Neutralizes the Biological Activity of CCL2 Third Extracellular (E3

A Novel Recombinant Fusion Protein Encoding a 20-Amino Acid Residue of the Third Extracellular (E3) Domain of CCR2 Neutralizes the Biological Activity of CCL2 This information is current as of September 28, 2021. Liat Izhak, Gizi Wildbaum, Yaniv Zohar, Rachel Anunu, Leah Klapper, Adi Elkeles, Jane Seagal, Eitan Yefenof, Michal Ayalon-Soffer and Nathan Karin J Immunol 2009; 183:732-739; Prepublished online 17 June 2009; Downloaded from doi: 10.4049/jimmunol.0802746 http://www.jimmunol.org/content/183/1/732 http://www.jimmunol.org/ References This article cites 44 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/183/1/732.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 28, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

A Novel Recombinant Fusion Protein Encoding a 20-Amino Acid Residue of the Third Extracellular (E3) Domain of CCR2 Neutralizes the Biological Activity of CCL21

Liat Izhak,* Gizi Wildbaum,* Yaniv Zohar,* Rachel Anunu,* Leah Klapper,† Adi Elkeles,† Jane Seagal,* Eitan Yefenof,‡ Michal Ayalon-Soffer,† and Nathan Karin2*

CCL2 is a key CC chemokine that has been implicated in a variety of inflammatory autoimmune diseases and in tumor progression and it is therefore an important target for therapeutic intervention in these diseases. Soluble receptor-based therapy is a known approach for neutralizing the in vivo functions of soluble mediators. Owing to the complexity of seven-transmembrane G protein- coupled receptors, efforts to generate neutralizing soluble chemokine receptors have so far failed. We developed a strategy that is based on the generation of short recombinant proteins encoding different segments of a G protein-coupled receptor, and tested Downloaded from the ability of each of them to bind and neutralize its target chemokine. We show that a fusion protein comprised of as few as 20 aa of the third extracellular (E3) domain of the CCL2 receptor, stabilized by the IgG H chain Fc domain (E3-IgG or BL-2030), selectively binds CCL2 and CCL16 and effectively neutralizes their biological activities. More importantly, E3-IgG (BL-2030) could effectively suppress the in vivo biological activity of CCL2, attenuating ongoing experimental autoimmune encephalomyelitis, as well as the development of human prostate tumor in SCID mice. The Journal of Immunology, 2009, 183: 732–739. http://www.jimmunol.org/ hemokines are small (ϳ8–14 kDa), structurally related mor cells, which also express their cognate receptors (for a general proteins that regulate cell trafficking via interactions with review see Ref. 9). Functionally, they are likely to direct tumor C a subset of seven-transmembrane G-coupled protein re- progression, angiogenesis, and survival. Cancer of the prostate is ceptor (1–4). CCL2 (MCP-1) is a key CC chemokine that partic- the most common cancer in American males, and the second lead- ipates in the regulation of inflammatory responses. CCL2 and its ing cause of cancer-related mortality (10, 11). The three major predominant receptor, CCR2, have been implicated in a variety chemokines produced by human prostate cancer cells that also ex- 3 of autoimmune diseases including multiple sclerosis (MS), press their target receptors are CXCL12 (SDF-1␣), CXCL8 (IL-8), rheumatoid arthritis, atherosclerosis, myocarditis, and others and CCL2 (MCP-1) (12–18). These chemokines are likely to pro- by guest on September 28, 2021 (5–8). Its major role involves the recruitment of macrophages mote tumor development and angiogenesis (12–18). Thus far, most to sites of inflammation, initiating a cascade of events that leads of the attention has focused on the role of CXCL12, which is likely to tissue destruction in chronic inflammatory diseases. We have to be the key chemokine that attracts these cells to the bones (19– previously shown that during experimental autoimmune en- 24). Interestingly, CCL2 became a major target of interest in a few cephalomyelitis (EAE), the murine model of MS, a T cell-me- recent reports showing that 1) in humans, CCR2 expression was diated autoimmune disease of the CNS, autoantibodies to CCL2 correlated with the Gleason score and clinical pathologic stages, that are capable of suppressing the disease are being produced, whereas lower levels of CCR2 were expressed in normal prostate supporting the rational of developing CCL2 inhibitors for MS tissues (25), 2) CCL2 is a potent regulator of prostate cancer cell treatment (7). migration and proliferation (12), 3) CCL2 acts as a paracrine and Many studies have shown the importance of chemokines in tu- an autocrine factor for prostate cancer growth and invasion (13), mor progression. Various chemokines are being produced by tu- and 4) CCL2 is involved in recruiting macrophages that assist tumor development (12, 14). These areas of interest have moti- vated us to select the third extracellular (E3) domain of the CCL2 *Department of Immunology, Rappaport Family Institute for Research in the Medical Sciences, Haifa, †BioLine Innovations Jerusalem, Jerusalem, and ‡Lautenberg Center receptor, stabilized by the IgG H chain Fc domain (E3-IgG) as a for General and Tumor Immunology, The Hebrew University Hadassah Medical Cen- potential candidate for therapy of this disease. ter, Jerusalem, Israel Its pivotal role in cancer and autoimmunity has made CCL2 an Received for publication August 20, 2008. Accepted for publication May 4, 2009. attractive target for therapy. We have focused on developing a The costs of publication of this article were defrayed in part by the payment of page soluble receptor-based approach for inhibiting CCL2. Previous charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. studies have shown that CCR2 binds its ligand CCL2 via the N- 1 This study was supported by grants from the Israel Science Foundation, the Israel terminal region alone (26), or the N-terminal region combined with Ministry of Health Chief Scientist, and a sponsored research grant from the Israel the third extracellular loop (E3 domain) element (27). We show in Ministry of Industry, together with BiolineRx. this study that a fusion protein, encoding 20 aa of the E3 domain, 2 Address correspondence and reprint requests to Dr. Nathan Karin, Bruce Rap- paport Faculty of Medicine, Technion, Rappaport Family Institute for Research in selectively binds and neutralizes CCL2 as effectively as a recom- the Medical Sciences, PO Box 9697, Haifa 31096, Israel. E-mail address: nkarin@ binant protein composed of the E3 domain fused to the N-terminal tx.technion.ac.il region. We then explored, for the first time, how in vivo neutral- 3 Abbreviations used in this paper: MS, multiple sclerosis; EAE, experimental auto- ization of CCL2 with this compound affects the development of immune encephalomyelitis. cancer of the prostate, as well as the manifestation of ongoing EAE Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 in C57BL/6 mice. www.jimmunol.org/cgi/doi/10.4049/jimmunol.0802746 The Journal of Immunology 733

