The FHA Domain of Aprataxin Interacts with the C-Terminal Region of XRCC1

BBRC Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 www.elsevier.com/locate/ybbrc

The FHA domain of aprataxin interacts with the C-terminal region of XRCC1

Hidetoshi Datea, Shuichi Igarashia,b,*, Yasuteru Sanoc, Toshiaki Takahashia, Tetsuya Takahashia, Hiroki Takanoa, Shoji Tsujid, Masatoyo Nishizawaa, Osamu Onoderaa,b

a Department of Neurology, Brain Research Institute Niigata University, Nigata, Japan b Department of Molecular Neuroscience, Resource Branch for Brain Disease Research, Center for Bioresource-based Research, Brain Research Institute Niigata University, Nigata, Japan c Department of Neurology, Yamaguchi University, Japan d Department of Neurology, The University of Tokyo Graduate School of Medicine, Japan

Received 25 September 2004 Available online 11 November 2004

Abstract

Aprataxin (APTX) is the causative gene product for early-onset ataxia with ocular motor apraxia and hypoalbuminemia (EAOH/AOA1). In our previous study, we found that APTX interacts with X-ray repair cross-complementing group 1 (XRCC1), a scaﬀold protein with an essential role in single-strand DNA break repair (SSBR). To further characterize the functions of APTX, we determined the domains of APTX and XRCC1 required for the interaction. We demonstrated that the 20 N-terminal amino acids of the FHA domain of APTX are important for its interaction with the C-terminal region (residues 492–574) of XRCC1. Moreover, we found that poly (ADP–ribose) polymerase-1 (PARP-1) is also co-immunoprecipitated with APTX. These ﬁndings suggest that APTX, together with XRCC1 and PARP-1, plays an essential role in SSBR. 2004 Elsevier Inc. All rights reserved.

Keywords: Aprataxin; SSBR; XRCC1; DNA repair; Single strand break repair; PNKP; Ligase; PARP; Neuronal death; Neuronal loss; AOA; EAOH; Spinocerebellar ataxia; Ataxia; FHA; FHA domain; BRCT; Oxidative stress

Early-onset ataxia with ocular motor apraxia and recently identified the causative gene for EAOH/AOA1 hypoalbuminemia (EAOH/AOA1) is a form of autoso- and designated it as aprataxin (APTX) [5,6]. Long form mal recessive spinocerebellar ataxia characterized clini- aprataxin (APTX) is a major form compared with other cally by ocular motor apraxia, cerebellar ataxia, four isoforms; it is expressed in various human tissues peripheral neuropathy, and hypoalbuminemia [1,2]. including the central nervous system tissues and is local- Neuropathological studies have revealed a severe loss of ized in nuclei [7]. APTX has a forkhead-associated Purkinje cells, the degeneration of posterior columns (FHA) domain in the N-terminal segment, which binds and spinocerebellar tracts of the spinal cord, and a to phosphopeptides, and the C-terminal segment of marked loss of myelinated and unmyelinated fibers of APTX contains a histidine-triad (HIT) motif and a peripheral nerves [3,4]. We and other researchers have DNA-binding C2H2 zinc-finger motif. Employing co-immunoprecipitation and yeast two-hybrid assays, we have recently demonstrated that APTX directly interacts with * Corresponding author. Fax: +81 25 223 6646. XRCC1, a scaffold protein involved in single-strand E-mail address: [email protected] (S. Igarashi). DNA break repair (SSBR) [7]. It has been demonstrated

