BBRC Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 www.elsevier.com/locate/ybbrc The FHA domain of aprataxin interacts with the C-terminal region of XRCC1 Hidetoshi Datea, Shuichi Igarashia,b,*, Yasuteru Sanoc, Toshiaki Takahashia, Tetsuya Takahashia, Hiroki Takanoa, Shoji Tsujid, Masatoyo Nishizawaa, Osamu Onoderaa,b a Department of Neurology, Brain Research Institute Niigata University, Nigata, Japan b Department of Molecular Neuroscience, Resource Branch for Brain Disease Research, Center for Bioresource-based Research, Brain Research Institute Niigata University, Nigata, Japan c Department of Neurology, Yamaguchi University, Japan d Department of Neurology, The University of Tokyo Graduate School of Medicine, Japan Received 25 September 2004 Available online 11 November 2004 Abstract Aprataxin (APTX) is the causative gene product for early-onset ataxia with ocular motor apraxia and hypoalbuminemia (EAOH/AOA1). In our previous study, we found that APTX interacts with X-ray repair cross-complementing group 1 (XRCC1), a scaffold protein with an essential role in single-strand DNA break repair (SSBR). To further characterize the functions of APTX, we determined the domains of APTX and XRCC1 required for the interaction. We demonstrated that the 20 N-terminal amino acids of the FHA domain of APTX are important for its interaction with the C-terminal region (residues 492–574) of XRCC1. Moreover, we found that poly (ADP–ribose) polymerase-1 (PARP-1) is also co-immunoprecipitated with APTX. These findings suggest that APTX, together with XRCC1 and PARP-1, plays an essential role in SSBR. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Aprataxin; SSBR; XRCC1; DNA repair; Single strand break repair; PNKP; Ligase; PARP; Neuronal death; Neuronal loss; AOA; EAOH; Spinocerebellar ataxia; Ataxia; FHA; FHA domain; BRCT; Oxidative stress Early-onset ataxia with ocular motor apraxia and recently identified the causative gene for EAOH/AOA1 hypoalbuminemia (EAOH/AOA1) is a form of autoso- and designated it as aprataxin (APTX) [5,6]. Long form mal recessive spinocerebellar ataxia characterized clini- aprataxin (APTX) is a major form compared with other cally by ocular motor apraxia, cerebellar ataxia, four isoforms; it is expressed in various human tissues peripheral neuropathy, and hypoalbuminemia [1,2]. including the central nervous system tissues and is local- Neuropathological studies have revealed a severe loss of ized in nuclei [7]. APTX has a forkhead-associated Purkinje cells, the degeneration of posterior columns (FHA) domain in the N-terminal segment, which binds and spinocerebellar tracts of the spinal cord, and a to phosphopeptides, and the C-terminal segment of marked loss of myelinated and unmyelinated fibers of APTX contains a histidine-triad (HIT) motif and a peripheral nerves [3,4]. We and other researchers have DNA-binding C2H2 zinc-finger motif. Employing co-im- munoprecipitation and yeast two-hybrid assays, we have recently demonstrated that APTX directly interacts with * Corresponding author. Fax: +81 25 223 6646. XRCC1, a scaffold protein involved in single-strand E-mail address: [email protected] (S. Igarashi). DNA break repair (SSBR) [7]. It has been demonstrated 0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.10.162 1280 H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 that XRCC1 plays an essential role in SSBR in collabora- Biotech) was added and the mixture was incubated for 30 min at RT tion with a polynucleotide kinase 30-phosphatase with gentle rotation. The beads were pulled down with a magnet and (PNKP), DNA polymerase b, poly(ADP–ribose) poly- washed with washing buffer (25 mM Hepes, pH 7.5, containing 50 mM NaCl, 0.1% NP40, and 10% glycerol and protease inhibitors (1 mM merase (PARP-1), and DNA ligase III [8,9]. These find- PMSF and 1· Complete Mini)). The beads were then dissolved in ings raise the possibility that APTX plays a role in Laemmli sample buffer (Bio-Rad). The samples were separated by SSBR through its interaction with XRCC1 [10,11].To SDS–PAGE using 5–15% precast gels (Bio-Rad) and then electrob- elucidate the functions of APTX, we conducted a detailed lotted onto PVDF membranes. Proteins were detected by immuno- analysis of the interaction between APTX and XRCC1 blotting with the anti-XRCC1 (C-15, 1:100 dilution; Santa Cruz), anti-PARP-1 (H-250, 1:200 dilution, Santa Cruz), anti-DNA poly- and other associated proteins. merase b (N-19, 1:100 dilution; K-16, 1:100 dilution; Santa Cruz), anti-TOPO1 (L-17, 1:100 dilution; C-15, 1:100 dilution, H-300; 1:200 dilution; Santa Cruz), and anti-APTX (ME44) antibodies (2000· dilution) for 1 h at 37 °C [7]. ECL Western blotting detection reagents Experimental procedures (Amersham Bioscience) were used for detection of bound antibodies. Yeast two-hybrid assay. For yeast two-hybrid assay, we used AH109, Plasmids. The plasmid construct of aprataxin-myc/pcDNA3.1 that which has MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4D, encodes the long form APTX