Materials and Methods Evaluation of the affinity of our anti-hCCL2 mAb to CCL2 Construction of soluble receptors The evaluation of the affinity of our anti-hCCL2 mAb to CCL2 was conducted by indirect competitive ELISA (34). Briefly, microtiter plates were Human and mouse cDNA encoding the constant region (Fc, Hinge-CH2- ␮ CH3) IgG1 were constructed as follows: human Fc was generated by RT- coated with recombinant CCL2 (dilution 1/10,000, 200 l/well). After overnight incubation at 4°C the plates were washed three times with wash- PCR on RNA extracted from human PBMC that was cultured for 4 days ␮ with LPS and IL-4. The primers used for this reaction were 5Ј-ctcgag ing buffer, blocked with 1% BSA in PBS (w/v, 250 l/well), and incubated Ј for 20 min. To titrate mAb affinity, a mixture of 100-2000 ng/100 ␮lof CCCAAATCTTGTGACAAAAC and 3 -gggcccTTTACCCGGGGACA 125 GGGAGA (AF237583). The mouse Fc was extracted from Con A-stimu- unlabelled mAbs and 100,000 cpm of I-labeled mAb was added to each well for 90 min at room temperature. Wells were washed three times and lated spleen cells and the primers were 5Ј-ccgCCGCTCGAGGTGCCCA radioactivity was counted in a gamma counter. GGGATTGTGGTTG and 3Ј-gaacaaTTGTTCGGGCCCTTTACCAGGA GAGTGGGAGA (L35037). Cytokine/chemokine detection by ELISA The PCR products were digested with XhoI and ApaI and ligated into mammalian expression/secretion vector pSecTag2/Hygro B (Invitrogen The specificity binding of the soluble receptors was detected by an ELISA Life Technologies). A different set of primers, 5Ј (sense) and 5Ј (antisense), as follows: each well was coated with 10 ng of either mouse or human were used to generate cDNA encoding the different human (NM000647) proteins, respectively—CCL2, CCL4, CCL5, CCL7, CCL7, CCL8, (28) and mouse (NM009915) (29) domains of CCR2 from the PC-3 and the CCL13, CCL11, CCL16, CCL19, CCL20, CXCL8, CXCL9, CXCL10, TRAMP mouse C-1 cell line (30), respectively. The cDNA encoding the CXCL11, CXCL12, XCL1, IL-1␤, CD40L (PeproTech) using coating human CXCR4 (NM001008540) (31) was obtained from the PC-3 line. buffer (PBS X1), and incubated at 4°C overnight. Wells were incubated Primers were designed as follows: human CCR2 N terminus 5Ј-CCCAAG with 200 ␮l of 1% BSA/PBS blocking buffer for1hatroom temperature. CTTATGCTGTCCACATCTCGTTCTCGGTT and 3Ј-CCGCTCGAG TG Soluble chemokine receptors were added (50 ␮g/ml) in 1% BSA/PBS GGCCCCAATTTGCTTCACGTCAA; human CCR2-E1 5Ј-CCCAAGCT buffer (50 ␮l per well) and incubated overnight at 4°C and washed four TTCTGCTGCAAATGAGTGGGT and 3Ј-CCGCTCGAGTTTGCACAT times with PBS/Tween 20 (0.05%). Then 50 ␮l of goat anti-human IgG- Downloaded from TGCATTCCCAA; human CCR2-E2 5Ј-CCCAAGCTTACTAAATGCCA HRP (Jackson ImmunoResearch) was added at 1/10,000 in 1% BSA/PBS GAAAGAAGA and 3Ј-CCGCTCGAGTGTGTGGAAATTATTCCATC; for 1 h and washed four times with PBS/Tween 20 (0.05%). The substrate human CCR2-E3 5Ј-CCCAAGCTTAACACCTTCCAGGAATTCTTCGG solution (tetramethylbenzidine) was then added at 50 ␮l/well. When a blue ␮ CCT and 3Ј-CCGCTCGAGTTGGTCCAGTTGACTGGTGCTTTCAC; color appeared, the reaction was terminated by adding 50 lofH2SO4 (1 human CXCR4 N terminus 5Ј-CCCAAGCTTTGGAGGGGATCAGTATA M). OD was determined at 450 nm with the reference filter set to 620 nm. TACACTTC and 3Ј-CCGCTCGAGATTTTATTGAAATTAGCATTTTC Ј Chemokine detection in sera by ELISA

