+&,-("*-"((,.* "#$%$&'&()*+,! !"#$%&'&()*+!"#%, -&./! 012/! .3(4$1.4&*&4+! 5/6/.4'! 36! 40/! '/-&(&6/$3#'! 4#7#*/',! 8&40! '41)(14&()! '%/$-143931! 8&40&(! 40/'/! 4#7#*/':! ;0&'! %0/(34+%/! &'! 5#/! %/$&4#7#*1$!-+3&5!./**'!3$!<;=>!5&'3$)1(&914&3(!8&40!17(3$-1*!?>;@A!$,B"=?C!/D%$/''&3(! 1(5!*&%&5!1..#-#*14&3(!8&40&(!40/'/!./**':!@(5//5,!<;=>!&'!&-%3$41(4!63$!'%/$-143)/(/'&'E! 1(5$3)/(! $/./%43$! &(21*&514&3(! 8&40&(! 40&'! .3-%1$4-/(4! &'! $/'%3('&7*/! 63$! 5/.$/1'/5! (#-7/$!36!'%/$-143)3(&1,!'%/$-143.+4/'!1(5!'%/$-14&5'!FGHI,GHJK:!L#$40/$-3$/,!40&'!*1+/$! &'! &-%3$41(4! 63$! '%/$-143931! %$3%1)14&3(! 1(5! /D%#*'&3(! 4381$5'! $/4/! 4/'4&':! ;0#',! '%/$-143931! '41)(14&3(! .3#*5! 166/.4! 40/! 6&(1*! (#-7/$! 36! '%/$-143931! */15&()! 43! 3*&)3'%/$-&1!1(5!0+%3!6/$4&*&4+:!! M/'%&4/,! 40&'! 5/41&*/5! 1(1*+'&'! 36! !"#$%&'&()*+!"#%, -&./,! 40/! -#./0/, /12345, $/-1&('!43!7/!&5/(4&6&/5:!N/!40&(O!4014!40/!)/$-!./**!5/6/.4'!1$/!40/!-1P3$!5/4/$-&(1(4'!36! 40/!6/$4&*&4+:!Q&%&5!1..#-#*14&3(!&(!)/$-!./**'!'#))/'4'!1!O/+!$3*/!36!QRS'!&(!*&%&5!03-/3'41'&'! 36!40/'/!./**'!5#$&()!'%/$-143)/(/'&':!@(!3$5/$!43!&5/(4&6+!QRS!$3*/'!8&40&(!)/$-!./**'!1(5! 40/&$! &(6*#/(./! 3(! 6/$4&*&4+,! 8/! '#))/'4! '4#5+&()! -3#'/! -35/*'! 8&40! '%/.&6&.! )/$-! ./**! &(21*&514&3(!BQ3D !"#$%&'(&))"*&%!"#$%&!"#'&()*&+),-%#+,-)(+".#%,((/0/1,#"2-%344567%8$&)&%9&:&(#)%(2/19%+&)/1#%"-% ,1#&+&9%(2-#+,(#"1"#;%2:%#$&%&."9"9;0")%#2%.+2.&1%9")#,11;%#$&%).&+0,#2<2,%,-9=2+%,::&(#%#$&% 0,#/+,#"2-% ,-9% (,.,("#,#"2-% 2:% #$&% ).&+07% 8$/)>% "-#+"-)"(% ?&+0% (&11% 9&:&(#)% !2/19% ,::&(#% ?&+0% (&11% 0,#/+,#"2-% ,-9% &*&-% 1,#&+% )#,?&)% 2:% (,.,("#,#"2->% !$"($% #,@&% .1,(&% "-% #$&% &."9"9;0")%344467% !" #$%&'()*'+(,*-**.*)&'(+(/0&,'*0123)/0*'1/&)4.,/0+'35*6/3(7&'8&4..7"'(),/37*'9:' A-92(+"-&% 9")+/.#"-?% ($&0"(,1)% BACDE% ,+&% "-(+&,)"-?1;% "0.1"(,#&9% "-% #$&% .$;)"2.,#$212?;% 2:% )#&+"1"#;% 3F467% A'.2)/+&% #2% #$&% &-92(+"-&% 9")+/.#2+)% 9/+"-?% :&#,1% 1":&% ")% +&).2-)"G1&% :2+% #&)#"(/1,+% 9;)?&-&)")>% (+;.#2+($"9")0% ,-9% ?&-"#,1% ,-20,1"&)% "-% ($"19$229>% $;.2?2-,9")0%,-9%$;.2%:&+#"1"#;%9/+"-?%./G&+#;%,-9%,9/1#$229%3F4>FH4>IJJ67% 8$&% .+&*,1&-(&% ,-9% ?12G,1% "-("9&-(&% 2:% 0,1&% "-:&+#"1"#;% ")% "-(+&,)"-?% )"-(&% #$+&&% #2% :2/+% 9&(,9&)7% 8$")% "-(+&0&-#% ")% "-% .,+,11&1% !"#$% #$&% .+2.,?,#"2-% 2:% 9"*&+)&% ($&0"(,1% (20.2/-9)% (,.,G1&% #2% 0"0"(% )20&% )"?-,1"-?% &-92?&-2/)% 021&(/1&)% ,-9% )#"0/1,#&% )20&% +&(&.#2+)>%1&,9"-?%#2%9")+/.#"2-%2:%(&+#,"-%.$;)"212?"(,1%.,#$!,;)7%A-92(+"-&%9")+/.#2+)%,+&% #$/)% (1&,+% ?/"1#;% #2% "-(+&,)&% 0,1&% "-:&+#"1"#;% 9/&% #2% #$&"+% ,-#"K,-9+2?&-"(% ,-9=2+% .+2K &)#+2?&-"(% &::&(#)7% L,-;% 2:% ACD% ,+&% 9&)(+"G&97% C"&#$;1)#"1G&)#+21% BCAME% ")% #$&% (1,))"(,1% 2-&% /)&9%"-%NJOH)%"-%!20&-%!"#$%+")@%2:%0")(,++",?&)7%P#%")%,%);-#$&#"(%&)#+2?&-%(2-)"9&+&9%,)%,-% &-92(+"-&%9")+/.#2+%#$,#%,::&(#)%#$&%:/-(#"2-)%2:%#$&%#&)#")%35HH>5HN67%P#%!,)%,))2(",#&9%!"#$% (2-?&-"#,1% 0,1:2+0,#"2-)% !"#$% G2;)% 9&1"*&+&9% !"#$% $;.2).,9",)>% (+;.#2+($"9")0% ,-9% 8CM7% 8$&)&%&::&(#)%!&+&%0&9",#&9%G;%AQ%,(#"*,#"2-7%R,+"2/)%1"-&)%2:%&*"9&-(&)%$,*&%0,9&%,%(1&,+% 1"-@% G&#!&&-% &)#+2?&-)>% #$&"+% -/(1&,+% +&(&.#2+)% AQ-% ,-9% AQ.>% ,-9% STQ-/.% 35HFU5HI67% STQ% ,(#"*"#;%(2/19%,1)2%G&%+&?/1,#&9%G;%#$&%-/(1&,+%+&(&.#2+%)0,11%$&#&+29"0&+%.,+#-&+%BMVWE>%,% #,+?&#% +&(&.#2+% :2+% CAM% 3FXY67% CAM% "-9/(&)% ,.2.#2)")% "-% #$&% #&)#")% G;% ,% MVW% 0&9",#&9% 0&($,-")0%35H567% STQ)%,+&%(1&,+1;%"0.1"(,#&9%"-%9",12?/&%!"#$%AQ%,-9%&)#+2?&->%&).&(",11;%"-%&-92#$&1",1% .+2#&(#"2->% G+&,)#% (,-(&+% 35HI>5HO67% 012-% ")% ,% #,+?&#% ?&-&% :2+% AQZ% ,-9% 0&9",#&)% #$&% (,+9"2.+2#&(#"*&%&::&(#)%2:%&)#+2?&-)%9/+"-?%#$&%+&.+29/(#"*&%1":&%2:%!20&-%3NIX67%% [&% #+&,#&9% .2)#-,#,1% !"19% #;.&% ,-9% 012-.#/#% 0"(&% !"#$% CAM% ,-9% ,-,1;<&9% #$&"+% #&)#"(/1,+%.$;)"212?;7%P-9&&9>%012-.#/#%0"(&%.+&)&-#%!"#$%,-9+2?&-%9&:"("&-(;%,-9%9&(+&,)&9% #&)#"(/1,+%!&"?$#7%CAM%#+&,#0&-#%9+"*&9%#$&%&'.+&))"2-%2:%,%?+2/.%2:%-/(1&,+%+&(&.#2+)%BAQ->% 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"!#$ %"&'($ )*+$ ,-./$ 0*$ 102+$ 3456$ 7086$ 103-$ *9$ 6::683$ 0*$ "#$%!&'&$ 7086;$ <=>3-6>79>6$ ?!,$ 0*8>6)@6+$A6>7$8622$)59539@0@$0*$102+$3456$7086$)*+$79>6$0759>3)*324$0*$"#$%!'B'$7086$CDEFG;$$ H3$0@$9IJ09=@$3-)3$%K"@$)>6$0*+0@56*@)I26$39$5>6J6*3$+62636>09=@$6@3>9A6*08$6::683$9:$?!,;$L9$ 93-6>$ @3=+06@$ 16>6$ 0*36>6@36+$ 0*$ 3-6$ >926$ 9:$ 36@308=2)>$ %K"$ 0*$ 3-6$ 6M59@=>6$ 39$ 3-6$ 93-6>$ 6*+98>0*6$+0@>=539>@#$)23-9=A-$@667@$0*+=86+$I4$I0@5-6*92$N;$ !" !#$%$&'#(&)%*$+,-'.$)%*( NA6$ >62)36+$ -459A9*)+0@7$ 0*$ 76*$ 0@$ )$ :>6O=6*3$ 89752)0*3$ CP#DEQG;$ R9@3$ 9:$ 3-6$ 630929A06@$ )>6$ =*S*91*;$ ,36>02034$ 0*$ "#$%!&'&( 7086$ 0@$ >62)30J624$ 8975)>)I26$ 39$ )A6$ >62)36+$ -459:6>302034;$R)*4$93-6>$79+62@$9:$7086$@=8-$)@$)*+,-&'&#$.#$!&'&#$/+0,1&'&()2@9$+6J6295$ 2)36$9*@63$@36>02034;$T-6@6$A6*6@$)>6$+0>68324$>62)36+$39$%K"$9>$89*@0+6>6+$)@$5)>3*6>@;$T-6@6$ 79+62@$ )>6$ 8-)>)836>0U6+$ I4$ ,6>3920$ 8622$ 2050+$ )88=7=2)309*$ C(V#WE#X(Y#X(V#PFWG;$ T-0@$ )88=7=2)309*$ 89=2+$ 5)>30805)36$ 0*$ 3-6$ 5-6*976*9*$ 9:$ -459$ :6>302034$ I4$ )$ 5>9A>6@@0J6$ +6@3>=8309*$9:$3-6$@670*0:6>9=@$3=I=26@#$)236>6+$,6>3920$8622$5-4@0929A4#$>6@0@3)*86$39$<,&$)*+$ +0@>=536+$I299+'36@30@$I)>>06>$C(V#DEVG;$%050+$)88=7=2)309*$103-0*$,6>3920$8622@$0@$+6@8>0I6+$0*$ 76*$+=>0*A$)A0*A#$I=3$)2@9$0*$@976$5)3-929A08)2$@03=)309*@$)@$)U99@56>70)$)*+$-459$:6>302034$ CXWP#XWYG;$ $H*$5)>)2262#$-459A9*)+0@7$9>$%64+0A$8622$+6:683@$0*$3-6@6$7086$0@$@0702)>$39$,23$0452( 3567+752+8( 06( ,4724( 9,:5$ 9>$ Z);)<=$ 0*$ 76*$ CD(EG;$ [6$ 89=2+$ 8975)>6$ 3-6$ 36@308=2)>$ 8622@$ 103-$ I299+$ J6@@62$ 6*+93-620)2$ 8622@;$ [03-$ )A0*A#$ 3-6$ A)36S6656>$ 768-)*0@7@$ )A)0*@3$ 8-926@36>92$ )88=7=2)309*$ I68976$ 16)S$ )*+$ 2050+$ )88=7=2)309*$ 5>9A>6@@6@$ 39$ 5)3-929A08)2$ 26J62@;$$ ,5680:08$ 20A)*+@$ :9>$ 6)8-$ 0@9:9>7$ 9:$ %K"$ 9>$ :9>$ 6)8-$ 9>A)*$ 1022$ 075>9J6$ 3-6$ 79+=2)309*$9:$3-6$I0929A08)2$)830J0306@$9:$3-6@6$>686539>@$)*+$0*8>6)@6$3-6$8-)*86@$:9>$*61$ 3)>A63$3-6>)506@;$T9$+)36#$:61$20A)*+@$)>6$S*91*$39$I6$@626830J6$)A9*0@3@$:9>$%K"!#$@=8-$)@$L' N8423-0)+0)U920*6$CD((G;$H+6*30:40*A$20A)*+@$3)>A630*A$603-6>$%K"%$9>$!$0*$3-6$36@30@$89=2+$I6$ 0*36>6@30*A$ 39$ 79+=2)36$ )*+>9A6*$ @4*3-6@0@$ )*+B9>$ @56>7)39A6*6@0@$ 0*$ @=IA>9=5@$ 9:$ 5)306*3@$103-$-459A9*)+0@7;$[6$@=AA6@3$@3=+40*A$3-6$6*+9A6*9=@$20A)*+@$:9>$6)8-$0@9:9>7$ 0*$ 6)8-$ 8622$ 3456$ \,6>3920#$ %64+0A$ 9>$ A6>7$ 8622/$ )*+$ 3-6$ +6@0A*$9:$*61$79=@6$79+62@$103-$ +6:0806*3$ 20A)*+@$ \3)>A630*A$ 6*U476@$ >6@59*@0I26$ :9>$ 3-6$ @4*3-6@0@$ 9:$ 3-6@6$ 20A)*+@/$ 1022$ 075>9J6$9=>$S*9126+A6$)I9=3$%K"$79+=2)309*;$<=>3-6>79>6#$)@$3-6$3)>A63$A6*6@$9:$%K"@$0*$ 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$!#%!&%$'(#$)&**#(#+!$*(,-$!"#$./'%%&.'/$%01%#!$&+$!"#$,!"#($,(2'+%3$%4#.&*&.$.,5'.!&6'!,(%$ '+)$.,5(#4(#%%,(%$.,0/)$1#$4(#%#+!$&+$!"#%#$,(2'+%7$$ 8"#$%4#.&*&.&!9$:&//$#;!#+)$!,$%022#%!$#6#+$%4#.&*&.$<=>?$*,($#'."$.#//$!94#7$@+)##)3$%4#.&*&.$ <=>?$!'(2#!#)$,+/9$19$'+$&%,*,(-$,*$!"#$(#.#4!,($.,0/)$#;&%!!"#$%"&'()*+&,"'$<=>?$A!94#$BC$&+$ !"#$4(,-,!#($,*$<=>D"&%$,+/9$'.!&6'!#)$19$&!%$4(,!#&+$-./0"&+$!"#$/&6#("EFGH7$ !" #$%&'$(')*#+',-'./&'$012,1-'3/4+,$31./$%$54' @+$ !"&%$ '(!&./#3$ :#$ '+'/9I#)$ '$ -,0%#$ %!('&+$ (#5#;4(#%%&+2$ <=>J$ %4#.&*&.'//9$ &+$ !"#$ 2('+0/,%'$ .#//%$ AKLC$ &+$ '$ -'%01232" 1'.M2(,0+)7$ N#$ %",:$ !"'!$ <=>$ 4(#6#+!%$ OPQQ$ )#6#/,4-#+!$ &+$ ,0($ -,0%#$ -,)#/7$ @+)##)3$ -'%1232" -&.#$ ),$ +,!$ )#6#/,4$ OPQQ$ 4"#+,!94#$ %022#%!&+2$ !"'!$ -'%0" '+)" 1" .,-4#+%'!#$ #'."$ ,!"#($ &+$ !"#$ KL$ .,-4'(!-#+!7$ 8"0%3$ (#5 #;4(#%%&,+$ ,*$ ,+#$ &%,*,(-$ &%$ %0**&.&#+!$ !,$ (#%!,(#$ !"#$ -'%01232" 4"#+,!94#7$ R#%&)#%3$ :#$ )#-,+%!('!#$!"#$4&6,!'/$(,/#$,*$<=>$&+$!"#$(#20/'!&,+$,*$!"#$KL$4"9%&,/,29$'+)$&!%$&-4'.!$,+$ !"#$ 2/,1'/$ ,6'(&'+$ *0+.!&,+7$ @!$ &%$ +#.#%%'(9$ *,($ +,(-'/$ ,,.9!#$ -'!0('!&,+$ '+)$ %0(6&6'/3$ ,60/'!&,+$'+)$%!#(,&)$%9+!"#%&%7$S0(!"#(-,(#3$:#$'(#$%!0)9&+2$!"##$<=>$%&2+'!0(#$&+$:,-#+$ 0+)#(2,&+2$.,+!(,//#)$,6'(&'+$%!&-0/'!&,+7$ 8"&%$ %!0)9$ :'%$ -,!&6'!#)$ 19T$ GC$ !"#$ ./,%#$ (#/'!&,+%"&4$ 1#!:##+$ .",/#%!#(,/$ '+)$ ,6'(&'+$ 4"9%&,/,29$EU3FBG3FBVH3$BC$!"#$&+.(#'%&+2$1,)9$,*$/&!#('!0(#$)#%.(&1&+2$+,6#/$1&,/,2&.'/$(,/#%$ ,*$<=>%$&+$!"#$(#20/'!&,+$,*$%!#(,&)$%9+!"#%&%$'+)$&+*/'--'!&,+3$!:,$4(,.#%%#%$+#.#%%'(9$*,($ *,//&./#$-'!0('!&,+$'+)$,60/'!&,+$EGW3BB3GVV3GVX3XGB3XGVH3$VC$!"#$*'.!$!"'!$,;9%!#(,/%$4/'9$'$ 4,!#+!&'/$ (,/#$ &+$ !"#$ -'!0('!&,+$ ,*$ !"#$ ,,.9!#%$ EBG3FY3FFVH3$ '+)$ FC$ !"#$ (,/#$ ,*$ <=>%$ &+$ %4#(-'!,2#+#%&%$ AZ(!&./#$ GC$ %4#.0/'!&+2$ .,--,+$ 2#(-$ .#//$ A,6'(9$ '+)$ !#%!&%C$ 4'!":'9%$ (#20/'!#)$19$<=>%$EGW3VG[3XGBH7$ !" #$%&'()$*'+&( • ,$-./'()0/%10/2$34( R,!"$ <=>$ 0$ '+)$ 1" '(#$ #;4(#%%#)$ &+$ !"#$ .0-0/0%$ '+)$ ,,.9!#%$ ,*$ -&.#$ :&!"$ !"#$ 4(#),-&+'+.#$,*$1#!'$&%,*,(-$EBGH7$\#6#(!"#/#%%3$&!$:'%$+,!$M+,:+$:"#!"#($<=>$&+$!"#$KL$ ,($ ,,.9!#%$ &%$ !"#$ -'%!#($ (#20/'!,($ ,*$ ,,.9!#$ -'!0('!&,+7$ @+)##)3$ !"#$ KL$ '(#$ !"#$ +0(%&+2$ +&."#$ %044,(!&+2$ 2(,:!"$ '+)$ -'!0('!&,+$ ,*$ !"#$ ,,.9!#%$ '+)$ 4#(-&!!&+2$ !"#$ #**#.!$ ,*$ 2,+'),!(,4&+%$ !,$ %!&-0/'!#$ ,,.9!#$ -#&,%&%$ (#%0-4!&,+$ '+)$ ,60/'!&,+7$ Q!#**#+%#+$ #!$ (+!$ )#-,+%!('!#)$ !"'!$ <=>$ '.!&6'!&,+$ 19$ KNVYUX$ &+)0.#)$ -#&,%&%$ (#%0-4!&,+$ ,+/9$ &+$ +'M#)$ ,,.9!#%$45"647%$!$8"&%$(#-'&+%$.,+!(,6#(%&'/3$'%$K(]+)'"/$#!$(+!$)&)$+,!$&)#+!&*9$!"&%$#**#.!7$ 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$$#%& '($)& '*$+'$#& ,,-)'$.& /0'(& ,1).'$*,2.& 203$& 4456()#*,1)-(,2$.'$*,2%& 786 ()#*,1)-(,2$.'$*,2%& 496()#*,1)-(,2$.'$*,2& +"#& 4:6()#*,1)-(,2$.'$*,2& 0"-2;#0"<& ==6>?@A& ,"2)& ==6>?@& 0"#;-$#& ,,-)'$& B$0,.0.& *$.;BC'0,"& DEEFGH& !'& /+.& .;<<$.'$#& '(+'& ==6>?@& 0.& C*,#;-$#& I)& '($& -;B;2;.&,,C(,*;.&;"#$*&JK&.;*<$&0"#;-0"<& B$0,.0.& *$.;BC'0,"& '(*,;<(& +-'0L+'0,"&,M&JN5!&/0'(0"&,,-)'$.&DEO%EE4GH& P;*&*$.;2'.&B0"0B0Q$&'($&$MM$-'&,M&,,-)'$6*$2+'$#&JN5&+"#&<;0#$&'($&.-,,C&,"&'($&RS6 JN5H& T$& 0#$"'0M)& JN5U& 0"& '($& RS& +.& "$-$..+*)& M,*& ,,-)'$& .;*L0L+2& +"#& B+';*+'0,"%& '(;.%& 0BC,*'+"'& M,*& ",*B+2& M$*'020')H& JN5& -,;2#& I$& '($& 0"'$*B$#0+'$& ',& B,#;2+'$& =@K& $MM$-'.& ,"& ,,-)'$&B+';*+'0,"&+"#&.;*L0L+2H&V(0.&0.&.;CC,*'$#&I)&'($&$L0#$"-$&'(+'&=@K&+-'0L+'$.&"#$!& %+"#%&'()*%0"&,,-)'$6-;B;2;.&-,BC2$1&*$'*0$L$#&M*,B&/02#&')C$&,L+*0$.%&+"#&'(+'&B$0,.0.& *$.;BC'0,"&/0'(&=@K&.'0B;2+'0,"&0.&+I,20.($#&0"&"#$!+,-,%B0-$&D47GH&=;*'($*B,*$%&/$&M,;"#& '(+'& B,.'& ,M& '($& C+*+-*0"$& M+-',*.& ,*0<0"+'0"<& M*,B& '($& RS& 0"& '($& "#$!+,-,% B0-$& +*$& #$*$<;2+'$#& -,"M0*B0"<& '(0.& ()C,'($.0.H& JN5.& +*$& '(;.& "$-$..+*)& M,*& =@K& .0<"+20"<& 0"& '($& ,L+*)H& !'& /022& I$& 0"'$*$.'0"<& ',& '$.'& /($'($*& VWOW7F7:& 0"& -,"X;"-'0,"& /0'(& =@K& .'0B;2+'$.& ,,-)'$&B+';*+'0,"&,*&B,#;2+'$.&,L;2+'0,"&0"&,;*&B,;.$&B,#$2H& P,-)'$& B$0,.0.& 0.& <*$+'2)& #$C$"#$"'& ,"& ==6>?@& .0<"+20"<& +"#& -(,2$.'$*,2& 2$L$2.H& Y$M$-'.&0"&'($&+--;B;2+'0,"&,M&==6>?@&;"#$*&=@K&.'0B;2+'0,"&DEFO%EEWG&,*&+I",*B+2&M*$$& -(,2$.'$*,2&2$L$2.&DE4FG&-,;2#&I$&C*$.$"'&0"&"#$!+,-,%B0-$%&+.&JN5&'+*<$'&<$"$.&0BC20-+'$#&0"& -(,2$.'$*,2& +"#& M+'')& +-0#& B$'+I,20.B& +*$& #0.';*I$#H& =;*'($*B,*$%& .,B$& B,;.$& B,#$2.& -,;2#&.(+*$&.,B$&+",B+20$.&/0'(&"#$!+,-,%B0-$A&&'(),-,&B0-$%&/(0-(&(+L$&2,/&KYJ&2$L$2.%& C*$.$"'& /0'(& .'$*,0#& .)"'($.0.& +",B+20$.& +"#& *$#;-$#& C;C.& C$*& 20''$*& DE47GH% .$'*,-,% B0-$& -,;2#&I$&+",'($*&$1+BC2$&DE44GA&'($)&+*$&.'$*02$&/0'(&*$#;-$#&-(,2$.'$*)2&$.'$*&0"&'($&,L+*)& +"#&0"-*$+.$#&M*$$&-(,2$.'$*,2&0"&'($&,,-)'$.&'(+'&0"#;-$.&.C,"'+"$,;.&B$0,.0.&*$.;BC'0,"& +"#&'($&$1C;2.0,"&,M&'($&.$-,"#&C,2+*&I,#)&I)&'($&,,-)'$.H&V($&.+B$&$MM$-'&/+.&0#$"'0M0$#&0"& B0-$&",;*0.($#&/0'(&-(,2$.'$*,26*0-(�$'%DE4FGH&!"#$$#%&-(,2$.'$*,2&0.&.;CC20$#&',&'($&,,-)'$& M*,B&'($&.;**,;"#0"<&-;B;2;.&-$22.&'(+'&+*$&-+C+I2$&',&.)"'($.0Q$&-(,2$.'$*,2&D97EGH&V(;.%& (0<(&-(,2$.'$*,2&2$L$2.&0"&'($&RS&#;$&',&+&JN5&3",-3,;'&.).'$B&0"#;-$&+I",*B+2&-(,2$.'$*,2& #$C,.0'0,"& ,"& ,,-)'$.& 0"M2;$"-0"<& '($0*& <*,/'(%& .;*L0L+2& +"#& B+';*+'0,"H& !"& '($& .+B$& #0*$-'0,"%& C,2)B,*C(0.B.& ,*& @Z[.& ,"& '($& ./0*% \@-+L$"<$*& *$-$C',*& -2+..& ]& ')C$^& /$*$& 0#$"'0M0$#&0"&.'$*02$&/,B$"&DEWFGH&V+3$"&',<$'($*%&'($.$&#+'+&.;<<$.'&'(+'&-(,2$.'$*,2&0"&'($& ,L+*0+"&M,220-2$&B;.'&I$&B+0"'+0"$#&/0'(0"&+&*$2+'0L$2)&"+**,/&C().0,2,<0-+2&*+"<$&',&$".;*$& '($&,,-)'$&B+';*+'0,"&+"#&.'$*,0#&.)"'($.0.H& 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%& '#(& ()$#*+$& ,-).+,/0& 123& ,.& +")& 45& 6$& +")& 7)-,6+'(& '/& +")& )//)8+& '/& 9:;%& 8"'*)$+)('*& 6.-& '<0$+)('*$& '.& ''80+)& 76+#(6+,'.& =>?>@A& B+& C,**& D)& ,.+)()$+,.E& +'& )F6*#6+)& 8"'*)$+)('*&6.-&'<0$+)('*&*)F)*$&,.&!"#$%$#7#*#$G).8*'$)-&''80+)$&/('7&+")&+"())&7'#$)& 7'-)*$A&!")$)&()$#*+$&8'#*-&D)&+(6.$*6+)-&,.&C'7).&C"'&D).)/,+&/('7&6$$,$+)-&()H('-#8+,F)& +)8".'*'E,)$&+'&6.6*0I)&'<0$+)('*&*)F)*$&,.&E(6.#*'$6&*#+),.&8)**$&J8#7#*#$K&6.-&/'**,8#*6(&/*#,-& 6.-&8'(()*6+)&+")$)&*)F)*$&C,+"&''80+)&76+#(6+,'.%&$#(F,F6*&6.-&)6(*0&D*6$+'80$+&/'(76+,'.A& • !"#$%&'()*+ L)0'.-&''80+)&76+#(6+,'.%#'"()*+,+#7,8)&"6F)&'F#*6+'(0&-)/)8+$A&M)F)(+")*)$$%&+")0& $))7&+'&D)&*6+)A&!",$&,$&$#HH'(+)-&D0&+")&()-#8+,'.&'/&+")&.#7D)(&'/&-&(.&(/#012!/&,.&+")& 'F6(,)$& '/& +")$)& 7,8)A& B.-))-%& 'F#*6+,'.& ,$& 6& H('G,./*6776+'(0& H('8)$$& $+,7#*6+)-& D0& +")& )//)8+&E'.6-'+('H,.&$#(E)&,.&7,-G808*)&'.&+")&8#7#*#$&8)**$&*)6-,.E&+'&+")&(#H+#()&'/&+")& 76+#()& /'**,8*)& =>?N@A& O)& /'#.-& 73MP& 6D#.-6.8)& '/& '(3+4%& 52678# 9:&"8;& 6.-& <=>/%.?# JE(6.#*'$6& 8)**& $H)8,/,8& 76(Q)($K# +'& D)& $#D$+6.+,6**0& -)()E#*6+)-& ,.& '"()*+,+# 7,8)& 6.-& .'(76*,I)-& ,.& '"()*+,+@ABC+'"(*& 7,8)& =RSS%>?T@A& !",$& ()F)6*$& 6& H'+).+,6*& 7)8"6.,$7& /'(& /6,*#()& '/& 8#7#*#$& ) !"#$$#%&'()!&*+&,-$&./*"0*.12&*+343/5&*"&,-$+$&0$22+&1"#&*+&*"#60*72$&78&-9:;&"#$%&#'()(*&%&36/& ,$15&#$53"+,/1,$#&,-1,&'()&10,*<1,*3"&=*,-&>?@?ABAC&*"#60$+&+,-..).$,/1"+0/*.,*3"&1"#& *"0/$1+$+&DE&+8",-$+*+&=*,-&"3&*"426$"0$&3"&./3F$+,$/3"$&+8",-$+*+&GEEH;&& I36J1,&$,&)/0&#$53"+,/1,$#&,-1,&>?@ABAC&*"0/$1+$+&DE&+8",-$+*+&*"&=*2#&,8.$&5*0$& GEEH;&K6,%&+,$/3*#&+8",-$+*+&/$F621,*3"&78&'()&*+&#*+,*"0,&4/35&,-$&3,-$/&"602$1/&/$0$.,3/+&1+& LMNA%& OP(NA& 3/& ')QNA;& !"#$$#%& '()& *"<12*#1,*3"& *"& ,-$& 3<1/8& 1"#& ,-$& 1#/$"12& F21"#& *+& .1/1#3R*01228&1++30*1,$#&=*,-&$R0$++*<$&+,$/3*#&+8",-$+*+&/$+62,*"F&*"&96+-*"F&+8"#/35$&1"#& -8.$/DE& GEE%ABSH;& P"3,-$/& +,6#8& #$53"+,/1,$#& ,-1,& '()& *"<12*#1,*3"& /$+62,+& *"& ,-$& 71+12& #$/$./$++*3"&34&12%).&,/1"+0/*.,*3"&*"&,-$&*",$+,*"$&1"#&510/3.-1F$%&*"0/$1+*"F&QO'&2$<$2+& GSSH;&>-6+%&'()&01"&46"0,*3"&1+&73,-&1"&10,*<1,3/&1"#T3/&1&/$./$++3/&34&+,$/3*#&+8",-$+*+&*"&1& F$"$N&1"#&,*++6$N+.$0*4*0&41+-*3";&& DE&2$<$2+&1/$&#$/$F621,$#&*"&,-$&17+$"0$&34&'()&1+&+6FF$+,$#&78&,-$&./34*2$&34&5)UP& 34&+,$/3*#&+8",-$+*+&$"J85$+;&>-*+&*+&7$016+$&34&:9&#$/$F621,*3";&34(5!676819:634(!$5*0$& 1/$& 0-1/10,$/*J$#& 78& "3/512*J$#& .21+51& MLQ& 2$<$2+%& 5)UP& 34& +,$/3*#3F$"*0& $"J85$+%& 3;(<$ =>;(<$+,-.?$1"#$@(5;&!"&,-$&./$+$"0$&34&23=&F3"1#3,/3.*"&2$<$2+&*"&34(5!676%&=$&,-*"V&,-1,&DE& 2$<$2+&=*22&7$&-*F-$/&,-1"&=*2#&,8.$&5*0$;&>-*+&+-362#&7$&03"4*/5$#&78&,-$&5$1+6/$5$",&34& .21+51&1"#&3<1/8&DE&2$<$2+;& D"-1"0$#& $+,/1#*32& *+& 1++30*1,$#& =*,-& 23=$/& 'Q& 1"#& MLQ& 2$<$2+& 7230V*"F& 4322*02$& F/3=,-%&065626+&$R.1"+*3"&W7230V*"F&./3+,1F21"#*"&EX&1"#&3<621,*3"&GBY@H;&!"&,-$&17+$"0$&34& '()%&$+,/1#*32&03"0$",/1,*3"+&1/$&*"0/$1+$#;&>-6+%&'()+&*"&,-$&:9&+$$5&,3&7$&1&F1,$V$$.$/& 1F1*"+,& 6"03",/322$#& +,$/3*#3F$"$+*+;& 93"+$Z6$",28%& +,-.?$ )#A$ @(5$ 5)UP& 2$<$2+& 1"#& *,+& ,1/F$,&F$"$&*"&>9&W+,-.BX$1/$&03"+,*,6,*<$28&*"-*7*,$#&*"&34(5!676$5*0$&+6FF$+,*"F&1&"$F1,*<$& /$,/3&03",/32&3"&>9&0$22+;& >-6+%& *"<12*#1,*3"& 34& '()& *"& ,-$& :9& /$53<$+& ,-$& /$./$++*3"& $R$/,$#& 3"& ,-$& +,$/3*#& +8",-$+*+%&1+&#$+0/*7$#&*"&,-$&1#/$"12&F21"#&GABSH;& !"& 3/#$/& ,3& *#$",*48& =-$,-$/& $R0$++*<$& DE& 1/$& /$+.3"+*72$& 43/& 3308,$& 51,6/1,*3"& #$4$0,+& 1"#T3/& 3<621,*3"& #$4$0,+%& F3"1#3,/3.*"& +,*5621,*3"& 0362#& 7$& 036.2$#& =*,-& 1/351,1+$&*"-*7*,3/+&,3&$<1261,$&,-$&/$+,3/1,*3"&34&,-$+$&#$4$0,+;& • !"##$% [<1/*1"& $R0$++*<$& /$+.3"+$& W*"0/$1+$#& DEX& ,3& F3"1#3,/3.*"+& *+& #$,$0,$#& *"& =35$"& =*,-&[QLL&GSA@H;&>-6+%&DE&2$<$2&43223=&6.&0362#&7$&6+$#&1+&1&51/V$/&34&[QLL&./$#*+.3+*,*3"& 1"#& 53,*<1,$+& ,-$& /$#60,*3"& 34& 3<1/*1"& +,*5621,*3";& P"& $R1FF$/1,$#& /$+.3"+$& ,3& 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%"&'"()#*+)*+,-$'$,&.')/.%+01+"2$')$#+.#3$'!.4.#&5+4$**)2.+)#63$44$&"'1+'.$,&)"#+$#%+ )#,'.$*.%+ ,$()33$'1+ (.'4.$0)3)&1+ 3.$%)#!+ &"+ 3)6.+ &-'.$&.#)#!+ ,"4(3),$&)"#*+ "6+ 7899+ :;<=>?+ @#%..%5+ 4$#1+ *&A%).*+ %.4"#*&'$&.%+ &-.+ )4(3),$&)"#+ "6+ &-.+ )#63$44$&"'15+ $#!)"!.#),+ $#%+ $#&)B$#!)"!.#),+6$,&"'*+*A,-+$*+)#&.'3.AC)#*5+DEFG+$#%+HEIG+)#+&-.+(-1*)"($&-"3"!1+"6+7899+ :; 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%&'()*!"#$%&!+,-.!/#&#/0$'(#$(#123#14$5!$67//$8#$79!#(#0!79:$!%$0!21)$!"#$#;<(#007%9$%=$ !"#$>293!7%9$<(%!#790$!%$#&'/2'!#$!"#7($(%/#$79$?@AA$1#&#/%<+#9!$79$%2($+%1#/4$$ 5!$ 70$ 7+<%(!'9!$ !%$ 9%!73#$ !"'!$ '$()*+*! '91! '$(,*+*! +73#$ '(#$ =#(!7/#$ '91$ 67!"$ 9%(+'/$ (#0<%90#$!%$:%9'1%!(%<7904$591##1*$6#$71#9!7=7#1$!"'!$8%!"$70%=%(+0$%=$BC,$'(#$#;<(#00#1$79$ !"#$DE4$F(#0#93#$%=$8%!"$70%=%(+0$'91$'80#93#$%=$'9$#&71#9!$<"#9%!)<#$79173'!#0$!"'!$!"#0#$ (#3# !" #$%&%'($)'*&+%,-.(/%*&+) 59=/'++'!7%9$ 70$ '$ <7&%!'/$ <(%3#00$ !%$ !(7::#($ %&2/'!7%94$ E)3/73$ :%9'1%!(%<79$ 02(:#$ 79123#0$ ")<#(#+7'*$ <(%0!':/'9179$ <(%123!7%9*$ <(%!#%/)!73$ #9I)+#0$ '91$ 79=/'++'!%()$ 3)!%J79#0$KLMNOLPQR4$S;'::#('!#1$(#0<%90#$!%$:%9'1%!(%<790$/#'179:$!%$?@AAT$!"#$/'!!#(*$7=$ 0#&#(#*$3%2/1$8#$'$0#(7%20$3%+ 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#$%#&'()$*+,($,%%-#$,($.'*#($)-/,(0$1"#$/#2/')-&1,3#$4,5#$,%$1"#$&4'%#$/#4+1,'(%",2$ 6#1.##($'3+/,+($)7%5-(&1,'($+()$*#1+6'4,&$%7()/'*#$89:;<=$>()##)?$'6#%,17$,%$5/#@-#(147$ +%%'&,+1#)$ .,1"$ &"/'(,&$ +('3-4+1,'($ +()$ ABCD$ 89EF<=$ !"#7$ "+3#$ 4'.#/$ &"+(&#%$ 1'$ '61+,($ 2/#0(+(&7$ )-/,(0$ +%%,%1#)$ /#2/')-&1,3#$ ,(1#/3#(1,'(%=$ G-/1"#/*'/#?$ 1"#7$ +/#$ /#4+1,3#47$ /#%,%1+(1$1'$0'(+)'1/'2,(%$.,1"$/#)-&#)$4#3#4%$'5$HB$*+/I#/%$JKLM$+()$>(",6,($NO$89EP?9EQ<=$ B"'4#%1#/'4$4#3#4%$+/#$),/#&147$/#4+1#)$1'$1"#$)-/+1,'($1'$'61+,($&'(,'($J!"#$%&'()*O$8P<=$ K0+,(?$RST$&'-4)$6#$+($,(1#/#%1,(0$*'4#&-4+/$4,(I$6#1.##($'6#%,17$+()$&"/'(,&$+('3-4+1,'(=$ RST$+&1,3+1,'($,($1"#%#$2+1,#(1%$&'-4)$6#$+($+41#/(+1,3#$.+7$1'$*+(+0#$1"#$'3-4+1'/7$)#5#&1%$ +()$ 1'$ ,*2/'3#$ 1"#$ &"+(&#%$ '5$ 2/#0(+(&7=$ U#3#/1"#4#%%?$ 1",%$ "72'1"#%,%$ %"'-4)$ 6#$ &'(5,/*#)$67$*'4#&-4+/$+(+47%#%$1'$#3+4-+1#$RST$#V2/#%%,'($+()$+&1,3,17$.,1",($1"#$'3+/,+($ 5'44,&4#%$ )-/,(0$ '3+/,+($ )/,44,(0$ 1"+1$ ,%$ -%#)$ 5'/$ 1"#$ *+(+0#*#(1$ '5$ ABCD=$ C1"#/.,%#?$ +$ %-60/'-2$ '5$ .'*#($ ,(&4-)#)$ 5'/$ +%%,%1#)$ /#2/')-&1,3#$ 1#&"(,@-#%$ .,44$ 6#$ &'*2+/#)$ .,1"$ .'*#($.,1"$('$+22+/#(1$ABCD$1'$,)#(1,57$*'4#&-4+/$),55#/#(&#%$6#1.##($1"#*=$$ C3#/+44?$ RST$ ,*24,&+1,'($ ,($ 1"#$ 2/#3#(1,'($ '5$ CMDD$ &'-4)$ 6#$ +$ 2#/%2#&1,3#$ ,($ 1"#$ 5-1-/#$&4,(,&+4$%1-)7$1'$,)#(1,57$.'*#($+1$",0"$/,%I$'5$CMDD$)#3#4'2*#(1$+()$1'$%1-)7$1"#$ 2'1#(1,+4$ ,*24,&+1,'($ '5$ RST$ %2#&,5,&$ +0'(,%1%$ 1'$ *')-4+1#$ 1"#$ 2/'1'&'4%$ '5$ "'/*'(#$ %1,*-4+1,'($ )-/,(0$ 2/'&/#+1,'($ +%%,%1+(&#=$ G-/1"#/*'/#?$ RST$ &'-4)$ 6#$ +$ I#7$ 24+7#/$ ,($ 1"#$ &/'%%$1+4I$6#1.##($*#1+6'4,&$%7()/'*#$+()$&"/'(,&$+('3-4+1,'(?$#%2#&,+447$,($2+1,#(1%$.,1"$ ABCD$5'/$.",&"$4,114#$,%$I('.($'($1"#$2"7%,'2+1"'4'07=$W/-0%$1+/0#1,(0$1",%$/#'/$&'-4)$ 6#$2/'*,%,(0$1'$/#)-&#$1"#$&'*24,&+1,'(%$/#4+1#)$1'$5#*+4#$5#/1,4,17=$ $ $ 01! ! ! ! ! ! ! ! ! ! "#$%&$$#'(!)(*!+,-$+,%.#/,$! !"#"$%&'()#(&*+,)#+' ! "#$%&'()#*! +,-.! /0! -)1&%'1,%&! )2)0)&2! 13&! #/#4(1&%/)2! #,$-&'%! %&$&51/%(! '(! 6'7/%! %&*,-'1/%(! /0! 13&! */#'2! 538()/-/*89! :3)(! ;/%.! 3'(! ,#$/<&%&2! 5%&<)/,(-8! ,#)2)0)&2! 5,1'1)<&!%/-&(!/0!=>?(!'#2!'+)-)18!/0!$3/-&(1&%/-!&@$&((!1/!'-1&%!6'-&!'#2!0&6'-&!*&%6!$&--! 6'1,%'1)/#9! A,%! %&(,-1(! )2)08! =>?(! '(! 5%)6/%2)'-! 1/! 6')#1')#! 6'-&! '#2! 0&6'-&! 0&%1)-)189! :3&8!3'<&!5-&/1%/5)$!B#/#4$-'(()$'-C!%/-&(!%'#*)#*!0%/6!-)5)2!3/6&/(1'()(!1/!13&!%&*,-'1)/#! /0!*&%6!$&--!6'1,%'1)/#!'#2!+)42)%&$1)/#'-!$/#1%/-!/0!(1&%/)2!(8#13&()(9!:3&(&!%&$&51/%(!'%&! 5/1)'-! 6/-&$,-'%! -)#.(! +&1;&&#! 6&1'+/-)$! (8#2%/6&! '#2! 385/*/#'2)(69! D,%13&%6/%&E! 13&8! (&&6! 13&! *'1&.&&5&%(! '*')#(1! 13&! #&*'1)<&! )#0-,&#$&! /0! /$%)#&! 2)(%,51/%(! /#! 0&%1)-)189!! "0!13&!$&--,-'%!2&0&$1(!)#!13&!'+(&#$&!/0!=>?(!;)13)#!13&!1&(1)(!'%&!()*#)0)$'#1E!13&8!'%&! *&#&%'--8! $/65&#('1&2! '#2! $/#(&F,-8E! ()#*-&! $&--! $/65'%16! )(! 1/-&%'1&29! G&<&%13&-&((E!=>?!%/-&(!2,%)#*!(5&%6'1/*&#&()(!%&6')#!'!!"#$%%&!'#2!(,**&(1&2!1/!+&!13&! 2%)<&%(!/0!6'-&!0&%1)-)189! H#-).&! 13&! 1&(1)(E! =>?I! )#! 13&! *%'#,-/('! $&--(! )(! B13&! %&*,-'1/%C! /0! 6,-1)5-&! 6&$3'#)(6(! &(()'-! 0/%! 0/--)$-&! 6'1,%'1)/#E! //$81&! (,%<)<'-! '#2! 0/%! $/#1%/--&2! /<,-'1)/#9! =>?I! )(! 13&%&0/%&! '! 5/1)'-! 1'%*&1! 1/! %&*,-'1&! 0&6'-&! 0&%1)-)18! '#2! 1/! 5%&<! /<'%)'#! 385&%(1)6,-'1)/#!(8#2%/6&9! A,%! %&(,-1(! /5&#! 13&! 5&%(5&$1)<&(! 0/%! 13&! )2)0)$'1)/#! /0! #&;! 2)'*#/(1)$! '#2J/%! 5%/*#/(1)$!6'%.&%(!)#!+/13!6'-&!'#2!0&6'-&!)#0&%1)-)189!D)#'--8E!13&(&!%&$&51/%(!'%&!5/1)'-! 13&%'5&,1)$!1'%*&1(K!13&)%!6/2,-'1)/#!$/,-2!+&!,(&0,-!1/!/51)6)L&!*&%6!$&--!6'1,%'1)/#!'#2! 1/!)65%/<&!13&!F,'-)18!/0!3/%6/#'-!(1)6,-'1)/#!2,%)#*!6&2)$'--8!'(()(1&2!5%/$%&'1)/#9' 00! ! ! ! ! ! ! ! ! ! "#$%#&!'()%*+#,! ! ! ! ! ! ! ! ! ! ! ! ! "#$%#&!'()%*+#,!-! ! "#$%#&! .()%*+#/0-!12*#! .23! 45(! .++6! 78"9! .23! 78":! .(#! ;.)#<##=#(,! 54! )>#! #235*(%2#! ,?,)#@A! "#$%#&'!()!*+,-&&,.!/)!*#-01+,.!2)!3,441!56)!7#+,.!()!8,9#::#+,!;/ ",4!/&=1:>&!"1% ! "#$%#&!.()%*+#/B-!C>5+#,)#(5+!.23!@.+#!4#()%+%)?-!&>.)!.D5E)!5(=>.2,!.23!.35=)#3!F! "#$%#&'!()!7#=>D&&#+>!")!31N#!/)!7#+,.!()!8,9#::#+,!;")!3,441!56 ",4!O144!P.%,:+D.,4 -.! ! ! ! ! ! ! ! Molecular Aspects of Medicine 49 (2016) 31–46 Contents lists available at ScienceDirect Molecular Aspects of Medicine journal homepage: www.elsevier.com/locate/mam Review Once and for all, LXR and LXR are gatekeepers of the endocrine system Salwan Maqdasy a,b,c,d,e, Amalia Trousson a,b,c,d, Igor Tauveron a,b,c,e, David H. Volle a,b,c,d, Silvère Baron a,b,c,d,*, Jean-Marc A. Lobaccaro a,b,c,d,* a Université Clermont Auvergne, Université Blaise Pascal, Génétique Reproduction et Développement, 28, place Henri Dunant, BP38, F63001 Clermont-Ferrand, France b CNRS UMR 6293, GReD, 10 Avenue Blaise Pascal, Campus Universitaire des Cézeaux, CS60026, F-63178 Aubiere, France c INSERM UMR 1103, GReD, 10 Avenue Blaise Pascal, Campus Universitaire des Cézeaux, CS60026, F-63178 Aubiere, France d Centre de Recherche en Nutrition Humaine d’Auvergne, 58 Boulevard Montalembert, F-63009 Clermont-Ferrand, France e Service d’Endocrinologie, Diabétologie et Maladies Métaboliques, Hôpital Gabriel Montpied, 58 Boulevard Montalembert, F-63003 Clermont- Ferrand, France ARTICLE INFO ABSTRACT Article history: Liver X receptors (LXRs)  and  are nuclear receptors whose transcriptional activity is regu- Received 11 November 2015 lated by oxysterols, the oxidized forms of cholesterol. Described in the late 1990s as lipid Revised 8 March 2016 sensors, both LXRs regulate cholesterol and fatty acid homeostasis. Over the years, deep Accepted 10 April 2016 phenotypic analyses of mouse models deficient for LXR and/or LXR have pointed out Available online 14 April 2016 various other physiological functions including glucose homeostasis, immunology, and neuroprotection. This review enlightens the “endocrine” functions of LXRs; they deeply impact Keywords: plasma glucose directly and by modulating insulin signaling, renin–angiotensin–aldosterone Liver X receptors Cholesterol axis, thyroid and pituitary hormone levels, and bone homeostasis. Besides, LXR signaling Endocrinology is also involved in adrenal physiology, steroid synthesis, and male and female reproduc- Reproduction tion. Hence, LXRs are definitely involved in the endocrine system and could thus be Pharmacology considered as endocrine receptors, even though oxysterols do not fully correspond to the definition of hormones. Finally, because they are ligand-regulated transcription factors, LXRs are potential pharmacological targets with promising beneficial metabolic effects. © 2016 Elsevier Ltd. All rights reserved. Contents 1. Introduction ...... 32 2. LXRs at a glance ...... 32 2.1. LXRs: two regulated transcription factors ...... 32 2.2. LXRs: sensors of lipid metabolism ...... 33 3. Are LXR and LXR really endocrine receptors? ...... 35 3.1. Insulin-glucose axis ...... 35 3.1.1. In the liver ...... 35 3.1.2. In the pancreas ...... 35 3.1.3. In other tissues ...... 35 3.2. LXRs and thyroid hormones ...... 36 * Corresponding author. Université Clermont Auvergne, Université Blaise Pascal, Génétique Reproduction et Développement, 28, place Henri Dunant, BP38, F63001 Clermont-Ferrand, France. Tel.: +33 473 40 74 16 (JMAL); fax: + 33 473 40 70 42. E-mail addresses: [email protected] (S. Baron); [email protected] (J.-M.A. Lobaccaro). http://dx.doi.org/10.1016/j.mam.2016.04.001 0098-2997/© 2016 Elsevier Ltd. All rights reserved. 32 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 3.3. LXRs and pituitary hormones ...... 37 3.4. LXRs and adrenal gland ...... 37 3.5. LXRs and bone homeostasis ...... 37 3.6. LXRs and the renin–angiotensin–aldosterone system ...... 37 3.7. LXRs and reproductive organs ...... 38 3.7.1. LXRs in endocrine regulation of female reproduction ...... 38 3.7.2. LXRs and testicular physiology ...... 39 4. Conclusions and perspectives ...... 40 Acknowledgements ...... 40 References ...... 41 1. Introduction ognized domains usually found in the nuclear receptors, the hallmark of this type of receptor is the presence of a DNA- The Liver X Receptors (LXRs), LXR (NR1H3) and LXR binding domain. The latter is composed of two zinc fingers (NR1H2), have been the goal of many researches for the last that mediate specific nucleic acid sequence recognition in- two decades. The first physiology studies independently done volved in the regulation of the promoter activities of target in Mangelsdorf’s and Gustafsson’s groups pointed out the genes (Fig. 1). On the carboxy terminal part, a hydropho- crucial role of these nuclear receptors in the homeostasis bic pocket determines the selectivity for the ligand and is of liver cholesterol (Alberti et al., 2001; Peet et al., 1998b). also involved in the binding to co-activators. Firstly described as orphan nuclear receptors, oxidized de- rivatives of cholesterol, named oxysterols, were confirmed 2.1. LXRs: two regulated transcription factors to be their bona fide ligands (Janowski et al., 1996, 1999). Phenotypic analyses of engineered Lxr-deficient mice have Human LXR and LXR are respectively composed of 447 definitely confirmed that LXRs are the drivers of various and 460 amino acids (Peet et al., 1998a). Even though both pathways implicated in lipid metabolism, glucose homeo- LXRs cannot be formally considered as true isoforms since stasis, immunology, cell cycle control and neuroprotection. they are encoded by two distinct genes, they have a great Altogether, their tight “repercussions” in many processes similarity with 77% of identity within their DNA- and ligand- have suggested that they could be pharmacologically tar- binding domains. Sequence specificities are found in the geted in pathologies such as atherosclerosis, diabetes, cancer, amino-terminal domain as well as in the hinge domain (for auto immune and neurological diseases (for review, see more details about LXR/ sequence alignment, please refer Tontonoz and Mangelsdorf, 2003; Viennois et al., 2011). In to Viennois et al., 2011). this review we will point out LXRs as major actors in the Like many other nuclear receptors, LXRs form obligato- endocrine system and modulators of various hormone levels, ry heterodimers with the nuclear receptors for 9-cis retinoic with a special focus on the gonads. Even though their ligands acid, the retinoid X receptors (RXRs or NR2B1-3) (Peet et al., do not fully correspond to the definition of hormones, we 1998a) in their canonical functioning (i.e. as oxysterol re- suggest considering LXRs as endocrine receptors. ceptors). This heterodimer is fixed on a canonical DNA sequence named DR4 and composed of two cores of 2. LXRs at a glance “AGGTCA” sequence separated by 4 nucleotides (Willy et al., 1995). In the absence of the ligand, their transcriptional ac- The nuclear receptors have constituted the central figure tivity is inhibited by corepressors’ recruitment, which blocks in endocrinology for many years, as steroids and hor- the activation domain of the receptor (Fig. 2). mones exert their biological activities via many members When bound to an oxysterol and/or 9-cis retinoic acid, of this superfamily: glucocorticoid (GR, NR3C1), mineralo- allosteric changes occur within the heterodimer allowing corticoid (MR, NR3C2), estrogen (ER/,NR3A1/2),androgen the release of corepressors, interaction with coactivators and (AR, NR3C4), thyroid (TR, NR1A1/2) and vitamin D (VDR, finally activation of transcription of the target genes NR1I2) receptors. LXRs have been considered by some groups (El-Hajjaji et al., 2011; Lobaccaro et al., 2001; Peet et al., as part of the steroid receptors as they bind the oxidized 1998a). Conversely to steroids, which bind their respec- forms of cholesterol, named oxysterols. Beside the four rec- tive receptors with a range aϫnity of pM to nM, oxysterols Fig. 1. Schematic representation of LXR/ structure. The 4 domains are represented and the main functions indicated. Scale is not representative. S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 33 Fig. 2. Schematic representation of LXR⌬/ϫ functioning as a heterodimer with the retinoid X receptor (RXR). In absence of ligand, a co-repressor binds the heterodimer and blocks its transcriptional activity. Upon binding either RXR (9-cis retinoic acid) or LXR (oxysterol) ligand, the co-repressor leaves the heterodimer and a co-activator is recruited, activating the transcription of the target gene. bind LXRs with a relatively low anity (M). As indicated LXR⌬ was first involved in bile acid synthesis and choles- above, oxysterols are the natural ligands of LXRs. Accord- terol excretion by regulation of hepatic cholesterol 7⌬- ing the tissues and the synthesizing enzymes, various hydroxylase Cyp71 (Peet et al., 1998b). Later on, LXRs were oxysterols could activate LXRs such as 20(S), 24(S), 22(R), described to regulate reverse cholesterol transport through 24(R), 27-hydroxycholesterol or 24,25-epoxycholesterol ATP-binding cassette (ABCs) encoding genes (Abca1, Abcg1, (Björkhem, 2002; Huang, 2014; Janowski et al., 1996; Abcg4, Abcg5, Abcg8)(Engel et al., 2001; Kennedy et al., 2001; Schroepfer, 2000; Viennois et al., 2012b). For many years Repa and Mangelsdorf, 2002; Repa et al., 2000b; Schwartz LXRϫ has been considered as ubiquitously expressed while et al., 2000; Venkateswaran et al., 2000; Yu et al., 2003). LXR⌬ was supposed to be restricted to tissues with an active Indeed, they protect cells from increased intra cellular cho- lipid metabolism (Annicotte et al., 2004; Peet et al., 1998a). lesterol levels (Korach-André et al., 2011a, 2011b). Once In fact, this tissue distribution has been a source of con- cholesterol levels increase, their oxidized forms activate LXRs troversy as this was mainly based on northern blot analyses. to mediate cholesterol eϮux from the cells by increasing It is now admitted that all cells may express both isoforms. the membrane transporters ABCs (Fig. 3). LXRs also repress For more information see www.nursa.org. the levels of Enolase, a glycolytic enzyme known to inhibit Besides oxysterol activation, it should be noted that LXR⌬ cholesteryl ester hydrolase (CEHs), which may promote cho- and LXRϫ transcriptional activity could also be modulated lesterol mobilization for subsequent eϮux (De Boussac et al., by protein kinase A (PKA) and regulate the transcription of 2015). renin encoding gene. In this configuration, LXR⌬ or LXRϫ In an LXR-dependent mechanism, cholesterol is cap- binds DNA as a monomer on a specific overlapping cAMP tured by high density lipoproteins (HDL) thanks to response element and a negative response element known apolipoproteins ApoA1, ApoC1 and ApoE, serving as a shuttle as CNRE (Morello et al., 2005). for the reverse transport to the liver (Rader and Hovingh, 2014). Moreover, LXRs block cellular cholesterol uptake when 2.2. LXRs: sensors of lipid metabolism they are saturated, by increasing low density lipoprotein (LDL) receptor (LDLR) degradation through IDOL (induc- Intracellular cholesterol levels are regulated by very sen- ible degrader of the LDLR) transcription (Zelcer et al., 2009). sible feedback mechanisms (Eberlé et al., 2004; Nohturfft Moreover, many other genes implicated in lipid homeosta- et al., 1999; Peet et al., 1998a; Weber et al., 2004). Cellular sis have been identified as direct or indirect LXR target genes: regulation of lipid concentrations is mostly achieved by tran- acyl-CoA carboxylase, cholesteryl ester transfer protein CETP scription factors that control the expression of genes (Luo and Tall, 2000), lipoprotein lipase LPL (Zhang et al., implicated in cholesterol/fatty acid de novo synthesis, trans- 2001), HDL-receptor SRBI (Malerød et al., 2002), phospho- port, excretion and bile acid synthesis (Bantubungi et al., lipid transfer protein (PLTP) and various apolipoproteins 2012; Horton et al., 1998; Hua et al., 1995; Luo and Tall, (ApoE and C) (Latte et al., 2001; Mak et al., 2002). Thus, 2000; Peet et al., 1998b; Schultz et al., 2000; Streicher et al., besides their hypocholesterolemic action at various stages, 1996; Zhang et al., 2001). they regulate reverse cholesterol transport to the liver and Liver and intestine are the major sites of lipid homeo- increase cholesterol excretion in intestine as bile acids. As stasis control where LXRs exert their effects (Brown and ademonstration,Lxr-/- mice fed a fat diet (Peet et al., Goldstein, 1997). LXRs were initially described to regulate 1998b)develophepaticsteatosis,cholesterolaccumula- cholesterol transport, elimination and lipogenesis. Hence, tion in foam cells (Tangirala et al., 2002; Teupser et al., 2008; 34 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 Fig. 3. Cholesterol metabolism and RXR/LXR activity. For more details see the text. ABC, ATP-binding cassette; Apo, apolipoprotein; CE, cholesteryl ester; CETP, cholesteryl ester transfer protein; Cyp71, cholesterol 7 hydroxylase; HDL, high density lipoprotein; LDL, low density lipoprotein; LCAT, lecithin cholesterol acyl transferase; LDLR, LDL receptor; VLDL, very low density lipoprotein; SRB1, scavenger receptor class B member 1. Yasuda et al., 2010)andinotherperipheraltissueslikebrain oxisome proliferator-activated receptor PPAR (NR1C1) and steroidogenic tissues (Cummins et al., 2006; Volle et al., (McCullough et al., 2011)areusedforhypertriglyceridemia. 2007; Wang et al., 2002). These crucial roles make them po- In many cases, these drugs are not well tolerated or unable tential actors in the physiopathology of atherosclerosis and to obtain hopeful results. It is thus necessary to identify new metabolic syndrome. Nevertheless, LXRs are lipogenic factors drugs targeting other cholesterol lowering pathways. LXRs regulating fatty acid synthesis by the modulation of sterol are good pharmacological targets as they can act on differ- response element binding protein (SREBP) 1c (Repa et al., ent sites by increasing its transformation into bile acids, 2000a), and its target genes fatty acid synthase (FASN) (Tobin decreasing intestinal absorption, favoring reverse trans- et al., 2002)andstearoyl-CoAdesaturase(SCD-1)(Chu et al., port (HDL), and preventing its accumulation in the peripheral 2006). LXR activation thus leads to hypertriglyceridemia of tissues, especially in macrophages and arterial wall hepatic origin (very low density lipoprotein (VLDL) (Brunham et al., 2006; Tangirala et al., 2002). For an over- secretion). view of LXR activity in cholesterol homeostasis, see Fig. 3. In intestine, enterocytes express LDLR, ABCA1 in the basal T0901317 and GW3965 are two “pan-LXR” agonists widely side and ABCA1, ABCG5, ABCG8 and Niemann–Pick C1- used in the research fields (Collins et al., 2002; Repa et al., like 1 protein (NPC1L1) in the luminal side of their 2000b). Both of them demonstrated an ecient anti- membranes (Altmann et al., 2004; Temel and Brown, 2012; atherogenic effect, associated with decreased LDL and Yu et al., 2002). NPC1L1 mediates cholesterol absorption increased HDL levels in mouse models of atherosclerosis from the intestinal lumen. Induction of LXRs by oxysterols (ApoE-/- and Ldlr-/- mice) (Chen et al., 2012; Joseph et al., blocks cholesterol absorption from the diet by decreasing 2002; Kratzer et al., 2009). NPC1L1 levels and transfers the absorbed one by ABCA1 to The putative beneficial effects are however counter- HDL particles (Hu et al., 2012). On the other side, LXR ac- acted by the fact that LXR activation induces tivation leads to increased fecal excretion of sterols via hypertriglyceridemia (Joseph and Tontonoz, 2003). Some ABCG5/ABCG8 complex activation. The final balance is the clinical trials used other LXR agonists, but unfortunately they increase of cholesterol excretion and HDL formation (Lo Sasso were interrupted because of neurological side effects. Tran- et al., 2010). sient hypertriglyceridemia and hepatic steatosis were also On a therapeutic level, many drugs are used to treat observed during these trials (DiBlasio-Smith et al., 2008; Katz dyslipidemia. 3-Hydroxy-3-methylglutaryl-coenzyme A et al., 2009). GW6340 is an interesting specific analogue that (HMGCoA) reductase inhibitors statins act on SREBP pathway acts specifically at intestinal level, increasing sterol excre- inhibiting de novo cholesterol synthesis (Chasman et al., tion in the feces and HDL levels in the blood (Yasuda et al., 2012), while ezetimibe blocks intestinal NPC1L1 and in- 2010). GW6340 could thus represent a good leading mol- hibits dietary cholesterol absorption (Hiramitsu et al., 2010; ecule to develop a cholesterol-lowering drug with fewer Rizzo et al., 2009), while fibrates by acting through the per- systemic effects. Likewise, LXRϫ agonists might overcome S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 35 hepatic lipogenesis (Griffett et al., 2013; Ratni et al., 2009). vate carboxykinase (PEPCK) and glucose-6-phosphatase (G- This selectivity is dicult to be challenged owing to the sim- 6Pase), major determinants of hepatic glucose production ilarity of the ligand-binding domain in both isoforms (Bécard et al., 2001; Cao et al., 2003; Chakravarty et al., 2001; (Svensson et al., 2003). Otherwise, tissue selective drugs Latte et al., 2003; Stulnig et al., 2002b). This effect is in- acting on macrophages or intestine might increase HDL direct, via the activation of SREBP1c and PPAR⌬ coactivator-1 levels activating reverse cholesterol transport, and improve alpha (PGC-1)(Commerford et al., 2007; Puigserver et al., its elimination. 2003)(Fig. 4). LXR activation has an effect similar to insulin Thus, research is currently directed toward selective ago- action on the liver, as the principal mechanism of insulin nists targeting either of isoforms with selective organ effects action on the liver is SREBP-1c activation (Horton et al., (Viennois et al., 2012b), and the discovery and test of spe- 1998). Furthermore, T0901317 and GW3965, two already cific LXR modulators. We previously defined these molecules presented potent synthetic analogues of LXRs (Schultz et al., as SLiMs, for selective liver X receptor modulators (Viennois 2000), improve insulin sensitivity by downregulation of the et al., 2012b). gluconeogenesis and upregulation of glucose uptake genes in mouse models of obesity/insulin resistance. 3. Are LXR and LXR really endocrine receptors? Indeed, a positive correlation has also been pointed out between LXRϫ expression and the degree of lipid accumu- Originally defined by Bayliss and Starling in 1902, en- lation, inflammation and fibrosis in the liver of patients with docrinology implied that a “hormone is produced by a well- non-alcoholic fatty liver and non-alcoholic steato-hepatitis defined organ, directly released in small amounts in blood (NASH) (Ahn et al., 2014), which are common complica- circulation to target a distant organ and to exert its specif- tions of diabetes. This could be a compensatory mechanism ic function”. Based on that, hormones were clustered in three to reduce inflammation in the liver rather than a cause of groups (GrinandOjeda,2000): amines (catecholamines), NASH and argues the relationship between LXR and dia- peptides (insulin, glucagon, Ghrelin, leptin…) and lipids (ste- betes in humans. roids). Some nuclear receptors have been considered as endocrine receptors as they were interacting with ste- 3.1.2. In the pancreas roids, while the new “orphan receptors” such as LXR and LXR and LXRϫ are expressed in both rodent and human LXRϫ (see chapter 2) were not taken in consideration, despite insulin and glucagon-secreting cells (Annicotte et al., 2004; the fact that their bona fide ligands were mostly derived from Efanov et al., 2004). In vitro studies show that T0901317 in- cholesterol, as the other steroids. Deep phenotypic analy- creases glucose-dependent insulin secretion (Efanov et al., sis of the mice lacking either LXR or LXRϫ definitively 2004)bybetacellsofisletsofLangerhans.LXRsalsomimic demonstrates their importance to regulate the endocrine the effects of hyperglycemia on the pancreatic beta cells in system. terms of proinsulin synthesis stimulation (Alarcon et al., 2002)(Fig. 4). LXRϫ-deficient mice are thus lean and dia- 3.1. Insulin-glucose axis betic due to insulinopenia rather than insulinoresistance (Gabbi et al., 2009; Gerin et al., 2005; Zitzer et al., 2006). Diabetes mellitus affects a large group of population and However, LXRs are lipogenic and their chronic activation is considered as an epidemic disease in the Westernized leads to elevation of Srebp1c levels, free fatty acid accumu- countries (Rankinen et al., 2015). Insulin resistance and/or lation, and hypertriglyceridemia, which could cause ϫ cell insulinopenia leading to chronic hyperglycemia are the hall- dysfunction and cytotoxicity (Diraison et al., 2004; Schultz marks of this pathology. Besides, low-grade inflammation et al., 2000; Wang et al., 2003). This negative effect could is a systemic phenomenon in type 2 diabetes increasing be reduced by using LXRϫ- or organ-specific ligands. insulin resistance (Grimble, 2002). This type of diabetes is the predominant form in obese patients with a genetic pre- 3.1.3. In other tissues disposition (Halban et al., 2014; Meigs et al., 2000). It Adipose tissue and muscles are primordial for glucose represents the major component of metabolic syndrome. uptake and metabolism (Leney and Tavaré, 2009). When re- Original molecules to treat diabetes other than the classi- sistant to insulin, they participate in hyperglycemia and cal drugs promoting insulin secretion or sensitization are diabetes, and induce further insulin resistance participat- becoming indispensable to manage diabetic patients. Liver, ing in a vicious circle responsible for weight gain and pancreas, muscles and adipose tissue are the main organs decreased insulin secretion by beta cells (Bensellam et al., implicated in glucose homeostasis. LXRs interfere in each 2012). Insulin-induced glucose uptake is mediated princi- organ to promote a normoglycemic effect and prevent pally by the glucose transporter (GLUT) 4 (Stenbit et al., diabetes. 1997; Tozzo et al., 1997), an LXR-target gene in mouse and human (Dalen et al., 2003; Latte et al., 2003). GLUT4 is 3.1.1. In the liver targeted by LXRs in white adipose tissue of mice and cul- Hepatic glycogenolysis and gluconeogenesis are the major tured human adipocytes (Commerford et al., 2007; Fletcher sources of plasma glucose besides alimentary carbohy- et al., 2014; Grefhorst et al., 2005; Latte et al., 2003; Ross drates (for review, see Newsholme et al., 2014). During et al., 2002). Furthermore, correlations between ABCA1 and fasting, increased glucagon and insulin resistance acceler- GLUT4 expression were identified in adipocytes (Le Lay et al., ate these two processes leading to hyperglycemia. LXRs, 2001). LXR activation also improves inflammation-induced especially alpha isoform, seem to be a potential inhibitor insulin resistance, promoting insulin signaling and glucose of gluconeogenesis, by downregulating phosphoenolpyru- uptake by peripheral tissues (Fernández-Veledo et al., 2006). 36 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 Fig. 4. LXRs regulate glucose homeostasis and insulin sensitivity. FBP-1, Fructose 1,6 biphosphatase-1; GLUT, glucose transporter; G-6pase, Glucose-6- phosphatase; HSD, hydroxysteroid dehydrogenase; PGC-1,PPAR⌬ coactivator-1;PEPCK,phosphoenolpyruvatecarboxykinase;SREBP1c,sterolregulatory element-binding protein-1c. Administration of a synthetic LXR agonist, GW3965, nor- women demonstrated reduced expression levels of LXR and malizes plasma glucose levels in mouse models of insulin SREBP1c, especially in the subcutaneous tissue (Lappas, resistance (db/db or ob/ob mice) and high fat fed rats but 2014). This confirms that LXR expression levels and tran- had no effect on non-diabetic models (Latte et al., 2003; scription activity are deregulated in the context of insulin Liu et al., 2006). Nevertheless, LXR activation of GLUT4 seems resistance. Moreover, a single nucleotide polymorphism to be limited to adipose tissue, and no effect is observed in (rs17373080) on LXRϫ human gene has also been corre- skeletal muscles of rodents (Commerford et al., 2007; Latte lated to type 2 diabetes, metabolic syndrome and obesity et al., 2003). Interestingly, T0901317 seems to have some (Dahlman et al., 2006, 2009; Legry et al., 2008; Solaas et al., beneficial effects on myotubules of diabetic patients 2010). (Fernández-Veledo et al., 2008; Kase et al., 2005, 2007). Like- Altogether, even characterized by a lipogenic effect, tar- wise, Baranowski et al. found that administration of geting LXRs seems interesting in the management of diabetes T0901317 to high-fat fed rats improved whole body insulin through their activity on insulin secretion, reduced hepatic sensitivity as well as insulin-stimulated glucose uptake in glucose production and improve peripheral insulin sensi- isolated soleus muscle (Baranowski et al., 2014). tivity. New SLiMs could thus be of interest as LXRs counteract Moreover, insulin-mediated glucose clearance by pe- diabetes-associated symptoms in mouse models (Mraz and ripheral tissues seems to be improved in high fat fed mice Haluzik, 2014; Spillmann et al., 2014). under hyperinsulinic and LXR activating treatment, inde- pendently from glucose production by the liver. Nevertheless, 3.2. LXRs and thyroid hormones others showed a decreased liver production of glucose under the effect of LXR agonists, without any impact on the pe- Although LXRs and TR belong to two distinct sub- ripheral tissues (Commerford et al., 2007). groups of nuclear receptors, they share DR4 DNA-binding Collectively, a coordinated response in both liver and sites and many target genes that could explain convergen- adipose tissue in profit of hypoglycemic balance is docu- ces between the pathways regulated by oxysterols and mented (Latte et al., 2003). Besides, LXRs are presumed thyroid hormones (Berkenstam et al., 2004). This phenom- to have a key role to reverse endothelial dysfunction, re- enon is observed in the human deiodinase-1 (DIO-1) (Zhang ducing potential diabetic complications (Hazra et al., 2012) et al., 1998) or carbohydrate-responsive element-binding (Fig. 4). protein (ChREBP)promoterregulation(Gauthier et al., 2010). In humans, study of subcutaneous and omental adipose Studies showed a direct effect of one receptor on the tissue expression of different lipid genes in women with other; hence, T3 hormone up-regulates Lxr but not Lxr obesity and gestational diabetes mellitus compared to lean mRNA levels in mice (Hashimoto et al., 2007). This effect S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 37 is mediated through TR1, which could explain part of the be metabolized to glucocorticoids. If LXR and LXR are ex- hypocholesterolemic effects of thyroid hormones. Converse- pressed in the adrenal gland during embryonic life (Annicotte ly, T0901317 decreases T3/T4 ratio in the plasma of rats with et al., 2004), LXR seems the dominant isoform in terms of asignificantreductionofT3levels,associatedwithare- activity preventing free cholesterol accumulation. The latter duction of DIO-1 and DIO-2 mRNA levels in the liver and is performed by regulating genes involved in cholesterol thyroid gland, respectively, while Srebp1c is markedly in- capture (LDLR, SRBI), e⌬ux (ABCA1), storage (apoE), and me- creased in thyroid, suggesting a probable lipid accumulation tabolism to steroids (steroidogenic acute regulatory protein, (Davies et al., 2008). Nevertheless, thyroid-stimulating StAR) (Cummins et al., 2006; Jefcoate, 2002; Kraemer, 2007). hormone (TSH) levels remain normal, suggesting an exces- Many of steroidogenic genes are transcriptional targets of sive T3 degradation. LXRs (Cummins et al., 2006). LXR agonist increases StAR and Hyperthyroidism has a lipolytic effect, decreasing LDL and the cholesterol side-chain cleavage enzyme (Cyp11A1) increasing HDL levels (Duntas, 2002), while hypothyroid- (Cummins et al., 2006) as well as melanocortin-2 receptor ism is a cause of secondary dyslipidemia (Duntas and Brenta, expression, suggesting LXR role in the direct synthesis of 2012). These effects are explained by the direct regulation glucocorticoids (Steffensen et al., 2004). But Lxr;-/- mice of different genes implicated in lipid metabolism by TRs have elevated Star, Cyp11A1 and 3-hydroxysteroid dehy- (Lazar, 2003), such as Cyp71, Srebp2, Abca1, Acc1, Chrebp drogenase type 1 (3hsd1)levelswithincreased and Ldlr (Drover and Agellon, 2004; Huuskonen et al., 2004; glucocorticoid concentrations in the blood. Therefore, LXR Mullur et al., 2014; Shin and Osborne, 2003), most of them can be considered as a “safety valve” preventing basal ex- being either direct or indirect LXR targets. cessive glucocorticoid synthesis. Furthermore, Lxr;-/- mice Altogether, these studies demonstrate the overlap exhibit adrenomegaly due to cholesteryl accumulation in between thyroid hormone homeostasis and LXRs to regu- chronic dietary stress, with abolished Abca1 and cholester- late lipid and carbohydrate metabolism. ol traϮcking (Cummins et al., 2006), while no abnormality is detected in the mineralocorticoid pathway. These results 3.3. LXRs and pituitary hormones support the role of LXR as an intermediate between corti- sol levels and energy expenditure (Nilsson et al., 2007). Pituitary gland is one of the master regulators of the en- docrine system. LXR seems to be the predominant isoform 3.5. LXRs and bone homeostasis in the pituitary gland. A specific variant of LXR has also been isolated in the mouse pituitary gland but its exact role Bone is a dynamic tissue with regular osteoblast and os- is still unclear (Hashimoto et al., 2009). SREBP1c and FAS teoclast activity promoting bone turn over. Osteoblasts are greatly increased in vivo after T0901317 treatment produce the receptor activator of nuclear factor ϽB ligand (Davies et al., 2008). Furthermore, T0901317 increases (RANKL) regulating osteoclast activity that induces bone re- proopiomelanocortin (Pomc)mRNAaccumulationandserum sorption. On the other side, RANKL receptor, osteoprotegerin corticosterone and adrenocorticotropin hormone (ACTH) (OPG), is produced by stromal cells and activates bone for- levels through LXR activation (Matsumoto et al., 2009), mation by osteoblasts. RANKL/OPG ratio is primordial to while LXR tends to repress Pomc expression (Hashimoto maintain a normal bone homeostasis and prevent osteo- et al., 2011). A non-significant effect is also observed on porosis. This system is affected by the inflammatory growth hormone levels (Davies et al., 2008). cytokines (for review, see Walsh and Choi, 2014). Being Apart from the direct effect of LXRs on POMC promo- largely implicated in the regulation of the inflammatory tor, an indirect effect was also revealed; LXRs negatively cytokines, LXRs could play a physiological role in bone ho- regulate 11-hydroxysteroid dehydrogenase type 1 (11hsd1) meostasis. Co-culture systems of osteoblasts and osteoclasts expression in the pituitary gland and adipose tissue (Stulnig have shown that LXRs control the RANKL/OPG ratio (Kleyer et al., 2002a), decreasing the active glucocorticoid levels in et al., 2012). A treatment with T0901317 or GW3965 strongly the pituitary gland, and therefore, stimulating ACTH and cor- reduces this ratio, directing the balance toward bone for- ticosterone secretion (Nilsson et al., 2007). Unlike PPARϫ, mation and reducing osteoclast differentiation and activity which is clearly dominant in ACTH adenomas (Heaney et al., (Kim et al., 2013). More interestingly, ovariectomized mice 2002), there is no clear association between LXRs and pi- are protected from osteoporosis when LXR is activated, re- tuitary tumors, even though an increased LXR/LXR mRNA ducing RANKL production by osteoblasts and blocking ratio has been described (Hashimoto et al., 2011). osteoclast differentiation (Remen et al., 2011). This pathway Overall, LXRs could represent key players of the offers further opportunities to prevent and treat osteoporosis. hypothalamo–pituitary axis, and probably one of the bridges connecting the neuroendocrine system with the metabol- 3.6. LXRs and the renin–angiotensin–aldosterone system ic activity of the body. The renin–angiotensin–aldosterone system is primor- 3.4. LXRs and adrenal gland dial for normal blood pressure maintenance. Renin is an enzyme produced by the juxta-glomerular apparatus in Cholesterol homeostasis is primordial for adrenal gland kidney that hydrolyses angiotensinogen to angiotensin I. An- function, being the obligate precursor for steroid (miner- giotensin I is further activated into angiotensin 2 by alocorticoids, glucocorticoids, and androgens in humans) angiotensin-converting enzymes (ACE 1 and 2). Angioten- synthesis (Jefcoate, 2002). Cholesterol is normally stored as sin 2 will later on activate the zona glomerulosa enzymes cholesteryl esters and it is mobilized in cases of stress to in the adrenal gland to produce aldosterone from 38 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 cholesterol. Aldosterone acts on renal tubules to increase identified single nucleotide polymorphisms of sterol cleav- sodium and water retention, optimizing the intravascular age activating protein (SCAP), a protein necessary for SREBP2 volume. Hyperaldosteronism is frequent and responsible for activation, in infertile women (Yates et al., 2011). Besides, secondary hypertension (Funder et al., 2008). some studies correlated oocyte quality to triglycerides and While protein kinase A (PKA) activates LXR through polyunsaturated fatty acid concentrations in the ovary cAMP and consequently increases Renin accumulation, LXR (Jungheim et al., 2011; Robinson et al., 2002; Robker et al., activity seems to be inhibited by cAMP. LXR-null mice have 2009). These evidence supported by animal and human a lower basal renin level, and do not show any regulation studies suggest that cholesterol homeostasis is crucial for of renin by cAMP nor any response to catecholamines a normal ovary physiology. (Morello et al., 2005). Inversely, LXR activation by GW3965 LXR and LXR are expressed in different stages of in rats inhibits angiotensin receptor (ATR2)geneexpres- murine follicle maturation (Mouzat et al., 2009)andfol- sion and blunts the vasopressor effects of angiotensin II. licular fluid-meiosis activating sterol (FF-MAS) is the Furthermore, LXR activation reduces ACE and type 1 an- predominant oxysterol activating LXR in the ovary (Janowski giotensin II receptor (AT1R) mRNA levels. The same effects et al., 1999). FF-MAS concentrations are largely increased could be observed in the vascular smooth muscle, prevent- after follicle stimulating hormone (FSH) and luteinizing ing vasoconstrictive effects of angiotensin (Imayama et al., hormone (LH) stimulation (Grøndahl, 2008; Leonardsen 2008). LXR could also act on the epithelial sodium channel et al., 2000). Furthermore, FF-MAS is responsible for oocyte (ENaC) levels in the collective ducts: T0901317 and GW3965 maturation and promotes embryo implantation (Marín decrease ENaC mRNA levels in vitro,preventingsodiumre- Bivens et al., 2004), probably through its receptor LXR absorption and hypertension. LXRs could thus block (Janowski et al., 1996, 1999). As oocytes do not express FSH aldosterone action in the collecting tubules (Kuipers et al., receptors, it is suggested that LXRs are intermediates, traf- 2010; Soodvilai et al., 2012). The peripheral negative effects ficking the signals generated by FSH induction of granulosa on ATR2, ACE, AT1R and ENaC could be a feedback mech- cells during folliculogenesis toward oocytes, promoting anism to prevent the hypertensive effects of LXR mediated oocyte meiosis and maturation. Indeed, Grondahl et al. tested by renin (Leik et al., 2007). in vitro meiosis resumption in cumulus-enclosed oocytes These findings open a new field of LXR-ligand screen- after treatment with FF-MAS, 22R-hydroxycholesterol, 16- ing to modulate blood pressure. Indeed ACE inhibitors, hydroxycholesterol, 25-hydroxycholesterol and 27- angiotensin receptor and renin blockers are largely used in hydroxycholesterol. They found that meiosis is only the treatment of hypertension. Selective LXR blockers could influenced by FF-MAS (Grøndahl et al., 1998). Inversely, have an additional place. Conversely, few treatments exist Steffensen et al. demonstrated that zymosterol, GW3965 and for hypotension, especially for postural hypotension. LXR se- FSH initiate meiosis resumption in an LXR-dependant lective agonists, or renin activators, could be promising. pattern. Meiosis activation by FSH, zymosterol or GW3965 Finally, the identification of LXR and LXR as regulators was abolished in cultured oocytes retrieved form Lxr-/- mice of renin has important implications and could be a funda- (Steffensen et al., 2006). Furthermore, meiosis resumption mental link between hypercholesterolemia, hypertension, with FSH stimulation was associated with accumulation of diabetes and cardiovascular diseases in metabolic pa- Lxr and Abca1 mRNA (Steffensen et al., 2006). These evi- tients (Daugherty et al., 2004). dence support the role of LXRs in oocyte maturation during folliculogenesis. In vivo,Stefensenetal.pointedouta hypofertility in LXR-deficient mice with reduced number 3.7. LXRs and reproductive organs of pups per litter (Steffensen et al., 2006). Inversely, under gonadotropin stimulation, exaggerated folliculogenesis and 3.7.1. LXRs in endocrine regulation of female reproduction excessive ovulation but with a high percentage of atretic oocytes is observed in Lxr;-/- mice (Mouzat et al., 2009). 