Syndromic Choroideremia: Sublocalization of Phenotypes Associated with Martin-Probst Deafness Mental Retardation Syndrome

Charlotte M. Poloschek,1,2 Barbara Kloeckener-Gruissem,2,3,4 Lutz L. Hansen,1 Michael Bach,1 and Wolfgang Berger3

1,2 PURPOSE. To identify the mutation leading to syndromic cho- eventually the choroid. Night blindness develops in affected roideremia (CHM) in two families and to define fundus males during the teenage years. As the disease progresses, they autofluorescence (FAF) in CHM carriers. experience peripheral visual loss that advances to severe con- METHODS. The ophthalmic and clinical phenotype was investi- striction of the visual fields and loss of visual acuity leading to gated including FAF, neuropediatric, otorhinolaryngologic, car- blindness in the late stages. Mental or motor retardation does diologic, and nephrologic examinations of three male patients not occur in the disease. Carriers usually do not manifest (age, 11–46 years) and three female carriers (age, 11–46 years) significant clinical symptoms but show scattered pigment de- from two families. Genomic DNA amplification (PCR) of the posits or focal areas of RPE atrophy.3,4 Sporadic cases of se- REP1 gene as well as adjacent loci was used to determine the verely manifesting carriers are known.5,6 This variability of molecular basis of the phenotype. clinical manifestation is a result of lyonization.7 8–10 RESULTS. Analysis of genomic DNA revealed large deletions that CHM is caused by mutations in the REP1 gene that asymmetrically flank REP1 in both families, ranging from a encodes the 653 amino acid long Rab escort protein-1 (REP1). minimum size of 6.3 and 8.5 mega base pairs (Mbp) to a The entire gene encompasses 186 Kb on the X-chromosome maximum size of 9.7 and 14.1 Mbp, respectively. In addition to and is transcribed into mRNA of 5.442 Kb. REP1 acts as a CHM, patients from these families exhibited mild syndromic regulator of Rab GTPases involved in intracellular vesicular features, including mental and motor retardation and low- transport.11,12 It is ubiquitously expressed in the body, includ- frequency hearing loss. FAF showed a distinctive pattern char- ing photoreceptors, RPE, and choroid.13 The pathogenesis of acterized by small areas of reduced and increased autofluo- CHM is still unclear. Different disease mechanisms have been rescence in all female carriers. proposed that suggest rods14 or the RPE15 to be the primary CONCLUSIONS. Both CHM families are the first to be described site of damage, as well as independent degeneration of the with large deletions that manifest with a mild syndromic phe- photoreceptors and RPE.16 notype. The location of the deletions indicates that they may Causative mutations in the CHM gene result in an absent or allow sublocalization of the syndromic features to the most nonfunctional REP1 and include: small deletions,17–26 small proximal region of X-linked distal spinal muscular atrophy insertions,19–23,27 nonsense,17–24,26,28–32 frame shift,20,22,24–26 (DSMAX) and Martin-Probst deafness mental retardation syn- or splice-site mutations.17,19–22,26,33,34 X-autosomal transloca- drome (MPDMRS). The FAF pattern is specific to CHM carriers tions in three female patients with choroideremia have also and thus will help to identify and differentiate between carriers been described.35–37 Mutations affecting larger regions include of other X-linked recessive carrier states such as in X-linked insertion of an L1 element21 and gross deletions ranging from retinitis pigmentosa. (Invest Ophthalmol Vis Sci. 2008;49: a few exons (Ku¨sters U, et al. IOVS 1996;37:ARVO Abstract 4096–4104) DOI:10.1167/iovs.08-2044 S107)17,19,21,26 to deletions of the entire gene.10,38,39 The latter accounts for approximately 25% of all REP1 horoideremia (CHM; Mendelian Inheritance in Man [MIM] mutations published so far. No correlation has been found C303100; National Center for Biotechnology Information, between the size of the deletion and the severity of CHM. Bethesda, MD) is an X-linked inherited retinal degeneration Strikingly, missense mutations in REP1 have not been identi- characterized by a progressive degeneration of photorecep- fied. tors, retinal pigment epithelium (RPE), choriocapillaris, and Complex phenotypes were found in a minor fraction of patients with CHM who showed larger deletions varying from 5 to 12 mega base pairs (Mbp).8,40 Deletions of this size can From the 1Department of Ophthalmology, University of Freiburg, cause syndromic CHM in the sense of a contiguous gene Freiburg, Germany; the 3Division of Medical Molecular Genetics and syndrome.41,42 Such large deletions are associated with a se- Gene Diagnostics, Institute of Medical Genetics, University of Zurich, vere clinical phenotype including choroideremia, severe men- 4 Schwerzenbach, Switzerland; and the Department of Biology, ETH tal retardation, agenesis of the corpus callosum, cleft lip and Zurich, Zurich, Switzerland. palate, and sensorineural deafness.43,44 2Contributed equally to the work and therefore should be consid- ered equivalent authors. To this group of patients with syndromic CHM with com- Submitted for publication March 18, 2008; revised April 23, 2008; plex phenotypes, we add two families with two novel, large accepted July 18, 2008. interstitial deletions of at least 6.3 to 8.5 Mbp manifesting with Disclosure: C.M. Poloschek, None; B. Kloeckener-Gruissem, CHM, motor retardation, moderate mental retardation, and None; L.L. Hansen, None; M. Bach, None; W. Berger, None hearing loss. In contrast to the previously described contiguous The publication costs of this article were defrayed in part by page gene deletion syndromes, the syndromic features in these two charge payment. This article must therefore be marked “advertise- ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. families are rather mild. This is the first report on large dele- Corresponding author: Charlotte M. Poloschek, Department of tions manifesting with such a mild syndromic phenotype. In Ophthalmology, University of Freiburg, Killianstr. 5, 79106 Freiburg, addition, we describe a characteristic fundus autofluorescence Germany; [email protected]. (FAF) pattern in CHM carriers.

