Oxidases Macrophages Via Upregulation of NADPH Ethanol

Ethanol Induces Oxidative Stress in Alveolar Macrophages via Upregulation of NADPH Oxidases

This information is current as Samantha M. Yeligar, Frank L. Harris, C. Michael Hart and of September 28, 2021. Lou Ann S. Brown J Immunol 2012; 188:3648-3657; Prepublished online 12 March 2012; doi: 10.4049/jimmunol.1101278

http://www.jimmunol.org/content/188/8/3648 Downloaded from

References This article cites 59 articles, 18 of which you can access for free at: http://www.jimmunol.org/content/188/8/3648.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Ethanol Induces Oxidative Stress in Alveolar Macrophages via Upregulation of NADPH Oxidases

Samantha M. Yeligar,*,† Frank L. Harris,* C. Michael Hart,† and Lou Ann S. Brown*

Chronic alcohol abuse is a comorbid variable of acute respiratory distress syndrome. Previous studies showed that, in the lung, chronic alcohol consumption increased oxidative stress and impaired alveolar macrophage (AM) function. NADPH oxidases (Noxes) are the main source of reactive oxygen species in AMs. Therefore, we hypothesized that chronic alcohol consumption increases AM oxidant stress through modulation of Nox1, Nox2, and Nox4 expression. AMs were isolated from male C57BL/6J mice, aged 8–10 wk, which were treated with or without ethanol in drinking water (20% w/v, 12 wk). MH-S cells, a mouse AM cell line, were treated with or without ethanol (0.08%, 3 d) for in vitro studies. Selected cells were treated with apocynin (300 mM), a Nox1 and Nox2 complex formation inhibitor, or were transfected with Nox small interfering RNAs (20–35 nM), before ethanol exposure.

Human AMs were isolated from alcoholic and control patients’ bronchoalveolar lavage ﬂuid. Nox mRNA levels (quantitative RT- Downloaded from PCR), protein levels (Western blot and immunostaining), oxidative stress (29,79-dichloroﬂuorescein-diacetate and Amplex Red analysis), and phagocytosis (Staphylococcus aureus internalization) were measured. Chronic alcohol increased Nox expression and oxidative stress in mouse AMs in vivo and in vitro. Experiments using apocynin and Nox small interfering RNAs demonstrated that ethanol-induced Nox4 expression, oxidative stress, and AM dysfunction were modulated through Nox1 and Nox2 upregulation. Further, Nox1, Nox2, and Nox4 protein levels were augmented in human AMs from alcoholic patients compared with control

subjects. Ethanol induces AM oxidative stress initially through upregulation of Nox1 and Nox2 with downstream Nox4 upregu- http://www.jimmunol.org/ lation and subsequent impairment of AM function. The Journal of Immunology, 2012, 188: 3648–3657.

cute respiratory distress syndrome (ARDS) is a severe infectious particles (14). Previous investigations demonstrate in form of lung injury with a 26% mortality rate (1). Disease animal models that the ability of AMs to bind and internalize A pathogenesis is characterized by the development of inactive Staphylococcus aureus is impaired with chronic ethanol pulmonary edema and inflammation in response to trauma, sepsis, ingestion (11), and that treatment with a GSH precursor improves or aspiration, which results in activation of systemic proin- AM phagocytosis in vivo (10). Collectively, these studies dem- flammatory cascades (2). Chronic alcohol abuse is a comorbid onstrate that chronic alcohol ingestion causes reduced GSH and variable associated with increased ARDS susceptibility (3). Spe- oxidant stress in the alveolar space leading to AM dysfunction by guest on September 28, 2021 cifically, the incidence of ARDS in alcoholic patients was 43%, (15). However, the specific mechanisms by which ethanol cause compared with 22% in nonalcoholic patients (4). Chronic alcohol AM dysfunction have yet to be clearly defined. ingestion predisposes patients to development of ARDS through Reactive oxygen species (ROS) mediate complex physiological multiple mechanisms, of which enhanced oxidative stress plays processes such as cell signaling and apoptosis (16, 17), and play a key role (5–8). Available evidence suggests that chronic alcohol critical roles in the pathogenesis of various diseases. NADPH consumption reduces levels of the critical antioxidant glutathione oxidases (Noxes) (18) within AMs are the main source of ROS (GSH) in bronchoalveolar lavage (BAL) fluid (9) and alveolar generation in the lungs under physiologic conditions (19). In AMs, macrophages (AMs) (10). Further, clinical and animal studies the primary ROS generated by Nox proteins is superoxide, a re- show that GSH depletion in the alveolar space is associated with active species that is essential to the respiratory burst involved in chronic oxidative stress and AM dysfunction (8, 10–12). AMs the killing of microbes after phagocytosis (18). play an important role in innate and acquired immunity (13) be- Nox proteins are multicomponent, membrane-associated en- cause of their ability to phagocytose and clear apoptotic cells and zymes that use NADPH as an electron donor to catalyze the re- duction of molecular oxygen to superoxide and hydrogen peroxide (20). Nox1 (21–23), Nox2 (21–23), and Nox4 (21–23) are ex- *Division of Neonatal–Perinatal Medicine, Department of Pediatrics, Emory Univer- pressed in the human lung. p22phox, a transmembrane subunit, † sity, Atlanta, GA 30322; and Department of Medicine, Atlanta Veterans Affairs and interacts with these active and inactive Noxes (24–26). Nox1 is Emory University Medical Centers, Decatur, GA 30033 primarily activated by interactions with the cytosolic subunits Received for publication May 3, 2011. Accepted for publication February 8, 2012. NoxO1, NoxA1, and GTP-Rac (27, 28). However, NoxO1 and This work was supported by National Institute of Alcohol Abuse and Alcoholism T32 Training Grant 5T32AA013528-08, the Emory Alcohol and Lung Biology Center NoxA1 can be replaced by p47phox and p67phox, respectively Grant 1P50AA135757, and Merit Review funding from the Atlanta Veterans’ Affairs (28, 29). Nox2 activation involves association with p47phox, Medical Center. p67phox, p40phox, and GTP-Rac (30), and is responsible for re- Address correspondence and reprint requests to Dr. Lou Ann S. Brown, Division spiratory burst in AMs (23). Nox4 associates with p22phox to pro- of Neonatal–Perinatal Medicine, Department of Pediatrics, Emory University, 2015 Uppergate Drive, Atlanta, GA 30322. E-mail address: [email protected] duce ROS (31) and has been implicated in various physiological processes, including cellular senescence (32), differentiation (33– Abbreviations used in this article: AM, alveolar macrophage; ARDS, acute respiratory distress syndrome; BAL, bronchoalveolar lavage; Con, control; DCFH-DA, 36), and oxygen sensing (37). Although Nox4 is constitutively 29,79-dichlorofluorescein-diacetate; EtOH, ethanol; GSH, glutathione; hAM, human active, its expression and/or activity can be increased through AM; mAM, mouse AM; Nox, NADPH oxidase; qRT-PCR, quantitative RT-PCR; RFU, relative fluorescence unit; ROS, reactive oxygen species; siRNA, small inter- several pathways, including angiotensin II binding to the angio- fering RNA; WT, wild-type. tensin II type 1 receptor, insulin activation of the insulin receptor, www.jimmunol.org/cgi/doi/10.4049/jimmunol.1101278 The Journal of Immunology 3649

