P53 Deficiency Enhances Mitotic Arrest and Slippage Induced by Pharmacological Inhibition of Aurora Kinases

ORIGINAL ARTICLE p53 deﬁciency enhances mitotic arrest and slippage induced by pharmacological inhibition of Aurora kinases

M Marxer, HT Ma, WY Man and RYC Poon

A number of small-molecule inhibitors of Aurora kinases have been developed and are undergoing clinical trials for anti-cancer therapies. Different Aurora kinases, however, behave as very different targets: while inhibition of Aurora A (AURKA) induces a delay in mitotic exit, inhibition of Aurora B (AURKB) triggers mitotic slippage. Furthermore, while it is evident that p53 is regulated by Aurora kinase-dependent phosphorylation, how p53 may in turn regulate Aurora kinases remains mysterious. To address these issues, isogenic p53-containing and -negative cells were exposed to classic inhibitors that target both AURKA and AURKB (Alisertib and ZM447439), as well as to new generation of inhibitors that target AURKA (MK-5108), AURKB (Barasertib) individually. The fate of individual cells was then tracked with time-lapse microscopy. Remarkably, loss of p53, either by gene disruption or small interfering RNA-mediated depletion, sensitized cells to inhibition of both AURKA and AURKB, promoting mitotic arrest and slippage respectively. As the p53-dependent post-mitotic checkpoint is also important for preventing genome reduplication after mitotic slippage, these studies indicate that the loss of p53 in cancer cells represents a major opportunity for anti-cancer drugs targeting the Aurora kinases.

Oncogene (2014) 33, 3550–3560; doi:10.1038/onc.2013.325; published online 19 August 2013 Keywords: mitosis; mitotic catastrophe; mitotic slippage

INTRODUCTION As Aurora kinases are upregulated in several human cancers Accurate cell division relies on a well-balanced regulating network and correlated with poor prognosis, they are believed to be 7 of protein kinases and phosphatases.1 One important family of important anti-cancer drug targets. A number of small-molecule mitotic kinases is the Aurora kinases. While yeasts contain a single Aurora kinase inhibitors have been developed over the recent Aurora kinase, mammals contain three homologs that display years and more than 20 compounds are currently at various 8 distinctive functions, substrate specificity and cellular localization stages of development and clinical trials. While the first group of during mitosis. Aurora kinase inhibitors inactivates both AURKA and AURKB Aurora A (also called AURKA) is a centrosomal protein that indiscriminately, several later generations of inhibitors are able to regulates the maturation and separation of centrosomes and specifically target AURKA or AURKB. formation of bipolar spindle.2 Although related in sequence to Due to the different functions of AURKA and AURKB, the effects AURKA, Aurora B (also called AURKB) is a component of the of their downregulation or pharmacological inactivation are chromosomal passenger complex, which comprises AURKB, different. Inhibition of AURKA causes defects in centrosome INCENP, borealin and survivin. chromosomal passenger complex separation and spindle formation, resulting in mitotic arrest and localizes to chromosomes and kinetochores in early mitosis apoptosis. By contrast, inhibition of AURKB interferes with histone and functions in chromosome–microtubule interactions, sister H3 phosphorylation, chromosome segregation and cytokinesis, chromatid cohesion and the spindle-assembly checkpoint. In causing the formation of polyploid cells.9 anaphase, the chromosomal passenger complex is relocated to Among the identified substrates for the Aurora kinases, the the mid zone to promote cytokinesis.3 The role of the last family transcription factor p53 is one of the prominent substrates that member, Aurora C (also called AURKC), which is mainly expressed may be involved in the checkpoint and apoptotic responses after in testis, is not well characterized.4 inhibition of Aurora kinases. AURKA phosphorylates p53 at Ser215 315 The activity of AURKA increases from late G2-phase onwards and Ser and downregulates its transactivation activity and and peaks in prometaphase. On the other hand, the activity protein stability.10,11 Hence inhibition of AURKA can promote the of AURKB peaks from metaphase to the end of mitosis. Activation accumulation and activation of p53. How p53 may conversely of AURKA requires binding to specific cofactors including Ajuba, regulate Aurora kinase is currently uncertain. Bora and TPX2, leading to the autophosphorylation of a residue As studies on pharmacological inhibition of Aurora kinases in the T-loop (Thr288).5 Similarly, AURKB is activated by auto- generally focus on end-point cytotoxicity assays, how single cells phosphorylation of Thr232 in the T-loop after binding to members behave dynamically remains incompletely understood. In this of the chromosomal passenger complex.6 At the end of mitosis, study, we have treated p53-containing and -negative cells to small both AURKA and AURKB are degraded by APC/C-mediated inhibitors targeting AURKA and/or AURKB, and tracked the fate of ubiquitination. individual cells with time-lapse microscopy to address these issues.