Downloaded from jov.arvojournals.org on 09/23/2021 IOVS, September 2008, Vol. 49, No. 9 Syndromic Choroideremia 4097

FIGURE 1. Pedigrees of family G (left) and family H (right). Filled sym- bols: affected status; centered dots: carriers. Generations are designated by roman numerals, and individuals by arabic numerals. The ﬁve-digit numbers below individuals represent laboratory identiﬁers assigned before DNA extractions.

METHODS The diagnosis of choroideremia was based on clinical and functional findings and was confirmed by genetic analysis, as described Patients and Clinical Investigation later in the following section. If indicated, patients underwent an interdisciplinary work-up including neuropediatric, otorhinolaryngo- Two unrelated families (three affected males, three carrier females) logic, cardiologic, and nephrologic examinations. were included in the study. The pedigrees are illustrated in Figure 1. Informed consent was obtained before examination and blood draws. The study adhered to the tenets of the Declaration of Helsinki. DNA Preparation and Analysis Members of family G (I-2, II-1, II-2 and II-3) and of family H (II-5, III-2, Genomic DNA was isolated from 3 mL venous blood by standard III-3 and III-4) underwent a complete ophthalmic examination includ- techniques (Chemagic Magnetic Separation Module I; Chemagen, Bae- ing Goldmann perimetry and Panel D15 color vision test. FAF was sweiler, Germany). Primers were designed with the Primer 3 public recorded with a standard confocal scanning laser ophthalmoscope domain software (Primer 3: http://frodo.wi.mit.edu/ developed by (Heidelberg Retina Angiograph [HRA]; Heidelberg Engineering, Heidel- Steve Rozen and Helen Skaletsky, Whitehead Institute and Howard berg, Germany). Full-field electroretinograms (ERG, maximum flash Hughes Medical Institute, Massachusetts Institute of Technology, Cam- intensity, 2 cd ⅐ s/m2; Nicolet, Madison, WI) and multifocal electroreti- bridge, MA) and synthesized (Microsynth, Balgach, Switzerland). The nograms (mfERG; VERIS 4.8, Electro-Diagnostic Imaging, Redwood sequences are listed in Table 1. City, CA) were performed with binocular stimulation, according to PCR conditions for 50 to 100 ng of genomic DNA template were as ISCEV (International Society for Clinical Electrophysiology of Vision) follows: Activation of the polymerase (HotFire; Solis BioDyne, Tartu, standards45 and guidelines.46 Estonia) for 15 minutes at 95°C was followed by denaturing at 95°C,

TABLE 1. PCR Primer Information

Locus Forward Reverse

CXorf43 ttgcccactactggggatta ccagggaagtgaagctgttt FAM121A TGGGTGTTGGCTTGTAATGA TCCCCCACCTAATAGCTCAA POF1b ctggcttcatccctgacatt agggacctcccagatgttct REP1 exon1 tcaaccctccaggctaaatg ccaaagtcgtctccgttgat REP1 exon2 caagcaaggatgggtctctt tgggcggatatagaaatgga REP1 exon3 acctgctaaatgcccatgtc cgcacccgagctctatttat REP1 exon4 ttctttggtgactctgaggtga aaattcggaggcgttaaggt REP1 exon5.1 tctgagtcacataagcaaaacg agcattttcatgtgagcacttt REP1 exon5.2 ccaatacagttcccctgtctg TTTTCCCCTGTCACTTCAGC REP1 exon6 atggatcaggttttgctgct ccacggaggactggaattta REP1 exon7 actgatggacggtgatgtga tgggagcccttgaaatacag REP1 exon8 tgtcctttgtgaggtctgtga aagctcaaaaagaggccaca REP1 exon9.1 tggctcttgcttagggacac gcttggatgaccaggagcta REP1 exon9.2 gattttcgggggataattgg ttgtgtttgggatatgtgtgtg REP1 exon10 tgtgtcagaaaacatggaattg ggcttccctaaaaccagacc REP1 exon11 gacttggttttgggaggtga gctaggcaaaatggggagac REP1 exon12 gagcatcatgtcggtgctaa gcagcccaaatggactaaga REP1 exon13 tgggtacttgttgggtacttcc cccacatgtttaggcagaca REP1 exon14 catggcttaatcggtaataggc attcccacgatggaactcat REP1 exon15 tgaggtactgccatccttga AAGGAAAATCCCCTTTTGGA DACH2 tagaggagtcagggcgagaa ggagagccaagaaacgagtg KLHL4 tgctccaaatctgctgaaaa gtgcagctcaaccagacaaa CPXCR1 gttttgtgggcattgtgatg gacccagagcgacaactctc PABPC5 GCTGTTTGGCCCATAGCTTA AGACCACATAAGGCGGAATG LOC401602 ATCTCTCTGAGCCCCTCCTC TACAGCATTAGCCACCACCA NAP1L3 TTTTCTGCCCATCTCTGGTC GGAAGGCTCAGGTACCCTCT DAIPH2 AACAACTTTGGCCATGAAGG tgcatgccgggtttattatt

Sequences of forward and reverse primers for PCR are given from 5Ј to 3Ј. Capital letters represent exon sequences.