TGF-b1 binding to the TGF-bR (20), and Poldip2 association with production in mAM or MH-S cells were determined using 29,79-dichlo- p22phox (38). In the human lung, Nox1, Nox2, and Nox4 con- rofluorescein-diacetate (DCFH-DA) dye as described previously (44). In stitute critical sources of ROS generation in response to ethanol brief, cells were incubated with 5 mM DCFH-DA in RPMI 1640 at 37˚C for 30 min in the dark and then washed with PBS three times to remove exposure in mouse embryos (39). Furthermore, chronic ethanol excess dye. Fluorescence was measured using FluoView (Olympus, Mel- exposure increased the expression of these Noxes in the mouse ville, NY) via quantitative digital analysis. ROS production values are 6 lung (23). Taken together, these findings suggest that Noxes may expressed as mean SEM, relative to average Con values. H2O2 released play an important role in ethanol-induced oxidative stress and into media collected from mAM or MH-S cells was determined using the Amplex Red assay (Invitrogen, Carlsbad, CA), according to the manu- pathogenesis of lung injury (23). facturer’s protocol. In brief, cells were incubated with 500 ml Amplex Red The objective of this study is to define the molecular mechanisms (20 mM) and HRP (0.1 U/ml) at 37˚C for 30 min. The reaction mixtures by which chronic alcohol ingestion mediates oxidant stress in AMs. were then measured for fluorescence in duplicate (excitation 540 nm, We hypothesize that chronic alcohol consumption augments oxi- emission 590 nm), and H2O2 concentrations were calculated using stan- dant stress in AMs through modulation of Nox expression. The dard curves generated with reagent H2O2. Cell cultures were then lysed in 100 ml cell lysis buffer and centrifuged at 12,000 rpm for 10 min. Su- investigations presented in this article demonstrate that ethanol pernatant protein concentrations were determined using a bicinchoninic induces Nox1 and Nox2 expression in the AM, which, in turn, acid assay. H2O2 concentrations were normalized to cellular protein con- enhance Nox4 expression, resulting in intracellular production of centrations and are expressed as mean 6 SEM, relative to average Con superoxide and hydrogen peroxide. values. RNA isolation and quantitative RT-PCR Materials and Methods mAMs were isolated from BAL fluid of Con and EtOH mice, and total RNA Downloaded from Mouse model of chronic ethanol consumption was extracted using TRIzol reagent (Invitrogen). Cultured MH-S and mAM cells were treated with or without ethanol (0.08%) for 3 d, followed by RNA All animal studies were performed in accordance with National Institutes of extraction. mRNA expression was determined and quantified using specific Health guidelines outlined in the Guide for the Care and Use of Laboratory mRNA primers given in Table I. Using the iScript One-Step RT-PCR kit Animals, as described in protocols reviewed and approved by the Emory with SYBR Green (Bio-Rad, Hercules, CA), real-time quantitative RT- University Institutional Animal Care and Use Committee. Male C57BL/6J PCR (qRT-PCR) of total RNA (100 ng) was performed using the Ap- mice (The Jackson Laboratory, Bar Harbor, ME), aged 8–10 wk, were plied Biosystems ABI Prism 7500 version 1.4 sequence detection system given either no ethanol or ethanol (5–20% w/v, starting at 5% and in- under the following conditions: cDNA synthesis at 50˚C for 10 min, iScript http://www.jimmunol.org/ creasing by 5% increments each week for 2 wk to help the animals ac- reverse transcriptase inactivation at 95˚C for 5 min, and PCR for 40 cycles climate to this intervention). Ethanol (EtOH)-fed mice then received 20% entailing 95˚C for 10 s, followed by annealing at 60˚C for 1 min and w/v for the following 10 wk in their drinking water (n = 5/group). This detection. Values are expressed as the relative expression of mRNA nor- method replicates blood alcohol levels after chronic ethanol consumption malized to 9s mRNA. in human subjects, as assessed by studies using pair-fed ethanol-treated female or male C57BL/6J or BALB/c mice (40, 41). Male Nox2 knockout Western blot analysis for MH-S cells (KO) mice (The Jackson Laboratory), generated as previously described on a C57BL/6J background (42), were fed ethanol using the same protocol. Proteins were isolated from MH-S cells using a cell lysis buffer consisting After sacrifice, tracheas from all mice were cannulated, and BAL fluid was of 2.5 mM EDTA, 20 mM Tris pH 7.4, 100 mM NaCl, 1 mM Na3VO4,1% collected via tracheotomy. Mouse AMs (mAMs) were then isolated from Triton X-100, 10 mM NaF, 1% sodium deoxycholate, 0.1% SDS, 2.5 mM the fluid by centrifugation at 8000 rpm for 5 min. The cell pellet was sodium pyrophosphate, 1 mM b-glycerol phosphate, and 1 tablet/10 ml by guest on September 28, 2021 resuspended in RPMI 1640 medium containing 2% FBS and 1% penicillin/ EDTA-free complete protease inhibitor mixture (Roche, Indianapolis, streptomycin. After staining with Diff-Quik (Dade Behring, Newark, DE) IN). Whole-cell extracts prepared from untreated and ethanol-treated and counting with a hemocytometer, the cell population was determined by MH-S cells (40 mg/lane) were resolved in 4–12% bis-Tris polyacryl- differential staining to be ∼95% AMs (15). The macrophages were then amide gels (Invitrogen), followed by transfer to nitrocellulose mem- plated overnight in RPMI 1640 medium containing 2% FBS and 1% branes. Membranes were probed with primary Abs for Nox1 (1:100; penicillin/streptomycin at 37˚C in 5% CO2 atmosphere, before beginning Santa Cruz Biotechnology, Santa Cruz, CA), Nox2 (1:1000; Abcam, experiments. Cambridge, MA), Nox4 (1:2500; gift from Dr. David Lambeth, Emory University), or GAPDH (Santa Cruz Biotechnology; 1:100). Proteins MH-S and mAM cell culture and ethanol stimulation were visualized by incubation with peroxidase-coupled anti-rabbit or anti-goat IgG (1:2000) in the presence of LumiGlo reagent while ex- The mAM cell line, MH-S (American Type Culture Collection, Manassas, posing in a Bio-Rad Chemidoc XRS/HQ. Densitometric analysis was VA), was used as a model system for studying effects of ethanol in vitro. performed using Bio-Rad Quantity One (version 4.5.0) software. Values Cells were cultured in RPMI 1640 media containing 10% FBS and 1% are expressed as the relative expression of protein normalized to GAPDH penicillin/streptomycin. Twenty-four hours after plating, MH-S cells were protein. cultured in media containing 2% FBS in a modular incubation chamber (Billups-Rothenberg, Del Mar, CA). Selected cells were treated with 0.08% Phagocytosis ethanol for 1–3 d as indicated. Selected cells were also treated with 300 mM apocynin (Sigma-Aldrich, St. Louis, MO), an inhibitor of cytosolic Phagocytic ability of MH-S cells treated with or without ethanol, in the p47phox translocation to the cell membrane (43), for the duration of presence or absence of apocynin, and mAMs treated with or without ethanol ethanol exposure. (0.08%) ex vivo for 3 d was assessed as previously described (15). In brief, mAMs isolated from wild-type (WT), Nox1 KO (The Jackson Labo- cells were incubated with 106 particles of pH-sensitive pHrodo S. aureus ratory), and Nox2 KO (gift from Dr. Kathy Griendling, Emory University) BioParticles conjugate (Invitrogen) for 2 h and then fixed with 4% para- were used to study the effects of ethanol exposure ex vivo. Cells were formaldehyde. Phagocytosis of bacteria and microbial killing by lysosomes cultured in RPMI 1640 media containing 5% FBS and 1% penicillin/ were analyzed using an Olympus confocal microscope containing an streptomycin. Twenty-four hours after plating, these mAMs were cul- argon/krypton laser. Cells from 10 fields per experimental condition were tured in media containing 2% FBS in a modular incubation chamber assessed using quantitative digital fluorescence imaging software (Olym- (Billups-Rothenberg). Selected cells were treated with 0.08% ethanol for pus FluoView 300, version 4.3). To measure S. aureus internalization, we 3 d or as indicated. These studies were also performed in accordance with performed laser confocal microscopy at 50% of cell depth using identical National Institutes of Health guidelines outlined in the Guide for the Care background and gain settings. MH-S cells with internalized bacteria were and Use of Laboratory Animals, as described in protocols reviewed and considered positive for phagocytosis. Phagocytosis was quantified by approved by the Emory University Institutional Animal Care and Use phagocytic index, which was calculated from the percentage of phagocytic Committee. cells multiplied by the relative fluorescence units (RFU) of S. aureus per cell. Estimation of cellular ROS production Confocal immunostaining of hAMs mAMs from control (Con) and EtOH mice, or untreated and ethanol-treated Alcoholic patients (n = 5) and nonalcoholic Con subjects (n = 5) were MH-S and mAM cells, were cultured in RPMI 1640 media containing recruited from the Substance Abuse Treatment Program at the Atlanta 2% FBS for 24 h, before the start of the experiment. Intracellular ROS Veterans Affairs Medical Center. The Short Michigan Alcoholism 3650 ETHANOL-INDUCED OXIDATIVE STRESS IN AMs

