DOCSLIB.ORG

The FHA Domain of Aprataxin Interacts with the C-Terminal Region of XRCC1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The FHA Domain of Aprataxin Interacts with the C-Terminal Region of XRCC1 BBRC Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 www.elsevier.com/locate/ybbrc The FHA domain of aprataxin interacts with the C-terminal region of XRCC1 Hidetoshi Datea, Shuichi Igarashia,b,*, Yasuteru Sanoc, Toshiaki Takahashia, Tetsuya Takahashia, Hiroki Takanoa, Shoji Tsujid, Masatoyo Nishizawaa, Osamu Onoderaa,b a Department of Neurology, Brain Research Institute Niigata University, Nigata, Japan b Department of Molecular Neuroscience, Resource Branch for Brain Disease Research, Center for Bioresource-based Research, Brain Research Institute Niigata University, Nigata, Japan c Department of Neurology, Yamaguchi University, Japan d Department of Neurology, The University of Tokyo Graduate School of Medicine, Japan Received 25 September 2004 Available online 11 November 2004 Abstract Aprataxin (APTX) is the causative gene product for early-onset ataxia with ocular motor apraxia and hypoalbuminemia (EAOH/AOA1). In our previous study, we found that APTX interacts with X-ray repair cross-complementing group 1 (XRCC1), a scaffold protein with an essential role in single-strand DNA break repair (SSBR). To further characterize the functions of APTX, we determined the domains of APTX and XRCC1 required for the interaction. We demonstrated that the 20 N-terminal amino acids of the FHA domain of APTX are important for its interaction with the C-terminal region (residues 492–574) of XRCC1. Moreover, we found that poly (ADP–ribose) polymerase-1 (PARP-1) is also co-immunoprecipitated with APTX. These findings suggest that APTX, together with XRCC1 and PARP-1, plays an essential role in SSBR. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Aprataxin; SSBR; XRCC1; DNA repair; Single strand break repair; PNKP; Ligase; PARP; Neuronal death; Neuronal loss; AOA; EAOH; Spinocerebellar ataxia; Ataxia; FHA; FHA domain; BRCT; Oxidative stress Early-onset ataxia with ocular motor apraxia and recently identified the causative gene for EAOH/AOA1 hypoalbuminemia (EAOH/AOA1) is a form of autoso- and designated it as aprataxin (APTX) [5,6]. Long form mal recessive spinocerebellar ataxia characterized clini- aprataxin (APTX) is a major form compared with other cally by ocular motor apraxia, cerebellar ataxia, four isoforms; it is expressed in various human tissues peripheral neuropathy, and hypoalbuminemia [1,2]. including the central nervous system tissues and is local- Neuropathological studies have revealed a severe loss of ized in nuclei [7]. APTX has a forkhead-associated Purkinje cells, the degeneration of posterior columns (FHA) domain in the N-terminal segment, which binds and spinocerebellar tracts of the spinal cord, and a to phosphopeptides, and the C-terminal segment of marked loss of myelinated and unmyelinated fibers of APTX contains a histidine-triad (HIT) motif and a peripheral nerves [3,4]. We and other researchers have DNA-binding C2H2 zinc-finger motif. Employing co-im- munoprecipitation and yeast two-hybrid assays, we have recently demonstrated that APTX directly interacts with * Corresponding author. Fax: +81 25 223 6646. XRCC1, a scaffold protein involved in single-strand E-mail address: [email protected] (S. Igarashi). DNA break repair (SSBR) [7]. It has been demonstrated 0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.10.162 1280 H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 that XRCC1 plays an essential role in SSBR in collabora- Biotech) was added and the mixture was incubated for 30 min at RT tion with a polynucleotide kinase 30-phosphatase with gentle rotation. The beads were pulled down with a magnet and (PNKP), DNA polymerase b, poly(ADP–ribose) poly- washed with washing buffer (25 mM Hepes, pH 7.5, containing 50 mM NaCl, 0.1% NP40, and 10% glycerol and protease inhibitors (1 mM merase (PARP-1), and DNA ligase III [8,9]. These find- PMSF and 1· Complete Mini)). The beads were then dissolved in ings raise the possibility that APTX plays a role in Laemmli sample buffer (Bio-Rad). The samples were separated by SSBR through its interaction with XRCC1 [10,11].To SDS–PAGE using 5–15% precast gels (Bio-Rad) and then electrob- elucidate the functions of APTX, we conducted a detailed lotted onto PVDF membranes. Proteins were detected by immuno- analysis of the interaction between APTX and XRCC1 blotting with the anti-XRCC1 (C-15, 1:100 dilution; Santa Cruz), anti-PARP-1 (H-250, 1:200 dilution, Santa Cruz), anti-DNA poly- and other associated proteins. merase b (N-19, 1:100 dilution; K-16, 1:100 dilution; Santa Cruz), anti-TOPO1 (L-17, 1:100 dilution; C-15, 1:100 dilution, H-300; 1:200 dilution; Santa Cruz), and anti-APTX (ME44) antibodies (2000· dilution) for 1 h at 37 °C [7]. ECL Western blotting detection reagents Experimental procedures (Amersham Bioscience) were used for detection of bound antibodies. Yeast two-hybrid assay. For yeast two-hybrid assay, we used AH109, Plasmids. The plasmid construct of aprataxin-myc/pcDNA3.1 that which has MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4D, encodes the long form APTX was described previously [7]. The cDNAs gal80D, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA- coding for the N-terminus-truncated aprataxin fragments lacking amino ADE2, and URA3::MEL1UAS-MEL1TATA-lacZ, as the reporter strain acid residues 1–20 (APTX21–343-myc), 1–50 (APTX51–343-myc), or 1–80 (Clontech). APTX, XRCC1, and PARP-1 cDNAs were subcloned into (APTX81–343-myc) were generated by PCR amplification using one of the pGADT7 and pGBKT7 vectors (Clontech) to generate fusion proteins following forward primers, d20 (50-GGGGATCCGCCGCCACCATG including the GAL4 activation domain and the GAL4-DNA-binding CATTTGGAAGCAGTTGTGATT-30), d50 (50-GGGGATCCGCC domain, respectively. These constructs were introduced into Saccharo- GCCACCATGTGTAACAAGGGATATGTCAAG-30), or d80 (50- myces cerevisiae (AH109). Clones positive for the interaction were GGGGATCCGCCGCCACCATGCTGCAGCCTGGCCAGGT-30), examined for growth on plates lacking uracil, leucine, and histidine. with c-myc-tagged reverse primer (50-GGCTCGAGTTACAGATCCT Positive clones were subsequently confirmed on the basis of growth CTTCTGAGATGAGTTTTTGTTCCTGTGTCCAGTGCTTCCT-30). activity on plates lacking uracil, leucine, histidine, and adenine. These forward and reverse primers contained BamHI and XhoI sites, respectively. The PCR products were subcloned into the BamHI and XhoI-cleaved pcDNA3.1 expression vector (Invitrogen). The full-length XRCC1 cDNA was obtained by PCR amplification using the following Results forward and reverse primers containing EcoRI and SalI sites, respec- tively: XRCC1 forward primer (50AAGAATTCGACATGCCGGAGA