Downloaded from jov.arvojournals.org on 09/23/2021 4098 Poloschek et al. IOVS, September 2008, Vol. 49, No. 9

annealing at 60°C, and extending at 72°C in 35 cycles, each step lasting cuate scotomas extending from the periphery to the center. 1 minute. Final extension at 72°C was continued for 10 minutes. The Panel D-15 test showed several errors along the protan and Amplified DNA fragments were visualized after gel electrophoresis deutan axes in accordance with a known protanomaly. The through 1% agarose in the presence of ethidium bromide. For each scotopic ERG amplitudes and the single-flash cone response primer combination, a nontemplate (water) control sample was in- were not detectable, and a discrete Fourier transform of the cluded. Based on the map view of the National Center for Biotechnol- flicker response did not reveal significant cone responses. ogy Information (NCBI) human genome build 36.2 (available at http:// MfERG amplitudes were reduced to one fifth of the norm. FAF www.ncbi.nlm.gov/mapview/map_search.cgi?taxidϭ9606), a list of could not be recorded from the patient due to fixation prob- loci was established. Not every locus between LOC401602 and lems. NAP1L3 was tested because of sequence duplications between X- and Examination results for the patient’s two brothers (II-2 and Y-chromosome. II-3) were normal including those of functional tests. Family H. The 21-year-old patient (III-2) (Fig. 1) reported RESULTS adaptation difficulties. His best corrected visual acuities were 20/20 (right eye) and 20/25 (left eye) in standard room illumi- Ophthalmic Observations in Patients nation. He had normal anterior segments. Fundus examination with Choroideremia showed peripheral to midperipheral loss of choriocapillaris, Family G. The 15-year-old patient (II-1) (Fig. 1) reported peripapillary sclerosis of the choroidal vasculature, normal having nyctalopia since early childhood. His best corrected retinal vessels, and normal optic nerve heads with a peripap- visual acuity was 20/50 (right eye) and 20/30 (left eye) in illary chorioretinal atrophy, the macula was relatively hyper- standard room illumination. He had mild subcapsular posterior pigmented (Figs. 2C, 2D). Goldmann perimetry revealed an cataracts. Fundus examination showed peripheral to midpe- arcuate scotoma (I/4) from 50° to 45° in the right eye. The ripheral loss of choriocapillaris, peripapillary sclerosis of the saturated Panel D-15 test was without errors in both eyes. choroidal vasculature, normal retinal vessels, and normal optic There was one error during unsaturated testing of the right eye nerve heads (Figs. 2A, 2B). Goldmann perimetry revealed ar- and four errors of the left eye. The scotopic ERG signals were

FIGURE 2. Fundus (left two columns) and FAF (right two columns) of the patients with choroideremia. (A, B) II-1 (family G), (C–F) III-2 (family H), and (G–J) III-3 (family H). Fundi showed peripheral to midperipheral loss of choriocapillaris, normal retinal vessels, and optic nerve heads, peripapillary sclerosis (black arrows: some of the sclerosed vessels) of the choroid in II-1, and relative hyperpigmentation of the macula (✽) in III-2 and III-3. FAF was decreased (darker) in areas of chorioretinal atrophy (E, F, I, J).

Downloaded from jov.arvojournals.org on 09/23/2021 IOVS, September 2008, Vol. 49, No. 9 Syndromic Choroideremia 4099

not detectable, and photopic responses were reduced to one reported that he had learned to walk in his 24th month of life fourth of the norm. MfERG amplitudes were reduced without and was attending a special school for learning-impaired chil- local preferences, yet in the normal range. FAF was almost dren. The patient underwent neuropediatric, nephrologic, and intact in the macula but severely reduced in the midperiphery otorhinolaryngologic examinations. There was no hint of mus- to periphery (Figs. 2E, 2F). cle disease. The gait problem and the mild mental retardation The 18-year-old sibling patient (III-3) had adaptation prob- were attributed to general delayed development. A beginning lems and mild nyctalopia. His best corrected visual acuities of auditory hair cell damage affecting the low-frequency hear- were 20/20 (both eyes) in standard room illumination. He had ing was found in audiometry. The nephrologic examination normal anterior segments. Fundus examination showed pe- was unremarkable except for a pelvic dilatation without func- ripheral to midperipheral loss of choriocapillaris, normal reti- tional impact. nal vessels, and normal optic nerve heads, the macula was Family H. Patient II-2 had had problems with motor coor- relatively hyperpigmented (Figs. 2G, 2H). Goldmann perimetry dination since infancy. He had learned to walk in his 18th results were normal. The saturated Panel D-15 test showed four month of life and showed delayed speech development with errors in the right eye, six errors during unsaturated testing of ongoing dyslalia. He had attended a special-needs school to the right eye, and five errors in the left eye, respectively. The graduate from a minimum-requirement school. In a neurope- scotopic ERG was reduced, and peak times of the photopic diatric examination he showed reduced facial expression, uni- responses were prolonged. MfERG amplitudes were normal, lateral postural destabilization, dysdiadochokinesis, and de- yet showed a pathologic perifoveolar peak time increase. FAF layed finger tapping. was almost intact in the macular area but was severely reduced His brother, patient II-3, displayed fine motor-skill problems in the midperiphery to periphery (Figs. 2I, 2J). during the third to fourth years of life. He had learned to walk General Clinical Data of the Patients in the 15th month of life. He graduated from a minimum- requirement school. A neuropediatric examination was unre- with Choroideremia markable. Both brothers were not available for otorhinolaryn- Family G. Delayed motor and mental development became gologic testing. obvious during patient II-1’s first years of life. At the age of 4 years, a microhematuria episode was noted. Metabolic diseases DNA Analysis were ruled out by serologic (thyroid stimulating hormone, triiodothyronine T3, thyroxine T4, circulating T3 and T4, elec- Family G. DNA amplification of all REP1 coding exons trolytes, creatinine, glucose, glutamic pyruvic transaminase, (1–15) from the proband (II-1) and his mother (I-2) revealed C-reactive protein, and total protein), blood (differential blood fragments of expected sizes only in the mother, indicative of a count), and urinary (uric acid, carbonic acid, fatty acids, and deletion of the entire coding region of REP1 (data not shown). monosaccharides) assays. Cranial magnetic resonance imaging In searching for the break points, we amplified DNA markers at age 7 was normal. Consequently, the diagnosis was global within various distances to REP1 (Fig. 3, Table 2). developmental delay of unknown origin. During the patient’s Of the proximal markers CXorf43, FAM121A, and POF1B, visit to our department, he displayed gait problems. His mother only CXorf43 was amplified in the patient (Fig. 3).