FIGURE 1. Ethanol-induced ROS generation in mAMs. In mAMs collected from Con and EtOH mice (n = 5, in duplicate), ROS production was measured by

DCFH-DA ﬂuorescence assay (A), and H2O2 generation was measured by Amplex Red assay (B). In cultured MH-S cells that were either untreated (None) or ethanol treated (EtOH, 0.08%) for 3 d (n = 3 independent experiments, in duplicate), ROS production (C) and H2O2 generation (D) were measured. H2O2 values were normalized to cellular protein concentration. All values are expressed as mean 6 SEM, relative to Con or no treatment. *p , 0.05, EtOH versus Con or None. Downloaded from

Screening Test questionnaire was administered to each patient, and those media, following the manufacturer’s recommendations. Con siRNA con- with a score of .3 were enrolled in the study. Other inclusion criteria were centrations were adjusted accordingly for comparison. For example, 20 nM daily or almost daily alcohol abuse, where the last alcoholic drink was Nox1 and Nox2 siRNA were compared with 20 nM Con siRNA, and 35 ,8 d before bronchoscopy. Patients were excluded if they primarily nM Nox4 siRNA was compared with 35 nM Con siRNA. However, be- http://www.jimmunol.org/ abused substances other than alcohol, currently had other medical prob- cause no significant difference was observed between 20 and 35 nM Con lems requiring ongoing active management (other than alcohol abuse), siRNA, these results were combined and are presented as a single siRNA were HIV+, were .55 y old, and had abnormal chest radiographs. Alco- value. Complete media containing 10% FBS with or without ethanol was holic patients were recruited and matched with healthy Con subjects for then added to the cells for 3 d. Nox1, Nox2, and Nox4 mRNA and protein age, race, sex, and smoking status. Before implementation, this project was levels in transiently transfected MH-S cells were measured using real-time reviewed and approved by both the Emory University Institutional Review PCR and Western blot analysis. Board and the Atlanta Veterans Affairs Medical Center Research and Development Committee. Statistical analysis Fiberoptic bronchoscopy was performed in Con and chronic alcoholic Data are represented as means 6 SEM. Statistical significance was calculated patients using topical anesthesia, and BAL was performed in the right using one-way ANOVA followed by Tukey–Kramer test to detect differences middle lobe, as previously described (45). Sterile saline (150 ml) was by guest on September 28, 2021 between individual groups using GraphPad Prism version 5 (GraphPad, San suffused and withdrawn by suction in three 50-ml aliquots. The BAL fluid Diego, CA). A p value ,0.05 was considered statistically significant. was passed through sterile gauze and centrifuged at 8000 rpm for 5 min. The cell pellet of AMs (purity of AMs ∼90% as measured by Diff-Quik [Dade Behring] staining and cell counting) (15) was resuspended in RPMI Results 1640 medium containing 2% FBS and 1% penicillin/streptomycin and Chronic alcohol exposure increased ROS generation in mAMs cultured for 24 h. Total RNA was isolated from these hAMs, and mRNA expression was determined and quantified using specific mRNA primers in vivo and in vitro for Nox1, Nox2, and Nox4, given as homologous mouse and human mAMs were isolated from Con and EtOH mice (20% w/v ethanol sequences in Table I, as described earlier. Selected hAMs cells were fixed to chamber slides with 4% paraformaldehyde. Cells were incubated with for 12 wk) to evaluate the effects of ethanol on AM oxidative stress primary Abs for Nox1 (1:100; Santa Cruz Biotechnology), Nox2 (1:100; in vivo. For in vitro experiments, MH-S cells were treated with or Abcam), and Nox4 (1:100; Santa Cruz Biotechnology), followed by in- without ethanol (0.08%) for 3 d. In both in vivo and in vitro cubation with fluorescent TRITC-labeled secondary Abs. Fluorescence experiments, AM oxidative stress was determined in response to was measured using FluoView (Olympus) via quantitative digital analysis. ethanol using DCFH-DA fluorescence to measure ROS production Values are expressed as mean 6 SEM RFU per cell. and Amplex Red to determine hydrogen peroxide generation. ROS Transient transfection of MH-S cells production by AMs from EtOH mice increased by 4.7-fold (Con = 3.2 3 105 RFU and EtOH = 1.5 3 106 RFU; Fig. 1A) and hydro- Expression of Nox1, Nox2, or Nox4 was attenuated using respective small gen peroxide generation by 3.9-fold (Con = 1.2 mM and EtOH = interfering RNAs (siRNAs) or Con siRNA (Qiagen, Valencia, CA). At ∼50% confluence, MH-S cells were incubated with the transfection re- 4.6 mM; Fig. 1B), compared with AM Con animals. Similarly, agent, Gene Silencer (Genlantis, San Diego, CA), and Nox1 (20 nM), compared with untreated MH-S cells, ethanol-stimulated cells ex- Nox2 (20 nM), or Nox4 siRNAs (35 nM) for 4 h in serum-free RPMI 1640 hibited increased generation of ROS by 1.8-fold (none = 4.4 3

Table I. Mouse and human primer sequences to measure mRNA expression using qRT-PCR

Primer Forward Sequence (59-39) Reverse Sequence (59-39) Nox1 CGCTCCCAGCAGAAGGTCGTGATTACCAAG GGAGTGACCCCAATCCCTGCCCCAACCA Nox2 GTCACACCCTTCGCATCCATTCTCAAGTCAGT CTGAGACTCATCCCAGCCAGTGAGGTAG Nox4 CTGGAGGAGCTGGCTCGCCAACGAAG GTGATCATGAGGAATAGCACCACCACCATGCAG p22phox AACGAGCAGGCGCTGGCGTCCG CACAGTGGTATTTCGGCGCC p47phox CCAGCACTATGTGTACATGT AAGGAGATGTTCCCCATTGA p67phox GCCTTCTGGTAAGCACCTAA GAGGCCTTCAGCGAGGTGCA 9s GAGCTAGCCTCTGCCAGAGG TCCAAGCCTCAAGACAGGAA The Journal of Immunology 3651