FHA domain of APTX interacts with XRCC1 TCCGCCTCCGCCATGTCG30) and XRCC1 reverse primer 0 0 (5 AAGTCGACGGCTTGCGGCACCACCCCATAGAGCTGG3 ). To identify the segments of APTX essential for binding The amplified DNA fragments were subcloned into EcoRI and SalI-cleaved pcDNA3.1/myc-His vectors (Invitrogen). To construct with XRCC1, we constructed five plasmids coding for the deletion mutants of XRCC1, pcDNA3.1/myc-His-XRCC1 was full-length and truncated APTX molecules with deletions digested with EcoRI and BamHI for residues 1–590 (XRCC11–590-myc), in the N-termini, as shown in Fig. 1A (APTX1–343-myc, EcoRI and XhoI (XRCC11–574-myc), EcoRI and SacI (XRCC11–538-myc), APTX21–343-myc, APTX51–343-myc, APTX81–343-myc, 1–401 or EcoRI and KpnI (XRCC1 -myc), and then subcloned into the and APTX175–343-myc). Co-immunoprecipitation assays corresponding cloning sites of pcDNA3.1/myc-His vectors (Invitro- gen). The cDNA of full-length PARP-1 cDNA was obtained by PCR of HEK 293 cells transfected with the plasmid coding 1–343 amplification using the following forward and reverse primers con- for APTX -myc clearly detected XRCC1 (Fig. 1B), taining the BglII and SalI sites, respectively: PARP-forward primer while XRCC1 was not co-immunoprecipitated for (50-AAAGATCTAGGATGGCGGAGTCTTCGGATAAGCTCTAT APTX21–343-myc, APTX51–343-myc, APTX81–343-myc or 0 0 CG-3 ) and PARP-HA-tagged reverse primer (5 -AAGCGGCCGCTC APTX175–343-myc, suggesting that the N-terminal 20 ami- AGGCATAATCTGGCACATCATAAGGGTAGTCGACCCACAG GGAGGTCTTAAAATTGAATTTCAGTTTTC-30). The amplified no acids are essential for the binding of APTX with DNA fragments were subcloned into the BamHI and NotI sites of XRCC1. pcDNA3.1(+). Plasmid DNAs prepared from the human ovary and To confirm the interaction between the N-terminal re- testis Marathon-Ready cDNA library (Clontech) were used as the gions of APTX and XRCC1, we then conducted yeast template DNA for PCR amplification. The nucleotide sequences of all two-hybrid assay. The interaction between APTX1–343- of the constructs were verified by nucleotide sequence analysis. Immunoprecipitation and immunoblotting. HEK293 cells were myc and XRCC1 was clearly demonstrated, while no grown in DulbeccoÕs modified EagleÕs medium supplemented with 10% interaction was detected between XRCC1 and truncated fetal calf serum (Invitrogen). HEK293 cells in a 10-cm dish plate were APTX lacking the N-terminal 20 amino acids transiently transfected with 24 lg of each expression construct. (APTX21–343,APTX51–343,APTX81–343,andAPTX175–343) Twenty-four hours after the transfection, HEK293 cells were harvested (Fig. 1C). and then lysed in 1 ml lysis buffer (25 mM Hepes, pH 7.5, containing 50 mM NaCl, 1% NP40, and 10% glycerol) containing protease inhibitors (1 mM PMSF, 1· Complete Mini (Roche Diagnostic)) for Role of BRCTII domain of XRCC1 for interaction 1 h at 4 °C with gentle shaking. The lysate was centrifuged at 13,000g with APTX for 10 min at 4 °C. 2.5 ll of anti-c-myc monoclonal antibody (9E10, Roche Diagnostic) was added to 500 ll of the supernatant and the mixture was incubated for 1 h at 4 °C with constant rotation. Then We then characterized the segments of XRCC1 in- 30 ll of protein G-coupled magnetizable polystyrene beads (Dynal volved in the interaction with APTX. In our previous H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 1281 Fig. 1. FHA domain of APTX interacts with XRCC1.