FIGURE 3. Gel electrophoresis im- ages of PCR fragments. PCR products are shown for families G and H. DNA template source: mother (M), patient (P), no-DNA control (nt). A molecular weight standard (S) was run on each gel to estimate fragment size. All PCR fragments were in the range of 200 to 700 bp. Above each set showing the DNA source, DNA marker loci are indicated. FAM121A, NAP1L3, and PABPC5 were deleted in the patients. CXorf43, DIAPH2, and LOC401602 were present in all DNA samples tested.

Downloaded from jov.arvojournals.org on 09/23/2021 4100 Poloschek et al. IOVS, September 2008, Vol. 49, No. 9

TABLE 2. List of Genetic Loci Contained within and Flanking the Deletions

Locus Description Family G Family H

RPS6KA6 Ribosomal protein S6 kinase, 90kDa, polypeptide 6 Present Present CXorf43 Chromosome X open reading frame 43 Present Present FAM121A Family with sequence similarity 121A Deleted Deleted SATL1 Spermidine/spermine N1-acetyl transferase-like 1 ZNF711 Zinc finger protein 711 POF1B Premature ovarian failure, 2B Deleted Deleted CHM Choroideremia (Rab escort protein 1) Deleted Deleted DACH2 Dachshund homolog 2 (Drosophila) Deleted Deleted bA345E19.2 COP9 pseudogene KLHL4 Kelch-like 4 (Drosophila) Deleted Deleted RPSAP15 Ribosomal protein SA pseudogene 15 MRPS22P1 Mitochondrial ribosomal protein S22 pseudogene 1 CAPZA1P Capping protein (actin filament) muscle Z-line, alpha 1 pseudogene CPXCR1 CPX chromosome region, candidate 1 Deleted Deleted TGIF2LX TGFB-induced factor 2-like, X-linked USP12P2 Ubiquitin specific peptidase 12 pseudogene 2 Deleted PABPC5 Poly(A) binding protein, cytoplasmic 5 Deleted LOC728150 Similar to protocadherin 11 X-linked LOC642784 Similar to eukaryotic translation initiation factor 4A, isoform 1 PCDH11X Protocadherin 11 X-linked KRT1BL1 Keratin 18-like 1 LOC401602 Similar to adaptor-related protein complex 2, beta 1 subunit Present LOC643310 Similar to heat shock 70kD protein binding protein NAP1L3 Nucleosome assembly protein 1-like 3 Deleted Present LOC643371 Similar to Tubulin, Beta family member (tbb-1) CALM1P1 Calmodulin 1 (phosphorylase kinase, delta) pseudogene 1 LOC648927 Similar to MYST histone acetyltransferase 2 LOC643486 Similar to testis-specific bromodomain protein RPA4 Replication protein A4, 34kDa DIAPH2 Diaphanous homolog 2 (Drosophila) Present Present

The order of the markers is arranged from proximal to distal, according to the map information from NCB map view, ver. 36.2. The Description provides more detailed information of the loci. For families G and H, the presence or absence of tested markers positioned at various intervals is given.

The distal markers DACH2, KLHL4, CPXCR1, and NAP1L3 proband carried a minimal-sized deletion of ϳ8.5 Mbp (Fig. 4). did not amplify, but PCR fragments speciﬁc to the DIAPH2 locus Based on the presence of the markers CXorf43 and DIAPH2, the were present (Fig. 3). From these data, we concluded that the maximum size of the deletion was estimated as 14.1 Mbp (Fig. 4).

FIGURE 4. The Xq21 region contain- ing REP1. Left: the minimum (shaded bar) and maximum extent (dotted lines) of the deletions (sizes given in Mbp) in family G (Fam G) and family H (Fam H) with corresponding genetic markers next to the ideogram are shown. Right: extent and names of mapped syndromes (vertical lines).

Downloaded from jov.arvojournals.org on 09/23/2021 IOVS, September 2008, Vol. 49, No. 9 Syndromic Choroideremia 4101