3.7.1.1. Ovarian physiology. Ovaries use cholesterol to Thus, we showed that Lxr;-/- mice are at high risk of de- produce progesterone in granulosa cells and androgens in veloping an ovarian hyperstimulation syndrome (OHSS) after theca cells, which will then be aromatized to estrogens in hormone induction (Mouzat et al., 2009). Indeed, OHSS is granulosa cells. Many evidence support the importance of adangerouscomplicationofhormonalstimulationforin cholesterol homeostasis in the ovarian physiology. Im- vitro fertilization and intracytoplasmic sperm injection, af- paired cholesterol uptake due to SRBI receptor defects results fecting nearly 2–4% of these patients. It is characterized by in reduced progesterone levels (Kolmakova et al., 2010; an acute, tremendous ovarian hypersensitivity to gonado- Miettinen et al., 2001). Furthermore, Abca1-/- female mice tropins, leading to a high folliculogenesis and an elevated have defects in steroidogenesis and reduced fertility serum estradiol, associated with increased vascular leakage (Christiansen-Weber et al., 2000). Moreover, Srb1-/- mice are and marked inflammatory process. This syndrome is asso- infertile with reduced cholesteryl ester levels in the ovary ciated with high mortality in these patients due to its and defects in embryogenesis (Trigatti et al., 1999). Yesilaltay potential complications (Albert et al., 2002; Chuderland et al., et al. have recently demonstrated that these mice have in- 2013; Rizk and Smitz, 1992; Soares et al., 2008). Lxr;-/- creased free cholesterol levels, inducing the oocytes for mice present massive hemorrhagic ovaries, with high es- spontaneous meiosis resumption (Yesilaltay et al., 2014). trogen levels, increased inflammation markers and vascular Indeed, free serum cholesterol levels are inversely corre- leak. LXRs could thus play a “gatekeeper role” during go- lated to the duration to obtain a conception in couples nadotropin stimulation, preventing uncontrolled estradiol (Schisterman et al., 2014). Furthermore, others have production. The control of hormonal activity of the ovary S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 39 is mediated by modulating StAR and Cyp11A1 levels (Mouzat to preeclampsia in a study over 155 preeclamptic patients et al., 2009). (Mouzat et al., 2011). Again, LXRs seem the major deter- In human, LXRs are expressed in granulosa cell com- minants in the regulation of the metabolic status even during partment, especially LXR.Thisexpressionisinducedby pregnancy. human chorionic gonadotropin (hCG). By contrast, LXR ago- nists inhibit progesterone production in the granulosa lutein 3.7.2. LXRs and testicular physiology cells (Drouineaud et al., 2007). The latter discrepancy could Spermatogenesis and testosterone production in adult- be explained by excessive cholesterol eux from the luteal hood are finely regulated thanks to the pulsatile stimulation cells under LXR activation, mediated by increased ABCA1, of gonadotropins (LH and FSH), and a complex dialogue ABCG1 levels (Bogan et al., 2012). between different cell types within the testis (Sertoli, Leydig Altogether, LXRs are key players in the main ovarian func- and germ cells) (Cheng and Mruk, 2011; Walker and Cheng, tions, folliculogenesis, ovulation and steroidogenesis during 2005). In this system, cholesterol is the fuel for androgen reproduction. Further studies to demonstrate the diagnos- synthesis and spermatogenesis (high cell turnover). Thus, tic and prognostic value of LXRs in different ovarian any abnormality in cholesterol metabolism could affect male pathologies such as OHSS, premature ovarian failure and fertility. Many studies identified correlations between male polycystic ovary syndrome could offer a new vision to the infertility and cholesterol metabolism (Eisenberg et al., 2014; physiopathology of the ovary. Kaplan et al., 2006; Kasturi et al., 2008; Ramírez-Torres et al., 2000; Schisterman et al., 2014). But, the molecular mecha- 3.7.1.2. Uterine physiology. Beyond ovarian dysfunction, nisms are not well elucidated. obesity has been associated with increased labor diϫcul- Meiosis-activating sterols, especially T-MAS and ties and dystocia (Zhang et al., 2007). Indeed, a close desmosterol, are the amin oxysterols of the testis (Byskov relationship between myometrial contraction and choles- et al., 1995; Keber et al., 2013). T-MAS induces germ cell terol levels has been evoked (Buxton and Vittori, 2005; Elmes meiosis in vitro (Byskov and Saxén, 1976). It is signifi- et al., 2011). Cholesterol accumulation is associated with cantly accumulated within the testis during puberty and lowered myometrial contractility (Noble et al., 2006; Smith adulthood (Keber et al., 2013). In rats, 25-hydroxycholesterol, et al., 2005). Furthermore, oxytocin resistance is observed issued from macrophages in the interstitium of the adult in obese women during labor (Andreasen et al., 2004). testis, reduces cholesterol and stimulates LH-independent If both isoforms are expressed in the endometrium and testosterone biosynthesis, and promotes for Leydig and myometrium, LXR is involved in the uterine contractility, Sertoli cell apoptosis in vitro (Le Goff et al., 2006; Lukyanenko preventing lipid accumulation, inducing Abca1 and Abcg1. et al., 2001; Travert et al., 2006). These data suggest the im- Indeed LXR-deficient female mice have labor diϫculties plication of LXRs in testicular physiology. Besides, the fact or dystocia (Mouzat et al., 2007) with non-delivered pups. that LXR-deficient mice present significant reproduction ab- This abnormality has also been linked to a decrease in pros- normalities opened the way to study the role of LXRs in the taglandin F2⌬ and oxytocin sensitivity in the myometrium. testicular physiology (Fig. 5). Our team and others showed This situation seriously affects the perinatal morbidity/ the relevant importance of these receptors in spermato- mortality (Sebire et al., 2001; Zhang et al., 2007). genesis and androgen production. Indeed, each isoform has apreferentialexpressionpattern:LXR⌬ in Leydig cells and 3.7.1.3. Placenta physiology. Cholesterol homeostasis in tro- LXR in Sertoli cells, while both are expressed within germ phoblast cells is crucial for fetal supplementation mediated cells (Maqdasy et al., 2015; Volle et al., 2007). Phenotypic by cholesterol eux, and progesterone production (Woollett, analysis of LXR-deficient mice showed specific roles and new 2011). LXRs prevent excessive cholesterol accumulation in target genes for LXRs: Star and 3hsd are LXR⌬ direct target the trophoblast cells, which is harmful to normal placen- genes in Leydig cells while LXR regulates Abca1 and Abcg1 tal function (Marceau et al., 2005). Furthermore, LXR agonists gene in Sertoli cells and Abcg8 in germ cells (Maqdasy et al., inhibit hCG production from the trophoblast cells in vitro, 2015; Mascrez et al., 2004; Robertson et al., 2005; Selva et al., which is primordial for pregnancy maintenance 2004; Volle et al., 2007). Beyond LXR⌬ endocrine activity, (Weedon-Fekjaer et al., 2005). Moreover, LXR activation by LXR within Sertoli cells regulates the endocrine physiol- T0901317 and oxidized LDL (rich in oxysterols) reduces tro- ogy of the testis by modulating inhibin and FSH levels from phoblast invasion and predisposes to preeclampsia (Aye et al., one side, and testosterone levels by a paracrine effect on the 2011; Fournier et al., 2008). Preeclampsia is closely related neighboring Leydig cells, on the other side (Maqdasy et al., to hypertension and diabetes during pregnancy, and in- 2015). Meanwhile, both isoforms are necessary to regu- creases maternal and fetal morbidity/mortality (Myatt, 2002; late germ cell homeostasis, especially the proliferation/ Myatt and Webster, 2009). The hallmark of this syndrome apoptosis ratio and spermiogenesis. LXR-deficient mice are is insuϫcient trophoblast invasion with contractile spiral thus infertile with azoospermia at 7 months of age. This phe- uterine arteries. Studies conducted on placenta of women notype is complex and results from Leydig dysfunction with preeclampsia pointed out an overexpression of LXR (LXR⌬-linked phenotype), cholesteryl ester accumulation and ABCA1 (Plösch et al., 2010)andareductionofLXR within Sertoli cells and blood–testis barrier (BTB) disrup- (Weedon-Fekjær et al., 2010). This action is mediated by tion (LXR-linked phenotype), peritubular smooth muscle Endoglin/CD105, a bona fide LXR target gene (Henry-Berger disorganization and spermiogenesis defects. et al., 2008)whichisoverexpressedinpreeclampsia In another study, we demonstrated that LXRs are gate- (Venkatesha et al., 2006). A single nucleotide polymor- keepers against endocrine disruptors, especially against phism of LXR was identified to be significantly correlated diethylstilbestrol (DES). They block the detrimental effects 40 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 Fig. 5. Sites of LXR expression in wild-type mouse testis and phenotypes observed in Lxr-deficient mice. (A) Schematic representation of a section from seminiferous tubule. LXR and LXR expression is indicated. (B) Lxr-/- mice present a reduced testosterone level, with a higher germ cell apoptosis. (C) Lxr-/- mice have cholesteryl ester (represented in yellow) in Sertoli cells, with lower germ cell proliferation. (D) Lxr;-/- mice show numerous testicu- lar anomalies such as cholesteryl ester accumulation, rupture of blood–testis barrier, reduced proliferation/apoptosis balance, reduced testosterone and increased inhibin levels, and peritubular smooth muscle defects (smooth muscle actin disorganization and lipid accumulation). gc, germ cell; lc, Leydig cell; mϫ, macrophage; sc, Sertoli cells; ptsm, peritubular smooth muscle cells; spz, spermatozoa. of DES on the testis in early adulthood (Oumeddour et al., various physiological functions in the endocrine system far 2014). Testicular damage is more profound in Lxr;-/- mice beyond being simple cholesterol/fatty acid sensors. They ac- when exposed to DES. tually orchestrate glucose homeostasis and insulin activity, Our team also studied the implication of LXRs in human thyroid and pituitary hormone levels, bone homeostasis, testis. We studied men with non-obstructive azoospermia renin–angiotensin–aldosterone axis, adrenal steroidogen- (NOA) and compared them with obstructive azoospermia esis, and male and female reproduction (Table 1). Overall, (OA) patients, who were considered as control patients. A one of the most important global endocrine activities is the significant decrease of LXR2 and LXR was observed regulation of steroid synthesis. Beyond, LXRs interact with within the testis of men with NOA, associated with steroid nuclear receptors such as AR (Viennois et al., 2012a) lower proliferating germ cells, suggesting a pivotal role of and ER (Han et al., 2014; Vedin et al., 2009), which are in- LXRs within human testis and its necessity for spermato- volved respectively in prostate and breast cancers. As ligand genesis (Rondanino et al., 2014). Finally, LXR, as a key activated transcription factors, LXRs are thus considered suit- regulator of the testicular physiology, could be added to able pharmacological targets. Despite their pleiotropic effects, the network of the other nuclear receptors regulating tes- one should understand that the magic potion will not be ticular physiology (for review, please refer to Maqdasy et al., soon available and other cell and animal models will be nec- 2012). essary to test putative ligands. 4. Conclusions and perspectives Acknowledgements While oxysterols could not be considered as “true” hor- This work is supported by Fondation pour la Recherche mones owing to their short half-life, LXR and LXR exert Médicale (JMAL), Région Auvergne “Nouveau chercheur” (SB, S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 41 Table 1 Summary of LXR target genes in endocrine tissues. Endocrine tissue Target genes Physiological effects Thyroid (LXRϫ) DIO-2 (downregulation) Increased T4/T3 ratio SREBP1c (activation) Pituitary (LXRϫ) POMC (activation) Stimulated ACTH and glucocorticoid secretion SREBP1c (activation) 11HSD-1 (downregulation) Adrenal gland (LXRϫ)LDL-R,SR-B1,ABCA1,ApoE Preventionoflipidaccumulation StAR,Cyp11A1 Controlofglucocorticoidsynthesis Bone (LXR) RANKL (downregulation) Reduced osteoclast activity Kidney (LXRϫ)Renin(activation)Hypertensiveeffects AT2R, AT1R, ACE, ENaC (downregulation) Anti-hypertensive effects Ovary (LXRϫ and LXR) IL6, VEGF, StAR, Cyp11A1 Folliculogenesis, meiosis, prevention of excessive ovarian response to gonadotropins Placenta (LXR) Endoglin/CD105 (activation) Reduced trophoblast invasion Uterus (LXR) ABCs (activation) Prevention of lipid accumulation, maintenance of contractility Testis Leydig (LXRϫ) StAR, 3hsd, Cyp11A1 (activation) Control of testosterone synthesis, Leydig cell survival Sertoli (LXR) ABCs (activation) Prevention of lipid accumulation, maintenance of BTB Germ cells (LXRϫ/LXR) ABCG8, SREBP1c, SCD1 (activation) Prevention of lipid accumulation, spermiogenesis DHV, AT). We thank the members of the lab for critically Bensellam, M., Laybutt, D.R., Jonas, J.-C., 2012. The molecular mechanisms reading the manuscript. of pancreatic -cell glucotoxicity: recent findings and future research directions. Mol. Cell. Endocrinol. 364, 1–27. doi:10.1016/ j.mce.2012.08.003. Berkenstam, A., Färnegårdh, M., Gustafsson, J.-A., 2004. Convergence of lipid References homeostasis through liver X and thyroid hormone receptors. Mech. Ageing Dev. 125, 707–717. doi:10.1016/j.mad.2004.05.005. Ahn, S.B., Jang, K., Jun, D.W., Lee, B.H., Shin, K.J., 2014. Expression of liver Björkhem, I., 2002. Do oxysterols control cholesterol homeostasis? J. Clin. X receptor correlates with intrahepatic inflammation and fibrosis in Invest. 110, 725–730. doi:10.1172/JCI16388. patients with nonalcoholic fatty liver disease. Dig. Dis. Sci. 59, 2975– Bogan, R.L., Debarber, A.E., Hennebold, J.D., 2012. Liver x receptor 2982. doi:10.1007/s10620-014-3289-x. modulation of gene expression leading to proluteolytic effects Alarcon, C., Wicksteed, B., Prentki, M., Corkey, B.E., Rhodes, C.J., 2002. in primate luteal cells. Biol. Reprod. 86, 89. doi:10.1095/ Succinate is a preferential metabolic stimulus-coupling signal for biolreprod.111.096347. glucose-induced proinsulin biosynthesis translation. Diabetes 51, Brown, M.S., Goldstein, J.L., 1997. The SREBP pathway: regulation of 2496–2504. cholesterol metabolism by proteolysis of a membrane-bound Albert, C., Garrido, N., Mercader, A., Rao, C.V., Remohí, J., Simón, C., et al., transcription factor. Cell 89, 331–340. 2002. The role of endothelial cells in the pathogenesis of ovarian Brunham, L.R., Kruit, J.K., Pape, T.D., Parks, J.S., Kuipers, F., Hayden, M.R., hyperstimulation syndrome. Mol. Hum. Reprod. 8, 409–418. 2006. Tissue-specific induction of intestinal ABCA1 expression with Alberti, S., Schuster, G., Parini, P., Feltkamp, D., Diczfalusy, U., Rudling, M., a liver X receptor agonist raises plasma HDL cholesterol levels. Circ. et al., 2001. Hepatic cholesterol metabolism and resistance to dietary Res. 99, 672–674. doi:10.1161/01.RES.0000244014.19589.8e. cholesterol in LXRbeta-deficient mice. J. Clin. Invest. 107, 565–573. Buxton, I.L.O., Vittori, J.C., 2005. Cholesterol depletion enhances both doi:10.1172/JCI9794. spontaneous and agonist-evoked uterine smooth muscle contractions Altmann, S.W., Davis, H.R., Zhu, L.-J., Yao, X., Hoos, L.M., Tetzloff, G., et al., in a reversible manner. Proc. West. Pharmacol. Soc. 48, 126–128. 2004. Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol Byskov, A.G., Saxén, L., 1976. Induction of meiosis in fetal mouse testis in absorption. Science 303, 1201–1204. doi:10.1126/science.1093131. vitro. Dev. Biol. 52, 193–200. Andreasen, K.R., Andersen, M.L., Schantz, A.L., 2004. Obesity and pregnancy. Byskov, A.G., Andersen, C.Y., Nordholm, L., Thøgersen, H., Xia, G., Wassmann, Acta Obstet. Gynecol. Scand. 83, 1022–1029. doi:10.1111/j.0001- O., et al., 1995. Chemical structure of sterols that activate oocyte 6349.2004.00624.x. meiosis. Nature 374, 559–562. doi:10.1038/374559a0. Annicotte, J.-S., Schoonjans, K., Auwerx, J., 2004. Expression of the liver X Cao, G., Liang, Y., Broderick, C.L., Oldham, B.A., Beyer, T.P., Schmidt, R.J., et al., receptor alpha and beta in embryonic and adult mice. Anat. Rec. A. 2003. Antidiabetic action of a liver x receptor agonist mediated by Discov Mol Cell Evol. Biol. 277, 312–316. doi:10.1002/ar.a.20015. inhibition of hepatic gluconeogenesis. J. Biol. Chem. 278, 1131–1136. Aye, I.L.M.H., Waddell, B.J., Mark, P.J., Keelan, J.A., 2011. Oxysterols inhibit doi:10.1074/jbc.M210208200. differentiation and fusion of term primary trophoblasts by activating Chakravarty, K., Leahy, P., Becard, D., Hakimi, P., Foretz, M., Ferre, P., et al., liver X receptors. Placenta 32, 183–191. doi:10.1016/j.placenta 2001. Sterol regulatory element-binding protein-1c mimics the negative .2010.12.007. effect of insulin on phosphoenolpyruvate carboxykinase (GTP) gene Bantubungi, K., Prawitt, J., Staels, B., 2012. Control of metabolism by transcription. J. Biol. Chem. 276, 34816–34823. doi:10.1074/ nutrient-regulated nuclear receptors acting in the brain. J. Steroid jbc.M103310200. Biochem. Mol. Biol. 130, 126–137. doi:10.1016/j.jsbmb.2011.10.002. Chasman, D.I., Giulianini, F., MacFadyen, J., Barratt, B.J., Nyberg, F., Ridker, Baranowski, M., Zabielski, P., Bachnio-Zabielska, A.U., Harasim, E., P.M., 2012. Genetic determinants of statin-induced low-density Chabowski, A., Górski, J., 2014. Insulin-sensitizing effect of LXR agonist lipoprotein cholesterol reduction: the Justification for the Use of Statins T0901317 in high-fat fed rats is associated with restored muscle GLUT4 in Prevention: an Intervention Trial Evaluating Rosuvastatin expression and insulin-stimulated AS160 phosphorylation. Cell. Physiol. (JUPITER) trial. Circ. Cardiovasc. Genet. 5, 257–264. doi:10.1161/ Biochem. 33, 1047–1057. doi:10.1159/000358675. CIRCGENETICS.111.961144. Bécard, D., Hainault, I., Azzout-Marniche, D., Bertry-Coussot, L., Ferré, P., Chen, J., Zhao, L., Sun, D., Narsinh, K., Li, C., Zhang, Z., et al., 2012. Liver X Foufelle, F., 2001. Adenovirus-mediated overexpression of sterol receptor activation attenuates plaque formation and improves regulatory element binding protein-1c mimics insulin effects on hepatic vasomotor function of the aortic artery in atherosclerotic ApoE(-/-) gene expression and glucose homeostasis in diabetic mice. Diabetes mice. Inflamm. Res. Off. J. Eur. Histamine Res. Soc. Al 61, 1299–1307. 50, 2425–2430. doi:10.1007/s00011-012-0529-4. 42 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 Cheng, C.Y., Mruk, D.D., 2011. Regulation of spermiogenesis, spermiation Efanov, A.M., Sewing, S., Bokvist, K., Gromada, J., 2004. Liver X receptor and blood-testis barrier dynamics: novel insights from studies on Eps8 activation stimulates insulin secretion via modulation of glucose and and Arp3. Biochem. J. 435, 553–562. doi:10.1042/BJ20102121. lipid metabolism in pancreatic beta-cells. Diabetes 53 (Suppl. 3), Christiansen-Weber, T.A., Voland, J.R., Wu, Y., Ngo, K., Roland, B.L., S75–S78. Nguyen, S., et al., 2000. Functional loss of ABCA1 in mice causes severe Eisenberg, M.L., Kim, S., Chen, Z., Sundaram, R., Schisterman, E.F., placental malformation, aberrant lipid distribution, and kidney Buck Louis, G.M., 2014. The relationship between male BMI glomerulonephritis as well as high-density lipoprotein cholesterol and waist circumference on semen quality: data from the deficiency. Am. J. Pathol. 157, 1017–1029. doi:10.1016/S0002- LIFE study. Hum. Reprod. Oxf. Engl. 29, 193–200. doi:10.1093/humrep/ 9440(10)64614-7. det428. Chu, K., Miyazaki, M., Man, W.C., Ntambi, J.M., 2006. Stearoyl-coenzyme El-Hajjaji, F.-Z., Oumeddour, A., Pommier, A.J.C., Ouvrier, A., Viennois, E., A desaturase 1 deficiency protects against hypertriglyceridemia and Dufour, J., et al., 2011. Liver X receptors, lipids and their reproductive increases plasma high-density lipoprotein cholesterol induced by liver secrets in the male. Biochim. Biophys. Acta 1812, 974–981. Xreceptoractivation.Mol.Cell.Biol.26,6786–6798.doi:10.1128/ doi:10.1016/j.bbadis.2011.02.004. MCB.00077-06. Elmes, M.J., Tan, D.S.-Y., Cheng, Z., Wathes, D.C., McMullen, S., 2011. The Chuderland, D., Ben-Ami, I., Kaplan-Kraicer, R., Grossman, H., Ron-El, R., effects of a high-fat, high-cholesterol diet on markers of uterine Shalgi, R., 2013. The role of pigment epithelium-derived factor in the contractility during parturition in the rat. Reprod. Camb. Engl. 141, pathophysiology and treatment of ovarian hyperstimulation syndrome 283–290. doi:10.1530/REP-10-0378. in mice. J. Clin. Endocrinol. Metab. 98, E258–E266. doi:10.1210/ Engel, T., Lorkowski, S., Lueken, A., Rust, S., Schlüter, B., Berger, G., et al., jc.2012-3037. 2001. The human ABCG4 gene is regulated by oxysterols and retinoids Collins, J.L., Fivush, A.M., Watson, M.A., Galardi, C.M., Lewis, M.C., Moore, in monocyte-derived macrophages. Biochem. Biophys. Res. Commun. L.B., et al., 2002. Identification of a nonsteroidal liver X receptor agonist 288, 483–488. doi:10.1006/bbrc.2001.5756. through parallel array synthesis of tertiary amines. J. Med. Chem. 45, Fernández-Veledo, S., Nieto-Vazquez, I., Rondinone, C.M., Lorenzo, M., 2006. 1963–1966. Liver X receptor agonists ameliorate TNFalpha-induced insulin Commerford, S.R., Vargas, L., Dorfman, S.E., Mitro, N., Rocheford, E.C., Mak, resistance in murine brown adipocytes by downregulating protein P.A., et al., 2007. Dissection of the insulin-sensitizing effect of liver X tyrosine phosphatase-1B gene expression. Diabetologia 49, 3038–3048. receptor ligands. Mol. Endocrinol. Baltim. Md 21, 3002–3012. doi:10.1007/s00125-006-0472-4. doi:10.1210/me.2007-0156. Fernández-Veledo, S., Nieto-Vazquez, I., de Castro, J., Ramos, M.P., Cummins, C.L., Volle, D.H., Zhang, Y., McDonald, J.G., Sion, B., Brüderlein, S., Möller, P., et al., 2008. Hyperinsulinemia induces insulin Lefrançois-Martinez, A.-M., et al., 2006. Liver X receptors regulate resistance on glucose and lipid metabolism in a human adipocytic cell adrenal cholesterol balance. J. Clin. Invest. 116, 1902–1912. line: paracrine interaction with myocytes. J. Clin. Endocrinol. Metab. doi:10.1172/JCI28400. 93, 2866–2876. doi:10.1210/jc.2007-2472. Dahlman, I., Nilsson, M., Jiao, H., Hoffstedt, J., Lindgren, C.M., Humphreys, Fletcher, R., Gribben, C., Ma, X., Burchfield, J.G., Thomas, K.C., Krycer, J.R., K., et al., 2006. Liver X receptor gene polymorphisms and adipose tissue et al., 2014. The role of the Niemann-Pick disease, type c1 protein in expression levels in obesity. Pharmacogenet. Genomics 16, 881–889. adipocyte insulin action. PLoS ONE 9, e95598. doi:10.1371/ doi:10.1097/01.fpc.0000236334.49422.48. journal.pone.0095598. Dahlman, I., Nilsson, M., Gu, H.F., Lecoeur, C., Efendic, S., Ostenson, C.G., Fournier, T., Handschuh, K., Tsatsaris, V., Guibourdenche, J., Evain-Brion, et al., 2009. Functional and genetic analysis in type 2 diabetes of liver D., 2008. Role of nuclear receptors and their ligands in human Xreceptoralleles–acohortstudy.BMCMed.Genet.10,27. trophoblast invasion. J. Reprod. Immunol. 77, 161–170. doi:10.1016/ doi:10.1186/1471-2350-10-27. j.jri.2007.05.004. Dalen, K.T., Ulven, S.M., Bamberg, K., Gustafsson, J.-A., Nebb, H.I., 2003. Funder, J.W., Carey, R.M., Fardella, C., Gomez-Sanchez, C.E., Mantero, F., Expression of the insulin-responsive glucose transporter GLUT4 in Stowasser, M., et al., 2008. Case detection, diagnosis, and treatment adipocytes is dependent on liver X receptor alpha. J. Biol. Chem. 278, of patients with primary aldosteronism: an endocrine society clinical 48283–48291. doi:10.1074/jbc.M302287200. practice guideline. J. Clin. Endocrinol. Metab. 93, 3266–3281. Daugherty, A., Rateri, D.L., Lu, H., Inagami, T., Cassis, L.A., 2004. doi:10.1210/jc.2008-0104. Hypercholesterolemia stimulates angiotensin peptide synthesis and Gabbi, C., Warner, M., Gustafsson, J.-A., 2009. Minireview: liver X receptor contributes to atherosclerosis through the AT1A receptor. Circulation beta: emerging roles in physiology and diseases. Mol. Endocrinol. 110, 3849–3857. doi:10.1161/01.CIR.0000150540.54220.C4. Baltim. Md 23, 129–136. doi:10.1210/me.2008-0398. Davies, J.S., Kotokorpi, P., Lindahl, U., Oscarsson, J., Wells, T., Mode, A., 2008. Gauthier, K., Billon, C., Bissler, M., Beylot, M., Lobaccaro, J.-M., Vanacker, Effects of the synthetic liver X receptor agonist T0901317 on the growth J.-M., et al., 2010. Thyroid hormone receptor beta (TRbeta) and liver hormone and thyroid hormone axes in male rats. Endocrine 33, Xreceptor(LXR)regulatecarbohydrate-responseelement-binding 196–204. doi:10.1007/s12020-008-9067-9. protein (ChREBP) expression in a tissue-selective manner. J. Biol. Chem. De Boussac, H., Maqdasy, S., Trousson, A., Zelcer, N., Volle, D.H., Lobaccaro, 285, 28156–28163. doi:10.1074/jbc.M110.146241. J.-M.A., et al., 2015. Enolase is regulated by Liver X Receptors. Steroids Gerin, I., Dolinsky, V.W., Shackman, J.G., Kennedy, R.T., Chiang, S.-H., Burant, doi:10.1016/j.steroids.2015.02.010. C.F., et al., 2005. LXRbeta is required for adipocyte growth, glucose DiBlasio-Smith, E.A., Arai, M., Quinet, E.M., Evans, M.J., Kornaga, T., Basso, homeostasis, and beta cell function. J. Biol. Chem. 280, 23024–23031. M.D., et al., 2008. Discovery and implementation of transcriptional doi:10.1074/jbc.M412564200. biomarkers of synthetic LXR agonists in peripheral blood cells. J. Transl. Grefhorst, A., van Dijk, T.H., Hammer, A., van der Sluijs, F.H., Havinga, R., Med. 6, 59. doi:10.1186/1479-5876-6-59. Havekes, L.M., et al., 2005. Differential effects of pharmacological liver Diraison, F., Parton, L., Ferré, P., Foufelle, F., Briscoe, C.P., Leclerc, I., et al., X receptor activation on hepatic and peripheral insulin sensitivity in 2004. Over-expression of sterol-regulatory-element-binding protein-1c lean and ob/ob mice. Am. J. Physiol. Endocrinol. Metab. 289, E829–E838. (SREBP1c) in rat pancreatic islets induces lipogenesis and decreases doi:10.1152/ajpendo.00165.2005. glucose-stimulated insulin release: modulation by 5-aminoimidazole- Griffett, K., Solt, L.A., El-Gendy, B.E.-D.M., Kamenecka, T.M., Burris, T.P., 2013. 4-carboxamide ribonucleoside (AICAR). Biochem. J. 378, 769–778. Aliver-selectiveLXRinverseagonistthatsuppresseshepaticsteatosis. doi:10.1042/BJ20031277. ACS Chem. Biol. 8, 559–567. doi:10.1021/cb300541g. Drouineaud, V., Sagot, P., Garrido, C., Logette, E., Deckert, V., Gambert, P., Grin, J.E., Ojeda, S., 2000. Textbook of endocrine physiology. In: Textbook et al., 2007. Inhibition of progesterone production in human luteinized of Endocrine Physiology. New York. granulosa cells treated with LXR agonists. Mol. Hum. Reprod. 13, Grimble, R.F., 2002. Inflammatory status and insulin resistance. Curr. Opin. 373–379. doi:10.1093/molehr/gam019. Clin. Nutr. Metab. Care 5, 551–559. Drover, V.A.B., Agellon, L.B., 2004. Regulation of the human cholesterol Grøndahl, C., 2008. Oocyte maturation. Basic and clinical aspects of in vitro 7alpha-hydroxylase gene (CYP7A1) by thyroid hormone in transgenic maturation (IVM) with special emphasis of the role of FF-MAS. Dan. mice. Endocrinology 145, 574–581. doi:10.1210/en.2003-0993. Med. Bull. 55, 1–16. Duntas, L.H., 2002. Thyroid disease and lipids. Thyroid Off. J. Am. Thyroid Grøndahl, C., Ottesen, J.L., Lessl, M., Faarup, P., Murray, A., Grønvald, F.C., Assoc. 12, 287–293. doi:10.1089/10507250252949405. et al., 1998. Meiosis-activating sterol promotes resumption of meiosis Duntas, L.H., Brenta, G., 2012. The effect of thyroid disorders on lipid levels in mouse oocytes cultured in vitro in contrast to related oxysterols. and metabolism. Med. Clin. North Am. 96, 269–281. doi:10.1016/ Biol. Reprod. 58, 1297–1302. j.mcna.2012.01.012. Halban, P.A., Polonsky, K.S., Bowden, D.W., Hawkins, M.A., Ling, C., Mather, Eberlé, D., Hegarty, B., Bossard, P., Ferré, P., Foufelle, F., 2004. SREBP K.J., et al., 2014. -cell failure in type 2 diabetes: postulated mechanisms transcription factors: master regulators of lipid homeostasis. Biochimie and prospects for prevention and treatment. J. Clin. Endocrinol. Metab. 86, 839–848. doi:10.1016/j.biochi.2004.09.018. 99, 1983–1992. doi:10.1210/jc.2014-1425. S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 43 Han, S.-I., Komatsu, Y., Murayama, A., Steffensen, K.R., Nakagawa, Y., Kase, E.T., Wensaas, A.J., Aas, V., Højlund, K., Levin, K., Thoresen, G.H., et al., Nakajima, Y., et al., 2014. Estrogen receptor ligands ameliorate fatty 2005. Skeletal muscle lipid accumulation in type 2 diabetes may involve liver through a nonclassical estrogen receptor/liver X receptor pathway the liver X receptor pathway. Diabetes 54, 1108–1115. in mice. Hepatol. Baltim. Md. 59, 1791–1802. doi:10.1002/hep Kase, E.T., Thoresen, G.H., Westerlund, S., Højlund, K., Rustan, A.C., Gaster, .26951. M., 2007. Liver X receptor antagonist reduces lipid formation and Hashimoto, K., Matsumoto, S., Yamada, M., Satoh, T., Mori, M., 2007. Liver increases glucose metabolism in myotubes from lean, obese and type Xreceptor-alphageneexpressionispositivelyregulatedbythyroid 2diabeticindividuals.Diabetologia50,2171–2180.doi:10.1007/ hormone. Endocrinology 148, 4667–4675. doi:10.1210/en.2007-0150. s00125-007-0760-7. Hashimoto, K., Ishida, E., Matsumoto, S., Shibusawa, N., Okada, S., Monden, Kasturi, S.S., Tannir, J., Brannigan, R.E., 2008. The metabolic syndrome and T., et al., 2009. A liver X receptor (LXR)-beta alternative splicing variant male infertility. J. Androl. 29, 251–259. doi:10.2164/jandrol.107.003731. (LXRBSV) acts as an RNA co-activator of LXR-beta. Biochem. Biophys. Katz, A., Udata, C., Ott, E., Hickey, L., Burczynski, M.E., Burghart, P., et al., Res. Commun. 390, 1260–1265. doi:10.1016/j.bbrc.2009.10.132. 2009. Safety, pharmacokinetics, and pharmacodynamics of single doses Hashimoto, K., Matsumoto, S., Ishida, E., Miura, A., Horiguchi, K., Ozawa, of LXR-623, a novel liver X-receptor agonist, in healthy participants. A., et al., 2011. Liver X receptor-/ expression ratio is increased in J. Clin. Pharmacol. 49, 643–649. doi:10.1177/0091270009335768. ACTH-secreting pituitary adenomas. Neurosci. Lett. 494, 34–37. Keber, R., Rozman, D., Horvat, S., 2013. Sterols in spermatogenesis and doi:10.1016/j.neulet.2011.02.048. sperm maturation. J. Lipid Res. 54, 20–33. doi:10.1194/jlr.R032326. Hazra, S., Rasheed, A., Bhatwadekar, A., Wang, X., Shaw, L.C., Patel, M., et al., Kennedy, M.A., Venkateswaran, A., Tarr, P.T., Xenarios, I., Kudoh, J., Shimizu, 2012. Liver X receptor modulates diabetic retinopathy outcome in a N., et al., 2001. Characterization of the human ABCG1 gene: liver X mouse model of streptozotocin-induced diabetes. Diabetes 61, 3270– receptor activates an internal promoter that produces a novel transcript 3279. doi:10.2337/db11-1596. encoding an alternative form of the protein. J. Biol. Chem. 276, 39438– Heaney, A.P., Fernando, M., Yong, W.H., Melmed, S., 2002. Functional 39447. doi:10.1074/jbc.M105863200. PPAR-gamma receptor is a novel therapeutic target for ACTH- Kim, H.-J., Yoon, K.-A., Yoon, H.-J., Hong, J.M., Lee, M.-J., Lee, I.-K., et al., 2013. secreting pituitary adenomas. Nat. Med. 8, 1281–1287. doi:10.1038 Liver X receptor activation inhibits osteoclastogenesis by suppressing /nm784. NF-⌬Bactivityandc-Fosinductionandpreventsinflammatorybone Henry-Berger, J., Mouzat, K., Baron, S., Bernabeu, C., Marceau, G., Saru, J.-P., loss in mice. J. Leukoc. Biol. 94, 99–107. doi:10.1189/jlb.1112601. et al., 2008. Endoglin (CD105) expression is regulated by the liver X Kleyer, A., Scholtysek, C., Bottesch, E., Hillienhof, U., Beyer, C., Distler, J.H., receptor alpha (NR1H3) in human trophoblast cell line JAR. Biol. Reprod. et al., 2012. Liver X receptors orchestrate osteoblast/osteoclast crosstalk 78, 968–975. doi:10.1095/biolreprod.107.066498. and counteract pathologic bone loss. J. Bone Miner. Res. Off. J. Am. Soc. Hiramitsu, S., Ishiguro, Y., Matsuyama, H., Yamada, K., Kato, K., Noba, M., Bone Miner. Res. 27, 2442–2451. doi:10.1002/jbmr.1702. et al., 2010. The effects of ezetimibe on surrogate markers of cholesterol Kolmakova, A., Wang, J., Brogan, R., Chaϫn, C., Rodriguez, A., 2010. absorption and synthesis in Japanese patients with dyslipidemia. J. Deficiency of scavenger receptor class B type I negatively affects Atheroscler. Thromb. 17, 106–114. progesterone secretion in human granulosa cells. Endocrinology 151, Horton, J.D., Bashmakov, Y., Shimomura, I., Shimano, H., 1998. Regulation 5519–5527. doi:10.1210/en.2010-0347. of sterol regulatory element binding proteins in livers of fasted and Korach-André, M., Archer, A., Barros, R.P., Parini, P., Gustafsson, J.-Å., 2011a. refed mice. Proc. Natl. Acad. Sci. U.S.A. 95, 5987–5992. Both liver-X receptor (LXR) isoforms control energy expenditure by Hu, X., Steffensen, K.R., Jiang, Z.-Y., Parini, P., Gustafsson, J.-Å., Gåfvels, M., regulating brown adipose tissue activity. Proc. Natl. Acad. Sci. U.S.A. et al., 2012. LXR activation increases intestinal cholesterol absorption, 108, 403–408. doi:10.1073/pnas.1017884108. leading to an atherogenic lipoprotein profile. J. Intern. Med. 272, Korach-André, M., Archer, A., Gabbi, C., Barros, R.P., Pedrelli, M., Steffensen, 452–464. doi:10.1111/j.1365-2796.2012.02529.x. K.R., et al., 2011b. Liver X receptors regulate de novo lipogenesis in a Hua, X., Sakai, J., Ho, Y.K., Goldstein, J.L., Brown, M.S., 1995. Hairpin tissue-specific manner in C57BL/6 female mice. Am. J. Physiol. orientation of sterol regulatory element-binding protein-2 in cell Endocrinol. Metab. 301, E210–E222. doi:10.1152/ajpendo.00541.2010. membranes as determined by protease protection. J. Biol. Chem. 270, Kraemer, F.B., 2007. Adrenal cholesterol utilization. Mol. Cell. Endocrinol. 29422–29427. 265–266, 42–45. doi:10.1016/j.mce.2006.12.001. Huang, C., 2014. Natural modulators of liver X receptors. Chin. J. Integr. Kratzer, A., Buchebner, M., Pfeifer, T., Becker, T.M., Uray, G., Miyazaki, M., Med. 12, 76–85. doi:10.1016/S2095-4964(14)60013-3. et al., 2009. Synthetic LXR agonist attenuates plaque formation in Huuskonen, J., Vishnu, M., Pullinger, C.R., Fielding, P.E., Fielding, C.J., 2004. apoE-/- mice without inducing liver steatosis and hypertriglyceridemia. Regulation of ATP-binding cassette transporter A1 transcription by J. Lipid Res. 50, 312–326. doi:10.1194/jlr.M800376-JLR200. thyroid hormone receptor. Biochemistry (Mosc) 43, 1626–1632. Kuipers, I., van der Harst, P., Kuipers, F., van Genne, L., Goris, M., Lehtonen, doi:10.1021/bi0301643. J.Y., et al., 2010. Activation of liver X receptor-alpha reduces activation Imayama, I., Ichiki, T., Patton, D., Inanaga, K., Miyazaki, R., Ohtsubo, H., et al., of the renal and cardiac renin-angiotensin-aldosterone system. Lab. 2008. Liver X receptor activator downregulates angiotensin II type 1 Investig. J. Tech. Methods Pathol. 90, 630–636. doi:10.1038/ receptor expression through dephosphorylation of Sp1. Hypertension labinvest.2010.7. 51, 1631–1636. doi:10.1161/HYPERTENSIONAHA.107.106963. Laϫtte, B.A., Repa, J.J., Joseph, S.B., Wilpitz, D.C., Kast, H.R., Mangelsdorf, Janowski, B.A., Willy, P.J., Devi, T.R., Falck, J.R., Mangelsdorf, D.J., 1996. An D.J., et al., 2001. LXRs control lipid-inducible expression of the oxysterol signalling pathway mediated by the nuclear receptor LXR apolipoprotein E gene in macrophages and adipocytes. Proc. Natl. Acad. alpha. Nature 383, 728–731. doi:10.1038/383728a0. Sci. U.S.A. 98, 507–512. doi:10.1073/pnas.021488798. Janowski, B.A., Grogan, M.J., Jones, S.A., Wisely, G.B., Kliewer, S.A., Corey, Laϫtte, B.A., Chao, L.C., Li, J., Walczak, R., Hummasti, S., Joseph, S.B., et al., E.J., et al., 1999. Structural requirements of ligands for the oxysterol 2003. Activation of liver X receptor improves glucose tolerance through liver X receptors LXRalpha and LXRbeta. Proc. Natl. Acad. Sci. U.S.A. 96, coordinate regulation of glucose metabolism in liver and adipose tissue. 266–271. Proc. Natl. Acad. Sci. U.S.A. 100, 5419–5424. doi:10.1073/ Jefcoate, C., 2002. High-flux mitochondrial cholesterol traϫcking, a pnas.0830671100. specialized function of the adrenal cortex. J. Clin. Invest. 110, 881–890. Lappas, M., 2014. Effect of pre-existing maternal obesity, gestational doi:10.1172/JCI16771. diabetes and adipokines on the expression of genes involved in lipid Joseph, S.B., Tontonoz, P., 2003. LXRs: new therapeutic targets in metabolism in adipose tissue. Metabolism 63, 250–262. doi:10.1016/ atherosclerosis? Curr. Opin. Pharmacol. 3, 192–197. j.metabol.2013.10.001. Joseph, S.B., McKilligin, E., Pei, L., Watson, M.A., Collins, A.R., Laϫtte, B.A., Lazar, M.A., 2003. Thyroid hormone action: a binding contract. J. Clin. Invest. et al., 2002. Synthetic LXR ligand inhibits the development of 112, 497–499. doi:10.1172/JCI19479. atherosclerosis in mice. Proc. Natl. Acad. Sci. U.S.A. 99, 7604–7609. Le Goff, D., Viville, C., Carreau, S., 2006. Apoptotic effects of 25- doi:10.1073/pnas.112059299. hydroxycholesterol in immature rat Sertoli cells: prevention by Jungheim, E.S., Macones, G.A., Odem, R.R., Patterson, B.W., Lanzendorf, S.E., 17beta-estradiol. Reprod. Toxicol. 21, 329–334. doi:10.1016/ Ratts, V.S., et al., 2011. Associations between free fatty acids, cumulus j.reprotox.2005.09.003. oocyte complex morphology and ovarian function during Le Lay, S., Krief, S., Farnier, C., Lefrère, I., Le Liepvre, X., Bazin, R., et al., 2001. in vitro fertilization. Fertil. Steril. 95, 1970–1974. doi:10.1016/ Cholesterol, a cell size-dependent signal that regulates glucose j.fertnstert.2011.01.154. metabolism and gene expression in adipocytes. J. Biol. Chem. 276, Kaplan, S.A., Meehan, A.G., Shah, A., 2006. The age related decrease in 16904–16910. doi:10.1074/jbc.M010955200. testosterone is significantly exacerbated in obese men with the Legry, V., Cottel, D., Ferrières, J., Chinetti, G., Deroide, T., Staels, B., et al., metabolic syndrome. What are the implications for the relatively high 2008. Association between liver X receptor alpha gene polymorphisms incidence of erectile dysfunction observed in these men? J. Urol. 176, and risk of metabolic syndrome in French populations. Int. J. Obes. 32, 1524–1527, discussion 1527-1528. doi:10.1016/j.juro.2006.06.003. 421–428. doi:10.1038/sj.ijo.0803705. 44 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 Leik, C.E., Carson, N.L., Hennan, J.K., Basso, M.D., Liu, Q.-Y., Crandall, D.L., Mouzat, K., Volat, F., Baron, S., Alves, G., Pommier, A.J.C., Volle, D.H., et al., et al., 2007. GW3965, a synthetic liver X receptor (LXR) agonist, reduces 2009. Absence of nuclear receptors for oxysterols liver X receptor angiotensin II-mediated pressor responses in Sprague-Dawley rats. Br. induces ovarian hyperstimulation syndrome in mice. Endocrinology J. Pharmacol. 151, 450–456. doi:10.1038/sj.bjp.0707241. 150, 3369–3375. doi:10.1210/en.2008-1519. Leney, S.E., Tavaré, J.M., 2009. The molecular basis of insulin-stimulated Mouzat, K., Mercier, E., Polge, A., Evrard, A., Baron, S., Balducchi, J.-P., et al., glucose uptake: signalling, tracking and potential drug targets. J. 2011. A common polymorphism in NR1H2 (LXRbeta) is associated with Endocrinol. 203, 1–18. doi:10.1677/JOE-09-0037. preeclampsia. BMC Med. Genet. 12, 145. doi:10.1186/1471-2350-12- Leonardsen, L., Wiersma, A., Baltsen, M., Byskov, A.G., Andersen, C.Y., 2000. 145. Regulation of spontaneous and induced resumption of meiosis in Mraz, M., Haluzik, M., 2014. The role of adipose tissue immune cells in mouse oocytes by different intracellular pathways. J. Reprod. Fertil. 120, obesity and low-grade inflammation. J. Endocrinol. 222, R113–R127. 377–383. doi:10.1530/JOE-14-0283. Liu, Y., Yan, C., Wang, Y., Nakagawa, Y., Nerio, N., Anghel, A., et al., 2006. Mullur, R., Liu, Y.-Y., Brent, G.A., 2014. Thyroid hormone regulation of Liver X receptor agonist T0901317 inhibition of glucocorticoid receptor metabolism. Physiol. Rev. 94, 355–382. doi:10.1152/physrev.00030 expression in hepatocytes may contribute to the amelioration of .2013. diabetic syndrome in db/db mice. Endocrinology 147, 5061–5068. Myatt, L., 2002. Role of placenta in preeclampsia. Endocrine 19, 103–111. doi:10.1210/en.2006-0243. doi:10.1385/ENDO:19:1:103. Lo Sasso, G., Murzilli, S., Salvatore, L., D.’Errico, I., Petruzzelli, M., Conca, Myatt, L., Webster, R.P., 2009. Vascular biology of preeclampsia. J. Thromb. P., et al., 2010. Intestinal specific LXR activation stimulates reverse Haemost. 7, 375–384. doi:10.1111/j.1538-7836.2008.03259.x. cholesterol transport and protects from atherosclerosis. Cell Metab. 12, Newsholme, P., Cruzat, V., Arfuso, F., Keane, K., 2014. Nutrient regulation 187–193. doi:10.1016/j.cmet.2010.07.002. of insulin secretion and action. J. Endocrinol. 221, R105–R120. Lobaccaro, J.M., Repa, J.J., Lu, T.T., Caira, F., Henry-Berger, J., Volle, D.H., et al., doi:10.1530/JOE-13-0616. 2001. Regulation of lipid metabolism by the orphan nuclear receptors]. Nilsson, M., Stulnig, T.M., Lin, C.-Y., Yeo, A.L., Nowotny, P., Liu, E.T., et al., Ann. Endocrinol. (Paris) 62, 239–247. 2007. Liver x receptors regulate adrenal steroidogenesis and Lukyanenko, Y.O., Chen, J.J., Hutson, J.C., 2001. Production of 25- hypothalamic-pituitary-adrenal feedback. Mol. Endocrinol. 21, 126–137. hydroxycholesterol by testicular macrophages and its effects on Leydig doi:10.1210/me.2006-0187. cells. Biol. Reprod. 64, 790–796. Noble, K., Zhang, J., Wray, S., 2006. Lipid rafts, the sarcoplasmic reticulum Luo, Y., Tall, A.R., 2000. Sterol upregulation of human CETP expression in and uterine calcium signalling: an integrated approach. J. Physiol. 570, vitro and in transgenic mice by an LXR element. J. Clin. Invest. 105, 29–35. doi:10.1113/jphysiol.2005.098475. 513–520. doi:10.1172/JCI8573. Nohturfft, A., DeBose-Boyd, R.A., Scheek, S., Goldstein, J.L., Brown, M.S., 1999. Mak, P.A., Latte, B.A., Desrumaux, C., Joseph, S.B., Curtiss, L.K., Mangelsdorf, Sterols regulate cycling of SREBP cleavage-activating protein (SCAP) D.J., et al., 2002. Regulated expression of the apolipoprotein E/C-I/C- between endoplasmic reticulum and Golgi. Proc. Natl. Acad. Sci. U.S.A. IV/C-II gene cluster in murine and human macrophages. A critical role 96, 11235–11240. for nuclear liver X receptors alpha and beta. J. Biol. Chem. 277, 31900– Oumeddour, A., Viennois, E., Caira, F., Decourbey, C., Maqdasy, S., Tahraoui, 31908. doi:10.1074/jbc.M202993200. A., et al., 2014. Liver X receptors interfere with the deleterious effect Malerød, L., Juvet, L.K., Hanssen-Bauer, A., Eskild, W., Berg, T., 2002. of diethylstilbestrol on testicular physiology. Biochem. Biophys. Res. Oxysterol-activated LXRalpha/RXR induces hSR-BI-promoter activity Commun. 446, 656–662. doi:10.1016/j.bbrc.2013.12.005. in hepatoma cells and preadipocytes. Biochem. Biophys. Res. Commun. Peet, D.J., Janowski, B.A., Mangelsdorf, D.J., 1998a. The LXRs: 299, 916–923. anewclassofoxysterolreceptors.Curr.Opin.Genet.Dev.8,571– Maqdasy, S., Baptissart, M., Vega, A., Baron, S., Lobaccaro, J.-M.A., Volle, D.H., 575. 2012. Cholesterol and male fertility: what about orphans and adopted? Peet, D.J., Turley, S.D., Ma, W., Janowski, B.A., Lobaccaro, J.M., Hammer, R.E., Mol. Cell. Endocrinol. doi:10.1016/j.mce.2012.06.011. et al., 1998b. Cholesterol and bile acid metabolism are impaired in mice Maqdasy, S., El Hajjaji, F.-Z., Baptissart, M., Viennois, E., Oumeddour, A., lacking the nuclear oxysterol receptor LXR alpha. Cell 93, 693– Brugnon, F., et al., 2015. Identification of the functions of Liver X 704. Receptor  in Sertoli cells using a targeted expression-rescue model. Plösch, T., Gellhaus, A., van Straten, E.M.E., Wolf, N., Huijkman, N.C.A., Endocrinology doi:10.1210/en.2015-1382; en20151382. Schmidt, M., et al., 2010. The liver X receptor (LXR) and its target gene Marceau, G., Volle, D.H., Gallot, D., Mangelsdorf, D.J., Sapin, V., Lobaccaro, ABCA1 are regulated upon low oxygen in human trophoblast cells: a J.-M.A., 2005. Placental expression of the nuclear receptors for reason for alterations in preeclampsia? Placenta 31, 910–918. oxysterols LXRalpha and LXRbeta during mouse and human doi:10.1016/j.placenta.2010.07.009. development. Anat. Rec. A. Discov Mol Cell Evol. Biol. 283, 175–181. Puigserver, P., Rhee, J., Donovan, J., Walkey, C.J., Yoon, J.C., Oriente, F., et al., doi:10.1002/ar.a.20157. 2003. Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC- Marín Bivens, C.L., Lindenthal, B., O’Brien, M.J., Wigglesworth, K., Blume, 1alpha interaction. Nature 423, 550–555. doi:10.1038/nature01667. T., Grøndahl, C., et al., 2004. A synthetic analogue of meiosis-activating Rader, D.J., Hovingh, G.K., 2014. HDL and cardiovascular disease. Lancet sterol (FF-MAS) is a potent agonist promoting meiotic maturation and 384, 618–625. doi:10.1016/S0140-6736(14)61217-4. preimplantation development of mouse oocytes maturing in vitro. Ramírez-Torres, M.A., Carrera, A., Zambrana, M., 2000. High incidence of Hum. Reprod. Oxf. Engl. 19, 2340–2344. doi:10.1093/humrep/deh436. hyperestrogenemia and dyslipidemia in a group of infertile men. Mascrez, B., Ghyselinck, N.B., Watanabe, M., Annicotte, J.-S., Chambon, P., Ginecol. Obstet. Mex. 68, 224–229. Auwerx, J., et al., 2004. Ligand-dependent contribution of RXRbeta to Rankinen, T., Sarzynski, M.A., Ghosh, S., Bouchard, C., 2015. Are there genetic cholesterol homeostasis in Sertoli cells. EMBO Rep. 5, 285–290. paths common to obesity, cardiovascular disease outcomes, and doi:10.1038/sj.embor.7400094. cardiovascular risk factors? Circ. Res. 116, 909–922. doi:10.1161/ Matsumoto, S., Hashimoto, K., Yamada, M., Satoh, T., Hirato, J., Mori, M., CIRCRESAHA.116.302888. 2009. Liver X receptor-alpha regulates proopiomelanocortin (POMC) Ratni, H., Blum-Kaelin, D., Dehmlow, H., Hartman, P., Jablonski, P., Masciadri, gene transcription in the pituitary. Mol. Endocrinol. Baltim. Md 23, R., et al., 2009. Discovery of tetrahydro-cyclopenta[b]indole as selective 47–60. doi:10.1210/me.2007-0533. LXRs modulator. Bioorg. Med. Chem. Lett. 19, 1654–1657. doi:10.1016/ McCullough, P.A., Ahmed, A.B., Zughaib, M.T., Glanz, E.D., Di Loreto, M.J., j.bmcl.2009.01.109. 2011. Treatment of hypertriglyceridemia with fibric acid derivatives: Remen, K.M.R., Henning, P., Lerner, U.H., Gustafsson, J.-Å., Andersson, G., impact on lipid subfractions and translation into a reduction in 2011. Activation of liver X receptor (LXR) inhibits receptor activator cardiovascular events. Rev. Cardiovasc. Med. 12, 173–185. of nuclear factor ϫBligand(RANKL)-inducedosteoclastdifferentiation Meigs, J.B., Cupples, L.A., Wilson, P.W., 2000. Parental transmission of type in an LXR-dependent mechanism. J. Biol. Chem. 286, 33084–33094. 2diabetes:theFraminghamOffspringStudy.Diabetes49,2201–2207. doi:10.1074/jbc.M111.235937. Miettinen, H.E., Rayburn, H., Krieger, M., 2001. Abnormal lipoprotein Repa, J.J., Mangelsdorf, D.J., 2002. The liver X receptor gene team: potential metabolism and reversible female infertility in HDL receptor (SR-BI)- new players in atherosclerosis. Nat. Med. 8, 1243–1248. doi:10.1038/ deficient mice. J. Clin. Invest. 108, 1717–1722. doi:10.1172/JCI13288. nm1102-1243. Morello, F., de Boer, R.A., Steffensen, K.R., Gnecchi, M., Chisholm, J.W., Repa, J.J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J.M., Shimomura, I., Boomsma, F., et al., 2005. Liver X receptors alpha and beta regulate renin et al., 2000a. Regulation of mouse sterol regulatory element-binding expression in vivo. J. Clin. Invest. 115, 1913–1922. doi:10.1172/JCI24594. protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and Mouzat, K., Prod’homme, M., Volle, D.H., Sion, B., Déchelotte, P., Gauthier, LXRbeta. Genes Dev. 14, 2819–2830. K., et al., 2007. Oxysterol nuclear receptor LXRbeta regulates cholesterol Repa, J.J., Turley, S.D., Lobaccaro, J.A., Medina, J., Li, L., Lustig, K., et al., 2000b. homeostasis and contractile function in mouse uterus. J. Biol. Chem. Regulation of absorption and ABC1-mediated e⌬ux of cholesterol by 282, 4693–4701. doi:10.1074/jbc.M606718200. RXR heterodimers. Science 289, 1524–1529. S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 45 Rizk, B., Smitz, J., 1992. Ovarian hyperstimulation syndrome after Stenbit, A.E., Tsao, T.S., Li, J., Burcelin, R., Geenen, D.L., Factor, S.M., et al., superovulation using GnRH agonists for IVF and related procedures. 1997. GLUT4 heterozygous knockout mice develop muscle insulin Hum. Reprod. Oxf. Engl. 7, 320–327. resistance and diabetes. Nat. Med. 3, 1096–1101. Rizzo, M., Rini, G.B., Spinas, G.A., Berneis, K., 2009. The effects of ezetimibe Streicher, R., Kotzka, J., Müller-Wieland, D., Siemeister, G., Munck, M., Avci, on LDL-cholesterol: quantitative or qualitative changes? Atherosclerosis H., et al., 1996. SREBP-1 mediates activation of the low density 204, 330–333. doi:10.1016/j.atherosclerosis.2008.10.005. lipoprotein receptor promoter by insulin and insulin-like growth Robertson, K.M., Schuster, G.U., Steffensen, K.R., Hovatta, O., Meaney, S., factor-I. J. Biol. Chem. 271, 7128–7133. Hultenby, K., et al., 2005. The liver X receptor-{beta} is essential for Stulnig, T.M., Oppermann, U., Steffensen, K.R., Schuster, G.U., Gustafsson, maintaining cholesterol homeostasis in the testis. Endocrinology 146, J.-A., 2002a. Liver X receptors downregulate 11beta-hydroxysteroid 2519–2530. doi:10.1210/en.2004-1413. dehydrogenase type 1 expression and activity. Diabetes 51, 2426–2433. Robinson, R.S., Pushpakumara, P.G.A., Cheng, Z., Peters, A.R., Abayasekara, Stulnig, T.M., Steffensen, K.R., Gao, H., Reimers, M., Dahlman-Wright, K., D.R.E., Wathes, D.C., 2002. Effects of dietary polyunsaturated fatty acids Schuster, G.U., et al., 2002b. Novel roles of liver X receptors exposed on ovarian and uterine function in lactating dairy cows. Reprod. Camb. by gene expression profiling in liver and adipose tissue. Mol. Pharmacol. Engl. 124, 119–131. 62, 1299–1305. Robker, R.L., Akison, L.K., Bennett, B.D., Thrupp, P.N., Chura, L.R., Russell, Svensson, S., Ostberg, T., Jacobsson, M., Norström, C., Stefansson, K., Hallén, D.L., et al., 2009. Obese women exhibit differences in ovarian D., et al., 2003. Crystal structure of the heterodimeric complex of metabolites, hormones, and gene expression compared with moderate- LXRalpha and RXRbeta ligand-binding domains in a fully agonistic weight women. J. Clin. Endocrinol. Metab. 94, 1533–1540. doi:10.1210/ conformation. EMBO J. 22, 4625–4633. doi:10.1093/emboj/cdg456. jc.2008-2648. Tangirala, R.K., Bischoff, E.D., Joseph, S.B., Wagner, B.L., Walczak, R., La⌬tte, Rondanino, C., Ouchchane, L., Chauffour, C., Marceau, G., Déchelotte, P., Sion, B.A., et al., 2002. Identification of macrophage liver X receptors as B., et al., 2014. Levels of liver X receptors in testicular biopsies of inhibitors of atherosclerosis. Proc. Natl. Acad. Sci. U.S.A. 99, 11896– patients with azoospermia. Fertil. Steril. 102, 361–371, e5. doi:10.1016/ 11901. doi:10.1073/pnas.182199799. j.fertnstert.2014.04.033. Temel, R.E., Brown, J.M., 2012. Biliary and nonbiliary contributions to reverse Ross, S.E., Erickson, R.L., Gerin, I., DeRose, P.M., Bajnok, L., Longo, K.A., et al., cholesterol transport. Curr. Opin. Lipidol. 23, 85–90. doi:10.1097/ 2002. Microarray analyses during adipogenesis: understanding the MOL.0b013e3283508c21. effects of Wnt signaling on adipogenesis and the roles of liver X Teupser, D., Kretzschmar, D., Tennert, C., Burkhardt, R., Wilfert, W., Fengler, receptor alpha in adipocyte metabolism. Mol. Cell. Biol. 22, 5989– D., et al., 2008. Effect of macrophage overexpression of murine liver 5999. Xreceptor-alpha(LXR-alpha)onatherosclerosisinLDL-receptor Schisterman, E.F., Mumford, S.L., Browne, R.W., Barr, D.B., Chen, Z., Louis, deficient mice. Arterioscler. Thromb. Vasc. Biol. 28, 2009–2015. G.M.B., 2014. Lipid concentrations and couple fecundity: the LIFE study. doi:10.1161/ATVBAHA.108.175257. J. Clin. Endocrinol. Metab. 99, 2786–2794. doi:10.1210/jc.2013-3936. Tobin, K.A.R., Ulven, S.M., Schuster, G.U., Steineger, H.H., Andresen, S.M., Schroepfer, G.J., 2000. Oxysterols: modulators of cholesterol metabolism Gustafsson, J.-A., et al., 2002. Liver X receptors as insulin-mediating and other processes. Physiol. Rev. 80, 361–554. factors in fatty acid and cholesterol biosynthesis. J. Biol. Chem. 277, Schultz, J.R., Tu, H., Luk, A., Repa, J.J., Medina, J.C., Li, L., et al., 2000. Role 10691–10697. doi:10.1074/jbc.M109771200. of LXRs in control of lipogenesis. Genes Dev. 14, 2831–2838. Tontonoz, P., Mangelsdorf, D.J., 2003. Liver X receptor signaling pathways Schwartz, K., Lawn, R.M., Wade, D.P., 2000. ABC1 gene expression and in cardiovascular disease. Mol. Endocrinol. Baltim. Md 17, 985–993. ApoA-I-mediated cholesterol eux are regulated by LXR. Biochem. doi:10.1210/me.2003-0061. Biophys. Res. Commun. 274, 794–802. doi:10.1006/bbrc.2000.3243. Tozzo, E., Gnudi, L., Kahn, B.B., 1997. Amelioration of insulin resistance in Sebire, N.J., Jolly, M., Harris, J.P., Wadsworth, J., Joffe, M., Beard, R.W., et al., streptozotocin diabetic mice by transgenic overexpression of GLUT4 2001. Maternal obesity and pregnancy outcome: a study of 287,213 driven by an adipose-specific promoter. Endocrinology 138, 1604–1611. pregnancies in London. Int. J. Obes. Relat. Metab. Disord. 25, 1175–1182. doi:10.1210/endo.138.4.5043. doi:10.1038/sj.ijo.0801670. Travert, C., Carreau, S., Le Goff, D., 2006. Induction of apoptosis by 25- Selva, D.M., Hirsch-Reinshagen, V., Burgess, B., Zhou, S., Chan, J., McIsaac, hydroxycholesterol in adult rat Leydig cells: protective effect of S., et al., 2004. The ATP-binding cassette transporter 1 mediates lipid 17beta-estradiol. Reprod. Toxicol. 22, 564–570. doi:10.1016/ eux from Sertoli cells and influences male fertility. J. Lipid Res. 45, j.reprotox.2006.05.006. 1040–1050. doi:10.1194/jlr.M400007-JLR200. Trigatti, B., Rayburn, H., Viñals, M., Braun, A., Miettinen, H., Penman, M., Shin, D.