TTC; mouse CCR2 N terminus 5 -CCAAGCTTATGGAAGACAATAA http://www.jimmunol.org/ Ј TATGTTAC and 3 -CCGCTCGAGCACACTGGTTTTATGACAAGGC; Detection of mouse CCL2 was done by ELISA development kit (Mouse Ј andmouseCCR2-E35 -CCCAAGCTTGAATCCTTGGGAATGAGTAAC CCL2/JE ELISA kit; R&D Systems) and conducted according to the man- Ј TGT and 3 -CCGCTCGAGTCCAAGAGTCTCTGTCACCTGCAT. ufacturer’s instruction. The constant region of the human Fc, (Hinge-CH2-CH3) alone (Ig) was also cloned and used later as a control for BiaCore analysis (see Fig. 3A). In vitro chemotaxis assays Each PCR product was digested with HindIII and XhoI and subcloned into the vector containing the human/mouse (h/m) IgG1 fragment. Each fused Chemotaxis assays in which the chemokine-induced migration of mono- ϫ 6 fragments was sequenced by dideoxynucleotide sequencing at our facility cyte cell lines (THP-1 and RAW 264.7 cells, 1 10 ) were determined, ␮ (Sequenase version 2; Upstate Biotechnology). were performed in a Transwell system (5- m pore size, Corning; Costar). Chemotaxis assays in which the chemokine-induced migration of PC-3 6 cells (1 ϫ 10 ) were conducted using the CytoSelect cell migration assay by guest on September 28, 2021 Expression and purification of fusion proteins (8-␮m pore size; Cell Biolabs. Briefly, cells were loaded into the upper chamber of the two systems. The lower chambers were loaded with 20 Expression and purification of the various fusion proteins was done using Ϫ Ϫ ng/ml chemokines (h/m CCL2, h/m CCL7, h/m CCL8, h/m CCL11, CHO dhfr / (DG44) cells provided by Dr. L. Chasin (Columbia Univer- hCCL16, hCCL13, mCCL12; PeproTech) and 50 ␮g/ml soluble receptors sity, New York, NY) according to the method described in detail (32). The (h/m E3-Ig) or Abs. Cells were let to migrate for 2 h under a humidified fusion protein was expressed as a disulfide-linked homodimer similar to 7.5% CO atmosphere at 37°C. The content of the lower chambers was IgG1, and it was purified from the culture medium by the High-Trap pro- 2 collected and counted using the FACSCalibur (BD Biosciences). The che- tein G affinity column (BD Biosciences). motaxis index was then calculated by dividing the number of migrating cells in the presence of chemoattractant by the number of cells migrated in Evaluation of the affinity of E3-IgG to CCL2 by surface its absence. plasmon resonance Evaluation of IC50 E3-IgG affinity to CCL2 was determined by BIAcore analysis, using the Chemokine-induced cell migration was assessed using 5-␮m pore Trans- biosensor BIAcore 3000. CCR2-IgG or Fc, as a negative control, were ϫ 6 ␮ ϭ well filter membranes (Costar). A total of 1 10 THP-1, or RAW 264.7 immobilized directly to CM5 chip (100 g/ml in 10 mM acetate (pH 4)) cells, were loaded into each Transwell filter. Soluble receptors (h/m E3-Ig) using amine coupling kit (BIAcore) to reach up to 2500 response units or mAbs (our anti-hCCL2 mAb and commercial anti-mCCL2 mAb; R&D binding level. All subsequent binding experiments were performed in HBS ϭ Systems) were added in the lower chamber at different concentrations (0.01 M HEPES (pH 7.4), 0.15 M NaCl, 3.4 mM EDTA, and 0.005% (0.01–100 ␮g/ml) with 20 ng/ml CCL2. Plates were then incubated at 37°C Tween 20 at 25°C). CCL2 (R&D Systems) was used in concentrations for 2 h. The migrated cells were collected and counted by FACSCalibur ranging from 94 to 1500 nM and a flow rate of 30 ␮l/min. The surface was ␮ (BD Biosciences). The IC50 calculation was performed by Origin8 soft- regenerated back to baseline level by injecting 10 l of 100 mM NaOH. ware (OriginLab). For binding kinetics, BIA-evaluation (version 4.1 software; BIAcore) was applied, and the 1:1 Langmuir binding model was chosen. In vitro proliferation assay A total of 1 ϫ 104 PC-3 cells were cultured in 96-well flat-bottom tissue Production of anti-human CCL2 mAb culture plates in their respective medium. After 24 h, wells were supple- ␮ mented with fresh medium, 200 ␮g/ml neutralizing Abs, 200 ␮g/ml soluble BALB/c mice were administered 50 g of human (h)CCL2 in CFA, fol- ␮ lowed by six injections every 3 wk, of 50 ␮g of hCCL2 in IFA. Spleno- receptors, or 200 g/ml total IgG from preimmune mice. Cells were cultured in the presence and absence of these supplements for 5 days. Each cytes were isolated and fused with NSO myeloma cells by standard pro- ␮ cedures (33). Hybridoma supernatants were first screened for their ability well was pulsed with 2 Ci of thymidine (specific activity 10 Ci/mmol) for the final 16 h. The cultures were then harvested on fiberglass filters. Results to bind hCCL2 by using an ELISA immunoassay. Selected clones were Ϯ then tested for their binding specificity by Western blotting using different are shown as the mean cpm of six replicates SE from three independent chemokines (PeproTech), and for their in vitro ability to inhibit CCL2- experiments, divided by the mean cpm of control cells. induced migration of the human monocyte cell line THP-1 in a Transwell Animal models system (Corning; Costar). Our anti-CCL2 mAb selectively binds and neutralizes human CCL2 with low cross-reactivity to its mouse counter An animal model of EAE used C57BL/6 female mice purchased from molecule. Harlan Laboratories and maintained in independent ventilated cages under 734 A NOVEL RECOMBINANT FUSION PROTEIN Downloaded from http://www.jimmunol.org/

FIGURE 1. CCR2 domain E3 binds CCL2 independently of the N-terminal domain of the receptor. A, Schematic presentation of CCR2 domain FIGURE 2. Human CCR2 E3-Ig selectively binds CCL2 and CCL16 structure and the related constructs encoding the cloned human CCR2-Ig and inhibits their chemokine-induced migration. A, Inhibition of CCL2- fusion proteins. B, SDS-PAGE analysis of the different CCR2-Ig fusion induced chemotaxis of THP-1 cells by CCR2-based fusion proteins. The

proteins shown in a Coomassie blue staining, under reducing and nonre- by guest on September 28, 2021 chemotaxis index of THP-1 cells was determined in the absence or pres- ducing conditions: N-terminal, E2, E1, E3, and E3 plus N-terminal under ence of 20 ng/ml CCL2 and 50 ␮g/ml soluble domains. Results are shown reducing (ϩ2-ME) and nonreducing (Ϫ2-ME) conditions. C, Comparative as mean triplicates Ϯ SE. B, THP-1 cells were tested for their ability to analysis of CCL2 binding to human CCR2-Ig fusion proteins and human migrate toward additional natural ligands of CCR2 (20 ng/ml each) in the CXCR4-Ig (N-terminal region) as determined by ELISA: E1 of human presence of 50 ␮g/ml hE3-Ig. Results are shown as mean triplicates Ϯ SE. CCR2 (E1-Ig), E2 of human CCR2 (E2-Ig), E3 of human CCR2 (E3-Ig), C, Comparative analysis of E3-Ig binding to different recombinant human the E3-N-terminal region-Ig of human CCR2 (E3ϩN-Ig), the N-terminal chemokines, and to CD40L and IL-1␤, in comparison to CCL2 and anti- region of human CCR2 (N-Ig), and the N-terminal region-Ig of human CCL2 Ab (ELISA). Results are shown as mean triplicates Ϯ SE. CXCR4 (CXCR4-Ig). Results are shown as mean triplicates Ϯ SE.

Statistical analysis pathogen-free conditions. At 6 wk of age, mice were subjected to active The significant difference was examined using Student’s t test. Values for Ͻ disease induction by a single administration of MOG33–55 emulsified in p 0.05 were considered statistically significant. CFA as described elsewhere (35). At the onset of disease only mice with an apparent clinical manifestation of disease were selected and separated Results into equally sick groups for therapy. Animals were then monitored for clinical signs daily by an observer blind to the treatment protocol. EAE was A fusion protein encoding 20 aa of the E3 domain selectively scored as follows: 0, clinically normal; 1, flaccid tail; 2, hind limb paral- binds CCL2 and neutralizes its biological function ysis; 3, total hind limb paralysis, accompanied by an apparent front limb In attempt to identify the CCL2 binding site on CCR2, we have paralysis; and 4, total hind limb and front limb paralysis. The animal xenograft model of prostate cancer used SCID/Beige male cloned the first, second, and third extracellular loops of human mice purchased from Harlan Laboratories and maintained in independent CCR2 (E1, E2, and E3, respectively), as well as its N-terminal ventilated cages under pathogen-free conditions. At 6 wk of age, mice were region and generated four different fusion proteins stabilized by ϫ 6 s.c. injected between the two flanks with 5 10 PC-3 cell line (American human Ig (Fc) as follows: E1-Ig, E2-Ig, E3-Ig, and N-terminal Type Culture Collection). Mice were monitored daily for tumor volume. Tumor diameters were measured using a caliper. Tumor volume was cal- region Ig. We have also generated a fusion protein encoding E3 culated using the formula ␲/6 ϫ a ϫ b2, where a is the longest dimension, and the N-terminal region of human CCR2 together. Fig. 1 shows and b is the width. the domain structure of CCR2, a schematic view of the related constructs we have generated (Fig. 1A) and the SDS-PAGE anal- Histology ysis of the resulted proteins (Fig. 1B). As control fusion proteins, we have cloned the N-terminal region of human CXCR4 and fused Spinal cords were subjected to histology analysis. Briefly, tissue samples were fixed overnight in 4% paraformaldehyde in PBS, then dehydrated, it to Ig. Our working hypothesis has been that the N-terminal re- paraffin-embedded, and sectioned into 5-␮m sections. Sections were then gion alone or in combination with the E3 domain would bind deparaffinized and stained with H&E and with Luxol fast blue. CCL2. We have therefore compared the CCL2 binding properties The Journal of Immunology 735