105 RFU and EtOH = 0.8 3 106 RFU; Fig. 1C) and hydrogen Furthermore, in mAMs treated with ethanol ex vivo, Nox1 and peroxide by 2.8-fold (none = 1.1 mM and EtOH = 3.1 mM) (Fig. Nox2 mRNA expression also increased after 6 h and Nox4 mRNA 1D). These ﬁndings indicated that ethanol stimulated ROS gen- levels increased after 12 h (Fig. 3B). These results suggested that eration in mAMs both in vivo and in vitro. ethanol-induced Nox1 and/or Nox2 induction could contribute to Nox4 induction. Although our data demonstrate that ethanol ex- Chronic ethanol exposure increased Nox expression posure for 12 h was sufﬁcient to increase Nox expression, subse- Because previous studies showed that Noxes are major producers quent studies were performed using ethanol exposure for 3 d to of ROS (20), we determined the expression of AM Nox subunits more accurately model prolonged exposure to increased levels of (Table I) after ethanol treatment. Compared with AMs isolated alcohol in patients with a history of chronic alcohol abuse. from Con mice, AMs isolated from EtOH mice exhibited in- To investigate potential interrelationships among Nox1, Nox2, creased mRNA expression levels of Nox1 (3.8-fold), Nox2 (5.6- and Nox4, we treated MH-S cells with and without 300 mM fold), Nox4 (4.1-fold), p22phox (3.2-fold), p47phox (2.5-fold), apocynin. In Con MH-S cells, apocynin attenuated mRNA ex- and p67phox (2.8-fold; Fig. 2A). As shown in Fig. 2B, similar pression of Nox1, Nox2, and Nox4 (Fig. 3C). However, this did results were seen in ethanol-treated MH-S cells, where ethanol not result in decreased protein expression in Nox1, Nox2, or increased the mRNA expression of Nox1 (3.0-fold), Nox2 (5.5- Nox4 during the 3-d culture period (Fig. 3D). In the ethanol 6 fold), Nox4 (6.4-fold), and p22phox (7.0-fold), as well as the apocynin group, apocynin inhibits Nox1 and Nox2 complex for- regulatory subunits of Nox1 and Nox2, p47phox (4.8-fold), and mation by impairing cytosolic p47phox translocation to the cell p67phox (4.9-fold). As shown in Fig. 2C, ethanol-induced in- membrane (43). As shown in Fig. 3C, apocynin attenuated creases in Nox mRNA expression were associated with similar ethanol-induced mRNA expression of Nox1 by 82 6 8.6%, Nox2 Downloaded from increases in protein levels. Ethanol also increased Nox1, Nox2, and by 89 6 5.6%, and Nox4 by 78 6 4.9%. Apocynin treatment also more dramatically, Nox4 protein levels in ethanol-treated MH-S abrogated ethanol-mediated increases in Nox1, Nox2, and Nox4 cells (Fig. 2C). Collectively, these data indicated that chronic protein levels (Fig. 3D). Treatment with apocynin additionally at- ethanol exposure enhanced Nox mRNA and protein expression in tenuated ethanol-induced ROS production completely, as measured mAMs, and highlights a mechanism by which ethanol contributed by DCFH-DA analysis (Fig. 3E), and reduced hydrogen peroxide

to increased ROS and oxidative stress in AM. generationby846 1.4%, as measured by Amplex Red assay (Fig. http://www.jimmunol.org/ 3F). Further, apocynin treatment completely reversed ethanol- Apocynin inhibited ethanol-induced Nox expression, oxidative mediated AM dysfunction (Fig. 3G) to rescue phagocytic ability. stress, and AM dysfunction in vitro To further examine potential interrelationships between ethanol- Nox1 and Nox2 participate in ethanol-mediated Nox4 induced alterations in Nox subunits, time-course studies after expression ethanol stimulation were performed. The mRNA expression of Because apocynin treatment inhibits both Nox1 and Nox2 through Nox1 and Nox2 in MH-S cells increased after 6 h of ethanol ex- regulation of their p47phox subunit, we used an siRNA silencing posure, whereas Nox4 mRNA levels increased after 12 h (Fig. 3A). approach to determine which Nox protein may be speciﬁcally by guest on September 28, 2021

FIGURE 2. Ethanol-induced Nox mRNA and protein expression levels in vivo and in vitro. (A) mAMs were collected from Con and EtOH mice. mRNA levels of Nox1, Nox2, Nox4, p22phox, p47phox, and p67phox in these mAMs were measured (n = 5). (B) Cultured MH-S cells were either untreated (None) or ethanol treated (EtOH, 0.08%) for 3 d. mRNA levels of Nox1, Nox2, Nox4, p22phox, p47phox, and p67phox in these MH-S cells were measured (n =3 independent experiments). All mRNA values were measured by qRT-PCR, normalized to 9s mRNA, and expressed as mean 6 SEM, relative to no treatment or Con. (C) Protein expression of Nox1, Nox2, and Nox4 in cultured MH-S cells either untreated (None) or ethanol treated (EtOH, 0.08%) for 3 d. Protein values in these MH-S cells were assessed by Western blotting and densitometric analysis, normalized to GAPDH protein levels (n = 3 independent experiments), and expressed as mean 6 SEM, relative to no treatment. *p , 0.05, EtOH versus Con or None. 3652 ETHANOL-INDUCED OXIDATIVE STRESS IN AMs Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 3. Ethanol mediated Nox4 expression and ROS generation in MH-S cells via regulation of Nox1 and Nox2. Cultured MH-S cells were either untreated (None) or ethanol treated (EtOH, 0.08%) for 3 d or for the indicated durations. (A) Time course of Nox1, Nox2, and Nox4 mRNA expression in these MH-S cells treated with ethanol for 2, 6, 12, or 24 h (n = 3 independent experiments). *p , 0.05, EtOH versus none. (B) Time course Nox1, Nox2, and Nox4 mRNA expression in mAMs treated ex vivo without (Con) or with ethanol (EtOH, 0.08%) for 6, 12, 24, 48, or 72 h (n = 3 independent experiments). *p , 0.05, EtOH versus Con. Where indicated, cultured MH-S cells were treated with 300 mM apocynin (Apo) for 3 d, with or without ethanol exposure. Nox1, Nox2, and Nox4 mRNA (C) and protein (D) levels were measured in these MH-S cells (n = 3–9 independent experiments). mRNA levels were measured by qRT-PCR analysis and normalized to 9s mRNA. #p , 0.05, none+Apo versus none; *p , 0.05, EtOH versus none; +p , 0.05, EtOH+Apo versus EtOH. Protein levels were measured by Western blotting analysis and normalized to GAPDH protein levels. (E) ROS production was measured by DCFH-DA fluorescence assay (n = 3 independent experiments, in duplicate). (F)H2O2 generation was measured by Amplex Red assay (n =3 independent experiments, in duplicate). H2O2 values were normalized to cellular protein concentration. (G) Phagocytic ability was assessed by phagocytosis assay (n = 3 independent experiments, 10 fields per experimental condition). Phagocytic index was calculated from the percentage of phagocytic cells multiplied by the RFU of S. aureus per cell. All values are expressed as mean 6 SEM, relative to no treatment. *p , 0.05, EtOH versus none; +p , 0.05, EtOH+Apo versus EtOH. responsible for regulating Nox4 expression. MH-S cells transfected demonstrated reduced levels of Nox1, Nox2, and Nox4 mRNA with Nox1 siRNA had reduced basal and ethanol-induced levels of expression (Fig. 4C). MH-S cells transfected with Nox4 siRNA Nox1 and Nox4 mRNA, whereas Nox2 mRNA expression was had reduced basal and ethanol-induced Nox4 mRNA levels, unaffected (Fig. 4A). Similarly, cells transfected with Nox2 siRNA whereas Nox1 and Nox2 levels were not altered (Fig. 4D). exhibited diminished basal and ethanol-induced levels of Nox2 As shown in Fig. 5A–C, the effects of these siRNAs on ethanol- and Nox4 mRNA, whereas Nox1 mRNA expression was unaf- induced Nox mRNA expression were reflected in the protein levels fected (Fig. 4B). Cells transfected with Nox1 plus Nox2 siRNAs of ethanol-treated MH-S cells. Ethanol-induced Nox1 protein levels The Journal of Immunology 3653 Downloaded from

FIGURE 4. Ethanol mediated Nox4 mRNA expression in MH-S cells via upregulation of Nox1 and Nox2. Cultured MH-S cells were either untreated (N) or ethanol treated (E, 0.08%) for 3 d. mRNA was isolated, and Nox1, Nox2, and Nox4 mRNA levels were measured in Nox1 siRNA transfected cells (A), Nox2 siRNA transfected cells (B), Nox1+Nox2 siRNA cotransfected cells (C), and Nox4 siRNA transfected cells (D) by qRT-PCR and normalized to 9s mRNA (n = 3–6 independent experiments). #p , 0.05, N+siRNA versus N; *p , 0.05, E versus N; +p , 0.05, E+siRNA versus E.