Load more

Recommended publications
  • Comparison of the Effect of Mutant and Wild-Type P53 on Global Gene Expression
    [CANCER RESEARCH 64, 8199–8207, November 15, 2004] Comparison of the Effect of Mutant and Wild-Type p53 on Global Gene Expression Thomas J. O’Farrell, Paritosh Ghosh, Nobuaki Dobashi, Carl Y. Sasaki, and Dan L. Longo Laboratory of Immunology, Gerontology Research Center, National Institute on Aging, NIH, Baltimore, Maryland ABSTRACT compared with wild-type (WT) p53 (9). Generally, mutation of resi- dues directly contacting DNA results in a complete loss of DNA The mechanisms for “gain-of-function” phenotypes produced by mu- binding with little loss in folding of the domain, whereas mutation of tant p53s such as enhanced proliferation, resistance to transforming structural residues results in a Ͼ50% loss of folding and DNA binding growth factor-␤–mediated growth suppression, and increased tumorigen- esis are not known. One theory is that these phenotypes are caused by (9). However, considering that the NH2- and COOH-terminal domains novel transcriptional regulatory events acquired by mutant p53s. Another of p53 are distinct from the compact DNA-binding domain and explanation is that these effects are a result of an imbalance of functions considerably less ordered, the mutations in the DNA-binding domain caused by the retention of some of the wild-type transcriptional regulatory are less likely to affect the integrity and function of these domains. events in the context of a loss of other counterbalancing activities. An Because p53 is found mutated in approximately 50% of all cancers, analysis of the ability of DNA-binding domain mutants A138P and R175H, p53 mutants have been rather extensively studied for their ability to ؋ 3 and wild-type p53 to regulate the expression levels of 6.9 10 genes confer “gain-of-function” phenotypes on cells.
    [Show full text]
  • Plugged Into the Ku-DNA Hub: the NHEJ Network Philippe Frit, Virginie Ropars, Mauro Modesti, Jean-Baptiste Charbonnier, Patrick Calsou
    Plugged into the Ku-DNA hub: The NHEJ network Philippe Frit, Virginie Ropars, Mauro Modesti, Jean-Baptiste Charbonnier, Patrick Calsou To cite this version: Philippe Frit, Virginie Ropars, Mauro Modesti, Jean-Baptiste Charbonnier, Patrick Calsou. Plugged into the Ku-DNA hub: The NHEJ network. Progress in Biophysics and Molecular Biology, Elsevier, 2019, 147, pp.62-76. 10.1016/j.pbiomolbio.2019.03.001. hal-02144114 HAL Id: hal-02144114 https://hal.archives-ouvertes.fr/hal-02144114 Submitted on 29 May 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Progress in Biophysics and Molecular Biology xxx (xxxx) xxx Contents lists available at ScienceDirect Progress in Biophysics and Molecular Biology journal homepage: www.elsevier.com/locate/pbiomolbio Plugged into the Ku-DNA hub: The NHEJ network * Philippe Frit a, b, Virginie Ropars c, Mauro Modesti d, e, Jean Baptiste Charbonnier c, , ** Patrick Calsou a, b, a Institut de Pharmacologie et Biologie Structurale, IPBS, Universite de Toulouse, CNRS, UPS, Toulouse, France b Equipe Labellisee Ligue Contre
    [Show full text]
  • Repair of Double-Strand Breaks by End Joining
    Downloaded from http://cshperspectives.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Repair of Double-Strand Breaks by End Joining Kishore K. Chiruvella1,4, Zhuobin Liang1,2,4, and Thomas E. Wilson1,3 1Department of Pathology, University of Michigan, Ann Arbor, Michigan 48109 2Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, Michigan 48109 3Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109 Correspondence: [email protected] Nonhomologous end joining (NHEJ) refers to a set of genome maintenance pathways in which two DNA double-strand break (DSB) ends are (re)joined by apposition, processing, and ligation without the use of extended homology to guide repair. Canonical NHEJ (c-NHEJ) is a well-defined pathway with clear roles in protecting the integrity of chromo- somes when DSBs arise. Recent advances have revealed much about the identity, structure, and function of c-NHEJ proteins, but many questions exist regarding their concerted action in the context of chromatin. Alternative NHEJ (alt-NHEJ) refers to more recently described mechanism(s) that repair DSBs in less-efficient backup reactions. There is great interest in defining alt-NHEJ more precisely, including its regulation relative to c-NHEJ, in light of evidence that alt-NHEJ can execute chromosome rearrangements. Progress toward these goals is reviewed. NA double-strand breaks (DSBs) are seri- the context of influences on the relative utiliza- Dous lesions that threaten a loss of chromo- tion of different DSB repair pathways. somal content. Repair of DSBs is particularly Nonhomologous end joining (NHEJ) is de- challenging because, unlike all other lesions, fined as repair in which two DSB ends are joined the DNA substrate is inherently bimolecular.