FIGURE 3. Despite low binding afﬁnity to CCL2 E3-Ig effectively neutralizes chemotaxis induced by this chemokine. A, BiaCore analysis (a) of of E3-Ig binding to CCL2 (left). KD (2.02E-07) for CCL2 binding of CCR2-IgG immobilized on a CM-5 sensor chip was determined by surface plasmon resonance. The concentration range of CCL2 was 94–1500 nM in ﬁve serial dilutions. Data are pre- Downloaded from sented as real-time graphs of response units (RU) against time and were an- alyzed using a 1:1 Langmuir model. B, Dose-dependent Inhibition of CCL2- induced chemotaxis of THP-1 cells by E3-Ig compared with anti-CCL2 Ab.

The chemotaxis index for THP-1 cells http://www.jimmunol.org/ was determined in the presence of 20 ng/ml CCL2 and different concentrations of hE3-Ig, anti-hCCL2, or control human IgG1. Results are shown as mean triplicates Ϯ SE. by guest on September 28, 2021

of each of our fusion proteins. Fig. 1C shows that of all fusion E3-Ig exerts lower affinity to CCL2 in comparison to mAb, yet proteins the E3 domain, the N-terminal domain, or their fusion effectively and selectively suppresses the biological activities of (E3-N-terminal) bind CCL2, with the first two exhibiting a slightly CCL2 Ϯ Ϯ higher binding (OD450 nm 0.96 0.1 and 0.92 0.08, compared The binding affinity of E3-Ig to recombinant CCL2 was deter- Ϯ Ͻ with 0.74 0.06, p 0.001). mined using the BiaCore technology. As shown in Fig. 3A, E3-Ig Fig. 2A shows the ability of each domain to inhibit the CCL2- exhibited specific binding to CCL2 compared with human Fc, induced migration of THP-1 cells. In these recombinant fusion which did not show any binding to CCL2, with a calculated affinity proteins, the E3 domain alone (E3-Ig or BL-2030) not only could of 2.02 ϫ 10Ϫ7 M. The binding affinity of our anti-CCL2 mAb, significantly inhibit CCL2-induced migration of THP-1 cells (che- determined as described in Materials and Methods,is6.5ϫ 10Ϫ9 Ϯ Ϯ Ͻ motaxis index of 1.32 0.2 compared with 14.34 1.5, p M, which is ϳ300-fold higher than E3-Ig. We then examined for 0.001) but could also do so better than each of the other fusion each of them the IC50 required for the inhibition of CCL2-induced proteins, including the E3-N-terminal fusion (chemotaxis index of migration of THP-1 cells. Fig. 3B shows a dose-dependent inhi- Ϯ Ϯ Ͻ 1.32 0.2 vs 5.9 0.6, p 0.01). Human CCR2 binds multiple bition assay for both CCL2 inhibitors, showing that although E3-Ig chemokines, including CCL2, CCL8, CCL16, CCL7, CCL11, and exhibits low affinity to CCL2, its CCL2 neutralization activity was CCL13. We have determined the ability of human E3-Ig to inhibit ␮ comparable with the high affinity anti-CCL2 Ab (IC50 of 2 g/ml the migration of THP-1 cells induced by each of these chemokines, compared with 2.5 ␮g/ml, respectively). as well as its direct binding to each of them (ELISA). Our observations clearly show that of these chemokines, E3-Ig (BL-2030) selectively inhibits THP-1-induced migration of two only of them: E3-Ig suppresses ongoing EAE in C57BL/6 mice CCL2 and CCL16. It also exclusively binds both chemokines (Fig. We have then cloned the reciprocal E3 domain of murine CCR2, 2C). Its ability to block CCL2-induced migration is significantly and constructed the murine E3-Ig fusion protein. In murine CCR2 higher than to inhibit CCL16-induced chemotaxis under the same binds CCL2, CCL8, CCL7, CCL11, CCL12, and CCL13 (CCL16 conditions (Fig. 2B, p Ͻ 0.01). is a human chemokine). The ability of murine E3-Ig to bind and 736 A NOVEL RECOMBINANT FUSION PROTEIN

FIGURE 4. E3-Ig selectively binds and neutralizes murine CCL2 and suppresses ongoing EAE in C57BL/6 mice. A, The monocytic cell line (RAW 264.7) was tested for its ability to migrate toward additional natural ligands of CCR2 (20 ng/ml each) in the presence of 50 ␮g/ml mE3-Ig. Results are shown as mean triplicates Ϯ SE. B, Murine E3-Ig was determined for its binding speciﬁcities to various chemokines. Results of triplicates are shown as mean OD at 450 nm Ϯ SE. C, Dose- dependent inhibition of CCL2-induced Downloaded from chemotaxis of RAW 264.7 cells by mE3-Ig compared with anti-CCL2 mAb. The chemotaxis index for RAW 264.7 cells was determined in the presence of 20 ng/ml CCL2 and different concentrations of either mE3-Ig or anti- mCCL2. Results are shown as mean http://www.jimmunol.org/ triplicates Ϯ SE. D, C57BL/6 mice were subjected to active induction of EAE. Following disease onset (day 15) mice were treated (every 3 days) with 200 ␮g/mouse of E3-Ig (f), control mouse IgG1 (E), or PBS (Œ) and monitored for disease progression by an observer blind to the experimental proto-

col. Results of six mice/group are by guest on September 28, 2021 shown as mean EAE score Ϯ SE. E, H&E (a, b, and c), or Luxol fast blue (d, e, and f) staining of spinal cord samples from mice treated with PBS (a and d), control IgG (b and e), and E3-Ig (c and f) at a magniﬁcation of ϫ20.