were completely attenuated with Nox1 siRNA (112 6 9.4%) and expressions in hAMs (Table I). As shown in Fig. 7, compared with http://www.jimmunol.org/ Nox1+Nox2 siRNAs (126 6 11.1%), but were unaffected by Nox2 Cons, AMs from chronic alcoholic patients show increased Nox1, and Nox4 siRNAs (Fig. 5A). Ethanol-mediated Nox2 protein levels Nox2, and Nox4 mRNA levels (Fig. 7A), as measured by qRT- were abrogated with Nox2 siRNA (84 6 10.5%) and Nox1+Nox2 PCR, and protein levels (Fig. 7B, 7C), as measured by computer siRNAs (123 6 11%), but were unchanged by Nox1 and Nox4 analysis of confocal microscopic images. These data suggested siRNAs (Fig. 5B). As shown in Fig. 5C, Nox4 protein levels aug- that the mechanisms of ethanol-induced oxidative stress eluci- mented by ethanol were reduced with siRNAs for Nox1, Nox2, dated in mAMs may be similar in hAMs. Nox1+Nox2, and Nox4. In vivo, a similar effect was seen in mAMs from commercially available (The Jackson Laboratory) Nox2 KO by guest on September 28, 2021 mice (Fig. 5D). Compared with Con WT mice, Con Nox2 KO mice Discussion showed reduced Nox4 expression in their AMs. Furthermore, AMs Chronic alcohol abuse is a comorbid variable associated with in- from EtOH Nox2 KO mice showed diminished Nox4 expression creased risk for ARDS and respiratory infections (3). AMs are compared with EtOH WT mice. Taken together, these results sug- critical to innate and acquired immunity (13) because of their gested that ethanol-induced Nox4 expression in mAMs occurred ability to clear apoptotic cells and infectious particles from the through upregulation of Nox1 and Nox2 expression. lung by phagocytosis and respiratory burst (14). Chronic ethanol exposure impairs AM function (11) through mechanisms that re- Nox1, Nox2, and Nox4 modulated ethanol-induced oxidative main to be defined and that may involve ethanol-induced oxidative stress stress (15). One potential mechanism for alcohol-induced oxida- Previous studies have shown that Nox1 and Nox2 produce su- tive stress is upregulation of the Nox family of proteins that peroxide anions (46, 47) and Nox4 generates hydrogen peroxide comprise multicomponent, membrane-associated Nox enzymes (48). As we have shown that ethanol increased Nox expression, we that generate ROS (20). Previous studies showed that, in whole evaluated the contributions of Nox1, Nox2, and Nox4 to ethanol- lung tissue, chronic ethanol ingestion increased the expression of mediated cellular oxidative stress. Using siRNAs for Nox1, Nox2, Nox2, the classical phagocytic oxidase essential for ROS gener- Nox1+Nox2, and Nox4 transfected MH-S cells, ethanol (0.08%) ation during respiratory burst (23). Although it is not involved in treatment for 3 d showed attenuation of ROS production, as the respiratory burst, Nox4, a constitutively active isoform that measured by DCFH-DA analysis (Fig. 6A), and hydrogen per- generates ROS, was similarly increased in the lung tissue of EtOH oxide generation (Fig. 6B), as measured by Amplex Red assay mice. Under physiological conditions, the primary sources of ROS when compared with MH-S cells transfected with Con siRNA. generation in AMs are the Noxes (18, 19). Nox1 (22), Nox2 (23), Furthermore, mAMs isolated from WT, Nox1 KO, or Nox2 KO and Nox4 (21) are expressed in the lung. Because Nox proteins are animals were treated with ethanol (0.08%) ex vivo for 3 d. central to the clearance of microbes through respiratory burst, it is Ethanol-induced ROS production (Fig. 6C), hydrogen peroxide important to understand how chronic ethanol ingestion alters the generation (Fig. 6D), and impaired phagocytic ability (Fig. 6E) were expression of Nox isoforms and their generation of ROS. attenuated in AMs from KO compared with WT mice. Collectively, Our studies showed that chronic ethanol increased oxidative these results indicated that ethanol, by upregulating Nox1, Nox2, stress in mAMs in vivo and in vitro through upregulation of Nox and Nox4, induced oxidative stress and dysfunction in mAMs. mRNA and protein expression. In our animal model, chronic ethanol ingestion also upregulated p22phox, a regulatory protein Chronic ethanol ingestion induced expression of Nox enzymes for Nox1, Nox2, and Nox4, as well as p47phox and p67phox, in human AMs regulatory proteins for Nox1 and Nox2, in mAMs. Our data also Because ethanol increased Nox enzyme expression in mAMs demonstrated in MH-S cells and mAMs that ethanol increased in vivo and in vitro, we determined the effects of ethanol on Nox Nox1, Nox2, and Nox4 mRNA expression in a time-dependent 3654 ETHANOL-INDUCED OXIDATIVE STRESS IN AMs Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021 FIGURE 5. Ethanol induced Nox4 protein expression in vitro and in vivo via upregulation of Nox1 and Nox2. MH-S cells were transfected with Con siRNA or siRNAs for Nox1, Nox2, Nox1+Nox2, or Nox4, and then cultured for 3 d with ethanol (EtOH, 0.08%) or without ethanol. Protein was isolated, and protein levels of Nox1 (A), Nox2 (B), and Nox4 (C) were determined by Western blotting analysis and normalized to GAPDH protein levels (n =3 independent experiments). *p , 0.05, EtOH versus none; +p , 0.05, EtOH+siRNA versus EtOH. (D) mAMs were collected from WT and Nox2 KO mice that were either Con or EtOH. Expression of Nox4 was measured by computer analysis of confocal fluorescence microscopic images (n = 5). Fluorescence values are expressed as mean RFU per cell 6 SEM, relative to Con. #p , 0.05, Con-Nox2-KO versus Con-Nox2-WT; *p , 0.05, EtOH-Nox2-WT versus Con-Nox2-WT; +p , 0.05, EtOH+Nox2-KO versus EtOH-Nox2-WT. manner. Although chronic ethanol exposure increased Nox ex- further ROS generation (52). Hypoxia upregulates Nox1 and pression in AMs, the mechanisms responsible for this increase activates hypoxia-inducible factor-1 through increased ROS (22). remain unclear. Previous studies from our laboratories have found The Nox1 promoter also contains an AP-1 binding site that is that chronic ethanol ingestion significantly attenuated antioxidant essential for its activity (53). LPS/IFN-g–induced ROS in mono- GSH levels in lung tissue and BAL fluid (5–8), and augmented cytes upregulated the redox-sensitive transcription factor NF-kB superoxide generation in lung tissue (23). In addition, ethanol has to activate Nox2 expression (54). Studies show that ROS gener- been shown to enhance angiotensin II activity (49), which sub- ated by thrombin-activated Nox4 induces NF-kB and hypoxia- sequently upregulates Nox expression (50). Recent studies suggest inducible factor-1 (55). Furthermore, the promoter of Nox4 con- that chronic ethanol ingestion upregulates TGF-b1 expression tains response elements for several oxidative stress-related tran- (51), which has been implicated in the regulation of Nox4 (20). scription factors, such as peroxisome proliferator-activated recep- Further studies are warranted to elucidate the molecular mecha- tor, forkhead domain factor, hypoxia-inducible factor-1, nuclear nisms involved in ethanol-mediated Nox expression, as well as its respiratory factor-1, and NF-kB (56). Collectively, these studies role in promoting AM oxidative stress. suggest that alcohol-induced oxidative stress may stimulate that Previous studies demonstrated that treating rats chronically fed activity of redox-regulated transcription factors that promotes in- ethanol with precursors to the antioxidant GSH (procysteine or N- creased expression of Nox subunits. Although our studies show acetylcysteine) normalized oxidative stress in the epithelial lining that chronic ethanol ingestion increased oxidative stress in mAMs fluid and in AMs, and restored phagocytic function (10, 11), im- in vivo and in vitro through upregulation of Nox enzymes, the plicating alcohol-induced oxidative stress in AM dysfunction. specific mechanisms by which ROS generation upregulates Nox Future studies will focus on the capacity of GSH precursors or expression remain unknown. antioxidant treatments to attenuate alcohol-induced AM oxidative In this article, our data demonstrated that apocynin attenuated stress in MH-S cells. Recent ischemia-reperfusion studies suggest ethanol-induced oxidative stress in addition to Nox1 and Nox2 that oxidative stress can be involved in a positive feedback loop of expression; however, how apocynin inhibited ethanol-induced The Journal of Immunology 3655 Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 6. Oxidative stress in ethanol-exposed MH-S and mAM cells was regulated by Nox1, Nox2, and Nox4 expression. MH-S cells were transfected with Con siRNA (20 and 35 nM) or siRNAs for Nox1 (20 nM), Nox2 (20 nM), Nox1+Nox2, or Nox4 (35 nM), and then cultured for 3 d with (EtOH) or without ethanol. Con siRNA concentrations were adjusted accordingly for comparison, combined, and presented as a single Con siRNA value. (A)ROS production in transfected MH-S cells was measured by DCFH-DA fluorescence assay (n = 3 independent experiments, in duplicate). (B)H2O2 generation in transfected MH-S cells was measured by Amplex Red assay (n = 3 independent experiments, in duplicate). H2O2 generation values were normalized to protein concentration. mAMs were isolated from WT, Nox1 KO, and Nox2 KO, and cultured for 3 d with ethanol (EtOH) or without ethanol (Con). (C)ROS production in these mAMs was measured by DCFH-DA fluorescence assay (n = 3 independent experiments, in duplicate). (D)H2O2 generation in these mAMs was measured by Amplex Red assay and normalized to protein concentration (n = 3 independent experiments, in duplicate). (E) Phagocytic ability was assessed in these mAMs by phagocytosis assay (n = 3 independent experiments, 10 fields per experimental condition). Phagocytic index was calculated from the percentage of phagocytic cells multiplied by the RFU of S. aureus per cell. All values are expressed as mean 6 SEM, relative to no treatment. #p , 0.05, no treatment+siRNA versus no treatment+Con siRNA; *p , 0.05, EtOH+Con siRNA versus no treatment+Con siRNA or WT+EtOH versus WT+Con; +p , 0.05, EtOH+siRNA versus EtOH+Con siRNA or Nox1/Nox2 KO+EtOH versus WT+EtOH.