0006-291X/$ - see front matter 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.10.162 1280 H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 that XRCC1 plays an essential role in SSBR in collabora- Biotech) was added and the mixture was incubated for 30 min at RT tion with a polynucleotide kinase 30-phosphatase with gentle rotation. The beads were pulled down with a magnet and (PNKP), DNA polymerase b, poly(ADP–ribose) poly- washed with washing buffer (25 mM Hepes, pH 7.5, containing 50 mM NaCl, 0.1% NP40, and 10% glycerol and protease inhibitors (1 mM merase (PARP-1), and DNA ligase III [8,9]. These find- PMSF and 1· Complete Mini)). The beads were then dissolved in ings raise the possibility that APTX plays a role in Laemmli sample buffer (Bio-Rad). The samples were separated by SSBR through its interaction with XRCC1 [10,11].To SDS–PAGE using 5–15% precast gels (Bio-Rad) and then electrob- elucidate the functions of APTX, we conducted a detailed lotted onto PVDF membranes. Proteins were detected by immuno- analysis of the interaction between APTX and XRCC1 blotting with the anti-XRCC1 (C-15, 1:100 dilution; Santa Cruz), anti-PARP-1 (H-250, 1:200 dilution, Santa Cruz), anti-DNA poly- and other associated proteins. merase b (N-19, 1:100 dilution; K-16, 1:100 dilution; Santa Cruz), anti-TOPO1 (L-17, 1:100 dilution; C-15, 1:100 dilution, H-300; 1:200 dilution; Santa Cruz), and anti-APTX (ME44) antibodies (2000· dilution) for 1 h at 37 C [7]. ECL Western blotting detection reagents Experimental procedures (Amersham Bioscience) were used for detection of bound antibodies. Yeast two-hybrid assay. For yeast two-hybrid assay, we used AH109, Plasmids. The plasmid construct of aprataxin-myc/pcDNA3.1 that which has MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4D, encodes the long form APTX was described previously [7]. The cDNAs gal80D, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA- coding for the N-terminus-truncated aprataxin fragments lacking amino ADE2, and URA3::MEL1UAS-MEL1TATA-lacZ, as the reporter strain acid residues 1–20 (APTX21–343-myc), 1–50 (APTX51–343-myc), or 1–80 (Clontech). APTX, XRCC1, and PARP-1 cDNAs were subcloned into (APTX81–343-myc) were generated by PCR amplification using one of the pGADT7 and pGBKT7 vectors (Clontech) to generate fusion proteins following forward primers, d20 (50-GGGGATCCGCCGCCACCATG including the GAL4 activation domain and the GAL4-DNA-binding CATTTGGAAGCAGTTGTGATT-30), d50 (50-GGGGATCCGCC domain, respectively. These constructs were introduced into Saccharo- GCCACCATGTGTAACAAGGGATATGTCAAG-30), or d80 (50- myces cerevisiae (AH109). Clones positive for the interaction were GGGGATCCGCCGCCACCATGCTGCAGCCTGGCCAGGT-30), examined for growth on plates lacking uracil, leucine, and histidine. with c-myc-tagged reverse primer (50-GGCTCGAGTTACAGATCCT Positive clones were subsequently confirmed on the basis of growth CTTCTGAGATGAGTTTTTGTTCCTGTGTCCAGTGCTTCCT-30). activity on plates lacking uracil, leucine, histidine, and adenine. These forward and reverse primers contained BamHI and XhoI sites, respectively. The PCR products were subcloned into the BamHI and XhoI-cleaved pcDNA3.1 expression vector (Invitrogen). The full-length XRCC1 cDNA was obtained by PCR amplification using the following Results forward and reverse primers containing EcoRI and SalI sites, respectively: XRCC1 forward primer (50AAGAATTCGACATGCCGGAGA FHA domain of APTX interacts with XRCC1 TCCGCCTCCGCCATGTCG30) and XRCC1 reverse primer 0 0 (5 AAGTCGACGGCTTGCGGCACCACCCCATAGAGCTGG3 ). To identify the segments of APTX essential for binding The amplified DNA fragments were subcloned into EcoRI and SalI-cleaved pcDNA3.1/myc-His vectors (Invitrogen). To construct with XRCC1, we constructed five plasmids coding for the deletion mutants of XRCC1, pcDNA3.1/myc-His-XRCC1 was full-length and truncated APTX molecules with deletions digested with EcoRI and BamHI for residues 1–590 (XRCC11–590-myc), in the N-termini, as shown in Fig. 1A (APTX1–343-myc, EcoRI and XhoI (XRCC11–574-myc), EcoRI and SacI (XRCC11–538-myc), APTX21–343-myc, APTX51–343-myc, APTX81–343-myc, 1–401 or EcoRI and KpnI (XRCC1 -myc), and then subcloned into the and APTX175–343-myc). Co-immunoprecipitation assays corresponding cloning sites of pcDNA3.1/myc-His vectors (Invitro- gen). The cDNA of full-length PARP-1 cDNA was obtained by PCR of HEK 293 cells transfected with the plasmid coding 1–343 amplification using the following forward and reverse primers con- for APTX -myc clearly detected XRCC1 (Fig. 1B), taining the BglII and SalI sites, respectively: PARP-forward primer while XRCC1 was not co-immunoprecipitated for (50-AAAGATCTAGGATGGCGGAGTCTTCGGATAAGCTCTAT APTX21–343-myc, APTX51–343-myc, APTX81–343-myc or 0 0 CG-3 ) and PARP-HA-tagged reverse primer (5 -AAGCGGCCGCTC APTX175–343-myc, suggesting that the N-terminal 20 ami- AGGCATAATCTGGCACATCATAAGGGTAGTCGACCCACAG GGAGGTCTTAAAATTGAATTTCAGTTTTC-30). The amplified no acids are essential for the binding of APTX with DNA fragments were subcloned into the BamHI and NotI sites of XRCC1. pcDNA3.1(+). Plasmid DNAs prepared from the human ovary and To confirm the interaction between the N-terminal re- testis Marathon-Ready cDNA library (Clontech) were used as the gions of APTX and XRCC1, we then conducted yeast template DNA for PCR amplification. The nucleotide sequences of all two-hybrid assay. The interaction between APTX1–343- of the constructs were verified by nucleotide sequence analysis. Immunoprecipitation and immunoblotting. HEK293 cells were myc and XRCC1 was clearly demonstrated, while no grown in DulbeccoÕs modified EagleÕs medium supplemented with 10% interaction was detected between XRCC1 and truncated fetal calf serum (Invitrogen). HEK293 cells in a 10-cm dish plate were APTX lacking the N-terminal 20 amino acids transiently transfected with 24 lg of each expression construct. (APTX21–343,APTX51–343,APTX81–343,andAPTX175–343) Twenty-four hours after the transfection, HEK293 cells were harvested (Fig. 1C). and then lysed in 1 ml lysis buffer (25 mM Hepes, pH 7.5, containing 50 mM NaCl, 1% NP40, and 10% glycerol) containing protease inhibitors (1 mM PMSF, 1· Complete Mini (Roche Diagnostic)) for Role of BRCTII domain of XRCC1 for interaction 1 h at 4 C with gentle shaking. The lysate was centrifuged at 13,000g with APTX for 10 min at 4 C. 2.5 ll of anti-c-myc monoclonal antibody (9E10, Roche Diagnostic) was added to 500 ll of the supernatant and the mixture was incubated for 1 h at 4 C with constant rotation. Then We then characterized the segments of XRCC1 in- 30 ll of protein G-coupled magnetizable polystyrene beads (Dynal volved in the interaction with APTX. In our previous H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 1281