inhibit chemokine-induced migration of the mouse monocytic cell These mice were subjected to active induction of EAE and, fol- line (RAW 264.7) in response to each of these chemokines was lowing the onset of disease (day 15), treated (every 3 days) with determined. Our observations clearly show that of these chemo- 200 ␮g/mouse of E3-Ig, control mouse IgG1, or PBS and moni- kines mE3-Ig exclusively inhibits the CCL2-induced migration of tored for disease progression by an observer blind to the experi- RAW 264.7 cells (Fig. 4A). It also solely binds this chemokine mental protocol (Fig. 4D). We show that administration of E3-Ig Ϯ (Fig. 4B). We then examined the IC50 required for the inhibition of (BL-2030) rapidly suppresses EAE (mean maximal score of 1.3 murine CCL2-induced migration of RAW 264.7, according the 0.2, compared with 3 Ϯ 1.2 and 3.3 Ϯ 0.9 in PBS or control IgG Ͻ protocol used in Fig. 2B. Our results show that the IC50 of murine treated mice, respectively, p 0.01). At the peak of disease, rep- E3-Ig (5.2 ␮g/ml) is comparable to the commercially available resentative mice were sacrificed, and lumbar spinal cords were control mAb (clone 123616; R&D Systems) (Fig. 4C), which is subjected to histological analysis. Fig. 4D shows the results of 4.7 ␮g/ml. representative sections (of 18 sections per group), showing a Although mice lacking CCL2 displayed markedly reduced EAE marked decrease in leukocyte infiltrate around HEV of mice (5), there is a dispute whether its targeted neutralization in wild- treated with E3-Ig but not with control IgG or PBS. A comple- type rodents suppresses the disease (6, 7, 36). Based on its high mentary Luxol fast blue staining was conducted to verify that re- specificity in binding and neutralization of CCL2 we have ex- covery is associated with reduction in demyelination that occurs plored the ability of E3-Ig to interfere in the regulation of ongoing during EAE in C57BL/6 mice (Fig. 4E). Thus, E3-Ig (BL-2030) EAE in C57BL/6 mice. effectively suppresses an ongoing EAE disease. Finally, We have The Journal of Immunology 737 Downloaded from http://www.jimmunol.org/

FIGURE 6. Human E3-Ig inhibits the development of primary tumor in by guest on September 28, 2021 FIGURE 5. Human E3-Ig inhibits the proliferation and CCL2-in- PC3 prostate cancer xenograft model. A, SCID/Beige mice (six mice/ 6 duced migration of PC3 cells. A, Human E3-Ig inhibits CCL2-induced group) were implanted with 5 ϫ 10 PC-3 cells and were treated twice a migration of PC-3 cells as determined by the CytoSelect cell migration week, starting from day 7, with either PBS (Œ), isotype-matched IgG1 (f), assay. Results are shown as mean triplicates Ϯ SE. Add amount of 50 ␮g/mouse (E), 100 ␮g/mouse (‚), or 200 ␮g/mouse (F) of hE3-Ig. CCL2.B, Human E3-Ig inhibits PC-3 cell proliferation. The 96-well Mice were monitored for the progression of the primary tumor until sac- tissue culture plates were loaded with 1 ϫ 104 PC-3 cells and cultured riﬁced on day 40. In the 100 and 200 ␮g/mouse groups, treatment was in the presence of culture medium, control IgG, anti-CCR2 mAb, and terminated on day 34 and mice were then monitored for tumor growth until 3 hE3-Ig. All gene products including control IgG, all mAbs, and E3-Ig tumors reached the volume of 1000 mm (day 54 for 100 ␮g/mouse group were isotype matched (IgG1). Results are shown as mean of [3H] uptake and day 68 for 200 ␮g/mouse group). Data presented represent one of three of triplicates Ϯ SE. independent experiments with similar data. Results are shown as mean tumor volume Ϯ SE. B, SCID/Beige mice (six mice/group) were implanted with 5 ϫ 106 PC-3 cells and were treated twice a week, starting from day measured the levels of CCL2 in circulating blood 1 day after the 7, with either PBS (f), isotype-matched IgG1 (Ⅺ), 200 ␮g/mouse anti- second mE3-Ig administration during EAE (Fig. 4D). We identi- CCL2 (‚), or 200 ␮g/mouse E3-Ig (F). Mice were monitored for the ﬁed an 1.8-fold increase in CCL2 levels in the circulation of progression of the primary tumor using a caliper. Data presented represent treated mice (57.15 Ϯ 6.1 ng/ml in E3-Ig-treated mice compared one of three independent experiments with similar data. Results are shown Ϯ with 30.1 Ϯ 4.2 ng/ml in PBS-treated mice. as mean tumor volume SE.

E3-Ig inhibits the proliferation and CCL-2 induced migration of PC-3 cells in vitro Three human prostate cancer cell lines are commonly used in cells is directed via the CCL2-CCR2 interaction (Fig. 5A). An xenograft experiments: LNCaP, an androgen-dependent cell anti-CCR2 mAb (38) provided by Dr. C. Martinez-A (Centro line derived from a patient’s lymph node, and DU-145 and Nacional de Biotecnologia, Universidad Autonoma de Madrid, PC-3, both androgen-independent cell lines, derived from brain Madrid, Spain) also effectively suppressed CCL2-induced mi- and bone metastases, respectively. Of these lines, PC-3 is the gration of these cells (chemotaxis index of 2.6 Ϯ 0.2 vs 10.3 Ϯ most aggressive (37) and has therefore been selected for our in 1.4, p Ͻ 0.01) (Fig. 5A). We then determined the ability of this vivo xenograft studies. After veriﬁcation of CCR2 expression soluble receptor to inhibit the proliferation/growth of PC-3 (FACS analysis, data not shown), we tested whether hE3-Ig cells. As shown in Fig. 5B, addition of E3-Ig to cultured PC-3 would affect CCL2-induced migration of PC-3 cells in vitro cells signiﬁcantly reduced the proliferation of these cells (41 Ϯ (Fig. 5A). We show that hE3-Ig effectively blocks CCL2-in- 2.4 ϫ 103 cpm vs 100 Ϯ 8.7 ϫ 103 cpm, p Ͻ 0.01). Similar duced chemotaxis of PC-3 cells (chemotaxis index of 3.16 Ϯ results were obtained using the anti-CCR2 mAb (28 Ϯ 1.9 ϫ 0.2 vs 10.3 Ϯ 0.09, p Ͻ 0.01), and that the migration of these 103 cpm vs 100 Ϯ 8.5 ϫ 103 cpm, p Ͻ 0.01). 738 A NOVEL RECOMBINANT FUSION PROTEIN