-J., Osborne, T.F., 2003. Thyroid hormone regulation and cholesterol et al., 1999. Influence of the high density lipoprotein receptor SR-BI metabolism are connected through Sterol Regulatory Element-Binding on reproductive and cardiovascular pathophysiology. Proc. Natl. Acad. Protein-2 (SREBP-2). J. Biol. Chem. 278, 34114–34118. doi:10.1074/ Sci. U.S.A. 96, 9322–9327. jbc.M305417200. Vedin, L.-L., Lewandowski, S.A., Parini, P., Gustafsson, J.-A., Steffensen, K.R., Smith, R.D., Babiychuk, E.B., Noble, K., Draeger, A., Wray, S., 2005. Increased 2009. The oxysterol receptor LXR inhibits proliferation of human breast cholesterol decreases uterine activity: functional effects of cholesterol cancer cells. Carcinogenesis 30, 575–579. doi:10.1093/carcin/bgp029. alteration in pregnant rat myometrium. Am. J. Physiol. Cell Physiol. 288, Venkatesha, S., Toporsian, M., Lam, C., Hanai, J., Mammoto, T., Kim, Y.M., C982–C988. doi:10.1152/ajpcell.00120.2004. et al., 2006. Soluble endoglin contributes to the pathogenesis of Soares, S.R., Gómez, R., Simón, C., García-Velasco, J.A., Pellicer, A., 2008. preeclampsia. Nat. Med. 12, 642–649. doi:10.1038/nm1429. Targeting the vascular endothelial growth factor system to prevent Venkateswaran, A., La⌬tte, B.A., Joseph, S.B., Mak, P.A., Wilpitz, D.C., ovarian hyperstimulation syndrome. Hum. Reprod. Update 14, 321–333. Edwards, P.A., et al., 2000. Control of cellular cholesterol eux by the doi:10.1093/humupd/dmn008. nuclear oxysterol receptor LXR alpha. Proc. Natl. Acad. Sci. U.S.A. 97, Solaas, K., Legry, V., Retterstol, K., Berg, P.R., Holven, K.B., Ferrières, J., et al., 12097–12102. doi:10.1073/pnas.200367697. 2010. Suggestive evidence of associations between liver X receptor  Viennois, E., Pommier, A.J.C., Mouzat, K., Oumeddour, A., El Hajjaji, F.-Z., polymorphisms with type 2 diabetes mellitus and obesity in three Dufour, J., et al., 2011. Targeting liver X receptors in human health: cohort studies: HUNT2 (Norway), MONICA (France) and HELENA deadlock or promising trail? Expert Opin. Ther. Targets 15, 219–232. (Europe). BMC Med. Genet. 11, 144. doi:10.1186/1471-2350-11-144. doi:10.1517/14728222.2011.547853. Soodvilai, S., Jia, Z., Fongsupa, S., Chatsudthipong, V., Yang, T., 2012. Liver Viennois, E., Esposito, T., Dufour, J., Pommier, A., Fabre, S., Kemeny, J.-L., X receptor agonists decrease ENaC-mediated sodium transport in et al., 2012a. Lxrϫ regulates the androgen response in prostate collecting duct cells. Am. J. Physiol. Renal Physiol. 303, F1610–F1616. epithelium. Endocrinology 153, 3211–3223. doi:10.1210/en.2011-1996. doi:10.1152/ajprenal.00283.2012. Viennois, E., Mouzat, K., Dufour, J., Morel, L., Lobaccaro, J.-M., Baron, S., Spillmann, F., Van Linthout, S., Miteva, K., Lorenz, M., Stangl, V., Schultheiss, 2012b. Selective liver X receptor modulators (SLiMs): what use in H.-P., et al., 2014. LXR agonism improves TNF-ϫ-induced endothelial human health? Mol. Cell. Endocrinol. 351, 129–141. doi:10.1016/ dysfunction in the absence of its cholesterol-modulating effects. j.mce.2011.08.036. Atherosclerosis 232, 1–9. doi:10.1016/j.atherosclerosis.2013.10.001. Volle, D.H., Mouzat, K., Duggavathi, R., Siddeek, B., Déchelotte, P., Sion, B., Steffensen, K.R., Neo, S.Y., Stulnig, T.M., Vega, V.B., Rahman, S.S., Schuster, et al., 2007. Multiple roles of the nuclear receptors for oxysterols liver G.U., et al., 2004. Genome-wide expression profiling; a panel of mouse X receptor to maintain male fertility. Mol. Endocrinol. Baltim. Md 21, tissues discloses novel biological functions of liver X receptors in 1014–1027. doi:10.1210/me.2006-0277. adrenals. J. Mol. Endocrinol. 33, 609–622. doi:10.1677/jme.1.01508. Walker, W.H., Cheng, J., 2005. FSH and testosterone signaling in Sertoli cells. Steffensen, K.R., Robertson, K., Gustafsson, J.-A., Andersen, C.Y., 2006. Reprod. Camb. Engl. 130, 15–28. doi:10.1530/rep.1.00358. Reduced fertility and inability of oocytes to resume meiosis in mice Walsh, M.C., Choi, Y., 2014. Biology of the RANKL-RANK-OPG system in deficient of the Lxr genes. Mol. Cell. Endocrinol. 256, 9–16. doi:10.1016/ immunity, bone, and beyond. Front. Immunol. 5, 511. doi:10.3389/ j.mce.2006.03.044. fimmu.2014.00511. 46 S. Maqdasy et al. / Molecular Aspects of Medicine 49 (2016) 31–46 Wang, H., Maechler, P., Antinozzi, P.A., Herrero, L., Hagenfeldt-Johansson, Yesilaltay, A., Dokshin, G.A., Busso, D., Wang, L., Galiani, D., Chavarria, T., K.A., Bjorklund, A., et al., 2003. The transcription factor SREBP-1c is et al., 2014. Excess cholesterol induces mouse egg activation and may instrumental in the development of beta-cell dysfunction. J. Biol. Chem. cause female infertility. Proc. Natl. Acad. Sci. U.S.A. 111, E4972–E4980. 278, 16622–16629. doi:10.1074/jbc.M212488200. doi:10.1073/pnas.1418954111. Wang, L., Schuster, G.U., Hultenby, K., Zhang, Q., Andersson, S., Gustafsson, Yu, L., Hammer, R.E., Li-Hawkins, J., Von Bergmann, K., Lutjohann, D., Cohen, J.-A., 2002. Liver X receptors in the central nervous system: from lipid J.C., et al., 2002. Disruption of Abcg5 and Abcg8 in mice reveals their homeostasis to neuronal degeneration. Proc. Natl. Acad. Sci. U.S.A. 99, crucial role in biliary cholesterol secretion. Proc. Natl. Acad. Sci. U.S.A. 13878–13883. doi:10.1073/pnas.172510899. 99, 16237–16242. doi:10.1073/pnas.252582399. Weber, L.-W., Boll, M., Stampfl, A., 2004. Maintaining cholesterol Yu, L., York, J., von Bergmann, K., Lutjohann, D., Cohen, J.C., Hobbs, H.H., homeostasis: sterol regulatory element-binding proteins. World J. 2003. Stimulation of cholesterol excretion by the liver X receptor Gastroenterol. 10, 3081–3087. agonist requires ATP-binding cassette transporters G5 and G8. J. Biol. Weedon-Fekjær, M.S., Johnsen, G.M., Anthonisen, E.H., Sugulle, M., Nebb, Chem. 278, 15565–15570. doi:10.1074/jbc.M301311200. H.I., Duttaroy, A.K., et al., 2010. Expression of liver X receptors in Zelcer, N., Hong, C., Boyadjian, R., Tontonoz, P., 2009. LXR regulates pregnancies complicated by preeclampsia. Placenta 31, 818–824. cholesterol uptake through Idol-dependent ubiquitination of the LDL doi:10.1016/j.placenta.2010.06.015. receptor. Science 325, 100–104. doi:10.1126/science.1168974. Weedon-Fekjaer, M.S., Duttaroy, A.K., Nebb, H.I., 2005. Liver X receptors Zhang, C.Y., Kim, S., Harney, J.W., Larsen, P.R., 1998. Further characterization mediate inhibition of hCG secretion in a human placental trophoblast of thyroid hormone response elements in the human type 1 cell line. Placenta 26, 721–728. doi:10.1016/j.placenta.2004.10.005. iodothyronine deiodinase gene. Endocrinology 139, 1156–1163. Willy, P.J., Umesono, K., Ong, E.S., Evans, R.M., Heyman, R.A., Mangelsdorf, doi:10.1210/endo.139.3.5849. D.J., 1995. LXR, a nuclear receptor that defines a distinct retinoid Zhang, J., Bricker, L., Wray, S., Quenby, S., 2007. Poor uterine contractility response pathway. Genes Dev. 9, 1033–1045. in obese women. BJOG – Int. J. Obstet. Gynaecol. 114, 343–348. Woollett, L.A., 2011. Review: transport of maternal cholesterol to the fetal doi:10.1111/j.1471-0528.2006.01233.x. circulation. Placenta 32 (Suppl. 2), S218–S221. doi:10.1016/ Zhang, Y., Repa, J.J., Gauthier, K., Mangelsdorf, D.J., 2001. Regulation of j.placenta.2011.01.011. lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta. Yasuda, T., Grillot, D., Billheimer, J.T., Briand, F., Delerive, P., Huet, S., et al., J. Biol. Chem. 276, 43018–43024. doi:10.1074/jbc.M107823200. 2010. Tissue-specific liver X receptor activation promotes macrophage Zitzer, H., Wente, W., Brenner, M.B., Sewing, S., Buschard, K., Gromada, J., reverse cholesterol transport in vivo. Arterioscler. Thromb. Vasc. Biol. et al., 2006. Sterol regulatory element-binding protein 1 mediates liver 30, 781–786. doi:10.1161/ATVBAHA.109.195693. Xreceptor-beta-inducedincreasesininsulinsecretionandinsulin Yates, M., Kolmakova, A., Zhao, Y., Rodriguez, A., 2011. Clinical impact of messenger ribonucleic acid levels. Endocrinology 147, 3898–3905. scavenger receptor class B type I gene polymorphisms on human doi:10.1210/en.2005-1483. female fertility. Hum. Reprod. Oxf. Engl. 26, 1910–1916. doi:10.1093/ humrep/der124. Molecular and Cellular Endocrinology 368 (2013) 30–46 Contents lists available at SciVerse ScienceDirect Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce Review Cholesterol and male fertility: What about orphans and adopted? Salwan Maqdasy a,b,c,d,e, Marine Baptissart a,b,c,d, Aurélie Vega a,b,c,d, Silvère Baron a,b,c,d, a,b,c,d a,b,c,d, Jean-Marc A. Lobaccaro , David H. Volle  a INSERM, U1103, GReD, F-63171 Aubiere, France b Clermont Université, Université Blaise Pascal, Génétique Reproduction et Développement, BP 10448, F-63000 Clermont-Ferrand, France c CNRS, UMR 6293, GReD, F-63177 Aubiere, France d Centre de Recherche en Nutrition Humaine d’Auvergne, F-63000 Clermont-Ferrand, France e Service d’endocrinologie, diabétologie, maladies métaboliques, Centre Hospitalier Universitaire et Université d’ Auvergne, F-63000 Clermont-Ferrand, France article info abstract Article history: The link between cholesterol homeostasis and male fertility has been clearly suggested in patients who Available online 3 July 2012 suffer from hyperlipidemia and metabolic syndrome. This has been confirmed by the generation of sev- eral transgenic mouse models or in animals fed with high cholesterol diet. Next to the alteration of the Keywords: endocrine signaling pathways through steroid receptors (androgen and estrogen receptors); ‘‘orphan’’ Cholesterol and ‘‘adopted’’ nuclear receptors, such as the Liver X Receptors (LXRs), the Proliferating Peroxisomal Acti- Male fertility vated Receptors (PPARs) or the Liver Receptor Homolog-1 (LRH-1), have been involved in this cross-talk. Testis These transcription factors show distinct expression patterns in the male genital tract, explaining the Nuclear receptors large panel of phenotypes observed in transgenic male mice and highlighting the importance of lipid homesostasis and the complexity of the molecular pathways involved. Increasing our knowledge of the roles of these nuclear receptors in male germ cell differentiation could help in proposing new approaches to either treat infertile men or define new strategies for contraception.  2012 Elsevier Ireland Ltd. All rights reserved. Contents 1. Introduction ...... 31 2. Cholesterol, a major actor of testicular physiology ...... 31 2.1. Male fertility ...... 31 2.1.1. Pathology ...... 31 2.1.2. Testicular histology ...... 32 2.1.3. Hormonal regulation of testicular physiology ...... 33 2.2. Lipid metabolism disorders and reproduction...... 33 2.3. ‘‘Lipidic’’ Nuclear Receptors in male genital tract ...... 34 2.3.1. Steroidogenic factor 1 ...... 34 2.3.2. Dosage-sensitive sex reversal, Adrenal hypoplasia critical region, on chromosome X, gene 1 (Dax1, NR0B1)...... 34 2.3.3. Liver X receptors LXRa and LXRb (NR1H3 and NR1H2) ...... 35 2.3.4. Peroxisome Proliferator Activated Receptors PPARa, b and c (NR1C1, NR1C2 and NR1C3) ...... 36 2.3.5. The Liver Receptor Homolog -1 (LRH-1; NR5A2) ...... 37 2.3.6. The Small Heterodimer Partner (SHP; NR0B2) ...... 37 2.3.6.1. Physiological functions ...... 37 2.3.6.2. Testicular expression pattern ...... 38 2.3.6.3. Role in the Leydig cells ...... 38 2.3.6.4. Potential role in germ cells ...... 38 2.3.7. The Bile acid receptor (FXR; NR1H4) ...... 38 2.3.7.1. Physiological functions ...... 38 Corresponding author at: Génétique Reproduction et Développement, Unité Mixte de Recherche CNRS 6293 Clermont Université, INSERM 1103, 24 Avenue des Landais,  BP 80026, 63171 Aubière Cedex, France. E-mail address: [email protected] (D.H. Volle). 0303-7207/$ - see front matter  2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mce.2012.06.011 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 31 2.3.7.2. Testicular expression pattern ...... 38 2.3.7.3. Role in the Leydig cells ...... 38 2.3.8. Retinoid X receptors ...... 38 3. Conclusions/discussion ...... 39 3.1. Post-testicular maturation ...... 39 3.2. Post-ejaculation ...... 40 3.2.1. Seminals ...... 40 3.2.2. Prostate ...... 40 3.3. From infertility to cancer? ...... 40 3.4. Potential therapeutic targets? ...... 40 Acknowledgements ...... 40 References ...... 40 1. Introduction over, many experimental and clinical data have highlighted the importance of lipid metabolism in the control of male fertility Cholesterol plays an important role in cellular function and and more particularly testicular physiology (Wathes et al., 2007; integrity. It is essential for membrane composition, permeability, El-Hajjaji et al., 2011). fluidity, endocytosis and intracellular signaling. Thus, its homeo- We will review data on the impact of cholesterol homeostasis stasis is crucial for optimal cellular functions. The balance between on male fertility, and the molecular mechanisms involved. Next its synthesis and catabolism should be strictly regulated. Deregula- to steroid receptors such as the androgen and estrogen receptors, tion of cholesterol homeostasis can be responsible for atheroscle- here we will focus on those guided by some orphans and adopted rosis and increases the risk of cardiac and/or cerebral vascular nuclear receptors which have been defined as sensors of lipid diseases (Carleton et al., 1991). Molecular mechanisms involved homeostasis (Francis et al., 2003); (Repa and Mangelsdorf, 2000). in lipids homeostasis have been well defined in liver and adipose Their impacts depend on their temporal and cellular localization tissue, two major organs implicated in the synthesis, storage and within the testis (Fig. 1). Thus we will discuss the involvement of elimination of cholesterol (Goedeke and Fernandez-Hernando, the Steroidogenic Factor-1 (SF-1, NR5A1), the Dosage-sensitive 2012). Besides, male reproductive system has been demonstrated sex reversal, Adrenal hypoplasia critical region, on chromosome to dependent on cholesterol homeostasis. As first evidence, X, gene 1 (Dax1, NR0B1), the Liver X Receptors (LXRs, NR1H2/3), cholesterol is the precursor for steroid synthesis (Parton and the Peroxisome Proliferator-Activated Receptors (PPARs, NR1C1/ Hancock, 2004; Simons and Ikonen, 2000; Yokoyama, 2000). More- 2/3), Liver Receptor Homolog-1 (LRH-1, NR5A2), Small Heterodi- Fig. 1. Temporal or cellular localisations of «lipidic» nuclear receptors in testis. (A) In the leydig cells; (B) in the Sertoli cells and (C) in the different stages of germ cell differentiation. 32 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 mer Partner (SHP, NR0B2), and Farnesoid X Receptor (FXRa, Androgens are involved in the maintenance of fertility and the NR1H4). development of secondary sexual characters (for review: (Haider, 2004)). Testosterone controls spermatogenesis through the regula- tion of the Sertoli cells functions (Sultan et al., 1992). Within the 2. Cholesterol, a major actor of testicular physiology latter, testosterone may act directly by stimulating the androgen receptor (Wang et al., 2009a,b), but also indirectly. Indeed, through 2.1. Male fertility the feedback on the hypothalamo-pituitary axis, testosterone lim- its the release of FSH, a key regulator of Sertoli cell functions 2.1.1. Pathology (Ruwanpura et al., 2010). Secretory and excretory pathologies are responsible for male Leydig physiology is controlled by LH, which will stimulate infertility. The former are due to altered spermatogenesis originat- cAMP pathways. This results in de novo protein synthesis, such as ing from testicular dysfunctions, whereas the later correspond to StAR protein (Stocco and Sodeman, 1991), and activation of choles- abnormalities of male genital tract (such as epididymis) that block terol ester hydroxylase (Stocco et al., 2005). Besides, Ca+2 depen- sperm excretion (Kolettis, 2003). In cases of infertility, Assisted dent kinase systeme MAPK pathways are also activated (Tajima Reproductive Technologies, In Vitro Fertilization (IVF) or Intra et al., 2005). Many other factors like glucocorticoids, inflammatory Cytoplasmic Sperm Injection (ICSI), are performed depending on cytokines, estradiol, prolactin, TGFb, IGF-1, EGF, factors secreted by the alterations. Regarding ICSI, it is indicated when few motile Sertoli cells, estradiol and testosterone itself (autocrine effect) can spermatozoa are found in the sperm and sometimes testicular modulate testosterone synthesis (Dufau, 1988; Manna et al., 2006; biopsy is needed (Schlegel and Girardi, 1997). This highlights the Saez, 1994) (for intracellular Leydig signalization review: (Stocco importance to better understand the mechanisms involved in tes- et al., 2005)). Under acute effects of LH, free cholesterol is trans- ticular germ cell differentiation. ferred to the inner membrane of mitochondria. Chronic stimula- tion leads to the expression of enzymes implicated in cholesterol 2.1.2. Testicular histology transformation into testosterone (CYP11A1, 3bHSD, CYP17a)(Payne The testis is composed of seminiferous tubules outlined by a ba- and Youngblood, 1995; Wang et al., 2009a,b). sal membrane that separates them from the interstitial compart- The crucial role of this pathway has been highlighted by the use ment. In adult, these two compartments respectively possess the of transgenic mouse models and by the identification of mutations exocrine and the endocrine functions. in humans. Mice lacking Star exhibit adrenocortical and gonadal insufficiencies due to defective steroidogenesis. They are also char- acterized by lipid accumulation in adrenal cortex and interstitium 2.1.2.1. Endocrine function. The interstitial space, traversed by of testes (Caron et al., 1997). Such mutations are described in hu- numerous blood and lymph vessels, provides the distribution of man and are associated with the same phenotypes, called lipoid nutrients (iron, vitamins A and E...), hormones (LH - luteinizing congenital adrenal hyperplasia (Bose et al., 1996). hormone, FSH - follicle stimulating hormone, insulin...), and Next to its direct effects, testosterone is transformed into estro- growth factors (EGF - Epidermal growth factor...) necessary for gen by cytochrome P450-19 (Cyp19), which is expressed in almost spermatogenesis (Li et al., 2011a,b; Shiraishi and Matsuyama, all cell types of the testis including Leydig cells (Bourguiba et al., 2012). It also contains immune cells, mainly macrophages, and 2003). Estrogen is a well known inhibitor of the hypothalamic- the Leydig cells which produced androgens. pituitary–gonadal axis (Strain et al., 1982). In obese men, probably From a clinical point of view, testosterone is essential for repro- through excess of estrogen or the increased insulin resistance, LH ductive function, muscle and bone mass maintenance, cognitive pulse amplitude is diminished, explaining the central origin of function and other physiological parameters (Juul and Skakkebaek, hypogonadism (Vermeulen, 1996; Strain et al., 1982). Many com- 2002; Matsumoto, 2002; Vermeulen, 2000). Testosterone defi- ponents of metabolic syndrome including dyslipidemia and diabe- ciency results in defects in spermatogenesis, diminished libido, al- tes mellitus are also associated with increased oxidative stress and tered erectile function, increased risk of osteoporosis and with lipid peroxidation (Dandona et al., 2005). Increased reactive decreased muscle mass (Bhasin et al., 2010). Recent population- oxygen species (ROS) reduces StAR function and steroidogenesis based studies indicate that testosterone deficiency predicts future in Leydig cells (Diemer et al., 2003). In the same context, cycloxy- development of diabetes mellitus, metabolic syndrome, endothe- genase-2 (COX 2) increase leads to inhibition of StAR expression lial dysfunctions, cardiovascular events (Cunningham and Toma, (Wang et al., 2005a,b). 2011; Ding et al., 2006; Khaw et al., 2007; Laaksonen et al., 2004; Laughlin et al., 2008; Maggio et al., 2007). 2.1.2.2. Exocrine function. Production and release of the gametes 2.1.2.1.1. Leydig cells. They constitute only 5% of somatic cells of take place in the seminiferous tubules. The seminiferous epithe- testis (Kerr, 1991; Setchell, 2008). Physiology of the Leydig cells is lium contains germ cells and Sertoli cells. It is supported by a basal under the control of the hypothalamo-pituitary LH secretion. These lamina and a wall formed of collagen fibers, fibroblasts and myoid cells support the endocrine function of the testis through the pro- cells. The latter possess a contractile activity involved in the pro- duction of androgens, mainly testosterone (Chen et al., 2009). pulsion of spermatozoa. Steroidogenesis is a muti-step process producing steroids from cholesterol. Leydig cells can synthesize de novo cholesterol, and can 2.1.2.2.1. Sertoli cells. The number of Sertoli cells in the adult also take cholesterol from circulating HDL (Hou et al., 1990). Ste- testis determines both testicular size and daily sperm production roidogenic acute regulatory protein (StAR) is a rate limiting protein (Sharpe et al., 2003). Based on the basal lamina, Sertoli cells play in the steroidogenesis. It regulates cholesterol transport through a supportive role on germ cell and ensure the maintenance of sper- mitochondrial membrane. Then, cholesterol side chain is cleaved matogenesis. Furthermore, they constitute the hemato-testicular by the cytochrome 450 CYP11a1 producing pregnenolone. Then barrier that isolates the germ cells from blood components, espe- several enzymatic reactions involving 3HSDB and CYP17a1 allow cially immune mediators (Fijak et al., 2011). Sertoli cells are thus the production of testosterone, which will then be transformed the only source of nutrients and growth factors for germinal cells. into dihydrotestoterone (DHT) by the 5a-reductase (Hanukoglu, Besides, they are responsible for phagocytosis of apoptotic germi- 1992), or into estradiol (E2) by the aromatase (Carreau et al., nal cells and seem to have a paracrine action on Leydig cells (John- 2011a,b). son et al., 2008). S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 33 To maintain these functions, Sertoli cells respond to two main cells. Recently, a G-protein-coupled receptor (GPCR; GPR30) has modulators, FSH and testosterone. FSH mediates transferin and been described to be activated by estrogens and to be expressed lactate production by Sertoli cells, necessary to support spermato- in germ cells (Carreau et al., 2011a,b). genesis. It also stimulates cAMP Response Element-Binding (CREB) Most of the data regarding the role of estrogen in testicular protein phosphorylation, which mediates Sertoli cell proliferation physiology have been obtained from transgenic mouse models before puberty (Simoni et al., 1999). Mice lacking FSH receptor (Couse et al., 2001), the exposition to aromatase inhibitors and have a diminished fertility with underdeveloped testes (Dierich estrogen-like molecules (Dunkel, 2006; Cho et al., 2003; Volle et al., 1998; Krishnamurthy et al., 2000). The same alterations are et al., 2009). found in men with FSHR mutations (Tapanainen et al., 1997). Inter- Estrogens have been described to down-regulate LH receptor estingly, mice with Sertoli cell-specific KO for androgen receptor and inhibit Star gene and others genes implicated in steroidogene- (AR) have decreased spermatocytes and round spermatids num- sis (for review: (Abney, 1999)). In mouse ERa have been demon- bers and are devoided of elongated spermatids (Denolet et al., strated to be involved in the maturation of the spermatozoa 2006; Sharpe et al., 1994; Verhoeven, 2005). This highlights that (Lubahn et al., 1993). These KO mice present an excess of fluid testosterone is absolutely necessary to maintain spermatogenesis, which increases the pressure within the seminiferous tubules via its actions on Sertoli cells. and leads to the germ cell loss (Eddy et al., 1996; Hess et al., Sertoli cell activities are also controlled by paracrine factors de- 1997). Surprisingly, the ERb-KO mice show no testicular default rived from the germ line. Among them, GDNF (Glial cell line-De- (Couse et al., 1997). rived Neurotrophic Factor) and bFGF (basic fibroblast growth The deficient male mice for Cyp19 (Cyp19-KO) develop nor- factor) are involved in the regulation of Cyp19 in response to FSH mally and their genital tract is anatomically similar to that of the (Schteingart et al., 1999; Perrard and Durand, 2009). wild-type. Males are fertile; however some of Cyp19-KO males ex- 2.1.2.2.2. Germ cells. Starting at puberty, spermatogenesis is the hibit an altered spermatogenesis by the age of 5 months (Robert- cyclical process by which germ cells differentiate to form sperm. son et al., 1999). By the age of one year, all males develop The duration is 35 and 74 days in mouse and human respectively abnormal spermatogenesis with a blockage of germ cell matura- (Yoshida, 2010). In contact with the basal lamina, undifferentiated tion at the spermatid stage. This is due to an increase in apoptotic spermatogonia divide asymmetrically. Thus, they amplify by suc- rates when compared to the wild-type animals. The observation of cessive mitoses or differentiate into intermediate type and then abnormal acrosome development in the Cyp19-KO mouse suggests type B spermatogonia. These early stages of differentiation corre- that acrosome biogenesis could be an estrogen-dependent process spond to the proliferative phase of spermatogenesis. In the second (Robertson et al., 1999). Interestingly, estradiol have been demon- meiotic phase, spermatogonia become primary and secondary strated to play a role as a survival factor for the human germ cells spermatocytes in which occur recombination of genetic material (Pentikainen et al., 2000), and also is beneficial for sperm motility and chromosome segregation. Finally in the last stage of differen- (Carreau and Hess, 2010). Moreover, next to these data, deleterious tiation, called spermiogenesis, spermatocytes become spermatids effects of numerous endocrine disruptors on sperm count and male after four major processes of maturation (Dadoune, 1994). The en- genital tract (cryptochidism, hypospadia and infertility) have been tire genome is condensed due to the replacement of histones by documented (Sikka and Wang, 2008; Iguchi et al., 2001), particu- protamines (Meistrich et al., 2003), while much of the cytoplasm larly in the context of in utero and/or neonatal exposures. is eliminated after phagocytosis by the Sertoli cells (Yefimova et al., 2008). In addition, the early stages of acrosome formation and the establishment of the flagellum lead to spermatozoa (Kiers- 2.2. Lipid metabolism disorders and reproduction zenbaum et al., 2007). Altered concentrations of plasma cholesterol can affect the 2.1.3. Hormonal regulation of testicular physiology reproductive function leading to infertility. This link between lipid The testis is a key target for androgen and estrogen actions. homeostasis and fertility is clearly evident in patients who suffer These hormonal sensitivities have been studied for decades from hyperlipidemia or metabolic syndrome (Kaplan et al., 2006; (Verhoeven et al., 2010). The role of testosterone is evident in pa- Kasturi et al., 2008; Padron et al., 1989). This has been confirmed tients with complete androgen insensitivity syndrome (Sultan by the generation of several transgenic mouse models such as et al., 1993). the Apolipoprotein-A1 knock-out (KO) mice or in animals fed a high cholesterol diet (Saez Lancellotti et al., 2010; Shalaby et al., 2004). 2.1.3.1. Androgens. Spermatogenesis is strictly controlled and de- Pathophysiological aspects of altered fertility associated with met- pends on a succession of signals provided by the local environment abolic syndrome are complex. One main cause of infertility seems (Skinner, 1991; Verhoeven, 1992; Jegou, 1993). Androgens play a to be a defect in the hypothalamo-pituitary gonadal axis leading to crucial role in the control of spermatogenesis. Molecular details a diminished LH secretion and thus a lower testosterone produc- have been discovered using transgenic KO mice for androgen tion. It has been associated with higher aromatization of testoster- receptor (AR) either in the testis or in different testicular compart- one into estrogen in the excessive adipose tissue. Furthermore, ments. Such mice have low testosterone levels with altered expres- higher leptin concentrations secreted from excess adipose tissues sion of steroidogenic enzymes, even Leydig cell mass is altered (for in patients can inhibit testosterone secretion (Saad, 2009; Caprio review: (Wang et al., 2009a,b)). AR is involved in autocrine action et al., 1999; Isidori et al., 1999). Next to this, metabolic diseases of testosterone on Leydig cells. Testosterone deficiency is responsi- are frequently associated with hyper-insulinemia which inhibits ble for spermatogenesis arrest due to altered Sertoli functions testosterone secretion through insulin receptors which are ex- (Wang et al., 2009a,b). pressed on Leydig cells (Pitteloud et al., 2005). Another mechanism of hypogonadism in patients with metabolic syndrome is the de- 2.1.3.2. Estrogens. First considered as female hormones, estrogens creased levels of sex hormone binding globulin (SHBG) synthesis have emerged as major contributors to male genital tract since sev- due to insulin resistance (Plymate et al., 1988). Thus, total and free eral years (Carreau et al., 2011a,b). Indeed, Cyp19 which trans- testosterone and SHBG are low in such patients (Pasquali et al., forms androgens into estrogens is present in almost all cell types 1995). Altered fertility could also results from abnormal spermato- of the testis. The estrogen receptor ERa is the major isoform ex- genesis due to increased oxidative stress in testicular microenvi- pressed in Leydig cells, while ER b is expressed in Sertoli and germ ronment (Sheweita et al., 2005). 34 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 Moreover, lipid homeostasis is of particular importance in germ adult rats, and Sertoli cells isolated from immature animals (Pezzi cells. These cells undergo different modifications in lipid concen- et al., 2004). These data show high levels of Sf-1 mRNA in immature trations, especially cholesterol, desmosterol and phospholipids and mature Sertoli cells as well as in mature Leydig cells; whereas during their differentiation. These modifications are important to in germ cells, the Sf-1 mRNA was present at negligible levels. maintain membrane fluidity and fertilization (Rejraji et al., 2006). On the other side, altered testicular functions may increase the 2.3.1.3. Role in Leydig cells. (Fig. 2): SF-1 has been demonstrated to risk of metabolic syndrome (Kupelian et al., 2006; Smith et al., be a key regulator of steroidogenic cell physiology. In these cells, 2006). Indeed, infertile patients frequently have dyslipidemia (Ra- SF-1 regulates all the aspects of cholesterol metabolism by control- mirez-Torres et al., 2000). The dramatic increase of the prevalence ling the expression of the scavenger receptor, class B, type I (SR-BI), of metabolic syndrome in our society (Ogden et al., 2003) rein- the predominant receptor that supplies plasma cholesterol to ste- forces the importance to better understand how cholesterol roidogenic tissues (Cao et al., 1999). It might also be involved in de homeostasis impacts on fertility and the involved molecular novo synthesis of cholesterol through the regulation of the HMG- mechanisms. CoA synthase (Mascaro et al., 2000). SF-1 also controls the transcription of almost all the genes 2.3. ‘‘Lipidic’’ Nuclear Receptors in male genital tract encoding the steroidogenic enzymes. It also regulates the expres- sion of Star, Cyp11a1, Hsd3b, and P450c17 (Caron et al., 1997; Chau As shown in the previous part, steroid nuclear receptors (AR, et al., 1997; Leers-Sucheta et al., 1997). If LH acts on steroidogenic ER) play major roles in male reproductive functions, and particu- genes through cAMP pathway, several evidences suggest that SF-1 larly testis. may not be involved in response to cAMP (Hu et al., 2001). Cellular regulation of cholesterol concentrations is mostly achieved by transcription factors that control the expression of 2.3.1.4. Involvement in Sertoli cell functions. (Fig. 2): The gonad-spe- genes implicated in lipid metabolism (Bantubungi et al., 2011). cific Sf-1 KO mice generated using Cre-loxP recombination with Over the last 20 years, some key regulators controlling the expres- Amhr2-Cre, are viable with affected the testes (Jeyasuria et al., sion of genes involved in lipid homeostasis have been identified 2004; Pelusi et al., 2008). The differential expression between (Horton et al., 1999; Hua et al., 1995; Lehmann et al., 1997; Luo wild-type and specific KO is clear in Sertoli cells at post-natal and Tall, 2000; Peet et al., 1998; Schultz et al., 1999; Streicher day 21. The germ cells were irregularly arranged with fewer Sertoli et al., 1996; Zeng et al., 2004). Interestingly, other members of cells compared with controls, vacuoles appeared, and many of the the nuclear receptor superfamily appear to play major roles on seminiferous tubules exhibited no lumen at P14. There is also a the control of testicular physiology. Among them, we will focus marked reduction of PCNA-positive germ cells and a significant in- here on those involved in cholesterol homeostasis. Indeed, we will crease in apoptosis in KO testes. As functional maturation of the focus on the nuclear receptors SF-1, Dax-1, LXR, PPAR, LRH-1, SHP, Sertoli cells is important for spermatogenesis (Sharpe et al., FXR and RXR (Fig. 1). 2003); it is possible that abnormal development of the Sertoli cells results in the impaired spermatogenesis seen in the adult gonad- 2.3.1. Steroidogenic factor 1 specific Sf-1 KO testes. Indeed. 2.3.1.1. Physiological functions. One of the nuclear receptor that has been involved in the control of testicular physiology is the steroi- 2.3.2. Dosage-sensitive sex reversal, Adrenal hypoplasia critical region, dogenic factor-1 (SF-1, NR5A1). SF-1 shows high homology with on chromosome X, gene 1 (Dax1, NR0B1) the drosophila Ftz-F1 transcription factor, which controls fushi tar- 2.3.2.1. Physiological functions. DAX1 is an unusual member of the azu homeotic gene expression (Lavorgna et al., 1993). Interestingly, nuclear receptor superfamily (Zanaria et al., 1994). Even though phospholipids have been demonstrated to activate SF-1 (Whitby it is an orphan receptor, the C-terminal portion has the structure et al., 2011). SF-1 knock-out mice die by eight days because of characteristic of a ligand-binding domain. DAX1 is a negative reg- acute glucocorticoid and mineralocorticoid deficiency (Luo et al., ulator that interacts with other nuclear receptors to inhibit their 1999). During development, SF-1 is an essential regulator of genes activities (McCabe, 2007). DAX1 blocks the heterodimerization be- involved in the sex determination cascade (Luo et al., 1995; Ingra- tween SF1 and the Wilms Tumor gene (WT1) which play a role in ham et al., 1994). The gonads of the Sf-1-KO mice degenerate by sexual differentiation (Vilain and McCabe, 1998). apoptosis just before differentiation at approximately embryonic Dax-1-KO mice show hypogonadism with reduced testis mass day 10.5 (E10.5; (Luo et al., 1994)). It has been suggested that (Yu et al., 1998). Defective spermatogenesis leading to complete SF-1 is required for the survival and proliferation of cells in the germ cell degeneration is due to germinal epithelium dysgenesis undifferentiated gonadal primordium (Parker et al., 2002; Schim- after 14 weeks of age. Testes also present a Leydig cell hyperplasia mer and White, 2010). (Meeks et al., 2003), whereas Sertoli cells seem unaffected. SF-1 has been mainly studied for its role in controlling the expression of all the steroidogenic enzymes and cholesterol trans- 2.3.2.2. Testicular expression pattern. (Fig. 1): Dax-1 is expressed in porters required for steroidogenesis. Interestingly, SF-1 regulates several endocrine tissues, including the gonads. In testis, it is pres- the hypothalamo-pituitary axis. Indeed, the pituitary-specific ent in Sertoli and Leydig cells (Meeks et al., 2003). knock-out mice show marked hypogonadism with a decrease in male and female gonad mass and absence of sexual maturation, 2.3.2.3. Role in the Leydig cells. (Fig. 2): It has been shown that, resulting in sterility (Ikeda et al., 1995; Zhao et al., 2001a,b). in vitro, Dax-1 is able to control the expression of the genes encod- ing for enzymes involved in steroid synthesis. However, in vivo, it 2.3.1.2. Testicular expression pattern. (Fig. 1): In the mouse, Sf-1 is was demonstrated that in Dax1-deficient Leydig the expression expressed in the early adrenogonadal primordium from 9 day levels of Star, Cyp11a1, Cyp17, 3-HSDB, and 17b-HSD type III mRNAs post-coïtum (Ikeda et al., 1994; Val et al., 2007). In testis, SF-1 were not altered compared with wild-type (Meeks et al., 2003). In expression is maintained in the somatic cells, where it may act contrast, the expression of Cyp19 mRNA was increased in Dax1- with SRY in supporting SOX9 expression (Sekido and Lovell-Badge, deficient Leydig (Wang et al., 2001a,b). The impact of this elevated 2008). estrogen pathway was reinforced by the use of the selective estro- Pezzi et al. studied the expression pattern of Sf-1 in testis using gen receptor modulator, tamoxifen, which rescues, at least in part, primary cell cultures of Leydig, Sertoli and germ cells, isolated from male fertility of Dax-1 KO males (Wang et al., 2001a,b). Moreover, S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 35 Fig. 2. Involvement of lipidic nuclear receptors in testis. (A) Main regulator of steroidogenesis is the hypothalamo-pituitary axis through LH secrecretion and then via PKA pathways. This LH secretion is in part regulated by LXRs. In the Leydig cells, steroids synthesis results from transformation of cholesterol originating from either endogenous production or uptake of exogenous cholesterol. Interestingly, PPARs could interfere with these pathways and mainly in the context of exposure to endocrine disrupters. Regarding the expression of steroidogenic genes, they have been demonstrated to be regulated by several nuclear receptors responding to lipidic stimulus. Positif effects were shown for SF-1, LRH-1 and LXRa. In contrast steroidogenesis is negatively controlled by PPARs, Dax-1, SHP and FXR and also by the estrogen receptors. All these data suggest that there could be some negative feedback involving several nuclear receptors such as FXR-SHP and LHR-1/SF-1. (B) Sertoli cells are supportive structure for normal spermatogenesis. This role is stimulated by testosterone and FSH. Lipid homeostasis play an important role in Sertoli cell functions as highlighted by the LXRb or the RXRb knock-out mice. Alteration of genes involved in the maintenance of cholesterol homeostasis led to abnormal storage of cholesterol esters which is supposed to altere Sertoli- germ cell communication. (C) Regarding germ-cells, eventhough both LXRs and LRH-1 have been reported to be expressed in some steps of spermatogenesis, their roles remain unknown. The role of RXRb has been well defined in the spermiation process. SHP has also been clearly involved the decision of germ cells to enter in meiosis and progress through spermatogenesis. in Dax-1 KO, the re-expression of Dax-1 specifically in Leydig re- 2.3.3. Liver X receptors LXRa and LXRb (NR1H3 and NR1H2) sults in improved fertility. Although testicular size was not re- 2.3.3.1. Physiological functions. The LXRs belong to the subclass of stored, Cyp19 expression was back to normal levels, and sperm nuclear receptors that form obligate heterodimers with the production was increased (Meeks et al., 2003). retinoid receptors RXR and are activated by oxysterols (Repa and Mangelsdorf, 2002). The heterodimer could be activated by both li- 2.3.2.4. Involvement in Sertoli cell functions. (Fig. 2): It was shown gands. LXRs have been identified as players of many physiological that the cAMP-signaling pathway induced by FSH leads to a potent functions (Baranowski, 2008; Zhu et al., 2012)). Human LXRa (447 down-regulation of Dax-1 expression in cultured Sertoli cells (Ta- amino acids) and LXRb (460 amino acids) share 77% sequence mai et al., 1996). homology in their DBD and LBD (Lobaccaro et al., 2001). In parallel, Sertoli cell-specific expression of a Dax-1 transgene If LXRb is ubiquitously expressed, LXRa is mostly present in is sufficient to partially rescue the primary testicular defect of tissues with active metabolism. LXR are involved in key functions the male Dax-1-KO (Jeffs et al., 2001). Fertility was completely re- in the control of cholesterol metabolism and lipogenesis (Zhang stored. However, there is only a modest improvement in testicular et al., 2012; Korach-Andre et al., 2011a,b). In the liver, these ef- morphology. The rescue of fertility may be attributed to a combi- fects are mediated by LXRa. It was first demonstrated that LXR nation of differences in the production and functional capacity of control the expression of the rate limiting step of bile acid synthe- spermatozoa (Jeffs et al., 2001). sis, cytochrome 7a1 (Cyp7a1) (Peet et al., 1998). Then, they were These data suggest that following FSH effect on DAX-1, it could also demonstrated to increase cholesterol reverse transport in be involved in the regulation of genes encoding paracrine factors intestine and macrophage regulating the ATP Binding Cassett that will be primordial for germ cells. 36 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 genes abca1, abcg5, abcg8 and abcg1 (Venkateswaran et al., 2.3.3.5. Potential role in germ cells. (Fig. 2): Both LXRa and b are ex- 2000a,b; Repa et al., 2002). pressed in germinal cells. These receptors seem to be implicated in They also control carbohydrate and energy metabolism. Indeed, their homeostasis. We showed that mice KO for both LXRs present several studies indicate that lack of LXR expression leads to in- lipid accumulations in germ cells, especially in spermatids. These creased energy expenditure and resist to diet-induced obesity, mice suffered from altered proliferation and apoptosis of germ due to the control of uncoupling protein 1 (UCP1) expression (Kor- cells resulting in desquamation and complete disorganization of ach-Andre et al., 2011a,b). seminiferous tubules and infertility (Volle et al., 2007a,b). LXR Both LXRa and LXRb have also been defined as anti-inflamma- implication in spermatogenesis could be indirect via the retinoic tory transcription factors and physiological regulators of innate acid pathway, which is up regulated in these mice (Volle et al., and adaptive immune responses, apoptosis and phagocytosis (Im 2007a,b). and Osborne, 2011; Valledor, 2005). 2.3.4. Peroxisome Proliferator Activated Receptors PPARa, b and c 2.3.3.2. Testicular expression pattern. (Fig. 1): LXRs isoforms are ex- (NR1C1, NR1C2 and NR1C3) pressed in adult testis. If both are detected in the germ cells, LXRa 2.3.4.1. Physiological functions. There are several PPAR isolforms: is mainly expressed in Leydig cells whereas LXRb is in the Sertoli PPARa (NR1C1), PPARb/d (NR1C2), and PPARc (NR1C3) (Auwerx, cells (Volle et al., 2007a,b). In human, the expression of several iso- 1992). As for LXRs, PPARs form obligate permissive heterodimers forms of LXRa has been described (Chen et al., 2005; Endo-Umeda with RXRs. et al., 2012). However, their cellular localisation has not been stud- PPAR isoforms have specific tissue distribution which might ac- ied so far, nor their physiological functions. count for their different functions. Indeed, these receptors have been identified to play a role in several key physiological functions 2.3.3.3. Role in Leydig cells. (Fig. 2): LXRa is the major isoform in such as in fatty acid metabolism and inflammation (Vacca et al., Leydig cells. Studies of mice KO for LXRa and LXRab isoforms 2011). PPARa is expressed in tissues with high fatty acid catabo- showed a clear alteration of androgen synthesis by Leydig cells. lism. In liver, PPARa is maximally expressed during fasting and This role of LXR is not unusual as it regulates intracellular choles- regulates lipid uptake (Blavy et al., 2009), and glucose metabolism terol levels (Cummins et al., 2006; Steffensen and Gustafsson, (Jay and Ren, 2007), and detoxification (Martin et al., 2007). 2004), the basic fuel for steroidogenesis. Mice lacking LXRa have PPARbd is ubiquitously expressed. PPARbd, generated null mice low intra-testicular testosterone levels (Volle et al., 2007a,b; Rob- are smaller, with altered brain myelinisation and adipose tissue ertson et al., 2005). Many enzymes implicated in steroidogenesis were smaller (Peters et al., 2000). However, the phenotype of these are bona fide targets for LXR; we and others showed that either ab- knockout animals seems to be dependent on the genetic sence or pharmacological stimulation of LXR modulate the expres- background. sion of Star, 3hsdB, and 17bhsd and alter intra-testicular Next to these data, a protective function of PPARbd in the heart testosterone concentrations (Volle et al., 2007a,b; Lee et al., has been proposed. Indeed, mouse model of cardiomyocyte-spe- 2008). LXRa is also expressed in pituitary gland and could be cific deletion of PPARb develop a dilated cardiomyopathy due to responsible for the LH secretion. Indeed, LXR agonists can stimu- lipotoxicity (Cheng et al., 2004). late LH secretion (Volle et al., 2007a,b; Lee et al., 2008). Next to PPARc is abundant in the white and brown adipose tissues, this, LXR also regulate the expression of Srebp1 which enhances where it promotes lipid storage and adipocyte differentiation and Star and Cyp17a (Ozbay et al., 2006; Shea-Eaton et al., 2001). maintenance (Tontonoz et al., 1994; Rosen et al., 1999). Further- In periphery, LXR activation induces sulfotransferase-2a1 more, PPARc is involved in glucose metabolism via an improve- (Sult-2a1), an enzyme responsible for androgen and estrogen ment of insulin sensitivity (Kubota et al., 1999; He et al., 2003; deactivation (Lee et al., 2008; Gong et al., 2007). Thus, Leydig cell Hevener et al., 2003). modulation by these receptors is partly direct and somewhat cen- tral and usually opposed by deactivation of excess testosterone by 2.3.4.2. Testicular expression pattern. (Fig. 1): Data from qPCR exper- its peripheral sulfonation. iments show that all three PPARs are expressed during develop- ment in both Sertoli and germ cells (Thomas et al., 2011). In 2.3.3.4. Involvement in Sertoli cell functions. (Fig. 2): LXRb has been adults, PPARs are expressed in different testicular compartments, described to be directly implicated in lipid homeostasis in Sertoli namely PPARa in Sertoli, Leydig cells and spermatocytes, PPARb/d cells. LXRab / and LXRb / mice showed excessive cholesteryl in Leydig and Sertoli cells (Schultz et al., 1999; Braissant and Wah-     ester accumulations mainly localized in Sertoli cells. (Volle et al., li, 1998). Human testis contains PPARa and b/d, but only PPARa is 2007a,b; Robertson et al., 2005). The main genes encoding for en- localized in Leydig cells, whereas PPARc is not expressed (Hase zymes implicated in lipid homeostasis, especially Srebp1c, Fatty et al., 2002). Acid Synthase (Fasn), Stearoyl-CoA desaturase-1 (Scd1) are dereg- ulated in testicular tissue of these mice (for review: (El-Hajjaji 2.3.4.3. Role in Leydig cells. (Fig. 2): Exposures to PPARs activators, et al., 2011)). This lipid accumulation in Sertoli cells might partic- either pharmacological agents or endocrine disruptors decrease ipate for a destructive testicular phenotype, and explains, in part, testosterone levels, probably due altered de novo synthesis of cho- the infertile phenotype in these mice. This seems to be linked to lesterol in Leydig cells (Mimeault et al., 2005; Velasco-Santamaria the regulation of ATP Binding Cassette-a1 (abca1), a membrane et al., 2011) or due to the inhibition of mitochondrial cholesterol bound cholesterol export pump (Hozoji-Inada et al., 2011). Sertoli uptake modulated by peripheral benzodiazepine receptor protein cells are the major site of testicular ABCA1 expression. It is respon- (Gazouli et al., 2002). PPARa agonists also by inhibit Star, Cyp11a1, sible for the efflux of excess lipids accumulating in Sertoli cells Cyp17a1 (Froment and Touraine, 2006; Li et al., 2011a,b; Corton after phagocytosis of germinal cells (Kerr and de Kretser, 1974). In- and Lapinskas, 2005). KO mice for PPARa or b isoforms are fertile, deed KO mice or mutations for abca1 lead to lipid accumulation in confirming that basal PPAR activity is not required for sexual Sertoli cells, lower intratesticular testosterone levels and sperm development and fertility (Peters et al., 2000; Lee et al., 1995). counts (Selva et al., 2004). This lipid accumulation is also responsi- However, their impact remains non negligible especially in the ble for altered Sertoli cell functions, evaluated by the modification context of endocrine disruptors such as phthalates (Velasco-San- of FSH level (Robertson et al., 2005; Meachem et al., 2001). tamaria et al., 2011; Barlow and Foster, 2003; Foster, 2006). S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 37 2.3.4.4. Involvement in Sertoli cell functions. (Fig. 2): PPARc could during embryogenesis. Only mlrh-1v2 was detected in ovary and play an important role in the regulation of expression of key lipid testis (Gao et al., 2006). metabolic genes in Sertoli cells, during postnatal development, as suggested by recent microarray analyses (Thomas et al., 2011). 2.3.5.3. Role in Leydig cells. (Fig. 2): LRH-1 is thought to modulate steroidogenesis. Most of steroidogenic enzymes are up regulated 2.3.4.5. Potential role in germ cells. (Fig. 2): PPARs are variably ex- by LRH-1 (Mueller et al., 2006; Sirianni et al., 2002; Wang et al., pressed in germ cells in different species. All three isoforms, a, b/ 2001a,b). It is a target for DAX-1 and SHP nuclear receptors (Volle d and c, are expressed in germinal cells of mice (Higashiyama et al., 2007c; Suzuki et al., 2003). It interacts directly with aroma- et al., 2007). PPARc is present in human sperm. Rosiglitazone, a tase promoter up regulating its expression and promoting normal PPARc agonist enhances capacitation, acrosome reaction and spermatogenesis (Sierens et al., 2010). In vivo, the LRh-1+/- males motility of ejaculated human sperm (Aquila et al., 2006). Further- show altered testicular steroidogenesis (Volle et al., 2007c). more, PPARs are expressed in Sertoli and Leydig cells; this may provide an environment for germ cell maturation (Huang, 2008). 2.3.6. The Small Heterodimer Partner (SHP; NR0B2) All these evidences support the role of these receptors beyond lipid homeostasis. 2.3.6.1. Physiological functions SHP was identified in 1996 as a member of the nuclear receptor superfamily that represses transcriptional activity of several other 2.3.5. The Liver Receptor Homolog -1 (LRH-1; NR5A2) nuclear receptors. Like DAX-1, SHP is an atypical NR as it lacks the 2.3.5.1. Physiological functions. LRH-1 is highly expressed in liver, classical DNA-binding domain (DBD) (Seol et al., 1996). pancreas and intestine (Repa and Mangelsdorf, 2000; Fayard SHP inhibits transcriptional activation of several other nuclear et al., 2004). LRH-1 belongs to the NR5A subfamily as SF-1. These receptors, it can act through several mechanisms (Bavner et al., two receptors are closely related (Wang et al., 2005a,b). Indeed, 2005). SHP interefers with the AF-2 coactivator domain of NRs the high degree of sequence conservation between their DNA bind- for the recruitment of co-activtors. It could also mediate this ing domains allows them to bind to the same hexameric elements repression through the interaction with corepressors including di- of the regulatory sequences of their direct target genes, suggesting rect interactions among mammalian homolog of the Saccharomyces that LRH-1 could control steroidogenesis (Fayard et al., 2004). cerevisiae transcriptional corepressor mSin3A, SWItch/Sucrose Even though several phospholipids have been found to bind NonFermentable (SWI/SNF) complexes (Kemper et al., 2004). SHP LRH-1 in vitro (Ortlund et al., 2005), the physiological ligands re- could also interact directly with NR or transcription factor, result- main unknonwn. In contrast, several corespressors are able to effi- ing in the blockade of DNA-binding and the consequent inhibition ciently repress the activity of LRH-1 by interacting with the of its transcriptional activity (Bavner et al., 2005). binding domain of LRH-1, and several covalent modifications, It is involved in fundamental biological functions and metabolic including phosphorylation and sumoylation are known to modu- processes. One of the first mechanism in which SHP was involved is late LRH-1 (Lee et al., 2006; Chalkiadaki and Talianidis, 2005; Yang the regulation of bile acid synthesis (Goodwin et al., 2000; Lu et al., et al., 2009). 2000). In response to bile acids, FXR induces Shp transcription. This LRH-1 plays key role during development for cell specification leads to the inhibition of LRH-1, LXRa and HNF4a activities on pro- during differentiation. It also involved in the regulation of many moters of key enzymes of this pathway, Cyp7a1 and Cyp8b1. Mech- other metabolic, immunoregulatory and proliferative function. anisms independent of the FXR/SHP/LRH pathway might also exist, LRH-1 is involved in reverse cholesterol transport and bile acid since BAs feeding to Shp / mice reduced the levels of CYP7A1   metabolism in the liver (Fayard et al., 2004). In the intestine, mRNA to similar levels of control mice. Indeed, FGF15/19 is an- LRH-1 was shown to regulate cell renewal (Botrugno et al., other FXR gene target in the intestine and appears to contribute 2004). LRH-1 is also a modulator of gut functions (Fernandez-Mar- to the fine tuning of bile acid synthesis in the liver (Inagaki et al., cos et al., 2011). 