Family H. DNA amplification of REP1 exon 10 from the Carrier II-5 showed signs of bronchial asthma and allergies proband (III-2) and his mother (II-5) revealed a fragment of against pollen and animal fur. Visual acuities, anterior seg- expected size in the mother, but not in the proband, suggest- ments, visual fields, and color vision tests were normal. ing a deletion of REP1 (data not shown). As described for Scotopic and photopic full-field ERG and mfERG amplitudes family G, we used various flanking loci (Figs. 3, 4; Table 2) to were normal; however, the central mfERG amplitude was identify the extent of the deletion. With the marker CXorf43, slightly diminished in individual I-2, and scotopic full-field ERG a fragment of expected size was amplified from both DNA amplitudes of individual III-4 were at the lower normal limit. samples, mother and affected son. Marker FAM121A did not The fundi showed mottling of the RPE, discrete peripheral RPE yield a fragment from DNA of the affected son. Markers clumping and small areas of chorioretinal atrophy (Figs. 5A, 5B, DACH2, KLHL4, CPXCR1, USP12P2, and PABPC5, which are 5E, 5F, 5I, 5J). distal to REP1, were absent. From this, we conclude that the In all three carriers, FAF displayed speckles, small areas of deletion had a minimum size of approximately 6.3 Mbp. Since reduced or increased autofluorescence, and an otherwise nor- amplification of marker LOC401602 was successful in both mal autofluorescence (Figs. 5C, 5D, 5G, 5H, 5K, 5L). In the samples, the maximum deletion size was determined to be 9.7 youngest carrier III-4, the speckled pattern was rather subtle Mbp (Figs. 3, 4). DNA analysis from patient III-3 revealed a (Figs. 5K, 5L). pattern identical to that found for proband III-2. Sibling carrier III-4 showed the same DNA amplification pattern as the mother II-5 (data not shown). DISCUSSION Ophthalmic Observations in the Carriers In two families with syndromic CHM, we detected two novel large deletions of at least 8.5 and 6.3 Mbp to at most 14.1 and The age of the three carriers at the time of diagnosis was 44 9.7 Mbp, respectively. Patients in both families exhibited a (family G, I-2), 46 (family H, II-5), and 10 (family H, III-4) years. mild but complex phenotype. Furthermore, a unique FAF pat- They did not have any ophthalmic or other medical symptoms. tern was found in CHM carriers.

FIGURE 5. Fundus (left two columns) and FAF (right two columns) of the choroideremia carriers. The fundi showed mottling of the retinal pigment epithelium, discrete peripheral RPE clumping, and small areas of chorioretinal atrophy (some marked with arrows in A, B, more subtle in the other fundi). There was a normal background autoﬂuorescence with a characteristic speckled pattern of areas with reduced and increased autoﬂuorescence. In the youngest carrier (III-4) these changes were very subtle. (A–D) Carrier I-2 (family G); (E–H) II-5 (family H); and (I–L) III-4 (family H).

Downloaded from jov.arvojournals.org on 09/23/2021 4102 Poloschek et al. IOVS, September 2008, Vol. 49, No. 9

FAF Pattern in CHM Carriers clinical conditions is consistent with reports that female carriers appear to be clinically normal. FAF is used to monitor the natural autofluorescence of lipofus- It seems more likely that these aspects are components of cin that accumulates in RPE cells after ingestion of rod outer the Martin-Probst deafness-mental retardation syndrome segments and can be recorded in vivo by a confocal scanning 47–49 (MPDMRS; MIM 300519). The entire chromosomal region as- laser ophthalmoscope. Some retinal dystrophies show dis- signed to this syndrome encompasses about 68 Mbp, of which tinctive changes in FAF, which can be displayed as a radial only approximately 13% were deleted in our two families. A pattern in XLRP50 or a ring-shaped pattern of increased FAF, 51 multitude of disorders such as congenital sensorineural hearing indicative of autosomal RP, X-linked cone-rod dystrophy, loss, mental retardation, short stature, congenital umbilical autosomal dominant cone-rod dystrophy,52 or macular dystro- 53,54 hernia, facial dysmorphism, abnormal teeth, widely spaced phies such as Stargardt disease. To date, FAF data on nipples, and abnormal dermatoglyphics all belong to this syn- choroideremia carriers are very limited. The characteristic drome. Progressive pancytopenia in adulthood has also been flecked autofluorescence pattern observed in our carriers observed.60,61 The mental retardation of the male patients seems to be specific to choroideremia carriers and has not described in this study could be a component of MPDMR been described in any other retinal dystrophy so far. A normal syndrome. In addition, the early stages of auditory hair cell background autofluorescence is flecked by some spots of de- damage for low frequencies diagnosed in patient II-1 from creased and others of increased autofluorescence. Spots of family G may also be accounted for by the MPDMR syndrome. decreased autofluorescence are likely to correspond to small We can exclude the possibility that this hair cell damage is patches of photoreceptor loss associated with RPE atrophy. related to the deafness mixed with perilymphatic gusher syn- Spots of increased autofluorescence are possibly due to in- drome, POU3F4 (MIM 