E3-Ig inhibits tumor growth in a prostate cancer xenograft to Ig) was the most effective inhibitor of CCL2-induced chemo- model taxis in vitro. Next, we explored the ability of hE3-Ig to suppress the growth of Neutralizing mAbs and soluble receptor-based fusion proteins PC-3 in SCID/Beige mice. Briefly, mice were implanted with 5 ϫ were shown to be effective in the treatment of autoimmune dis- ␣ 106 PC-3 cells and beginning on day 7, when tumors were clearly eases and cancer. Use of anti-TNF- mAbs and recombinant sol- ␣ identified in all animals, were treated (twice a week) with PBS, uble TNF- receptor fusion proteins is a classical example of suc- cessful treatment of rheumatoid arthritis and other related isotype-matched IgG1, or 50, 100, or 200 ␮g/mouse of hE3-Ig and autoimmune diseases (39–41). One of the major disadvantages of monitored for tumor growth (Fig. 6). Our results clearly show a mAb-based therapies is their tendency to elicit anti-idiotypic neu- dose-dependent blockade of primary tumor growth in E3-Ig- tralizing Abs, as a part of a natural regulatory network (42). From treated mice (tumor size at day 40, 1550 mm3 Ϯ 123.7 and 2020 this perspective, soluble receptors have a therapeutic advantage. mm3 Ϯ 134.8 in control groups, compared with 90.5 mm3 Ϯ 26.1 The CCL2/CCR2 axis has been implicated in the pathophysiology and 505 mm3 Ϯ 91.1 in those treated with 200 and 100 ␮gof of a wide range of both acute and chronic inflammatory conditions, E3-Ig, respectively, p Ͻ 0.001). Most importantly, E3-Ig inhibi- such as rheumatoid arthritis, MS, atherosclerosis, uveitis, asthma, tory effect was still observed 15–35 days following treatment ter- psoriasis, diabetes, inflammatory bowel disease, lupus nephritis, mination, hinting to its therapeutic potential as anticancer agent. transplant rejection, and several CCL2/CCR2 antagonists are cur- After determining the dissociation constant (K ) and neutraliz- d rently under clinical development. ing activity (IC ) of our anti-human CCL2 mAb in comparison to 50 The role of CCL2 in EAE has been studied by either using hE3-Ig (Fig. 3), we have compared their ability to suppress the deficient mice, or by administering anti-CCL2 polyclonal Abs to Downloaded from growth of human prostate cancer cell line (PC-3) in SCID mice. It EAE in mice or rats. Izikson et al. (43) showed that mice lacking has been previously shown that in this xenograft model even CCR2 are EAE-resistant. Nevertheless, at least six different che- though both the murine and tumor-derived CCL2 contribute to mokines bind CCR2, therefore other chemokines, aside of CCL2, tumor development, targeted neutralization of the human-derived might contribute to EAE resistance in CCR2-deficient mice as chemokine markedly suppresses tumor development (14). Our re- demonstrated in that study. A complementary publication of sults clearly show that under the same experimental conditions, Huang et al. (5) showing that mice lacking CCL2 display a mark- http://www.jimmunol.org/ both equally very effectively suppressed tumor development (Fig. edly reduced form of disease, further emphasizes the pivotal role 6B) despite the major difference in anti-human CCL2 mAb in com- of CCL2 in the pathogenesis of EAE. Thus far the evidence that parison to hE3-Ig binding affinity to CCL2 (ϳ300-fold higher for targeting CCL2 alone, in wild-type rodents suppresses EAE the Ab). emerged from studies that used polyclonal Ab-based therapies, with their limitations. There is a dispute in these studies whether targeted neutralization of CCL2 in wild-type rodents suppresses Discussion the disease (6, 7, 36). We show in this study that in C57BL/6 EAE In this study, we describe a novel recombinant soluble form of the mice injection of E3-Ig, that specifically and exclusively binds and CCL2 receptor, E3-Ig (BL-2030). We have shown that E3-Ig se- neutralizes CCL2 (Fig. 4, A–C), effectively suppressed an ongoing by guest on September 28, 2021 lectively binds CCL2 and neutralizes its biological activity, mainly disease (Fig. 4, D and E) further implies that this chemokine plays the chemotaxis of human monocytes in vitro. In addition, it inhib- a pivotal role in EAE, as previously demonstrated in mice lacking its the proliferation and migration of the human prostate cancer CCL2 (5). cell line PC-3 that expresses CCL2 and its receptor. The in vivo It has been reported that administration of anti-CCL2 mAbs to activity of E3-Ig was demonstrated in two separate disease models patients suffering from rheumatoid arthritis led to a 2000-fold in- in which the CCL2-CCR2 pathway was shown to play a role, the crease in their circulating CCL2 (44), which may explain, in part, EAE model of MS and the PC-3 prostate cancer model. E3-Ig why therapy was ineffective. In the current study we show that (BL-2030) significantly suppressed ongoing EAE disease and ex- repeated administration of E3-Ig only moderately increased circu- hibited dose-dependant inhibition of PC-3 tumor growth. The in- lating blood levels CCL2 (1.8-fold increase). It is possible that in hibition of PC-3 cell proliferation and migration in vitro together human therapy with E3-Ig would also result in a moderated in- with the suppression of tumor growth in vivo indicate an anti- crease in circulating CCL2. This effect would be a major advan- tumorigenic and anti-metastatic potential of E3-Ig. In support of tage to the recipients, though this feature has yet to be carefully our results, a previous study has demonstrated that an anti-CCL2- detected along clinical trails. neutralizing Ab attenuates tumor burden in the PC-3 prostate can- In addition of being a key regulator of monocytes infiltration to cer model (14). sites of inflammation, CCL2 was shown to possess protumorigenic Chemokine receptors belong to the superfamily of seven-trans- and proangiogenic functions. The mechanisms by which CCL2 membrane G protein-coupled receptors (2) that span the plasma promotes tumor progression are still unclear. CCL2 is primarily membrane seven times generating three loops (domains). Their responsible for the recruitment of tumor infiltrating macrophages three-dimensional structure is dependent on plasma-membrane sta- into the tumor site, stimulating angiogenesis and metastasis. In bilization, and therefore the generation of soluble chemokine re- addition, CCL2 has been shown to have direct effects on the tumor ceptors that are highly effective in neutralizing their target chemo- cells in several neoplasms including breast, lung, cervix, ovary, kines is still a major challenge. In an attempt to overcome this sarcoma, and prostate, inducing cancer cell proliferation, migra- obstacle, we generated short recombinant proteins encoding dif- tion, and survival. ferent segments of the G protein-coupled receptor CCR2, and We clearly show that E3-Ig well suppresses the establishment of tested their ability to bind and neutralize its target chemokine human tumor cells in SCID mice. Our human E3-Ig (BL-2030) CCL2. We show that although both the E3 domain and the N binds and neutralizes both CCL2 and CCL16 (Fig. 2). Human terminus of CCR2 bind CCL2, only the E3 domain alone, or in cancer cells produce both chemokines (9). CCL16 is also likely to combination with the N-terminal region, neutralizes the basic bi- contribute to tumor invasion and angiogenesis (45). Therefore it ological activity of CCL2; chemoattraction of monocytes. Surpris- could be that its neutralization by BL-2030 also contributes to ingly, the E3 domain alone comprising only 20 aa of CCR2 (fused tumor suppression in a xenograft model of cancer (Fig. 6). The Journal of Immunology 739