    [Show full text]
  • Differential Effects of the Poly (ADP-Ribose)Polymerase (PARP
    British Journal of Cancer (2001) 84(1), 106–112 © 2001 Cancer Research Campaign doi: 10.1054/ bjoc.2000.1555, available online at http://www.idealibrary.com on http://www.bjcancer.com Differential effects of the poly (ADP-ribose) polymerase (PARP) inhibitor NU1025 on topoisomerase I and II inhibitor cytotoxicity in L1210 cells in vitro KJ Bowman*, DR Newell, AH Calvert and NJ Curtin Cancer Research Unit, University of Newcastle upon Tyne Medical School, Framlington Place, Newcastle upon Tyne NE2 4HH, UK Summary The potent novel poly(ADP-ribose) polymerase (PARP) inhibitor, NU1025, enhances the cytotoxicity of DNA-methylating agents and ionizing radiation by inhibiting DNA repair. We report here an investigation of the role of PARP in the cellular responses to inhibitors of topoisomerase I and II using NU1025. The cytotoxicity of the topoisomerase I inhibitor, camptothecin, was increased 2.6-fold in L1210 cells by co-incubation with NU1025. Camptothecin-induced DNA strand breaks were also increased 2.5-fold by NU1025 and exposure to camptothecin-activated PARP. In contrast, NU1025 did not increase the DNA strand breakage or cytotoxicity caused by the topoisomerase II inhibitor etoposide. Exposure to etoposide did not activate PARP even at concentrations that caused significant levels of apoptosis. Taken together, these data suggest that potentiation of camptothecin cytotoxicity by NU1025 is a direct result of increased DNA strand breakage, and that activation of PARP by camptothecin-induced DNA damage contributes to its repair and consequently cell survival. However, in L1210 cells at least, it would appear that PARP is not involved in the cellular response to etoposide-mediated DNA damage.
    [Show full text]
  • Protein Kinase CK2 in DNA Damage and Repair
    Review Article Protein kinase CK2 in DNA damage and repair Mathias Montenarh Medical Biochemistry and Molecular Biology, Saarland University, Homburg, Germany Correspondence to: Mathias Montenarh. Medical Biochemistry and Molecular Biology, Saarland University, Building 44, D-66424 Homburg, Germany. Email: [email protected]. Abstract: Protein kinase CK2, formerly known as casein kinase 2, is a ubiquitously expressed serine/ threonine kinase, which is absolutely required for cell viability of eukaryotic cells. The kinase occurs predominantly as a tetrameric holoenzyme composed of two regulatory α or α' subunits and two non- catalytic β subunits. It is highly expressed and highly active in many tumour cells. The proliferation promoting as well as the anti-apoptotic functions have made CK2 an interesting target for cancer therapy. It phosphorylates numerous substrates in eukaryotic cells thereby regulating a variety of different cellular processes or signalling pathways. Here, I describe the role of CK2 in DNA damage recognition followed by cell cycle regulation and DNA repair. It turns out that CK2 phosphorylates a number of different proteins thereby regulating their enzymatic activity or platform proteins which are required for recruiting proteins for DNA repair. In addition, the individual subunits bind to various proteins, which may help to target the kinase to places of DNA damage and repair. Recently developed pharmacological inhibitors of the kinase activity are potent regulators of the CK2 activity in DNA repair processes. Since DNA damaging agents are used in cancer therapy the knowledge of CK2 functions in DNA repair as well as the use of specific inhibitors of CK2 may improve cancer treatment in the future.