Nox1 and Nox2 mRNA expression in AMs is unclear. Apocynin is ity to reduce ROS. Further studies are necessary to elucidate the a commonly used pharmacological inhibitor of Nox1 and Nox2 mechanisms by which apocynin can attenuate ROS. complex formation through prevention of p47phox cytosolic Our experiments using apocynin were confirmed by siRNAs for translocation to the membrane (43). However, recent studies Nox1 and Nox2 to account for apocynin’s nonspecific functions. suggest that apocynin may act as an antioxidant in endothelial Experiments with apocynin and siRNAs for Nox1, Nox2, as well cells and smooth muscle cells, rather than specifically inhibiting as Nox1 plus Nox2 reduced ethanol-induced Nox4 expression and Nox (57). If apocynin can reduce ethanol-induced ROS in AMs, it oxidative stress in AMs. Our data showed that Nox1 or Nox2 may lead to subsequent downregulation of Nox1 and Nox2 mRNA induce Nox4, so silencing of Nox1, Nox2, or Nox4 has similar expression. In addition, apocynin may affect other regulators of effects on hydrogen peroxide generation. Further, in AMs isolated Nox expression, such as p38 MAPK, Akt, and ERK1/2 (57). Our from Nox1 KO or Nox2 KO mice, ROS production and AM studies show that apocynin treatment can reverse ethanol-medi- dysfunction caused by ex vivo treatment with ethanol was atten- ated AM dysfunction, which may be an effect of apocynin’s abil- uated. Taken together, these data suggested that the ethanol- 3656 ETHANOL-INDUCED OXIDATIVE STRESS IN AMs

of Nox1 or Nox2, and to subsequently promote oxidative stress. These studies suggest that strategies to reduce alcohol-mediated increases in AM Nox expression and activity may provide a novel therapeutic approach for attenuating ethanol-induced AM oxidative stress and dysfunction, resulting in reduced susceptibility to lung infection and injury.

Acknowledgments We thank members of the clinical core of the Emory Alcohol and Lung Biology Center, Dr. Ashish Mehta, Dr. Annette Esper, and Amy Anderson, for recruiting and enrolling patients for BAL collection in this study.

Disclosures The authors have no ﬁnancial conﬂicts of interest.