2005). LRH-1 has been shown to play key functions in ovarian physiol- Furthermore, SHP appears to play a central role in obesity. SHP- ogy ((Duggavathi et al., 2008), see Mouzat et al. this issue). Re- deficient mice resist to high-fat-diet-induced obesity. Transgenic cently, it was also identified as a key player in the control of mice that specifically expressed SHP in adipose tissue have in- stem cell pluripotency (Heng et al., 2010). creased body weight and adiposity (Tabbi-Anneni et al., 2010). En- ergy metabolism is increased and BAT cold exposure function is 2.3.5.2. Testicular expression pattern. (Fig. 1): During the embryonic enhanced with activation of thermogenic genes and mitochondrial development, LRH-1 is expressed in the gonadal primordium since biogenesis. Compared with wild-type mice on a high-fat diet, SHP E10.5. Then at E11.5, when the bipotential gonad can be differen- overexpression is associated with enhanced diet-induced obesity tiated from adrenal, LRH-1 is expressed in the germ cells and the phenotype with weight gain, increased adiposity, and severe glu- surrounding somatic cells (Hinshelwood et al., 2005). In males, cose intolerance. Consistently, SHP over-expression in 3T3-L1 pre- the expression of LRH-1 is still detected in the germ cells and the adipocytes inhibits cell differentiation and lipid accumulation Sertoli cells during the embryonic development up to 8-days post- (Song et al., 2009). natal. In the adult testis LRH-1 was found to be expressed in germ Interestingly, mutations in human Shp gene were also associ- cells as well as in Leydig cells (Pezzi et al., 2004; Sierens et al., ated with influence on birth weight, mild obesity, and insulin lev- 2010; Volle et al., 2007c; Guo et al., 2007). These results obtained els (Hung et al., 2003; Nishigori et al., 2001; Enya et al., 2008). at different times of the development including adulthood reveal Shp / mice are characterized by hypo-insulinemia, increased glu-   several putative roles of LRH-1 in the gonads. Indeed, the expres- cose dependent response of islets, increased peripheral insulin sen- sion profiles suggest that LRH-1 could be involved in the prolifera- sitivity, and increased glycogen stores (Wang et al., 2006a,b). SHP tion of germ cells in the developing gonads, and also in the has been hypothesized to act on glucose homeostasis via complex regulation of the steroid synthesis in both ovary and testis. Inter- pathways involving the inhibition of glucocorticoid receptors (GR) estingly, a new lrh-1 transcript (mlrh-1v2) was recently identified in mammalian cells and the inhibition of PGC-1 gene, a coactivator which is due to an alternative promoter. This transcript is ex- of NRs important for gluconeogenic gene expression and the pressed throughout embryogenesis and in several adult tissues, PGC-1-regulated phospho(enol)pyruvate carboxykinase (PEPCK) while the previously known transcript (mlrh-1v1) appears later promoter (Borgius et al., 2002). Following the bile acid-induced 38 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 stimulation, SHP inhibits a number of other pathways, including FXR seems to be involved in regulating bile acid (BA) biosynthe- the HNF4a-mediated transactivation of the PEPCK and fructose sis and enterohepatic cycle Indeed, Fxra / mice exhibit high BA   biphosphate (FBP) promoters (Yamagata et al., 2004; Park et al., plasma levels associated with abnormal hepatic biosynthesis, due 2007), as well as the transactivation of the glucose-6- phosphatase to an alteration of FXRa-mediated negative feedback on BA biosyn- (G6Pase) promoter mediated by Foxo1 (Wei et al., 2011). thesis (Sinal et al., 2000). In liver, FXRa represses Cyp7a1 gene expression, a key enzyme of BA biosynthesis. At the molecular le- 2.3.6.2. Testicular expression pattern vel, this pathway involves several other members of nuclear recep- (Fig. 1): SHP has been demonstrated to be expressed in the tes- tor superfamily, such as SHP (Small heterodimer partner, NR0B2), tis and ovary (Bookout et al., 2006; Johansson et al., 1999). Few LRH1 (Liver receptor homolog-1, NR5A2), or LXRa (Liver X data are available concerning the role of SHP in either testis or Receptor a, NR1H3) (Goodwin et al., 2000; Lu et al., 2000). In + ovary. We have demonstrated that Shp is expressed during the hepatocytes, FXRa decreases BA uptake via repression of Na postnatal development in the tubular compartment of the testis, -taurocholate cotransporting polypeptide (NTCP), organic anion- either in Sertoli or germinal cells. Then around puberty and in transporting polypeptide (OATP) -1 and OATP4 expressions adult testis, SHP is expressed in the interstitial cells (Volle et al., (Denson et al., 2001; Maeda et al., 2004)). It also promotes BA 2007c). excretion in bile ducts through transcriptional induction of the specific BA transporter BSEP (Bile salt export pump) in hepatocytes (Ananthanarayanan et al., 2001). FXRa is also involved in control- 2.3.6.3. Role in the Leydig cells ling lipid and glucose homeostasis as suggested by high plasma tri- (Fig. 2): Being important in the regulation of cholesterol homeo- glycerides concentrations in Fxra / mice (Lefebvre et al., 2009; stasis and interacting with various nuclear receptors such as FXR,   Sinal et al., 2000) via a SHP-dependant pathway, FXRa limits tri- LXR and PPAR, SHP is thought to have a fundamental role in steroi- glyceride synthesis. Indeed, it inhibits the expression of enzymes dogenesis (Volle et al., 2007c; Brendel et al., 2002). SHP represses involved in triglyceride synthesis such as Srebp1c, Fasn and Scd-1 steroidogenesis in testes by limiting the expression of the steroido- (Watanabe et al., 2004). In parallel, FXRa controls blood glucose genic enzymes, Star, Cyp11a1 and 3bhsd. This effect is mediated by lowering expression of Pepck and G6Pase (Renga et al., 2012). through SF-1 and LRH-1 (Pezzi et al., 2004; Bakke et al., 2001a,b). FXR also regulates Fgf15/19 in the intestine which contributes to SHP KO mice show increased testosterone synthesis and preco- the fine tuning of bile acid synthesis in the liver (Inagaki et al., cious sexual maturation via derepression of SF-1 and LRH-1 (Volle 2005). et al., 2007c). These effects are independent of LH concentrations. Interestingly, testicular LXR genes are not implicated in this regu- 2.3.7.2. Testicular expression pattern lation (Volle et al., 2007c). (Fig. 1): Like SHP, very few data are available regarding the expression of Fxr in the genital tract. Northern blot analyses have 2.3.6.4. Potential role in germ cells demonstrated that Fxr is expressed in both ovary and testis (Repa (Fig. 2): SHP regulates germ cell maturation, differentiation and and Mangelsdorf, 2000). Furthermore, we showed that Fxr is ex- transition into meiotic phase. In Shp / mice, germinal cells enter   pressed in the interstitial cells of the adult testis (Volle et al., in meiosis earlier than wild-type males. This effect is indirect 2007c). through regulation of retinoic acid pathways (Volle et al., 2007c). SHP-KO mice have increased intra testicular concentrations of all 2.3.7.3. Role in the Leydig cells trans- retinoic acids. Normally, SHP down regulates retinoic acid (Fig. 2): Fxra is expressed in the interstitium of testis (Volle pathway genes (Stra-8, Dmc1, Scp3, Hoxa1) by derepressing Rar. et al., 2007c). Mice treated with FXR pharmacological agonist show SHP-KO mice have increased accumulation of intra testicular Stra8, induced shp mRNA expression. Interestingly, Fxr-KO mice have Dmc1 and Scp3. Furthermore, Cyp26b1 gene, encoding for an en- normal testosterone concentrations, Shp and steroidogenic en- zyme implicated in degradation of retinoic acid (Bowles et al., zymes mRNA levels (Volle et al., 2007c). FXR has been demon- 2006), is down regulated. Indeed, RARs are also expressed in germ strated to regulate steroidogenesis down regulation of the cells. This expression is cell specific and may vary between species aromatase activity in Leydig cells (Swales et al., 2006; Catalano (Eskild et al., 1991). They play an important role in maturation and et al., 2010), modulation of Sult2a1, 3bhsd and 5a-reductase, en- the progression of spermatogenesis (Bowles et al., 2006). In mice, zymes involved in steroid synthesis, activation and deactivation RARb is expressed in step 7 and 8 spermatids and RARc in sperma- of testosterone (Catalano et al., 2010; Miyata et al., 2006). Note togonia. RARa controls spermiation (Vernet et al., 2006). Mice thus, androsterone, a metabolic product of testosterone, is able to invalidated for RARa exhibit severe degeneration of germ cells activate FXR (Wang et al., 2006a,b). This could give a nice negative resulting in the production of seminiferous tubules devoid of epi- feedback of the androgen synthesis where androgen metabolites thelium (Lufkin et al., 1993), a phenotype similar to the one ob- could inhibit their own production through a FXR/SHP/SF1-LRH1 served in mice with vitamin A deficiency (Ismail et al., 1990). pathway, as in the liver. 2.3.7. The Bile acid receptor (FXR; NR1H4) 2.3.8. Retinoid X receptors 2.3.8.1. Physiological functions. Retinoid X receptors (RXRa, b and c) 2.3.7.1. Physiological functions heterodimerize with numerous nuclear receptors, which include FXRa belongs to nuclear receptor superfamily which acts as an retinoic acid receptors (RARs), peroxisome proliferator-activated obligatory heterodimer with retinoid X receptor (RXR) (Wang et al., receptors (PPARs) and liver oxysterol receptors (LXRs), and display 1999). Identified in liver, intestine and kidney, it has been defined a ligand-dependent transcriptional activity that requires the integ- as bile acid receptor and preferably binds to chenodeoxycholic acid rity of the activation function 2 (AF-2) core, contained within a-he- (CDCA) and its conjugated forms (Makishima et al., 1999; Wang lix 12 (Chambon, 1996). In nonpermissive heterodimers, RXRs are et al., 1999). The RXR/FXR heterodimer binds to specific IR1 (in- transcriptionally inactive, unless their partners are liganded, verted repeat-1) sequences on target gene promoters and then reg- whereas in permissive heterodimers RXRs can be transcriptionally ulates their transcription. FXRa has been involved in regulation of active, irrespective of the presence of their partner’s ligand (Vivat many physiological functions (Chen et al., 2011; Hageman et al., et al., 1997). Thus, permissive heterodimerization may integrate 2010; Trauner et al., 2010). two hormonal pathways within a single functional unit. Genetic S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 39 evidence indicates that the highly pleiotropic developmental ef- least because of RARa signaling dysfunction in these animals. Nev- fects of retinoic acid are mediated by nonpermissive RXRa/RARa, ertheless, RXRb null mice are infertile due to oligo-astheno-terato- b and c heterodimers, in which the AF-2 of RXRa may either be dis- zoospermia and because of failure of spermatid release. With pensable or required (Mascrez et al., 1998; Matt et al., 2003). aging, these mice demonstrate complete germ cell degeneration Regarding cholesterol homeostasis, RXR isoforms play an (Kastner et al., 1996). important role as they form heterodimers with key ‘‘lipidic’’ nucle- ar receptors such as LXR, PPAR and FXR as discussed above. 3. Conclusions/discussion 2.3.8.2. Testicular expression pattern. (Fig. 1): Regarding Leydig cells, The development of intra-cytoplasmic sperm injection (ICSI) is RXRa and b are the major isoforms in fetal life and RXRa and b in an important recent breakthrough in the treatment of male infer- adulthood (Boulogne et al., 1999). In contrast, RXRb is the main iso- tility, but it does not treat the cause. Indeed, male fertility seems form expressed in Sertoli cells. RXRa and c are thought to be the to have declined over the last decades (Skakkebaek et al., 2006). If major isoforms of RXR expressed in germinal cells. RXRa is ex- testicular physiology has been considered for long for endocrine pressed in spermatogonia, spermatocytes and round spermatids, issues, the increasing incidence of disorders might be linked with while RXRc isoform is mainly found in pachytene spermatocytes environmental and/or compartmental features. Beside the classi- and elongated spermatids (Dufour and Kim, 1999). cal steroid hormone receptors (AR, ER), reverse endocrinology pointed out, in male fertility, the determinant role of the 2.3.8.3. Role in Leydig cells. (Fig. 2): LXRs, FXRa and PPARs, as many ‘‘orphan-adopted’’ nuclear receptors, such as those controlling other nuclear receptors, form heterodimers with RXRa. Retinoids lipid homeostasis. Indeed, cholesterol plays an important role in may have a double effect; being antioxidant, retinoic acid at phys- maintenance of reproductive functions and can be responsible of iological concentrations increases Leydig cell viability, promotes its fertility disorders. proliferation and blocks the negative effect of oxidative stress on As reviewed here, several nuclear receptors, adopted or steroidogenesis (Hales et al., 2005; Perri et al., 2010). In adult Ley- orphans, have been demonstrated to be key regulators of the dig cells, retinoids increase the basal testosterone secretion and testis physiology. They act throughout the development from expression of StAR and P450c17 and decrease 3hsdB and Lhr synthe- embryo to adulthood. They clearly appear to control all the aspects sis (Chaudhary et al., 1989; Lefevre et al., 1994). Vitamin A defi- of lipid metabolism from synthesis, storage and catabolism. In the ciency is known to be associated with impaired testosterone future, these receptors may help to better understand, at the secretion (Appling and Chytil, 1981). Inversely, excess of retinoids molecular level, the association between Metabolic Syndrome has negative effects on mass and function of Leydig cells. Animal and infertility. and cellular studies showed that high doses of retinoid reduce gen- Here, we focus on testicular physiology; however, fertility re- erally the number of somatic (Sertoli and Leydig) cells (Boulogne quires combined activities of several organs. Indeed, even though et al., 1999), induce apoptosis of Leydig cells, probably due to lipid the testis is the key organ for the production of the spermatozoa, peroxidation (Tucci et al., 2008) and may play a negative role on these testicular spermatozoa are not functional. They will need fur- steroidogenesis during fetal and adulthood life (Livera et al., ther maturation during transit into epididymis. Then after ejacula- 2004). Thus, nuclear receptors for retinoids are directly involved tion, spermatozoa also need to be protected. For that purpose, the in regulation of Leydig cell function and may either promote or composition (proteins and minerals) of the semen will be of major block retinoid effect on testes during their mild deficiency or importance to nourish, transport and to protect spermatozoa excess. (Gonzales, 2001). Thus its proper and successful functioning is a key factor in male fertility. 2.3.8.4. Involvement in Sertoli cell functions. (Fig. 2): RXRb is the ma- jor isoform expressed in Sertoli cells and it plays a key role in lipid 3.1. Post-testicular maturation homeostasis in these cells. Indeed, KO mice for RXRb are infertile with a defect in spermiation, enlightening the importance of reti- The epididymis plays an important role in their maturation. In- noic acids for this step; they show a progressive lipid accumulation deed, spermatozoa leaving testes are neither mobile nor fertile; in Sertoli cell cytoplasm (Kastner et al., 1996; Mascrez et al., 2004). they are submitted to different modifications in the epididymis The dialogue between retinoic pathway and LXR is well estab- and female genital tract to be fertile (Yanagimachi, 1994). Sperm lished, LXR deficient mice show an up regulation of gene involved maturation in the epididymis includes morphological modifica- in retinoic pathways (Volle et al., 2007a,b). This could participate in tions affecting protein and lipid composition (Rejraji et al., 2006). the testicular degeneration, be responsible for lipid accumulation These modifications render spermatozoa mobile. in Sertoli cells (Biswas and Deb, 1965) and may induce defects in Cholesterol is found in spermatic membrane. Cholesterol to synchronization of spermiation. All these factors participate in phospholipid ratio affects membrane fluidity and determines sper- the phenotype of infertility in these mice (for review: (Livera matic mobility, capacitation and acrosomial reaction (Motamed et al., 2002)). Khorasani et al., 2000). During their maturation, spermatozoa lose Specific inactivation of RXRb in Sertoli cells leads to the failure cholesterol in favor of desmosterol and undergo different modifica- of spermatid release, accumulation of cholesterol esters and, sub- tions in concentrations of different phospholipidss to promote sequently, testis degeneration (Vernet et al., 2008). membrane fluidity (Haidl and Opper, 1997; Jones, 1998; Travis and Kopf, 2002). 2.3.8.5. Potential role in germ cells. (Fig. 2): RXRs are also implicated A study of sterols and phospholipid repartition in spermatozoa in germ cell differentiation and maturation. RXRa and c are and seminal fluid in hypercholesterolemic patients did not show thought to be the major isoforms of RXR expressed in germinal any modification compared to normocholesterolemic patients cells. RXRa is expressed in spermatogonia, spermatocytes and (Grizard et al., 1995). Other studies showed that a statin treatment, round spermatids, while RXRc isoform is mainly found in pachy- changing plasma cholesterol levels, does not affect sperm quality, tene spermatocytes and elongated spermatids (Dufour and Kim, or slightly alter sperm mobility (Farnsworth et al., 1987; Nieder- 1999). These isoforms are mainly described to dimerize with other berger, 2005; Purvis and Christiansen, 1992). nuclear receptors in germ cells, especially RARa. Thus it is not Cholesterol homeostasis in epididymal microenvironment is unexpected that animals with RXRa or c mutation be infertile, at not well understood. Few studies have been performed on the con- 40 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 trol of this process and on its effects on sperm maturity. ABC pro- 3.3. From infertility to cancer? teins are expressed on spermatozoa membrane (Morales et al., 2008). They may be responsible for cholesterol efflux from sperma- There are evidences that infertility may predispose to the devel- tozoa, which will be liberated to apolipoproteins secreted from opment of testicular cancer (Hotaling and Walsh, 2009). Men seek- epidididymis and implicated in sperm maturation (Law et al., ing infertility treatment had an increased risk of developing 1997). testicular cancer (Walsh et al., 2009). Testicular cancer is the most LXRs are implicated in lipid homeostasis in different organs common malignancy in 20- to 34-years-old males (Ziglioli et al., (Volle and Lobaccaro, 2007a), LXRa and b are expressed in caput 2011). It has been stated that testicular cancer derives from a pre- and cauda epididymides, LXRb being the highest (Frenoux et al., cocious lesion, the carcinoma in situ of the testis, also known as 2004). LXR / mice are characterized by the loss of epithelial Intratubular Germ Cell Neoplasia (IGCN) or Testicular Intraepithe-   height due to epithelial cell apoptosis and lipid accumulation in lial Neoplasia (TIN) (Ziglioli et al., 2011). It is hypothesized that the peritubular and interstitial compartments of first and second parts molecular and genetic alterations responsible for this pathology of epididymis caput. Gametes obtained from the tail of epididymis could take place during embryonic development. This is the basis of these mice are fragile (Frenoux et al., 2004; Saez et al., 2007). of the Testicular Dysgenesis Syndrome, which sustains the poten- Further evaluation demonstrated cholesteryl ester accumulation tial involvement of endocrine disrupters in such pathology due to down regulation of cholesterol trafficking protein (ABCA1) (Skakkebaek et al., 2001). in caput epididymides which is segmental specific (Ouvrier et al., Interestingly, dietary patterns play a role on cancer develop- 2009). ment such as prostate tumors (Sebastiano et al., 2012). Indeed, some epidemiological and animal studies have reported a relation between the increase of fat intake and incidence of cancers. For 3.2. Post-ejaculation example, some studies have proved that effects on these cancers are greatly different by the type of fatty acids contained in the fatty Coagulation occurs immediately after ejaculation. This step is diet rather than the quantity of the fat intake itself (Swinnen et al., important to allow all spermatozoa to be in contact with the nutri- 2006). ents in the semen. It promotes sperm motility, increase stability of Regarding the emerging role of lipid metabolism in the develop- sperm chromatin, and suppress the immune activity in the female ment and the progression of tumors (Brusselmans et al., 2007), reproductive tract to avoid rejection of spermatozoa (Gonzales, these ‘‘lipidic’’ nuclear receptors could be of interest in the context 2001). Secretion of the seminal vesicles and prostate constitutes of testicular cancer. So far, few data are available on a potential role the majority of the ejaculates. of these nuclear receptors in the etiology of this pathology. How- ever, it was recently described that PPARc is highly expressed in 3.2.1. Seminals human testicular cancers compared to normal tissues (Hase This organ is mainly under the control of androgens (Fujii, et al., 2002). 1977) as proved by its regression during castration experiments. So far independently of hormonal alteration, the potential role of 3.4. Potential therapeutic targets? the other ‘‘lipidic’’ nuclear receptor discuss above have not been studied. The measurement of seminal fructose is used as a marker Thus, a new field of investigations is now open which suggests of the seminal vesicle function (Gonzales and Villena, 2001). several questions to be answered. Indeed, are there, in human infertility, some mutations of these NRs or deregulated pathways activated by the NRs? Could these transcription factors be used 3.2.2. Prostate as therapeutical targets? Such ideas have been reported by many The prostate works in conjunction with the seminal vesicles and authors for almost all the orphans reviewed here, and this in many Cowper’s glands which also participate to sperm production. different diseases (Viennois et al., 2011; Decourteix and Volle, Prostate secretions have huge impact on fertility as they are in- 2010). The challenge will be to develop strategies that will allow volved at many levels. Zinc in prostate fluid can kill bacteria, in or- targeting some of this receptors at specific timing and specific cel- der to protect the prostate gland and the whole genito-urinary lular localization. The road will be long before using any synthetic system (Cowan et al., 1991). There is also some nutritive material agonist to treat human infertility, but the gate is open.... for sperm. Prostate fluid can neutralize the acid in vagina to ensure the survival of sperm. At least, protease and fibrinolytic enzyme in Acknowledgements the prostate fluid can help the sperm to get through the mucus at cervix of womb and ZP zona pellucida of the egg, so that the egg can be fertilized ((Espana et al., 2007; Quinn and Begley, 1984). Lobaccaro’s lab is supported by FRM and Fondation BNP-Pari- Many studies have associated the potential impact of PPAR, FXR bas, Association de Recherche sur les Tumeurs Prostatiques, Ligue or LXR in the context of the tumor processes, modulating prolifer- contre le Cancer (Comité Allier), Fondation pour la Recherche ation, apoptosis or migration (Kim et al., 2009; Pommier et al., Médicale (FRM), Fondation BNP-Paribas and Association de Recher- 2010; Jiang et al., 2011; Kaeding et al., 2008). In the context of this che contre le Cancer (ARC), Grant from Ministère de l’Enseigne- review on the link between secretion and fertility one recent article ment Supérieur et de la recherche (to MB), Nouveau Chercheur could be of interest. Indeed Viennois et al. demonstrate that in Auvergne (to SB and DHV), ANR Jeune Chercheur (#1103, to DHV). Lxra / secretion process was altered (Viennois et al., 2012).   These mice develop ventral prostate hypertrophy, correlating with References an overaccumulation of secreted proteins in prostatic ducts and an alteration of vesicular trafficking in epithelial cells. In the fluid of Abney, T.O., 1999. The potential roles of estrogens in regulating Leydig cell development and function: a review. Steroids 64, 610–617. the lxra( / ) prostates, spermine binding protein is highly accu-   Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D.J., mulated. These data point out the crucial role of Lxra in the Suchy, F.J., 2001. Human bile salt export pump promoter is transactivated by homeostasis of the ventral prostate. It is not excluded that such the farnesoid X receptor/bile acid receptor. J. Biol. Chem. 276, 28857–28865. Appling, D.R., Chytil, F., 1981. Evidence of a role for retinoic acid (vitamin A-acid) in alteration of prostate secretion could have an impact on sperm the maintenance of testosterone production in male rats. Endocrinology 108, quality. 2120–2124. S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 41 Aquila, S., Bonofiglio, D., Gentile, M., Middea, E., Gabriele, S., Belmonte, M., Catalano, Catalano, S., Malivindi, R., Giordano, C., Gu, G., Panza, S., Bonofiglio, D., Lanzino, M., S., Pellegrino, M., Ando, S., 2006. Peroxisome proliferator-activated receptor Sisci, D., Panno, M.L., Ando, S., 2010. Farnesoid X receptor, through the binding (PPAR)gamma is expressed by human spermatozoa: its potential role on the with steroidogenic factor 1-responsive element, inhibits aromatase expression sperm physiology. J. Cell. Physiol. 209, 977–986. in tumor Leydig cells. J. Biol. Chem. 285, 5581–5593. Auwerx, J., 1992. Regulation of gene expression by fatty acids and fibric acid Chalkiadaki, A., Talianidis, I., 2005. SUMO-dependent compartmentalization in derivatives: an integrative role for peroxisome proliferator activated receptors. promyelocytic leukemia protein nuclear bodies prevents the access of LRH-1 to The belgian endocrine society lecture 1992. Horm. Res. 38, 269–277. chromatin. Mol. Cell. Biol. 25, 5095–5105. Bakke, M., Zhao, L., Hanley, N.A., Parker, K.L., 2001a. SF-1: a critical mediator of Chambon, P., 1996. A decade of molecular biology of retinoic acid receptors. FASEB J. steroidogenesis. Mol. Cell. Endocrinol. 171, 5–7. 10, 940–954. Bakke, M., Zhao, L., Parker, K.L., 2001b. Approaches to define the role of SF-1 at Chau, Y.M., Crawford, P.A., Woodson, K.G., Polish, J.A., Olson, L.M., Sadovsky, Y., different levels of the hypothalamic-pituitary-steroidogenic organ axis. Mol. 1997. Role of steroidogenic-factor 1 in basal and 3’,5’-cyclic adenosine Cell. Endocrinol. 179, 33–37. monophosphate-mediated regulation of cytochrome P450 side-chain cleavage Bantubungi, K., Prawitt, J., Staels, B., 2011. Control of metabolism by nutrient- enzyme in the mouse. Biol. Reprod. 57, 765–771. regulated nuclear receptors acting in the brain. J. Steroid Biochem. Mol. Biol.. Chaudhary, L.R., Hutson, J.C., Stocco, D.M., 1989. Effect of retinol and retinoic acid on Baranowski, M., 2008. Biological role of liver X receptors. J. Physiol. Pharmacol. 59 testosterone production by rat Leydig cells in primary culture. Biochem. (Suppl 7), 31–55. Biophys. Res. Commun. 158, 400–406. Barlow, N.J., Foster, P.M., 2003. Pathogenesis of male reproductive tract lesions from Chen, M., Beaven, S., Tontonoz, P., 2005. Identification and characterization of two gestation through adulthood following in utero exposure to Di(n-butyl) alternatively spliced transcript variants of human liver X receptor alpha. J. Lipid phthalate. Toxicol. Pathol. 31, 397–410. Res. 46, 2570–2579. Bavner, A., Sanyal, S., Gustafsson, J.A., Treuter, E., 2005. Transcriptional corepression Chen, H., Ge, R.S., Zirkin, B.R., 2009. Leydig cells: from stem cells to aging. Mol. Cell. by SHP: molecular mechanisms and physiological consequences. Trends Endocrinol. 306, 9–16. Endocrinol. Metab. 16, 478–488. Chen, W.D., Wang, Y.D., Meng, Z., Zhang, L., Huang, W., 2011. Nuclear bile acid Bhasin, S., Cunningham, G.R., Hayes, F.J., Matsumoto, A.M., Snyder, P.J., Swerdloff, receptor FXR in the hepatic regeneration. Biochim. Biophys. Acta 1812, 888– R.S., Montori, V.M., 2010. Testosterone therapy in men with androgen 892. deficiency syndromes: an Endocrine Society clinical practice guideline. J. Clin. Cheng, L., Ding, G., Qin, Q., Huang, Y., Lewis, W., He, N., Evans, R.M., Schneider, M.D., Endocrinol. Metab. 95, 2536–2559. Brako, F.A., Xiao, Y., Chen, Y.E., Yang, Q., 2004. Cardiomyocyte-restricted Biswas, N.M., Deb, C., 1965. Testicular degeneration in rats during hypervitaminosis peroxisome proliferator-activated receptor-delta deletion perturbs myocardial A. Endokrinologie 49, 64–69. fatty acid oxidation and leads to cardiomyopathy. Nat. Med. 10, 1245–1250. Blavy, P., Gondret, F., Guillou, H., Lagarrigue, S., Martin, P.G., van Milgen, J., Cho, H.W., Nie, R., Carnes, K., Zhou, Q., Sharief, N.A., Hess, R.A., 2003. The Radulescu, O., Siegel, A., 2009. A minimal model for hepatic fatty acid balance antiestrogen ICI 182,780 induces early effects on the adult male mouse during fasting: application to PPAR alpha-deficient mice. J. Theor. Biol. 261, reproductive tract and long-term decreased fertility without testicular 266–278. atrophy. Reprod Biol Endocrinol 1, 57. Bookout, A.L., Jeong, Y., Downes, M., Yu, R.T., Evans, R.M., Mangelsdorf, D.J., 2006. Corton, J.C., Lapinskas, P.J., 2005. Peroxisome proliferator-activated receptors: Anatomical profiling of nuclear receptor expression reveals a hierarchical mediators of phthalate ester-induced effects in the male reproductive tract? transcriptional network. Cell 126, 789–799. Toxicol. Sci. 83, 4–17. Borgius, L.J., Steffensen, K.R., Gustafsson, J.A., Treuter, E., 2002. Glucocorticoid Couse, J.F., Lindzey, J., Grandien, K., Gustafsson, J.A., Korach, K.S., 1997. Tissue signaling is perturbed by the atypical orphan receptor and corepressor SHP. J. distribution and quantitative analysis of estrogen receptor-alpha (ERalpha) and Biol. Chem. 277, 49761–49766. estrogen receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type Bose, H.S., Sugawara, T., Strauss 3rd, J.F., Miller, W.L., 1996. The pathophysiology and ERalpha-knockout mouse. Endocrinology 138, 4613–4621. and genetics of congenital lipoid adrenal hyperplasia. N. Engl. J. Med. 335, Couse, J.E., Mahato, D., Eddy, E.M., Korach, K.S., 2001. Molecular mechanism of 1870–1878. estrogen action in the male: insights from the estrogen receptor null mice. Botrugno, O.A., Fayard, E., Annicotte, J.S., Haby, C., Brennan, T., Wendling, O., Tanaka, Reprod Fertil Dev 13, 211–219. T., Kodama, T., Thomas, W., Auwerx, J., Schoonjans, K., 2004. Synergy between Cowan, L.A., Barsanti, J.A., Brown, J., Jain, A., 1991. Effects of bacterial infection and LRH-1 and beta-catenin induces G1 cyclin-mediated cell proliferation. Mol. Cell castration on prostatic tissue zinc concentration in dogs. Am. J. Vet. Res. 52, 15, 499–509. 1262–1264. Boulogne, B., Levacher, C., Durand, P., Habert, R., 1999. Retinoic acid receptors and Cummins, C.L., Volle, D.H., Zhang, Y., McDonald, J.G., Sion, B., Lefrancois-Martinez, retinoid X receptors in the rat testis during fetal and postnatal development: A.M., Caira, F., Veyssiere, G., Mangelsdorf, D.J., Lobaccaro, J.M., 2006. Liver X immunolocalization and implication in the control of the number of gonocytes. receptors regulate adrenal cholesterol balance. J. Clin. Invest. 116, 1902–1912. Biol. Reprod. 61, 1548–1557. Cunningham, G.R., Toma, S.M., 2011. Clinical review: why is androgen replacement Bourguiba, S., Genissel, C., Lambard, S., Bouraima, H., Carreau, S., 2003. Regulation of in males controversial? J. Clin. Endocrinol. Metab. 96, 38–52. aromatase gene expression in Leydig cells and germ cells. J. Steroid Biochem. Dadoune, J.P., 1994. The cellular biology of mammalian spermatids: a review. Bull. Mol. Biol. 86, 335–343. Assoc. Anat. (Nancy) 78, 33–40. Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J., Mamiya, S., Yashiro, K., Dandona, P., Aljada, A., Chaudhuri, A., Mohanty, P., Garg, R., 2005. Metabolic Chawengsaksophak, K., Wilson, M.J., Rossant, J., Hamada, H., Koopman, P., 2006. syndrome: a comprehensive perspective based on interactions between obesity, Retinoid signaling determines germ cell fate in mice. Science 312, 596–600. diabetes, and inflammation. Circulation 111, 1448–1454. Braissant, O., Wahli, W., 1998. Differential expression of peroxisome proliferator- Decourteix, M., Volle, D.H., 2010. Endocrine disruptors and fertility: NR0B2, a new activated receptor-alpha, -beta, and -gamma during rat embryonic therapeutic target? Med. Sci. (Paris) 26, 359–361. development. Endocrinology 139, 2748–2754. Denolet, E., De Gendt, K., Allemeersch, J., Engelen, K., Marchal, K., Van Hummelen, P., Brendel, C., Schoonjans, K., Botrugno, O.A., Treuter, E., Auwerx, J., 2002. The small Tan, K.A., Sharpe, R.M., Saunders, P.T., Swinnen, J.V., Verhoeven, G., 2006. The heterodimer partner interacts with the liver X receptor alpha and represses its effect of a sertoli cell-selective knockout of the androgen receptor on testicular transcriptional activity. Mol. Endocrinol. 16, 2065–2076. gene expression in prepubertal mice. Mol. Endocrinol. 20, 321–334. Brusselmans, K., Timmermans, L., Van de Sande, T., Van Veldhoven, P.P., Guan, G., Denson, L.A., Sturm, E., Echevarria, W., Zimmerman, T.L., Makishima, M., Shechter, I., Claessens, F., Verhoeven, G., Swinnen, J.V., 2007. Squalene synthase, Mangelsdorf, D.J., Karpen, S.J., 2001. The orphan nuclear receptor, shp, a determinant of Raft-associated cholesterol and modulator of cancer cell mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. proliferation. J. Biol. Chem. 282, 18777–18785. Gastroenterology 121, 140–147. Cao, G., Zhao, L., Stangl, H., Hasegawa, T., Richardson, J.A., Parker, K.L., Hobbs, H.H., Diemer, T., Allen, J.A., Hales, K.H., Hales, D.B., 2003. Reactive oxygen disrupts 1999. Developmental and hormonal regulation of murine scavenger receptor, mitochondria in MA-10 tumor Leydig cells and inhibits steroidogenic acute class B, type 1. Mol. Endocrinol. 13, 1460–1473. regulatory (StAR) protein and steroidogenesis. Endocrinology 144, 2882–2891. Caprio, M., Isidori, A.M., Carta, A.R., Moretti, C., Dufau, M.L., Fabbri, A., 1999. Dierich, A., Sairam, M.R., Monaco, L., Fimia, G.M., Gansmuller, A., LeMeur, M., Expression of functional leptin receptors in rodent Leydig cells. Endocrinology Sassone-Corsi, P., 1998. Impairing follicle-stimulating hormone (FSH) signaling 140, 4939–4947. in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis Carleton, R.A., Dwyer, J., Finberg, L., Flora, J., Goodman, D.S., Grundy, S.M., Havas, S., and hormonal imbalance. Proc. Natl. Acad. Sci. USA 95, 13612–13617. Hunter, G.T., Kritchevsky, D., Lauer, R.M., et al., 1991. Report of the expert panel Ding, E.L., Song, Y., Malik, V.S., Liu, S., 2006. Sex differences of endogenous sex on population strategies for blood cholesterol reduction a statement from the hormones and risk of type 2 diabetes: a systematic review and meta-analysis. national cholesterol education program, national heart, lung, and blood JAMA 295, 1288–1299. institute, national institutes of health. Circulation 83, 2154–2232. Dufau, M.L., 1988. Endocrine regulation and communicating functions of the Leydig Caron, K.M., Soo, S.C., Wetsel, W.C., Stocco, D.M., Clark, B.J., Parker, K.L., 1997. cell. Annu. Rev. Physiol. 50, 483–508. Targeted disruption of the mouse gene encoding steroidogenic acute regulatory Dufour, J.M., Kim, K.H., 1999. Cellular and subcellular localization of six retinoid protein provides insights into congenital lipoid adrenal hyperplasia. Proc. Natl. receptors in rat testis during postnatal development: identification of potential Acad. Sci. USA 94, 11540–11545. heterodimeric receptors. Biol. Reprod. 61, 1300–1308. Carreau, S., Hess, R.A., 2010. Oestrogens and spermatogenesis. Philos. Trans. R. Soc. Duggavathi, R., Volle, D.H., Mataki, C., Antal, M.C., Messaddeq, N., Auwerx, J., Lond. B Biol. Sci. 365, 1517–1535. Murphy, B.D., Schoonjans, K., 2008. Liver receptor homolog 1 is essential for Carreau, S., Bois, C., Zanatta, L., Silva, F.R., Bouraima-Lelong, H., Delalande, C., 2011a. ovulation. Gene Dev. 22, 1871–1876. Estrogen signaling in testicular cells. Life Sci. 89, 584–587. Dunkel, L., 2006. Use of aromatase inhibitors to increase final height. Mol. Cell. Carreau, S., Bouraima-Lelong, H., Delalande, C., 2011b. Estrogens in male germ cells. Endocrinol. 254–255, 207–216. Spermatogenesis 1, 90–94. 42 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 Eddy, E.M., Washburn, T.F., Bunch, D.O., Goulding, E.H., Gladen, B.C., Lubahn, D.B., Hase, T., Yoshimura, R., Mitsuhashi, M., Segawa, Y., Kawahito, Y., Wada, S., Nakatani, Korach, K.S., 1996. Targeted disruption of the estrogen receptor gene in male T., Sano, H., 2002. Expression of peroxisome proliferator-activated receptors in mice causes alteration of spermatogenesis and infertility. Endocrinology 137, human testicular cancer and growth inhibition by its agonists. Urology 60, 542– 4796–4805. 547. El-Hajjaji, F.Z., Oumeddour, A., Pommier, A.J., Ouvrier, A., Viennois, E., Dufour, J., He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., Nelson, M., Ong, E., Olefsky, Caira, F., Drevet, J.R., Volle, D.H., Baron, S., Saez, F., Lobaccaro, J.M., 2011. Liver X J.M., Evans, R.M., 2003. Adipose-specific peroxisome proliferator-activated receptors, lipids and their reproductive secrets in the male. Biochim. Biophys. receptor gamma knockout causes insulin resistance in fat and liver but not in Acta 1812, 974–981. muscle. Proc. Natl. Acad. Sci. USA 100, 15712–15717. Endo-Umeda, K., Uno, S., Fujimori, K., Naito, Y., Saito, K., Yamagishi, K., Jeong, Y., Heng, J.C., Feng, B., Han, J., Jiang, J., Kraus, P., Ng, J.H., Orlov, Y.L., Huss, M., Yang, L., Miyachi, H., Tokiwa, H., Yamada, S., Makishima, M., 2012. Differential Lufkin, T., Lim, B., Ng, H.H., 2010. The nuclear receptor Nr5a2 can replace Oct4 in expression and function of alternative splicing variants of human liver the reprogramming of murine somatic cells to pluripotent cells. Cell Stem Cell 6,  receptor alpha. Mol. Pharmacol. 81, 800–810. 167–174. Enya, M., Horikawa, Y., Kuroda, E., Yonemaru, K., Tonooka, N., Tomura, H., Oda, N., Hess, R.A., Gist, D.H., Bunick, D., Lubahn, D.B., Farrell, A., Bahr, J., Cooke, P.S., Greene, Yokoi, N., Yamagata, K., Shihara, N., Iizuka, K., Saibara, T., Seino, S., Takeda, J., G.L., 1997. Estrogen receptor (alpha and beta) expression in the excurrent ducts 2008. Mutations in the small heterodimer partner gene increase morbidity risk of the adult male rat reproductive tract. J. Androl. 18, 602–611. in Japanese type 2 diabetes patients. Hum. Mutat. 29, E271–E277. Hevener, A.L., He, W., Barak, Y., Le, J., Bandyopadhyay, G., Olson, P., Wilkes, J., Evans, Eskild, W., Ree, A.H., Levy, F.O., Jahnsen, T., Hansson, V., 1991. Cellular localization of R.M., Olefsky, J., 2003. Muscle-specific Pparg deletion causes insulin resistance. mRNAs for retinoic acid receptor-alpha, cellular retinol-binding protein, and Nat. Med. 9, 1491–1497. cellular retinoic acid-binding protein in rat testis: evidence for germ cell- Higashiyama, H., Billin, A.N., Okamoto, Y., Kinoshita, M., Asano, S., 2007. Expression specific mRNAs. Biol. Reprod. 44, 53–61. profiling of peroxisome proliferator-activated receptor-delta (PPAR-delta) in Espana, F., Navarro, S., Medina, P., Zorio, E., Estelles, A., 2007. The role of protein C mouse tissues using tissue microarray. Histochem. Cell Biol. 127, 485–494. inhibitor in human reproduction. Semin. Thromb. Hemost. 33, 41–45. Hinshelwood, M.M., Shelton, J.M., Richardson, J.A., Mendelson, C.R., 2005. Temporal Farnsworth, W.H., Hoeg, J.M., Maher, M., Brittain, E.H., Sherins, R.J., Brewer Jr., H.B., and spatial expression of liver receptor homologue-1 (LRH-1) during 1987. Testicular function in type II hyperlipoproteinemic patients treated with embryogenesis suggests a potential role in gonadal development. Dev. Dyn. lovastatin (mevinolin) or neomycin. J. Clin. Endocrinol. Metab. 65, 546–550. 234, 159–168. Fayard, E., Auwerx, J., Schoonjans, K., 2004. LRH-1: an orphan nuclear receptor Horton, J.D., Shimano, H., Hamilton, R.L., Brown, M.S., Goldstein, J.L., 1999. involved in development, metabolism and steroidogenesis. Trends Cell Biol. 14, Disruption of LDL receptor gene in transgenic SREBP-1a mice unmasks 250–260. hyperlipidemia resulting from production of lipid-rich VLDL. J. Clin. Invest. Fernandez-Marcos, P.J., Auwerx, J., Schoonjans, K., 2011. Emerging actions of the 103, 1067–1076. nuclear receptor LRH-1 in the gut. Biochim. Biophys. Acta 1812, 947–955. Hotaling, J.M., Walsh, T.J., 2009. Male infertility: a risk factor for testicular cancer. Fijak, M., Bhushan, S., Meinhardt, A., 2011. Immunoprivileged sites: the testis. Nat. Rev. Urol. 6, 550–556. Methods Mol. Biol. 677, 459–470. Hou, J.W., Collins, D.C., Schleicher, R.L., 1990. Sources of cholesterol for testosterone Foster, P.M., 2006. Disruption of reproductive development in male rat offspring biosynthesis in murine Leydig cells. Endocrinology 127, 2047–2055. following in utero exposure to phthalate esters. Int. J. Androl 29, 140–147, Hozoji-Inada, M., Munehira, Y., Nagao, K., Kioka, N., Ueda, K., 2011. Liver X receptor discussion 181–5. beta (LXRbeta) interacts directly with ATP-binding cassette A1 (ABCA1) to Francis, G.A., Fayard, E., Picard, F., Auwerx, J., 2003. Nuclear receptors and the promote high density lipoprotein formation during acute cholesterol control of metabolism. Annu. Rev. Physiol. 65, 261–311. accumulation. J. Biol. Chem. 286, 20117–20124. Frenoux, J.M., Vernet, P., Volle, D.H., Britan, A., Saez, F., Kocer, A., Henry-Berger, J., Hu, M.C., Hsu, N.C., Pai, C.I., Wang, C.K., Chung, B., 2001. Functions of the upstream Mangelsdorf, D.J., Lobaccaro, J.M., Drevet, J.R., 2004. Nuclear oxysterol receptors and proximal steroidogenic factor 1 (SF-1)-binding sites in the CYP11A1 LXRs, are involved in the maintenance of mouse caput epididymidis structure promoter in basal transcription and hormonal response. Mol. Endocrinol. 15, and functions. J. Mol. Endocrinol. 33, 361–375. 812–818. Froment, P., Touraine, P., 2006. Thiazolidinediones and Fertility in Polycystic Ovary Hua, X., Sakai, J., Ho, Y.K., Goldstein, J.L., Brown, M.S., 1995. Hairpin orientation of Syndrome (PCOS). PPAR Res. 2006, 73986. sterol regulatory element-binding protein-2 in cell membranes as determined Fujii, T., 1977. Roles of age and androgen in the regulation of sex accessory organs. by protease protection. J. Biol. Chem. 270, 29422–29427. Adv. Sex Horm. Res. 3, 103–137. Huang, J.C., 2008. The role of peroxisome proliferator-activated receptors in the Gao, D.M., Wang, L.F., Liu, J., Kong, Y.Y., Wang, Y., Xie, Y.H., 2006. Expression of development and physiology of gametes and preimplantation embryos. PPAR mouse liver receptor homologue 1 in embryonic stem cells is directed by a Res. 2008, 732303. novel promoter. FEBS Lett. 580, 1702–1708. Hung, C.C., Farooqi, I.S., Ong, K., Luan, J., Keogh, J.M., Pembrey, M., Yeo, G.S., Dunger, Gazouli, M., Yao, Z.X., Boujrad, N., Corton, J.C., Culty, M., Papadopoulos, V., 2002. D., Wareham, N.J., S, O.R., 2003. Contribution of variants in the small Effect of peroxisome proliferators on Leydig cell peripheral-type heterodimer partner gene to birthweight, adiposity, and insulin levels: benzodiazepine receptor gene expression, hormone-stimulated cholesterol mutational analysis and association studies in multiple populations. Diabetes transport, and steroidogenesis: role of the peroxisome proliferator-activator 52, 1288–1291. receptor alpha. Endocrinology 143, 2571–2583. Iguchi, T., Watanabe, H., Katsu, Y., 2001. Developmental effects of estrogenic agents Goedeke, L., Fernandez-Hernando, C., 2012. Regulation of cholesterol homeostasis. on mice, fish, and frogs: a mini-review. Horm. Behav. 40, 248–251. Cell. Mol. Life Sci. 69, 915–930. Ikeda, Y., Shen, W.H., Ingraham, H.A., Parker, K.L., 1994. Developmental expression Gong, H., Guo, P., Zhai, Y., Zhou, J., Uppal, H., Jarzynka, M.J., Song, W.C., Cheng, S.Y., of mouse steroidogenic factor-1, an essential regulator of the steroid Xie, W., 2007. Estrogen deprivation and inhibition of breast cancer growth hydroxylases. Mol. Endocrinol. 8, 654–662. in vivo through activation of the orphan nuclear receptor liver X receptor. Mol. Ikeda, Y., Luo, X., Abbud, R., Nilson, J.H., Parker, K.L., 1995. The nuclear receptor Endocrinol. 21, 1781–1790. steroidogenic factor 1 is essential for the formation of the ventromedial Gonzales, G.F., 2001. Function of seminal vesicles and their role on male fertility. hypothalamic nucleus. Mol. Endocrinol. 9, 478–486. Asian J. Androl. 3, 251–258. Im, S.S., Osborne, T.F., 2011. Liver x receptors in atherosclerosis and inflammation. Gonzales, G.F., Villena, A., 2001. True corrected seminal fructose level: a better Circ. Res. 108, 996–1001. marker of the function of seminal vesicles in infertile men. Int. J. Androl. 24, Inagaki, T., Choi, M., Moschetta, A., Peng, L., Cummins, C.L., McDonald, J.G., Luo, G., 255–260. Jones, S.A., Goodwin, B., Richardson, J.A., Gerard, R.D., Repa, J.J., Mangelsdorf, Goodwin, B., Jones, S.A., Price, R.R., Watson, M.A., McKee, D.D., Moore, L.B., Galardi, D.J., Kliewer, S.A., 2005. Fibroblast growth factor 15 functions as an C., Wilson, J.G., Lewis, M.C., Roth, M.E., Maloney, P.R., Willson, T.M., Kliewer, S.A., enterohepatic signal to regulate bile acid homeostasis. Cell Metab. 2, 217–225. 2000. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 Ingraham, H.A., Lala, D.S., Ikeda, Y., Luo, X., Shen, W.H., Nachtigal, M.W., Abbud, R., represses bile acid biosynthesis. Mol. Cell 6, 517–526. Nilson, J.H., Parker, K.L., 1994. The nuclear receptor steroidogenic factor 1 acts at Grizard, G., Sion, B., Jouanel, P., Benoit, P., Boucher, D., 1995. Cholesterol, multiple levels of the reproductive axis. Gene Dev. 8, 2302–2312. phospholipids and markers of the function of the accessory sex glands in the Isidori, A.M., Caprio, M., Strollo, F., Moretti, C., Frajese, G., Isidori, A., Fabbri, A., 1999. semen of men with hypercholesterolaemia. Int. J. Androl. 18, 151–156. Leptin and androgens in male obesity: evidence for leptin contribution to Guo, J., Tao, S.X., Chen, M., Shi, Y.Q., Zhang, Z.Q., Li, Y.C., Zhang, X.S., Hu, Z.Y., Liu, Y.X., reduced androgen levels. J. Clin. Endocrinol. Metab. 84, 3673–3680. 2007. Heat treatment induces liver receptor homolog-1 expression in monkey Ismail, N., Morales, C., Clermont, Y., 1990. Role of spermatogonia in the stage- and rat sertoli cells. Endocrinology 148, 1255–1265. synchronization of the seminiferous epithelium in vitamin-A-deficient rats. Am. Hageman, J., Herrema, H., Groen, A.K., Kuipers, F., 2010. A role of the bile salt J. Anat. 188, 57–63. receptor FXR in atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 30, 1519–1528. Jay, M.A., Ren, J., 2007. Peroxisome proliferator-activated receptor (PPAR) in Haider, S.G., 2004. Cell biology of Leydig cells in the testis. Int. Rev. Cytol. 233, 181– metabolic syndrome and type 2 diabetes mellitus. Curr. Diabetes Rev. 3, 33–39. 241. Jeffs, B., Ito, M., Yu, R.N., Martinson, F.A., Wang, Z.J., Doglio, L.T., Jameson, J.L., 2001. Haidl, G., Opper, C., 1997. Changes in lipids and membrane anisotropy in human Sertoli cell-specific rescue of fertility, but not testicular pathology, in Dax1 spermatozoa during epididymal maturation. Hum. Reprod. 12, 2720–2723. (Ahch)-deficient male mice. Endocrinology 142, 2481–2488. Hales, D.B., Allen, J.A., Shankara, T., Janus, P., Buck, S., Diemer, T., Hales, K.H., 2005. Jegou, B., 1993. The Sertoli-germ cell communication network in mammals. Int. Rev. Mitochondrial function in Leydig cell steroidogenesis. Ann. N. Y. Acad. Sci. 1061, Cytol. 147, 25–96. 120–134. Jeyasuria, P., Ikeda, Y., Jamin, S.P., Zhao, L., De Rooij, D.G., Themmen, A.P., Behringer, Hanukoglu, I., 1992. Steroidogenic enzymes: structure, function, and role in R.R., Parker, K.L., 2004. Cell-specific knockout of steroidogenic factor 1 reveals regulation of steroid hormone biosynthesis. J. Steroid Biochem. Mol. Biol. 43, its essential roles in gonadal function. Mol. Endocrinol. 18, 1610–1619. 779–804. S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 43 Jiang, M., Strand, D.W., Franco, O.E., Clark, P.E., Hayward, S.W., 2011. PPARgamma: a Lee, J.H., Gong, H., Khadem, S., Lu, Y., Gao, X., Li, S., Zhang, J., Xie, W., 2008. Androgen molecular link between systemic metabolic disease and benign prostate deprivation by activating the liver X receptor. Endocrinology 149, 3778–3788. hyperplasia. Differentiation 82, 220–236. Leers-Sucheta, S., Morohashi, K., Mason, J.I., Melner, M.H., 1997. Synergistic Johansson, L., Thomsen, J.S., Damdimopoulos, A.E., Spyrou, G., Gustafsson, J.A., activation of the human type II 3beta-hydroxysteroid dehydrogenase/delta5- Treuter, E., 1999. The orphan nuclear receptor SHP inhibits agonist-dependent delta4 isomerase promoter by the transcription factor steroidogenic factor-1/ transcriptional activity of estrogen receptors ERalpha and ERbeta. J. Biol. Chem. adrenal 4-binding protein and phorbol ester. J. Biol. Chem. 272, 7960–7967. 274, 345–353. Lefebvre, P., Cariou, B., Lien, F., Kuipers, F., Staels, B., 2009. Role of bile acids and bile Johnson, L., Thompson Jr., D.L., Varner, D.D., 2008. Role of Sertoli cell number and acid receptors in metabolic regulation. Physiol. Rev. 89, 147–191. function on regulation of spermatogenesis. Anim. Reprod. Sci. 105, 23–51. Lefevre, A., Rogier, E., Astraudo, C., Duquenne, C., Finaz, C., 1994. Regulation by Jones, R., 1998. Plasma membrane structure and remodelling during sperm retinoids of luteinizing hormone/chorionic gonadotropin receptor, cholesterol maturation in the epididymis. J. Reprod. Fertil. Suppl. 53, 73–84. side-chain cleavage cytochrome P-450, 3 beta-hydroxysteroid dehydrogenase/ Juul, A., Skakkebaek, N.E., 2002. Testosterone treatment of elderly men. The so delta (5–4)-isomerase and 17 alpha-hydroxylase/C17-20 lyase cytochrome P- called andropause doesn’t exist. Ugeskr. Laeger 164, 4941–4942. 450 messenger ribonucleic acid levels in the K9 mouse Leydig cell line. Mol. Kaeding, J., Bouchaert, E., Belanger, J., Caron, P., Chouinard, S., Verreault, M., Cell. Endocrinol. 106, 31–39. Larouche, O., Pelletier, G., Staels, B., Belanger, A., Barbier, O., 2008. Activators of Lehmann, J.M., Kliewer, S.A., Moore, L.B., Smith-Oliver, T.A., Oliver, B.B., Su, J.L., the farnesoid X receptor negatively regulate androgen glucuronidation in Sundseth, S.S., Winegar, D.A., Blanchard, D.E., Spencer, T.A., Willson, T.M., 1997. human prostate cancer LNCAP cells. Biochem. J. 410, 245–253. Activation of the nuclear receptor LXR by oxysterols defines a new hormone Kaplan, S.A., Meehan, A.G., Shah, A., 2006. The age related decrease in testosterone is response pathway. J. Biol. Chem. 272, 3137–3140. significantly exacerbated in obese men with the metabolic syndrome What are Li, H., Palczewski, K., Baehr, W., Clagett-Dame, M., 2011a. Vitamin A deficiency the implications for the relatively high incidence of erectile dysfunction results in meiotic failure and accumulation of undifferentiated spermatogonia observed in these men? J. Urol. 176, 1524–1527, discussion 1527–8. in prepubertal mouse testis. Biol. Reprod. 84, 336–341. Kastner, P., Mark, M., Leid, M., Gansmuller, A., Chin, W., Grondona, J.M., Decimo, D., Li, Y., Ramdhan, D.H., Naito, H., Yamagishi, N., Ito, Y., Hayashi, Y., Yanagiba, Y., Krezel, W., Dierich, A., Chambon, P., 1996. Abnormal spermatogenesis in RXR Okamura, A., Tamada, H., Gonzalez, F.J., Nakajima, T., 2011b. Ammonium beta mutant mice. Gene Dev. 10, 80–92. perfluorooctanoate may cause testosterone reduction by adversely affecting Kasturi, S.S., Tannir, J., Brannigan, R.E., 2008. The metabolic syndrome and male testis in relation to PPARalpha. Toxicol. Lett. 205, 265–272. infertility. J. Androl. 29, 251–259. Livera, G., Rouiller-Fabre, V., Pairault, C., Levacher, C., Habert, R., 2002. Regulation Kemper, J.K., Kim, H., Miao, J., Bhalla, S., Bae, Y., 2004. Role of an mSin3A-Swi/Snf and perturbation of testicular functions by vitamin A. Reproduction 124, 173– chromatin remodeling complex in the feedback repression of bile acid 180. biosynthesis by SHP. Mol. Cell. Biol. 24, 7707–7719. Livera, G., Pairault, C., Lambrot, R., Lelievre-Pegorier, M., Saez, J.M., Habert, R., Kerr, J.B., 1991. Ultrastructure of the seminiferous epithelium and intertubular Rouiller-Fabre, V., 2004. Retinoid-sensitive steps in steroidogenesis in fetal tissue of the human testis. J. Electron Microsc. Tech. 19, 215–240. and neonatal rat testes: in vitro and in vivo studies. Biol. Reprod. 70, 1814– Kerr, J.B., de Kretser, D.M., 1974. Proceedings: the role of the Sertoli cell in 1821. phagocytosis of the residual bodies of spermatids. J. Reprod. Fertil. 36, 439–440. Lobaccaro, J.M., Repa, J.J., Lu, T.T., Caira, F., Henry-Berger, J., Volle, D.H., Mangelsdorf, Khaw, K.T., Dowsett, M., Folkerd, E., Bingham, S., Wareham, N., Luben, R., Welch, A., D.J., 2001. Regulation of lipid metabolism by the orphan nuclear receptors. Ann. Day, N., 2007. Endogenous testosterone and mortality due to all causes, Endocrinol. (Paris) 62, 239–247. cardiovascular disease, and cancer in men: European prospective investigation Lu, T.T., Makishima, M., Repa, J.J., Schoonjans, K., Kerr, T.A., Auwerx, J., Mangelsdorf, into cancer in Norfolk (EPIC-Norfolk) Prospective Population Study. Circulation D.J., 2000. Molecular basis for feedback regulation of bile acid synthesis by 116, 2694–2701. nuclear receptors. Mol. Cell 6, 507–515. Kierszenbaum, A.L., Rivkin, E., Tres, L.L., 2007. Molecular biology of sperm head Lubahn, D.B., Moyer, J.S., Golding, T.S., Couse, J.F., Korach, K.S., Smithies, O., 1993. shaping. Soc. Reprod. Fertil. Suppl. 65, 33–43. Alteration of reproductive function but not prenatal sexual development after Kim, H.J., Andersson, L.C., Bouton, D., Warner, M., Gustafsson, J.A., 2009. Stromal insertional disruption of the mouse estrogen receptor gene. Proc. Natl. Acad. Sci. growth and epithelial cell proliferation in ventral prostates of liver X receptor USA 90, 11162–11166. knockout mice. Proc. Natl. Acad. Sci. USA 106, 558–563. Lufkin, T., Lohnes, D., Mark, M., Dierich, A., Gorry, P., Gaub, M.P., LeMeur, M., Kolettis, P.N., 2003. Evaluation of the subfertile man. Am. Fam. Physician 67, 2165– Chambon, P., 1993. High postnatal lethality and testis degeneration in retinoic 2172. acid receptor alpha mutant mice. Proc. Natl. Acad. Sci. USA 90, 7225–7229. Korach-Andre, M., Archer, A., Gabbi, C., Barros, R.P., Pedrelli, M., Steffensen, K.R., Luo, Y., Tall, A.R., 2000. Sterol upregulation of human CETP expression in vitro and in Pettersson, A.T., Laurencikiene, J., Parini, P., Gustafsson, J.A., 2011a. Liver X transgenic mice by an LXR element. J. Clin. Invest. 105, 513–520. receptors regulate de novo lipogenesis in a tissue-specific manner in C57BL/6 Luo, X., Ikeda, Y., Parker, K.L., 1994. A cell-specific nuclear receptor is essential for female mice. Am. J. Physiol. Endocrinol. Metab. 301, E210–E222. adrenal and gonadal development and sexual differentiation. Cell 77, 481–490. Korach-Andre, M., Archer, A., Barros, R.P., Parini, P., Gustafsson, J.A., 2011b. Both Luo, X., Ikeda, Y., Parker, K.L., 1995. The cell-specific nuclear receptor steroidogenic liver-X receptor (LXR) isoforms control energy expenditure by regulating brown factor 1 plays multiple roles in reproductive function. Philos. Trans. R. Soc. Lond. adipose tissue activity. Proc. Natl. Acad. Sci. USA 108, 403–408. B Biol. Sci. 350, 279–283. Krishnamurthy, H., Danilovich, N., Morales, C.R., Sairam, M.R., 2000. Qualitative and Luo, X., Ikeda, Y., Lala, D., Rice, D., Wong, M., Parker, K.L., 1999. Steroidogenic factor quantitative decline in spermatogenesis of the follicle-stimulating hormone 1 (SF-1) is essential for endocrine development and function. J. Steroid Biochem. receptor knockout (FORKO) mouse. Biol. Reprod. 62, 1146–1159. Mol. Biol. 69, 13–18. Kubota, N., Terauchi, Y., Miki, H., Tamemoto, H., Yamauchi, T., Komeda, K., Satoh, S., Maeda, T., Miyata, M., Yotsumoto, T., Kobayashi, D., Nozawa, T., Toyama, K., Nakano, R., Ishii, C., Sugiyama, T., Eto, K., Tsubamoto, Y., Okuno, A., Murakami, Gonzalez, F.J., Yamazoe, Y., Tamai, I., 2004. Regulation of drug transporters by K., Sekihara, H., Hasegawa, G., Naito, M., Toyoshima, Y., Tanaka, S., Shiota, K., the farnesoid X receptor in mice. Mol. Pharm. 1, 281–289. Kitamura, T., Fujita, T., Ezaki, O., Aizawa, S., Kadowaki, T., et al., 1999. PPAR Maggio, M., Lauretani, F., Ceda, G.P., Bandinelli, S., Basaria, S., Paolisso, G., Ble, A., gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin Egan, J.M., Metter, E.J., Abbatecola, A.M., Zuliani, G., Ruggiero, C., Valenti, G., resistance. Mol. Cell 4, 597–609. Guralnik, J.M., Ferrucci, L., 2007. Association of hormonal dysregulation with Kupelian, V., Page, S.T., Araujo, A.B., Travison, T.G., Bremner, W.J., McKinlay, J.B., metabolic syndrome in older women: data from the InCHIANTI study. Am. J. 2006. Low sex hormone-binding globulin, total testosterone, and symptomatic Physiol. Endocrinol. Metab. 292, E353–E358. androgen deficiency are associated with development of the metabolic Makishima, M., Okamoto, A.Y., Repa, J.J., Tu, H., Learned, R.M., Luk, A., Hull, M.V., syndrome in nonobese men. J. Clin. Endocrinol. Metab. 91, 843–850. Lustig, K.D., Mangelsdorf, D.J., Shan, B., 1999. Identification of a nuclear receptor Laaksonen, D.E., Niskanen, L., Punnonen, K., Nyyssonen, K., Tuomainen, T.P., for bile acids. Science 284, 1362–1365. Valkonen, V.P., Salonen, R., Salonen, J.T., 2004. Testosterone and sex hormone- Manna, P.R., Chandrala, S.P., King, S.R., Jo, Y., Counis, R., Huhtaniemi, I.T., Stocco, binding globulin predict the metabolic syndrome and diabetes in middle-aged D.M., 2006. Molecular mechanisms of insulin-like growth factor-I mediated men. Diabetes Care 27, 1036–1041. regulation of the steroidogenic acute regulatory protein in mouse leydig cells. Laughlin, G.A., Barrett-Connor, E., Bergstrom, J., 2008. Low serum testosterone and Mol. Endocrinol. 20, 362–378. mortality in older men. J. Clin. Endocrinol. Metab. 