    [Show full text]
  • Base Excision Repair Synthesis of DNA Containing 8-Oxoguanine in Escherichia Coli
    EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 35, No. 2, 106-112, April 2003 Base excision repair synthesis of DNA containing 8-oxoguanine in Escherichia coli Yun-Song Lee1,3 and Myung-Hee Chung2 Introduction 1Division of Pharmacology 8-oxo-7,8-dihydroguanine (8-oxo-G) in DNA is a muta- Department of Molecular and Cellular Biology genic adduct formed by reactive oxygen species Sungkyunkwan University School of Medicine (Kasai and Nishimura, 1984). As a structural prefe- Suwon 440-746, Korea rence, adenine is frequently incorporated into oppo- 2Department of Pharmacology site template 8-oxo-G (Shibutani et al., 1991), and 8- Seoul National University College of Medicine oxo-dGTP is incorporated into opposite template dA Jongno-gu, Seoul 110-799, Korea during DNA synthesis (Cheng et al., 1992). Thus, un- 3Corresponding author: Tel, 82-31-299-6190; repaired, these mismatches lead to GT and AC trans- Fax, 82-31-299-6209; E-mail, [email protected] versions, respectively (Grollman and Morya, 1993). In Escherichia coli, several DNA repair enzymes, Accepted 29 March 2003 preventing mutagenesis by 8-oxo-G, are known as the GO system (Michaels et al., 1992). The GO system Abbreviations: 8-oxo-G, 8-oxo-7,8-dihydroguanine; Fapy, 2,6-dihy- consists of MutT (8-oxo-dGTPase), MutM (2,6-dihydro- droxy-5N-formamidopyrimidine; FPG, Fapy-DNA glycosylase; BER, xy-5N-formamidopyrimidine (Fapy)-DNA glycosylase, base excision repair; AP, apurinic/apyrimidinic; dRPase, deoxyribo- Fpg) and MutY (adenine-DNA glycosylase). 8-oxo- phosphatase GTPase prevents incorporation of 8-oxo-dGTP into DNA by degrading 8-oxo-dGTP.
    [Show full text]
  • Association of the XRCC1 Gene Polymorphisms with Cancer Risk in Turkish Breast Cancer Patients
    EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 36, No. 6, 572-575, December 2004 Association of the XRCC1 gene polymorphisms with cancer risk in Turkish breast cancer patients Ugur Deligezer1 and Nejat Dalay1,2 and family history (Madigan et al., 1995). In the majority of cases the cause of the disease is still 1Department of Basic Oncology obscure. Amino acid substitutions in the DNA repair Oncology Institute Istanbul University genes as result of genetic polymorphisms may lead Istanbul, Turkey to alterations in DNA repair capacity and affect the 2Corresponding author: Tel, 90-212-5313100; susceptibility to cancer. Polymorphic alleles have Fax, 90-212-5348078; E-mail, [email protected] been described for many DNA repair genes including the genes responsible for nucleotide and base Accepted 9 December 2004 excision repair (Shen et al., 1998; Fan et al., 1999). Recent data suggest that DNA repair capacity may Abbreviations: BRCA1, Breast cancer-associated gene 1; BRCT-1, vary between individuals (Berwick, 2000) and is lower BRCA1 C terminus repeat 1; CI, Confidence interval; OR, Odds in cancer patients than healthy controls (Mohrenweiser ratio; XRCC1, X-ray repair cross-complementing group 1 and Jones, 1998). It has been hypothesized that multiple alleles may act in combination in conferring cancer risk (Mohrenweiser and Jones, 1998; Shen et al., 1998). Abstract The protein encoded by the XRCC1 gene plays an important role in base excision repair and removes The X-ray repair cross-complementing group 1 base adducts formed by ionizing radiation and alk- (XRCC1) gene is believed to play an important role ylating agents (Yu et al., 1999).