300039), since marker CXorf43 is creased lipofuscin accumulation in RPE cells due to the high present in the patients and hence the deletion may not extend turnover rate of photoreceptor outer segments47,55 or to im- 56 to POU3F4 (Fig. 4). Taken together, the partial overlap of the paired phagocytosis. An age-dependent intensifying of the deletions described herein with previously reported syn- autofluorescence pattern seems possible, since the youngest dromes may allow a sublocalization of particular phenotypes. carrier (family H, III-4) showed only very subtle changes com- Two further syndromes, coronary heart disease, susceptibil- pared with the adult carriers. ity to, 3 (CHDS3; MIM 300464) and diaphanous homolog 2 These three new cases of altered autofluorescence in cho- (DIAPH2; MIM 300108) map only to the distal end of the roideremia carriers confirm the preliminary results of Weg- potentially deleted region in family G. None of the character- scheider et al. who reported similar findings in five indepen- istic phenotypical aspects62,63 were noted in our patients, dent carriers (Wegscheider E, et al. IOVS 2005;46:ARVO 6 suggesting that the deletion may not extend this far distally. E-Abstract 4088) and Renner et al., who described one carrier. Fine mapping of the deletion by using additional molecular According to these data and our findings, FAF promises to markers may support our interpretation. We were not able to be a powerful means of identifying CHM carriers and of differ- conduct fine-mapping because we encountered difficulties entiating between X-linked retinitis pigmentosa carriers who 50 with sequence specificity due to partial sequence duplications show a radial FAF pattern. of this X-chromosomal region on the Y-chromosome. Large deletions have also been reported earlier to be asso- Deletion Mapping: Understanding the Syndromic ciated not only with choroideremia but also with cleft lip and Aspect Displayed by the Two Families palate as well as mental retardation and deafness.57 While three The large deletions involving X-chromosome q21.1-q21.33 in of five syndromic deletions showed only partial overlap with our two families encompass several mapped syndromes, either deletions of our patients, two of the five (patient NP and XL62) in their entirety or only parts of them. REP1 (MIM 300390) is covered the entire region deleted in both families reported completely lacking, which correlates with the molecular and herein. Of note, the phenotypes displayed in our families are clinical findings in the families described herein, as well as with considerably less severe. This lack of severity may in part be previously reported deletions of the REP1 gene leading to explained by the distal extension of the published deletions syndromic and nonsyndromic choroideremia.39,57 The region beyond the breakpoints seen in our patients. Similarly, the carrying the premature ovarian failure syndrome (POF2B; MIM deafness phenotype reported by Cremers et al.57 and the here 300604) is also entirely deleted, but as all affected members in reported hearing loss of low frequencies are most likely of our families were males, the syndrome is not expected to different origin, since the previously published deletions in- become manifest. It is unlikely that the female carriers of the clude the POU3F4 locus for deafness. deletion will be affected by this syndrome, but it remains to be An alternative explanation could be breakage, repair, and seen, although heterozygotes have not been described to man- rejoining of previously unrelated, nonconsecutive DNA se- ifest this syndrome.58 quences. Detailed knowledge of DNA sequences adjacent to The X-linked distal spinal muscular atrophy DSMAX syn- the deletion breakpoints may shed light on this possibility. The drome (MIM 300489) is only partially affected by the deletions individual genetic background may also contribute to the vari- described herein, although the distal end may be completely able phenotypes. included in the deletion (Fig. 4). This syndrome has not yet been mapped to a particular gene. Rather, its region extends over 21 Mbp. It is an X-linked recessive progressive disorder CONCLUSIONS causing atrophy of the upper and lower limbs. In addition to foot deformities, gait instability has been reported.59 Even In this study we found an FAF pattern that is unique to CHM though patient II-1 of family G had no diagnosed muscle dis- carriers and thus will be a powerful tool for identifying CHM ease, it is conceivable that his gait problems constitute part of carriers alongside funduscopy and to distinguish between car- the DSMAX syndrome, as may the delayed motor coordination riers of other X-linked recessive mutations such as in retinitis of patients III-2 and III-3 from family H. As no cognitive or pigmentosa. sensory impairment has been described to be part of this Further, we report two comparably large novel deletions in syndrome, the mental retardation diagnosed in the patients we the range of minimally 6 Mbp to maximally 14 Mbp surround- have described appears unrelated to DSMAX. The fact that ing the REP1 gene, which is associated with choroideremia. To female carriers in our two families did not show signs of date few large deletions of similar size and localization have