Fig. 1. FHA domain of APTX interacts with XRCC1. (A) APTX expression constructs with deletions of various lengths. Schematic presentation of full-length long-form aprataxin (APTX) and its deletion mutants. Solid boxes represent the c-myc tag sequences. Gray boxes represent the functional nuclear localization signal. The number for each clone represents the number of amino acid residues in the APTX sequences (NP_778243). (B) Interaction of between XRCC1 and APTX demonstrated by co-immunoprecipitation experiments. HEK293 cells were transfected with each myc- tagged APTX construct (APTX1–343-myc, APTX21–343-myc, APTX51–343-myc, APTX81–343-myc, and APTX175–343-myc). Twenty-four hours after transfection, the whole-cell extracts of HEK293 cells were made, co-immunoprecipitated with (+) or without () the anti-c-myc antibody, and then subjected to Western blot analyses using the anti-XRCC1 or c-myc antibody. IP, immunoprecipitation. IB, immunoblot. (C) Interaction between XRCC1 and APTX demonstrated by yeast two-hybrid assay. To confirm the interaction between APTX and XRCC1, pGADT7-XRCC1 and each length pGBKT7-APTX construct (APTX1–343, APTX21–343, APTX51–343, APTX81–343, and APTX175–343) were introduced into S. cerevisiae (AH109). Each cotransformant was grown on Trp and Leu drop-out plates (top), Trp, Leu, and His drop-out (middle), and Trp, Leu, His, and Ade drop-out plates (bottom). Cells cotransformed with pGBKT7-deleted APTX mutants and pGBKT7-XRCC1 did not grow on the Trp, Leu, His, and Ade drop-out plates. study, we found that truncated XRCC1 (residues 492– acts with APTX, we conclude that residues 492–574 of 633) interacts with APTX. To further characterize the seg- XRCC1 are essential for binding with APTX. ments involved in the interaction, we constructed various deletion mutants of XRCC1 as shown in Fig. 2A Interaction between PARP-1 and APTX (XRCC11–633-myc, XRCC11–590-myc, XRCC11–574, XRCC11–538-myc, and XRCC11–401-myc). In Fig. 2B, it The binding of APTX to XRCC1 suggested that is clearly demonstrated that the endogenous APTX is APTX forms a complex with proteins involved in the co-immunoprecipitated with XRCC11–633-myc, DNA repair system, particularly, SSBR. To explore this XRCC11–590-myc, XRCC11–574-myc or XRCC11–538-myc possibility, we transiently expressed c-myc-tagged but not with XRCC11–401-myc. APTX1–343-myc (full-length APTX) or APTX175–343- We then confirmed this interaction by yeast two-hy- myc in HEK293 cells. The immunoprecipitates with brid assay. As shown in Fig. 2C, there was interaction the anti-c-myc-antibody were analyzed by Western blot- with APTX in the case of XRCC11–633, XRCC11–590 ting with the anti-DNA polymerase b, anti-TOPO1 or or XRCC11–574 under stringent conditions; Trp-/Leu-/ anti-PARP-1 antibodies. Among them, only endoge- His-/Ade- (bottom). In the case of XRCC11–538, the nous PARP-1 was detected in the immunoprecipitates clone grew on a selective plate lacking Trp, Leu, and of APTX1–343 but not in the immunoprecipitates of His (middle), but not under stringent conditions lacking APTX175–343 (Fig. 3A). The interaction between APTX Trp, Leu, His, and Ade (bottom). These results indicate and PARP-1 was confirmed by the co-immunoprecipita- that XRCC1–538 does not show a complete full binding tion assay of HEK293 cells transiently expressing capacity compared with XRCC11–633, XRCC11–590 or HA-tagged PARP-1 (data not shown). XRCC11–574. They also indicate that the C-terminal do- We further investigated the interaction between full- main of XRCC1, residues 575–633, is not necessary for length APTX and PARP-1 by yeast two-hybrid assay. binding to APTX. Taken together with our previous We subcloned APTX1–343-myc, APTX21–343-myc, findings that truncated XRCC1 (residues 492–633) inter- APTX51–343-myc, and APTX81–343-myc into pGBKT7 1282 H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285