93, 68–75. Martin, P.G., Guillou, H., Lasserre, F., Dejean, S., Lan, A., Pascussi, J.M., Sancristobal, Lavorgna, G., Karim, F.D., Thummel, C.S., Wu, C., 1993. Potential role for a FTZ-F1 M., Legrand, P., Besse, P., Pineau, T., 2007. Novel aspects of PPARalpha-mediated steroid receptor superfamily member in the control of Drosophila regulation of lipid and xenobiotic metabolism revealed through a nutrigenomic metamorphosis. Proc. Natl. Acad. Sci. USA 90, 3004–3008. study. Hepatology 45, 767–777. Law, G.L., McGuinness, M.P., Linder, C.C., Griswold, M.D., 1997. Expression of Mascaro, C., Nadal, A., Hegardt, F.G., Marrero, P.F., Haro, D., 2000. Contribution of apolipoprotein E mRNA in the epithelium and interstitium of the testis and the steroidogenic factor 1 to the regulation of cholesterol synthesis. Biochem. J. 350 epididymis. J. Androl. 18, 32–42. (Pt 3), 785–790. Lee, S.S., Pineau, T., Drago, J., Lee, E.J., Owens, J.W., Kroetz, D.L., Fernandez-Salguero, Mascrez, B., Mark, M., Dierich, A., Ghyselinck, N.B., Kastner, P., Chambon, P., 1998. P.M., Westphal, H., Gonzalez, F.J., 1995. Targeted disruption of the alpha isoform The RXRalpha ligand-dependent activation function 2 (AF-2) is important for of the peroxisome proliferator-activated receptor gene in mice results in mouse development. Development 125, 4691–4707. abolishment of the pleiotropic effects of peroxisome proliferators. Mol. Cell. Mascrez, B., Ghyselinck, N.B., Watanabe, M., Annicotte, J.S., Chambon, P., Auwerx, J., Biol. 15, 3012–3022. Mark, M., 2004. Ligand-dependent contribution of RXRbeta to cholesterol Lee, Y.K., Choi, Y.H., Chua, S., Park, Y.J., Moore, D.D., 2006. Phosphorylation of the homeostasis in Sertoli cells. EMBO Rep. 5, 285–290. hinge domain of the nuclear hormone receptor LRH-1 stimulates Matsumoto, A.M., 2002. Andropause: clinical implications of the decline in serum transactivation. J. Biol. Chem. 281, 7850–7855. testosterone levels with aging in men. J. Gerontol. A Biol. Sci. Med. Sci. 57, M76– M99. 44 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 Matt, N., Ghyselinck, N.B., Wendling, O., Chambon, P., Mark, M., 2003. Retinoic acid- Peters, J.M., Lee, S.S., Li, W., Ward, J.M., Gavrilova, O., Everett, C., Reitman, M.L., induced developmental defects are mediated by RARbeta/RXR heterodimers in Hudson, L.D., Gonzalez, F.J., 2000. Growth, adipose, brain, and skin alterations the pharyngeal endoderm. Development 130, 2083–2093. resulting from targeted disruption of the mouse peroxisome proliferator- McCabe, E.R., 2007. DAX1: increasing complexity in the roles of this novel nuclear activated receptor beta(delta). Mol. Cell. Biol. 20, 5119–5128. receptor. Mol. Cell. Endocrinol. 265–266, 179–182. Pezzi, V., Sirianni, R., Chimento, A., Maggiolini, M., Bourguiba, S., Delalande, C., Meachem, S.J., Nieschlag, E., Simoni, M., 2001. Inhibin B in male reproduction: Carreau, S., Ando, S., Simpson, E.R., Clyne, C.D., 2004. Differential expression of pathophysiology and clinical relevance. Eur. J. Endocrinol. 145, 561–571. steroidogenic factor-1/adrenal 4 binding protein and liver receptor homolog-1 Meeks, J.J., Russell, T.A., Jeffs, B., Huhtaniemi, I., Weiss, J., Jameson, J.L., 2003. Leydig (LRH-1)/fetoprotein transcription factor in the rat testis: LRH-1 as a potential cell-specific expression of DAX1 improves fertility of the Dax1-deficient mouse. regulator of testicular aromatase expression. Endocrinology 145, 2186–2196. Biol. Reprod. 69, 154–160. Pitteloud, N., Hardin, M., Dwyer, A.A., Valassi, E., Yialamas, M., Elahi, D., Hayes, F.J., Meistrich, M.L., Mohapatra, B., Shirley, C.R., Zhao, M., 2003. Roles of transition 2005. Increasing insulin resistance is associated with a decrease in Leydig cell nuclear proteins in spermiogenesis. Chromosoma 111, 483–488. testosterone secretion in men. J. Clin. Endocrinol. Metab. 90, 2636–2641. Mimeault, C., Woodhouse, A.J., Miao, X.S., Metcalfe, C.D., Moon, T.W., Trudeau, V.L., Plymate, S.R., Jones, R.E., Matej, L.A., Friedl, K.E., 1988. Regulation of sex hormone 2005. The human lipid regulator, gemfibrozil bioconcentrates and reduces binding globulin (SHBG) production in Hep G2 cells by insulin. Steroids 52, testosterone in the goldfish Carassius auratus. Aquat. Toxicol. 73, 44–54. 339–340. Miyata, M., Matsuda, Y., Tsuchiya, H., Kitada, H., Akase, T., Shimada, M., Nagata, K., Pommier, A.J., Alves, G., Viennois, E., Bernard, S., Communal, Y., Sion, B., Marceau, G., Gonzalez, F.J., Yamazoe, Y., 2006. Chenodeoxycholic acid-mediated activation of Damon, C., Mouzat, K., Caira, F., Baron, S., Lobaccaro, J.M., 2010. Liver X Receptor the farnesoid X receptor negatively regulates hydroxysteroid sulfotransferase. activation downregulates AKT survival signaling in lipid rafts and induces Drug Metab. Pharmacokinet. 21, 315–323. apoptosis of prostate cancer cells. Oncogene 29, 2712–2723. Morales, C.R., Marat, A.L., Ni, X., Yu, Y., Oko, R., Smith, B.T., Argraves, W.S., 2008. ATP- Purvis, K., Christiansen, E., 1992. Male infertility: current concepts. Ann. Med. 24, binding cassette transporters ABCA1, ABCA7, and ABCG1 in mouse 259–272. spermatozoa. Biochem. Biophys. Res. Commun. 376, 472–477. Quinn, P., Begley, A.J., 1984. Effect of human seminal plasma and mouse accessory Motamed Khorasani, A., Cheung, A.P., Lee, C.Y., 2000. Cholesterol inhibitory effects gland extracts on mouse fertilization in vitro. Aust. J. Biol. Sci. 37, 147–152. on human sperm-induced acrosome reaction. J. Androl. 21, 586–594. Ramirez-Torres, M.A., Carrera, A., Zambrana, M., 2000. High incidence of Mueller, M., Cima, I., Noti, M., Fuhrer, A., Jakob, S., Dubuquoy, L., Schoonjans, K., hyperestrogenemia and dyslipidemia in a group of infertile men. Ginecol. Brunner, T., 2006. The nuclear receptor LRH-1 critically regulates extra-adrenal Obstet. Mex. 68, 224–229. glucocorticoid synthesis in the intestine. J. Exp. Med. 203, 2057–2062. Rejraji, H., Sion, B., Prensier, G., Carreras, M., Motta, C., Frenoux, J.M., Vericel, E., Niederberger, C., 2005. Atorvastatin and male infertility: is there a link? J. Androl. Grizard, G., Vernet, P., Drevet, J.R., 2006. Lipid remodeling of murine 26, 12. epididymosomes and spermatozoa during epididymal maturation. Biol. Nishigori, H., Tomura, H., Tonooka, N., Kanamori, M., Yamada, S., Sho, K., Inoue, I., Reprod. 74, 1104–1113. Kikuchi, N., Onigata, K., Kojima, I., Kohama, T., Yamagata, K., Yang, Q., Renga, B., Mencarelli, A., D’Amore, C., Cipriani, S., Baldelli, F., Zampella, A., Distrutti, Matsuzawa, Y., Miki, T., Seino, S., Kim, M.Y., Choi, H.S., Lee, Y.K., Moore, D.D., E., Fiorucci, S., 2012. Glucocorticoid receptor mediates the gluconeogenic Takeda, J., 2001. Mutations in the small heterodimer partner gene are activity of the farnesoid X receptor in the fasting condition. FASEB J.. associated with mild obesity in Japanese subjects. Proc. Natl. Acad. Sci. USA Repa, J.J., Mangelsdorf, D.J., 2000. The role of orphan nuclear receptors in the 98, 575–580. regulation of cholesterol homeostasis. Annu. Rev. Cell Dev. Biol. 16, 459–481. Ogden, C.L., Carroll, M.D., Flegal, K.M., 2003. Epidemiologic trends in overweight and Repa, J.J., Mangelsdorf, D.J., 2002. The liver X receptor gene team: potential new obesity. Endocrinol. Metab. Clin. North Am. 32, 741–760, vii. players in atherosclerosis. Nat. Med. 8, 1243–1248. Ortlund, E.A., Lee, Y., Solomon, I.H., Hager, J.M., Safi, R., Choi, Y., Guan, Z., Tripathy, A., Repa, J.J., Berge, K.E., Pomajzl, C., Richardson, J.A., Hobbs, H., Mangelsdorf, D.J., 2002. Raetz, C.R., McDonnell, D.P., Moore, D.D., Redinbo, M.R., 2005. Modulation of Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the human nuclear receptor LRH-1 activity by phospholipids and SHP. Nat. Struct. liver X receptors alpha and beta. J. Biol. Chem. 277, 18793–18800. Mol. Biol. 12, 357–363. Robertson, K.M., O’Donnell, L., Jones, M.E., Meachem, S.J., Boon, W.C., Fisher, C.R., Ouvrier, A., Cadet, R., Vernet, P., Laillet, B., Chardigny, J.M., Lobaccaro, J.M., Drevet, Graves, K.H., McLachlan, R.I., Simpson, E.R., 1999. Impairment of J.R., Saez, F., 2009. LXR and ABCA1 control cholesterol homeostasis in the spermatogenesis in mice lacking a functional aromatase (cyp 19) gene. Proc. proximal mouse epididymis in a cell-specific manner. J. Lipid Res. 50, 1766– Natl. Acad. Sci. USA 96, 7986–7991. 1775. Robertson, K.M., Schuster, G.U., Steffensen, K.R., Hovatta, O., Meaney, S., Hultenby, Ozbay, T., Rowan, A., Leon, A., Patel, P., Sewer, M.B., 2006. Cyclic adenosine 5’- K., Johansson, L.C., Svechnikov, K., Soder, O., Gustafsson, J.A., 2005. The liver X monophosphate-dependent sphingosine-1-phosphate biosynthesis induces receptor-{beta} is essential for maintaining cholesterol homeostasis in the human CYP17 gene transcription by activating cleavage of sterol regulatory testis. Endocrinology 146, 2519–2530. element binding protein 1. Endocrinology 147, 1427–1437. Rosen, E.D., Sarraf, P., Troy, A.E., Bradwin, G., Moore, K., Milstone, D.S., Spiegelman, Padron, R.S., Mas, J., Zamora, R., Riverol, F., Licea, M., Mallea, L., Rodriguez, J., 1989. B.M., Mortensen, R.M., 1999. PPAR gamma is required for the differentiation of Lipids and testicular function. Int. Urol. Nephrol. 21, 515–519. adipose tissue in vivo and in vitro. Mol. Cell 4, 611–617. Park, M.J., Kong, H.J., Kim, H.Y., Kim, H.H., Kim, J.H., Cheong, J.H., 2007. Ruwanpura, S.M., McLachlan, R.I., Meachem, S.J., 2010. Hormonal regulation of male Transcriptional repression of the gluconeogenic gene PEPCK by the orphan germ cell development. J. Endocrinol. 205, 117–131. nuclear receptor SHP through inhibitory interaction with C/EBPalpha. Biochem. Saad, F., 2009. The role of testosterone in type 2 diabetes and metabolic syndrome J. 402, 567–574. in men. Arq. Bras. Endocrinol Metabol. 53, 901–907. Parker, K.L., Rice, D.A., Lala, D.S., Ikeda, Y., Luo, X., Wong, M., Bakke, M., Zhao, L., Saez, J.M., 1994. Leydig cells: endocrine, paracrine, and autocrine regulation. Frigeri, C., Hanley, N.A., Stallings, N., Schimmer, B.P., 2002. Steroidogenic factor Endocr. Rev. 15, 574–626. 1: an essential mediator of endocrine development. Recent Prog. Horm. Res. 57, Saez, F., Chabory, E., Cadet, R., Vernet, P., Baron, S., Lobaccaro, J.M., Drevet, J.R., 2007. 19–36. Liver X receptors and epididymal epithelium physiology. Asian J. Androl. 9, Parton, R.G., Hancock, J.F., 2004. Lipid rafts and plasma membrane 574–582. microorganization: insights from Ras. Trends Cell Biol. 14, 141–147. Saez Lancellotti, T.E., Boarelli, P.V., Monclus, M.A., Cabrillana, M.E., Clementi, M.A., Pasquali, R., Casimirri, F., De Iasio, R., Mesini, P., Boschi, S., Chierici, R., Flamia, R., Espinola, L.S., Cid Barria, J.L., Vincenti, A.E., Santi, A.G., Fornes, M.W., 2010. Biscotti, M., Vicennati, V., 1995. Insulin regulates testosterone and sex Hypercholesterolemia impaired sperm functionality in rabbits. PLoS One 5, hormone-binding globulin concentrations in adult normal weight and obese e13457. men. J. Clin. Endocrinol. Metab. 80, 654–658. Schimmer, B.P., White, P.C., 2010. Minireview: steroidogenic factor 1: its roles in Payne, A.H., Youngblood, G.L., 1995. Regulation of expression of steroidogenic differentiation, development, and disease. Mol. Endocrinol. 24, 1322–1337. enzymes in Leydig cells. Biol. Reprod. 52, 217–225. Schlegel, P.N., Girardi, S.K., 1997. Clinical review 87: In vitro fertilization for male Peet, D.J., Janowski, B.A., Mangelsdorf, D.J., 1998. The LXRs: a new class of oxysterol factor infertility. J. Clin. Endocrinol. Metab. 82, 709–716. receptors. Curr. Opin. Genet. Dev. 8, 571–575. Schteingart, H.F., Meroni, S.B., Canepa, D.F., Pellizzari, E.H., Cigorraga, S.B., 1999. Peet, D.J., Turley, S.D., Ma, W., Janowski, B.A., Lobaccaro, J.M., Hammer, R.E., Effects of basic fibroblast growth factor and nerve growth factor on lactate Mangelsdorf, D.J., 1998. Cholesterol and bile acid metabolism are impaired in production, gamma-glutamyl transpeptidase and aromatase activities in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93, 693–704. cultured Sertoli cells. Eur. J. Endocrinol. 141, 539–545. Pelusi, C., Ikeda, Y., Zubair, M., Parker, K.L., 2008. Impaired follicle development and Schultz, R., Yan, W., Toppari, J., Volkl, A., Gustafsson, J.A., Pelto-Huikko, M., 1999. infertility in female mice lacking steroidogenic factor 1 in ovarian granulosa Expression of peroxisome proliferator-activated receptor alpha messenger cells. Biol. Reprod. 79, 1074–1083. ribonucleic acid and protein in human and rat testis. Endocrinology 140, Pentikainen, V., Erkkila, K., Suomalainen, L., Parvinen, M., Dunkel, L., 2000. Estradiol 2968–2975. acts as a germ cell survival factor in the human testis in vitro. J. Clin. Endocrinol. Sebastiano, C., Vincenzo, F., Tommaso, C., Giuseppe, S., Marco, R., Ivana, C., Giorgio, Metab. 85, 2057–2067. R., Massimo, M., Giuseppe, M., 2012. Dietary patterns and prostatic diseases. Perrard, M.H., Durand, P., 2009. Redundancy of the effect of TGFbeta1 and beta-NGF Front. Biosci. (Elite Ed) 4, 195–204. on the second meiotic division of rat spermatocytes. Microsc. Res. Tech. 72, Sekido, R., Lovell-Badge, R., 2008. Sex determination involves synergistic action of 596–602. SRY and SF1 on a specific Sox9 enhancer. Nature 453, 930–934. Perri, M., Pingitore, A., Cione, E., Vilardi, E., Perrone, V., Genchi, G., 2010. Proliferative Selva, D.M., Hirsch-Reinshagen, V., Burgess, B., Zhou, S., Chan, J., McIsaac, S., Hayden, and anti-proliferative effects of retinoic acid at doses similar to endogenous M.R., Hammond, G.L., Vogl, A.W., Wellington, C.L., 2004. The ATP-binding levels in Leydig MLTC-1/R2C/TM-3 cells. Biochim. Biophys. Acta 1800, 993– cassette transporter 1 mediates lipid efflux from Sertoli cells and influences 1001. male fertility. J. Lipid Res. 45, 1040–1050. S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 45 Seol, W., Choi, H.S., Moore, D.D., 1996. An orphan nuclear hormone receptor that Tajima, K., Yoshii, K., Fukuda, S., Orisaka, M., Miyamoto, K., Amsterdam, A., Kotsuji, lacks a DNA binding domain and heterodimerizes with other receptors. Science F., 2005. Luteinizing hormone-induced extracellular-signal regulated kinase 272, 1336–1339. activation differently modulates progesterone and androstenedione production Setchell, B.P., 2008. Blood-testis barrier, junctional and transport proteins and in bovine theca cells. Endocrinology 146, 2903–2910. spermatogenesis. Adv. Exp. Med. Biol. 636, 212–233. Tamai, K.T., Monaco, L., Alastalo, T.P., Lalli, E., Parvinen, M., Sassone-Corsi, P., 1996. Shalaby, M.A., el-Zorba, H.Y., Kamel, G.M., 2004. Effect of alpha-tocopherol and Hormonal and developmental regulation of DAX-1 expression in Sertoli cells. simvastatin on male fertility in hypercholesterolemic rats. Pharmacol. Res. 50, Mol. Endocrinol. 10, 1561–1569. 137–142. Tapanainen, J.S., Aittomaki, K., Min, J., Vaskivuo, T., Huhtaniemi, I.T., 1997. Men Sharpe, R.M., Kerr, J.B., McKinnell, C., Millar, M., 1994. Temporal relationship homozygous for an inactivating mutation of the follicle-stimulating hormone between androgen-dependent changes in the volume of seminiferous tubule (FSH) receptor gene present variable suppression of spermatogenesis and fluid, lumen size and seminiferous tubule protein secretion in rats. J. Reprod. fertility. Nat. Genet. 15, 205–206. Fertil. 101, 193–198. Thomas, K., Sung, D.Y., Chen, X., Thompson, W., Chen, Y.E., McCarrey, J., Walker, W., Sharpe, R.M., McKinnell, C., Kivlin, C., Fisher, J.S., 2003. Proliferation and functional Griswold, M., 2011. Developmental patterns of PPAR and RXR gene expression maturation of Sertoli cells, and their relevance to disorders of testis function in during spermatogenesis. Front. Biosci. (Elite Ed) 3, 1209–1220. adulthood. Reproduction 125, 769–784. Tontonoz, P., Hu, E., Spiegelman, B.M., 1994. Stimulation of adipogenesis in Shea-Eaton, W.K., Trinidad, M.J., Lopez, D., Nackley, A., McLean, M.P., 2001. Sterol fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79, regulatory element binding protein-1a regulation of the steroidogenic acute 1147–1156. regulatory protein gene. Endocrinology 142, 1525–1533. Trauner, M., Claudel, T., Fickert, P., Moustafa, T., Wagner, M., 2010. Bile acids as Sheweita, S.A., Tilmisany, A.M., Al-Sawaf, H., 2005. Mechanisms of male infertility: regulators of hepatic lipid and glucose metabolism. Dig. Dis. 28, 220–224. role of antioxidants. Curr. Drug Metab. 6, 495–501. Travis, A.J., Kopf, G.S., 2002. The role of cholesterol efflux in regulating the Shiraishi, K., Matsuyama, H., 2012. Local expression of epidermal growth factor-like fertilization potential of mammalian spermatozoa. J. Clin. Invest. 110, 731–736. growth factors in human testis and its role in spermatogenesis. J. Androl. 33, Tucci, P., Cione, E., Perri, M., Genchi, G., 2008. All-trans-retinoic acid induces 66–73. apoptosis in Leydig cells via activation of the mitochondrial death pathway and Sierens, J., Jakody, I., Poobalan, Y., Meachem, S.J., Knower, K., Young, M.J., Sirianni, R., antioxidant enzyme regulation. J. Bioenerg. Biomembr. 40, 315–323. Pezzi, V., Clyne, C.D., 2010. Localization and regulation of aromatase liver Vacca, M., Degirolamo, C., Mariani-Costantini, R., Palasciano, G., Moschetta, A., 2011. receptor homologue-1 in the developing rat testis. Mol. Cell. Endocrinol. 323, Lipid-sensing nuclear receptors in the pathophysiology and treatment of the 307–313. metabolic syndrome. Wiley Interdiscip. Rev. Syst. Biol. Med. 3, 562–587. Sikka, S.C., Wang, R., 2008. Endocrine disruptors and estrogenic effects on male Val, P., Martinez-Barbera, J.P., Swain, A., 2007. Adrenal development is initiated by reproductive axis. Asian J. Androl. 10, 134–145. Cited2 and Wt1 through modulation of Sf-1 dosage. Development 134, 2349– Simoni, M., Weinbauer, G.F., Gromoll, J., Nieschlag, E., 1999. Role of FSH in male 2358. gonadal function. Ann. Endocrinol. (Paris) 60, 102–106. Valledor, A.F., 2005. The innate immune response under the control of the LXR Simons, K., Ikonen, E., 2000. How cells handle cholesterol. Science 290, 1721–1726. pathway. Immunobiology 210, 127–132. Sinal, C.J., Tohkin, M., Miyata, M., Ward, J.M., Lambert, G., Gonzalez, F.J., 2000. Velasco-Santamaria, Y.M., Korsgaard, B., Madsen, S.S., Bjerregaard, P., 2011. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid Bezafibrate, a lipid-lowering pharmaceutical, as a potential endocrine homeostasis. Cell 102, 731–744. disruptor in male zebrafish (Danio rerio). Aquat. Toxicol. 105, 107–118. Sirianni, R., Seely, J.B., Attia, G., Stocco, D.M., Carr, B.R., Pezzi, V., Rainey, W.E., 2002. Venkateswaran, A., Laffitte, B.A., Joseph, S.B., Mak, P.A., Wilpitz, D.C., Edwards, P.A., Liver receptor homologue-1 is expressed in human steroidogenic tissues and Tontonoz, P., 2000a. Control of cellular cholesterol efflux by the nuclear activates transcription of genes encoding steroidogenic enzymes. J. Endocrinol. oxysterol receptor LXR alpha. Proc. Natl. Acad. Sci. USA 97, 12097–12102. 174, R13–R17. Venkateswaran, A., Repa, J.J., Lobaccaro, J.M., Bronson, A., Mangelsdorf, D.J., Skakkebaek, N.E., Rajpert-De Meyts, E., Main, K.M., 2001. Testicular dysgenesis Edwards, P.A., 2000b. Human white/murine ABC8 mRNA levels are highly syndrome: an increasingly common developmental disorder with induced in lipid-loaded macrophages. A transcriptional role for specific environmental aspects. Hum. Reprod. 16, 972–978. oxysterols. J. Biol. Chem. 275, 14700–14707. Skakkebaek, N.E., Jorgensen, N., Main, K.M., Rajpert-De Meyts, E., Leffers, H., Verhoeven, G., 1992. Local control systems within the testis. Baillieres Clin. Andersson, A.M., Juul, A., Carlsen, E., Mortensen, G.K., Jensen, T.K., Toppari, J., Endocrinol. Metab. 6, 313–333. 2006. Is human fecundity declining? Int. J. Androl. 29, 2–11. Verhoeven, G., 2005. A Sertoli cell-specific knock-out of the androgen receptor. Skinner, M.K., 1991. Cell–cell interactions in the testis. Endocr. Rev. 12, 45–77. Andrologia 37, 207–208. Smith, M.R., Lee, H., Nathan, D.M., 2006. Insulin sensitivity during combined Verhoeven, G., Willems, A., Denolet, E., Swinnen, J.V., De Gendt, K., 2010. Androgens androgen blockade for prostate cancer. J. Clin. Endocrinol. Metab. 91, 1305– and spermatogenesis: lessons from transgenic mouse models. Philos. Trans. R. 1308. Soc. Lond. B Biol. Sci. 365, 1537–1556. Song, G., Park, K., Wang, L., 2009. Gene expression profiling reveals a diverse array of Vermeulen, A., 1996. Decreased androgen levels and obesity in men. Ann. Med. 28, pathways inhibited by nuclear receptor SHP during adipogenesis. Int. J. Clin. 13–15. Exp. Pathol. 2, 275–285. Vermeulen, A., 2000. Senile hypogonadism in man and hormone replacement Steffensen, K.R., Gustafsson, J.A., 2004. Putative metabolic effects of the liver X therapy. Acta Med. Austriaca 27, 11–17. receptor (LXR). Diabetes 53 (Suppl 1), S36–S42. Vernet, N., Dennefeld, C., Rochette-Egly, C., Oulad-Abdelghani, M., Chambon, P., Stocco, D.M., Sodeman, T.C., 1991. The 30-kDa mitochondrial proteins induced by Ghyselinck, N.B., Mark, M., 2006. Retinoic acid metabolism and signaling hormone stimulation in MA-10 mouse Leydig tumor cells are processed from pathways in the adult and developing mouse testis. Endocrinology 147, 96–110. larger precursors. J. Biol. Chem. 266, 19731–19738. Vernet, N., Dennefeld, C., Klopfenstein, M., Ruiz, A., Bok, D., Ghyselinck, N.B., Mark, Stocco, D.M., Wang, X., Jo, Y., Manna, P.R., 2005. Multiple signaling pathways M., 2008. Retinoid X receptor beta (RXRB) expression in Sertoli cells controls regulating steroidogenesis and steroidogenic acute regulatory protein cholesterol homeostasis and spermiation. Reproduction 136, 619–626. expression: more complicated than we thought. Mol. Endocrinol. 19, 2647– Viennois, E., Pommier, A.J., Mouzat, K., Oumeddour, A., El Hajjaji, F.Z., Dufour, J., 2659. Caira, F., Volle, D.H., Baron, S., Lobaccaro, J.M., 2011. Targeting liver X receptors Strain, G.W., Zumoff, B., Kream, J., Strain, J.J., Deucher, R., Rosenfeld, R.S., Levin, J., in human health: deadlock or promising trail? Expert Opin. Ther. Targets 15, Fukushima, D.K., 1982. Mild Hypogonadotropic hypogonadism in obese men. 219–232. Metabolism 31, 871–875. Viennois, E., Esposito, T., Dufour, J., Pommier, A., Fabre, S., Kemeny, J.L., Guy, L., Streicher, R., Kotzka, J., Muller-Wieland, D., Siemeister, G., Munck, M., Avci, H., Morel, L., Lobaccaro, J.M., Baron, S., 2012. Lxralpha Regulates the Androgen Krone, W., 1996. SREBP-1 mediates activation of the low density lipoprotein Response in Prostate Epithelium. Endocrinology. receptor promoter by insulin and insulin-like growth factor-I. J. Biol. Chem. 271, Vilain, E., McCabe, E.R., 1998. Mammalian sex determination: from gonads to brain. 7128–7133. Mol. Genet. Metab. 65, 74–84. Sultan, C., Lobaccaro, J.M., Belon, C., Terraza, A., Lumbroso, S., 1992. Molecular Vivat, V., Zechel, C., Wurtz, J.M., Bourguet, W., Kagechika, H., Umemiya, H., Shudo, biology of disorders of sex differentiation. Horm. Res. 38, 105–113. K., Moras, D., Gronemeyer, H., Chambon, P., 1997. A mutation mimicking ligand- Sultan, C., Lumbroso, S., Poujol, N., Belon, C., Boudon, C., Lobaccaro, J.M., 1993. induced conformational change yields a constitutive RXR that senses allosteric Mutations of androgen receptor gene in androgen insensitivity syndromes. J. effects in heterodimers. EMBO J. 16, 5697–5709. Steroid Biochem. Mol. Biol. 46, 519–530. Volle, D.H., Lobaccaro, J.M., 2007a. Role of the nuclear receptors for oxysterols LXRs Suzuki, T., Kasahara, M., Yoshioka, H., Morohashi, K., Umesono, K., 2003. LXXLL- in steroidogenic tissues: beyond the ‘‘foie gras’’, the steroids and sex? Mol. Cell. related motifs in Dax-1 have target specificity for the orphan nuclear receptors Endocrinol. 265–266, 183–189. Ad4BP/SF-1 and LRH-1. Mol. Cell. Biol. 23, 238–249. Volle, D.H., Mouzat, K., Duggavathi, R., Siddeek, B., Dechelotte, P., Sion, B., Veyssiere, Swales, K.E., Korbonits, M., Carpenter, R., Walsh, D.T., Warner, T.D., Bishop-Bailey, G., Benahmed, M., Lobaccaro, J.M., 2007b. Multiple roles of the nuclear receptors D., 2006. The farnesoid X receptor is expressed in breast cancer and regulates for oxysterols liver X receptor to maintain male fertility. Mol. Endocrinol. 21, apoptosis and aromatase expression. Cancer Res. 66, 10120–10126. 1014–1027. Swinnen, J.V., Brusselmans, K., Verhoeven, G., 2006. Increased lipogenesis in cancer Volle, D.H., Duggavathi, R., Magnier, B.C., Houten, S.M., Cummins, C.L., Lobaccaro, cells: new players, novel targets. Curr. Opin. Clin. Nutr. Metab. Care. 9, 358–365. J.M., Verhoeven, G., Schoonjans, K., Auwerx, J., 2007c. The small heterodimer Tabbi-Anneni, I., Cooksey, R., Gunda, V., Liu, S., Mueller, A., Song, G., McClain, D.A., partner is a gonadal gatekeeper of sexual maturation in male mice. Gene Dev. Wang, L., 2010. Overexpression of nuclear receptor SHP in adipose tissues 21, 303–315. affects diet-induced obesity and adaptive thermogenesis. Am. J. Physiol. Volle, D.H., Decourteix, M., Garo, E., McNeilly, J., Fenichel, P., Auwerx, J., McNeilly, Endocrinol. Metab. 298, E961–E970. A.S., Schoonjans, K., Benahmed, M., 2009. The orphan nuclear receptor small 46 S. Maqdasy et al. / Molecular and Cellular Endocrinology 368 (2013) 30–46 heterodimer partner mediates male infertility induced by diethylstilbestrol in Small molecule agonists of the orphan nuclear receptors steroidogenic factor-1 mice. J. Clin. Invest. 119, 3752–3764. (SF-1, NR5A1) and liver receptor homologue-1 (LRH-1, NR5A2). J. Med. Chem. Walsh, T.J., Croughan, M.S., Schembri, M., Chan, J.M., Turek, P.J., 2009. Increased risk 54, 2266–2281. of testicular germ cell cancer among infertile men. Arch. Intern. Med. 169, 351– Yamagata, K., Daitoku, H., Shimamoto, Y., Matsuzaki, H., Hirota, K., Ishida, J., 356. Fukamizu, A., 2004. Bile acids regulate gluconeogenic gene expression via small Wang, H., Chen, J., Hollister, K., Sowers, L.C., Forman, B.M., 1999. Endogenous bile heterodimer partner-mediated repression of hepatocyte nuclear factor 4 and acids are ligands for the nuclear receptor FXR/BAR. Mol. Cell 3, 543–553. Foxo1. J. Biol. Chem. 279, 23158–23165. Wang, Z.J., Jeffs, B., Ito, M., Achermann, J.C., Yu, R.N., Hales, D.B., Jameson, J.L., 2001a. Yanagimachi, R., 1994. Fertility of mammalian spermatozoa: its development and Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1. relativity. Zygote 2, 371–372. Proc. Natl. Acad. Sci. USA 98, 7988–7993. Yang, F.M., Pan, C.T., Tsai, H.M., Chiu, T.W., Wu, M.L., Hu, M.C., 2009. Liver receptor Wang, Z.N., Bassett, M., Rainey, W.E., 2001b. Liver receptor homologue-1 is homolog-1 localization in the nuclear body is regulated by sumoylation and expressed in the adrenal and can regulate transcription of 11 beta- cAMP signaling in rat granulosa cells. FEBS J. 276, 425–436. hydroxylase. J. Mol. Endocrinol. 27, 255–258. Yefimova, M.G., Sow, A., Fontaine, I., Guilleminot, V., Martinat, N., Crepieux, P., Wang, W., Zhang, C., Marimuthu, A., Krupka, H.I., Tabrizizad, M., Shelloe, R., Mehra, Canepa, S., Maurel, M.C., Fouchecourt, S., Reiter, E., Benzakour, O., Guillou, F., U., Eng, K., Nguyen, H., Settachatgul, C., Powell, B., Milburn, M.V., West, B.L., 2008. Dimeric transferrin inhibits phagocytosis of residual bodies by testicular 2005a. The crystal structures of human steroidogenic factor-1 and liver receptor rat Sertoli cells. Biol. Reprod. 78, 697–704. homologue-1. Proc. Natl. Acad. Sci. USA 102, 7505–7510. Yokoyama, S., 2000. Release of cellular cholesterol: molecular mechanism for Wang, X., Shen, C.L., Dyson, M.T., Eimerl, S., Orly, J., Hutson, J.C., Stocco, D.M., 2005b. cholesterol homeostasis in cells and in the body. Biochim. Biophys. Acta 1529, Cyclooxygenase-2 regulation of the age-related decline in testosterone 231–244. biosynthesis. Endocrinology 146, 4202–4208. Yoshida, S., 2010. Stem cells in mammalian spermatogenesis. Dev. Growth Differ. Wang, L., Huang, J., Saha, P., Kulkarni, R.N., Hu, M., Kim, Y., Park, K., Chan, L., 52, 311–317. Rajan, A.S., Lee, I., Moore, D.D., 2006a. Orphan receptor small heterodimer Yu, R.N., Ito, M., Saunders, T.L., Camper, S.A., Jameson, J.L., 1998. Role of Ahch in partner is an important mediator of glucose homeostasis. Mol. Endocrinol. 20, gonadal development and gametogenesis. Nat. Genet. 20, 353–357. 2671–2681. Zanaria, E., Muscatelli, F., Bardoni, B., Strom, T.M., Guioli, S., Guo, W., Lalli, E., Moser, Wang, S., Lai, K., Moy, F.J., Bhat, A., Hartman, H.B., Evans, M.J., 2006b. The nuclear C., Walker, A.P., McCabe, E.R., et al., 1994. An unusual member of the nuclear hormone receptor farnesoid X receptor (FXR) is activated by androsterone. hormone receptor superfamily responsible for X-linked adrenal hypoplasia Endocrinology 147, 4025–4033. congenita. Nature 372, 635–641. Wang, G., Weng, C.C., Shao, S.H., Zhou, W., de Gendt, K., Braun, R.E., Verhoeven, G., Zeng, L., Liao, H., Liu, Y., Lee, T.S., Zhu, M., Wang, X., Stemerman, M.B., Zhu, Y., Shyy, Meistrich, M.L., 2009a. Androgen receptor in Sertoli cells is not required for J.Y., 2004. Sterol-responsive element-binding protein (SREBP) 2 down-regulates testosterone-induced suppression of spermatogenesis, but contributes to ATP-binding cassette transporter A1 in vascular endothelial cells: a novel role of Sertoli cell organization in Utp14b jsd mice. J. Androl. 30, 338–348. SREBP in regulating cholesterol metabolism. J. Biol. Chem. 279, 48801–48807. Wang, R.S., Yeh, S., Tzeng, C.R., Chang, C., 2009b. Androgen receptor roles in Zhang, Y., Breevoort, S.R., Angdisen, J., Fu, M., Schmidt, D.R., Holmstrom, S.R., spermatogenesis and fertility: lessons from testicular cell-specific androgen Kliewer, S.A., Mangelsdorf, D.J., Schulman, I.G., 2012. Liver LXRalpha expression receptor knockout mice. Endocr. Rev. 30, 119–132. is crucial for whole body cholesterol homeostasis and reverse cholesterol Watanabe, M., Houten, S.M., Wang, L., Moschetta, A., Mangelsdorf, D.J., Heyman, transport in mice. J. Clin. Invest. 122, 1688–1699. R.A., Moore, D.D., Auwerx, J., 2004. Bile acids lower triglyceride levels via a Zhao, L., Bakke, M., Krimkevich, Y., Cushman, L.J., Parlow, A.F., Camper, S.A., Parker, pathway involving FXR, SHP, and SREBP-1c. J. Clin. Invest. 113, 1408–1418. K.L., 2001a. Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope Wathes, D.C., Abayasekara, D.R., Aitken, R.J., 2007. Polyunsaturated fatty acids in function. Development 128, 147–154. male and female reproduction. Biol. Reprod. 77, 190–201. Zhao, L., Bakke, M., Parker, K.L., 2001b. Pituitary-specific knockout of steroidogenic Wei, D., Tao, R., Zhang, Y., White, M.F., Dong, X.C., 2011. Feedback regulation of factor 1. Mol. Cell. Endocrinol. 185, 27–32. hepatic gluconeogenesis through modulation of SHP/Nr0b2 gene expression by Zhu, R., Ou, Z., Ruan, X., Gong, J., 2012. Role of liver X receptors in cholesterol efflux Sirt1 and FoxO1. Am. J. Physiol. Endocrinol. Metab. 300, E312–E320. and inflammatory signaling (review). Mol. Med. Report. 5, 895–900. Whitby, R.J., Stec, J., Blind, R.D., Dixon, S., Leesnitzer, L.M., Orband-Miller, L.A., Ziglioli, F., Maestroni, U., Dinale, F., Ciuffreda, M., Cortellini, P., 2011. Carcinoma Williams, S.P., Willson, T.M., Xu, R., Zuercher, W.J., Cai, F., Ingraham, H.A., 2011. in situ (CIS) of the testis. Acta Biomed. 82, 162–169. ! ! "#$$%&'&()*+,!*+)-.%&/! ! ! ! ! ! ! ! "#$$%&'&()*+,!*+)-.%&/! ! ! ! ! ! ! ! ! ! 01! ! ! ! ! ! ! ! Biochemical and Biophysical Research Communications 446 (2014) 656–662 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc Liver X receptors interfere with the deleterious effect of diethylstilbestrol on testicular physiology Abdelkader Oumeddour a,b,c,d,e, Emilie Viennois a,b,c,d, Françoise Caira a,b,c,d, Clélia Decourbey a,b,c,d, a,b,c,d,f e a,b,c,d a,b,c,d, Salwan Maqdasy , Abdelkrim Tahraoui , Silvère Baron , David H. Volle , a,b,c,d, Jean-Marc A. Lobaccaro  a Clermont Université, Université Blaise Pascal, Génétique Reproduction et Développement, BP 10448, F-63000 Clermont-Ferrand, France b CNRS, UMR 6293, GReD, F-63171 Aubiere, France c INSERM, UMR 1103, GReD, F-63171 Aubiere, France d Centre de Recherche en Nutrition Humaine d’Auvergne, F-63000 Clermont-Ferrand, France e Laboratoire de Neuroendocrinologie Appliquée, Université Badji Mokhtar Annaba, BP12, 23000 Annaba, Algeria f Service d’endocrinologie, diabétologie et maladies métaboliques, CHU Clermont-Ferrand, F-63003 Clermont-Ferrand, France article info abstract Article history: Liver X receptors LXRa (NR1H3) and LXRb (NR1H2) are transcription factors belonging to the nuclear Received 22 November 2013 receptor superfamily, activated by specific oxysterols, oxidized derivatives of cholesterol. These receptors Available online 11 December 2013 are involved in the regulation of testis physiology. Lxr-deficient mice pointed to the physiological roles of these nuclear receptors in steroid synthesis, lipid homeostasis and germ cell apoptosis and proliferation. Keywords: Diethylstilbestrol (DES) is a synthetic estrogen considered as an endocrine disruptor that affects the func- Diethylstilbestrol tions of the testis. Various lines of evidences have made a clear link between estrogens, their nuclear LXR receptors ERa (NR3A1) and ERb (NR3A2), and Lxra/b. As LXR activity could also be regulated by the Nuclear receptors nuclear receptor small heterodimer partner (SHP, NR0A2) and DES could act through SHP, we wondered Testis Germ cells whether LXR could be targeted by estrogen-like endocrine disruptors such as DES. For that purpose, wild- type and Lxr-deficient mice were daily treated with 0.75 lg DES from days 1 to 5 after birth. The effects of DES were investigated at 10 or 45 days of age. We demonstrated that DES induced a decrease of the body mass at 10 days only in the Lxr-deficient mice suggesting a protective effect of Lxr. We defined three cat- egories of DES-target genes in testis: those whose accumulation is independent of Lxr; those whose accu- mulation is enhanced by the lack of both Lxra/b; those whose accumulation is repressed by the absence of Lxra/b. Lipid accumulation is also modified by neonatal DES injection. Lxr-deficient mice present dif- ferent lipid profiles, demonstrating that DES could have its effects in part due to Lxra/b. Altogether, our study shows that both nuclear receptors Lxra and Lxrb are not only basally important for testicular phys- iology but could also have a preventive effect against estrogen-like endocrine disruptors.  2013 Elsevier Inc. All rights reserved. 1. Introduction cholesterol homeostasis; Lxra/b are hence considered as intracel- lular cholesterol sensors whose activation leads to decreased plas- The nuclear receptors LXRa (NR1H3) [1] and LXRb (NR1H2) ma cholesterol. Beyond cholesterol homeostasis, they modulate [2,3] were first described in the mid 90’ in the liver as orphan numerous physiological functions such as fatty acid synthesis, lipid receptors. David Mangelsdorf’s group ‘‘deorphanized’’ them [4] metabolism, glucose homeostasis, steroidogenesis, immunity, and and oxidized or hydroxylated metabolites of cholesterol known neurological homeostasis. Lxra/b are also involved in the control as oxysterols have been described to be the bona fide ligands of reproductive functions in both females [11,12] and males (for [5,6]. Their putative association with human diseases makes them a review see [13]). Indeed, deficient mice for both isoforms become promising pharmacological targets [7,8]. First in vivo analyses of infertile during aging [14,15]. Several functions have been associ- Lxr-deficient mice [9,10] pointed out their pivotal roles in ated with both Lxr isoforms in mouse testis. Lxra regulates steroid synthesis by Leydig cells through transcriptionally enhancing Star Corresponding authors at: Clermont Université, Université Blaise Pascal, and Cyp11a1, respectively encoding the steroidogenic acute regula-  Génétique Reproduction et Développement, BP 10448, F-63000 Clermont-Ferrand, tory (StAR) protein whose function is to translocate cholesterol France. from the outer to the inner mitochondrial membrane in steroido- E-mail addresses: [email protected] (D.H. Volle), j-marc.lobaccaro@ genic cells [16] and the cholesterol side-chain cleavage enzyme univ-bpclermont.fr (J.-M.A. Lobaccaro). 0006-291X/$ - see front matter  2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.bbrc.2013.12.005 !"#$%%&"'($)(*+,(-..$/)(&.(0-1(&2(34'565()$7)87,(9( ( Supplementary data Figure S1. Representative pictures of eosin/hematoxylin stained testis of 45 day of age. Testes were collected, fixed, and embedded in paraffin, and 4- to 6-!m-thick sections were prepared and stained with hematoxylin/eosin. Magnification x 20. Wild-type / oil Wild-type / DES Lxr-/- / oil Lxr-/- / DES A. Oumeddour et al. / Biochemical and Biophysical Research Communications 446 (2014) 656–662 657 that catalyzes conversion of cholesterol to pregnenolone [15]. Table 1 Lxra-deficient mice also present an increased apoptosis of the qPCR primer sequences used for qPCR analyses. germ cells. Next to this, Lxrb has been identified in Sertoli cells Gene Sequence as a major sensor of lipid homeostasis. Moreover Lxrb-deficient 18S fw GGGAGCCTGAGAAACGGC mice show lower germ cell proliferation [15]. These data define rev GGGTCGGGAGTGGGTAATTTT the Lxra/b as key factors to control testicular integrity and func- Lxra/nr1h3 fw TGCCATCAGCATCTTCTCTG tions [13]. rev GGCTCACCAGCTTCATTAGC Lxr /nr1h2 fw CGCTACAACCACGAGACAGA The incidence of male fertility disorders is constantly increasing b rev TGTTGATGGCGATAAGCAAG [17,18] since the 60’s as proven by studies on semen quality per- Era/nr3a1 fw CATATGATCAACTGGGCAAAGA formed on men from the Nordic countries, Germany, France, UK rev ACTCCGGAATTAAGCAAAATGA and the Baltic countries, as well as from Japan and the USA. This Erb/nr3a2 fw TCTTTGCTCCAGACCTCGTT has been linked to multiple factors [19]. Among these, endocrine rev CCAGGAACTTGAGACATACAAACTC Lrh1/nr5a2 fw CTCTTGATTCTCGATCACATTTACC disruptors have been suspected to be involved [20]. These com- rev CCAGGAACTTGAGACATACAAACTC pounds have either estrogenic or anti-androgenic activities. Dieth- Shp/nr0b2 fw CGATCCTCTTCAACCCAGATG ylstilbestrol (DES) is a synthetic estrogen that has been prescribed rev AGGGCTCCAAGACTTCACACA for 30 years until the 70’s to pregnant women to prevent abortions CyclinA1 fw GATGTGTATGAAGTCGACACC rev GTGGGGTCAACCAGCATTGG and pregnancy complications. DES was banned from reproductive CyclinA2 fw CAAGGAGTGTGTGCATCAGGACT medication after it was proved to increase the incidence of cancer rev CTGGCCAGAAGTGTCTGTTC clear-cell adenocarcinoma of the vagina in pubertal girls who were CyclinB2 fw CTGGCCAGAAGTGTCTGTTC exposed in utero [21] and cryptorchidism and abnormalities in the rev TTTCTCGGATTTGGGAACTG urogenital tract of boys [22]. This synthetic estrogen is hence con- CyclinD1 fw TCTCCTGCTACCGCACAAC rev TTCCTCCACTTCCCCCTC sidered as an endocrine disruptor that affects the functions of the CyclinD2 fw TCCCGCAGTGTTCCTATTTC testis. Interestingly, several types of evidences have linked the rev TCCCGCAGTGTTCCTATTTC estrogens, their nuclear receptors ERa (NR3A1) and ERb (NR3A2), Stra8 fw GTTTCCTGCGTGTTCCACAAG and Lxra/b [23–26]. rev CACCCGAGGCTCAAGCTTC Oct3 fw AAGTTGGAGAAGGTGGAACC Based on that, we hypothesized that Lxr /b could be in part in- a rev CTTCCTGCCACTTTTGGAAC volved in the deleterious impact of estrogenic endocrine disruptors abca1 fw CGTTTCCGGGAAGTGTCCTA on testicular physiology. To analyze whether such a link exists, we rev GCTAGAGATGACAAGGAGGAGGA neonatally treated wild-type or Lxr-deficient mice with a low dose Star fw TGTCAAGGAGATCAAGGTCCTG of DES and measured the body and testis masses, as well as accu- rev CGATAGGACCTGGTTGATGAT cyp11a fw CTGCCTCCAGACTTCTTTCG mulation of lipids and DES-affected genes. rev TTCTTGAAGGGCAGCTTGTT 3bhsd3 fw ATGGTCTGCCTGGGAATGAC rev ACTGCAGGAGGTCAGAGCT 2. Materials and methods cyp17 fw CCAGGACCCAAGTGTGTTCT rev CCTGATACGAAGCACTTCTCG 2.1. Animals Cyp19 fw CGGAAGAATGCACAGGCTCGAG rev CGATGTACTTCCCAGCACAGC The Lxr-deficient mice (Lxr / ) were previously described [15], Insl3 fw ACTGATGCTCCTGGCTCTGG   rev GGAGATGTCTCTGCTCTAGC maintained on a mixed background (C57BL/129sv) and housed in a Lhr fw AGCTAATGCCTTTGACAACC temperature-controlled room with 12-h light, 12-h dark cycles. rev GATGGACTCATTATTCATCC Mice were fed ad libitum with water and Global-diet 2016S from Fshr fw GTGCTCACCAAGCTTCGAGTCAT Harlan (Gannat, France). Mice were daily injected subcutaneously rev AAGGCCTCAGGGTTGATGTACAG from days 1 to 5 after birth with 0.75 lg diethylstilbestrol (DES, Fw, forward primer; rev, reverse primer. Sequences are given 50 ? 30. Sigma–Aldrich, L’Isle D’Abeau, France) diluted in 25 ll of corn oil as previously described [27]. At day 10 or day 45, mice were eutha- Quantitative PCR experiments were performed as previously nized by decapitation less than 1.5 h after the beginning of the described [15]. 18S was used as housekeeping gene. light cycle and bled before tissue collection. All aspects of animal care were approved by the Regional Ethics Committee (authoriza- 2.4. TUNEL analysis tion CE2-04). TUNEL experiment was performed as described previously [27] 2.2. Histology on 5 lm of testis fixed in 4% PFA. Briefly 5-lm-thick paraffin- embedded sections were deparaffined with toluol followed by rehy- Hematoxylin/eosin staining was performed as described previ- dratation. The slides of each group were incubated for 5 min in ously [27]. Testes from 10- or 45-days-old mice were collected, unmasking buffer (citrate acetate 1.8 mM, sodium citrate 8.2 mM, fixed with 4% paraformaldehyde and embedded in paraffin, and pH 6.0) at 86 C. Then the slides were incubated with 0.3 U/ll termi- 5 lm-thick sections were prepared and stained with hematoxy- nal deoxynucleotidyl transferase (Euromedex, Mundolsheim, lin/eosin (Supplementary data 1). France), 6.7 mM biotin-11-dUTP (Euromedex), and 26.7 mM dATP (Promega, Charbonnières, France) in terminal deoxynucleotidyl 2.3. Real-time PCR transferase buffer 1 h at 37 C. Counterstain was performed with Mayer’s hematoxylin solution (Sigma–Aldrich) for 30 s. In each Following testis RNA extraction (TRIzol; Invitrogen, Cergy- testis, at least 100 random seminiferous tubules were counted. Pontoise, France) and cDNA synthesis (SuperScript II First-Strand Synthesis System; Fisher Scientific, Illkirch, France), real-time 2.5. Ki67 staining PCR measurement of individual cDNAs was performed using SYBR green dye to measure duplex DNA formation. Primer sequences are Five-micrometer cryosections of testis were fixed 10 min in 4% shown in Table 1. Results were analyzed using the DDCt method. paraformaldehyde. Slides were incubated with anti Ki67 1/500 658 A. Oumeddour et al. / Biochemical and Biophysical Research Communications 446 (2014) 656–662 (Tebu-bio, Le Perray en Yvelines, France) overnight at 4 C and then 3. Results washed three times in 1 PBS. Slides were incubated for 1 h at  room temperature with a goat antirabbit secondary antibody la- As the activity of DES on testis function has been extensively beled with Alexa 488 (1/250; from Invitrogen). In each testis, at studied and the effects reported in numerous articles ([27]; for a least 100 random seminiferous tubules were counted. review see [28]), and in order to clarify the role of the nuclear receptors Lxra/b in the development of these phenotypes, we chose to compare the effect of DES vs. oil treatments in each 2.6. Lipid analysis studied genotype. Lipids were extracted as described previously [15]. High-perfor- mance thin-layer chromatography plates (Silica gel 60; Merck) 3.1. Neonatal treatment with DES decreases body mass and testis were used after being prewashed with a mixture of methanol/chlo- somatic index of LXR deficient-mice at 10 days roform (1:1, vol/vol) followed by heating at 125 C for 5 min. Plates were then developed with hexane, diethylether, and glacial acetic Neonatal DES treatment has been known to alter adult body acid (80:20:2, vol/vol) and analyzed by densitometry (Sigma Scan mass [29], as shown by the significant decreased body weights at Pro; Sigma–Aldrich) using standards. 45 days for wild-type and Lxr / mice (Fig. 1A, left panel) demon-   strating the efficient effect of DES. Interestingly, at 10 days, a sig- nificant 25% lower body weight was observed in the Lxr / mice 2.7. Testosterone measurement   treated with DES, while this effect was not found in wild-type ani- Testosterone levels were measured in testis from 45 days old mals. This suggests that Lxr-deficient mice are more prone to DES mice using the direct ELISA Kit EiAsyTM WayTESTOSTERONE effect compared to wild-type animals. A similar DES-effect was (Diagnostics Biochem Canada Inc, London, Canada) according the also found for testis somatic index, defined by the calculation of manufacturer’s instruction. Briefly, fresh testes were dounced- the testis mass as a proportion of the total body mass (testis weight/body weight 100), (Fig. 1A, right panel): neonatal DES homogenized in PBS-BSA 0.1 mg/ml and aliquots were used for  the testosterone as well protein assays. treatment induced a higher decrease of the somatic index only in Lxr / mice (20% at 10 and 45 days), compared to the Lxr / mice     treated with vehicle (oil). Conversely, DES did not alter the testis 2.8. Statistics weight of wild-type animals at these ages. As many physiological functions of the testis are regulated by For statistical analysis, 2-way ANOVA was performed using the nuclear receptors, we investigated whether neonatal DES treat- statistical software package SigmaStat 3.0. When significant effects ment could affect their mRNA levels (Fig. 1B). Both Lxr levels were of treatment or genotype or their interactions were obtained, not modified by the treatment in wild-type animals. Estrogen multiple comparisons were made with Holm–Sidak method. All receptor Era accumulation was induced as previously shown numerical data are mean ± SEM. A p value less than 0.05 was con- [27], demonstrating that DES was efficient. Likewise, Erb level sidered significant. was increased by DES in wild-type mice. Two downstream Era Oil A DES 10 days 45 days 10 days 45 days 1.0 *** *** 1.0 **** **** **** Bodymass 0.0 Testis0.0 so matic ind ex Wild-type Lxr-/- Wild-type Lxr-/- Wild-type Lxr-/- Wild-type Lxr-/- B **** 20.0 Wild-type/Oil ns Wild-type/DES 18.0 **** Lxr-/-/Oil Lxr-/-/DES ** * 2.0 1.5 1.0 0.5 0.0 Relative mRNA accumulationat 45 days Lxr Lxr Er Er Lrh1 Shp Fig. 1. Effects of neonatal DES treatment on body mass, testis somatic index and nuclear receptors mRNA accumulation. (A) Body mass and somatic index have been arbitrarily fixed at 1 for vehicle-treated wild-type and Lxr / mice. Measurements were done at 10 and 45 days of age. Histograms represent mean ± SEM; N = 8–15 animals   per group. Statistical analysis: ⁄⁄⁄p < 0.001 vs. vehicle treated mice; ⁄⁄⁄⁄p < 0.0001 vs. vehicle-treated mice. (B) Nuclear receptor encoding mRNAs were measured by qPCR. Vehicle-treated wild-type and Lxr / mice were arbitrarily fixed at 1. Measurements were done on testis collected at 45 days of age. Histograms represent mean ± SEM;   N = 8–15 animals per group. Statistical analysis: ⁄p < 0.05; ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001; ⁄⁄⁄⁄p < 0.0001 vs. vehicle-treated mice. !"#$%%&"'($)(*+,(-..$/)(&.(0-1(&2(34'565()$7)87,(9( ( Figure S2. Representative pictures of oil-red O stained testis of 45 day of age. Red vacuoles indicate the presence of neutral lipids. Lipid staining was performed on cryosections with 1,2 propanediol for 1 min and in Oil red O (Sigma-Aldrich) at 60 C for 7 min. Nuclei and cytoplasm were stained in Harris’ hematoxylin solution (Sigma-Aldrich) for 1 min. Magnification x20. Wild-type / oil Wild-type / DES Lxr-/- / oil Lxr-/- / DES A. Oumeddour et al. / Biochemical and Biophysical Research Communications 446 (2014) 656–662 659 genes were also accumulated, namely the encoding nuclear recep- ruptors are known to alter lipid composition in testis [32]. We thus tors Lrh1 (NR5A2) and Shp (NR0B2) involved in lipid and steroid wondered whether DES could interfere with the lipid defects ob- homeostasis in testis [27], respectively 18- and 2.5-fold. Interest- served in Lxr / mice, such as the higher cholesterol ester accu-   ingly, none of these genes was significantly accumulated following mulation [14,15] (Supplementary data 2). As shown in Fig. 3A, the neonatal DES treatment in Lxr-deficient mice, suggesting that cholesterol ester levels were not differentially affected by DES part of the DES effect needs Lxr receptors. (means of 0.14 lg/mg tissue for vehicle vs. 0.12 for DES in wild-type animals; 0.35 lg/mg tissue vs. 0.24 for Lxr / mice,   3.2. Effect of DES on cell apoptosis is increased in LXR deficient mice at non-significant). As already described, testis total cholesterol was 10 days decreased by DES-treatment in wild-type animals. This effect was not observed in Lxr-deficient mice. Conversely a slight in- As already reported [27], 0.75 lg DES did not induce a signifi- crease of Abca1 (encoding the membrane cholesterol transporter cant cell apoptosis in testis at 10 days of life (Fig. 2A, left panel), ATP-binding cassette 1) was observed in DES-treated Lxr / mice   conversely to what was observed at 45 days. The same higher (Fig. 3B, p = 0.1). Neonatal treatment with DES significantly de- apoptosis rate (2-fold, p < 0.001) was present in Lxr-deficient mice creased the amount of phosphatidyl-ethanolamine (55% decrease, at 45 days. Interestingly, a significant 3-fold increase (p < 0.0001) is p < 0.05), phosphatidyl-choline (35% decrease, p < 0.05) and sphin- present at 10 days in the DES-treated Lxr / mice, suggesting they gosine (25% decrease, p < 0.05). Note that these alterations were   are more sensitive to neonatal DES. While DES had no effect on cell not seen in Lxr / mice (Fig. 3A).   proliferation in wild-type mice, a slight (15%) but significant lower proliferation was observable in DES-treated Lxr / mice at 3.4. Lxra/b modify neonatal effects of DES on Leydig and Sertoli cells   45 days (Fig. 2A, right panel). markers At 45 days, lower Cyclin A1 (marker of meiosis of germ cells), Cyclin B2 (mitosis maker), and Oct3 (germ cell marker) mRNA accu- Lxra and Lxrb have been shown to regulate Leydig and Sertoli mulation was shown in Lxr / mice neonatally treated with cell physiology [15], by the transcriptional regulation of genes such   0.75 lg DES. In wild-type mice, DES induced a higher accumulation as Star, Cyp11a1, Cyp17 (encoding P450c17 enzyme) and 3bHSD level of Cyclin A2 (mitosis marker) and a decreased level of Stra8 (encoding 3-beta-hydroxysteroid dehydrogenase), or the decrease (meiosis marker) [27]. Altogether, the decreased meiosis marker of the basal anti-Müllerian hormone (AMH) mRNA, respectively. together with the increased cell apoptosis and the lower cell prolif- Neonatal treatment with DES induced a decreased accumulated eration rates could participate to the decreased somatic index of level Star, Cyp11a1 and Cyp17 in wild-type mice at 45 days. the testis. Conversely 3bHSD, Cyp19 (encoding aromatase), Lhr (encoding LH-receptor) and Insl3 (encoding insulin-like 3) were not signifi- 3.3. DES affects accumulation of lipids in testis at 45 days of age cantly affected. Interestingly, lack of both Lxr abolished DES effect on Star level while 3bHSD was highly accumulated (Fig. 4A). The Lipids have an important role in male fertility [30] and Lxra/b levels of testosterone were significantly (p = 0.03) decreased by regulate testis lipid homeostasis [14,15,31]. Besides, endocrine dis- 30% at 45 days in Lxr / testis neonatally treated with DES   Oil A 10 days 45 days 10 days 45 days **** DES 3.0 3.0 *** *** 2.0 2.0 ns **** 1.0 1.0 ** Cell apoptosis index Cell proliferation index 0.0 0.0 Wild-type Lxr-/- Wild-type Lxr-/- Wild-type Lxr-/- Wild-type Lxr-/- B **** 3.0 45 days 45 Wild-type/Oil 2.5 Wild-type/DES Lxr-/-/Oil 2.0 Lxr-/-/DES 1.5 1.0 * * ** 0.5 **** Relative Relative mRNA accumulationat 0.0 Cyclin A1 Cyclin A2 Cyclin B2 Cyclin D1 Cyclin D2 Stra8 Oct3 Fig. 2. Effects of neonatal DES treatment on cell apoptosis and proliferation and on meiosis and mitosis markers. (A) Cell apoptosis index (left panel) and cell proliferation index (right panel) determined by TUNEL analysis and Ki67 staining, respectively. Vehicle-treated wild-type and Lxr / mice were arbitrarily fixed at 1. Measurements were   done at 10 and 45 days of age. Histograms represent mean ± SEM; N = 3–5 animals per group. Statistical analysis: ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001; ⁄⁄⁄⁄p < 0.0001 vs. vehicle-treated mice. (B) Meiosis and mitosis marker encoding mRNA were measured by qPCR. Vehicle-treated wild-type and Lxr / mice were fixed at 1. Histograms represent   mean ± SEM; N = 6-8 animals per group. Statistical analysis: ⁄p < 0.05; ⁄⁄p < 0.01; ⁄⁄⁄⁄p < 0.0001 vs. vehicle-treated mice. 660 A. Oumeddour et al. / Biochemical and Biophysical Research Communications 446 (2014) 656–662 A 1.4 1.2 1.0 * * 0.8 * * 0.6 0.4 0.2 Relative Relative lipid accumulation 0.0 Chol. esters Cholesterol Triglycerides Phosphatidyl- Phosphatidyl Sphingosine ethanolamine - choline Wild-type/Oil B Wild-type/DES 2.0 Lxr-/-/Oil Lxr-/-/DES 1.5 1.0 mRNA accumulation 0.5 Relative Relative 0.0 Abca1 Fig. 3. Effects of neonatal DES treatment on lipid accumulation on testis from 45 days old animals. (A) Cholesterol esters, total cholesterol, triglycerides, phosphatidyl- ethanolamine, phosphatidyl-choline and sphingosine were measured by thin chromatography layer. Vehicle-treated wild-type and Lxr / mice were arbitrarily fixed at 1.   Histograms represent mean ± SEM; N = 5–15 animals per group. Statistical analysis: ⁄⁄p < 0.01 vs. vehicle-treated mice. (B) Abca1 encoding mRNA was measured by qPCR. Vehicle-treated wild-type and Lxr / mice were fixed at 1. Histograms represent mean ± SEM; N = 8–12 animals per group. Statistical analysis: ⁄p < 0.05; ⁄⁄p < 0.01;   ⁄⁄⁄⁄p < 0.0001 vs. vehicle treated mice. A Wild-type/Oil 2.0 ** Wild-type/DES * Lxr-/-/Oil *** Lxr-/-/DES 1.5 1.0 * * * ** ** 0.5 Relative mRNA0.0 accumulation Star Cyp11a1 3 hsd3 Cyp17 Cyp19 Insl3 Lhr Fshr Leydigcellmarkers Sertoli cell marker DES B Intratesticular testosterone Er/ C 45 days Er/ 1.0 Oil DES * Lrh1 Shp Fold induction 0.0 Fshr StarCyp11a1 Cyp17Cyclin A2 Stra8 Oct3 Wild-type Lxr-/- Sertoli Leydig cell Germ cell physiology endocrine functioning differentiation Fig. 4. Effects of neonatal DES treatment on Leydig and Sertoli cell markers from 45 days old animals. (A) Leydig and Sertoli cell markers were measured by qPCR. Vehicle- treated wild-type and Lxr / mice were arbitrarily fixed at 1. Histograms represent mean ± SEM; N = 6–8 animals per group. Statistical analysis: ⁄p < 0.05; ⁄⁄p < 0.01;   ⁄⁄⁄p < 0.001 vs. vehicle treated mice. (B) Testosterone levels were measured in testis from 45 days old animals. Vehicle-treated wild-type and Lxr / mice were arbitrarily   fixed at 1. Histograms represent mean ± SEM; N = 5–10 animals per group. Statistical analysis: ⁄p < 0.05 vs. vehicle treated mice. (C) Proposed model for the role of Lxra/b in DES-induced gene variations. Adapted from Volle et al. [27]. Grey disk, Lxra/b; arrow, induction; broken arrow, inhibition. A. Oumeddour et al. / Biochemical and Biophysical Research Communications 446 (2014) 656–662 661 (Fig. 4B). Besides, DES significantly enhanced the accumulation of References Fshr (FSH-receptor; 1.5-fold; Fig. 4B) as well as InhA (Inhibin A; 2-fold; data not shown), two Sertoli cell markers, in wild-type [1] P.J. Willy, K. Umesono, E.S. Ong, R.M. Evans, R.A. Heyman, D.J. Mangelsdorf, but not in Lxr / mice. LXR, a nuclear receptor that defines a distinct retinoid response pathway,   Genes Dev. 9 (1995) 1033–1045. [2] C. Song, J.M. Kokontis, R.A. Hiipakka, S. Liao, Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone 4. Discussion receptors, Proc. Natl. Acad. Sci. USA 91 (1994) 10809–10813. [3] D.M. Shinar, N. Endo, S.J. Rutledge, R. Vogel, G.A. Rodan, A. Schmidt, NER, a new member of the gene family encoding the human steroid hormone nuclear In a previous study Volle et al. [27] demonstrated that mice receptor, Gene 147 (1994) 273–276. treated with 0.75 lg DES induced the neonatal germ cell differen- [4] D.J. Peet, B.A. Janowski, D.J. Mangelsdorf, The LXRs: a new class of oxysterol receptors, Curr. Opin. Genet. Dev. 8 (1998) 571–575. tiation without gross abnormalities in the male genital tract, nor [5] B.A. Janowski, P.J. Willy, T.R. Devi, J.R. Falck, D.J. Mangelsdorf, An oxysterol alteration in epididymis, vesicle seminals, and testis weights. The signalling pathway mediated by the nuclear receptor LXR alpha, Nature 383 authors showed that Shp-deficient mice were protected from DES (1996) 728–731. [6] B.A. Janowski, M.J. Grogan, S.A. Jones, G.B. Wisely, S.A. Kliewer, E.J. Corey, et al., effects, which acts through several signaling pathways, such as Structural requirements of ligands for the oxysterol liver X receptors LXRa and estrogen receptors Era and Erb. Our study points out that DES does LXRb, Proc. Natl. Acad. Sci. USA 96 (1999) 266–271. not always have a canonical effect on Lxr-deficient mice, i.e. [7] E. Viennois, K. Mouzat, J. Dufour, L. Morel, J.