Downloaded from jov.arvojournals.org on 09/23/2021 IOVS, September 2008, Vol. 49, No. 9 Syndromic Choroideremia 4103

been characterized by severe syndromic features in addition to 20. van Bokhoven H, Schwartz M, Andreasson S, et al. Mutation spec- choroideremia.57 Our families are the first described as carry- trum in the CHM gene of Danish and Swedish choroideremia ing large deletions yet showing rather mild clinical manifesta- patients. Hum Mol Genet. 1994;3:1047–1051. tions. 21. van den Hurk JA, van de Pol DJ, Wissinger B, et al. Novel types of Although our data do not narrow down the MPDMR syn- mutation in the choroideremia (CHM) gene: a full-length L1 inser- drome locus, they potentially sublocalize the mild hearing tion and an intronic mutation activating a cryptic exon. Hum Genet. 2003;113:268–275. defect as well as mental retardation and motor problems to the 22. van den Hurk JA, Schwartz M, van Bokhoven H, et al. Molecular most proximal region of the locus for this complex syndrome. basis of choroideremia (CHM): mutations involving the Rab escort protein-1 (REP-1) gene. Hum Mutat. 1997;9:110–117. Acknowledgments 23. Nesslinger N, Mitchell G, Strasberg P, MacDonald IM. Mutation analysis in Canadian families with choroideremia. Ophthalmic Genet. 1996;17:47–52. The authors thank Jaya Balakrishnan, Esther Glaus, and Philippe Reuge 24. van den Hurk JA, van de Pol TJ, Molloy CM, et al. Detection and for preparation of the genomic DNA. characterization of point mutations in the choroideremia candidate gene by PCR-SSCP analysis and direct DNA sequencing. Am J References Hum Genet. 1992;50:1195–1202. 25. Pascal O, Donnelly P, Fouanon C, Herbert O, Le Roux MG, Moisan 1. Waardenburg P. Chorioideremia als Erbmerkmal. Acta Ophthal- JP. A new (old) deletion in the choroideremia gene. Hum Mol mol. 1942;20:235–274. Genet. 1993;2:1489. 2. McCulloch C. A hereditary and clinical study of choroideremia. 26. Schwartz M, Rosenberg T, van den Hurk JA, van de Pol DJ, Cremers Trans Am Acad Ophthalmol Otolaryngol. 1948;53:160–190. FP. Identification of mutations in Danish choroideremia families. 3. Karna J. Choroideremia: a clinical and genetic study of 84 Finnish Hum Mutat. 1993;2:43–47. patients and 126 female carriers. Acta Ophthalmol Suppl. 1986; 27. Sankila EM, Tolvanen R, van den Hurk JA, Cremers FP, de la 176:1–68. Chapelle A. Aberrant splicing of the CHM gene is a significant 4. Heckenlively J. Choroideremia. In: J. Heckenlively J, ed. Retinitis cause of choroideremia. Nat Genet. 1992;1:109–113. Pigmentosa. Philadelphia: JB Lippincott; 1988:176–187. 28. Francis PJ, Fishman GA, Trzupek KM, MacDonald IM, Stone EM, 5. Fraser GR, Friedmann AI. Choroideremia in a female. BMJ. 1968; Weleber RG. Stop mutations in exon 6 of the choroideremia gene, 2:732–734. CHM, associated with preservation of the electroretinogram. Arch 6. Renner AB, Kellner U, Cropp E, et al. Choroideremia: variability of Ophthalmol. 2005;123:1146–1149. clinical and electrophysiological characteristics and first report of 29. Hayakawa M, Fujiki K, Hotta Y, et al. Visual impairment and REP-1 a negative electroretinogram. Ophthalmology. 2006;113:2066.e1– gene mutations in Japanese choroideremia patients. Ophthalmic e10. Genet. 1999;20:107–115. 7. Lyon MF. Gene action in the X-chromosome of the mouse (Mus 30. Trujillo MJ, Sanz R, Rodriguez de Alba M, et al. First mutation musculus L.). Nature. 1961;190:372–373. (S340X) in choroideremia gene in a Spanish family: mutations in 8. Cremers FP, van de Pol DJ, van Kerkhoff LP, Wieringa B, Ropers brief no. 173. Hum Mutat. 1998;12:213. HH. Cloning of a gene that is rearranged in patients with cho- 31. Forsythe P, Maguire A, Fujita R, Moen C, Swaroop A, Bennett J. A roideraemia. Nature. 1990;347:674–677. carboxy-terminal truncation of 99 amino acids resulting from a 9. Merry DE, Janne PA, Landers JE, Lewis RA, Nussbaum RL. Isolation novel mutation (Arg5553stop) in the CHM gene leads to choroi- of a candidate gene for choroideremia. Proc Natl Acad SciUSA. deremia. Exp Eye Res. 1997;64:487–490. 1992;89:2135–2139. 32. Beaufrere L, Tuffery S, Hamel C, Arnaud B, Demaille J, Claustres M. 10. van Bokhoven H, van den Hurk JA, Bogerd L, et al. Cloning and A novel mutation (S558X) causing choroideremia. Hum Mutat. characterization of the human choroideremia gene. Hum Mol 1996;8:395. Genet. 1994;3:1041–1046. 33. Donnelly P, Menet H, Fouanon C, et al. Missense mutation in the 11. Seabra MC, Brown MS, Goldstein JL. Retinal degeneration in choroideremia gene. Hum Mol Genet. 1994;3:1017. choroideremia: deficiency of rab geranylgeranyl transferase. Sci- 34. Beaufrere L, Rieu S, Hache JC, Dumur V, Claustres M, Tuffery S. ence. 1993;259:377–381. Altered rep-1 expression due to substitution at position ϩ3ofthe 12. Preising M, Ayuso C. Rab escort protein 1 (REP1) in intracellular IVS13 splice-donor site of the choroideremia (CHM) gene. Curr traffic: a functional and pathophysiological overview. Ophthalmic Eye Res. 1998;17:726–729. Genet. 2004;25:101–110. 35. Siu VM, Gonder JR, Jung JH, Sergovich FR, Flintoff WF. Choroider- 13. Seabra MC, Mules EH, Hume AN. Rab GTPases, intracellular traffic emia associated with an X-autosomal translocation. Hum Genet. and disease. Trends Mol Med. 2002;8:23–30. 1990;84:459–464. 14. Syed N, Smith JE, John SK, Seabra MC, Aguirre GD, Milam AH. 36. Cremers FP, van de Pol DJ, Diergaarde PJ, et al. Physical fine Evaluation of retinal photoreceptors and pigment epithelium in a mapping of the choroideremia locus using Xq21 deletions associ- female carrier of choroideremia. Ophthalmology. 2001;108:711– ated with complex syndromes. Genomics. 1989;4:41–46. 720. 37. Lorda-Sanchez IJ, Ibanez AJ, Sanz RJ, et al. Choroideremia, senso- 15. Krock BL, Bilotta J, Perkins BD. Noncell-autonomous photorecep- rineural deafness, and primary ovarian failure in a woman with a tor degeneration in a zebrafish model of choroideremia. Proc Natl balanced X-4 translocation. Ophthalmic Genet. 2000;21:185–189. Acad SciUSA. 2007;104:4600–4605. 38. Ponjavic V, Abrahamson M, Andreasson S, et al. Phenotype varia- 16. Tolmachova T, Anders R, Abrink M, et al. Independent degenera- tions within a choroideremia family lacking the entire CHM gene. tion of photoreceptors and retinal pigment epithelium in condi- Ophthalmic Genet. 1995;16:143–150. tional knockout mouse models of choroideremia. J Clin Invest. 39. Mura M, Sereda C, Jablonski MM, MacDonald IM, Iannaccone A. 2006;116:386–394. Clinical and functional findings in choroideremia due to complete 17. McTaggart KE, Tran M, Mah DY, Lai SW, Nesslinger NJ, MacDonald deletion of the CHM gene. Arch Ophthalmol. 2007;125:1107– IM. Mutational analysis of patients with the diagnosis of choroi- 1113. deremia. Hum Mutat. 2002;20:189–196. 40. Merry DE, Lesko JG, Sosnoski DM, et al. Choroideremia and deaf- 18. Beaufrere L, Tuffery S, Hamel C, Bareil C, Arnaud B, Demaille J, ness with stapes fixation: a contiguous gene deletion syndrome in Claustres M. The protein truncation test (PTT) as a method of Xq21. Am J Hum Genet. 1989;45:530–540. detection for choroideremia mutations. Exp Eye Res. 1997;65: 41. Schmickel RD. Contiguous gene syndromes: a component of rec- 849–854. ognizable syndromes. J Pediatr. 1986;109:231–241. 19. Fujiki K, Hotta Y, Hayakawa M, et al. REP-1 gene mutations in 42. Cremers FP, van de Pol DJ, Wieringa B, et al. Chromosomal jump- Japanese patients with choroideremia. Graefes Arch Clin Exp ing from the DXS165 locus allows molecular characterization of Ophthalmol. 1999;237:735–740. four microdeletions and a de novo chromosome X/13 transloca-