    [Show full text]
  • XRCC3 Gene Polymorphism Is Associated with Survival in Japanese Lung Cancer Patients
    Int. J. Mol. Sci. 2012, 13, 16658-16667; doi:10.3390/ijms131216658 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article XRCC3 Gene Polymorphism Is Associated with Survival in Japanese Lung Cancer Patients Kayo Osawa 1,*, Chiaki Nakarai 1, Kazuya Uchino 2, Masahiro Yoshimura 2, Noriaki Tsubota 3, Juro Takahashi 1 and Yoshiaki Kido 1,4 1 Faculty of Health Sciences, Kobe University Graduate School of Health Sciences, Kobe 654-0142, Japan; E-Mails: [email protected] (C.N.); [email protected] (J.T.); [email protected] (Y.K.) 2 Department of General Thoracic Surgery, Hyogo Cancer Center, Akashi 673-0021, Japan; E-Mails: [email protected] (K.U.); myoshi@ hp.pref.hyogo.jp (M.Y.) 3 Department of Thoracic Oncology, Hyogo College of Medicine, Nishinomiya 663-8501, Japan; E-Mail: [email protected] 4 Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe 650-0017, Japan * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +81-78-796-4581; Fax: +81-78-796-4509. Received: 28 September 2012; in revised form: 7 November 2012 / Accepted: 28 November 2012 / Published: 5 December 2012 Abstract: We focused on OGG1 Ser326Cys, MUTYH Gln324His, APEX1 Asp148Glu, XRCC1 Arg399Gln, and XRCC3 Thr241Met and examined the relationship between the different genotypes and survival of Japanese lung cancer patients. A total of 99 Japanese lung cancer patients were recruited into our study. Clinical data were collected, and genotypes of the target genes were identified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).
    [Show full text]
  • Aprataxin Localizes to Mitochondria and Preserves Mitochondrial Function
    Aprataxin localizes to mitochondria and preserves mitochondrial function Peter Sykora, Deborah L. Croteau, Vilhelm A. Bohr1, and David M. Wilson III1,2 Laboratory of Molecular Gerontology, National Institute on Aging, National Institutes of Health, Baltimore, MD 21224 Edited* by James E. Cleaver, University of California, San Francisco, CA, and approved March 23, 2011 (received for review January 4, 2011) Ataxia with oculomotor apraxia 1 is caused by mutation in the APTX and flap endonuclease 1 (FEN1), has confirmed that BER in the gene, which encodes the DNA strand-break repair protein apra- mitochondria has many, if not all, proteins and pathways active in taxin. Aprataxin exhibits homology to the histidine triad superfam- nuclear BER (26–29). These facts led us to speculate that apra- ily of nucleotide hydrolases and transferases and removes 5′- taxin might have a significant role in the maintenance of mtDNA. adenylate groups from DNA that arise from aborted ligation reac- This hypothesis is also supported by similarities between AOA1 tions. We report herein that aprataxin localizes to mitochondria and diseases associated with mitochondrial dysfunction, such as in human cells and we identify an N-terminal amino acid sequence FA (30). Like AOA1, FA patients are not susceptible to cancer that targets certain isoforms of the protein to this intracellular but frequently present with peripheral neuropathy and pro- compartment. We also show that transcripts encoding this unique gressive ataxia. FA and AOA1 patients are also reported to be fi N-terminal stretch are expressed in the human brain, with highest de cient in coenzyme Q10, an essential component of the elec- tron transport chain and potent antioxidant within the mito- production in the cerebellum.