E3-Ig (BL-2030) represents a novel approach for inhibiting 1alpha (CXCL12) increases endothelial adhesion and transendothelial migration: ␬ CCL2. Its potent anti-tumorigenic effect, together with its anti- role of MEK/ERK signaling pathway-dependent NF- B activation. Cancer Res. 65: 9891–9898. inflammatory activity, suggests a therapeutic potential for the treat- 22. Sun, Y. X., J. Wang, C. E. Shelburne, D. E. Lopatin, A. M. Chinnaiyan, ment of autoimmune disease, as well as various malignancies. Fur- M. A. Rubin, K. J. Pienta, and R. S. Taichman. 2003. Expression of CXCR4 and CXCL12 (SDF-1) in human prostate cancers (PCa) in vivo. J. Cell Biochem. 89: ther studies exploring the therapeutic potential of E3-Ig in 462–473. additional inflammatory disease models and various cancer models 23. Taichman, R. S., C. Cooper, E. T. Keller, K. J. Pienta, N. S. Taichman, and are required. L. K. McCauley. 2002. Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone. Cancer Res. 62: 1832–1837. 24. Vaday, G. G., S. B. Hua, D. M. Peehl, M. H. Pauling, Y. H. Lin, L. Zhu, Disclosures D. M. Lawrence, H. D. Foda, and S. Zucker. 2004. CXCR4 and CXCL12 N.K., L.I., G.W. and Y.Z. hold a pending patent on therapy of inflamma- (SDF-1) in prostate cancer: inhibitory effects of human single chain Fv antibod- tory autoimmunity and cancer using CCL2 E3-Ig that has been licensed out ies. Clin. Cancer Res. 10: 5630–5639. to BiolineRx. L.K., M.A.-S., and A.E. are research scientists at BiolineRX 25. Lu, Y., Z. Cai, G. Xiao, E. T. Keller, A. Mizokami, Z. Yao, G. D. Roodman, and J. Zhang. 2007. Monocyte chemotactic protein-1 mediates prostate cancer-in- and preformed part of the in vitro analysis within the manuscripts and also duced bone resorption. Cancer Res. 67: 3646–3653. participate in discussing the results. 26. Monteclaro, F. S., and I. F. Charo. 1997. The amino-terminal domain of CCR2 is both necessary and sufficient for high affinity binding of monocyte chemoat- References tractant protein 1: receptor activation by a pseudo-tethered ligand. J. Biol. Chem. 272: 23186–23190. 1. Rollins, B. J. 1997. Chemokines. Blood 90: 909–928. 27. Datta-Mannan, A., and M. J. Stone. 2004. Chemokine-binding specificity of sol- 2. Zlotnic, A., and O. Yoshei. 2000. Chemokines: a new clasification system and uble chemokine-receptor analogues: identification of interacting elements by chi- their role in immunity. Immunity 12: 121–127. mera complementation. Biochemistry 43: 14602–14611. 3. Mackay, C. R. 2001. Chemokines: immunology’s high impact factors. Nat. Im- munol. 2: 95–101. 28. Charo, I. F., S. J. Myers, A. Herman, C. Franci, A. J. Connolly, and Downloaded from 4. Proudfoot, A. E. 2002. Chemokine receptors: a multifaceted therapeutic targets. S. R. Coughlin. 1994. Molecular cloning and functional expression of two mono- Nat. Rev. Immunol 2: 106–115. cyte chemoattractant protein 1 receptors reveals alternative splicing of the car- 5. Huang, D. R., J. Wang, P. Kivisakk, B. J. Rollins, and R. M. Ransohoff. 2001. boxyl-terminal tails. Proc. Natl. Acad. Sci. USA 91: 2752–2756. Absence of monocyte chemoattractant protein 1 in mice leads to decreased local 29. Kurihara, T., and R. Bravo. 1996. Cloning and functional expression of mCCR2, macrophage recruitment and antigen-specific T helper cell type 1 immune re- a murine receptor for the C-C chemokines JE and FIC. J. Biol. Chem. 271: sponse in experimental autoimmune encephalomyelitis. J. Exp. Med. 193: 11603–11607. 713–726. 30. Gingrich, J. R., R. J. Barrios, B. A. Foster, and N. M. Greenberg. 1999. Patho- logic progression of autochthonous prostate cancer in the TRAMP model. Pros- 6. Kennedy, K. J., R. M. Strieter, S. L. Kunkel, N. W. Lukacs, and W. J. Karpus. http://www.jimmunol.org/ 1998. Acute and relapsing experimental autoimmune encephalomyelitis are reg- tate Cancer Prostatic Dis. 2: 70–75. ulated by differential expression of the CC chemokines macrophage inflammatory 31. Loetscher, M., T. Geiser, T. O’Reilly, R. Zwahlen, M. Baggiolini, and B. Moser. protein-1␣ and monocyte chemotactic protein-1. J. Neuroimmunol. 92: 98–108. 1994. Cloning of a human seven-transmembrane domain receptor, LESTR, that 7. Youssef, S., G. Wildbaum, G. Maor, N. Lanir, A. Gour-Lavie, N. Grabie, and is highly expressed in leukocytes. J. Biol. Chem. 269: 232–237. N. Karin. 1998. Long-lasting protective immunity to experimental autoimmune 32. Carothers, A. M., G. Urlaub, J. Mucha, D. Grunberger, and L. A. Chasin. 1989. encephalomyelitis following vaccination with naked DNA encoding C-C chemo- Point mutation analysis in a mammalian gene: rapid preparation of total RNA, kines. J. Immunol. 161: 3870–3879. PCR amplification of cDNA, and Taq sequencing by a novel method. BioTech- 8. Goser, S., R. Ottl, A. Brodner, T. J. Dengler, J. Torzewski, K. Egashira, niques 7: 494–499. N. R. Rose, H. A. Katus, and Z. Kaya. 2005. Critical role for monocyte che- 33. Harlow, E., and D. Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor moattractant protein-1 and macrophage inflammatory protein-1␣ in induction of Laboratory, New York; 1988. experimental autoimmune myocarditis and effective anti-monocyte chemoattrac- 34. Friguet, B., A. F. Chaffotte, L. Djavadi-Ohaniance, and M. E. Goldberg. 1985.