Fig. 2. Residues 575–633 of XRCC1 are involved in interaction with APTX. (A) Plasmid constructs for expression of XRCC1 with various length deletions at the C-terminus. The full-length XRCC1 and its deletion mutants are shown schematically. Solid boxes represent c-myc tag sequences. Solid green boxes represent the functional domain of the nuclear localization signal (NLS) and BRCT. The numbers for each construct represent the number of amino acid residues in the XRCC1 sequence (NP_006288.1). (B) Interaction between APTX and XRCC1 with deletions in the C-terminus demonstrated by co-immunoprecipitation experiments. HEK293 cells were transfected with each myc-tagged XRCC1 construct (XRCC11–633-myc, XRCC11–590-myc, XRCC11–574, XRCC11–538-myc, and XRCC11–401-myc). Twenty-four hours after the transfection, the whole-cell extracts of HEK293 cells were prepared, co-immunoprecipitated with (+) or without () the anti-c-myc antibody, and then subjected to Western blot analyses using the anti-APTX or XRCC1 antibody. IP, immunoprecipitation; IB, immunoblot. (C) Interaction between APTX and deleted XRCC1 demonstrated by yeast two-hybrid assay. To conﬁrm the interaction between APTX and XRCC1, each length XRCC1-pGBKT7 (XRCC11–633-myc, XRCC11–590-myc, XRCC11–574, XRCC11–538-myc, and XRCC11–401-myc) construct and APTX pGADT7 were introduced into S. cerevisiae (AH109). Each cotransformant was grown on Trp and Leu drop-out plates (top), Trp, Leu, and His drop-out (middle), and the Trp, Leu, His, and Ade drop-out plates (bottom). Cells cotransformed with pGBKT7-XRCC11–538 and pGADT7-APTX grew on the Trp, Leu, and His drop-out plates but not on the Trp, Leu, His, and Ade drop-out plates.