    [Show full text]
  • P53 and Disease: When the Guardian Angel Fails
    Cell Death and Differentiation (2006) 13, 1017–1026 & 2006 Nature Publishing Group All rights reserved 1350-9047/06 $30.00 www.nature.com/cdd Review p53 and disease: when the guardian angel fails JA Royds*,1 and B Iacopetta2 recent evidence suggesting a role for p53 in non-neoplastic diseases. 1 Department of Pathology, University of Otago, Dunedin, New Zealand This is not intended as an exhaustive appraisal of the 2 School of Surgery and Pathology, University of Western Australia, Western impact p53 can make in the clinic but as a selection of Australia, Australia examples of how failure of regulated p53 function not only * Corresponding author: JA Royds, Department of Pathology, Dunedin School of leads to disease but can also influence its management. Medicine, PO box 913, Dunedin 9001, New Zealand. Tel: þ 64 3 4797471; Fax: þ 64 3 479 7136; E-mail: [email protected] Received 15.12.05; revised 24.2.06; accepted 24.2.06; published online 24.3.06 p53 Germline Mutations and Li–Fraumeni Edited by A Braithwaite Disease p53, famously dubbed ‘The Guardian of the Genome’, is Abstract arguably the most significant gene for cancer suppression.2 The p53 tumor suppressor gene (TP53) is mutated more often Somatic loss of function of p53 underpins tumor progression in most epithelial cancers and many others besides. Indeed in human cancers than any other gene yet reported. Of haploinsufficiency and even certain polymorphisms in TP53 or importance, it is mutated frequently in the common human its controlling factor Mdm2 are enough to increase cancer malignancies of the breast and colorectum and also, but less incidence.3 What phenotype should we expect therefore in frequently, in other significant human cancers such as cases of germline loss of this gene? The LFS (MIM 151623) is glioblastomas.
    [Show full text]
  • University of Dundee DOCTOR of PHILOSOPHY Characterisation Of
    University of Dundee DOCTOR OF PHILOSOPHY Characterisation of ALADIN’s function during cell division Carvalhal, Sara Award date: 2015 Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Download date: 10. Oct. 2021 Characterisation of ALADIN’s function during cell division Sara Carvalhal Supervisor Dr Eric Griffis Submission for the degree of Doctor of Philosophy October 2015 Declaration This thesis, submitted for the degree of Doctor in Philosophy at the University of Dundee, has been performed in the laboratory of Dr Eric Griffis at the Centre for Gene Regulation & Expression within the School of Life Sciences, Dundee. The presented work was performed under the guidance of Dr Eric Griffis, and contains no material that has been accepted for the award of any other degree in any university. Sara Carvalhal I declare that Sara Carvalhal has spent the equivalent of at least nine terms in the research department of the School of Life Sciences at the University of Dundee, and that she has fulfilled the conditions of Ordinance General No.
    [Show full text]
  • The Dark Side of UV-Induced DNA Lesion Repair
    G C A T T A C G G C A T genes Review The Dark Side of UV-Induced DNA Lesion Repair Wojciech Strzałka 1, Piotr Zgłobicki 1, Ewa Kowalska 1, Aneta Ba˙zant 1, Dariusz Dziga 2 and Agnieszka Katarzyna Bana´s 1,* 1 Department of Plant Biotechnology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland; [email protected] (W.S.); [email protected] (P.Z.); [email protected] (E.K.); [email protected] (A.B.) 2 Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-12-664-6410 Received: 27 October 2020; Accepted: 29 November 2020; Published: 2 December 2020 Abstract: In their life cycle, plants are exposed to various unfavorable environmental factors including ultraviolet (UV) radiation emitted by the Sun. UV-A and UV-B, which are partially absorbed by the ozone layer, reach the surface of the Earth causing harmful effects among the others on plant genetic material. The energy of UV light is sufficient to induce mutations in DNA. Some examples of DNA damage induced by UV are pyrimidine dimers, oxidized nucleotides as well as single and double-strand breaks. When exposed to light, plants can repair major UV-induced DNA lesions, i.e., pyrimidine dimers using photoreactivation. However, this highly efficient light-dependent DNA repair system is ineffective in dim light or at night. Moreover, it is helpless when it comes to the repair of DNA lesions other than pyrimidine dimers.
    [Show full text]