Downloaded from jov.arvojournals.org on 09/23/2021 4104 Poloschek et al. IOVS, September 2008, Vol. 49, No. 9

tion associated with choroideremia. Proc Natl Acad SciUSA. 53. Gerth C, Andrassi-Darida M, Bock M, Preising MN, Weber BH, 1989;86:7510–7514. Lorenz B. Phenotypes of 16 Stargardt macular dystrophy/fundus 43. Rosenberg T, Schwartz M, Niebuhr E, et al. Choroideremia in flavimaculatus patients with known ABCA4 mutations and evalua- interstitial deletion of the X chromosome. Ophthalmic Paediatr tion of genotype-phenotype correlation. Graefes Arch Clin Exp Genet. 1986;7:205–210. Ophthalmol. 2002;240:628–638. 44. Tabor A, Andersen O, Lundsteen C, Niebuhr E, Sardemann H. 54. Poloschek CM, Hansen LL, Bach M. Annular fundus autofluores- Interstitial deletion in the “critical region” of the long arm of the X cence abnormality in a case of macular dystrophy. Doc Ophthal- chromosome in a mentally retarded boy and his normal mother. mol. 2008;116(2):91–95 Hum Genet. 1983;64:196–199. 55. Sanyal S, Hawkins RK. Development and degeneration of retina in 45. Marmor MF, Holder GE, Seeliger MW, Yamamoto S. Standard for rds mutant mice: altered disc shedding pattern in the albino het- clinical electroretinography (2004 update). Doc Ophthalmol. erozygotes and its relation to light exposure. Vision Res. 1988;28: 2004;108:107–114. 1171–1178. 56. Kennedy CJ, Rakoczy PE, Constable IJ. Lipofuscin of the retinal 46. Marmor MF, Hood DC, Keating D, Kondo M, Seeliger MW, Miyake pigment epithelium: a review. Eye. 1995;9:763–771. Y. Guidelines for basic multifocal electroretinography (mfERG). Doc Ophthalmol. 2003;106:105–115. 57. Cremers FP, Sankila EM, Brunsmann F, et al. Deletions in patients with classical choroideremia vary in size from 45 kb to several 47. von Ruckmann A, Fitzke FW, Bird AC. Distribution of fundus megabases. Am J Hum Genet. 1990;47:622–628. autofluorescence with a scanning laser ophthalmoscope. Br J 58. Lacombe A, Lee H, Zahed L, et al. Disruption of POF1B binding to Ophthalmol. 1995;79:407–412. nonmuscle actin filaments is associated with premature ovarian 48. Bellmann C, Holz FG, Schapp O, Volcker HE, Otto TP. Topography failure. Am J Hum Genet. 2006;79:113–119. of fundus autofluorescence with a new confocal scanning laser 59. Takata RI, Speck Martins CE, Passosbueno MR, et al. A new locus ophthalmoscope (in German). Ophthalmologe. 1997;94:385–391. for recessive distal spinal muscular atrophy at Xq13.1-q21. J Med 49. Holz F. FAM-Study Group. Am J Ophthalmol. 2007;143:463–472. Genet. 2004;41:224–229. 50. Wegscheider E, Preising MN, Lorenz B. Fundus autofluorescence 60. Martin DM, Probst FJ, Camper SA, Petty EM. Characterisation and in carriers of X-linked recessive retinitis pigmentosa associated genetic mapping of a new X linked deafness syndrome. J Med with mutations in RPGR, and correlation with electrophysiological Genet. 2000;37:836–841. and psychophysical data. Graefes Arch Clin Exp Ophthalmol. 61. Probst FJ, Hedera P, Sclafani AM, et al. Skewed X-inactivation in 2004;242:501–511. carriers establishes linkage in an X-linked deafness-mental retarda- 51. Ebenezer ND, Michaelides M, Jenkins SA, et al. Identification of tion syndrome. Am J Med Genet A. 2004;131:209–212. novel RPGR ORF15 mutations in X-linked progressive cone-rod 62. Sala C, Arrigo G, Torri G, et al. Eleven X chromosome breakpoints dystrophy (XLCORD) families. Invest Ophthalmol Vis Sci. 2005; associated with premature ovarian failure (POF) map to a 15-Mbp 46:1891–1898. YAC contig spanning Xq21. Genomics. 1997;40:123–131. 52. Michaelides M, Holder GE, Hunt DM, Fitzke FW, Bird AC, Moore 63. Pajukanta P, Cargill M, Viitanen L, et al. Two loci on chromosomes AT. A detailed study of the phenotype of an autosomal dominant 2 and X for premature coronary heart disease identified in early- cone-rod dystrophy (CORD7) associated with mutation in the gene and late-settlement populations of Finland. Am J Hum Genet. for RIM1. Br J Ophthalmol. 2005;89:198–206. 2000;67:1481–1493.

Downloaded from jov.arvojournals.org on 09/23/2021