-M. Lobaccaro, S. Baron, Selective repression of the steroidogenic encoding genes, modification of liver X receptor modulators (SLiMs): what use in human health?, Mol Cell. Endocrinol. 351 (2012) 129–141. germ cell differentiation markers, and Sertoli cell physiology alter- [8] E. Viennois, A.J.C. Pommier, K. Mouzat, A. Oumeddour, F.-Z. El Hajjaji, J. Dufour, ation. This has been observed on the testicular somatic index as et al., Targeting liver X receptors in human health: deadlock or promising well as on the accumulation of various transcripts involved in trail?, Expert Opin Ther. Targets 15 (2011) 219–232. [9] D.J. Peet, S.D. Turley, W. Ma, B.A. Janowski, J.M. Lobaccaro, R.E. Hammer, et al., endocrine functions, cell differentiation and lipid accumulation, Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear and encoded by Leydig, germ and Sertoli cells, respectively. Our oxysterol receptor LXR alpha, Cell 93 (1998) 693–704. data could potentially establish a link between DES, Shp, Era/b [10] S. Alberti, G. Schuster, P. Parini, D. Feltkamp, U. Diczfalusy, M. Rudling, et al., and Lxr / . Hepatic cholesterol metabolism and resistance to dietary cholesterol in a b LXRbeta-deficient mice, J. Clin. Invest. 107 (2001) 565–573. The analysis of the transcript accumulation allowed classifying [11] K. Mouzat, M. Prod’homme, D.H. Volle, B. Sion, P. Déchelotte, K. Gauthier, et al., the genes sensitive to neonatal treatment by DES in 3 categories Oxysterol nuclear receptor LXRbeta regulates cholesterol homeostasis and (Fig. 4C): (i) genes whose DES-variations are independent of contractile function in mouse uterus, J. Biol. Chem. 282 (2007) 4693–4701. [12] K. Mouzat, F. Volat, S. Baron, G. Alves, A.J.C. Pommier, D.H. Volle, et al., Absence Lxra/b, such as Cyp11a1 and Cyp17; (ii) genes whose DES-varia- of nuclear receptors for oxysterols liver X receptor induces ovarian tions are countered by Lxra/b, such as Oct3 and 3bhSD; (iii) genes hyperstimulation syndrome in mice, Endocrinology 150 (2009) 3369–3375. whose induction by DES needs the presence of Lxra/b, such as [13] F.-Z. El-Hajjaji, A. Oumeddour, A.J.C. Pommier, A. Ouvrier, E. Viennois, J. Dufour, et al., Liver X receptors, lipids and their reproductive secrets in the Era, Shp, Lrh1, Star, and Stra8. male, Biochim. Biophys. Acta 2011 (1812) 974–981. DES has been considered for years as the paradigm of the envi- [14] K.M. Robertson, G.U. Schuster, K.R. Steffensen, O. Hovatta, S. Meaney, K. ronmental endocrine disruptors with an estrogen-like activity. In- Hultenby, et al., The liver X receptor-{beta} is essential for maintaining deed DES has been described to act through the estrogen receptors. cholesterol homeostasis in the testis, Endocrinology 146 (2005) 2519–2530. [15] D.H. Volle, K. Mouzat, R. Duggavathi, B. Siddeek, P. Déchelotte, B. Sion, et al., Regarding the results it appears that the nuclear receptors Lxra Multiple roles of the nuclear receptors for oxysterols liver X receptor to and Lxrb not only are basally important for testicular physiology maintain male fertility, Mol. Endocrinol. Baltim. Md. 21 (2007) 1014–1027. but could also have a protective effect against estrogen-like endo- [16] D.M. Stocco, Tracking the role of a star in the sky of the new millennium, Mol. Endocrinol. Baltim. Md. 15 (2001) 1245–1254. crine disruptors as their absence induces a stronger variation of [17] T.K. Jensen, A.-M. Andersson, N.E. Skakkebæk, U.N. Joensen, M.B. Jensen, T.H. important testis target genes in Lxr-deficient mice. Lassen, et al., Association of sleep disturbances with reduced semen quality: a cross-sectional study among 953 healthy young Danish men, Am. J. Epidemiol. 177 (2013) 1027–1037. [18] T.K. Jensen, T. Sobotka, M.A. Hansen, A.T. Pedersen, W. Lutz, N.E. Skakkebaek, Acknowledgments Declining trends in conception rates in recent birth cohorts of native Danish women: a possible role of deteriorating male reproductive health, Int. J. We thank J.-P. Saru and A. De Haze for their excellent techni- Androl. 31 (2008) 81–92. [19] C. Wohlfahrt-Veje, K.M. Main, N.E. Skakkebaek, Testicular dysgenesis cal help; S. Plantade, K. Ouchen and P. Mazuel for expert techni- syndrome: foetal origin of adult reproductive problems, Clin. Endocrinol. cal assistance in breeding the transgenic mice; the members of (Oxford) 71 (2009) 459–465. the Chester’s lab for critically reading the manuscript, assistance [20] K. Bay, C. Asklund, N.E. Skakkebaek, A.-M. Andersson, Testicular dysgenesis syndrome: possible role of endocrine disrupters, Best Pract. Res. Clin. in animal dissections and discussions; Dr. D.J. Mangelsdorf Endocrinol. Metab. 20 (2006) 77–90. (Howard Hughes Medical Institute, Dallas, TX) for providing the [21] A.L. Herbst, H. Ulfelder, D.C. Poskanzer, Adenocarcinoma of the vagina. mice; AO is recipient of a Grant from Algeria government. EV Association of maternal stilbestrol therapy with tumor appearance in young was recipient of Fond Européen de DEveloppement Régional women, N. Engl. J. Med. 284 (1971) 878–881. [22] B.E. Henderson, B. Benton, M. Cosgrove, J. Baptista, J. Aldrich, D. Townsend, (FEDER) and Région Auvergne Grants. JMAL is supported by Fon- et al., Urogenital tract abnormalities in sons of women treated with dation pour la Recherche Médicale and Fondation BNP-Paribas, diethylstilbestrol, Pediatrics 58 (1976) 505–507. Association de Recherche sur les Tumeurs Prostatiques, Ligue [23] T. Ishikawa, I.S. Yuhanna, J. Umetani, W.-R. Lee, K.S. Korach, P.W. Shaul, et al., LXRb/estrogen receptor-a signaling in lipid rafts preserves endothelial contre le Cancer (Comités Allier et Puy-de-Dôme), Association integrity, J. Clin. Invest. 123 (2013) 3488–3497. de Recherche contre le Cancer, Région Auvergne grants. J.M.A.L. [24] L.-L. Vedin, S.A. Lewandowski, P. Parini, J.-A. Gustafsson, K.R. Steffensen, The is Professor at the Université Blaise Pascal. DHV is supported oxysterol receptor LXR inhibits proliferation of human breast cancer cells, by Grants from Agence National de la Recherche ‘‘Programme Carcinogenesis 30 (2009) 575–579. [25] L. Lundholm, S. Movérare, K.R. Steffensen, M. Nilsson, M. Otsuki, C. Ohlsson, Jeune Chercheur’’. DHV and SB are recipients of grants from et al., Gene expression profiling identifies liver X receptor alpha as an Région Auvergne. estrogen-regulated gene in mouse adipose tissue, J. Mol. Endocrinol. 32 (2004) 879–892. [26] H. Gong, P. Guo, Y. Zhai, J. Zhou, H. Uppal, M.J. Jarzynka, et al., Estrogen deprivation and inhibition of breast cancer growth in vivo through activation Appendix A. Supplementary data of the orphan nuclear receptor liver X receptor, Mol. Endocrinol. Baltim. Md. 21 (2007) 1781–1790. [27] D.H. Volle, M. Decourteix, E. Garo, J. McNeilly, P. Fenichel, J. Auwerx, et al., The Supplementary data associated with this article can be found, in orphan nuclear receptor small heterodimer partner mediates male infertility the online version, at http://dx.doi.org/10.1016/j.bbrc.2013.12.005. induced by diethylstilbestrol in mice, J. Clin. Invest. 119 (2009) 3752–3764. 662 A. Oumeddour et al. / Biochemical and Biophysical Research Communications 446 (2014) 656–662 [28] H.E. Virtanen, A. Adamsson, Cryptorchidism and endocrine disrupting function to possible scavenger therapy, Hum. Reprod. Update 2 (1996) 246– chemicals, Mol. Cell. Endocrinol. 355 (2012) 208–220. 256. [29] K. Warita, K. Okamoto, K.-I. Mutoh, Y. Hasegawa, Z.-P. Yue, T. Yokoyama, et al., [31] B. Mascrez, N.B. Ghyselinck, M. Watanabe, J.-S. Annicotte, P. Chambon, J. Activin A and equine chorionic gonadotropin recover reproductive dysfunction Auwerx, et al., Ligand-dependent contribution of RXRbeta to cholesterol induced by neonatal exposure to an estrogenic endocrine disruptor in adult homeostasis in Sertoli cells, EMBO Rep. 5 (2004) 285–290. male mice, Biol. Reprod. 78 (2008) 59–67. [32] M. Chen, B. Xu, W. Ji, S. Qiao, N. Hu, Y. Hu, et al., Bisphenol A alters n-6 fatty [30] A. Lenzi, M. Picardo, L. Gandini, F. Dondero, Lipids of the sperm plasma acid composition and decreases antioxidant enzyme levels in rat testes: a LC- membrane: from polyunsaturated fatty acids considered as markers of sperm QTOF-based metabolomics study, PLoS ONE 7 (2012) e44754. Steroids 99 (2015) 266–271 Contents lists available at ScienceDirect Steroids journal homepage: www.elsevier.com/locate/steroids Enolase is regulated by Liver X Receptors De Boussac Hugues a,b,c,d, Maqdasy Salwan a,b,c,d,e,f, Trousson Amalia a,b,c,d, Zelcer Noam g, a,b,c,d a,b,c,d a,b,c,d, Volle David H. , Lobaccaro Jean-Marc A. , Baron Silvère  a Université Clermont Auvergne, Université Blaise Pascal, Génétique Reproduction et Développement, BP 10448, F63000 Clermont-Ferrand, France b CNRS, UMR 6293, GReD, F-63177 Aubiere, France c INSERM, UMR 1103, GReD, F-63177 Aubiere, France d Centre de Recherche en Nutrition Humaine d’Auvergne, F-63000 Clermont-Ferrand, France e Service d’Endocrinologie, Diabétologie et Maladies Métaboliques, Hôpital Gabriel Montpied, F-63003 Clermont-Ferrand, France f Service de Médecine Nucléaire, Centre Jean Perrin, 58 rue Montalembert, F-63011 Clermont-Ferrand, France g Department of Medical Biochemistry Academic, Medical Center, Amsterdam 1105 AZ, The Netherlands article info abstract Article history: Enolase is a glycolytic enzyme known to inhibit cholesteryl ester hydrolases (CEHs). Cholesteryl ester Received 16 December 2014 loading of macrophages, as occurs during atherosclerosis, is accompanied by increased Enolase protein Received in revised form 2 February 2015 and activity. Here, we describe that J774 macrophages treated with LXR agonists exhibit reduced Enolase Accepted 6 February 2015 transcript and protein abundance. Moreover, we show that this reduction is further potentiated by Available online 21 February 2015 activation of the LXR/RXR heterodimer with the RXR ligand 9-cis retinoic acid. Enolase levels are also reduced in vivo following activation of LXRs in the intestine, but not in the liver. This effect is lost in Keywords: Lxrab / mice. In aggregate, our study identified Enolase as a new target of LXRs in vivo, which may Enolase   promote cholesterol mobilization for subsequent efflux. Liver X Receptors Cholesterol esters  2015 Elsevier Inc. All rights reserved. Macrophages 1. Introduction and Abcg1 [11,12], and by limiting uptake of LDL-derived cholesterol due to induction of Idol, an E3 ubiquitin ligase that The enzyme Enolase (ENO1, EC.4.2.1.11) acts in glycolysis to promotes lysosomal degradation of the LDLR [13]. Despite the convert 2-phosphoglycerate to phosphoenolpyruvate. Twenty crucial role of LXRs in cholesterol homeostasis, their effect on years ago, Shand and West had proposed that next to its glycolytic cellular cholesterol storage is not well understood. Through function Enolase can also inhibit cholesteryl ester hydrolases transcriptional profiling, we have identified that Enolase is subject (CEHs) [1,2]. The transition of macrophages to ‘‘foam cells’’ in the to LXR-dependent regulation [14]. Here, we show that Enolase atherosclerotic plaque is accompanied by storage of cholesterol transcript and protein abundance are reduced by LXRs in macro- esters in lipid droplets [3,4]. This process, which can be mimicked phages and intestine and discuss the impact this may have on experimentally in vitro by loading macrophages with acetyl-LDL or mobilization of cholesterol towards efflux pathways. oxidized-LDL, requires enhanced cholesterol esterification activity. Accordingly, cholesterol loading of macrophages results in a marked increase in ENO1 protein [5,6], which can potentially 2. Materials and methods inhibit CEHs on the surface of lipid droplets [7,8]. The Liver X Receptor-a and -b (LXRs, NR1H3 and NR1H2, 2.1. Cell culture and treatments respectively) are members of the nuclear receptor superfamily that play a central role in controlling cholesterol homeostasis [9,10]. In J774-A1 murine macrophage cell line was cultured in DMEM macrophages, LXRs can decrease the cellular sterol burden by medium supplemented with L-glutamine (2 mM), penicillin strep- inducing expression of the cholesterol efflux transporters Abca1 tomycin (100 lg/ml) and 10% of Fetal Bovine Serum. Twenty-four hours after seeding, cells were treated with synthetic LXR agonists, GW3965 (Sigma–Aldrich, L’Isle d’Abeau, France) or T0901317 (Cay- Corresponding author at: GReD, 24, Avenue des Landais, F-63177 Aubiere, man Chemical, Montigny-le-Bretonneux, France) and/or RXR ligand  France. Tel.: +33 4 73 40 74 12; fax: +33 4 73 40 70 42. 9-cis RA (Sigma–Aldrich) diluted in DMSO as indicated in the figure E-mail address: [email protected] (S. Baron). legends in a 1% lipoprotein-deficient serum (LPDS) medium. http://dx.doi.org/10.1016/j.steroids.2015.02.010 0039-128X/ 2015 Elsevier Inc. All rights reserved. H. De Boussac et al. / Steroids 99 (2015) 266–271 267 2.2. Animals mEno1 Fw: 50-TGATCCTGCCTGTGGGGGCA-30; mEno1 Rev: 50-GCCG GCCTTTGCGATTGCAG-30;m36b4 Fw: 50-GTCACTGTGCCAGCTCA- Mice lacking Lxra and Lxrb (LXR double knockout mice) and GAA-30,m36b4 Rev: 50-TCAATGGTGCCTCTGGAGAT-30. their wild-type controls were maintained and housed as previously described [14]. Male mice were orally gavaged daily with methyl- 2.4. Western blotting cellulose or 25 mg/kg T0901317 for 3 consecutive days. Animals were sacrificed at day 4, and organs collected and stored at Proteins from J774-A1 cells or mice organs were extracted, 80 C prior to RNA or protein extraction, or paraformaldehyde  transferred and detected as described previously [15]. Primary (PFA)-fixed and embedded in paraffin for immunofluorescence antibodies used are the following: ABCA1 (NB400-105, Novus experiments. All experiments were approved by the local Regional Biologicals, Littleton, CO), ENO1 (#3810, Cell Signaling, Danvers, Ethics Committee. MA), a-Tubulin (T6074, Sigma Aldrich), ABCG1 (NB400-132, Novus Biologicals) and GAPDH (NB300221, Novus Biologicals). Detection 2.3. RNA and real-time quantitative PCR was performed using HRP-conjugated secondary antibodies (P.A.R.I.S., Compiègne, France) and Western Lightning System kit Total RNA was extracted using TRIzol reagent (Life Technologies, (Perkin Elmer, Villebon s/ Yvette, France) on a MF-ChemiBIS imager Saint Aubin, France) according to manufacturer instructions. RNA (DNR bio-imaging systems, Jerusalem, Israel). was reverse transcribed to cDNA with 200 U of Moloney murine leukemia virus-reverse transcriptase (Promega, Charbonnières, France), 5 pmol of random primers (C1181, Promega), 40 U RNAsin 2.5. Immunofluorescence (Promega), and 2.5 mM deoxynucleotide triphosphate mix. Quanti- tative PCR was performed on a Mastercycler epRealplex (Eppendorf, Following necropsy, jejunum was collected, paraformaldehyde LePecq, France) using MESA GREEN quantitative PCR masterMix (PFA)-fixed, embedded in paraffin, and 5-lm-thick sections were Plus for SYBR (Eurogentec, Angers, France). Primer sequences are: prepared for immunofluorescence analysis as described previously mAbca1 Fw: 50-GGAGCTGGGAAGTCAACAAC-30,mAbca1 Rev: 50- [14]. Antibody used was ENO1 (#3810, Cell Signaling). Stained ACATGCTCTCTTCCCGTCAG-30;mAbcg1 Fw: 50-GCTGTGCGTTTTGTG slides were visualized with a Carl Zeiss Axiocam digital camera CTGTT-30,mAbcg1 Rev: 50-TGCAGCTCCAATCAGTAGTCCTAA-30; on a Zeiss Axioplan 2 microscope. Fig. 1. LXRs agonists decrease Eno1 expression in J774 macrophages. (A) Eno1 and Abca1 expression levels were quantified by RTqPCR on cells treated with 0, 0.5, 1, 3 and 5 lM of T0901317 for 8 h. (B) Expression levels of Eno1 and Abca1 were monitored on cells incubated with 5 lM of T0901317 for 48 h. (C) Expression levels of Eno1 and Abca1 were analyzed on cells incubated with either 3 lM of T0901317 or 3 lM of GW3965 for 24 h. (D) Eno1 and Abca1 expression were quantified on cells incubated for 24 h with 3 lM of T0901317 and/or 3 lM of 9-cis retinoic acid. RTqPCR were normalized using 36b4 gene expression. Analyzes results from three independent experiments of each realized in triplicates Data are expressed as the means ± SEM. Statistical analysis: ⁄p < 0.05 and ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001. 268 H. De Boussac et al. / Steroids 99 (2015) 266–271 2.6. Statistical analysis was mirrored by a concomitant upregulation of the canonical LXR target gene Abca1 (Fig. 1A). The repression of Eno1 expression Values are expressed as means ± SEM. Statistical comparisons by LXRs was stable and maintained over time, as it was still were performed using a two-tailed Student’s t test. A p < 0.05 observed after 48 h of treatment with T0901317 (Fig. 1B). To fur- was considered statistically significant. ther establish involvement of LXRs we challenged J774 macro- phages with a second LXR synthetic agonist, GW3965 [17]. Inhibition of Eno1 expression in response to GW3965 treatment 3. Results was similar to that observed with T0901317 (Fig. 1C). There is ample evidence demonstrating that LXRs bind their obligate 3.1. Inhibition of Eno1 expression by LXR agonists heterodimer partner RXR to form a permissive nuclear receptor complex that can be activated by ligands of any of the two interact- To investigate the potential role of LXRs in regulation of Eno1 ing receptors, often with additive/synergistic transcriptional activ- expression, we tested the effect of T0901317, a LXR synthetic ity [18]. We tested this idea by treating the cells with either ligand [16], treatment in J774 cells, which represent an established synthetic ligands of LXR, RXR, or a combination of both. As depict- murine macrophage cell line. In these cells, we observed dose- ed in Fig. 1D, concomitant stimulation of LXR and RXR using dependent repression of Eno1 by LXR activation, upon 8 h, that Fig. 2. ENO1 protein accumulation is decreased by LXRs agonists in J774 macrophages. (A) ENO1 and ABCA1 accumulations were quantified by western blot on cells treated with 0, 1, 3 and 5 lM of T0901317 for 48 h. (B) ENO1 and ABCA1 accumulation levels were analyzed on cells incubated with 48 h of T0901317 (3 lM) or GW3965 (1 lM) treatments. (C) ENO1 and ABCA1 accumulation were quantified on cells incubated for 48 h with 3 lM of T0901317 and/or 3 lM of 9-cis retinoic acid. Signals are normalized using GAPDH signal quantification. Pictures are representative and results from at least three independent experiments. Data are expressed as the means ± SEM. Statistical analysis: ⁄p < 0.05 and ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001. H. De Boussac et al. / Steroids 99 (2015) 266–271 269 T09013147 and 9-cis retinoic acid, respectively, results in an addi- ENO1 in intestine, but not in liver (Fig. 3A, upper panel). Support- tive decrease in Eno1 transcript levels, suggesting that Eno1 repres- ing the role of LXR in regulating Enolase levels in vivo we found sion depends on RXR/LXR heterodimer activity. LXR and/or RXR that the protein level of Enolase remains insensitive to T0901317 stimulation induces a parallel induction of Abca1, as expected. in the intestine of Lxrab / mice. We also determined the level   of ABCA1 and ABCG1 in the intestine and liver, respectively, and 3.2. LXR stimulation decreases ENO1 protein abundance the increase in their protein abundance serves as a positive con- trols for LXR activation in wild-type mice. Interestingly, although To address whether the reduction in Eno1 transcript is T0901317 did not change ENO1 abundance in the liver of wild type paralleled by a decrease in abundance of Enolase protein ENO1 in or in Lxrab / mice, mice lacking LXRs have a lower level of   murine macrophages, we monitored its level by western blot. After detectable Enolase protein in both organs (Fig. 3A). These findings T0901317 treatment, the level of ENO1 decreased in a dose depen- suggested that although ENO1 abundance is repressed by LXR dent manner (Fig. 2A), whereas ABCA1 protein was conversely stimulation, their expressions are required for a normal basal increased. Furthermore, treatment of J774 macrophages using expression. Conversely to Abcg1 expression, Enolase regulation GW3965 resulted in a comparable reduction in ENO1 abundance seems to occur at the post-transcriptional level given that Eno1 to that observed with T0901317 (Fig. 2B). In line with their addi- expression remains unchanged in liver whatever the genotype tive effect on Eno1 transcript, treatment of macrophages with both and treatment (Fig. 3B). We also determined the level of Eno1 T0901317 and 9-cis retinoic acid dramatically decreased the level and Abca1 expression in the intestine. These were largely in agree- of ENO1 (Fig. 2C). Collectively, these results indicate that the ment with the western blotting results showing a decrease in Eno1 LXR/RXR heterodimer represses Eno1 expression and as a conse- and increase in Abca1 following ligand treatment. (Fig. 3B). In quence reduces the level of Enolase protein in murine Lxrab / mice the ability of the ligand to increase Abca1 was abol-   macrophages. ished, as expected. Unexpectedly, we found that loss of LXRs reduces basal levels of Eno1, which likely explains the reduced 3.3. LXRs regulate Enolase in vivo Enolase protein (Fig. 3A). Finally, we investigated ENO1 represen- tation in situ using intestine slides and confirmed a decreased sig- To further establish LXRs as regulators of Eno1, we measured nal in villi of mice challenged with T0901317 (Fig. 4). Altogether, the levels of Enolase in mice that have been pharmacologically these findings therefore suggest that the influence of LXRs on dosed with methylcellulose or T0901317. We found that treating Eno1 in vivo is complex and likely involved direct and indirect mice with the LXR ligand resulted in a marked reduction in transcriptional processes. Fig. 3. Enolase is regulated by LXRs in vivo. (A) ENO1, ABCA1 and ABCG1 accumulations were quantified by western blot on intestine and/or liver samples from wild type (white squares) and Lxrab / mice (black squares) gavaged with methylcellulose (vehicle) or T0901317 (25 mg/kg) (n = 6/8 animals per group). (B) Eno1, Abca1 and Abcg1   expression levels were quantified by RTqPCR on intestinal and/or liver samples from wild type (white squares) and Lxrab / (black squares) as (A). RTqPCR were normalized   using 36b4 gene expression. Data are expressed as the means ± SEM. Statistical analysis: ⁄p < 0.05 and ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001. 270 H. De Boussac et al. / Steroids 99 (2015) 266–271 Fig. 4. Enolase accumulation is decreased in intestine villi. Immunofluorescence detection of ENO1 on intestine slides from wild type mice dosed with methylcellulose (methyl) as a vehicle or T0901317 (25 mg/kg). Scale bar represent 100 lm. 4. Discussion observed by ChIP-seq analysis in the vicinity of the ENO1 gene in human macrophages [21]. However, careful in silico analyses of We report herein the regulation of Enolase by LXRs. The major both human and mouse promoters failed to reveal potential bind- finding of this study is that activated LXRs decrease Eno1 expres- ings sites (not shown). Alternatively, it is well established that LXR sion and corresponding protein levels in murine macrophages are potent anti-inflammatory factors in macrophages, largely due and in vivo in a tissue-specific and LXR-dependent manner. to their ability to trans-repress inflammatory gene signaling Despite being an important metabolic enzyme the regulation of [22,23]. Accordingly, ligand activated LXRs inhibit expression of Eno1 expression is poorly understood. Recently, Cai et al. reported NF-jB-responsive genes such as COX2, iNOS and MMP-9 during that Estrogen-Related Receptors (ERRs) a, b, and c (NR3B1, 2 and 3, the inflammatory response [24]. Given that ENO1 gene expression respectively) can bind and drive transcriptional activity of the Eno1 is also enhanced by NF-jB signaling we postulate that repression promoter in cooperation with hypoxia-inducible factors under of Eno1 by LXRs may follow a similar mechanism, an hypothesis hypoxic conditions [19]. Expression of ENO1 is also highly respon- that warrants future studies. The question is still open in the con- sive to proinflammatory signals such as IL- 1b, IL-6, PGE2, or TNF-a text of human macrophages. Preliminary data lead us to confirm in peripheral blood mononuclear cells [20]. These cytokines, large- that ENO1 regulation by LXRs is present in THP1 human cell line ly acting through the NF-jB pathway, increase expression of ENO1 (data not shown) but occurs only at the protein level. This observa- as part of the inflammatory program. Our finding that LXRs are tion suggest that molecular mechanism underlying Eno1 regulation potent repressors of Eno1 expression further illustrates the com- by LXRs is complex and probably organism specific. plex regulation of this enzyme. An important question that In the context of cellular cholesterol homeostasis regulation of emerges from our study relates to the mechanism underlying Eno1 is of particular interest. There is ample evidence pin pointing repression of Eno1 expression by LXRs. LXR binding has been changes in ENO1 abundance as a key determinant in the H. De Boussac et al. / Steroids 99 (2015) 266–271 271 [7] Zhao B, Fisher BJ, St Clair RW, Rudel LL, Ghosh S. Redistribution of macrophage cholesteryl ester hydrolase from cytoplasm to lipid droplets upon lipid loading. J Lipid Res 2005;46:2114–21. http://dx.doi.org/10.1194/ jlr.M500207-JLR200. [8] Bouchoux J, Beilstein F, Pauquai T, Guerrera IC, Chateau D, Ly N, et al. The proteome of cytosolic lipid droplets isolated from differentiated Caco-2/TC7 enterocytes reveals cell-specific characteristics. Biol Cell 2011;103:499–517. http://dx.doi.org/10.1042/BC20110024. [9] Zelcer N, Tontonoz P. Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest 2006;116:607–14. http://dx.doi.org/ 10.1172/JCI27883. [10] Calkin AC, Tontonoz P. Transcriptional integration of metabolism by the nuclear sterol-activated receptors LXR and FXR. Nat Rev Mol Cell Biol 2012;13:213–24. http://dx.doi.org/10.1038/nrm3312. [11] Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, et al. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci U S A 2000;97:12097–102. Fig. 5. Schematic diagram of cholesterol storage control mediated by LXRs through [12] Kennedy MA, Venkateswaran A, Tarr PT, Xenarios I, Kudoh J, Shimizu N, et al. Enolase regulation (for more details, see text). Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein. J Biol Chem 2001;276:39438–47. transformation of macrophages to ‘‘foam cells’’ in response to [13] Zelcer N, Hong C, Boyadjian R, Tontonoz P. LXR regulates cholesterol uptake cholesterol loading [5,6]. Shand and West [2] demonstrated that through Idol-dependent ubiquitination of the LDL receptor. Science ENO1 inhibits activity of CEHs. Together with increased ENO1 2009;325:100–4. [14] Pommier AJC, Dufour J, Alves G, Viennois E, De Boussac H, Trousson A, et al. expression this activity may contribute to enhanced-cholesteryl Liver X receptors protect from development of prostatic intra-epithelial ester accumulation in macrophages loaded with lipoprotein- neoplasia in mice. PLoS Genet 2013;9:e1003483. http://dx.doi.org/10.1371/ derived cholesterol. Whereas the roles of LXRs in cholesterol efflux journal.pgen.1003483. [15] Dufour J, Pommier A, Alves G, De Boussac H, Lours-Calet C, Volle DH, et al. Lack and uptake are well established, their effect on cholesterol-ester of liver X receptors leads to cell proliferation in a model of mouse dorsal storage is less-well studied. In this context, it is interesting to point prostate epithelial cell. PLoS ONE 2013;8:e58876. http://dx.doi.org/10.1371/ out some oxysterols, which are endogenous LXR ligands, are journal.pone.0058876. reported to modulate cholesterol esterification by ACAT1 and 2 [16] Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, et al. Role of LXRs in control of lipogenesis. Genes Dev 2000;14:2831–8. independent of LXRs activation [25–28]. Nevertheless, mobiliza- [17] Collins JL, Fivush AM, Watson MA, Galardi CM, Lewis MC, Moore LB, et al. tion of cholesterol from intracellular pools to the plasma mem- Identification of a nonsteroidal liver X receptor agonist through parallel array brane is an essential step in cholesterol efflux [29]. Indeed, NPC1 synthesis of tertiary amines. J Med Chem 2002;45:1963–6. [18] Willy PJ, Mangelsdorf DJ. Unique requirements for retinoid-dependent and NPC2 are required for efficient cholesterol efflux supported transcriptional activation by the orphan receptor LXR. Genes Dev by cholesterol transporters such as ABCA1 and ABCG1 [30]. Fur- 1997;11:289–98. thermore, overexpression of CEH have been shown to enhances [19] Cai Q, Lin T, Kamarajugadda S, Lu J. Regulation of glycolysis and the Warburg effect by estrogen-related receptors. Oncogene 2013;32:2079–86. http:// cholesterol elimination and reverse cholesterol transport in vivo dx.doi.org/10.1038/onc.2012.221. [31]. Repression of Enolase expression by activated LXRs could [20] Bae S, Kim H, Lee N, Won C, Kim H-R, Hwang Y, et al. a-Enolase expressed on therefore relieves their inhibition of CEH activity and enhances the surfaces of monocytes and macrophages induces robust synovial inflammation in rheumatoid arthritis. J Immunol 2012;189:365–72. http:// cholesteryl ester hydrolysis in macrophages. This in turn could dx.doi.org/10.4049/jimmunol.1102073. provide a source of free cholesterol that is accessible to cholesterol [21] Pehkonen P, Welter-Stahl L, Diwo J, Ryynänen J, Wienecke-Baldacchino A, efflux transporters (Fig. 5). In conclusion, Enolase repression by Heikkinen S, et al. Genome-wide landscape of liver X receptor chromatin binding and gene regulation in human macrophages. BMC Genomics LXRs could represent a novel regulation node of cholesterol home- 2012;13:50. http://dx.doi.org/10.1186/1471-2164-13-50. ostasis network within the cell. [22] Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med 2003;9:213–9. Acknowledgments [23] Spann NJ, Garmire LX, McDonald JG, Myers DS, Milne SB, Shibata N, et al. Regulated accumulation of desmosterol integrates macrophage lipid metabolism and inflammatory responses. Cell 2012;151:138–52. http:// This work was supported by Région Auvergne ‘‘Nouveau dx.doi.org/10.1016/j.cell.2012.06.054. chercheur’’. This study has been performed with the assistance of [24] Castrillo A, Joseph SB, Marathe C, Mangelsdorf DJ, Tontonoz P. Liver X receptor- Christelle Damon-Soubeyrand for histology technical assistance dependent repression of matrix metalloproteinase-9 expression in macrophages. J Biol Chem 2003;278:10443–9. using ‘‘Anipath’’ Platform (GReD) and Sandrine Plantade, Keredine [25] Laffitte BA, Repa JJ, Joseph SB, Wilpitz DC, Kast HR, Mangelsdorf DJ, et al. LXRs Ouchen and Philippe Mazuel for animal facilities. Thanks to master control lipid-inducible expression of the apolipoprotein E gene in students that worked on training project ‘‘Enolase’’ (Sabrina macrophages and adipocytes. Proc Natl Acad Sci U S A 2001;98:507–12. Boudon, Sylvain Lamoine, Gweltas Odye, Maxime Voisin). [26] Miller LR, Needleman DH, Brabson JS, Wang KS, Schroepfer GJ. 5 alpha-cholest- 8(14)-en-3 beta-ol-15-one. A competitive substrate for acyl coenzyme A:cholesterol acyl transferase. Biochem Biophys Res Commun 1987;148:934–40. References [27] Erickson SK, Shrewsbury MA, Brooks C, Meyer DJ. Rat liver acyl-coenzyme A:cholesterol acyltransferase: its regulation in vivo and some of its properties [1] Shand JH, West DW. Does enolase have a role in cholesterol metabolism? in vitro. J Lipid Res 1980;21:930–41. Biochem Soc Trans 1994;22:435S. [28] Erickson SK, Matsui SM, Shrewsbury MA, Cooper AD, Gould RG. Effects of 25- [2] Shand JH, West DW. Inhibition of neutral cholesteryl ester hydrolase by the hydroxycholesterol on rat hepatic 3-hydroxy-3-methylglutaryl coenzyme A glycolytic enzyme enolase. Is this a secondary function of enolase? Lipids reductase activity in vivo, in perfused liver, and in hepatocytes. J Biol Chem 1995;30:763–70. 1978;253:4159–64. [3] Glass CK, Witztum JL. Atherosclerosis. The road ahead. Cell 2001;104:503–16. [29] Repa JJ, Turley SD, Lobaccaro JA, Medina J, Li L, Lustig K, et al. Regulation of [4] Lusis AJ. Atherosclerosis. Nature 2000;407:233–41. absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. [5] Bottalico LA, Kendrick NC, Keller A, Li Y, Tabas I. Cholesteryl ester loading of Science 2000;289:1524–9. mouse peritoneal macrophages is associated with changes in the expression or [30] Rigamonti E, Helin L, Lestavel S, Mutka AL, Lepore M, Fontaine C, et al. Liver X modification of specific cellular proteins, including increase in an alpha- receptor activation controls intracellular cholesterol trafficking and enolase isoform. Arterioscler Thromb 1993;13:264–75. esterification in human macrophages. Circ Res 2005;97:682–9. http:// [6] Conway JP, Kinter M. Proteomic and transcriptomic analyses of macrophages dx.doi.org/10.1161/01.RES.0000184678.43488.9f. with an increased resistance to oxidized low density lipoprotein (oxLDL)- [31] Zhao B, Song J, Ghosh S. Hepatic overexpression of cholesteryl ester hydrolase induced cytotoxicity generated by chronic exposure to oxLDL. Mol Cell enhances cholesterol elimination and in vivo reverse cholesterol transport. J Proteomics 2005;4:1522–40. http://dx.doi.org/10.1074/mcp.M500111- Lipid Res 2008;49:2212–7. http://dx.doi.org/10.1194/jlr.M800277-JLR200. MCP200. Biochimie 95 (2013) 504e517 Contents lists available at SciVerse ScienceDirect Biochimie journal homepage: www.elsevier.com/locate/biochi Review Bile acids: From digestion to cancersq Marine Baptissart a,b,c,d, Aurelie Vega a,b,c,d, Salwan Maqdasy a,b,c,d,e, Françoise Caira a,b,c,d, Silvère Baron a,b,c,d, Jean-Marc A. Lobaccaro a,b,c,d, David H. Volle a,b,c,d,* a INSERM U 1103, Génétique Reproduction et Développement (GReD), F-63177 AUBIERE, France b Clermont Université, Université Blaise Pascal, GReD, BP 10448, F-63000 CLERMONT-FERRAND, France c CNRS, UMR 6293, GReD, F-63177 AUBIERE, France d Centre de Recherche en Nutrition Humaine d’Auvergne, F-63000 CLERMONT-FERRAND, France e Service d’endocrinologie, diabétologie, maladies métaboliques, Centre Hospitalier Universitaire et Université d’Auvergne. F-63000 CLERMONT-FERRAND, France article info abstract Article history: Bile acids (BAs) are cholesterol metabolites that have been extensively studied these last decades. BAs Received 27 March 2012 have been classied in two groups. Primary BAs are synthesized in liver, when secondary BAs are Accepted 21 June 2012 produced by intestinal bacteria. Recently, next to their ancestral roles in digestion and fat solubilization, Available online 3 July 2012 BAs have been described as signaling molecules involved in many physiological functions, such as glucose and energy metabolisms. These signaling pathways involve the activation of the nuclear receptor Keywords: FXRa or of the G-protein-coupled receptor TGR5. These two receptors have selective afnity to different Bile acids types of BAs and show different expression patterns, leading to different described roles of BAs. It has FXRa TGR5 been suggested for long that BAs could be molecules linked to tumor processes. Indeed, as many other Cancer molecules, regarding analyzed tissues, BAs could have either protective or pro-carcinogen activities. However, the molecular mechanisms responsible for these effects have not been characterized yet. It involves either chemical properties or their capacities to activate their specic receptors FXRa or TGR5. This review highlights and discusses the potential links between BAs and cancer diseases and the perspectives of using BAs as potential therapeutic targets in several pathologies.  2012 Elsevier Masson SAS. All rights reserved. 1. Introduction known as classical pathway, involves CYP7A1 and CYP8B1, the second named alternative pathway, involves cytochromes CYP27A1 and 1.1. Physico-chemical function and biosynthesis: old stories. CYP7B1. Both syntheses lead respectively to production of so-called primary BAs: cholic acid (CA) and chenodeoxycholic (CDCA) [2] With cholesterol, phospholipids and bilirubin, bile acids (BAs) (Fig. 1). BAs greatly differ between species. It has to be noticed that are the main component of bile. Present in digestive tract during mice present muricholic acids derived from chenodeoxycholic acid the meal, they ensure fat solubilization and emulsication and thus which is more hydrophobic and less toxic for cells than CDCA. promote digestion [1]. This property is mainly due to their During the entero-hepatic cycle, in distal ileum as well as in amphipathic nature. colon, small part of BAs could be deconjugated and enzymatically In adult human, around 500 mg of cholesterol are converted into modied by intestinal microora [3]. These transformations lead to BAs perday. Theirsynthesis takes place in liverand involves a series of secondary BA, namely deoxycholic acid (DCA) and lithocholic acid enzymatic modications of cholesterol at both sterol ring and lateral [4], respectively originating from CA and CDCA [4]. By the end, side chain. There are two different synthetic pathways. The rst one, conjugated BAs represent 98% of the pool. In liver, primary and secondary BAs are coupled with amine residues (glycine or taurine) leading to production of amphipathic q This study was supported by ANR JCJC (#JCJC1103 01). bile salts tauro- and glyco-conjugated and stored in gallbladder. * Corresponding author. “Génétique Reproduction et Développement”,Inserm After meal BAs and their conjugates are delivered in duodenum to U1103, Unité Mixte de Recherche CNRS 6293, Clermont Université, 24 avenue facilitate digestion and absorption of fats and liposoluble vitamins des Landais, BP80026, 63171 Aubière Cedex, France. Tel.: 33 (0) 473407415;  fax: 33 (0) 473407042. in the intestine throughout the enterocyte barrier (Fig. 2). Indeed,  E-mail address: [email protected] (D.H. Volle). BAs are transported from apical surface into enterocytes by the 0300-9084/$ e see front matter  2012 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.biochi.2012.06.022 M. Baptissart et al. / Biochimie 95 (2013) 504e517 505 Fig. 1. Schematic representation of pathways of BA synthesis. BA synthesis takes place in the liver. They are formed from cholesterol. The classical pathway involves among other cytochromes CYP7A1, CYP27A1 and CYP8B1; alternative pathway involves cytochromes CYP27A1 and CYP7B1. Both lead to the production of primary BAs, cholic acid (CA) and chenodeoxycholic (CDCA). Then, they are converted into secondary BAs by bacterial ora in the ileum: deoxycholic acid (DCA) and lithocholic [4], respectively. apical sodium-dependent BAs transporter ASBT (Apical Sodium- several other members of nuclear receptor superfamily, such as SHP Dependent Bile Acid transporter). Then, BAs are bound to the ileal (Small heterodimer partner, NR0B2), LRH1 (Liver receptor BA binding protein IBABP, transported across cell to basolateral homolog-1, NR5A2), or LXRa (Liver X Receptor a, NR1H3) [10].Itis membrane, and exported by the heterodimeric organic solute interesting to note that in human, the regulation of Cyp7a1 doesn’t transporter OSTa/b [5]. not exist, what highlights the differences between species [11]. In ileum and colon, the majority of BAs (95%) is reabsorbed and In parallel, FXRa protects liver from toxic effects of accumulated recycled in liver. Thus, neo-synthesized BAs can be excreted again, BAs. In hepatocytes, FXRa decreases BA uptake via repression of 20e40 times during digestion. This recycling mechanism, called Na -taurocholate cotransporting polypeptide (NTCP), organic  entero-hepatic cycle, involves a system of tightly regulated trans- anion-transporting polypeptide (OATP)-1 and OATP-4 expressions porters ensuring not only the maintenance of BAs metabolism, but also [12]. It also promotes BA excretion in bile ducts through tran- the control of cholesterol homeostasis from which they are derived [6]. scriptional induction of the specic BA transporter BSEP (Bile salt export pump) in hepatocytes [6]. This effect is related to BA 1.2. BAs as cell signaling molecules: a new story begins. decreased excretion in digestive tract of Fxra mutant mice [9]. FXRa is also involved in controlling lipid and glucose homeo- In addition to their mechanical role, BAs have been described as stasis as suggested by high plasma triglycerides concentrations signaling molecules binding two specic receptors: the nuclear in FXRa / mice [13] (Fig. 3). Via a SHP-dependant pathway,   receptor Farnesol-X-receptor (FXRa, NR1H4) and G-protein-coupled FXRa limits triglyceride synthesis. Indeed, it inhibits the expression receptor TGR5 (GPBAR1, G-protein-coupled bile acid receptor). of enzymes involved in triglyceride synthesis such as sterol- regulatory-element-binding (SREBP1-c), fatty-acid-synthase 1.2.1. The nuclear receptor for bile acids: FXRa (FASN) and stearoyl coenzyme A desaturase-1 (SCD-1) [14].In Identied in liver, intestine, or kidney, FXRa belongs to nuclear parallel, FXRa controls blood glucose by lowering expression of receptor superfamily [7]. More potent ligands for FXRa are CDCA phosphoenolpyruvate carboxykinase (PEPCK), a key enzyme of and its conjugated forms [8]. It acts as an obligatory heterodimer gluconeogenesis, and glucose-6-phosphatase (G6P) involved in with retinoid X receptor (RXR). This heterodimer binds to specic glycogenolysis reactions [15] (Fig. 3). IR1 (inverted repeat-1) sequences on target gene promoters and then regulates their transcription. FXRa has been involved in 1.2.2. G-protein-coupled receptor for BAs: TGR5 regulation of many physiological functions. Among them, mouse TGR5 is a member of G-protein-coupled receptors family with model invalidated for Fxra gene (Fxra / ), allows to highlight its seven transmembrane domains. It has been recently recognized as   involvement in regulating BAs biosynthesis and entero-hepatic BA receptor [16] more particularly for LCA and DCA [17]. TGR5 cycle [9]. Fxra / mice exhibit high BA plasma levels associated agonist activates protein kinase-A (PKA) pathway leading to cAMP-   with abnormal hepatic biosynthesis, due to an alteration of FXRa- responsive-element-binding protein (CREB) phosphorylation mediated negative feed-back on BA biosynthesis. The molecular which induces expression of its target genes, even though most of mechanisms involved have been described (Fig. 3). In liver, FXRa these transcriptional targets need to be identied (Fig. 4). represses Cyp7a1 gene expression, a key enzyme of BA biosyn- Expressed predominantly in liver, intestine or brown adipose thesis. At molecular level, in mouse models, this pathway involves tissues, TGR5 has been implicated in regulation of multiple 506 M. Baptissart et al. / Biochimie 95 (2013) 504e517 Fig. 2. Schematic representation of the entero-hepatic circulation of BAs. Primary BAs neo-synthesized in the liver are conjugated with glycine or taurine. Then, BAs are stored in the gallbladder and excreted into bile in the duodenum where they participate to the digestion of fats. In the ileum, under the action of intestinal bacteria, BAs are deconjugated and converted into secondary BAs. In the colon, the majority of BAs is reabsorbed and transported by the portal vein to the liver to participate in a new round of digestion. Excess of BAs is eliminated by the feces. metabolic functions. TGR5 knockout mice are predisposed to incompetence of the lower esophageal sphincter and a disturbed obesity in response to high fat diet [18]. This is consistent with the clearance of esophagus, this pathology increases esophagus expo- fact that, in response to BAs, TGR5 promotes energy expenditure sure not only to acidity from stomach but also to BAs from through thyroid hormone T3 activation by the iodothyronine dei- duodenum [24]. odinase 2 enzyme (DIO2) [19]. This increases b-oxidation of fatty acids in brown adipose tissue or skeletal muscle, in mouse and 2.1.1. BAs and esophagus diseases human cells, and thereby promotes the conversion of fat into The involvement of BAs in the progression from BE disease to EA energy. Next to this, it has been demonstrated that, through GLP-1 is now well established. Indeed, many studies in humans show that synthesis regulation in entero-endocrine cells [20], TGR5 partici- not only concentration, nature but also length of exposure of pates in insulin release from pancreas, and then favors glycemia mucous membranes to BAs are correlated with the degree of regulation. pathology [24,27,28]. Several surgical models of GERD have been shown to result in EA 2. Bile acids and gastro-intestinal cancer development development without exogenous carcinogen [29e31]. Further- more, one study shows that zinc decient diet containing DCA 2.1. Esophagus adenocarcinoma supplementation increases reactive oxygen species (ROS) produc- tion and leads to BE-like lesions in mice [32]. Moreover, ex-vivo and With an incidence increasing in western countries over the past in vitro experiments, using either biopsies or cell lines derived from decades, esophageal cancer is the seventh leading cause of cancer- patients with GERD, show that exposure to BAs induces expression related death worldwide [21]. There are two main histological of inammatory mediators (e.g. Interleukin-8 (IL-8), cyclo- types of esophageal cancers, squamous cell carcinoma and adeno- oxygenase (COX-2)), oxidative stress and DNA damage that could carcinoma. It is now well established that Barrett’s esophagus (BE) be linked to mutational events leading, over a longer period, to constitutes a major risk factor for esophageal adenocarcinoma (EA) development of resistant apoptotic cells and ultimately cancer [33]. development [22]. Indeed, recent data consider that patients with However, the exact molecular pathways involved remain BE disease have an estimated 30e125 fold increased risk of unclear. Few studies have investigated the implication of BAs developing esophageal cancers [23]. BE syndrome is dened by receptors in the development of BE disease and adenocarcinoma. presence of metaplastic lesions where damaged squamous cells are replaced by columnar epithelium. This phenomenon occurs during 2.1.2. Is FXRa involved? healing of esophageal mucosal injury typically triggered by gastro- 2.1.2.1. FXRa expression and disease progression. The rst evi- esophageal reux diseases (GERD) [24e26]. Characterized by an dence suggesting the involvement of FXRa in BE disease and M. Baptissart et al. / Biochimie 95 (2013) 504e517 507 Fig. 3. The nuclear receptor FXRa is involved in regulating hepatic lipid carbohydrate and BA metabolisms. FXRa, through its target gene SHP (Small heterodimer partner), regulates the transcription of enzymes involved in synthesis of BAs and triglycerides [119]. It also participates in the efux of BAs by activating the transcription of BSEP (bile salt export pump) and the control of gluconeogenesis and glycogenolysis via PEPCK (phosphoenolpyruvate carboxykinase) and G6P (Glucose-6-phosphatase). Note that LXRa controls mouse Cyp7a1 gene expression and that this regulation doesn’t exist in human. LRH1 (Liver receptor homolog-1), LXR (Liver X receptor), SCD-1 (Stearoyl coenzyme A desaturase-1). Fig. 4. The G-protein-coupled receptor TGR5 participates in the control of carbohydrate and energy metabolisms. Stimulation of TGR5 activates the adenylate cyclase (AC) and causes the production of cAMP. Activated protein kinase-A phosphorylates the transcription factor CREB (cAMP-responsive-element-binding protein). The latter induces the expression of the gene encoding the enzyme DIO2 (deiodinase iodothyronine 2) that induces production of the thyroid hormone T3 and promotes b-oxidation of fatty acid (FA) in brown adipose tissue or muscle. In the enterocytes, cAMP pathway allows the synthesis of the GLP-1 (glucagon-like peptide-1), thus promoting the release of insulin from the pancreas. 508 M. Baptissart et al. / Biochimie 95 (2013) 504e517 adenocarcinoma development was recently report by several treated ex-vivo with DCA present resistance to apoptosis compared studies showing increased FXRa expression along the progression to esophageal squamous epithelium [41]. In this context, involve- from normal esophagus to BE disease [34e36]. In patients with BE ment of FXRa in regulation of apoptosis has been suggested by disease, FXRa is overexpressed in both esophageal squamous in vitro experiments showing that antagonizing FXRa with gug- epithelium and specialized intestinal BE cells, while almost no gulsterone treatment signicantly enhances apoptosis in a human FXRa was found in healthy squamous epithelium. Furthermore, loss BE-derived cell line [34]. While suggesting the involvement of FXRa of FXRa expression has been reported in EA probably due to low in promoting inammation and resistance to apoptosis, an FXRa- grade differentiation [34]. independent effect of guggulsterone cannot be excluded. Indeed, in The origin and the signicance of these changes in FXRa further studies guggulsterone was shown to suppress the activation expression were reported in several clinical and epidemiological of a nuclear factor-kappa B (NF-kB) induced by tumor necrosis studies. During chronic GERD, squamous epithelium cells are factor a (TNF-a) and chemotherapeutic agents through inhibition of replaced by intestinal type epithelium. As enterocytes express FXRa, IkB kinase (IKK) [42]. By this pathway, guggulsterone leads to this modication in cell population may in part contribute to the the inhibition of p65 phosphorylation, nuclear translocation, and over-expression described in epithelium of patients with BE disease. down-regulation of target genes involved in anti-apoptosis and Unlike esophageal epithelium cells, enterocytes are adapted to inammatory pathways. However, the precise mechanism by transport BAs from lumen back to bloodstream by both apical and which guggulsterone leads to IKK inhibition remains unknown and basolateral transporters controlled by FXRa. Recently Dvorak et al. the hypothesis implicating its FXRa antagonist property remains to [37] demonstrate in human that, like FXRa, BA transporters IBAT, be explored. IBABP or multidrug resistance-associated protein 3 (MRP3) expres- sions are increased in non dysplasia esophageal cells compared with 2.1.3. Does TGR5 may also be involved? normal squamous epithelium. This suggests an adaptive mechanism The potential role of TGR5 in EA tumorigenesis has been to protect cells from components of reux particularly from BAs. recently discussed for the rst time by Hong et al. [43]. Unlike FXRa, Interestingly, DCA treatment increases Fxra and Ibabp mRNA level in TGR5 mRNA and protein levels were signicantly higher in human human TE7 esophageal cell line suggesting that BAs may be involved EA than in normal esophageal mucosa or Barrett’s mucosa sug- in the establishment of this adaptive mechanism [36]. gesting that it might play a central role in adenocarcinoma On the other hand, decreased mRNA levels of BA transporters development. were observed during progression of Barrett’s esophagus and In the human EA cell lines FLO or BAR-T, low dose of TDCA adenocarcinoma consistent with decreased expression of FXRa increases NADPH oxidase NOX-5S expression leading to peroxide [37]. This decline in transporter expression may be responsible, at production and increased proliferation rate [43]. Interestingly, in least in part, for the increased cellular damage due to excessive these cell lines, TGR5 knockdown by siRNA strategy reduces intraluminal BAs concentrations. Another hypothesis proposes that signicantly BA induced NOX-5S expression, H2O2 production and this phenomenon may also be considered as a further adaptive cell proliferation [43]. In contrast, over-expression of TGR5 response to high BAs exposure in order to limit DNA damage of increases these effects [43]. premetaplastic cells [37]. These data dene TGR5 as a mediator of ROS production and All these data suggest that, through regulation of BA trans- increased proliferation induced by BA exposure. Thus, TGR5 porters, FXRa controls an adaptative mechanism to lower esoph- activity could be involved in evolution of Barrett’s syndrome to agus exposure to BAs toxicity in BE and adenocarcinoma. adenocarcinoma. 2.1.2.2. FXRa promotes inammation. Chronic inammation of 2.1.4. Conclusion epithelial cells in GERD was shown to play a key role in the tran- BAs seem to play important roles throughout the progression of sition from Barrett’s syndrome to adenocarcinoma. BE disease leading to EA. FXRa intervenes during early steps leading Chemokines such as macrophage inammatory protein-3a to BE disease by promoting inammation and resistance to (MIP3a) or IL-8 have been shown to promote inammatory apoptosis (Fig. 5). response by increasing the inux of immune cells such as neutro- Regarding TGR5, its high expression in EA suggests its potential phils and b-cells [38]. Compared to the squamous epithelium of role in adenocarcinoma development. Indeed, mediating ROS Barrett’s syndrome patients, their columnar epithelium displayed production and increasing proliferation induced by BAs exposure, an increase in MIP3a and IL-8 levels with enhanced expression of TGR5 activity must be involved in evolution of Barrett’s syndrome FXRa and FXRa targets genes suggesting involvement of FXRa in to adenocarcinoma (Fig. 6). initiation and maintenance of the inammatory response in BE [36]. In line with these data, in vitro experiment shows that exposure 2.2. Hepatocellular carcinoma of human esophageal TE7 cell line to DCA results in increased mRNA levels of MIP3a and IL-8 [36]. Interestingly, pretreatment Hepatocellular carcinoma is the third leading cause of cancer with guggulsterone, a natural FXRa antagonist, inhibits this pro- deaths worldwide. In developed countries, its incidence has inammatory response suggesting a direct involvement of FXRa particularly increased in the last twenty years with 500 000 people in the enhanced inammatory reaction seen in patients with BE affected a year [21]. Hepatocarcinoma is a frequent complication in [36]. patients with cirrhosis caused by chronic inammatory diseases like non-alcoholic steatohepatitis (NAFL), hepatitis B or C virus. 2.1.2.3. FXRa induces apoptosis resistance. Previous studies demonstrate that the transformation of Barrett’s syndrome to 2.2.1. Role of BAs in hepatocarcinoma adenocarcinoma is related to a loss of apoptotic mechanism [39]. Several evidences show that BAs may be implicated in liver Several biopsies analyses indicate reduced apoptosis in BE tissues tumorigenesis. Indeed, child with progressive familial intrahepatic which may contribute to progression to EA. This is highlighted by cholestasis type 2 (PFIC type 2) is predisposed to hepatocellular the expression of proapoptotic and anti-apoptotic signaling mole- carcinoma [44]. This pathology is characterized by a genetic de- cules such as Bcl-xl or Bax [40]. Moreover, human BE epithelial cells ciency of the canalicular bile salt export pump BSEP or ABCB11, M. Baptissart et al. / Biochimie 95 (2013) 504e517 509 Fig. 5. Impacts of FXRa in gastro-intestinal cancers. leading to severe cholestasis with elevated serum and liver BA hepatocytes by inducing ROS production leading to DNA damage levels, particularly CDCA and CA. and apoptosis. Hydrophobic BAs like DCA, glucuro-CDCA or tauro- In vivo experiments on rats show that exogenous administration CDCA have been reported to generate ROS in rat hepatocytes, of DCA is a relatively strong promoter of the appearance of pre- human hepatoma cell line or primary human hepatocytes [49e52]. neoplastic lesions in hepatocarcinogenesis [45,46]. In wild-type Consistently, treatment of human hepatocarcinoma cells with DCA mice, a 0.2% CA-enriched diet strongly promoted N-nitrosodiethyl- induces transcription of genes that respond to oxidative stress amine-initiated carcinogenesis [47]. Furthermore a report highlights (NF-kB, c-fos, hsp70 and gadd153) or DNA damage (gadd153, hsp70 that, in rat, elevated BA concentrations in pathological conditions and c-fos) [53]. Moreover, several in vitro strategies using isolated rat might act as endogenous promoters of hepatocarcinogenesis [48]. hepatocytes, liver tissue sections or human hepatocarcinoma cell Several in vitro studies report evidences that BAs may affect directly lines, show that BAs induce apoptosis in liver cells [54e56]. Among Esophagus Liver Deleterious Benefit Deleterious Benefit - Pro-oxidant (NOX-5S) - Apoptosis -Energy homeostasis (JNK, Caspase8) -Anti-inflammatory - Pro-proliferative (NF-B) function (NOX-5S) TGR5TGR5 Deleterious Benefit - Intestinal motility -Anti-inflammatory (cytokine release) Intestine / colon Fig. 6. Impacts of TGR5 in gastro-intestinal cancers. 