References

1. Erickson, S. E., G. S. Martin, J. L. Davis, M. A. Matthay, and M. D. Eisner; NIH Downloaded from NHLBI ARDS Network. 2009. Recent trends in acute lung injury mortality: 1996-2005. Crit. Care Med. 37: 1574–1579. 2. Ware, L. B., and M. A. Matthay. 2000. The acute respiratory distress syndrome. N. Engl. J. Med. 342: 1334–1349. 3. Moss, M., P. E. Parsons, K. P. Steinberg, L. D. Hudson, D. M. Guidot, E. L. Burnham, S. Eaton, and G. A. Cotsonis. 2003. Chronic alcohol abuse is FIGURE 7. Ethanol enhanced Nox expression levels in human AMs associated with an increased incidence of acute respiratory distress syndrome and severity of multiple organ dysfunction in patients with septic shock. Crit. http://www.jimmunol.org/ (hAMs). hAMs were collected from Con (control, n = 5) and chronic al- Care Med. 31: 869–877. coholic patients (alcoholic, n = 5). (A) mRNA expression levels of Nox1, 4. Moss, M., B. Bucher, F. A. Moore, E. E. Moore, and P. E. Parsons. 1996. The Nox2, and Nox4 were measured by qRT-PCR and normalized to 9s mRNA role of chronic alcohol abuse in the development of acute respiratory distress (n = 10). (B) Protein expression levels of Nox1, Nox2, and Nox4 were syndrome in adults. JAMA 275: 50–54. 5. Brown, L. A., F. L. Harris, R. Bechara, and D. M. Guidot. 2001. Effect of chronic measured using computer analysis of confocal fluorescence microscopic ethanol ingestion on alveolar type II cell: glutathione and inflammatory images (original magnification 360) (n = 10). (C) Quantification of fluo- mediator-induced apoptosis. Alcohol. Clin. Exp. Res. 25: 1078–1085. rescence images of Nox1, Nox2, and Nox4 protein levels. Fluorescence 6. Guidot, D. M., K. Modelska, M. Lois, L. Jain, I. M. Moss, J. F. Pittet, and values are normalized to DAPI nuclear stain and are expressed as mean L. A. Brown. 2000. Ethanol ingestion via glutathione depletion impairs alveolar 6 , epithelial barrier function in rats. Am. J. Physiol. Lung Cell. Mol. Physiol. 279: RFU per cell SEM. *p 0.05, Alcoholic versus Con. L127–L135. 7. Guidot, D. M., and L. A. Brown. 2000. Mitochondrial glutathione replacement by guest on September 28, 2021 restores surfactant synthesis and secretion in alveolar epithelial cells of ethanol- mediated increase in AM Nox4 expression, oxidative stress, and fed rats. Alcohol. Clin. Exp. Res. 24: 1070–1076. dysfunction were secondary to increased Nox1 and Nox2. We also 8. Holguin, F., I. Moss, L. A. Brown, and D. M. Guidot. 1998. Chronic ethanol ingestion impairs alveolar type II cell glutathione homeostasis and function and demonstrated that the expression levels of Nox1, Nox2, and Nox4 predisposes to endotoxin-mediated acute edematous lung injury in rats. J. Clin. were increased in human AMs isolated from alcoholics compared Invest. 101: 761–768. 9. Moss, M., D. M. Guidot, M. Wong-Lambertina, T. Ten Hoor, R. L. Perez, and with healthy Cons. However, further studies are necessary to de- L. A. Brown. 2000. The effects of chronic alcohol abuse on pulmonary gluta- termine whether Nox1 or Nox2 expression drives Nox4 expression thione homeostasis. Am. J. Respir. Crit. Care Med. 161: 414–419. in the human AMs. 10. Brown, L. A., X. D. Ping, F. L. Harris, and T. W. Gauthier. 2007. Glutathione availability modulates alveolar macrophage function in the chronic ethanol-fed Nox1 and Nox2 play important roles in producing ROS (58). rat. Am. J. Physiol. Lung Cell. Mol. Physiol. 292: L824–L832. ROS increase TGF-b1 expression (59), which upregulates Nox4 11. Brown, L. A., F. L. Harris, X. D. Ping, and T. W. Gauthier. 2004. Chronic ethanol expression (20) through a Smad binding site in the Nox4 promoter. ingestion and the risk of acute lung injury: a role for glutathione availability? Alcohol 33: 191–197. ROS also activate redox-sensitive transcription factors, such as NF- 12. Yeh, M. Y., E. L. Burnham, M. Moss, and L. A. Brown. 2007. Chronic alco- kB, that bind to and activate the Nox4 promoter to increase Nox4 holism alters systemic and pulmonary glutathione redox status. Am. J. Respir. Crit. Care Med. 176: 270–276. expression (56). Based on these reports, we speculate that ROS 13. Trapnell, B. C., and J. A. Whitsett. 2002. Gm-CSF regulates pulmonary sur- produced by Nox1 and Nox2 increase TGF-b1 and NF-kB sig- factant homeostasis and alveolar macrophage-mediated innate host defense. naling pathways to promote Nox4 expression. A more detailed Annu. Rev. Physiol. 64: 775–802. 14. Lundahl, J., G. Halldeń, and C. M. Sko¨ld. 1996. Human blood monocytes, but examination of these pathways constitutes a focus of current not alveolar macrophages, reveal increased CD11b/CD18 expression and adhe- studies in our laboratories. Regardless of the mechanisms involved, sion properties upon receptor-dependent activation. Eur. Respir. J. 9: 1188–1194. however, our study provides novel evidence of ethanol-induced 15. Brown, S. D., T. W. Gauthier, and L. A. Brown. 2009. Impaired terminal differentiation of pulmonary macrophages in a Guinea pig model of chronic ethanol Nox4 expression in AMs through upregulation of Nox1 and Nox2. ingestion. Alcohol. Clin. Exp. Res. 33: 1782–1793. In summary, chronic ethanol ingestion increased AM oxidative 16. Thannickal, V. J., and B. L. Fanburg. 2000. Reactive oxygen species in cell signaling. Am. J. Physiol. Lung Cell. Mol. Physiol. 279: L1005–L1028. stress through upregulation of Nox1, Nox2, and Nox4. Apocynin 17. Fleury, C., B. Mignotte, and J. L. Vayssie`re. 2002. Mitochondrial reactive ox- experiments showed that Nox1 and Nox2 complex formation, ygen species in cell death signaling. Biochimie 84: 131–141. involving p47phox, is required for Nox4 expression. Silencing 18. Forman, H. J., and M. Torres. 2002. Reactive oxygen species and cell signaling: respiratory burst in macrophage signaling. Am. J. Respir. Crit. Care Med. 166: experiments using siRNAs for Nox1 and Nox2 further demon- S4–S8. strated that Nox1 and Nox2 are required for Nox4 expression and 19. Piotrowski, W. J., and J. Marczak. 2000. Cellular sources of oxidants in the lung. ethanol-mediated oxidative stress. Nox1 and Nox2 KO experiments Int. J. Occup. Med. Environ. Health 13: 369–385. 20. Brown, D. I., and K. K. Griendling. 2009. Nox proteins in signal transduction. showed that either Nox1 or Nox2 is required for ethanol-induced Free Radic. Biol. Med. 47: 1239–1253. AM oxidative stress and dysfunction. To our knowledge, this is the 21. Mittal, M., M. Roth, P. Ko¨nig, S. Hofmann, E. Dony, P. Goyal, A. C. Selbitz, R. T. Schermuly, H. A. Ghofrani, G. Kwapiszewska, et al. 2007. Hypoxia- first report of ethanol’s ability to induce Nox1 and Nox2 expres- dependent regulation of nonphagocytic NADPH oxidase subunit NOX4 in the sion in AMs, to increase Nox4 expression via increased expression pulmonary vasculature. Circ. Res. 101: 258–267. The Journal of Immunology 3657

22. Goyal, P., N. Weissmann, F. Grimminger, C. Hegel, L. Bader, F. Rose, L. Fink, 41. Song, K., R. A. Coleman, X. Zhu, C. Alber, Z. K. Ballas, T. J. Waldschmidt, and H. A. Ghofrani, R. T. Schermuly, H. H. Schmidt, et al. 2004. Upregulation of R. T. Cook. 2002. Chronic ethanol consumption by mice results in activated NAD(P)H oxidase 1 in hypoxia activates hypoxia-inducible factor 1 via increase splenic T cells. J. Leukoc. Biol. 72: 1109–1116. in reactive oxygen species. Free Radic. Biol. Med. 36: 1279–1288. 42. Pollock, J. D., D. A. Williams, M. A. Gifford, L. L. Li, X. Du, J. Fisherman, 23. Polikandriotis, J. A., H. L. Rupnow, S. C. Elms, R. E. Clempus, D. J. Campbell, S. H. Orkin, C. M. Doerschuk, and M. C. Dinauer. 1995. Mouse model of R. L. Sutliff, L. A. Brown, D. M. Guidot, and C. M. Hart. 2006. Chronic ethanol X-linked chronic granulomatous disease, an inherited defect in phagocyte su- ingestion increases superoxide production and NADPH oxidase expression in the peroxide production. Nat. Genet. 9: 202–209. lung. Am. J. Respir. Cell Mol. Biol. 34: 314–319. 43. Lemarie, A., E. Bourdonnay, C. Morzadec, O. Fardel, and L. Vernhet. 2008. 24. Ambasta, R. K., P. Kumar, K. K. Griendling, H. H. Schmidt, R. Busse, and Inorganic arsenic activates reduced NADPH oxidase in human primary macro- R. P. Brandes. 2004. Direct interaction of the novel Nox proteins with p22phox is phages through a Rho kinase/p38 kinase pathway. J. Immunol. 180: 6010–6017. required for the formation of a functionally active NADPH oxidase. J. Biol. 44. Patel, N., C. S. Gonsalves, M. Yang, P. Malik, and V. K. Kalra. 2009. Placenta Chem. 279: 45935–45941. growth factor induces 5-lipoxygenase-activating protein to increase leukotriene 25. Hanna, I. R., L. L. Hilenski, A. Dikalova, Y. Taniyama, S. Dikalov, A. Lyle, formation in sickle cell disease. Blood 113: 1129–1138. M. T. Quinn, B. Lasse`gue, and K. K. Griendling. 2004. Functional association of 45. Perez, R. L., A. P. Kimani, T. E. King, Jr., S. M. Aguayo, and J. Roman; Emory nox1 with p22phox in vascular smooth muscle cells. Free Radic. Biol. Med. 37: Interstitial Lung Disease Center. 2007. Bronchoalveolar lavage fluid D dimer 1542–1549. levels are higher and more prevalent in black patients with pulmonary sarcoid- 26. Kawahara, T., D. Ritsick, G. Cheng, and J. D. Lambeth. 2005. Point mutations in osis. Respiration 74: 297–303. the proline-rich region of p22phox are dominant inhibitors of Nox1- and Nox2- 46. Kim, Y. M., T. J. Guzik, Y. H. Zhang, M. H. Zhang, H. Kattach, C. Ratnatunga, dependent reactive oxygen generation. J. Biol. Chem. 280: 31859–31869. R. Pillai, K. M. Channon, and B. Casadei. 2005. A myocardial Nox2 containing 27. Cheng, G., B. A. Diebold, Y. Hughes, and J. D. Lambeth. 2006. Nox1-dependent NAD(P)H oxidase contributes to oxidative stress in human atrial fibrillation. reactive oxygen generation is regulated by Rac1. J. Biol. Chem. 281: 17718– Circ. Res. 97: 629–636. 17726. 47. Lasse`gue, B., D. Sorescu, K. Szo¨cs, Q. Yin, M. Akers, Y. Zhang, S. L. Grant, 28. Sumimoto, H., K. Miyano, and R. Takeya. 2005. Molecular composition and J. D. Lambeth, and K. K. Griendling. 2001. Novel gp91(phox) homologues in regulation of the Nox family NAD(P)H oxidases. Biochem. Biophys. Res. vascular smooth muscle cells : nox1 mediates angiotensin II-induced superoxide Commun. 338: 677–686. formation and redox-sensitive signaling pathways. Circ. Res. 88: 888–894. 29. Bańfi, B., R. A. Clark, K. Steger, and K. H. Krause. 2003. Two novel proteins 48. Dikalov, S. I., A. E. Dikalova, A. T. Bikineyeva, H. H. Schmidt, D. G. Harrison, Downloaded from activate superoxide generation by the NADPH oxidase NOX1. J. Biol. Chem. and K. K. Griendling. 2008. Distinct roles of Nox1 and Nox4 in basal and an- 278: 3510–3513. giotensin II-stimulated superoxide and hydrogen peroxide production. Free 30. Bedard, K., and K. H. Krause. 2007. The NOX family of ROS-generating Radic. Biol. Med. 45: 1340–1351. NADPH oxidases: physiology and pathophysiology. Physiol. Rev. 87: 245–313. 49. Bechara, R. I., A. Pelaez, A. Palacio, P. C. Joshi, C. M. Hart, L. A. Brown, 31. Ellmark, S. H., G. J. Dusting, M. N. Fui, N. Guzzo-Pernell, and R. Raynor, and D. M. Guidot. 2005. Angiotensin II mediates glutathione de- G. R. Drummond. 2005. The contribution of Nox4 to NADPH oxidase activity in pletion, transforming growth factor-beta1 expression, and epithelial barrier mouse vascular smooth muscle. Cardiovasc. Res. 65: 495–504. dysfunction in the alcoholic rat lung. Am. J. Physiol. Lung Cell. Mol. Physiol.