Fig. 3. Interaction between APTX and PARP-1. (A) HEK293 cells were transfected with either deleted aprataxin (APTX175–343-myc) or the myc- tagged full-length aprataxin (APTX 1–343-myc) construct. Twenty-four hours after transfection, the whole cell extracts were prepared, immunoprecipitated with the anti-c-myc antibody, and then subjected to Western blot analyses using the anti-PARP1 and anti-c-myc antibodies. IP, immunoprecipitation. IB, immunoblot. (B) Interaction between PARP-1 and APTX demonstrated by yeast two-hybrid system. To confirm the interaction between APTX and PARP-1, S. cerevisiae (AH109) was transformed with PARP-1-pGADT7 and APTX-pGBKT7. Each cotransformant was grown on Trp and Leu drop-out plates (top), Trp, Leu, and His-drop-out plates (middle), and the Trp, Leu, His, and Ade-drop-out plates (bottom). Cells cotransformed with any pGBKT7-APTX mutants and pGBKT7-PARP-1 did not grow on the Trp, Leu, His, and Ade drop-out plates. H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 1283 as bait and full-length PARP-1 cDNA into pGADT7 as The BRCT II domain of XRCC1 is composed of prey. However, as shown in Fig. 3B, interactions be- three a-helices and four b-sheets [17,18]. Our results re- tween PARP-1 and the APTX constructs were not con- vealed that the C-terminal region of the BRCT II do- firmed under a stringent condition; (growth medium main of XRCC1 (575–633) is not necessary for the lacking Trp, Leu, His, and Ade). interaction of XRCC1 with APTX and that amino acid residues 492–574, including the N-terminal first a-helix (a1) of the BRCT II domain of XRCC1 (538–574), are Discussion important for the strong interaction of XRCC1 with APTX. Loizou et al. [16] reported that eight candidate In this study, we have shown that the N-terminal 20 phosphorylation sites exist between the BRCT I and amino acid residues of APTX interact with amino acid BRCT II domains of XRCC1 (401–538) which bind to residues 492–574 of XRCC1 by co-immunoprecipitation the FHA domain of PNKP. It will be interesting to and yeast two-hybrid assays. The N-terminus of APTX determine the phosphorylation sites of XRCC1 involved is highly homologous to the N-terminus of PNKP [12] in binding to the FHA domain of APTX, and, further- (Fig. 4A). These homologous regions contain a fork- more, to explore whether the binding of XRCC1 to head-associated (FHA) domain. The FHA domain is PNKP and that of XRCC1 to APTX are competitive. characterized as a binding motif, which is important for We have also demonstrated that PARP-1 is co-immu- the interaction with phosphopeptides involved in main- noprecipitated with the N-terminus of APTX. The inter- taining cell cycle checkpoints, DNA repair or transcrip- action between APTX and PARP-1, however, was not tional regulation [13–15]. It spans approximately 80–100 confirmed by yeast two-hybrid assay. Since the interac- amino acid residues that are folded into an 11-stranded tion between PARP-1 and XRCC1 has been well estab- b-sandwich [13]. For binding to other molecules, the N- lished [7,10], the result raises the possibility that APTX or C-terminus of the FHA domain is important [15]. and PARP1 constitute a new SSBR complex with Our results revealed that the N-terminal 20 amino acid XRCC1 as a molecular scaffold. Since XRCC1 is a residues of the FHA domain of APTX are necessary for molecular scaffold protein that plays a central role in binding to XRCC1. The results strongly suggest that the the recruitment of PARP-1, PNKP, DNA polymerase FHA domain of APTX binds to phosphorylated XRCC1 b, and DNA ligase III in the base excision repair similarly as has been demonstrated in the binding between machinery of SSBR, the present study raises an the FHA domain of PNKP and XRCC1 [16]. intriguing hypothesis that APTX, in place of PNKP,