510 M. Baptissart et al. / Biochimie 95 (2013) 504e517 them, three works on rats report that induction of apoptosis by BAs Moreover, human CYP7A1 deciency results in a statin-resistant can be reduced by an anti-oxidant treatment like a-tocopherol or b- hypercholesterolemia [69]. carotene suggesting that this event is caused by ROS production In addition, FXRa null mice also exhibit glucose intolerance and [51,57,58]. insulin insensitivity [70]. Furthermore, activation of FXRa was Even if the carcinogenic potential of BAs in liver is well estab- shown to decrease blood glucose levels in both diabetic db/db and lished, the precise mechanisms by which they act remains unclear wild-type mice [70]. In mouse and human hepatocytes, FXRa and involvement of their receptors FXRa and TGR5 are poorly inhibits transcription of gluconeogenic genes such as G6P or PEPCK understood. in a SHP-dependent manner [71,72]. According to its central role in regulation of both glucose and 2.2.2. Involvement of the nuclear receptor FXRa lipid metabolisms, FXRa prevents liver metabolic disorders and 2.2.2.1. FXRa: gatekeeper of BAs homeostasis in liver. FXRa plays their potential to evolve into hepatocarcinoma. a central role in the regulation of liver BAs homeostasis and their entero-hepatic circulation. This property is mainly due to the 2.2.2.3. FXRa shows anti-inammatory property. Hepatic inam- regulation of expression of gene involved in synthesis, conjugation mation is closely linked to hepatocarcinogenesis [73,74]. The use of and transport of BAs. FXRa null mice demonstrates that liver inammation is prior to FXRa activation causes human BSEP up-regulation, the major development of spontaneous liver tumors since increased expres- excretion transporter of bile acids in hepatocytes [59]. Through sion of genes involved in inammation (interferon-gamma (IFN-g), a SHP-dependent pathway, FXRa decreases transcription of genes TNF-a, IL-6, IL-1b) were described before cancer development [47]. that control BAs synthesis like Cyp7a1 [11] or Cyp8b1 [60]. SHP also During liver pathological conditions such as cholestasis, affects Ntcp expression, the sodium-dependent bile acid uptake inammation has been mainly attributed to NF-kB activation by carrier [61]. Furthermore, FXRa activation by CDCA enhances tran- hydrophobic BAs [75e77]. Interestingly, recent report demon- scription of UDP-glucuronosyltransferase (UGT) proteins leading to strates that FXRa negatively modulates NF-kB-mediated hepatic more hydrophilic and therefore less toxic BA glucuronides [62]. inammation [78]. In addition, FXRa activation induces the ileal expression of Hepatic expression of the chimeric protein VP16FXR, a strong broblast growth factor (FGF) 15 (FGF19 in human) [63]. Released transcriptional activated form of FXRa, suppresses the lipopolysac- into portal vein, this hormone binds its receptor FGFR4 in hepato- charide (LPS) induced expression of nitric oxide synthases [79], cytes leading to Cyp7a repression and then decreased BA synthesis. COX-2 and IFN-g in vivo [78]. Moreover, in vitro experiments using As negative feed-back regulation of BA neosynthesis by FXRa- human HepG2 cells and primary hepatocyte culture show that FXRa FGF15 axis is absent, FXRa null mice were shown to present an agonist inhibits NF-kB transcriptional activity by decreasing its expanded BA pool [64]. binding to DNA [78]. Furthermore it was demonstrated that NF-kB This is also of particular interest as FGF19 was implicated in reciprocally decreases FXRa transcriptional activity indicating tumorigenesis. Indeed, FGF19-transgenic mice develop hepatocel- a negative crosstalk between the FXRa and NF-kB signaling path- lular carcinoma (HCC) by 10e12 months. This is associated with an ways [78,80]. The mutual suppression between FXRa and NF-kB increased mitotic activity of hepatocytes. The mechanism by which might be an important mechanism to prevent carcinogenesis. FGF19 induces this tumorigenesis is not fully understood. However, These data reveal that FXRa acts as a negative mediator of through phosphorylation of GSK3b, FGF19 allows b-catenin to hepatic inammation which may contribute to critical roles in accumulate in the nucleus for activation of genes involved in hepatoprotection and suppression of hepatocarcinogenesis. proliferation. Although it is assumed that many, if not all, of the actions of 2.2.2.4. FXRa ghts against brosis. Chronic liver brosis is associ- FGF19 are the same as its mouse orthologous FGF15. ated with hepatocarcinogenesis. Interestingly, several clinical Thus, through its liver and intestinal functions, FXRa contributes reports show that levels of FXRa expression and transcriptional to reduce accumulation of BAs in liver and thus to decrease their activity decrease with brosis as the disease progresses to a severe toxicity for hepatocytes. grade [81]. Consistent with clinical data, histologic signs of liver brosis are observed in FXRa null mice [47,82]. 2.2.2.2. FXRa maintains energy homeostasis in liver. Non-alcoholic Hepatic brosis has been shown to be the consequence of both fatty liver disease (NAFLD) is one of the most important liver increased of extracellular matrix (ECM) and reduced breakdown of diseases in western countries characterized by triglyceride accu- ECM component [83,84]. Hepatic stellate cells (HSCs) are the major mulation in hepatocytes. In connection with pathologies associated source of ECM in liver and can also participate to its degradation by to metabolic syndrome as obesity, insulin resistance or type 2 the proteolytic enzyme like matrix metalloproteinase-2 (MMP) diabetes mellitus, NAFLD could evolve to liver steatosis leading [85]. In mouse HSC culture, FXRa activation by 6-ECDCA leads to progressively to brosis, cirrhosis and by the end to hepatocellular SHP-dependent inhibition of tissue inhibitor of metalloproteinase 1 carcinogenesis [4,65]. (TIMP-1) expression, a major MMP inhibitor [86]. On the other The involvement of FXRa in liver metabolism regulation was hand, TIMP-1 has been involved in both anti-apoptotic and prolif- illustrated by FXRa invalidation in mice resulting in both triglyc- erative pathways in HSCs. Thus, its inhibition enhances the eride and cholesterol accumulation in liver [9]. Indeed, FXRa was susceptibility of HSCs to apoptogenic stimuli and decreases prolif- shown to control lipid homeostasis in hepatocytes through nega- eration. Moreover, activation of the FXRa-SHP pathway, after tive SHP-dependant regulation of sterol-regulatory-element- administration of 6-ECDCA to cirrhotic rats, reduces liver brosis by binding protein 1c (SREBP1-c) and its target genes such as acetyl increasing HSC apoptotic rate [86]. coa carboxylase (ACC) or FAS [14,66]. Additionally, FXRa activation Thus, by limiting accumulation of HSCs and by promoting ECM by 6a-ethyl-chenodeoxycholic acid (6-ECDCA), a potent and degradation, FXRa protects liver from brosis and tumorigenesis. selective semi-synthetic FXRa agonist, protects against liver stea- tosis in animal models [67]. 2.2.2.5. FXRa acts as anti-oxidant factor. Experimental data from Indirectly FXRa controls liver cholesterol accumulation by animal models and clinical data from patients with chronic liver modulation of Cyp7A1 expression, the rate-limiting enzyme infection suggest that an excess of ROS produced by inammatory responsible to cholesterol catabolism into bile acid [10,68]. mediators facilitates the progression of liver brosis [87,88]. M. Baptissart et al. / Biochimie 95 (2013) 504e517 511 FXRa has been shown to play a role in the induction of genes Moreover, in rat isolated Kupffer cells, resident macrophages in encoding for proteins involved in anti-oxidant defense system liver, oleanoloic acid or treatment with TGR5 specic agonist BR27 [89e91]. Mice treated with CDCA show increased expression of were shown to lower LPS-induced cytokine expression such as anti-oxidant and xenobiotic enzymes due to CCAAT/enhancer IL-1a, IL-1b, IL-6 and TNF-a [105]. binding protein b (C/EBPb) activation [92]. Moreover, in human Furthermore, the molecular mechanism by which TGR5 activa- hepatocyte derived cell line, FXRa activation by natural ligand tion down regulates immune functions has been recently assessed. CDCA or specic synthetic ligand, induces C/EBPb through In vitro studies, carried both in mouse macrophages and in hepa- AMPkinase-ERK1/2 pathway [92]. tocyte cell lines, show that TGR5 activation by 23(S)CDCA enhances LKB1 belongs to kinase family and has been shown, through interaction between b-arrestin2 and IkBa thus reducing the phos- AMPK activation, to play a key role in protecting cells against phorylation of IkBa by IKK and then abolishes NF-kB translocation mitochondrial dysfunction and ROS production [93]. In a recent into nucleus [104]. In that line, Pols et al. have recently demon- study Lee et al. [94] report that FXRa activation by its specic ligand strated in vivo, in mouse, that activation of TGR5 in macrophages GW4064 increases level and activity of LKB1 both in hepatocyte by 6a-ethyl-23(S)-methylcholic acid (6-EMCA, INT-777), a semi- culture and mouse liver by reducing levels of its post transcrip- synthetic BA, inhibits pro-inammatory cytokine production via tional inhibitor Mir-199a-3p. cAMP signaling and subsequent NF-kB inhibition. The inhibition of Thus, by promoting C/EBPb and LKB1 functions, FXRa limits ROS atherosclerotic lesion was associated with decreased intraplaque induced injuries in hepatocytes and protects liver against brosis inammation and less plaque macrophage content [106]. development and evolution to hepatocellular carcinoma. These ndings identify TGR5 as a negative mediator of NF-kB transcriptional activity preventing chronic liver inammation 2.2.2.6. FXR counteracts apoptosis. Chronic hepatocyte death is diseases. crucial for initiation and progression of liver brosis and cirrhosis [95]. As FXRa null mice exhibit strong cell apoptosis leading to 2.2.3.3. TGR5 is involved in BA induced apoptosis. Pathological BA brosis, FXRa was suggested to also protect liver cells from death accumulation in liver causes hepatocyte injury by inducing [47]. In human hepatoma cell line HepG2, FXRa prevents serum apoptosis and thereby leads to progression of cholestatic liver deprivation-induced apoptosis through MAPK/ERK1/2 survival disease to cancer [107e110]. pathway [96]. In vivo, starved FXRa null mice present enhanced Recently, Yang et al. [111] demonstrate the involvement of TGR5 apoptosis compared to wild-type mice. This is associated to lower activation in the mechanism of BA induced human hepatocyte ERK1/2 phosphorylation status [96]. As discussed previously, FXRa apoptosis. Indeed, in hepatocyte cell line TGR5 stimulation was was shown to inhibit the NF-kB-mediated hepatic inammatory shown to promote c-Jun N-terminal kinases (JNK) activation and to response. Interestingly, FXRa activation has no negative effects on reduce complex formation of JNK with caspase-8. This facilitates NF-kB-activated anti-apoptotic genes, selectively maintaining NF- caspase-8 recruitment to death-inducing signaling complex (DISC) kB cell survival response [78]. and induction of apoptosis signaling. Thus, by suppressing cell apoptosis and selectively maintaining Even though, these data need to be conrmed, these observa- cell survival, FXRa plays an additional function in hepatoprotection. tions suggest that, by inducing apoptosis in hepatocytes, TGR5 should also participate to the genesis and progression of liver 2.2.3. TGR5 involvement diseases and then contribute to liver carcinogenesis. 2.2.3.1. TGR5 gatekeeper of energy homeostasis in liver. TGR5 is well known for its roles in regulation of both energy homeostasis and 2.2.4. Conclusion glucose metabolism [19,97,98]. Through this, TGR5 is a potential Several evidences show that BAs may be implicated in liver target for the treatment of diabetes and associated metabolic carcinogenesis. FXRa acts at multiple levels highlighting its major disorders such as NAFL that could lead to liver carcinoma roles to protect hepatocytes. FXRa reduces BAs accumulation in [19,20,97,99]. liver. It will also prevent liver metabolic disorders and their By inducing energy expenditure in brown adipose tissue (BAT), potential to evolve into hepatocarcinoma. Then FXRa acts as Watanabe et al. [19] report for the rst time that TGR5 activation by a negative mediator of hepatic inammation and may contribute to BAs improves glucose tolerance and insulin sensitivity in fat-fed critical roles in hepatoprotection and suppression of hep- mice and prevents obesity. Furthermore, TGR5 was shown to atocarcinogenesis. In addition, by limiting accumulation of HSC and promote mitochondrial oxidative phosphorylation and calcium by promoting ECM degradation, FXRa protects liver from brosis inux in murine entero-endocrine cells which result in an and tumorigenesis. Thus, by suppressing cell apoptosis and selec- increased secretion of GLP-1 [20], improving insulin secretion in tively maintaining cell survival, FXRa plays an additional function pancreas cells [97,100]. in hepatoprotection (Fig. 5). Thus, by improving metabolic syndrome and then liver In parallel, TGR5 mainly acts by improving metabolic syndrome homeostasis TGR5 activation could participate indirectly to prevent and then liver homeostasis participating indirectly to prevent hepatocellular carcinoma development. hepatocellular carcinoma development. Indeed, TGR5 is also dened as negative mediator NF-kB transcriptional activity pre- 2.2.3.2. TGR5 has anti-inammatory property. Metabolic syndrome venting chronic liver inammation diseases. However, by inducing is associated with liver chronic inammation, characterized by apoptosis in hepatocytes, TGR5 could promote genesis and abnormal cytokine production and activation of inammatory progression of liver diseases and then contribute to liver carcino- signaling pathways such as NF-kB [101e103]. Using LPS-induced genesis (Fig. 6). inammation model, recent data show that TGR5 / mice   exhibit a more severe inammation and liver necrosis compared to 2.3. Intestine/colon tumor wild-type mice [104]. These phenotypes were associated with elevated protein levels of NF-kB target such as IL-1b or IFN-g. The estimated number of deaths from colonic cancer is 600 000 Moreover, as it was shown with FXRa, TGR5 activation by 23(S)- per year making it the fourth leading cause of cancer deaths [21]. mCDCA treatment suppresses LPS-induced NF-kB pathway in The pathogenesis of colon cancer in humans is a multistep process mouse liver [104]. involving both genetic and environmental factors. Among them, 512 M. Baptissart et al. / Biochimie 95 (2013) 504e517 dietary factors have been implicated in the majority of sporadic leads to the activation of a feed-back catabolic pathway that colorectal cancers. increases CYP3A expression and leads to detoxication of LCA. This Dietary fat intake appears to be one of the most powerful suggests that another pathway involving a nuclear receptor could promoters in development and progression of colon cancer. While protect intestine from the potentially harmful effects of LCA. high ber diet protects against carcinogenesis, several epidemio- Thus, by maintaining intestinal BA pool size FXRa/VDR play key logical studies link high consumption of red or processed meat, role in preventing chronic injuries and inammation that could saturated fat intake and colonic cancer risk [112e116]. lead to carcinogenesis. In rodents, in vivo experiments report that wild-type CB57Bl/6 mice fed a western diet, containing elevated lipids, develop colonic 2.3.2.2. FXRa ghts against inammation. Inammatory bowel min/ tumor [117]. Moreover, APC  mice, predisposed among others diseases have been shown to predispose to intestinal cancer to develop colon cancer, present an increased incidence of carci- development. Ulcerative colitis and Crohn’s disease are typical noma and number of invasive tumors when they are fed a high fat chronic intestinal inammation characterized by deregulations of diet [118,119]. mucosal immune system and bacterial overgrowth compromising intestinal epithelial barrier function and leading to systemic 2.3.1. Involvement of BAs in intestine/colon tumorigenesis infection [140,141]. Interestingly, colon inammation in patients The potential role of BAs in enteric cancers is highlighted by the with a Crohn’s disease and in rodent models of colitis is associated fact that people who consume western diet are more sensitive to with reduced expression of Fxra mRNA providing evidence that colon cancer development and display increased fecal BA concen- FXRa may play a central role in protecting intestine against chronic trations, mainly secondary BAs as DCA and LCA [120,121]. This injuries and forward carcinogenesis [142e144]. In addition, FXRa suggest that exposure of colorectal epithelium to high concentra- expression was inversely correlated to progression of human tions of BAs appears to be an etiologic factor in colorectal colorectal cancers and degree of malignancy of human colon cell carcinogenesis. lines [145]. Several studies report that exposure of colon cells to BAs leads to Consistently, compromised intestinal architecture was observed ROS production that cause DNA damage, mutation or apoptosis. in FXRa / mice. This seems to be related to an excessive immune   Indeed, hydrophobic acids, DCA and LCA, induce ROS in rodent response and high expression levels of IL-6, IL-1b or TNF-a [47,82]. colonic mucosa cell or in human adenocarcinoma cell lines like This phenotype appears to be independent of elevated BA HCT-116 or CACO-2 [122e126]. In that line, numerous studies concentrations observed in these mice since administration of describe that secondary BAs induce DNA damage in colon cells cholestyramine does not modify their intestinal tumor suscepti- consecutive to oxidative stress. Indeed, DCA treatment of human bility [47]. Last, FXRa deciency results in increased sensitivity to min/ colon adenocarcinoma cells HCT-116 induces the expression of the tumorigenesis in both APC  or azoxymethane (AOM)-induced DNA repair protein breast-cancer 1 (BRCA-1) [127] and DNA colon carcinogenesis mouse models [146]. damage inducible gene GADD34/45/153 [128]. Moreover, major Moreover, FXRa activation decreases the severity of inamma- oxidative DNA damage, 8-OH-dG, increases in colon epithelial cells tion and improves colitis symptoms in several surgical or chemical of DCA-fed mice for 8 months [123]. murine colitis models. Bile duct ligation in mice induces colitis that Next to this, a large number of reports shows that secondary BAs could be reversed by GW4064 administration [147]. INT-747 treat- could also induce apoptosis in several human adenocarcinoma cell ment has been shown to prevent inammation in animal models of lines probably due to DNA damage accumulation [128e131]. dextran sodium sulfate (DSS) or trinitrobenzenesulfonic acid Studies from other laboratories indicate a paradoxical prolifera- (TNBS)-induced colitis with preservation of the intestinal epithelial tive action of BAs on cell lines. In human colon cancer cell line (H508 barrier function and reduction of goblet cell loss [148]. In addition, in cells), taurine and glycine conjugates of LCA and DCA induce cell mouse expression of microbicidal genes like Angiogenine1 (Ang1) proliferation through the M3 muscarinic receptor-dependent was shown to be promoted after FXRa activation [147]. pathway and transactivation of epidermal growth factor receptor The ability of FXRa to regulate intestinal inammation was (EGFR) [132]. Furthermore, low concentrations of DCA (5 and 50 mM) described at several molecular levels including both anti- signicantly increase b-catenin activation and cyclin-D1 expression inammatory response in enterocytes and functions of intestinal and enhance colon cancer cell proliferation and invasiveness [133]. innate immunity [148]. Thus, chronic exposure of colon epithelial cells to low concen- 2.3.2.2.1. FXRa activation controls inammatory response in trations of hydrophobic BAs can result in gene mutation and enterocytes. NF-kB activation has been identied as a key factor in constitutive activation of pro-survival stress-response pathways. pro-inammatory response to chronic intestinal diseases [149]. This could instigate cancer development. In line with this, DCA Consistent with described pro-carcinogen property of BAs, recent administration in a rat model of colonic carcinogenesis signicantly report reveals that DCA induces constitutive NF-kB activation in increased the incidence of K-ras point mutation and proliferation human colon epithelial HCT-116 cells through multiple mecha- index in colon tumors [134]. nisms involving, among others, the terminal mitochondrial respi- ratory complex IV [124]. 2.3.2. Is FXRa involved in this tumor? In HT29 and Caco-2 human enterocyte cell lines, GW4064 2.3.2.1. FXRa: gatekeeper of BA homeostasis in intestine. As in treatment abolished the TNF-a-mediated induction of IL-1b hepatocytes, concentrations of BAs within enterocytes are tightly expression by decreasing NF-kB transcriptional activity [148]. regulated in order to protect cells against BAs toxicity. In intestinal Moreover, FXRa target genes were repressed by pro-inammatory cells, FXRa activation decreases BA absorption by repressing the stimuli and NF-kB in enterocyte cell line or in ex-vivo ileal samples expression of human IBAT [135]. In line with this nding, FXRa / of mice [150]. The authors propose a physical interaction between   mice display enhanced intestinal BA absorption [64]. Furthermore, NF-kB and FXRa that may be involved in reciprocal repression for FXRa promotes BA transport through enterocytes and excretion binding promoter sequences of their respective target genes. into the portal system by enhancing respectively the expression of 2.3.2.2.2. FXRa activation controls mucosal immune system. In IBABP [64,136] and OSTa/b in basolateral side [137,138]. addition, FXRa agonist in activated immune cells negatively regu- Interestingly, it has been demonstrated that human and mouse lates inammatory cytokine expression. Indeed, FXRa activation vitamin-D nuclear receptor (VDR) can also bind LCA [139]. This reduces inammatory signaling in activated human peripheral M. Baptissart et al. / Biochimie 95 (2013) 504e517 513 blood mononuclear cells, puried CD14 monocytes and dendritic bowel disease. Recently, loss of function mutation of the Tgr5 gene cells, as well as in lamina propria mononuclear cells from patients was associated with ulcerative colitis [155]. Conversely, Crohn’s with intestinal chronic inammation [148]. Interestingly, in DSS or disease patients exhibited an increased expression of TGR5 TNBS-induced colitis mice, FXRa agonist counteracts expression of compared to non-inamed colon [67]. This observation was mainly pro-inammatory genes such as TNF-a or IL-1b, both NF-kB tran- attributed to excess recruitment of immune cells which express scriptional targets [148]. Moreover, addition of INT-747 signi- TGR5 in intestinal mucosa. cantly decreases TNF-a secretion in different mouse immune cell TGR5 null mice aged from 12 months present altered colonic type such as monocytes or dendritic cells [144]. histology with increased recruitment of mononuclear cells associ- Recently, using mouse Fxr / mice, Vavassori et al. describe ated with disruption of intestinal barrier architecture and increased   a molecular mechanism whereby FXRa could inhibit immune expression and mislocalisation of Zonula-occludens 1 (Zo1) [67]. function through NF-kB transcriptional activity repression [144]. In addition, systemic administration to mouse model of colitis of Indeed, treatment of LPS-activated macrophages with INT-747 ciprooxacin or oleanoloic acid, both well characterized TGR5 results in stabilizing the nuclear co-repressor NCOR on the NF-kB agonists, protects against development of local signs of colonic responsive element of the IL-1b promoter. Thus, immune cell inammation and reduces expression of inammatory mediators modulation by FXRa may be responsible for intestinal inamma- such as IL-6, TNF-a and IFN-g [67]. tion improvement. In vitro studies have provided evidences that TGR5 exerts By preventing cytokine expression, FXRa decreases the negative regulation of immune cells functions. BAs inhibit LPS- recruitment of an excess of inammatory cells to the intestinal induced cytokine expression in Kupffer cells via TGR5-cAMP mucosa preserving barrier permeability. Furthermore, in vitro dependent pathways [105]. In RAW macrophage oleanoloic acid experiment suggests a direct role of FXRa in maintaining intestinal leads to reduced TNF-a release [67]. barrier integrity independently of its anti-inammatory function. Thus through regulation of immune function, TGR5 protects Indeed, FXRa activation protects against DSS-induced permeability intestine from chronic inammation and prevents carcinogenesis. in Caco-2 cell monolayer [148]. However the potential involvement of FXRa in controlling expression and localization of tight junction 2.3.3.2. TGR5 and intestinal motility. In a recent study, Poole et al. proteins remains unknown. [156] report that TGR5 is localized in the enteric nervous system prominently expressed by inhibitory motor neurons in both colon 2.3.2.3. FXRa: from anti-inammatory to anti-proliferative func- and proximal small intestine mediating the effects of BAs on tion. In addition, FXRa was shown to control enterocyte balance intestinal motility. In vivo, luminal administration of DCA inhibits between proliferation and apoptosis. Two-month old FXRa null gastric emptying and small intestinal transit. Furthermore, DCA mice exhibit an expansion of basal proliferative intestinal inhibits spontaneous phasic activity of isolated segments of ileum compartment concomitantly with increased protein levels of b- and colon induced by a neurogenic, cholinergic and nitrergic catenine, c-myc and cyclin-D1 [146]. Furthermore, in nude mice, mechanism [156]. reactivation of FXRa in injected intestinal cancer cell increases Alternatively, releasing GLP-1 from entero-endocrine L-cells, TGR5 apoptotic events, reduces proliferation and blocks growth of activation leads indirectly to inhibition of proximal gut transit [157]. xenograft [151]. Thus TGR5 could play a role in increased exposure of intestinal LS174T human colon adenocarcinoma cells infected with the mucosa to BA toxicity and then in inammatory bowel disease and chimeric protein VP16FXRa present increased mRNA levels of FXRa carcinogenesis. target gene Shp paralleled with increased expression of proapo- ptotic genes such as Fas or Fadd [151]. Moreover, decreased mRNA 2.3.4. Conclusion levels of anti-apoptotic Bcl2 and pro-inammatory gene Tnf-a were By maintaining BA pool size in intestine, FXRa prevents chronic observed. In addition, GW4064 was able to activate apoptosis in injuries and inammation that could lead to carcinogenesis. In both human colon HT29 cells and normal intestinal mucosa in vivo addition, the ability of FXRa to maintain intestinal homeostasis [151]. includes both control of inammatory response in enterocytes and In mouse liver, TNF-a production by activated macrophages was regulation of intestinal innate immunity functions. In addition and shown to promote Wnt/beta-catenin signaling through inhibition by this way, FXRa also controls the balance between proliferation of glycogen synthase kinase 3 b (GSK3b), which may contribute to and apoptosis of enterocytes. Moreover, FXRa preserves intestinal tumor development [152]. Thus, by repressing mucosal inltration barrier permeability by decreasing recruitment of inammatory of activated macrophages and then TNF-a signaling, FXRa could cells to the intestinal mucosa (Fig. 5). contribute to decrease Wnt signaling in enterocytes and prevent Regarding TGR5, it regulates immune function and protects proliferation and tumor development. intestine from chronic inammation and prevents carcinogenesis. Consistent with decreased level of FXRa, data indicate that However, by inhibiting gastric emptying and small intestinal ileal expression of the FXRa target gene Shp is markedly lowered transit, TGR5 could increase exposure of intestinal mucosa to BA (50%) in patients with Crohn’s colitis [150]. As it was described in toxicity and then inducing inammatory bowel disease and carci- human breast carcinoma and leukemia cell lines as well as in nogenesis (Fig. 6). mouse embryonic cells, Shp suppresses cell proliferation and promotes apoptosis [153,154]. Inversely, loss of Shp expression 3. Conclusions and perspectives inhibits 3-(1-adamantyl)-4-hydroxyphenyl]-3-chlorocinnamic acid (3-Cl-AHPC)-mediated apoptosis in both mouse and human cells BAs represent the main cholesterol catabolites. Their synthesis [154]. Thus, by decreasing TNF-a production and promoting Shp take place in liver and their entero-hepatic cycle importance has expression, FXRa could maintain intestinal homeostasis and been known for decades. They ensure fat solubilization and emul- preserve from carcinogenesis. sication and thus promote digestion. In addition to this mechanical role, BAs have been described as 2.3.3. Is there a role of TGR5 in intestinal diseases? signaling molecules. They act through the binding of two specic 2.3.3.1. TGR5 shows anti-inammatory function. Few are known receptors: the nuclear receptor FXRa and the membrane receptor about the role of TGR5 on the pathogenesis of human inammatory TGR5. The identication of these two receptors has recently opened 514 M. Baptissart et al. / Biochimie 95 (2013) 504e517 a new eld of research in order to dene if these receptors could be [9] C.J. Sinal, M. Tohkin, M. Miyata, J.M. Ward, G. Lambert, F.J. Gonzalez, Targeted potential pharmacological targets. In this line, interesting data have disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis, Cell 102 (2000) 731e744. been obtained in vitro or in rodent models suggesting that BA [10] B. Goodwin, S.A. Jones, R.R. Price, M.A. Watson, D.D. McKee, L.B. Moore, receptors could be targeted for pathologies such as diabetes and C. Galardi, J.G. Wilson, M.C. Lewis, M.E. Roth, P.R. Maloney, T.M. Willson, obesity. However, it is also important to explore their potential role S.A. Kliewer, A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis, Mol. Cell 6 (2000) 517e526. in cancer development as altered BA concentrations have been [11] J.Y. Chiang, R. Kimmel, C. Weinberger, D. Stroup, Farnesoid X receptor associated with tumor process since many decades [158]. responds to bile acids and represses cholesterol 7alpha-hydroxylase gene Within this review we report the involvement of BAs through (CYP7A1) transcription, J. Biol. Chem. 275 (2000) 10918e10924. [12] P. Lefebvre, B. Cariou, F. Lien, F. Kuipers, B. Staels, Role of bile acids and bile both receptors in pathologies of the gastro-enteric tract and more acid receptors in metabolic regulation, Physiol. Rev. 89 (2009) 147e191. precisely tumor development. The analyses of human data as well [13] T. Claudel, B. Staels, F. Kuipers, The Farnesoid X receptor: a molecular link as ex-vivo and transgenic mouse models combined with pharma- between bile acid and lipid and glucose metabolism, Arterioscler. Thromb.  Vasc. Biol. 25 (2005) 2020e2030. cological approaches help to de ne the exact role of BAs in these [14] M. Watanabe, S.M. Houten, L. Wang, A. Moschetta, D.J. Mangelsdorf, pathologies. R.A. Heyman, D.D. Moore, J. Auwerx, Bile acids lower triglyceride levels via It is well known that BAs per se show detrimental effects due to a pathway involving FXR, SHP, and SREBP-1c, J. Clin. Invest. 113 (2004) e their chemical properties (detergent) that can lead to DNA 1408 1418. [15] K.R. Stayrook, K.S. Bramlett, R.S. Savkur, J. Ficorilli, T. Cook, M.E. Christe, damages. However, through the activation of both receptors, BAs L.F. Michael, T.P. Burris, Regulation of carbohydrate metabolism by the Far- could have paradoxical activities depending on considered tissues nesoid X receptor, Endocrinology 146 (2005) 984e991. [16] T. Maruyama, Y. Miyamoto, T. Nakamura, Y. Tamai, H. Okada, E. Sugiyama, (Figs. 5 and 6). Thus, if in esophagus FXRa might exert deleterious   T. Nakamura, H. Itadani, K. Tanaka, Identi cation of membrane-type receptor effects promoting in ammation and resistance to apoptosis, these for bile acids (M-BAR), Biochem. Biophys. Res. Commun. 298 (2002) effects are opposite in liver and intestine, where it counteracts 714e719. cancer development. Concerning TGR5, if its high expression is [17] Y. Kawamata, R. Fujii, M. Hosoya, M. Harada, H. Yoshida, M. Miwa, S. Fukusumi, Y. Habata, T. Itoh, Y. Shintani, S. Hinuma, Y. Fujisawa, M. Fujino, associated to esophagus adenocarcinoma, it seems to have more A G protein-coupled receptor responsive to bile acids, J. Biol. Chem. 278 complex roles in liver and intestine carcinogenesis. (2003) 9435e9440. If genetic predisposition seems to be involved like for many [18] T. Maruyama, K. Tanaka, J. Suzuki, H. Miyoshi, N. Harada, T. Nakamura, Y. Miyamoto, A. Kanatani, Y. Tamai, Targeted disruption of G protein-coupled other diseases, lifestyle must play an important role on develop- bile acid receptor 1 (Gpbar1/M-Bar) in mice, J. Endocrinol. 191 (2006) ment of these cancers. Indeed, limiting fat and meat will maintain 197e205. BA homeostasis lower and thus reduces their cell toxicity. More- [19] M. Watanabe, S.M. Houten, C. Mataki, M.A. Christoffolete, B.W. Kim, H. Sato, N. Messaddeq, J.W. Harney, O. Ezaki, T. Kodama, K. Schoonjans, A.C. Bianco, over, these studies are of major importance as they are dealing with J. Auwerx, Bile acids induce energy expenditure by promoting intracellular pathologies whose incidences are increasing every year. Altogether thyroid hormone activation, Nature 439 (2006) 484e489. this suggests that we need to clearly identify all the involved [20] C. Thomas, A. Gioiello, L. Noriega, A. Strehle, J. Oury, G. Rizzo, A. Macchiarulo, pathways activated by BAs through both FXR and TGR5. It also H. Yamamoto, C. Mataki, M. Pruzanski, R. Pellicciari, J. Auwerx, K. Schoonjans, a TGR5-mediated bile acid sensing controls glucose homeostasis, Cell Metab. highlights the complexity of the system as activation of a receptor 10 (2009) 167e177. could lead to both benec and deleterious effects depending on the [21] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer considered pathology. statistics, CA Cancer J. Clin. 61 (2011) 69e90. [22] G.W. Falk, Barrett’s esophagus, Gastroenterology 122 (2002) 1569e1591. Moreover, strategy to generate pharmacological drugs to treat [23] D. Coppola, R.C. Karl, Barrett’s esophagus and Barrett’s associated neoplasia: diseases is even more difcult as these receptors are essential for etiology and pathologic features, Cancer Contr. 6 (1999) 21e27. normal physiology. Thus, it will not be as simple to specically [24] D. Nehra, P. Howell, C.P. Williams, J.K. Pye, J. Beynon, Toxic bile acids in gastro-oesophageal reux disease: inuence of gastric acidity, Gut 44 (1999) target one BA receptor rather than the other. Thus, we need to 598e602. develop strategy to specically act on one receptor in specic cell [25] M. Menges, M. Muller, M. Zeitz, Increased acid and bile reux in Barrett’s type. We will also need to take into consideration the patient esophagus compared to reux esophagitis, and effect of proton pump inhibitor therapy, Am. J. Gastroenterol. 96 (2001) 331e337. history (genetic, environment, feeding habits.). Thus we might [26] J. Theisen, D. Nehra, D. Citron, J. Johansson, J.A. Hagen, P.F. Crookes, develop in the future personalized therapeutic. This is a challenging S.R. DeMeester, C.G. Bremner, T.R. DeMeester, J.H. Peters, Suppression of opened eld for future research that will require to intercross gastric acid secretion in patients with gastroesophageal reux disease results e e in gastric bacterial overgrowth and deconjugation of bile acids, chemical physical biological as well as clinical research areas. J. Gastrointest. Surg. 4 (2000) 50e54. [27] D. Nehra, P. Howell, J.K. Pye, J. Beynon, Assessment of combined bile acid and pH proles using an automated sampling device in gastro-oesophageal References reux disease, Br. J. Surg. 85 (1998) 134e137. [28] K. Kono, A. Takahashi, H. Sugai, H. Iizuka, H. Fujii, Trypsin activity and bile [1] R. Poupon, N. Chignard, O. Rosmorduc, V. Barbu, C. Housset. [Biliary function acid concentrations in the esophagus after distal gastrectomy, Dig. Dis. Sci. and its regulation], Med. Sci. (Paris) 20 (2004) 1096e1099. 51 (2006) 1159e1164. [2] D.W. Russell, The enzymes, regulation, and genetics of bile acid synthesis, [29] G. Towler, R. Shepherd, Application of Fishbein and Ajzen’s expectancy-value Annu. Rev. Biochem. 72 (2003) 137e174. model to understanding fat intake, Appetite 18 (1992) 15e27. [3] J.M. Ridlon, D.J. Kang, P.B. Hylemon, Bile salt biotransformations by human [30] M. Fein, J.H. Peters, T.R. DeMeester, Carcinogenesis in reux diseaseein intestinal bacteria, J. Lipid Res. 47 (2006) 241e259. search for bile-specic effects, Microsurgery 27 (2007) 647e650. [4] L. Caballeria, M.A. Auladell, P. Toran, G. Pera, D. Miranda, A. Aluma, J.D. Casas, [31] K. Miwa, H. Sahara, M. Segawa, S. Kinami, T. Sato, I. Miyazaki, T. Hattori, L. Munoz, C. Sanchez, A. Tibau, M. Birules, S. Canut, J. Bernad, J. Auba, Reux of duodenal or gastro-duodenal contents induces esophageal carci- M.M. Aizpurua, E. Alcaraz, Risk factors associated with non-alcoholic fatty noma in rats, Int. J. Cancer 67 (1996) 269e274. liver disease in subjects from primary care units. A case-control study, BMC [32] N.C. Guy, H. Garewal, H. Holubec, H. Bernstein, C.M. Payne, C. Bernstein, Gastroenterol. 8 (2008) 44. A.K. Bhattacharyya, K. Dvorak, A novel dietary-related model of esophagitis [5] W.A. Alrefai, R.K. Gill, Bile acid transporters: structure, function, regulation and Barrett’s esophagus, a premalignant lesion, Nutr. Cancer 59 (2007) and pathophysiological implications, Pharm. Res. 24 (2007) 1803e1823. 217e227. [6] M. Trauner, J.L. Boyer, Bile salt transporters: molecular characterization, [33] K.R. McQuaid, L. Laine, M.B. Fennerty, R. Souza, S.J. Spechler, Systematic function, and regulation, Physiol. Rev. 83 (2003) 633e671. review: the role of bile acids in the pathogenesis of gastro-oesophageal [7] M. Makishima, A.Y. Okamoto, J.J. Repa, H. Tu, R.M. Learned, A. Luk, M.V. Hull, reux disease and related neoplasia, Aliment. Pharmacol. Ther. 34 (2011) K.D. Lustig, D.J. Mangelsdorf, B. Shan, Identication of a nuclear receptor for 146e165. bile acids, Science 284 (1999) 1362e1365. [34] A. De Gottardi, J.M. Dumonceau, F. Bruttin, A. Vonlaufen, I. Morard, L. Spahr, [8] R. Pellicciari, G. Costantino, E. Camaioni, B.M. Sadeghpour, A. Entrena, L. Rubbia-Brandt, J.L. Frossard, W.N. Dinjens, P.S. Rabinovitch, A. Hadengue, T.M. Willson, S. Fiorucci, C. Clerici, A. Gioiello, Bile acid derivatives as ligands Expression of the bile acid receptor FXR in Barrett’s esophagus and of the Farnesoid X receptor. Synthesis, evaluation, and structure-activity enhancement of apoptosis by guggulsterone in vitro, Mol. Cancer 5 (2006) 48. relationship of a series of body and side chain modied analogues of che- [35] A. van de Winkel, K.P. van Zoest, H. van Dekken, L.M. Moons, E.J. Kuipers, nodeoxycholic acid, J. Med. Chem. 47 (2004) 4559e4569. L.J. van der Laan, Differential expression of the nuclear receptors Farnesoid X M. Baptissart et al. / Biochimie 95 (2013) 504e517 515 receptor (FXR) and pregnane X receptor (PXR) for grading dysplasia in [59] M. Ananthanarayanan, N. Balasubramanian, M. Makishima, D.J. Mangelsdorf, patients with Barrett’s oesophagus, Histopathology 58 (2011) 246e253. F.J. Suchy, Human bile salt export pump promoter is transactivated by the [36] A. Capello, L.M. Moons, A. Van de Winkel, P.D. Siersema, H. van Dekken, Farnesoid X receptor/bile acid receptor, J. Biol. Chem. 276 (2001) E.J. Kuipers, J.G. Kusters, Bile acid-stimulated expression of the Farnesoid X 28857e28865. receptor enhances the immune response in Barrett esophagus, Am. J. Gas- [60] Y. Yang, M. Zhang, G. Eggertsen, J.Y. Chiang, On the mechanism of bile acid troenterol. 103 (2008) 1510e1516. inhibition of rat sterol 12alpha-hydroxylase gene (CYP8B1) transcription: [37] K. Dvorak, G.S. Watts, L. Ramsey, H. Holubec, C.M. Payne, C. Bernstein, roles of alpha-fetoprotein transcription factor and hepatocyte nuclear factor G.J. Jenkins, R.E. Sampliner, A. Prasad, H.S. Garewal, H. Bernstein, Expression 4alpha, Biochim. Biophys. Acta 1583 (2002) 63e73. of bile acid transporting proteins in Barrett’s esophagus and esophageal [61] L.A. Denson, E. Sturm, W. Echevarria, T.L. Zimmerman, M. Makishima, adenocarcinoma, Am. J. Gastroenterol. 104 (2009) 302e309. D.J. Mangelsdorf, S.J. Karpen, The orphan nuclear receptor, shp, mediates bile [38] A. Mantovani, A. Sica, S. Sozzani, P. Allavena, A. Vecchi, M. Locati, The che- acid-induced inhibition of the rat bile acid transporter, ntcp, Gastroenter- mokine system in diverse forms of macrophage activation and polarization, ology 121 (2001) 140e147. Trends Immunol. 25 (2004) 677e686. [62] O. Barbier, I.P. Torra, A. Sirvent, T. Claudel, C. Blanquart, D. Duran-Sandoval, [39] C.J. van der Woude, P.L. Jansen, A.T. Tiebosch, A. Beuving, M. Homan, F. Kuipers, V. Kosykh, J.C. Fruchart, B. Staels, FXR induces the UGT2B4 J.H. Kleibeuker, H. Moshage, Expression of apoptosis-related proteins in enzyme in hepatocytes: a potential mechanism of negative feedback control Barrett’s metaplasia-dysplasia-carcinoma sequence: a switch to a more of FXR activity, Gastroenterology 124 (2003) 1926e1940. resistant phenotype, Hum. Pathol. 33 (2002) 686e692. [63] T. Inagaki, M. Choi, A. Moschetta, L. Peng, C.L. Cummins, J.G. McDonald, G. Luo, [40] N. Katada, R.A. Hinder, T.C. Smyrk, N. Hirabayashi, G. Perdikis, R.J. Lund, S.A. Jones, B. Goodwin, J.A. Richardson, R.D. Gerard, J.J. Repa, D.J. Mangelsdorf, T. Woodward, P.J. Klingler, Apoptosis is inhibited early in the dysplasia- S.A. Kliewer, Fibroblast growth factor 15 functions as an enterohepatic signal carcinoma sequence of Barrett esophagus, Arch. Surg. 132 (1997) 728e733. to regulate bile acid homeostasis, Cell Metab. 2 (2005) 217e225. [41] K. Dvorakova, C.M. Payne, L. Ramsey, H. Bernstein, H. Holubec, M. Chavarria, [64] T. Kok, C.V. Hulzebos, H. Wolters, R. Havinga, L.B. Agellon, F. Stellaard, B. Shan, C. Bernstein, R.E. Sampliner, C. Riley, A. Prasad, H. Garewal, Apoptosis M. Schwarz, F. Kuipers, Enterohepatic circulation of bile salts in Farnesoid X resistance in Barrett’s esophagus: ex vivo bioassay of live stressed tissues, receptor-decient mice: efcient intestinal bile salt absorption in the absence Am. J. Gastroenterol. 100 (2005) 424e431. of ileal bile acid-binding protein, J. Biol. Chem. 278 (2003) 41930e41937. [42] S. Shishodia, B.B. Aggarwal, Guggulsterone inhibits NF-kappaB and Ikappa- [65] G. Marchesini, E. Bugianesi, G. Forlani, F. Cerrelli, M. Lenzi, R. Manini, Balpha kinase activation, suppresses expression of anti-apoptotic gene S. Natale, E. Vanni, N. Villanova, N. Melchionda, M. Rizzetto, Nonalcoholic products, and enhances apoptosis, J. Biol. Chem. 279 (2004) 47148e47158. fatty liver, steatohepatitis, and the metabolic syndrome, Hepatology 37 [43] J. Hong, J. Behar, J. Wands, M. Resnick, L.J. Wang, R.A. DeLellis, D. Lambeth, (2003) 917e923. R.F. Souza, S.J. Spechler, W. Cao, Role of a novel bile acid receptor TGR5 in the [66] J.D. Horton, J.L. Goldstein, M.S. Brown, SREBPs: activators of the complete development of oesophageal adenocarcinoma, Gut 59 (2010) 170e180. program of cholesterol and fatty acid synthesis in the liver, J. Clin. Invest. 109 [44] A.S. Knisely, S.S. Strautnieks, Y. Meier, B. Stieger, J.A. Byrne, B.C. Portmann, (2002) 1125e1131. L.N. Bull, L. Pawlikowska, B. Bilezikci, F. Ozcay, A. Laszlo, L. Tiszlavicz, [67] S. Cipriani, A. Mencarelli, M.G. Chini, E. Distrutti, B. Renga, G. Bifulco, L. Moore, J. Raftos, H. Arnell, B. Fischler, A. Nemeth, N. Papadogiannakis, F. Baldelli, A. Donini, S. Fiorucci, The bile acid receptor GPBAR-1 (TGR5) J. Cielecka-Kuszyk, I. Jankowska, J. Pawlowska, H. Melin-Aldana, modulates integrity of intestinal barrier and immune response to experi- K.M. Emerick, P.F. Whitington, G. Mieli-Vergani, R.J. Thompson, Hepatocel- mental colitis, PLoS One 6 (2010) e25637. lular carcinoma in ten children under ve years of age with bile salt export [68] T.T. Lu, M. Makishima, J.J. Repa, K. Schoonjans, T.A. Kerr, J. Auwerx, pump deciency, Hepatology 44 (2006) 478e486. D.J. Mangelsdorf, Molecular basis for feedback regulation of bile acid [45] S. Kitazawa. [Studies on initiating activity of secondary bile acids for rat synthesis by nuclear receptors, Mol. Cell 6 (2000) 507e515. hepatocarcinogenesis], Hokkaido Igaku Zasshi 68 (1993) 110e120. [69] C.R. Pullinger, C. Eng, G. Salen, S. Shefer, A.K. Batta, S.K. Erickson, A. Verhagen, [46] R.G. Cameron, K. Imaida, H. Tsuda, N. Ito, Promotive effects of steroids and C.R. Rivera, S.J. Mulvihill, M.J. Malloy, J.P. Kane, Human cholesterol 7alpha- bile acids on hepatocarcinogenesis initiated by diethylnitrosamine, Cancer hydroxylase (CYP7A1) deciency has a hypercholesterolemic phenotype, Res. 42 (1982) 2426e2428. J. Clin. Invest. 110 (2002) 109e117. [47] F. Yang, X. Huang, T. Yi, Y. Yen, D.D. Moore, W. Huang, Spontaneous devel- [70] Y. Zhang, F.Y. Lee, G. Barrera, H. Lee, C. Vales, F.J. Gonzalez, T.M. Willson, opment of liver tumors in the absence of the bile acid receptor Farnesoid X P.A. Edwards, Activation of the nuclear receptor FXR improves hypergly- receptor, Cancer Res. 67 (2007) 863e867. cemia and hyperlipidemia in diabetic mice, Proc. Natl. Acad. Sci. U.S.A. 103 [48] H. Tsuda, T. Masui, K. Imaida, S. Fukushima, N. Ito, Promotive effect of (2006) 1006e1011. primary and secondary bile acids on the induction of gamma-glutamyl [71] K. Yamagata, H. Daitoku, Y. Shimamoto, H. Matsuzaki, K. Hirota, J. Ishida, transpeptidase-positive liver cell foci as a possible endogenous factor for A. Fukamizu, Bile acids regulate gluconeogenic gene expression via small hepatocarcinogenesis in rats, Gann 75 (1984) 871e875. heterodimer partner-mediated repression of hepatocyte nuclear factor 4 and [49] C.M. Rodrigues, G. Fan, X. Ma, B.T. Kren, C.J. Steer, A novel role for urso- Foxo1, J. Biol. Chem. 279 (2004) 23158e23165. deoxycholic acid in inhibiting apoptosis by modulating mitochondrial [72] K. Ma, P.K. Saha, L. Chan, D.D. Moore, Farnesoid X receptor is essential for membrane perturbation, J. Clin. Invest. 101 (1998) 2790e2799. normal glucose homeostasis, J. Clin. Invest. 116 (2006) 1102e1109. [50] R.J. Sokol, B.M. Winklhofer-Roob, M.W. Devereaux, J.M. McKim Jr., Genera- [73] A.B. Rogers, J.G. Fox, Inammation and Cancer. I. Rodent models of infectious tion of hydroperoxides in isolated rat hepatocytes and hepatic mitochondria gastrointestinal and liver cancer, Am. J. Physiol. Gastrointest. Liver Physiol. exposed to hydrophobic bile acids, Gastroenterology 109 (1995) 1249e1256. 286 (2004) G361eG366. [51] B. Yerushalmi, R. Dahl, M.W. Devereaux, E. Gumpricht, R.J. Sokol, Bile acid- [74] W.E. Naugler, T. Sakurai, S. Kim, S. Maeda, K. Kim, A.M. Elsharkawy, M. Karin, induced rat hepatocyte apoptosis is inhibited by antioxidants and blockers Gender disparity in liver cancer due to sex differences in MyD88-dependent of the mitochondrial permeability transition, Hepatology 33 (2001) 616e626. IL-6 production, Science 317 (2007) 121e124. [52] K.P. Tan, M. Yang, S. Ito, Activation of nuclear factor (erythroid-2 like) factor [75] M.K. Li, J.M. Crawford, The pathology of cholestasis, Semin. Liver Dis. 24 2 by toxic bile acids provokes adaptive defense responses to enhance cell (2004) 21e42. survival at the emergence of oxidative stress, Mol. Pharmacol. 72 (2007) [76] S.A. Shah, Y. Volkov, Q. Arn, M.M. Abdel-Latif, D. Kelleher, Ursodeoxycholic 1380e1390. acid inhibits interleukin 1 beta [corrected] and deoxycholic acid-induced [53] H. Bernstein, C.M. Payne, C. Bernstein, J. Schneider, S.E. Beard, C.L. Crowley, activation of NF-kappaB and AP-1 in human colon cancer cells, Int. J. Activation of the promoters of genes associated with DNA damage, oxidative Cancer 118 (2006) 532e539. stress, ER stress and protein malfolding by the bile salt, deoxycholate, Tox- [77] G.J. Jenkins, K. Harries, S.H. Doak, A. Wilmes, A.P. Grifths, J.N. Baxter, icol. Lett. 108 (1999) 37e46. J.M. Parry, The bile acid deoxycholic acid (DCA) at neutral pH activates NF- [54] L. Qiao, E. Studer, K. Leach, R. McKinstry, S. Gupta, R. Decker, R. Kukreja, kappaB and induces IL-8 expression in oesophageal cells in vitro, Carcino- K. Valerie, P. Nagarkatti, W. El Deiry, J. Molkentin, R. Schmidt-Ullrich, genesis 25 (2004) 317e323. P.B. Fisher, S. Grant, P.B. Hylemon, P. Dent, Deoxycholic acid (DCA) causes [78] Y.D. Wang, W.D. Chen, M. Wang, D. Yu, B.M. Forman, W. Huang, Farnesoid X ligand-independent activation of epidermal growth factor receptor (EGFR) receptor antagonizes nuclear factor kappaB in hepatic inammatory and FAS receptor in primary hepatocytes: inhibition of EGFR/mitogen- response, Hepatology 48 (2008) 1632e1643. activated protein kinase-signaling module enhances DCA-induced [79] T. Tanaka, T. Uchiumi, E. Hinoshita, A. Inokuchi, S. Toh, M. Wada, H. Takano, apoptosis, Mol. Biol. Cell 12 (2001) 2629e2645. K. Kohno, M. Kuwano, The human multidrug resistance protein 2 gene: [55] P. Kwo, T. Patel, S.F. Bronk, G.J. Gores, Nuclear serine protease activity functional characterization of the 50-anking region and expression in contributes to bile acid-induced apoptosis in hepatocytes, Am. J. Physiol. 268 hepatic cells, Hepatology 30 (1999) 1507e1512. (1995) G613eG621. [80] M.S. Kim, J. Shigenaga, A. Moser, K. Feingold, C. Grunfeld, Repression of [56] H. Higuchi, J.H. Yoon, A. Grambihler, N. Werneburg, S.F. Bronk, G.J. Gores, Bile Farnesoid X receptor during the acute phase response, J. Biol. Chem. 278 acids stimulate cFLIP phosphorylation enhancing TRAIL-mediated apoptosis, (2003) 8988e8995. J. Biol. Chem. 278 (2003) 454e461. [81] A. Wolfe, A. Thomas, G. Edwards, R. Jaseja, G.L. Guo, U. Apte, Increased [57] T. Patel, G.J. Gores, Inhibition of bile-salt-induced hepatocyte apoptosis by the activation of the Wnt/beta-catenin pathway in spontaneous hepatocellular antioxidant lazaroid U83836E, Toxicol. Appl. Pharmacol. 142 (1997) 116e122. carcinoma observed in Farnesoid X receptor knockout mice, J. Pharmacol. [58] E. Gumpricht, R. Dahl, M.W. Devereaux, R.J. Sokol, Beta-carotene prevents Exp. Ther. 338 (2011) 12e21. bile acid-induced cytotoxicity in the rat hepatocyte: evidence for an anti- [82] I. Kim, K. Morimura, Y. Shah, Q. Yang, J.M. Ward, F.J. Gonzalez, Spontaneous oxidant and anti-apoptotic role of beta-carotene in vitro, Pediatr. Res. 55 hepatocarcinogenesis in Farnesoid X receptor-null mice, Carcinogenesis 28 (2004) 814e821. (2007) 940e946. 516 M. Baptissart et al. / Biochimie 95 (2013) 504e517 [83] D.A. Mann, D.E. Smart, Transcriptional regulation of hepatic stellate cell [109] C. Rust, G.J. Gores, Apoptosis and liver disease, Am. J. Med. 108 (2000) activation, Gut 50 (2002) 891e896. 567e574. [84] S.L. Friedman, Liver brosis e from bench to bedside, J. Hepatol. 38 (Suppl. 1) [110] J.H. Yoon, G.J. Gores, Death receptor-mediated apoptosis and the liver, (2003) S38eS53. J. Hepatol. 37 (2002) 400e410. [85] M.J. Arthur, Fibrogenesis II. Metalloproteinases and their inhibitors in liver [111] J.I. Yang, J.H. Yoon, S.J. Myung, G.Y. Gwak, W. Kim, G.E. Chung, S.H. Lee, brosis, Am. J. Physiol. Gastrointest. Liver Physiol. 279 (2000) G245eG249. S.M. Lee, C.Y. Kim, H.S. Lee, Bile acid-induced TGR5-dependent c-Jun-N [86] S. Fiorucci, G. Rizzo, E. Antonelli, B. Renga, A. Mencarelli, L. Riccardi, terminal kinase activation leads to enhanced caspase 8 activation in hepa- S. Orlandi, M. Pruzanski, A. Morelli, R. Pellicciari, A Farnesoid X receptor- tocytes, Biochem. Biophys. Res. Commun. 361 (2007) 156e161. small heterodimer partner regulatory cascade modulates tissue metal- [112] K. Wakai, K. Hirose, K. Matsuo, H. Ito, K. Kuriki, T. Suzuki, T. Kato, T. Hirai, loproteinase inhibitor-1 and matrix metalloprotease expression in hepatic Y. Kanemitsu, K. Tajima, Dietary risk factors for colon and rectal cancers: stellate cells and promotes resolution of liver brosis, J. Pharmacol. Exp. a comparative case-control study, J. Epidemiol. 16 (2006) 125e135. Ther. 314 (2005) 584e595. [113] A. Chao, M.J. Thun, C.J. Connell, M.L. McCullough, E.J. Jacobs, W.D. Flanders, [87] Y. Nakamoto, S. Kaneko, Mechanisms of viral hepatitis induced liver injury, C. Rodriguez, R. Sinha, E.E. Calle, Meat consumption and risk of colorectal Curr. Mol. Med. 3 (2003) 537e544. cancer, JAMA 293 (2005) 172e182. [88] T. Kitada, S. Seki, S. Iwai, T. Yamada, H. Sakaguchi, K. Wakasa, In situ [114] J.A. Meyerhardt, D. Niedzwiecki, D. Hollis, L.B. Saltz, F.B. Hu, R.J. Mayer, detection of oxidative DNA damage, 8-hydroxydeoxyguanosine, in chronic H. Nelson, R. Whittom, A. Hantel, J. Thomas, C.S. Fuchs, Association of dietary human liver disease, J. Hepatol. 35 (2001) 613e618. patterns with cancer recurrence and survival in patients with stage III colon [89] B.L. Urquhart, R.G. Tirona, R.B. Kim, Nuclear receptors and the regulation of cancer, JAMA 298 (2007) 754e764. drug-metabolizing enzymes and drug transporters: implications for inter- [115] M.L. Slattery, K.M. Boucher, B.J. Caan, J.D. Potter, K.N. Ma, Eating patterns and individual variability in response to drugs, J. Clin. Pharmacol. 47 (2007) risk of colon cancer, Am. J. Epidemiol. 148 (1998) 4e16. 566e578. [116] M.L. Slattery, J.D. Potter, D.M. Duncan, T.D. Berry, Dietary fats and colon [90] W. Huang, K. Ma, J. Zhang, M. Qatanani, J. Cuvillier, J. Liu, B. Dong, X. Huang, cancer: assessment of risk associated with specic fatty acids, Int. J. Cancer D.D. Moore, Nuclear receptor-dependent bile acid signaling is required for 73 (1997) 670e677. normal liver regeneration, Science 312 (2006) 233e236. [117] H.L. Newmark, K. Yang, N. Kurihara, K. Fan, L.H. Augenlicht, M. Lipkin, [91] F.Y. Lee, T.Q. de Aguiar Vallim, H.K. Chong, Y. Zhang, Y. Liu, S.A. Jones, Western-style diet-induced colonic tumors and their modulation by calcium T.F. Osborne, P.A. Edwards, Activation of the Farnesoid X receptor provides and vitamin D in C57Bl/6 mice: a preclinical model for human sporadic colon protection against acetaminophen-induced hepatic toxicity, Mol. Endocrinol. cancer, Carcinogenesis 30 (2009) 88e92. 24 (2010) 1626e1636. [118] K. Yang, W. Edelmann, K. Fan, K. Lau, D. Leung, H. Newmark, R. Kucherlapati, [92] K. Noh, Y.M. Kim, Y.W. Kim, S.G. Kim, Farnesoid X receptor activation by M. Lipkin, Dietary modulation of carcinoma development in a mouse model chenodeoxycholic acid induces detoxifying enzymes through AMP-activated for human familial adenomatous polyposis, Cancer Res. 58 (1998) protein kinase and extracellular signal-regulated kinase 1/2-mediated 5713e5717. phosphorylation of CCAAT/enhancer binding protein beta, Drug Metab. [119] K.A. Baltgalvis, F.G. Berger, M.M. Pena, J.M. Davis, J.A. Carson, The interaction Dispos. 39 (2011) 1451e1459. of a high-fat diet and regular moderate intensity exercise on intestinal polyp [93] R.J. Shaw, K.A. Lamia, D. Vasquez, S.H. Koo, N. Bardeesy, R.A. Depinho, development in Apc Min/ mice, Cancer Prev. Res. (Phila) 2 (2009) 641e649.  M. Montminy, L.C. Cantley, The kinase LKB1 mediates glucose homeostasis in [120] A. Bajor, P.G. Gillberg, H. Abrahamsson, Bile acids: short and long term liver and therapeutic effects of metformin, Science 310 (2005) 1642e1646. effects in the intestine, Scand. J. Gastroenterol. 45 (2010) 645e664. [94] C.G. Lee, Y.W. Kim, E.H. Kim, Z. Meng, W. Huang, S.J. Hwang, S.G. Kim, Far- [121] D.H. Stamp, Three hypotheses linking bile to carcinogenesis in the gastro- nesoid X receptor protects hepatocytes from injury by repressing miR-199a- intestinal tract: certain bile salts have properties that may be used to 3p, which increases levels of LKB1, Gastroenterology 142 (2012). complement chemotherapy, Med. Hypotheses 59 (2002) 398e405. 