Division of Life Science, Center for Cancer Research, and State Key Laboratory of Molecular Neuroscience, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong, China. Correspondence: Professor RYC Poon, Division of Life Science, Center for Cancer Research, and State Key Laboratory of Molecular Neuroscience, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong, China. E-mail: [email protected] Received 17 January 2013; revised 9 May 2013; accepted 13 June 2013; published online 19 August 2013 p53 affects responses to Aurora kinase inhibitors M Marxer et al 3551 RESULTS increasing concentration of Alisertib up to 250 nM (quantified in Alisertib inhibits both AURKA and AURKB and promotes mitotic Figure 1c). For the cells that could exit mitosis, they underwent exit delay and slippage anaphase and cytokinesis relatively normally. By contrast, further Alisertib (also called MLN8237), the first orally available Aurora increase in the concentrations of Alisertib resulted in a shortening kinase inhibitor to enter human clinical trials, is generally believed of mitosis and increase in mitotic slippage (no anaphase), 12 to be an AURKA-specific inhibitor with IC50 of 1.2 nM in vitro. As suggesting that AURKB could also be inhibited. Examples of expected, exposure of HeLa cells to Alisertib (250 nM) induced a control (Supplementary Video S1), Alisertib-mediated mitotic G2/M cell cycle delay (Figure 1a). A higher concentration (1 mM), retardation (Supplementary Video S2) and mitotic slippage however, resulted in a repeated round of DNA synthesis, (Supplementary Video S3) are shown in the Supplementary Movies. suggesting Alisertib could also induce mitotic slippage or failure Extensive cell death was associated with the defective mitosis of cytokinesis. induced by 250 nM of Alisertib (Figure 1b). Interestingly, the To demonstrate more rigorous that premature mitotic exit was shortening of mitosis due to slippage at higher concentrations of indeed triggered by Alisertib, the fate of individual cells were Alisertib actually increased overall cell survival within the imaging tracked with time-lapse microscopy (Figure 1b). Consistent with an period (Figure 1b). Nevertheless, the resulting tetraploid cells die inhibition of AURKA, mitosis was lengthened progressively with shortly afterwards, as indicated by imaging the cells for a longer

Figure 1. Alisertib inhibits AURKA and AURKB in a concentration-dependent manner. (a) Alisertib induces G2/M delay or genome reduplication. HeLa cells were exposed to buffer or the indicated concentrations of Alisertib. After 24 h, the cells were harvested and analyzed with flow cytometry. The positions of 2N, 4N and 8N DNA contents are indicated. (b) Alisertib delays mitotic exit or induces slippage. HeLa cells stably expressing histone H2B-GFP were exposed to buffer or the indicated concentrations of Alisertib. Individual cells were then tracked for 24 h with time-lapse microscopy. Each horizontal bar represents one cell (n ¼ 50). Key: light gray ¼ interphase; black ¼ mitosis (from DNA condensation to anaphase or mitotic slippage); dark gray ¼ interphase after mitotic slippage; truncated bars ¼ cell death. (c) Different concentrations of Alisertib are involved in delaying mitotic exit and inducing slippage. Live-cell imaging of cells treated with Alisertib was described in panel (b). The duration of mitosis (mean±90% confidence interval) and the percentage of cells that underwent mitotic slippage during the imaging period was quantified. (d) Alisertib promotes apoptosis in a concentration-dependent manner. HeLa cells were incubated with the indicated concentrations of Alisertib for 48 h. The cells were then harvested and analyzed with flow cytometry. (e) Concentration- dependent cytotoxicity of Alisertib. HeLa cells were cultured in the presence of the indicated concentrations of Alisertib for 48 h. The number of live and dead cells was analyzed with trypan blue exclusion assay. (f) Concentration-dependent suppression of long-term survival by Alisertib. HeLa cells were seeded on 60-mm culture plates and grown in the presence of 250 nM or 1 mM of Alisertib. After 24 h, the cells were washed gently and propagated in normal medium for another 10–12 days. Colonies were fixed and stained with crystal violet solution (examples of the plates are shown). Average±s.d. from three independent experiments. (g) Both AURKA and AURKB are inhibited by Alisertib. Mitotic HeLa cells were obtained by exposure to nocodazole for 16 h followed by mechanical shake off. The cells were incubated with the indicated concentrations of Alisertib for 2 h. Lysates were then prepared and activated phospho-AURKAThr288 and AURKBThr232 were detected with immunoblotting. The asterisk indicates the position of an AURKB-like protein (the same throughout this study). Uniform loading was confirmed by immunoblotting for actin. In this assay, nocodazole and MG132 (a proteasome inhibitor) were added to prevent the cells from exiting mitosis. Accordingly, the total AURKA and AURKB levels remained constant throughout the experiment. (h) Alisertib prevents activation of AURKA and AURKB. HeLa cells were incubated with the indicated concentrations of Alisertib for 8 h. Nocodazole was then added for another 6 h to trap cells that entered mitosis. Lysates were prepared and analyzed with immunoblotting. Actin analysis was included to assess loading and transfer.