Fig. 4. (A) N-terminal regions of APTX and PNKP share FHA domain. The deduced amino acid sequences of human aprataxin (NCBI Accession NP_778243), human PNKP (NCBI Accession NP_009185), and the consensus sequence of FHA (NCBI Accession cd00060) were aligned by CLUSTAL · 1.8 [21] and conserved amino acid residues were shaded by GeneDoc (http://www.psc.edu/biomed/genedoc). Each shade represents the strength of conservations (black 100% and dark gray 66%). b-strands are denoted by white arrows according to PSIPRED [22]. The N-terminal 20 amino acids that play an important role in efficient binding to XRCC1 are boxed. (B) Binding domain of XRCC1. The BRCT II domain of XRCC1 is underlined. Helical regions are denoted by white boxes and b-strands by white arrows according to the predicted secondary structure of XRCC1 BRCT II domain [14]. The red box indicates the region involved in the binding to the FHA domain of APTX. Red characters indicate the 20 amino acids that are necessary and sufficient for binding to DNA ligase III [15]. 1284 H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 constitutes a new SSBR complex together with PARP-1, (HMSNCA): clinical and neuropathological features of a Japanese DNA polymerase b, and DNA ligase III. Since APTX family, J. Neurol. Sci. 158 (1998) 30–37. shares homology only with the FHA domain of PNKP [5] H. Date, O. Onodera, H. Tanaka, K. Iwabuchi, K. Uekawa, S. Igarashi, R. Koike, T. Hiroi, T. Yuasa, Y. Awaya, T. Sakai, T. but not at the catalytic sites of PNKP, APTX is likely Takahashi, H. Nagatomo, Y. Sekijima, I. Kawachi, Y. Takiyama, to have novel functions distinct from those of PNKP. M. Nishizawa, N. Fukuhara, K. Saito, S. Sugano, S. Tsuji, Early- The elucidation of catalytic activities of APTX will be onset ataxia with ocular motor apraxia and hypoalbuminemia is the immediate focus in future studies. caused by mutations in a new HIT superfamily gene, Nat. Genet. The importance of a DNA repair system in neuronal 29 (2001) 184–188. [6] M.C. Moreira, C. Barbot, N. Tachi, N. Kozuka, E. Uchida, T. cells has been represented in patients with hereditary Gibson, P. Mendonca, M. Costa, J. Barros, T. Yanagisawa, M. neurodegenerative disorders with impairment of the Watanabe, Y. Ikeda, M. Aoki, T. Nagata, P. Coutinho, J. DNA repair system, such as xeroderma pigmentosum Sequeiros, M. Koenig, The gene mutated in ataxia-ocular apraxia (XP), Cockayne syndrome (CS), ataxia telangiectasia 1 encodes the new HIT/Zn-finger protein aprataxin, Nat. Genet. 29 (AT), AT-like disorder, and autosomal recessive spinoc- (2001) 189–193. [7] Y. Sano, H. Date, S. Igarashi, O. Onodera, M. Oyake, T. erebellar ataxia with axonal neuropathy type 1 [19,20]. Takahashi, S. Hayashi, M. Morimatsu, H. Takahashi, T. Mak- The gradual accumulation of DNA damage may lead ifuchi, N. Fukuhara, S. Tsuji, Aprataxin, the causative protein for to neuronal cell death particularly in the cerebellum. EAOH is a nuclear protein with a potential role as a DNA repair However, to elucidate the mechanism of neuronal cell protein, Ann. Neurol. 55 (2004) 241–249. degeneration by impairment of the DNA repair system, [8] K.W. Caldecott, S. Aoufouchi, P. Johnson, S. Shall, XRCC1 polypeptide interacts with DNA polymerase beta and possibly further studies of the physiological function of APTX poly(ADP–ribose) polymerase, and DNA ligase III is a novel are important. molecular Ônick-sensorÕ in vitro, Nucleic Acids Res. 24 (1996) 4387–4394. [9] C.J. Whitehouse, R.M. Taylor, A. Thistlethwaite, H. Zhang, F. Karimi-Busheri, D.D. Lasko, M. Weinfeld, K.W. Caldecott, Acknowledgments XRCC1 stimulates human polynucleotide kinase activity at damaged DNA termini and accelerates DNA single-strand break This study was supported in part by a Grant-in-Aid repair, Cell 104 (2001) 107–117. for Scientific Research on Priority Areas (C)—Ad- [10] K.W. Caldecott, DNA single-strand break repair and spinocere- vanced Brain Science Project—and a