1206.e7e1217.e7. [122] P.A. Craven, J. Pfanstiel, F.R. DeRubertis, Role of reactive oxygen in bile salt [95] F. Farinati, R. Cardin, M. Fiorentino, A. D’Errico, W. Grigioni, A. Cecchetto, stimulation of colonic epithelial proliferation, J. Clin. Invest. 77 (1986) R. Naccarato, Imbalance between cytoproliferation and apoptosis in hepatitis 850e859. C virus related chronic liver disease, J. Viral Hepat. 8 (2001) 34e40. [123] H. Bernstein, H. Holubec, C. Bernstein, N. Ignatenko, E. Gerner, K. Dvorak, [96] Y.D. Wang, F. Yang, W.D. Chen, X. Huang, L. Lai, B.M. Forman, W. Huang, D. Besselsen, L. Ramsey, M. Dall’Agnol, K.A. Blohm-Mangone, J. Padilla- Farnesoid X receptor protects liver cells from apoptosis induced by serum Torres, H. Cui, H. Garewal, C.M. Payne, Unique dietary-related mouse model deprivation in vitro and fasting in vivo, Mol. Endocrinol. 22 (2008) of colitis, Inamm. Bowel Dis. 12 (2006) 278e293. 1622e1632. [124] C.M. Payne, C. Weber, C. Crowley-Skillicorn, K. Dvorak, H. Bernstein, [97] C. Thomas, J. Auwerx, K. Schoonjans, Bile acids and the membrane bile acid C. Bernstein, H. Holubec, B. Dvorakova, H. Garewal, Deoxycholate induces receptor TGR5econnecting nutrition and metabolism, Thyroid 18 (2008) mitochondrial oxidative stress and activates NF-kappaB through multiple 167e174. mechanisms in HCT-116 colon epithelial cells, Carcinogenesis 28 (2007) [98] H. Sato, C. Genet, A. Strehle, C. Thomas, A. Lobstein, A. Wagner, 215e222. C. Mioskowski, J. Auwerx, R. Saladin, Anti-hyperglycemic activity of a TGR5 [125] J.M. Longpre, G. Loo, Protection of human colon epithelial cells against agonist isolated from Olea europaea, Biochem. Biophys. Res. Commun. 362 deoxycholate by rottlerin, Apoptosis 13 (2008) 1162e1171. (2007) 793e798. [126] M. Venturi, R.J. Hambly, B. Glinghammar, J.J. Rafter, I.R. Rowland, Genotoxic [99] S. Fiorucci, A. Mencarelli, G. Palladino, S. Cipriani, Bile-acid-activated activity in human faecal water and the role of bile acids: a study using the receptors: targeting TGR5 and Farnesoid-X-receptor in lipid and glucose alkaline comet assay, Carcinogenesis 18 (1997) 2353e2359. disorders, Trends Pharmacol. Sci. 30 (2009) 570e580. [127] D.F. Romagnolo, R.B. Chirnomas, J. Ku, B.D. Jeffy, C.M. Payne, H. Holubec, [100] E.P. Rafferty, A.R. Wylie, K.H. Hand, C.E. Elliott, D.J. Grieve, B.D. Green, L. Ramsey, H. Bernstein, C. Bernstein, K. Kunke, A. Bhattacharyya, J. Warneke, Investigating the effects of physiological bile acids on GLP-1 secretion and H. Garewal, Deoxycholate, an endogenous tumor promoter and DNA glucose tolerance in normal and GLP-1R(-/-) mice, Biol. Chem. 392 (2011) damaging agent, modulates BRCA-1 expression in apoptosis-sensitive 539e546. epithelial cells: loss of BRCA-1 expression in colonic adenocarcinomas, [101] E. Pikarsky, R.M. Porat, I. Stein, R. Abramovitch, S. Amit, S. Kasem, Nutr. Cancer 46 (2003) 82e92. E. Gutkovich-Pyest, S. Urieli-Shoval, E. Galun, Y. Ben-Neriah, NF-kappaB [128] D. Qiao, E. Im, W. Qi, J.D. Martinez, Activator protein-1 and CCAAT/enhancer- functions as a tumour promoter in inammation-associated cancer, Nature binding protein mediated GADD153 expression is involved in deoxycholic 431 (2004) 461e466. acid-induced apoptosis, Biochim. Biophys. Acta 1583 (2002) 108e116. [102] M. Karin, F.R. Greten, NF-kappaB: linking inammation and immunity to [129] S. Yui, T. Saeki, R. Kanamoto, K. Iwami, Characteristics of apoptosis in HCT116 cancer development and progression, Nat. Rev. Immunol. 5 (2005) 749e759. colon cancer cells induced by deoxycholic acid, J. Biochem. 138 (2005) [103] G.S. Hotamisligil, Inammation and metabolic disorders, Nature 444 (2006) 151e157. 860e867. [130] S. Yui, R. Kanamoto, T. Saeki, Deoxycholic acid can induce apoptosis in the [104] Y.D. Wang, W.D. Chen, D. Yu, B.M. Forman, W. Huang, The G-Protein-coupled human colon cancer cell line HCT116 in the absence of Bax, Nutr. Cancer 60 bile acid receptor, Gpbar1 (TGR5), negatively regulates hepatic inammatory (2008) 91e96. response through antagonizing nuclear factor kappa light-chain enhancer of [131] B.W. Katona, S. Anant, D.F. Covey, W.F. Stenson, Characterization of enan- activated B cells (NF-kappaB) in mice, Hepatology 54 (2011) 1421e1432. tiomeric bile acid-induced apoptosis in colon cancer cell lines, J. Biol. Chem. [105] V. Keitel, M. Donner, S. Winandy, R. Kubitz, D. Haussinger, Expression and 284 (2009) 3354e3364. function of the bile acid receptor TGR5 in Kupffer cells, Biochem. Biophys. [132] K. Cheng, J.P. Raufman, Bile acid-induced proliferation of a human colon Res. Commun. 372 (2008) 78e84. cancer cell line is mediated by transactivation of epidermal growth factor [106] T.W. Pols, M. Nomura, T. Harach, G. Lo Sasso, M.H. Oosterveer, C. Thomas, receptors, Biochem. Pharmacol. 70 (2005) 1035e1047. G. Rizzo, A. Gioiello, L. Adorini, R. Pellicciari, J. Auwerx, K. Schoonjans, TGR5 [133] R. Pai, A.S. Tarnawski, T. Tran, Deoxycholic acid activates beta-catenin activation inhibits atherosclerosis by reducing macrophage inammation signaling pathway and increases colon cell cancer growth and invasive- and lipid loading, Cell Metab. 14 (2012) 747e757. ness, Mol. Biol. Cell 15 (2004) 2156e2163. [107] T. Patel, G.J. Gores, Apoptosis and hepatobiliary disease, Hepatology 21 [134] H. Narahara, M. Tatsuta, H. Iishi, M. Baba, N. Uedo, N. Sakai, H. Yano, (1995) 1725e1741. S. Ishiguro, K-ras point mutation is associated with enhancement by [108] T. Patel, L.R. Roberts, B.A. Jones, G.J. Gores, Dysregulation of apoptosis as deoxycholic acid of colon carcinogenesis induced by azoxymethane, but not a mechanism of liver disease: an overview, Semin. Liver Dis. 18 (1998) with its attenuation by all-trans-retinoic acid, Int. J. Cancer 88 (2000) 105e114. 157e161. M. Baptissart et al. / Biochimie 95 (2013) 504e517 517 [135] E. Neimark, F. Chen, X. Li, B.L. Shneider, Bile acid-induced negative feedback G. Laverny, L. Adorini, A. Moschetta, S.W. van Mil, Farnesoid X receptor regulation of the human ileal bile acid transporter, Hepatology 40 (2004) activation inhibits inammation and preserves the intestinal barrier in 149e156. inammatory bowel disease, Gut 60 (2011) 463e472. [136] J. Grober, I. Zaghini, H. Fujii, S.A. Jones, S.A. Kliewer, T.M. Willson, T. Ono, [149] G. Rogler, K. Brand, D. Vogl, S. Page, R. Hofmeister, T. Andus, R. Knuechel, P. Besnard, Identication of a bile acid-responsive element in the human P.A. Baeuerle, J. Scholmerich, V. Gross, Nuclear factor kappaB is activated in ileal bile acid-binding protein gene. Involvement of the Farnesoid X macrophages and epithelial cells of inamed intestinal mucosa, Gastroen- receptor/9-cis-retinoic acid receptor heterodimer, J. Biol. Chem. 274 (1999) terology 115 (1998) 357e369. 29749e29754. [150] R.M. Gadaleta, B. Oldenburg, E.C. Willemsen, M. Spit, S. Murzilli, L. Salvatore, [137] J.F. Landrier, J.J. Eloranta, S.R. Vavricka, G.A. Kullak-Ublick, The nuclear L.W. Klomp, P.D. Siersema, K.J. van Erpecum, S.W. van Mil, Activation of bile receptor for bile acids, FXR, transactivates human organic solute transporter- salt nuclear receptor FXR is repressed by pro-inammatory cytokines acti- alpha and -beta genes, Am. J. Physiol. Gastrointest. Liver Physiol. 290 (2006) vating NF-kappaB signaling in the intestine, Biochim. Biophys. Acta 1812 G476eG485. (2011) 851e858. [138] A. Rao, J. Haywood, A.L. Craddock, M.G. Belinsky, G.D. Kruh, P.A. Dawson, The [151] S. Modica, S. Murzilli, L. Salvatore, D.R. Schmidt, A. Moschetta, Nuclear bile organic solute transporter alpha-beta, Ostalpha-Ostbeta, is essential for acid receptor FXR protects against intestinal tumorigenesis, Cancer Res. 68 intestinal bile acid transport and homeostasis, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 9589e9594. (2008) 3891e3896. [152] K. Oguma, H. Oshima, M. Aoki, R. Uchio, K. Naka, S. Nakamura, A. Hirao, [139] M. Makishima, T.T. Lu, W. Xie, G.K. Whiteld, H. Domoto, R.M. Evans, H. Saya, M.M. Taketo, M. Oshima, Activated macrophages promote Wnt M.R. Haussler, D.J. Mangelsdorf, Vitamin D receptor as an intestinal bile acid signalling through tumour necrosis factor-alpha in gastric tumour cells, sensor, Science 296 (2002) 1313e1316. EMBO J. 27 (2008) 1671e1681. [140] D.K. Podolsky, Inammatory bowel disease, N. Engl. J. Med. 347 (2002) [153] M.I. Dawson, Z. Xia, G. Liu, M. Ye, J.A. Fontana, L. Farhana, B.B. Patel, 417e429. S. Arumugarajah, M. Bhuiyan, X.K. Zhang, Y.H. Han, W.B. Stallcup, [141] F.E. Ahmed, Role of genes, the environment and their interactions in the J. Fukushi, T. Mustelin, L. Tautz, Y. Su, D.L. Harris, N. Waleh, P.D. Hobbs, etiology of inammatory bowel diseases, Expert Rev. Mol. Diagn. 6 (2006) L. Jong, W.R. Chao, L.J. Schiff, B.P. Sani, An adamantyl-substituted retinoid- 345e363. derived molecule that inhibits cancer cell growth and angiogenesis by [142] R.M. Nijmeijer, R.M. Gadaleta, S.W. van Mil, A.A. van Bodegraven, J.B. Crusius, inducing apoptosis and binds to small heterodimer partner nuclear G. Dijkstra, D.W. Hommes, D.J. de Jong, P.C. Stokkers, H.W. Verspaget, receptor: effects of modifying its carboxylate group on apoptosis, prolif- R.K. Weersma, C.J. van der Woude, J.M. Stapelbroek, M.E. Schipper, eration, and protein-tyrosine phosphatase activity, J. Med. Chem. 50 (2007) C. Wijmenga, K.J. van Erpecum, B. Oldenburg, Farnesoid X receptor (FXR) 2622e2639. activation and FXR genetic variation in inammatory bowel disease, PLoS [154] L. Farhana, M.I. Dawson, M. Leid, L. Wang, D.D. Moore, G. Liu, Z. Xia, One 6 (2011) e23745. J.A. Fontana, Adamantyl-substituted retinoid-related molecules bind small [143] J. Jahnel, P. Fickert, C. Langner, C. Hogenauer, D. Silbert, J. Gumhold, heterodimer partner and modulate the Sin3A repressor, Cancer Res. 67 A. Fuchsbichler, M. Trauner, Impact of experimental colitis on hepatobiliary (2007) 318e325. transporter expression and bile duct injury in mice, Liver Int. 29 (2009) [155] J.R. Hov, V. Keitel, J.K. Laerdahl, L. Spomer, E. Ellinghaus, A. ElSharawy, 1316e1325. E. Melum, K.M. Boberg, T. Manke, T. Balschun, C. Schramm, A. Bergquist, [144] P. Vavassori, A. Mencarelli, B. Renga, E. Distrutti, S. Fiorucci, The bile acid T. Weismuller, D. Gotthardt, C. Rust, L. Henckaerts, C.M. Onnie, receptor FXR is a modulator of intestinal innate immunity, J. Immunol. 183 R.K. Weersma, M. Sterneck, A. Teufel, H. Runz, A. Stiehl, C.Y. Ponsioen, (2009) 6251e6261. C. Wijmenga, M.H. Vatn, P.C. Stokkers, S. Vermeire, C.G. Mathew, B.A. Lie, [145] A. De Gottardi, F. Touri, C.A. Maurer, A. Perez, O. Maurhofer, G. Ventre, U. Beuers, M.P. Manns, S. Schreiber, E. Schrumpf, D. Haussinger, A. Franke, C.L. Bentzen, E.J. Niesor, J.F. Dufour, The bile acid nuclear receptor FXR and T.H. Karlsen, Mutational characterization of the bile acid receptor TGR5 in the bile acid binding protein IBABP are differently expressed in colon cancer, primary sclerosing cholangitis, PLoS One 5 (2010) e12403. Dig. Dis. Sci. 49 (2004) 982e989. [156] D.P. Poole, C. Godfrey, F. Cattaruzza, G.S. Cottrell, J.G. Kirkland, J.C. Pelayo, [146] R.R. Maran, A. Thomas, M. Roth, Z. Sheng, N. Esterly, D. Pinson, X. Gao, N.W. Bunnett, C.U. Corvera, Expression and function of the bile acid receptor Y. Zhang, V. Ganapathy, F.J. Gonzalez, G.L. Guo, Farnesoid X receptor de- GpBAR1 (TGR5) in the murine enteric nervous system, Neurogastroenterol. ciency in mice leads to increased intestinal epithelial cell proliferation and Motil. 22 (2010) 814e825. e227e818. tumor development, J. Pharmacol. Exp. Ther. 328 (2009) 469e477. [157] M.A. Nauck, U. Niedereichholz, R. Ettler, J.J. Holst, C. Orskov, R. Ritzel, [147] T. Inagaki, A. Moschetta, Y.K. Lee, L. Peng, G. Zhao, M. Downes, R.T. Yu, W.H. Schmiegel, Glucagon-like peptide 1 inhibition of gastric emptying J.M. Shelton, J.A. Richardson, J.J. Repa, D.J. Mangelsdorf, S.A. Kliewer, Regu- outweighs its insulinotropic effects in healthy humans, Am. J. Physiol. 273 lation of antibacterial defense in the small intestine by the nuclear bile acid (1997) E981eE988. receptor, Proc. Natl. Acad. Sci. U.S.A. 103 (2006) 3920e3925. [158] B.S. Reddy, C.W. Martin, E.L. Wynder, Fecal bile acids and cholesterol [148] R.M. Gadaleta, K.J. van Erpecum, B. Oldenburg, E.C. Willemsen, W. Renooij, metabolites of patients with ulcerative colitis, a high-risk group for devel- S. Murzilli, L.W. Klomp, P.D. Siersema, M.E. Schipper, S. Danese, G. Penna, opment of colon cancer, Cancer Res. 37 (1977) 1697e1701. ! ! "#$%#&'()*+,! !"#$"%&'()*+, ! /!! 0%)1)!23!4)5675!8943!:;<&=!"3!!"#$%&!>6=#1)=#&5!&?!=+7!?(7@;75<,!&?!#5A&%;5=)(,! #5?7(=#%#=,! &5! )! 5)=#&5BC#D7! $)6#6E! '()# *!+,-.# /01# 234%! F./FG!"H/I-JKJ-E! D&#H/.E/.JLM+;1(7*MD76.N.! F!! 9();6O!PE!Q)%7!#5?7(=#%#=,H!*)=+&'7576#6!)5D!<%#5#<)%!D#)'5&6#6E!5!6"#7,$8"#*!6#9%:3# 23.-8,:3-%#;!"$# ?@3$!8-%# /<6"!"# /11# /,4$3# =3"# A!.# ?@3$!8-%# /<6"!"! F./LG$!%& '())*& !H0IK-E! D&#H/.E/./SMTE#T'&EF./LE.JE..R! I!! 9)6=;(#!003!Y)55#(!Z3!"()55#')5!2>E!Y+7!17=)$&%## B3.,-%!F..-G!+HFR/KJE!D&#H/.EF/SIMT)5D(&%E/.NE..LNL/! R!! [&(1)5! 2Z3! [&)\76! Q3! ];! 23! !"# $%&! X1*(&A#5'! (7*(&D;<=#A7! *7(?&(1)5<7! #5! &A7(C7#'+=M&$767! C&175! C#=+! 7??7<=#A7! C7#'+=! 1)5)'7175=E! '()# *!+,-.# C+.$"!! F..IG$,HFSNK-.E!D&#H/.E/.JLM+;1;*DMD1+./-! S!! 0<+#6=7(1)5!>V3!Q;1?&(D!0^3!"(&C57!2]3!!"#$%&!^#*#D!<&5<75=()=#&56!)5D!<&;*%7! ?7<;5D#=,H! =+7! ^XV>! 6=;D,E! ># 9%:3# 23.-8,:3-%# ;!"$#675$7('!Q^3!9#1!03!P+75!_3!!"#$%&!Y+7!(7%)=#&56+#*!$7=C775!1)%7!"QX!)5D!C)#6=! <#(<;1?7(75<7! &5! 67175! @;)%#=,H! D)=)! ?(&1! =+7! ^XV>! 6=;D,E! '()# *!+,-.# /01# 234%! F./IG!+H/JLKF..E!D&#H/.E/.JLM+;1(7*MD7=IF-! -!! `*(#D&5#DO7!Y3!>66)+!U`3!X;&(5&!QZ3!!"#$%&!U(7A)%75<7!)5D!<+)()<=7(#6=#<6!&?!=+7! 17=)$&%##9%:3#23.-8,:3-%#;!"$# 9%:3# 23.-8,:3-%# ;!"$;(&*7)5! `66&<#)=#&5! &?! a(&%&',! ';#D7%#576! &5! Q)%7! X5?7(=#%#=,H! =+7! F./F! ;*D)=7E! 2(,# C,-%! F./FG-!HLFIKLFE! D&#H/.E/./SMTE7;(;(&EF./FE.IE.I-! //!! Q)=O;\! QQ3! ^)1$! :ZE! Y+7! $#&%&',! &?! #5?7(=#%#=,H! (767)(<+! )DA)5<76! )5D! <%#5#<)%! <+)%%75'76E!D$"#;!.!F..-G$.H//JNKF/LE!D&#H/.E/.L-M51E?E/-JR! /F!! Z&67*+! 0"3! Y&5=&5&O! UE! ^b26H! 57C! =+7()*7;=#DC)(D6!U`3!97557D,!Q`3!Q)\!U`E!^b26G!&d,6=7(&%B)<=#A)=7D!5;<%7)(!(7<7*=&(6! =+)=!(7';%)=7!'7576!<&5=(&%%#5'!%#*#D!+&17&6=)6#6E!F$68(%#7E$,)$8-%!F..FG%/HFIJKRSE! /I!! ^)??#==7! "`3! P+)&! ^P3! ^#! Z3! !"#$%&! `<=#A)=#&5! &?! %#A7(! b! (7<7*=&(! #1*(&A76! '%;<&67! =&%7()5<7! =+(&;'+! <&&(D#5)=7! (7';%)=#&5! &?! '%;<&67! 17=)$&%#61! #5! %#A7(! )5D! )D#*&67! =#66;7E!7,-8#D$"%#B8$.#G8:#C#G#B!F..LG$,,HRI/JKFIE!D&#H/.E/.NLM*5)6E.-L.SN//..! /R!! W(;5D,! 0QE! 8$76#=,3! 17=)$&%##H$<# 9%:3#;!.!F..LG$.!HNKF.E!D&#H/.E/./SM0..FFBF/ILe.Lf...--Bb! /N!! ^;5D! >W3! Q75\7! ZW3! 0*)((&C! PUE! ^#A7(! b! (7<7*=&(! )'&5#6=6! )6! *&=75=#)%! =+7()*7;=# ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! .-!! /&%%0!123!4&56)7!83!15'')9)7+#!:3!!"#$%&!45%7#*%0!(&%0;!&%0)(!(0>0*7&(;!<&(! &?,;70(&%;! %#90(! @! (0>0*7&(! 7&! A)#=7)#=! A)%0! <0(7#%#7,B! '(%# )*+(,-.*(%# /$%".0# '+! CDDEF!"G.D.HICEB!J&#G.DB.C.DKA0BCDDLMDCEE! .N!! :&$0(7;&=! 843! O>+5;70(! PQ3! O70<<0=;0=! 8:3! !"#$%&! R+0! %#90(! @! (0>0*7&(MS$07)T! #;! 0;;0=7#)%! <&(! A)#=7)#=#='! >+&%0;70(&%! +&A0&;7);#;! #=! 7+0! 70;7#;B! )*+(,-.*(%(12! CDDUF"#$GCU.NIVDB!J&#G.DB.C.DK0=BCDDHM.H.V! CD!! 4);>(06!"3!P+,;0%#=>W!X"3!Y)7)=)$0!43!!"#$%&!Z#')=JMJ0*0=J0=7!>&=7(#$57#&=!&+&%0;70(&%! +&A0&;7);#;! #=! O0(7&%#! >0%%;B! )'/3# 4!5! CDDHF%GC-UINDB! J&#G.DB.DV-K;[B0A$&(BEHDDDNH! C.!! O70<<0=;0=!8:3!:&$0(7;&=!83!P5;7)<;;&=!\M]3!!"#$%&!:0J5>0J!<0(7#%#7,!)=J!#=)$#%#7,!&,70;! 7&! (0;5A0! A0#&;#;! #=! A#>0! J0<#>#0=7! &0BCDDLBDVBDHH! CC!! 4&56)7!83!/&%)7!^3!")(&=!O3!!"#$%&!]$;0=>0!&%0)(!(0>0*7&(;!<&(!&?,;70(&%;!%#90(! @! (0>0*7&(! #=J5>0;! &9)(#)=! +,*0(;7#A5%)7#&=! ;,=J(&A0! #=! A#>0B! )*+(,-.*(%(12! CDDNF"%&GVVLNIEUB!J&#G.DB.C.DK0=BCDD-M.U.N! CV!! "),!83!];W%5=J!_3!OW)WW0$)0W!X`3!!"#$%&!R0;7#>5%)(!J,;'0=0;#;!;,=J(&A0G!*&;;#$%0! (&%0! &(#=0! J#;(5*70(;B! /!7"# 8-$,"# 4!7# 6%.*# )*+(,-.*(%# '!"$9! CDDLF!&GEEINDB! J&#G.DB.D.LK[B$00ABCDDUBDNBDDH! CH!! Z&$)>>)(&!\43!:0*)!\\3!Z5!RR3!!"#$%&!a:0'5%)7#&=!&%0)(!(0>0*7&(;bB!:**#)*+(,-.*(%!CDD.F$!GCVNIHEB! CU!! ^&5(=#0(!R3!2)=J;>+5+!83!R;)7;)(#;!/3!!"#$%&!:&%0!&%0)(!(0>0*7&(;!)=J!7+0#(! %#')=J;! #=! +5A)=! 7(&*+&$%);7! #=9);#&=B! ;# 4!5-(+# <00=*(%! CDD-F''G.L.IEDB! J&#G.DB.D.LK[B[(#BCDDEBDUBDDH! CL!! O)<0!O3!\#=!QM23!20J(#>W!`3!!"#$%&!4#=#(09#0cG!(&%0!&%0)(!(0>0*7&(;!#=! >)=>0(! )=J! *&70=7#)%! );! J(5'! 7)('07;B! '(%# )*+(,-.*(%# /$%".0# '+! CD.HF!(G.UEIECB! J&#G.DB.C.DKA0BCD.VM.CN.! CE!! R()90(;)(#! _3! O&66)=#! O3! O70<<0=;0=! 8:3! !"# $%&! Z@:MJ0*0=J0=7! )=J! M#=J0*0=J0=7! 0<<0>7;!&#J;G! <(&A! J#'0;7#&=! 7&! >)=>0(;B! /.(,>.0.!!CD.VF)%GUDHI.EB!J&#G.DB.D.LK[B$#&>+#BCD.CBDLBDCC! CN!! _+0='!e3!e;7(&c;W#!:f3!Z#5!Y3!!"#$%&!]>7#9)7#&=!&0*7&(!(0J5>0;!'%&$)%! #;>+0A#>! $()#=! #=[5(,! $,! (0J5>7#&=! &%0)(! <)>7&(MW)**)"B! ?!=-(7,.!*,!! CD.DF"$$G..D.INB!J&#G.DB.D.LK[B=05(&;>#0=>0BCD.DBD.BDCH! VD!! P#'5g(0!/3!h)='!X3!O0'5#!f3!!"#$%&!iJ0=7#<#>)7#&=!&%);;!&0*7&(;B!?$"=-!!.N--F**"GN.IHB!J&#G.DB.DV-KVV.DN.)D! V.!! 4)='0%;J&(0*7&(;B! 6!%%! .NNUF(*G-H.IUDB! VC!! Y#%%,!f\3!QA0;&=&!83!e='!`O3!!"#$%&!Z@:3!)!=5>%0)(!(0>0*7&(!7+)7!J0<#=0;!)!J#;7#=>7! (07#=&#J!(0;*&=;0!*)7+c),B!@!*!7#A!B!.NNUF)G.DVVIHUB! VV!! O+#=)(! 143! `=J&! X3! :57%0J'0! O\3! !"# $%&! X`:3! )! =0c! A0A$0(! &&J#='!7+0!+5A)=!;70(&#J!+&(A&=0!=5>%0)(!(0>0*7&(B!@!*!!.NNHF"#'GCEVILB! VH!! O&='! _3! 8&W&=7#;! \43! 2##*)WW)! :]3! !"# $%&! Q$#d5#7&5;! (0>0*7&(G! )! (0>0*7&(! 7+)7! A&J5%)70;! '0=0! )>7#9)7#&=! $,! (07#=&#>! )>#J! )=J! 7+,(&#J! +&(A&=0! (0>0*7&(;B! 8-(,#?$"%# :,$+#C,.#D#C#:!.NNHF)"G.D-DNI.VB! VU!! ]%$0(7#!O3!O70<<0=;0=!8:3!P5;7)<;;&=!\]B!O7(5>75()%!>+)()>70(#;)7#&=!&%0)(!&?,;70(&%!(0>0*7&(!'0=0;!Z@:)%*+)!)=J!Z@:$07)B!@!*!!CDDDF!#*GNVI.DVB! VL!! f007! 1\3! \)=&c;W#! "]3! 4)='0%;J&(%);;! &0*7&(;B!6=--#35.*#@!*!"#A!B!.NN-F(GUE.IUB! ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /0!! 123&45673)!89!52&!:9!;<=#6&(#!89!!"#$%&!>#??7(72@#)%!7A*(7BB#&2!)23!?<2C@#&2!&?! )%@7(2)@#D7!B*%#C#2'!D)(#)2@B!&?!+<6)2!%#D7(!E!(7C7*@&(!FG!'(%#)*$+,$-(%!.HI.J!"K-HHL IHG!3&#KIHGII.MN6&%GIIIGH00.HO! /-!! P+72! Q9! "7)D72! :9! R&2@&2&S! TG! U372@#?#C)@#&2! )23! C+)()C@7(#S)@#&2! &?! @V&! )%@7(2)@#D7%,! B*%#C73! @()2BC(#*@! D)(#)2@B! &?! +<6)2! %#D7(! E! (7C7*@&(! )%*+)G! .# /0102# 3!4! .HHWJ#$K.W0HLXG!3&#KIHGIIXMN=%(GQWHHIW04YZ[.HH! /X!! :@7??72B72!8[9!:C+ ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! +&(/&01!(121*3&(45!!"#$%&!67789!"":;8;<=5!>&#:6?56?.-@.==;8;)?! 88!! A)'01(! "BC! D)%%1>&(! EFC! G+)&! HC! &#' "()! I(&/&31(J4*12#K#2! (&%14! K&(! %#L1(! M! (121*3&(@2&(1*(144&(! 2&/*%1N14! #0! 3+1! (1'O%)3#&0! &K! E"PE6! )0>! GQR"I6! '101! 1N*(144#&05!*+(',&(('-.+(!S??.9#!:8=-?<75! 8T!! Q1*)!UUC!V)0'1%4>&(K!WU5!X+1!(&%1!&K!&(*+)0!0O2%1)(!(121*3&(4!#0!3+1!(1'O%)3#&0!&K! 2+&%1431(&%! +&/1&43)4#45! /00$' 1&2' ,&((' 3&2' -.+(! S???9$%:;87<-65! >&#:6?566;T@)00O(1L521%%$#&56T565;87! 8=!! H#'OY(1!D5!G3(O23O(1!)0>!KO023#&0!&K!3+1!0O2%1)(!(121*3&(!4O*1(K)/#%,!K&(!431(&#>C! 3+,(&#>!+&(/&01!)0>!(13#0!)2#>5!4&0&#'506'7!'89!677?9$#:6-. ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /.!! 0&123!456!"&(2+7(8!496!07*%7(!:;6!!"#$%&!<=>=?@?/!#A!)!B1)%!CDEFGDE!)'&H#A8I! '(%#)!*!"#'!"$+!J==.K!"L?-.M/I!B&#L?=I?=?NFOI,P'P7IJ==.I=/I==/! /Q!! R+7H&,! R;6! R*7H27(! <56! 97(27(S0)#H7A! T56! !"# $%&! :UV@5! #HB128#&H! $,! %#W7(! X! (727*8&(! %#')HBA! #H! *(#P)(,! 21%81(7B! ()8! )HB! P&1A7! +7*)8&2,87A! #A! P7B#)87B! $,! 8+7! *(7'H)H7! D! (727*8&(I! ,-./# '!"$+# ,012(1# 30(%# 4$"!# 56!7! J==.K"#LNNM/?I! B&#L?=I??J.FBPBI@JI?INN! /N!! 9#8(&!T6!Y)(')A!C6!E&P7&!E6!!"#$%&!<=>=?@?/!#A!)!*&87H8!VDE!%#')HBL!#P*%#2)8#&HA! Z&(! 8+7! $#&%&',! )A2(#$7B! 8&! CDEI! 4839# :!""! J==/K$!%L?/J?MNI! B&#L?=I?=?NFOIZ7$A%78IJ==/I=@I=./! //!! [&A7*+!R"6!924#%%#'#H!\6!V7#!C6!!"#$%&!R,H8+78#2!CDE!%#')HB!#H+#$#8A!8+7!B7W7%&*P7H8! &Z! )8+7(&A2%7(&A#A! #H! P#27I! ;-(<# =$"%# ><$?# 9<0# @# 9# >! J==JK&&L/N=.M>I! B&#L?=I?=/@F*H)AI??J=Q>J>>! /-!! U)A1B)!<6!](#%%&8!;6!"#%%+7#P7(![<6!!"#$%&!<#AA17SA*72#Z#2!%#W7(!D!(727*8&(!)28#W)8#&H! *(&P&87A! P)2(&*+)'7! (7W7(A7! 2+&%7A87(&%! 8()HA*&(8! #H! W#W&I! >-"!-0(1<%!-#A6-(7+#B$1<# 30(%!J=?=K"'L/-?MNI!B&#L?=I??N?F5 ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! +&/0&12)1#1!#3!40%%1!)35!#3!2+0!$&5,6!!"#$%"&'!"#(%)*'+$,-!78889!"#$:7;<=>>6! ?;!! @&()4+AB35(C! DE! B(4+0(! BE! F)$$#! GE! .,' -/0! H#I0(! J! (040*2&(1! (0'K%)20! 50! 3&I&! %#*&'0301#1!#3!)!2#11K0A1*04#L#4!/)330(!#3!G.M"HNO!L0/)%0!/#406!+&'1'2%)*"#/'345#$6"4#/' 7.,-8!78<<9%&!:P7<8=776!5&#:<86<<.7N)Q*035&688.><678<8! ?>!! @&()4+AB35(C!DE!B(4+0(!BE!")((&1!RSE!.,'-/0!"&2+!%#I0(AJ!(040*2&(!THJRU!#1&L&(/1! 4&32(&%!030(',!0V*035#2K(0!$,!(0'K%)2#3'!$(&W3!)5#*&10!2#11K0!)42#I#2,6!26#$'9-,/'+$-5' :$"';':'+!78<<9!&':>8;=-6!5&#:<86<8M;N*3)16<8 ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /01!! 23&! 45! 6)%%! 789! :;<(&%! 3*(<'3%);#&=! &>! +3?)=! @A6B! ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /0&%102*230234! 5$#65#4#3)4#&3! &7! 4+2! 898! (2:2*4&(;! !"#$%"$! <==>?!"#@A==BC;! 0&#@A=;AA ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! .&#/012003-456"211177819! 0:;!! <=>?@!AB!C#D)(.!E2!6,F&F&@#G!=HH=GFI!&H!&@,IF=(&%I!)II&G#)F=.!J#F+!+?K)L!.#I=)I=I/! ML.?GF#&L! &H! G=%%! .=)F+! N)*&*F&I#I! )L.4&(! &LG&I#IOB! &@#.)F#P=! )L.! #LH%)KK)F&(,! )GF#P#F#=IB! )L.! *+&I*+&%#*#.&I#I2! !"#$ %&'()*&$ !(+! 311QR!"/0S;T712! .&#/01201094>2K)K2311Q2132119! 0::!! C)L.#I!5UB!V)F=%!W ! --! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /0-!! 123%4#'!567!1289984:84!;<7!=)&!>7!!"#$%&!?&@8%!(&%8:!&9!%#@8(!A!(8B8*2&(:!8C*&:8D!$,! '848!8C*(8::#&4!*(&9#%#4'!#4!%#@8(!)4D!)D#*&:8!2#::38E!'(%#)*$+,$-(%!FGGFH!"I/F..JKG0E! /0.!! L+)M()@)(2,! ;7! N8)+,! O7! "8B)(D! P7! !"# $%&! 128(&%! (8'3%)2&(,! 8%8Q842R$#4D#4'! *(&28#4R/B!Q#Q#B:!2+8!48')2#@8!8998B2!&9!#4:3%#4!&4!*+&:*+&84&%*,(3@)28!B)($&C,M#4):8! S=5OT! '848! 2()4:B(#*2#&4E! .# /0(%# 1*!,! FGG/H"#!IKU-/VJFKE! D&#I/GE/GWUXY$BE6/GKK/GFGG! /VG!! "ZB)(D! P7! >)#4)3%2! [7! \]]&32R6)(4#B+8! P7! !"# $%&! \D84&@#(3:RQ8D#)28D! &@8(8C*(8::#&4!&9!:28(&%!(8'3%)2&(,!8%8Q842!$#4D#4'!*(&28#4R/B!Q#Q#B:!#4:3%#4!8998B2:!&4! +8*)2#B! '848! 8C*(8::#&4! )4D! '%3B&:8! +&Q8&:2):#:! #4! D#)$82#B! Q#B8E! 20$3!"!4! FGG/H$%IFUF0JKGE! /V/!! L)&!=7!N#)4'!^7!"(&D8(#BM!LN7!!"#$%&!\42#D#)$82#B!)B2#&4!&9!)!%#@8(!C!(8B8*2&(!)'&4#:2! Q8D#)28D! $,! #4+#$#2#&4! &9! +8*)2#B! '%3B&48&'848:#:E! .# /0(%# 1*!,! FGGKH"#&I//K/JVE! D&#I/GE/GWUXY$BE6F/GFG-FGG! /VF!! L&QQ8(9&(D!1<7!_)('):!N7!P&(9Q)4!1`7!!"#$%&!P#::8B2#&4!&9!2+8!#4:3%#4R:84:#2#]#4'! 8998B2! &9! %#@8(! A! (8B8*2&(! %#')4D:E! '(%# 567(-+06(%# /$%"0,# '7! FGGWH"'IKGGFJ/FE! D&#I/GE/F/GXQ8EFGGWRG/0V! /VK!! O3#':8(@8(!O7!<+88!a7!P&4&@)4!a7!!"#$%&![4:3%#4R(8'3%)28D!+8*)2#B!'%3B&48&'848:#:! 2+(&3'+! bcAc/RO=LR/)%*+)! #428()B2#&4E! 8$"9+!! FGGKH(")I00GJ0E! D&#I/GE/GK-X4)23(8G/VVW! /VU!! >&(2&4! aP7! "):+Q)M&@! ^7! 1+#Q&Q3()! [7! !"# $%&! <8'3%)2#&4! &9! :28(&%! (8'3%)2&(,! 8%8Q842! $#4D#4'! *(&28#4:! #4! %#@8(:! &9! 9):28D! )4D! (898D! Q#B8E! )+(-#8$"%#:-$7#;-0#<#;#:! /..-H*$I0.-WJ.FE! /V0!! P842#4!<7!P848B+)3D!ORP7!"84+)Q8D!b7!!"#$%&!>8*)2#B!'848!(8'3%)2#&4!$,!'%3B&:8! )4D!*&%,34:)23()28D!9)22,!)B#D:I!)!(&%8!9&(!L+<`"OE!.#89"+!FGGVH')!I//U0J.E! /VV!! P848B+)3D! ORP7! =#()(D! a7! O&:2#B! LE! L)($&+,D()28! (8:*&4:#@8! 8%8Q842! $#4D#4'! *(&28#4! )4D! %#*#D! +&Q8&:2):#:E! 19++# =>06# ?0>07(%! FGG-H'*IKG/JVE! D&#I/GE/G.WX6cNEG$G/K8KF-F99)9))! /VW!! L+)! aR^7! <8*)! aaE! 5+8! %#@8(! A! (8B8*2&(! SNA ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /01!! 2345$#3! 678! 9:)&! 928! ;#! <8! !"# $%&! =;>91! +434(&?,'&@:! A5&BA&@3! C#B4! D4E4%&*! C@:B%4!#5:@%#5!(4:#:3)5B4!)5D!D#)$434:F!'$"#(!)!/--0G!H/.-IJ/./F! /0K!! 9&??&!78!=5@D#!;8!L)+5!""F!6C4%#&()3#&5!&M!#5:@%#5!(4:#:3)5B4!#5!:3(4*3&?&3&B#5! D#)$43#B! C#B4! $,! 3()5:'45#B! &E4(4N*(4::#&5! &M! =;>91! D(#E45! $,! )5! )D#*&:4O:*4B#M#B! *(&C&34(F!*+),-./+,%,01!/--0G"!#H/I.1J//F!D&#H/.F/P/.Q45D&F/RSF1FK.1R! /0I!! T)%45! L98! >%E45! 2U8! ")C$4('! L8! !"# $%&! 7N*(4::#&5! &M! 3+4! #5:@%#5O(4:*&5:#E4! '%@B&:4!3()5:*&(34(!=;>91!#5!)D#*&B,34:!#:!D4*45D453!&5!%#E4(!V!(4B4*3&(!)%*+)F!2#3/,%# 45!6!P..RG$%#H1SPSRJ-/F!D&#H/.F/.01QW$BFUR.PPS0P..! /00!! X&::! 278! 7(#BA:&5! X;8! =4(#5! Y8! !"# $%&! U#B(&)((),! )5)%,:4:! D@(#5'! )D#*&'454:#:H! @5D4(:3)5D#5'! 3+4! 4MM4B3:! &M! Z53! :#'5)%#5'! &5! )D#*&'454:#:! )5D! 3+4! (&%4:! &M! %#E4(! V! (4B4*3&(!)%*+)!#5!)D#*&B,34!C43)$&%#:CF!(,%#4!%%#3/,%!P..PG$$HK-S-J--F! /0S!! =(4M+&(:3!68!E)5!T#WA!9[8![)CC4(!68!!"#$%&!T#MM4(453#)%!4MM4B3:!&M!*+)(C)B&%&'#B)%! %#E4(! V! (4B4*3&(! )B3#E)3#&5! &5! +4*)3#B! )5D! *4(#*+4()%! #5:@%#5! :45:#3#E#3,! #5! %4)5! )5D! &$Q&$! C#B4F! 76# 2# 8519/,%# *+),-./+,%# (!"$:! P..KG$#&H7SP-JRSF! D&#H/.F//KPQ)W*45D&F../IKFP..K! /0-!! \%43B+4(!X8!=(#$$45!]8!U)!V8!!"#$%&!9+4!(&%4!&M!3+4!5#4C)55O*#BA!D#:4):48!3,*4!B/! *(&34#5! #5! )D#*&B,34! #5:@%#5! )B3#&5F! 8%,;# <+!! P./1G&H4-KK-SF! D&#H/.F/R0/QW&@(5)%F*&54F..-KK-S! /S.!! \4(5^5D4?O_4%4D&! 28! `#43&O_)?a@4?! Y8! X&5D#5&54! ]U8! !"# $%&! ;#E4(! V! (4B4*3&(! )'&5#:3:! )C4%#&()34! 9`\)%*+)O#5D@B4D! #5:@%#5! (4:#:3)5B4! #5! C@(#54! $(&b5! )D#*&B,34:! $,! D&b5(4'@%)3#5'! *(&34#5! 3,(&:#54! *+&:*+)3):4O/"! '454! 4N*(4::#&5F! =/$:!",%,0/$! P..IG'&HR.RSJ1SF!D&#H/.F/..0Q:../PKO..IO.10PO1! /S/!! ;#@! c8! c)5! ]8! Z)5'! c8! !"# $%&! ;#E4(! V! (4B4*3&(! )'&5#:3! 9.-./R/0! #5+#$#3#&5! &M! '%@B&B&(3#B&#D!(4B4*3&(!4N*(4::#&5!#5!+4*)3&B,34:!C),!B&53(#$@34!3&!3+4!)C4%#&()3#&5!&M! D#)$43#B! :,5D(&C4! #5! D$QD$! C#B4F! *+),-./+,%,01! P..IG"'%HK.I/JSF! D&#H/.F/P/.Q45FP..IO.P1R! /SP!! ;)**):! UF! 7MM4B3! &M! *(4O4N#:3#5'! C)34(5)%! &$4:#3,8! '4:3)3#&5)%! D#)$434:! )5D! )D#*&A#54:! &5! 3+4! 4N*(4::#&5! &M! '454:! #5E&%E4D! #5! %#*#D! C43)$&%#:C! #5! )D#*&:4! 3#::@4F! (!"$:,%/96!P./1G(!HPK.JIPF!D&#H/.F/./IQWFC43)$&%FP./RF/.F../! /SR!! 6+5! 2"8! <)5'! L8! <@5! TZ8! !"# $%&! 7N*(4::#&5! &M! %#E4(! V! (4B4*3&(! B&((4%)34:! b#3+! #53()+4*)3#B!#5M%)CC)3#&5!)5D!M#$(&:#:!#5!*)3#453:!b#3+!5&5)%B&+&%#B!M)33,!%#E4(!D#:4):4F! =/0#=/9#;-/!P./1G)&HP-0KJSPF!D&#H/.F/..0Q:/.IP.O./1ORPS-ON! /S1!! 2&%)):!L8!;4'(,!_8!X4334(:3&%!L8!!"#$%&!2@''4:3#E4!4E#D45B4!&M!)::&B#)3#&5:!$43b445! %#E4(! V! (4B4*3&(! d! *&%,C&(*+#:C:! b#3+! 3,*4! P! D#)$434:! C4%%#3@:! )5D! &$4:#3,! #5! 3+(44! B&+&(3! :3@D#4:H! [>`9P! e`&(b),f8! Ug`Y]6! e\()5B4f! )5D! [7;7`6! e7@(&*4fF! 3(4#(!)# >!+!"!P./.G""H/11F!D&#H/.F//SIQ/10/OPRK.O//O/11! /SK!! T)+%C)5! Y8! `#%::&5! U8! =@! [\8! !"# $%&! \@5B3#&5)%! )5D! '4543#B! )5)%,:#:! #5! 3,*4! P! D#)$434:! &M! %#E4(! V! (4B4*3&(! )%%4%4:OO)! B&+&(3! :3@D,F! 3(4# (!)# >!+!"! P..-G"*HP0F! D&#H/.F//SIQ/10/OPRK.O/.OP0! /SI!! ;4'(,! _8! ]&334%! T8! \4((#h(4:! <8! !"#$%&! 6::&B#)3#&5! $43b445! %#E4(! V! (4B4*3&(! )%*+)! '454!*&%,C&(*+#:C:!)5D!(#:A!&M!C43)$&%#B!:,5D(&C4!#5!\(45B+!*&*@%)3#&5:F!?+"#2#<:!9# @AAB!P..SG!$H1P/JSF!D&#H/.F/.RSQ:WF#W&F.S.R0.K! /S0!! T)+%C)5! Y8! `#%::&5! U8! <#)&! [8! !"# $%&! ;#E4(! V! (4B4*3&(! '454! *&%,C&(*+#:C:! )5D! )D#*&:4! 3#::@4! 4N*(4::#&5! %4E4%:! #5! &$4:#3,F! 85$.6$-,0!+!"# >!+,6/-9! P..IG"(HSS/J-F! D&#H/.F/.-0Q./FM*BF....PRIRR1F1-1PPF1S! /SS!! iM(#4'4(! \ZF! ]+&%4:34(&%! +&C4&:3):#:! )5D! M@5B3#&5! #5! 54@(&5:! &M! 3+4! B453()%! 54(E&@:! :,:34CF! 4!%%# (,%# C/D!# ;-/# 4(C;! P..RG(*H//KSJ0/F! D&#H/.F/..0Q:.../SO..RO R./SO0! /S-!! T#43:B+,! ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /00.1!"2.034./5! .-0!! "67(8+9:! ;?6&+)@@! A!2#?@@# '#1-#A*3#(*9!#7)9!0#>!2!/0./1"#2/KK/43.5!H.05.00/Z6$:(5.S0/! /0.!! M?)+%!V`!B#7!:!/0./1'&23/34K05!H.05..K^Z)@@B(9FO:9HO03.Q.0O.0.0T^! /0/!! `BB%! \!B#89:*30)9*%!/0.K1!%233T4^/5!H.05.0TQZ@(9@H&5/0.K5-S! /0T!! a&+%E)+(?Oe969! X!2!/0..1#"#2^/4S.5!H.05.0.^Z65:((9F5/0..50K500/! /0^!! a)%89(!af!H0*:#+$-5# ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! !"#$!.//01!"#2304.56!7/6308/9(:*636//805! ./;!! <)#7:(!=>6!?:%%!$#&%&',!&@!A:,7#'!B:%%C!#D!E+:!E:CE#C6!%"&'()*'+,&-$!.//F1$""23534 .F36!7/63/3G9=//;FH;G-GI/FJ88//0HG! ./5!! K#%%:(!LA6!MD7(&':D!$#&C,DE+:C#C!@(&N!B+&%:CE:(&%!E&!O ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! //0!! 1$2%!345!")62(!785!9+)(%:&;!435!!"#$%&!<*2(=):&'2;2>#>!);?!>2(:&%#!@2%%!)@:#A#:,!#;! =#@2! %)@6#;'! >2(:&%#! @2%%! (2@2*:&(>! B&(! B&%%#@%2C>:#=D%):#;'! +&(=&;2! );?! );?(&'2;E! '()*+,-(*%*./!/FFGH!"#I./0-JGKE!?&#ILFEL/LFM2;E/FFGCFFGN! //G!! <#;'+!85!4);?2%>=);!O8E!P+2!2BB2@:>!&B!(2@&=$#;);:!Q<4!&;!:2>:&>:2(&;2C#;?D@2?! >*2(=):&'2;2>#>!#;!'&;)?&:(&*+#;C?2B#@#2;:!R+*'S!=#@2E!0#1(),*%!L--NH!$I.G/J-.E! //-!! <)?):2CT'):@+&D! 7U5! 7&D@+;#6! O85! V(#>W&%?! 3OE! Q&%%#@%2C>:#=D%):#;'! +&(=&;2! #;?D@2?! @+);'2>! #;! '2;2! 2X*(2>>#&;! &B! =D(#;2! :2>:#>E! 2*%# '()*+,-(*%# 3$%"-4# 2)! /FFYH!%I/GFKJLNE!?&#ILFEL/LFM=2E/FF.CF/F.! /.F!! ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /.0!! 1&2'! 3456! 3+72'! 389! :#;&'724)<;#=);7>! *(&;7#2! ?#2)@7@6! )>+7(72@! AB2<;#&2! >,2)C#<@6! )2>! @*7(C);&'727@#@D! )! (7=#7E! &F! (7<72;! >);)9! !"#$ %&'(! /GG0H!"#DIJI09! >&#DIG9IGIKLA9,>$#&9/GG09GM9GGI! /.K!! N7%%7;#7(! O:6! ",7(@! P19! Q+7! $%&&>4;7@;#@! $)((#7(! )2>! P7(;&%#! <7%%! AB2<;#&2@D! @;(B<;B()%! <&2@#>7();#&2@9! )&*+',*$ -",$ ."*/! I--/H!$DRJRR9! >&#DIG9IGG/LA7C;9IGSG/GGIG.! /.S!! TUV&227%%!W6!X#<+&%%@!NY6!TU"(,)2!:Y6!"0$1(2!P*7(C#);#&2D!Q+7!*(&<7@@!&F!@*7(C! (7%7)@79!34"+510'6"7",&,!/GIIH%DI.JR09!>&#DIG9.IKIL@*C'9I9I9I.0/0! /.M!! T@+#C)! Z9! P;(B<;B(7! )2>! <%&@B(7! &F! <&227[#2! ')*! AB2<;#&2! <+)227%@9! 89%3$ :"00! /GI.H&""DI/RGJS9!>&#DIG9IGIKLA9F7$@%7;9/GI.9GI9G./! /.-!! W#7! NN86! 3+72'! 386! :(B?! VV9! P#'2)%%#2'! *);+E),@! (7'B%);#2'! ;+7! $%&&>4;7@;#@! $)((#7(9!;70$<$%&'*/"5$="(($%&'(!/GIRH'&DK/IJ09!>&#DIG9IGIKLA9$#&<7%9/GI/9I/9GG-! /0G!! WB#! 1486! W77! 1:9! :&%7 ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /&0'10#2)%! %#*! )3(10)%! +,*1(*%)4#)5! !" #$%&" '" ()*! 6--78!!"96:;<=:5! 3`<56<.7>[email protected]. ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /0/!! 122,! 134! 5)6+$7(8! 9:4! "78;+! <=4! !"# $%&! 9)('>?>2! 2#6(7*?#&8! &@! ?+>! >6?(&'>8! (>;>*?&(! '>8>! #8! A)%>! A#;>! ;)76>6! )%?>()?#&8! &@! 6*>(A)?&'>8>6#6! )82! #8@>(?#%#?,B! '()*+,-(*%*./!C--.D!"#EFG-.H0IJB!2&#ECIBC/CIK>82&BCLGBCCB00-JLF-! /0L!! M&76>! N:4! O#82P>,! N4! Q()82#>8! R4! !"# $%&! 9#667>! 2#6?(#$7?#&8! )82! S7)8?#?)?#T>! )8)%,6#6! &@! >6?(&'>8! (>;>*?&(U)%*+)! V1W)%*+)X! )82! >6?(&'>8! (>;>*?&(U$>?)! V1W$>?)X! A>66>8'>(! (#$&87;%>#;! );#2! #8! ?+>! Y#%2U?,*>! )82! 1W)%*+)UZ8&;Z&7?! A&76>B! '()*+,-(*%*./!C--GD!"$EF.CLH/CB!2&#ECIBC/CIK>82&BCL0BCCBJF-.! /0F!! Q&7%2!3O4![7(6?!\W4!]#;+&%6&8![ ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /--!! 0)12(3456&((37! 89:! ;)((3()! 9:! <)1$()=)! 8>! ?@#'+! #=A#B3=A3! &C! +,*3(37D(&'3=31#)!)=B!B,7%#*#B31#)!#=!)!'(&E*!&C!#=C3(D#%3!13=F>!!"#$%&'()*+,$,(-./"%&! /GGGH!"I//JK->! LGG!! 6()M#7! 9N:! O&*C! PQ>! 6+3! (&%3! &C! A+&%37D3(&%! 3CC%ER! #=! (3'E%)D#='! D+3! C3(D#%#4)D#&=! *&D3=D#)%! &C! 1)11)%#)=! 7*3(1)D&4&)>! 0( 1'"#( 2#3$+,! /GG/H##$I.LSKT>! B&#ISG>SS./UN;VSTL-/! LGS!! 8#%%3(! WX:! 9EA+E7! 0N>! 6+3! 1&%3AE%)(! $#&%&',:! $#&A+31#7D(,:! )=B! *+,7#&%&',! &C! +E1)=! 7D3(&#B&'3=37#7! )=B! #D7! B#7&(B3(7>! 4#5&%6( 7$3! /GSSH%&IYSKSZS>! B&#ISG>S/SGU3(>/GSG5GGSL! LG/!! [)1)1&D&![:!Q+#1)1&D&!O:!Q&C#\#D#7!]:!$,(8'9!^CC3AD7!&C!+,*3(A+&%37D3(&%)31#)!&=! X3,B#'! )=B! Q3(D&%#! A3%%! 73A(3D&(,! CE=AD#&=! )=B! D+3! &M3()%%! 7*3(1! C3(D#%#4#='! A)*)A#D,! #=! D+3!()$$#D>!:;<(7$=6&5()/>(4#?'!S---H#'ISZSTK/S>! LGL!! _E%%7D&=! 6:! 8A`+3(7&=! ]a:! ab3=7! N9:! $,(8'9! `)D3(=)%! &$37#D,! #=BEA37! 13D)$&%#A! )=B!7*3(1!B#7DE($)=A37!#=!1)%3!&CC7*(#='!D+)D!)(3!3R)A3($)D3B!$,!D+3#(!3R*&7E(3!D&!)=! c&$37&'3=#Ad!B#3D>!@AB+"&'(7$=!/GSZH%>!B&#ISG>SJYSJU*+,/>S/LLT! LGJ!! Q+)%)$,!89:!3%5<&($)!@[:!O)13%!P8>!^CC3AD!&C!)%*+)5D&A&*+3(&%!)=B!7#1M)7D)D#=! &=! 1)%3! C3(D#%#D,! #=! +,*3(A+&%37D3(&%31#A! ()D7>! @A86<8%&'( 7$+( )>>( 0( 2,8'( @A86<8%&'( C&%! /GGJH($ISL.KJ/>!B&#ISG>SGSTUe>*+(7>/GGL>SG>GSL! LGZ!! `E(M#7! O:! 6&%%3C7(EB! 9:! 0E#! @:! $,( 8'9! Q+&(D5D3(1! 3CC3AD7! &C! D(3)D13=D! b#D+! 7#1M)7D)D#=! &=! D37D#AE%)(! CE=AD#&=! #=! *)D#3=D7! b#D+! +3D3(&4,'&E7! C)1#%#)%! +,*3(A+&%37D3(&%)31#)>!4;6(0(1'"#(@A86<8%&'!S--/H'&ITSKJ>! LGT!! `&=7503e()e#! @:! "(E'=&=! _:! Q#&=! ":! $,(8'9! ^M)%E)D#&=! &C! )D&(M)7D)D#=! 3CC#A)A,! )=B! D&R#A#D,!&=!7*3(1)D&4&):!)AA377&(,!'%)=B7!)=B!'&=)B)%!+&(1&=37!&C!+3)%D+,!13=I!)!*#%&D! *(&7*3AD#M3! A%#=#A)%! D(#)%>! 7$=6&5( D"&'( 4#5&%6"#&'( 7D4! /GSJH#&ITZ>! B&#ISG>SSYTUSJ..5 .Y/.5S/5TZ! LG.!! QA+&&%#='!;8:!9E![3E='!QX:!_(331)=!P:!$,(8'9!6+3!3CC3AD!&C!7D)D#=7!&=!D37D&7D3(&=3! #=! 13=! )=B! b&13=:! )! 7,7D31)D#A! (3M#3b! )=B! 13D)5)=)%,7#7! &C! ()=B&1#43B! A&=D(&%%3B! D(#)%7>!D-1(-$5!/GSLH##IZ.>!B&#ISG>SSYTUS.JS5.GSZ5SS5Z.! LGY!! P&%&1$! "9:! f#17B)%3! N^:! O&7%#\! @N:! $,( 8'9! QD)D#=! ^CC3AD7! &=! 9''(377#&=I! 037E%D7! C(&1!D+3!g;Qf!QD)D#=!QDEB,:!)!0)=B&1#43B!;&=D(&%!6(#)%>!@'&C()#$!/GSZH#$I3GS/JJZS>! B&#ISG>SL.SUe&E(=)%>*&=3>GS/JJZS! LG-!! f#='!^X:!Q&='![:!8)%#\!hQ:!$,(8'9!Q3R!B#CC3(3=A37!&C!3=B&'3=&E7!73R!+&(1&=37!)=B! (#7\!&C!D,*3!/!B#)$3D37I!)!7,7D31)D#A!(3M#3b!)=B!13D)5)=)%,7#7>!0E-E!/GGTH&)(IS/YYK-->! B&#ISG>SGGSUe)1)>/-Z>SS>S/YY! LSG!! X))\7&=3=!f^:!]#7\)=3=!X:!`E==&=3=!O:!$,(8'9!Q3R!+&(1&=37:!#=C%)11)D#&=!)=B! D+3!13D)$&%#A!7,=B(&13I!)!*&*E%)D#&=5$)73B!7DEB,>!4;6(0(4#5&%6"#&'(4;6(F$5(4#5&%6(C&%! /GGLH#')ITGSKY>! LSS!! X))\7&=3=! f^:! ]#7\)=3=! X:! `E==&=3=! O:! $,(8'9! 637D&7D3(&=3! )=B! 73R! +&(1&=35 $#=B#='! '%&$E%#=! *(3B#AD! D+3! 13D)$&%#A! 7,=B(&13! )=B! B#)$3D37! #=! 1#BB%35)'3B! 13=>! G"8*$,$+(186$!/GGJH&*ISGLTKJS>! LS/!! X)E'+%#=! P9:! ")((3DD5;&==&(! ^:! "3('7D(&1! N>! X&b! 73(E1! D37D&7D3(&=3! )=B! 1&(D)%#D,! #=! &%B3(! 13=>! 0( 1'"#( 4#5&%6"#&'( -$,8*! /GGYH)%ITYK.Z>! B&#ISG>S/SGUeA>/GG.5 S.-/! LSL!! 8)''#&!8:!X)E(3D)=#!_:!;3B)!P`:!$,(8'9!977&A#)D#&=!&C!+&(1&=)%!B,7(3'E%)D#&=!b#D+! 13D)$&%#A! 7,=B(&13! #=! &%B3(! b&13=I! B)D)! C(&1! D+3! V=;@V9]6V! 7DEB,>! E<( 0( @AB+"&'( 4#5&%6"#&'(-$,8*!/GG.H&)&I^LZLKY>!B&#ISG>SSZ/U)e*3=B&>GGLL->/GGT! LSJ!! O+)b! O56:! f&b73DD! 8:! _&%\3(B! ^:! $,(8'9! ^=B&'3=&E7! D37D&7D3(&=3! )=B! 1&(D)%#D,! BE3! D&! )%%! A)E737:! A)(B#&M)7AE%)(! B#73)73:! )=B! A)=A3(! #=! 13=I! ^E(&*3)=! *(&7*3AD#M3! #=M37D#')D#&=! #=D&! A)=A3(! #=! ]&(C&%\! i^`V;5]&(C&%\j! `(&7*3AD#M3! `&*E%)D#&=! QDEB,>! ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! !"#$%&'(")*!/0012!!"3/4-561078!9�:;<=;>?@A ! -.! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! !"#$%&'"$(!.//01!!23456789! 330!! :;<(#=(! >?! @)A=B! C?! D=(E=B! F?! )*+ ,(-! GHC! )EA! >"@>5! I&EB(&%! I+&%=JB=(&%! +&K=&JB)J#J! #E! B+=! *(&L#K)%! K&;J=! =*#A#A,K#J! #E! )! I=%%MJ*=I#N#I! K)EE=(9! .+ /'0'#+ 1)2! .//-1"#257446789!A/955-0OP%(9QR//487MSGC.//! 338!! T+#BN#=%A!Q?!:;<(#=(!>?!@)A=B!C?!)*+,(-!G#<=(!H!C=I=*B&(J!UGHCJV!>%*+)!)EA!"=B)! F%),! W#JB#EIB! C&%=J! #E! B+=! Q&;J=! X*#A#A,K#J9! 3'$(+ 1)0&$#! F;$%#J+=A! :E%#E=! Y#(JB2! ./! S)E;)(,!./549!A/95/-8O$#&%(=*(&A9558953383R! 334!! Z#%%#=(! [\9! \&E)A&B(&*#I! I&EB(&%! &N! &<)(#)E! N&%%#I;%)(! '(&]B+! )EA! A=<=%&*K=EB9! 4$(+5)((+!"#$%&'"$(!.//51$%&23-6049! 337!! [)(()P! Q>?! W(;KK&EA! >X9! Q)KK)%#)E! N&=B)%! &<)(#)E! A=<=%&*K=EB2! I&EJ=^;=EI=J! N&(! +=)%B+! )EA! A#J=)J=9! 1)0&$#+ 5,67+ !"8(! ./5.1$'!25856439! A/9583/OCXFM55M/.07! 33R!! XAJ&E! Q>?! _)')()P)! >`?! Q)Ba;b! QQ9! c+=! K)KK)%#)E! &<)(,! N(&K! '=E=J#J! B&! (=<=%)B#&E9!!"#$%&+1)9!.//-1!#24.0675.9!A/95.5/O=(9.//-M//5.! 33-!! F=*%#E'!QX?![*()A%#E'!>@9!Q&;J=!&<)(#)E!'=(K!I=%%!I,JBJ!;EA=('&!*(&'()KK=A! $(=)bA&]E! B&! N&(K! *(#K&(A#)%! N&%%#I%=J9! :)9+ 3'$(! .//51(!'233-6859! A/95//4OA$#&9.//59/.4-! 30/!! [b#EE=(! Q`9! C=';%)B#&E! &N! *(#K&(A#)%! N&%%#I%=! )JJ=K$%,! )EA! A=<=%&*K=EB9! ;<6+ 1)0&$#+=0#,*)!.//81$$20456759!A/95/-3O+;K;*AOAK#/./! 305!! [I+K#AB!W?!:<#BB!@X?!>E%)'!`?!)*+,(-!c+=!K;(#E=!]#E'=AM+=%#L!B()EJI(#*B#&E!N)IB&(! Y&L%.! #J! (=^;#(=A! N&(! '()E;%&J)! I=%%! A#NN=(=EB#)B#&E! )EA! &<)(,! K)#EB=E)EI=9! :)9+5,67+ !"8(!.//01$!$2-3360.9!A/95.0.OA=<9//-4-! 30.!! dA)! Q?! :BB&%=E'+#! @?! @(#J*&E#! G?! )*+ ,(-! Y&L%.! A#J(;*B#&E! I);J=J! K&;J=! &<)(#)E! N)#%;(=!$,!*=(<)J#<=!$%&Ib)'=!&N!N&%%#I%=!A=<=%&*K=EB9!;<6+4$(+>)")*!.//01$!255756R59! A/95/-3O+K'OAA+5.0! 303!! "&A=EJB=#E=(! `S?! @%),! @Q?! Q&=%%=(! @G?! )*+ ,(-! Q&%=I;%)(! I%&E#E'! &N! B+=! &<#E=! \(&]B+OW#NN=(=EB#)B#&E!N)IB&(M-!'=E=!)EA!=L*(=JJ#&E!&N!'(&]B+OA#NN=(=EB#)B#&E!N)IB&(M-! #E!&<#E=!)EA!$&<#E=!&<)(#=J9!3'$(+1)0&$#!5---1)#23R5649! 300!! Q#J+#E)!e?!C=,!C?!Y#E='&%A!QS?!)*+,(-!\=E=B#I!)E)%,J#J!&N!B+=!Qf%%=(#)EM#E+#$#B#E'! J;$JB)EI=!J#'E)%!B()EJA;IB#&E!*)B+]),!#E!K)KK)%#)E!J=L;)%!A#NN=(=EB#)B#&E9!>)")2+:)9! 5--41$#2.8776R79! 308!! W;(%#E'=(!>G?!`()K=(!F?!`)(=%J!"?!)*+,(-!@&EB(&%!&N!*(#K&(A#)%!N&%%#I%=!(=I(;#BK=EB! $,! )EB#MQf%%=(#)E! +&(K&E=! #E! B+=! K&;J=! &<)(,9! !"#$%&'"$($8?! 5---1$'#287R-6-49! A/95.5/O=EA&950/95.97./0! 304!! `=<=E))(! QX?! Q==()J)+#$! QY?! `()K=(! F?! )*+ ,(-! [=(;K! )EB#MK;%%=(#)E! +&(K&E=! %=<=%J! (=N%=IB! B+=! J#a=! &N! B+=! *(#K&(A#)%! N&%%#I%=! *&&%! #E! K#I=9! !"#$%&'"$($8?! .//41$'%23..R6309!A/95.5/O=E9.//8M58RR! 307!! D#JJ=(!S>?!A=!S&E'!YZ?!G)<=E!S[X?!)*+,(-!>EB#MQf%%=(#)E!+&(K&E=2!)!E=]!K)(b=(!N&(! &<)(#)E!N;EIB#&E9!1)0&$#+5,67+!"8(!.//41$!$256-9!A/9583/O(=*959//8.-! 30R!! @)(&E! F?! @+);<#E! [?! @+(#JB#EMQ)#B(=! [?! )*+,(-! C=J#JB)EI=! &N! +,*&'&E)A#I! *)B#=EBJ! ]#B+!K;B)B=A!\ECZ!(=I=*B&(!'=E=J!B&!*;%J)B#%=!\ECZ!)AK#E#JB()B#&E9!.+5('"+!"#$%&'"$(+ 4)*,7!5---1*'2--/649!A/95.5/OPI=K9R0939885R! 30-!! A=! C&;L! _?! e&;E'! S?! Q#J()+#! Q?! )*+ ,(-! >! N)K#%,! ]#B+! +,*&'&E)A&B(&*#I! +,*&'&E)A#JK!)EA!K;B)B#&EJ!#E!B+=!'&E)A&B(&*#EM(=%=)J#E'!+&(K&E=!(=I=*B&(9!@+!"8(+.+ 4)#!5--71!!%258-764/.9!A/95/84O_XSQ5--755.7337../8! 38/!! G),K)E!G@?!@&+=E!WF?!S#E!Q?!)*+,(-!Q;B)B#&EJ!#E!'&E)A&B(&*#EM(=%=)J#E'!+&(K&E=! (=I=*B&(! '=E=! I);J=! +,*&'&E)A&B(&*#I! +,*&'&E)A#JK9! @,*+ >)")*! 5--R1$*250689! A/95/3ROE'/5-RM50! 385!! F)((&BB! S>?! [b#EE=(! Q`9! `#B! %#')EA! )IB#&EJ! &E! &<)(#)E! JB(&K)%! I=%%J2! =NN=IBJ! &E! ! --! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /+01)! 10%%! (01(2#/304/! )45! 6/0(! *(&521/#&47! !"#$ %&'(")$ *&+! 8...9!!:;;<=>7! 5&#:[email protected];@8....-D;;:-I;;::JBKGLMKFNO7.7CP98GQ! O;8!! R**#'! SS7! P&1,/0! 1&4/(&%! &T! &U)(#)4! T&%%#12%)(! 50U0%&*304/! )45! T241/#&4! #4! 3)33)%67!%&'(")$,-./$012#!8..-9"##:F8E ! -..! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! /&0)1&2(&*#0! 345(42#&0! #0! 647)%4! 8#54! 9#)! :52#9)2#&0! &;! <=>! #0! ?#@@*4*2#0! A4B(&0@C! !"#$%&'"$($)*!D.-EFG40D.-H-IDJC!1&#G-.C-D-.K40CD.-HL-IDJ! JM.!! N4#! O8P! 8#@+()! 3P! O&B! QP! +,- .(/! R)('4241! 1#@(B*2#&0! &;! %B24#0#S#0'! +&(7&04K+B7)0! 5+&(#&0#5! '&0)1&2(&*#0! (454*2&(! '404C! 0$(- !"#$%&'"$(- 1.(,'2- 0#! D..-F!"G-TUVD..C!1&#G-.C-D-.K7401C-HC-C.HTE! JM-!! 8)!WP!X&0'!YP!8)2SBZ!88P!+,-.(/!R)('4241!1#@(B*2#&0!&;!%B24#0#S#0'!+&(7&04!$42)L @B$B0#2!%4)1@!2&!+,*&'&0)1#@7P!14;452@!#0!'&0)1)%!@24(&'404@#@P!)01!#0;4(2#%#2,C!3&$%- 4.,(-5%.#-6%'-7-6-5!D..UF!#!G-MDIUVIC!1&#G-.C-.MJK*0)@C.U.UMUJ-.-! JMD!! Q#024(+)'4(! ! -.-! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! *(0&12%)3&(,!4&%%#5%067!!"#$%&'(")$*&+!/.-/8!"9:;<=>./7!? -.7-../@A(?7//--B! C>>!! D)E)F)! GH! I)F)$0! JH! I)KK&! LH! &,$ -#.! MK?(&'0K@)K?(&'0K! (050*3&(! *)3+F),! (0'2%)306! 0N*(066#&K! &4! 3+0! '0K06! 4&(! 5,5%&&N,'0K)60O/! )K?! )A*+#(0'2%#K! #K! *0(#&12%)3&(,! '()K2%&6)! 50%%67! !"#$ /&##$ 01)"2(31"#! /.-C8#$"9B/=<-7! ? -.7-.-P@Q7A507/.-C7./7..B! C>;!! R2!SH!S#2!TH!R2!UH!&,$-#.!L03)$&%#5!5&K3(&%!&4!&&5,30!?010%&*A0K39!%#KV#K'!A)30(K)%! K23(#3#&K! )K?! (0*(&?253#10! &235&A067! /&##$ !"#$ 435&$ 623$ /!46! /.-<8!%9/<-=:-7! ? -.7-..:@6...->O.-BO-:C;OB! C;.!! W)3()Q!XH!Y#5+)(?6!ZJ7!T&(A&K)%!(0'2%)3#&KH!%&5)%#E)3#&KH!)K?!42K53#&K)%!)53#1#3,!&4! 3+0!*(&'0630(&K0!(050*3&(!#K!'()K2%&6)!50%%6!&4!()3!*(0&12%)3&(,!4&%%#5%067!01)"2(31"#"78! -;;C8&##9:P-=;7!? -.7-/-.@0K?&7-CC7/7>CBB/-8!$9-;.C=/-7! C;/!! ",0(6! LH! I2#*0(! RRH! R263)466&K! ZMH! &,$ -#.! [63(&'0K! (050*3&(O$03)! AYWM! 0N*(066#&K! #K! ()3! &1)(,9! ?&FKO(0'2%)3#&K! $,! '&K)?&3(&*#K67!!"#$01)"2(31"#$<-#,3;$!)! -;;:8&&9-:/=>/7!? -.7-/-.@A0K?7--7/7;>>:! C;C!! S2$)+K! \"H! L&,0(! ZJH! R&%?#K'! GJH! &,$-#.! M%30()3#&K! &4! (0*(&?253#10! 42K53#&K! $23! K&3! *(0K)3)%! 60N2)%! ?010%&*A0K3! )430(! #K60(3#&K)%! ?#6(2*3#&K! &4! 3+0! A&260! 063(&'0K! (050*3&(!'0K07!=("2$>-,#$:2-)$623$?$6$:!-;;C8"'9---P/=P7! C;B!! I(0'0!ZTH!T&?'#K!Z"H!]&260!Z^H!&,$-#.!R0K0()3#&K!)K?!(0*(&?253#10!*+0K&3,*06!&4! A#50!%)5V#K'!063(&'0K!(050*3&(!$03)7!=("2$>-,#$:2-)$623$?$6$:!-;;>8"(9- ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! 0.1!! 2()3#)!456!7(889):!;<6!=)998%!>?6!!"#$%&!@+8!(8%)A#&:B+#*!$8AC88:!&$8B#A,!):D! ()38!&:!#:+#$#:!"!DE(#:'!A+8!98:&*)EB8!A():B#A#&:F!'!()*$+,!#-#.#-!G..HI!"JHHKL11F! D&#J-.F-.KMN.-F'98F....-MGG1OFG0K0KFK0! 0.M!! 7(889):!;<6!2()3#)!456!=)998%!>?6!!"#$%&!PBB&3#)A#&:!&Q!):A#R9E%%8(#):!+&(9&:8! %8S8%B! C#A+! &$8B#A,! #:! %)A8! (8*(&DE3A#S8R)'8! C&98:F! /!0"1%# 2"!01%! G..MI#$J-.-L1F! D&#J-.F-.-1NTFQ8(A:BA8(AFG..1F.HF.M0! 0.O!! 5)9%)ERU):B8:! 4U6! @+E%BA(E*! P>6! V&+(! ;P6! !"# $%&! =E$Q83E:D#A,! #:! &S8(C8#'+A! ):D! &$8B8! 3&E*%8BF! 3+4# 5!*0)6# 789# :(;%! G..MI""J-1/0LMF! D&#J-.F-.K/N+E9(8*ND89./H! 0.K!! =)(Q)A#! W6! X&E:'! W6! 4+(#BA#:R>)#A(8! =F! YZ$8B#A,! ):D! Q89)%8! (8*(&DE3A#&:[F! <((# :(6)=01()%!G.-.I$!%&'(()%!J=0KLH/F!D&#J-.F-.-1N=.../R0G11\-.]M...MR^! 0-.!! @88D8!UW6!>8,8(!46!UEA3+#B&:!=_6!!"#$%&!;:D&A+8%#)%!QE:3A#&:!):D!#:BE%#:!(8B#BA):38! #:!*&%,3,BA#3!&S)(,!B,:D(&98J!A+8!8QQ83AB!&Q!98D#3)%!A+8()*,F!/!0"1%#2"!01%!G.-.I*+J-O0L K-F!D&#J-.F-.-1NTFQ8(A:BA8(AFG..OF.KF./0! 0--!! >)(3+! ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! !"#"$!-0001!"20344567! /43!! 89:#%)%;),! <=! >&?:+#@! A<=! "B::&! >=! %&"'()! CDE9::! E+&%9:;9(&%! #@FBE9:! G&B:9! 9''! )E;#H);#&@!)@F!G),!E)B:9!I9G)%9!#@I9(;#%#;,7!*+,-".'&("$-'/"#-0"!"#"$!4.-/1###2C/0645 J.7!F-.7-.63K*@):7-/-J0L/---! /4/!! M#N?! "=! OG#;N! P7! QH)(#)@! +,*9(:;#GB%);#&@! :,@F(&G9! )I;9(! :B*9(&HB%);#&@! B:#@'! A@MR!)'&@#:;:!I&(!STU!)@F!(9%);9F!*(&E9FB(9:7!123"4%5+,/"678"9:;(!-0041$234.567! /4L!! <%$9(;! V=! A)((#F&! W=! X9(E)F9(! <=! %&" '()! Y+9! (&%9! &I! 9@F&;+9%#)%! E9%%:! #@! ;+9! *);+&'9@9:#:!&I!&H)(#)@!+,*9(:;#GB%);#&@!:,@F(&G97!<,("123"4%5+,/!4..41%2/.05-J7! /4Z!! V+BF9(%)@F!>=!"9@[ ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! +01)2! %034#2#546! '()20%&7)! 84%%7! 3(4)346! 9#3+! :;..?@!"AB?BCD=!6&#A-.=-.DBE1&%4+(E')1.-D! FBD!! :4&2)(6742! :G! H#4(71)! IG! ")%3742! JG! )-$ .#/! <4'0%)3#&2! &K! 7*&23)24&07! )26! #260846!(4701*3#&2!&K!14#&7#7!#2!1&074!&&8,347!$,!6#KK4(423!#23()84%%0%)(!*)3+9),7=!0$ ()*+",$1)+-2#!>...@!#$AB??CLB=! FF.!! M(N26)+%!O=!P&8,34!1)30()3#&2=!")7#8!)26!8%#2#8)%!)7*4837!&K!#2!Q#3(&!1)30()3#&2! RSTJU!9#3+!7*48#)%!41*+)7#7!&K!3+4!(&%4!&K!VVWJIX=!3.4$!),$5&##!>..L@%%A-C-Y=! FF-!! J)(Z2!"#Q427!O:G!:#26423+)%!"G!P["(#42!J\G!)-$.#/!I!7,23+43#8!)2)%&'04!&K!14#&7#7W )83#Q)3#2'! 734(&%! RVVWJIXU! #7! )! *&3423! )'&2#73! *(&1&3#2'! 14#&3#8! 1)30()3#&2! )26! *(4#1*%)23)3#&2!64Q4%&*1423!&K!1&074!&&8,347!1)30(#2'!#2!Q#3(&=!%&'$()*+",$678$94:#! >..F@!&A>BF.CF=!6&#A-.=-.DBE+01(4*E64+FBY! FF>!! \)2&97]#!"IG!M(&')2!J\G!\&247!XIG!)-$.#/!X3(0830()%!(4^0#(414237!&K!%#')267!K&(!3+4! &_,734(&%! %#Q4(! ;! (484*3&(7! :;<)%*+)! )26! :;<$43)=! ;+"<$ =.-#$ ><.,$ ?<2$ @$ ?$ >! -DDD@&'A>YYC?-=! FFB!! M(N26)+%! OG! P334742! \:G! :477%! JG! )-$ .#/! J4#&7#7W)83#Q)3#2'! 734(&%! *(&1&347! (4701*3#&2! &K! 14#&7#7! #2! 1&074! &&8,347! 80%30(46! #2! Q#3(&! #2! 8&23()73! 3&! (4%)346! &_,734(&%7=!52"#$()*+",!-DDL@%(A->D?CB.>=! FFF!! X4$#(4! `\G! \&%%,! JG! a)((#7! \bG! )-$.#/! J)34(2)%! &$47#3,! )26! *(4'2)28,! &038&14A! )! 7306,!&K!>L?G>-B!*(4'2)28#47!#2!:&26&2=!A4-$0$6B)C$()#.-$!)-.B$32C"+,$0$A4-$>CC"<$?-&,D$ 6B)C!>..-@#%A--?/CL>=!6&#A-.=-.BLE7c=#c&=.L.-Y?.! FF/!! d+)2'!\G!"(#8]4(!:G!H(),!XG!)-$.#/!b&&(!034(#24!8&23()83#%#3,!#2!&$474!9&142=!506E$ A4-$0$6BC-)-$ED4.)<"#!>..?@!!)ABFBCL=!6&#A-.=----Ec=-F?-W./>L=>..Y=.->BB=_! FFY!! X+)2])(!eG!d+&2'!fG!e)2'!bG!)-$.#/!J)34(2)%!&$47#3,!*(&1&347!)!*(K%)11)3&(,! 7#'2)30(4! #2! ()3! 034(07! )26! $%)73&8,73=! 94,"<+24"#":D! >.--@!%#AF-/LC?.=! 6&#A-.=->-.E42=>.-.W-.?L! FF?!! M)((#7! g ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! 01/!! 2#3454$&('! 67! 85(9(:,;;5! <7! =)4;;54;! >?! @+5! :A5(#45! ;*#()%! )(A5(#5;! #4! +:B)4! *(5'4)49,C! D)9A;! )4E! 9&4A(&F5(;#5;?! !"#$%&'#! G../H!"CIJIK1L?! E&#C-.?-.-/M3?*%)954A)?G..1?-G?../! 01N!! O#B!PQR7!O#B!R>?!S9:A5!SA+5(&;#;!&D!A+5!TA5(#45!U*#()%!S(A5(#5;C!V%#4#9&*)A+&%&'#9! WB*%#9)A#&4;?!()!#'*+"),-#&.")/%0!G.-1H#$C0/GKN-?!E&#C-.?0-JGM3*AB?G.-1?-.?GJ! 01L!! 2)F)4! <7! =5(B&:5A! S7! @;)A;)(#;! 87! %') #"1! <#*#E;! D(&B! &X#E#Y5E! %&ZQE54;#A,! %#*&*(&A5#4! B&E:%)A5! +:B)4! A(&*+&$%);A! #4F);#&4C! #4F&%F5B54A! &D! 4:9%5)(! %#F5(! [! (595*A&(;?!2&0+$-3&+"+45!G..0H%#&C01LJKI-?!E&#C-.?-G-.M54?G..JQ-N0N! 01I!! >)(95):!\7!8&%%5!]=7!\)%%&A!]7!%')#"1!2%)954A)%!5X*(5;;#&4!&D!A+5!4:9%5)(!(595*A&(;! D&(!&X,;A5(&%;!<[6)%*+)!)4E!<[6$5A)!E:(#4'!B&:;5!)4E!+:B)4!E5F5%&*B54A?!6&#')7%$)6) 83.$+9)/+"):%"")29+");3+"!G..1H!'(C-N1KL-?!E&#C-.?-..GM)(?)?G.-1N! 0/.!! 2%^;9+!@7!\5%%+):;!S7!F)4!UA()A54!_>_7!%')#"1!@+5!%#F5(![!(595*A&(!`<[6a!)4E!#A;! A)('5A!'545!S"VS-!)(5!(5':%)A5E!:*&4!%&Z!&X,'54!#4!+:B)4!A(&*+&$%);A!95%%;C!)!(5);&4! D&(! )%A5()A#&4;! #4! *(559%)B*;#)b! !"#$%&'#! G.-.H(%CI-.KL?! E&#C-.?-.-/M3?*%)954A)?G.-.?.N?..I! 0/-!! S,5!W<>=7!c)EE5%%!"P7!>)(d!2P7!%')#"1!eX,;A5(&%;!#4+#$#A!E#DD5(54A#)A#&4!)4E!D:;#&4! &D!A5(B!*(#B)(,!A(&*+&$%);A;!$,!)9A#F)A#4'!%#F5(![!(595*A&(;?!!"#$%&'#!G.--H(!C-LJKI-?! E&#C-.?-.-/M3?*%)954A)?G.-.?-G?..N! 0/G!! c55E&4Qf5d3g(! >U7! P&+4;54! \>7! S4A+&4#;54! _=7! %') #"1! _X*(5;;#&4! &D! %#F5(! [! (595*A&(;! #4! *(5'4)49#5;! 9&B*%#9)A5E! $,! *(559%)B*;#)?! !"#$%&'#! G.-.H(%CL-LKG0?! E&#C-.?-.-/M3?*%)954A)?G.-.?./?.-1! 0/J!! =54(,Q"5('5(! P7! >&:Y)A! O7! ")(&4! U7! %') #"1! _4E&'%#4! `V]-.1a! 5X*(5;;#&4! #;! (5':%)A5E!$,!A+5!%#F5(![!(595*A&(!)%*+)!`h6-=Ja!#4!+:B)4!A(&*+&$%);A!95%%!%#45!PS6?!;3+") 7%<-+0!G..LH"'CI/LKN1?!E&#C-.?-.I1M$#&%(5*(&E?-.N?.//0IL! 0/0!! 854d)A5;+)! U7! @&*&(;#)4! >7! <)B! V7! %') #"1! U&%:$%5! 54E&'%#4! 9&4A(#$:A5;! A&! A+5! *)A+&'545;#;!&D!*(559%)B*;#)?!=#')/%0!G../H%!C/0GKI?!E&#C-.?-.JLM4B-0GI! 0/1!! >&:Y)A! O7! >5(9#5(! _7! 2&%'5! S7! %') #"1! S! 9&BB&4! *&%,B&(*+#;B! #4! h6-=G! `<[6$5A)a! #;! );;&9#)A5E! Z#A+! *(559%)B*;#)?! ;/:) /%0) >%&%'! G.--H%!C-01?! E&#C-.?--L/M-0N-QGJ1.Q-GQ-01! 0//!! >#5AA#454! =_7! 6),$:(4! =7! O(#5'5(! >?! S$4&(B)%! %#*&*(&A5#4! B5A)$&%#;B! )4E! (5F5(;#$%5! D5B)%5! #4D5(A#%#A,! #4! =]7! \5%,Q25(4&A! S7! fi(5A! "7! %') #"1! 65A#4 ! )9#E! #4E:95;! U5(A&%#! 95%%! *)()9(#45! ;#'4)%;! D&(! ;*5(B)A&'&4#)! E#DD5(54A#)A#&4! $:A! 95%%! ):A&4&B&:;%,! E(#F5;! ;*5(B)A&9,A5! B5#&;#;?! !-+$) =#'") 6$#0) @$3) A) @) 6! G.-GH%)$C-/1LGKN?! E&#C-.?-.NJM*4);?-G-0IJ/-.I! 0/L!! 85(45A! h7! ]5445D5%E! V7! 6&9+5AA5Q_'%,! V7! %') #"1! 65A#4 ! )9#E! B5A)$&%#;B! )4E! ;#'4)%#4'! *)A+Z),;! #4! A+5! )E:%A! )4E! E5F5%&*#4'! B&:;5! A5;A#;?! 2&0+$-3&+"+45! G../H%#"CI/K--.?!E&#C-.?-G-.M54?G..1Q.I1J! 0/I!! ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! 0/1!! 2)3!45!6#7!45!879!:5!!"#$%&!;#9<=#3>7?9>!&$9@#<,!#3!A)%9!BC/"6DE!A#?9!>9?(9)@9@! F9(<#%#<,!)@!)!?&3@9G793?9!&F!>#@(7*<9>!$%&&>=<9@<#@!$)((#9(H!'%()#*+!!I.-CJ!"K9.-I.//CH! >&#K-.H-1/-DL&7(3)%H*&39H.-I.//C! 0/0!! MN7A)! 45! MOB&33&(! PQ5! R7#(! SP5! !"# $%&! T9'7%)<#&3! &F! )?<#U#3! P! )3>! #3+#$#3! "! @9?(9<#&3! $,! #3F%)AA)<&(,! A9>#)<&(@! #3! )>7%&#K-.H-E//DL&9H-H.EIEE! 0/C!! :)@<39(!X5!R)(N!R5!69#>!R5!!"#$%&!P$3&(A)%!@*9(A)<&'939@#@!#3!T8T!$9<)!A7<)3=>9*93>93&#K-.H-.1ZD@LH9A$&(H/0...Y0! 0//!! X%7A*! PV5! Q(#?N@&3! V:5! ^93'! ^5! !"# $%&! P*&%#*&*(&<9#3! P=_! #@! (9G7#(9>! F&(! ?+&%9@<9(,%! 9@<9(! )??7A7%)<#&3! #3! @<9(&#>&'93#?! ?9%%@! )3>! F&(! 3&(A)%! )>(93)%! @<9(&#>! *(&>7?<#&3H!,#:%1+#;+5!3"!-YYEJ&$KIEE.W/-H!>&#K-.H--/IDSB_--Z/-E! 0/Z!! `()U9(7?<#&3!&F!)*&*<&@#@!$,!IC=+,>(&a,?+&%9@<9(&%! #3!)>7%#'!?9%%@K!*(&<9?<#U9!9FF9?#&%H!8!90(.#<(=1/(%#-%>3?(0.#@! I..EJ''KCE0W/.H!>&#K-.H-.-EDLH(9*(&<&aHI..EH.CH..E! 0/Y!! R)<<)?N!]5!;9U#!T5!:7<7A!`5!!"#$%&!`+9!9U)%7)<#&3!&F!@9(7A!%9U9%@!&F!<9@<&@<9(&39! #3! <,*9! I! >#)$9<#?! A93! )3>! #<@! (9%)<#&3! b#<+! %#*#>! *(&F#%9H! ,# :%1+# 41$A+# 8!3# ,:48! I.-CJ&K"B.0W/H!>&#K-.H/ZE.DSB;TDI.-CD--.0YHC1Z-! 0Z.!! X)*)>&*&7%&@! cH! B+&%9@<9(&%! +&A9&@<)@#@! )3>! #3F9(<#%#<,K! <+9! %#U9(! 8! (9?9*<&(! ?&339?<#&3H!-+.(/01+(%(AB!I..CJ!()KIC-/WZH!>&#K-.H-I-.D93HI..C=.1-Y! 0Z-!! 6&$)??)(&!S=RP5!`(&7@@&3!PH!Q3U#(&3A93<)%!9@<(&'93!9a*&@7(9!>7(#3'!F9<)%!%#F9K!)! <#A9! $&A$! F&(! *(&@<)<9! ?)3?9(H! -+.(/01+(%(AB! I.-0J!%%KECEWZH! >&#K-.H-I-.D93HI.-0= -.C/! 0ZI!! X&AA#9(!PSB5!;7F&7(!S5!P%U9@!\5!!"#$%&!6#U9(!a!(9?9*<&(@!*(&<9?9U9%&*A93&#K-.H-1/-DL&7(3)%H*'93H-..10Z1! 0Z1!! ")@?#)3#!V5!;9!67?)!\5!;&%?#!V5!!"#$%&!X%)<9%9<=>9(#U9>!'(&b<+!F)?<&(!(9?9*<&(!$9<)= @7$<,*9! (9'7%)<9@! *(&%#F9()<#&3! )3>! A#'()<#&3! &F! '&3&?,<9@H! -+.(/01+(%(AB! I..ZJ!(&KEIIEW1CH!>&#K-.H-I-.D93HI..Z=.10Y! 0Z0!! \)(?#)!`85!d&FA)33!R=BH!]M`Bd!@#'3)%#3'!#3!V9(<&%#!?9%%@!(9'7%)<9@!'&3&?,<9!F)<9H! :!%%#:B/%!#2!(0A!"#&#K-.H0-E-D??HICEI/! 0ZC!! ]&(<&3! S]5! VN#339(! R:H! T9'7%)<#&3! &F! V9(<&%#! ?9%%! F73?<#&3! )3>! >#FF9(93<#)<#&3! <+(&7'+! <+9! )?<#&3@! &F! )! <9@<#?7%)(! *)()?(#39! F)?<&(! X=R&>=VH! -+.(/01+(%(AB! -YZYJ!'(KI/--WYH!>&#K-.H-I-.D93>&=-I0=E=I/--! 0ZE!! 6#7!;5!R)<[7N!RR5!V73'!^:5!!"#$%&!B,?%#3!P-!#@!(9G7#(9>!F&(!A9#&@#@!#3!<+9!A)%9! A&7@9H!@$"#2!+!"!-YYZJ'"K1//WZ.H!>&#K-.H-.1ZD1ZCC! 0Z/!! V?+()>9(! R5! Re%%9(=`#>&b! B5! T)U3#N! V5! !"# $%&! B,?%#3! P-! )3>! ')A9<&'939@#@! #3! F9(<#%9!)3>!#3F9(<#%9!*)<#93<@K!)!*&<93<#)%!39b!A&%9?7%)(!>#)'3&@<#?!A)(N9(H!DE>#8!90(.# *=?#-+A%!I..IJ!$KI11ZW01H! 0ZZ!! V+)+)!B5!`(#*)<+#!T5!R#@+()!;XH!R)%9!'9(A!?9%%!)*&*<&@#@K!(9'7%)<#&3!)3>!$#&%&',H! 'F1%(3#<0$+3#8#)(/#C(+.#7#71(%#)/1!I.-.J*)%K-C.-W-CH!>&#K-.H-.YZD(@<$HI..YH.-I0! 0ZY!! P# ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! 01-!! 2%%#&33! 456! 7+89'! :6! ;)(98?*8@38A! (8BC#(8D893! E&(! 2F4G-! #9! @%8)()9@8! &E! )*&*3&3#@! '8(D! @8%%H! #9! I#I&J! '$"()!! K.-.L!"#MNNNOPJ! A&#M-.J-.N/Q9)3C(8.1NRS! 01K!! 2%%#&33! 456! 5)I#@+)9A()9! T:J! 2F4G-! H#'9)%#9'! #9! )*&*3&3#@! '8(D! @8%%! @%8)()9@8! )9A! H*8(D)3&'898H#HJ! *++# '# ,# *-$.# /-0! K.-.L$%&'MN.OSJ! A&#M-.J----QUJ-P01V SSNKJK.-.J.RPS0J?! 01N!! W#H3)%!46!58')A8()!X6!Y#9#3Z<,!;6!!"#$%&![()9C%)(!@+)9'8H!#9!:8(3&%#!@8%%H!#9!@+#%A(89! )9A! *C$8(3)%! *)3#893HJ! 1!)"0%# /"!)0%! K..RL()M-0/1O11J! A&#M-.J-.-SQUJE8(39H38(3JK..0J-KJ.NK! 010!! ;&9HV58U()U#! \6! :#&9! "6! :)8Z! ]6! !"#$%&! ^5&%8! &E! (8)@3#I8! &?,'89! H*8@#8H! _5G:`! &9! +CD)9!H*8(D)3&Z&)!)9A!D)%8!#9E8(3#%#3,aJ!23+4-5%560!#789"4")0:(!#1!)"0%!K..1L)#MRK1O NRJ!A&#M-.J-.-SQUJ',&$E8JK..1J.0J.-R! 01R!! Y#%C9A! T56! bC! F6! cC! ]6! !"# $%&! \#'+V%8I8%! 8?*(8HH#&9! &E! d"e[R! )9A! d"e[/! )3389C)38H! A#83V#9AC@8A! +,*8(@+&%8H38(&%8D#)! )9A! )3+8(&H@%8(&H#H! #9! FA%(VQV! D#@8J! ;# <0=0.#>!9!K..0L!*M-0K1ONSJ!A&#M-.J--10QU%(J40..-SPVXF5K..! 01S!! :&%@)! e6! f#93! [:6! ;)38%! :"J! =#83)(,! ?89&H38(&%H! %8)A! 3&! #9E8(3#%#3,! )9A! %&HH! &E! )$A&D#9)%! )A#*&H8! 3#HHC8! #9! H38(&%#9VA8E#@#893! D#@8J! ;# <0=0.# >!9! K.-NL*!MN1PO0.1J! A&#M-.J--10QU%(J4.N-0PS! 01P!! Y8%38(!\6!T)D*E8(!e6!F)CE!:6!!"#$%&!;)(3#)%!%&HH!&E!@&93()@3#%8!D)(<8(!*(&38#9H!#9! +CD)9! 38H3#@C%)(! *8(#3C$C%)(! @8%%H! #9! #9E8(3#%#3,! *)3#893HJ! *+.)5%563! K.-NL$MN-/OK0J! A&#M-.J----QUJK.0PVK1KPJK.-KJ...N.J?! 01/!! Y8%H+! 46! :)C9A8(H! ;fT6! d3)9)HH&I)! W6! !"# $%&! d9A(&'89! )@3#&9! I#)! 38H3#@C%)(! *8(#3C$C%)(! D,&#A! @8%%H! #H! 8HH893#)%! E&(! D)%8! E8(3#%#3,J! 1*/?@#;#7AA#B(8%#1!.#*C#/5-#?D=# @05%!K..1L%)M0K-/ON.J!A&#M-.J-.1SQEUJ.1V-N/N0P! 011!! f&**)(#!X6!g#(3)989!\26!4)#9!T46!!"#$%&!e(,*3&(@+#A#HD!)9A!+,*&H*)A#)H!)H!)!H#'9! &E!38H3#@C%)(!A,H'898H#H!H,9A(&D8!_f=:`M!89I#(&9D893)%!@&998@3#&9J!@0)"#E!A!-"9#>!9#*# F%0+#G5%#H!)$"5%!K.-.L((M1-.O1J!A&#M-.J-..KQ$A()JK.P.P! R..!! \89A8(H&9!e[6!d+D8A!dd6!:8H38(+899!h6!!"#$%&!29C@%8)3#&9!E&(!*(8*C$8(3)%!%8,A#'! @8%%!3CD&(J!;#I)5%!K..SL$#"MP.NORJ!A&#M-.J-.-SQUJUC(&JK..SJ.NJ./N! R.-!! g#(3)989!\26!f&**)(#!XJ!2*#A8D#&%&',!)9A!*)3+&'898H#H!&E!@(,*3&(@+#A#HDJ!J(C# >!=)5.#I=.$"!!K../L$!M01OR/J!A&#M-.J-.1NQ+CDC*AQADD.KP! R.K!! FC9A+&%D!F6!4&Ii()(8!:6!:38EE89H89!T56!!"#$%&![898!8?*(8HH#&9!*(&E#%#9'!#A893#E#8H! %#I8(! c! (8@8*3&(! )%*+)! )H! )9! 8H3(&'89V(8'C%)38A! '898! #9! D&CH8! )A#*&H8! 3#HHC8J! ;# G5%# ?+.5-)0+5%!K..0L)%M/P1O1KJ! R.N!! \)9!:Vh6!T&D)3HC!b6!4C(),)D)!d6!!"#$%&!2H3(&'89!(8@8*3&(!%#')9AH!)D8%#&()38!E)33,! %#I8(! 3+(&C'+! )! 9&9@%)HH#@)%! 8H3(&'89! (8@8*3&(QF#I8(! c! (8@8*3&(! *)3+j),! #9! D#@8J! J!=$"5%#@$%"0C#G.!K.-0L*'M-P1-O/.KJ!A&#M-.J-..KQ+8*JKS1R-! R.0!! hH+#<)j)!f6!bC+)99)!h:6!>D83)9#!X6!!"#$%&!Fc5kQ8H3(&'89!(8@8*3&(Vl!H#'9)%#9'!#9! %#*#A! ()E3H! *(8H8(I8H! 89A&3+8%#)%! #938'(#3,J! ;# F%0+# K+L!9"! K.-NL$%)MN0//O1PJ! A&#M-.J--PKQXehSSRNN! R.R!! 5&C#%%8(V])$(8! g6! [C8(BC#9! 4X6! WmfCD$)V",9! f6! !"# $%&! WC@%8)(! (8@8*3&(H! )9A! 89A&@(#98!A#H(C*3&(H!#9!E83)%!)9A!98&9)3)%!38H38HM!)!')**8A!%)9AH@)*8J!1)5+"#?+.5-)0+5%! K.-RL"MR/J!A&#M-.JNN/1QE89A&JK.-RJ...R/! R.S!! g8A#9!FVF6!F8j)9A&jH<#!:d6!;)(#9#!;6!!"#$%&!f+8!&?,H38(&%!(8@8*3&(!Fc5!#9+#$#3H! *(&%#E8()3#&9! &E! +CD)9! $(8)H3! @)9@8(! @8%%HJ! F$)-0+56!+!909! K..1L)&MRPRO1J! A&#M-.J-.1NQ@)(@#9Q$'*.K1! R.P!! GCD8AA&C(! d6! g#899&#H! 26! e)#()! ]6! !"# $%&! F#I8(! c! (8@8*3&(H! #938(E8(8! j#3+! 3+8! A8%838(#&CH! 8EE8@3! &E! A#83+,%H3#%$8H3(&%! &9! 38H3#@C%)(! *+,H#&%&',J! @05-M!C# @05=M39# >!9# F5CC(+!K.-0L!!"MSRSOSKJ!A&#M-.J-.-SQUJ$$(@JK.-NJ-KJ..R! ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! 0.1!! 234#5)6! 78! 29:3:;3%! ?8! !"# $%&! @3%)5#&:6+#*! $35A33:! )'3! ):&%#:368! )! :3A! C%)66! &;! %#43(! [! (3C3*5&(! )'&:#656! A#5+! 63%3C5#4#5,! ;&(! 2[@$35)G! 0# 5!)# 47!8! F..HI%&DJF00K/G! <&#D-.G-.F-LMB.H.J0N;! 0-F!! Q)^<)6,! R8! 7%! W)MM)M#! XO_8! ")*5#66)(5! Q8! !"# $%&! T<3:5#;#C)5#&:! &;! 5+3! ;9:C5#&:6! &;! 2#43(! [! @3C3*5&(! `! #:! R3(5&%#! C3%%6! 96#:'! )! 5)('353)5!a8!")(&:!R8!Q)(C3)9!V8!!"#$%&!7B3('#:'!(&%36!;&(!2[@6!):*+)!-///I%DHFEK N-G! 0-E!! RB&%#\&4)!a8!Q%,:)(C#\&4)!]8!RC69\&4)!RG!@&%3!&;!#:53(%39\#:6!#:!5+3!(3'9%)5#&:!&;! &4)(#):!;9:C5#&:6G!.()+1*#=!,/%!F.-FI$'DFNHK0NG! 0-H!! 2#B! W8! e)(#)! "U8! f)6! Ra8! !"# $%&! Q9%5#*%3! ;3B)%3! (3*(&<9C5#43! ;)#%9(36! #:! C,C%&&P,'3:)63!FO<3;#C#3:5!B#C3G!4!%%!-//HI"#D-/HKF.1G! 0-1!! U&963! SX8! "9:C+! fd8! 2#:<>3,! S8! !"# $%&! e(343:5#&:! &;! 5+3! *&%,C,65#C! &4)(#):! *+3:&5,*3! ):)5#&:! &;! &49%)5&(,! C)*)C#5,! #:! 5+3! 365(&'3:! (3C3*5&(O)%*+)! \:&C\&95!B&963G!.()+1*-(+%+,9!-///I#$&D0100KE0G!<&#D-.G-F-.L3:<&G-J.G-FGHFFF! 0-/!! f3%4#':3!]8!@&>3:$3('!RG!R,653B)5#C!(34#3A!&;!<)5)!C&:C3(:#:'!35#&*)5+&%&',!&;! &4)(#):!+,*3(65#B9%)5#&:!6,:<(&B3G!?("#0#2!*"-%#@+8!(A#5!)!F..FI$)DF--KFEG! 0F.!! ](5#:#! eV8! Q&:5#! Q8! X)6C#):#! ]8! !"# $%&! Z)6C9%)(! 3:<&5+3%#)%! '(&A5+! ;)C5&(8! #:53(%39\#:OE! ):*+)#D-+%!F..FI#&#D-E/KHJG! 0F-!! ")(OS&63*+! W8! "3:O]B#! T8! @&:O7%! @8! !"# $%&! e#'B3:5! 3*#5+3%#9BO<3(#43*+)# 4$86# .(,%! F.-EI#%#D-H/K10G!<&#[email protected]! 0FF!! Q#%%3(!T8!U+9<3(%): ! -./! ! ! ! ! ! ! ! ! ! "#$%#&'()*+,! )/'#&'0/01#1! $,! #2*)#(#/'! %#*#3! ()45! %&6)%#7)5#&/! )/3! 1#'/)%#/'! &4! 8)169%)(! 0/3&5+0%#)%! '(&:5+! 4)65&(! (060*5&(;<=! !"#$"%&'()$"* +,"&-.* /0'(* 1%&)! <.-<>!"?<<@.A@=! 3&#?-.=--B-CDEF"DGD=--<= ! --.! ! ! ! ! ! ! ! !"#$%&'(%)*+,-+.+/%0-1+2+3-&-#()14+5+,'*4+$'+#674%)#'(6)$)8%-+,-4+8)*',-4+ 39:;<9+ !"# $%&'()(%&# "**+,%+# -# )./+0'+# ",%0+))+# 1'2$# 3+# 456789# 3+$# ,:01)+$# +%# $"# 1'&;")+<,+# +$%# +<# 1':='+$$(:<#3+10($#>0"%'+#-#,(<>#3&,+<<(+$?#@+%%+#1':='+$$(:<#&;:)0+#1"'"))2)+A+<%#-#)"#1'&;")+<,+#3+# ).&1(3&A(+# 3.:B&$(%&# +%# 3+# $C<3':A+# A&%"B:)(>0+# 3"<$# )+# A:<3+?# D+# A0)%(1)+$# "'=0A+<%$# 1/C$(:):=(>0+$# +%# &1(3&A(:):=(>0+$# ,/+E# ).F:AA+# $:0%(+<<+<%# )./C1:%/2$+# 3+# ).(<*)0+<,+# 3+# )./:A&:$%"$(+#3+$#)(1(3+$#$0'#)"#*:<,%(:<#=:<"3(>0+?#G<#1"'%(,0)(+'H#)+#,/:)+$%&':)#+$%#0<#*",%+0'#,)+*#3"<$# )"#'&=0)"%(:<#3+#)"#$%&':I3:=+<2$+#+%#3+#)"#="A&%:=+<2$+?#J(+<#>0+#)+$#"%%+(<%+$#=:<"3(>0+$#$+AB)+<%# A0)%(*",%:'(+))+$H#)+$#A&,"<($A+$#A:)&,0)"('+$#'+$%+<%#A&,:<<0$#3"<$#)"#A"K:'(%+$#,"$?#!+$#!"#$%&'& ($)$*+,%-#L!MNO#+%#PQ#$:<%#3+$#'&,+1%+0'$#<0,)&"('+$#",%(;&$#1"'#)+$#:RC$%&':)$H#,+#$:<%#,)"$$(>0+A+<%# 3+$# '&=0)"%+0'$# 30# A&%"B:)($A+# )(1(3(>0+?# S)0$(+0'$# &%03+$# :<%# 3&A:<%'&# ).(A1:'%"<,+# 3+# ,+$# '&,+1%+0'$#3"<$#)"#1/C$(:):=(+#3+$#=:<"3+$?## @+# %'";"()# (3+<%(*(+# )+$# 'T)+$# A0)%(1)+$# 3+$# !MN$# 3"<$# )+# A"(<%(+<# 3+# )"# *+'%()(%&# A"$,0)(<+# +%# *&A(<(<+H#+%#3&,'(%#).+**+%#3+#)./:A&:$%"$(+#30#,/:)+$%&':)#$0'#)"#A"%0'"%(:<#3+$#,+))0)+$#=+'A(<")+$#3"<$# )+# %+$%(,0)+# +%# ).:;"('+?# @+# %'";"()# $+# ,:<,+<%'+# $0'# )."<")C$+# ,:A1"'"%(;+# 3.0<+# )(=<&+# 3+# $:0'($# '&6 +R1'(A"<%#!MNP#L!.%/01213456!.%0Q#$:0$#,:<%'T)+#3+#1':A:%+0'#3.UVF#/0A"(<#L+R1'+$$(:<#$1&,(*(>0+# 3"<$# )+$# ,+))0)+$# 3+# W+'%:)(# 3"<$# )+# %+$%(,0)+# +%# )+$# ,+))0)+$# 3+# X'"<0):$"# 3"<$# ).:;"('+Q# $0'# 0<# *:<3# =&<&%(>0+#3+#$:0'($#!.%/0121?# !."B$+<,+#3.0<#($:*:'A+#3+#!MN#"B:0%(%#-#3+$#3&*"0%$#$1&,(*(>0+$#3"<$#0<#%C1+#,+))0)"('+#30# %+$%(,0)+?# Y&"D3$5"#$!)2&.-#$567$).1)]".*$!U"Z%'"##)(.$-U'<=->%2/61?%"*$@51A$'*%B'#./%"*$-&.#$!U&('*"$-"$ /(-F!"#$/:').#$-+8"!(%%&.*$:."$&*1+'(#0!+'(#"$;??D3$S"*$"VV"*$&$+*+$+2&!"/".*$0(.V)'/+$ #:'$ !"#$ /(.(0E*"#$ 1:/&).#$ &8"0$ #*)/:!&*)(.$ -"$ !U"Z%'"##)(.$ -"$ T_RW,$ :."$ 0E*(`)."$ %'($ ).V!&//&*()'"$ ;