was described previously [7]. The cDNAs gal80D, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA- coding for the N-terminus-truncated aprataxin fragments lacking amino ADE2, and URA3::MEL1UAS-MEL1TATA-lacZ, as the reporter strain acid residues 1–20 (APTX21–343-myc), 1–50 (APTX51–343-myc), or 1–80 (Clontech). APTX, XRCC1, and PARP-1 cDNAs were subcloned into (APTX81–343-myc) were generated by PCR amplification using one of the pGADT7 and pGBKT7 vectors (Clontech) to generate fusion proteins following forward primers, d20 (50-GGGGATCCGCCGCCACCATG including the GAL4 activation domain and the GAL4-DNA-binding CATTTGGAAGCAGTTGTGATT-30), d50 (50-GGGGATCCGCC domain, respectively. These constructs were introduced into Saccharo- GCCACCATGTGTAACAAGGGATATGTCAAG-30), or d80 (50- myces cerevisiae (AH109). Clones positive for the interaction were GGGGATCCGCCGCCACCATGCTGCAGCCTGGCCAGGT-30), examined for growth on plates lacking uracil, leucine, and histidine. with c-myc-tagged reverse primer (50-GGCTCGAGTTACAGATCCT Positive clones were subsequently confirmed on the basis of growth CTTCTGAGATGAGTTTTTGTTCCTGTGTCCAGTGCTTCCT-30). activity on plates lacking uracil, leucine, histidine, and adenine. These forward and reverse primers contained BamHI and XhoI sites, respectively. The PCR products were subcloned into the BamHI and XhoI-cleaved pcDNA3.1 expression vector (Invitrogen). The full-length XRCC1 cDNA was obtained by PCR amplification using the following Results forward and reverse primers containing EcoRI and SalI sites, respec- tively: XRCC1 forward primer (50AAGAATTCGACATGCCGGAGA FHA domain of APTX interacts with XRCC1 TCCGCCTCCGCCATGTCG30) and XRCC1 reverse primer 0 0 (5 AAGTCGACGGCTTGCGGCACCACCCCATAGAGCTGG3 ). To identify the segments of APTX essential for binding The amplified DNA fragments were subcloned into EcoRI and SalI-cleaved pcDNA3.1/myc-His vectors (Invitrogen). To construct with XRCC1, we constructed five plasmids coding for the deletion mutants of XRCC1, pcDNA3.1/myc-His-XRCC1 was full-length and truncated APTX molecules with deletions digested with EcoRI and BamHI for residues 1–590 (XRCC11–590-myc), in the N-termini, as shown in Fig. 1A (APTX1–343-myc, EcoRI and XhoI (XRCC11–574-myc), EcoRI and SacI (XRCC11–538-myc), APTX21–343-myc, APTX51–343-myc, APTX81–343-myc, 1–401 or EcoRI and KpnI (XRCC1 -myc), and then subcloned into the and APTX175–343-myc). Co-immunoprecipitation assays corresponding cloning sites of pcDNA3.1/myc-His vectors (Invitro- gen). The cDNA of full-length PARP-1 cDNA was obtained by PCR of HEK 293 cells transfected with the plasmid coding 1–343 amplification using the following forward and reverse primers con- for APTX -myc clearly detected XRCC1 (Fig. 1B), taining the BglII and SalI sites, respectively: PARP-forward primer while XRCC1 was not co-immunoprecipitated for (50-AAAGATCTAGGATGGCGGAGTCTTCGGATAAGCTCTAT APTX21–343-myc, APTX51–343-myc, APTX81–343-myc or 0 0 CG-3 ) and PARP-HA-tagged reverse primer (5 -AAGCGGCCGCTC APTX175–343-myc, suggesting that the N-terminal 20 ami- AGGCATAATCTGGCACATCATAAGGGTAGTCGACCCACAG GGAGGTCTTAAAATTGAATTTCAGTTTTC-30). The amplified no acids are essential for the binding of APTX with DNA fragments were subcloned into the BamHI and NotI sites of XRCC1. pcDNA3.1(+). Plasmid DNAs prepared from the human ovary and To confirm the interaction between the N-terminal re- testis Marathon-Ready cDNA library (Clontech) were used as the gions of APTX and XRCC1, we then conducted yeast template DNA for PCR amplification. The nucleotide sequences of all two-hybrid assay. The interaction between APTX1–343- of the constructs were verified by nucleotide sequence analysis. Immunoprecipitation and immunoblotting. HEK293 cells were myc and XRCC1 was clearly demonstrated, while no grown in DulbeccoÕs modified EagleÕs medium supplemented with 10% interaction was detected between XRCC1 and truncated fetal calf serum (Invitrogen). HEK293 cells in a 10-cm dish plate were APTX lacking the N-terminal 20 amino acids transiently transfected with 24 lg of each expression construct. (APTX21–343,APTX51–343,APTX81–343,andAPTX175–343) Twenty-four hours after the transfection, HEK293 cells were harvested (Fig. 1C). and then lysed in 1 ml lysis buffer (25 mM Hepes, pH 7.5, containing 50 mM NaCl, 1% NP40, and 10% glycerol) containing protease inhibitors (1 mM PMSF, 1· Complete Mini (Roche Diagnostic)) for Role of BRCTII domain of XRCC1 for interaction 1 h at 4 °C with gentle shaking. The lysate was centrifuged at 13,000g with APTX for 10 min at 4 °C. 2.5 ll of anti-c-myc monoclonal antibody (9E10, Roche Diagnostic) was added to 500 ll of the supernatant and the mixture was incubated for 1 h at 4 °C with constant rotation. Then We then characterized the segments of XRCC1 in- 30 ll of protein G-coupled magnetizable polystyrene beads (Dynal volved in the interaction with APTX. In our previous H. Date et al. / Biochemical and Biophysical Research Communications 325 (2004) 1279–1285 1281 Fig. 1. FHA domain of APTX interacts with XRCC1.