tant protein-1 gene therapy. Circulation 112: 3400–3407. Measurements of the true affinity constant in solution of antigen-antibody com- by guest on September 28, 2021 9. Homey, B., A. Muller, and A. Zlotnik. 2002. Chemokines: agents for the immu- plexes by enzyme-linked immunosorbent assay. J. Immunol. Methods 77: notherapy of cancer? Nat. Rev. Immunol. 2: 175–184. 305–319. 10. Garnick, M. B. 1993. Prostate cancer: screening, diagnosis, and management. 35. Mendel, I., N. Kerlero de Rosbo, and A. Ben-Nun. 1995. A myelin oligodendro- Ann. Intern. Med. 118: 804–818. cyte glycoprotein peptide induces typical chronic experimental autoimmune en- 11. Pienta, K. J., and P. S. Esper. 1993. Risk factors for prostate cancer. Ann. Intern. cephalomyelitis in H-2b mice: fine specificity and T cell receptor V␤ expression Med. 118: 793–803. of encephalitogenic T cells. Eur. J. Immunol. 25: 1951–1959. 12. Loberg, R. D., L. L. Day, J. Harwood, C. Ying, L. N. St. John, R. Giles, 36. Karpus, W. J., and K. J. Kennedy. 1997. MIP-1␣ and MCP-1 differentially reg- C. K. Neeley, and K. J. Pienta. 2006. CCL2 is a potent regulator of prostate ulate acute and relapsing autoimmune encephalomyelitis as well as Th1/Th2 lym- cancer cell migration and proliferation. Neoplasia 8: 578–586. phocyte differentiation. J. Leukocyte Biol. 62: 681–687. 13. Lu, Y., Z. Cai, D. L. Galson, G. Xiao, Y. Liu, D. E. George, M. F. Melhem, 37. Rubio, N., M. M. Villacampa, N. El Hilali, and J. Blanco. 2000. Metastatic Z. Yao, and J. Zhang. 2006. Monocyte chemotactic protein-1 (MCP-1) acts as a burden in nude mice organs measured using prostate tumor PC-3 cells expressing paracrine and autocrine factor for prostate cancer growth and invasion. Prostate the luciferase gene as a quantifiable tumor cell marker. Prostate 44: 133–143. 66: 1311–1318. 38. Frade, J. M., M. Mellado, G. del Real, J. C. Gutierrez-Ramos, P. Lind, and 14. Loberg, R. D., C. Ying, M. Craig, L. L. Day, E. Sargent, C. Neeley, K. Wojno, A. C. Martinez. 1997. Characterization of the CCR2 chemokine receptor: func- L. A. Snyder, L. Yan, and K. J. Pienta. 2007. Targeting CCL2 with systemic tional CCR2 receptor expression in B cells. J. Immunol. 159: 5576–5584. delivery of neutralizing antibodies induces prostate cancer tumor regression in 39. Feldmann, M., F. M. Brennan, and R. N. Maini. 1996. Role of cytokines in vivo. Cancer Res. 67: 9417–9424. rheumatoid arthritis. Annu. Rev. Immunol. 14: 397–440. 15. Caruso, D. J., A. J. Carmack, V. B. Lokeshwar, R. C. Duncan, M. S. Soloway, and B. L. Lokeshwar. 2008. Osteopontin and interleukin-8 expression is inde- 40. Moreland, L. W., G. Margolies, L. W. Heck, Jr., A. Saway, C. Blosch, R. Hanna, pendently associated with prostate cancer recurrence. Clin. Cancer Res. 14: and W. J. Koopman. 1996. Recombinant soluble tumor necrosis factor receptor 4111–4118. (p80) fusion protein: toxicity and dose finding trial in refractory rheumatoid ar- 16. Waugh, D. J., and C. Wilson. 2008. The interleukin-8 pathway in cancer. Clin. thritis. J. Rheumatol. 23: 1849–1855. Cancer Res. 14: 6735–6741. 41. Moreland, L. W., S. W. Baumgartner, M. H. Schiff, E. A. Tindall, 17. Akashi, T., K. Koizumi, O. Nagakawa, H. Fuse, and I. Saiki. 2006. Androgen R. M. Fleischmann, A. L. Weaver, R. E. Ettlinger, S. Cohen, W. J. Koopman, receptor negatively influences the expression of chemokine receptors (CXCR4, K. Mohler, et al. 1997. Treatment of rheumatoid arthritis with a recombinant CCR1) and ligand-mediated migration in prostate cancer DU-145. Oncol. Rep. human tumor necrosis factor receptor (p75)-Fc fusion protein. N. Engl. J. Med. 16: 831–836. 337: 141–147. 18. Mydlo, J. H., M. I. Gerstein, C. F. Harris, and A. S. Braverman. 2003. Immune 42. Hebert, J., D. Bernier, Y. Boutin, M. Jobin, and W. Mourad. 1990. Generation of function, mitogenicity, and angiogenic growth factor concentrations in lean and anti-idiotypic and anti-anti-idiotypic monoclonal antibodies in the same fusion: obese rodent sera: implications in obesity-related prostate tumor biology. Pros- support of Jerne’s Network Theory. J. Immunol. 144: 4256–4261. tate Cancer Prostatic Dis. 6: 286–289. 43. Izikson, L., R. S. Klein, I. F. Charo, H. L. Weiner, and A. D. Luster. 2000. 19. Darash-Yahana, M., E. Pikarsky, R. Abramovitch, E. Zeira, B. Pal, R. Karplus, Resistance to experimental autoimmune encephalomyelitis in mice lacking the K. Beider, S. Avniel, S. Kasem, E. Galun, and A. Peled. 2004. Role of high CC chemokine receptor (CCR)2. J. Exp. Med. 192: 1075–1080. expression levels of CXCR4 in tumor growth, vascularization, and metastasis. 44. Haringman, J. J., D. M. Gerlag, T. J. Smeets, D. Baeten, F. van den Bosch, FASEB J. 18: 1240–1242. B. Bresnihan, F. C. Breedveld, H. J. Dinant, F. Legay, H. Gram, et al. 2006. A 20. Engl, T., B. Relja, D. Marian, C. Blumenberg, I. Muller, W. D. Beecken, J. Jones, randomized controlled trial with an anti-CCL2 (anti-monocyte chemotactic pro- E. M. Ringel, J. Bereiter-Hahn, D. Jonas, and R. A. Blaheta. 2006. CXCR4 tein 1) monoclonal antibody in patients with rheumatoid arthritis. Arthritis ␣ ␤ chemokine receptor mediates prostate tumor cell adhesion through 5 and 3 Rheum. 54: 2387–2392. integrins. Neoplasia 8: 290–301. 45. Strasly, M., G. Doronzo, P. Cappello, D. Valdembri, M. Arese, S. Mitola, 21. Kukreja, P., A. B. Abdel-Mageed, D. Mondal, K. Liu, and K. C. Agrawal. 2005. P. Moore, G. Alessandri, M. Giovarelli, and F. Bussolino. 2004. CCL16 activates Up-regulation of CXCR4 expression in PC-3 cells by stromal-derived factor- an angiogenic program in vascular endothelial cells. Blood 103: 40–49.