& 2014 Macmillan Publishers Limited Oncogene (2014) 3550 – 3560 p53 affects responses to Aurora kinase inhibitors M Marxer et al 3552 period of time (Supplementary Figure S1) and the massive sub-G1 and c). Accordingly, whole-genome reduplication occurred after population at 48 h (Figure 1d). We also used trypan blue exclusion Barasertib treatment in both HeLa (Figure 2d) and HCT116 assays to confirm the cytotoxicity caused by the different (Figure 2e). As expected, cell proliferation (as measured with concentrations of Alisertib (Figure 1e). Finally, the percentage of WST-1 assays) was reduced after Barasertib treatment in the cell clonogenic survival after treatment with 250 nM of Alisertib was lines (Figure 2f). Upon further incubation, more cells displayed consistent with the portion of cells that eventually able to apoptosis morphology (Supplementary Figure S1) and sub-G1 complete mitosis during live-cell imaging (B30%; Figure 1b). By DNA contents, which could be reduced with a caspase inhibitor comparison, although B98% cells survived immediately following (Figure 2g). Alisertib (1 mM)-mediated mitotic slippage (Figure 1b), only a small Interestingly, mitotic slippage induced by Barasertib was not portion survived in clonogenic assays (Figure 1f). identical to that induced by Alisertib. Alisertib (or ZM447439)- Inactivation of different Aurora kinases was detected directly treated cells exited mitosis from a prometaphase-like state. using an antibody that recognized the phosphorylated forms of While some Barasertib-treated cells also exited mitosis pre- Aurora kinases (AURKAThr288, AURKBThr232 and AURKCThr198) maturely from a prometaphase-like state (Supplementary Video S4), (Figure 1g). As expected, AURKA and AURKB were activated a subset of cells were able to form a metaphase plate before during mitosis (lane 2). Alisertib inhibited AURKA and AURKB DNA decondensation (Supplementary Video S5) (quantified in differentially: while AURKA was completely inhibited with 50 nM of Supplementary Figure S5). Neither of these cell populations could Alisertib, complete inhibition of AURKB required 1 mM of Alisertib. undergo proper chromosome segregation and anaphase. These Although the above experiment showed that Alisertib could results indicate while metaphase plate could form when AURKB inhibit mitotic AURKA and AURKB, cells are generally exposed to alone was inhibited, it was not formed when both AURKA and inhibitors before they enter mitosis. To better recapitulate this AURKB were inhibited at the same time. situation, cells were first exposed to Alisertib before nocodazole Alternatively, AURKA could be specifically inactivated with the was added to trap cells in mitosis. Figure 1h confirms that while inhibitor MK-5108 (also called VX-689).15 Specific inhibition of Thr288 50 nM of Alisertib was adequate to prevent AURKA activation, 1 mM AURKA was demonstrated by the loss of mitotic AURKA of Alisertib was required to abolish AURKB activation. phosphorylation without affecting AURKBThr232 phosphorylation In addition to AURKA and AURKB, the anti-phospho-Aurora (Figure 3a). Likewise, activation of AURKA, but not AURKB, was antibody also recognized a faster-migrating band of similar size as inhibited by MK-5108 (Figure 3b). Flow cytometry analysis predicted for AURKC (indicated by an asterisk in this paper). indicated that MK-5108 induced a G2/M delay without evidence Nevertheless, several pieces of evidence suggested that the band of genome reduplication (Figure 3c), suggesting that AURKA is not AURKC (see Supplementary Figure S2). Instead, it could inhibition induced a mitotic exit delay without triggering mitotic be an isoform or truncated version of AURKB. In all our slippage. This was later confirmed more rigorously using live-cell experiments, phosphorylation of this band completely followed imaging (see Figure 7c). that of AURKB. Collectively, these results unequivocally show that inhibition of To consolidate the link between mitotic slippage and AURKB AURKB alone (rather than together with AURKA) is sufficient to inhibition, we conducted similar analysis with another AURKB trigger mitotic slippage, resulting in extensive