Grant-in-Aid for bellar ataxia, Cell 112 (2003) 7–10. [11] K.W. Caldecott, XRCC1 and DNA strand break repair, DNA Scientific Research (A) from the Ministry of Education, Repair (Amst) 2 (2003) 955–969. Culture, Sports, and Science and Technology, Japan, a [12] A. Jilani, D. Ramotar, C. Slack, C. Ong, X.M. Yang, S.W. grant for the Research for the Future Program from Scherer, D.D. Lasko, Molecular cloning of the human gene, the Japan Society for the Promotion of Science, a grant PNKP, encoding a polynucleotide kinase 30-phosphatase and for Surveys and Research on Specific Diseases, the Min- evidence for its role in repair of DNA strand breaks caused by oxidative damage, J. Biol. Chem. 274 (1999) 24176–24186. istry of Health, Labor and Welfare, Japan, a grant of the [13] D. Durocher, S.P. Jackson, The FHA domain, FEBS Lett. 513 Virtual Research Institute of Aging of Nippon Boehrin- (2002) 58–66. ger Ingelheim, a grant from the Naito Foundation, and [14] D. Durocher, I.A. Taylor, D. Sarbassova, L.F. Haire, S.L. grants from the Takeda Science Foundation, Suzuken Westcott, S.P. Jackson, S.J. Smerdon, M.B. Yaffe, The molecular Memorial Foundation, Tsubaki Memorial Foundation, basis of FHA domain:phosphopeptide binding specificity and implications for phospho-dependent signaling mechanisms, Mol. and The Tsukada Grant. We are grateful to Miss M. Cell 6 (2000) 1169–1182. Tsuchiya for excellent technical assistance. [15] J. Li, G.P. Smith, J.C. Walker, Kinase interaction domain of kinase-associated protein phosphatase, a phosphoprotein-binding domain, Proc. Natl. Acad. Sci. USA 96 (1999) 7821–7826. [16] J.I. Loizou, S.F. El-Khamisy, A. Zlatanou, D.J. Moore, D.W. References Chan, J. Qin, S. Sarno, F. Meggio, L.A. Pinna, K.W. Caldecott, The protein kinase CK2 facilitates repair of chromosomal DNA [1] J. Aicardi, C. Barbosa, E. Andermann, F. Andermann, R. single-strand breaks, Cell 117 (2004) 17–28. Morcos, Q. Ghanem, Y. Fukuyama, Y. Awaya, P. Moe, [17] X. Zhang, S. Morera, P.A. Bates, P.C. Whitehead, A.I. Coffer, Ataxia-ocular motor apraxia: a syndrome mimicking ataxia- K. Hainbucher, R.A. Nash, M.J. Sternberg, T. Lindahl, P.S. telangiectasia, Ann. Neurol. 24 (1988) 497–502. Freemont, Structure of an XRCC1 BRCT domain: a new [2] K. Uekawa, T. Yuasa, S. Kawasaki, T. Makibuchi, T. Ideta, A protein–protein interaction module, EMBO J. 17 (1998) 6404– hereditary ataxia associated with hypoalbuminemia and hyperlip- 6411. idemia—a variant form of FriedreichÕs disease or a new clinical [18] R.M. Taylor, B. Wickstead, S. Cronin, K.W. Caldecott, Role of a entity?, Rinsho Shinkeigaku 32 (1992) 1067–1074. BRCT domain in the interaction of DNA ligase III-alpha with the [3] N. Fukuhara, T. Nakajima, K. Sakajiri, N. Matsubara, M. DNA repair protein XRCC1, Curr. Biol. 8 (1998) 877–880. Fujita, Hereditary motor and sensory neuropathy associated with [19] H. Takashima, C.F. Boerkoel, J. John, G.M. Saifi, M.A. Salih, cerebellar atrophy (HMSNCA): a new disease, J. Neurol. Sci. 133 D. Armstrong, Y. Mao, F.A. Quiocho, B.B. Roa, M. Nakagawa, (1995) 140–151. D.W. Stockton, J.R. Lupski, Mutation of TDP1, encoding a [4] Y. Sekijima, S. Ohara, S. Nakagawa, K. Tabata, K. Yoshida, H. topoisomerase I-dependent DNA damage repair enzyme, in Ishigame, Y. Shimizu, N. Yanagisawa, Hereditary motor and spinocerebellar ataxia with axonal neuropathy, Nat. Genet. 32 sensory neuropathy associated with cerebellar atrophy (2002) 267–272. H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 1285

[20] P.J. Brooks, DNA repair in neural cells: basic science and clinical for multiple sequence alignment aided by quality analysis tools, implications, Mutat. Res. 509 (2002) 93–108. Nucleic Acids Res. 25 (1997) 4876–4882. [21] J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. [22] L.J. McGuﬃn, K. Bryson, D.T. Jones, The PSIPRED protein Higgins, The CLUSTAL_X windows interface: ﬂexible strategies structure prediction server, Bioinformatics 16 (2000) 404–405.