32. Schilder, Y. D., E. H. Heiss, D. Schachner, J. Ziegler, G. Reznicek, D. Sorescu, 289: L363–L370. http://www.jimmunol.org/ and V. M. Dirsch. 2009. NADPH oxidases 1 and 4 mediate cellular senescence 50. Seshiah, P. N., D. S. Weber, P. Rocic, L. Valppu, Y. Taniyama, and induced by resveratrol in human endothelial cells. Free Radic. Biol. Med. 46: K. K. Griendling. 2002. Angiotensin II stimulation of NAD(P)H oxidase activity: 1598–1606. upstream mediators. Circ. Res. 91: 406–413. 33. Cucoranu, I., R. Clempus, A. Dikalova, P. J. Phelan, S. Ariyan, S. Dikalov, and 51. Bechara, R. I., L. A. Brown, J. Roman, P. C. Joshi, and D. M. Guidot. 2004. D. Sorescu. 2005. NAD(P)H oxidase 4 mediates transforming growth factor- Transforming growth factor beta1 expression and activation is increased in the beta1-induced differentiation of cardiac fibroblasts into myofibroblasts. Circ. alcoholic rat lung. Am. J. Respir. Crit. Care Med. 170: 188–194. Res. 97: 900–907. 52. Becker, L. B. 2004. New concepts in reactive oxygen species and cardiovascular 34. Yang, S., Y. Zhang, W. Ries, and L. Key. 2004. Expression of Nox4 in osteo- reperfusion physiology. Cardiovasc. Res. 61: 461–470. clasts. J. Cell. Biochem. 92: 238–248. 53. Cevik, M. O., M. Katsuyama, S. Kanda, T. Kaneko, K. Iwata, M. Ibi, 35. Li, J., M. Stouffs, L. Serrander, B. Banfi, E. Bettiol, Y. Charnay, K. Steger, K. Matsuno, T. Kakehi, W. Cui, M. Sasaki, and C. Yabe-Nishimura. 2008. The K. H. Krause, and M. E. Jaconi. 2006. The NADPH oxidase NOX4 drives AP-1 site is essential for the promoter activity of NOX1/NADPH oxidase,

cardiac differentiation: role in regulating cardiac transcription factors and MAP a vascular superoxide-producing enzyme: possible involvement of the ERK1/2- by guest on September 28, 2021 kinase activation. Mol. Biol. Cell 17: 3978–3988. JunB pathway. Biochem. Biophys. Res. Commun. 374: 351–355. 36. Clempus, R. E., D. Sorescu, A. E. Dikalova, L. Pounkova, P. Jo, G. P. Sorescu, 54. Anrather, J., G. Racchumi, and C. Iadecola. 2006. NF-kappaB regulates H. H. Schmidt, B. Lasse`gue, and K. K. Griendling. 2007. Nox4 is required for phagocytic NADPH oxidase by inducing the expression of gp91phox. J. Biol. maintenance of the differentiated vascular smooth muscle cell phenotype. Chem. 281: 5657–5667. [Published erratum appears in 2007 Arterioscler. Thromb. Vasc. Biol. 27: e8.] 55. Bonello, S., C. Za¨hringer, R. S. BelAiba, T. Djordjevic, J. Hess, C. Michiels, Arterioscler. Thromb. Vasc. Biol. 27: 42–48. T. Kietzmann, and A. Go¨rlach. 2007. Reactive oxygen species activate the HIF- 37. Lee, Y. M., B. J. Kim, Y. S. Chun, I. So, H. Choi, M. S. Kim, and J. W. Park. 1alpha promoter via a functional NFkappaB site. Arterioscler. Thromb. Vasc. 2006. NOX4 as an oxygen sensor to regulate TASK-1 activity. Cell. Signal. 18: Biol. 27: 755–761. 499–507. 56. Lu, X., T. C. Murphy, M. S. Nanes, and C. M. Hart. 2010. PPARgamma regulates 38. Lyle, A. N., N. N. Deshpande, Y. Taniyama, B. Seidel-Rogol, L. Pounkova, hypoxia-induced Nox4 expression in human pulmonary artery smooth muscle cells P. Du, C. Papaharalambus, B. Lasse`gue, and K. K. Griendling. 2009. Poldip2, through NF-kappaB. Am. J. Physiol. Lung Cell. Mol. Physiol. 299: L559–L566. a novel regulator of Nox4 and cytoskeletal integrity in vascular smooth muscle 57. Heumu¨ller, S., S. Wind, E. Barbosa-Sicard, H. H. Schmidt, R. Busse, cells. Circ. Res. 105: 249–259. K. Schro¨der, and R. P. Brandes. 2008. Apocynin is not an inhibitor of vascular 39. Dong, J., K. K. Sulik, and S. Y. Chen. 2010. The role of NOX enzymes in NADPH oxidases but an antioxidant. Hypertension 51: 211–217. ethanol-induced oxidative stress and apoptosis in mouse embryos. Toxicol. Lett. 58. Suh, Y. A., R. S. Arnold, B. Lassegue, J. Shi, X. Xu, D. Sorescu, A. B. Chung, 193: 94–100. K. K. Griendling, and J. D. Lambeth. 1999. Cell transformation by the 40. Jerrells, T. R., J. A. Pavlik, J. DeVasure, D. Vidlak, A. Costello, J. M. Strachota, superoxide-generating oxidase Mox1. Nature 401: 79–82. and T. A. Wyatt. 2007. Association of chronic alcohol consumption and in- 59. Choi, W. S., A. Mitsumoto, and I. E. Kochevar. 2009. Involvement of reactive creased susceptibility to and pathogenic effects of pulmonary infection with oxygen species in TGF-beta1-induced tropoelastin expression by human dermal respiratory syncytial virus in mice. Alcohol 41: 357–369. ﬁbroblasts. Photochem. Photobiol. 85: 1425–1433.