apoptosis. inhibitor called ZM447439. Similar to Alisertib, ZM447439 also inhibited both AURKA and AURKB, with IC50 of 110 nM and 130 nM, p53 is activated by inhibitors of AURKA and AURKB respectively.13 Although ZM447439 could also inhibit AURKA without affecting AURKB, the range of concentrations that could To examine the relationship between p53 and inhibition of AURKA differentiate the two Aurora kinases was narrower compared with and AURKB, several p53-containing cell lines were challenged with Alisertib (Supplementary Figure S3A). Accordingly, cells readily different Aurora inhibitors. When HCT116 cells were incubated with Alisertib, both p53 and its downstream transcriptional underwent mitotic slippage when incubated with 1 mM of CIP1/WAF1 ZM447439, a concentration that targeted both AURKA and AURKB target p21 were stabilized in a dose-dependent manner (Supplementary Figure S3B). (Figure 4a). Notably, p53 was activated by Alisertib at concentra- To ascertain that p53-containing cells also responded similarly tions that targeted AURKA or AURKB (see Supplementary Figure S4). The results were confirmed with another p53-containing cell line to Alisertib, we treated HCT116 cells with Alisertib and showed its CIP1/WAF1 ability to differentially inhibit AURKA and AURKB (Supplementary HepG2 (Figure 4b). The p53-dependent nature of p21 induction was demonstrated by the fact that it was abolished in the Figure S4A). Single-cell analysis confirmed the dose-dependent À / À induction of mitotic retardation and slippage (Supplementary isogenic HCT116(p53 ) cell line (Figure 4b). We next examined if specific inhibition of AURKA or AURKB also Figure S4B). Clonogenic survival was reduced by inhibition of CIP1/WAF1 AURKA alone or together with AURKB (Supplementary Figure S4C). activates p53. Figure 4c shows both p53 and p21 were As expected, downregulation of AURKB with small interfering RNA induced after HCT116 cells were incubated with Barasertib or (siRNA) promoted Alisertib-mediated mitotic slippage, further MK-5108. Taken together, these results indicated that p53 is verifying that the mitotic slippage was triggered by an inhibition stabilized and activated after treatment with Aurora inhibitors at of AURKB (Supplementary Figure S4B). concentrations that induced mitotic exit delay or slippage. Collectively, these results indicate that AURKA and AURKB can be differentially inhibited by Alisertib, causing mitotic exit delay Loss of p53 promotes AURKB inhibition, mitotic slippage and and slippage, respectively. genome reduplication Given that p53 is activated by different Aurora inhibitors, we next examined if the mitotic responses to the Aurora inhibitors are Specific inhibition of AURKA and AURKB induces mitotic exit delay influenced by p53. Clones of HCT116 and HCT116(p53 À / À ) stably and mitotic slippage respectively expressing histone H2B-GFP were generated. The cells were Given that Alisertib and ZM447439 targeted both AURKA and examined with time-lapse microscopy after challenged with AURKB, we next sought to resolve if mitotic slippage could be Alisertib. Figure 5a shows that both p53-containing and -deficient induced by inhibition of AURKB alone by using the inhibitor cells responded to high concentration of Alisertib (1 mM) similarly Barasertib (also called AZD1152-HQPA).14 Figure 2a shows that by undergoing mitotic slippage. However, the cells behaved very Barasertib inactivated AURKB without affecting AURKA over a differently when treated with 250 nM of Alisertib: while HCT116 range of concentrations. In agreement with this, Barasertib exhibited a longer mitosis typical of AURKA inhibition stimulated mitotic slippage in B100% of the cells (Figures 2b (Supplementary Figure S4C), a large subset of HCT116(p53 À / À )

Oncogene (2014) 3550 – 3560 & 2014 Macmillan Publishers Limited p53 affects responses to Aurora kinase inhibitors M Marxer et al 3553

Figure 2. Barasertib inhibits AURKB specifically and triggers mitotic slippage. (a) Barasertib inhibits AURKB without affecting AURKA. Mitotic HeLa cells were obtained by exposure to nocodazole for 16 h followed by mechanical shake off. The cells were incubated with the indicated concentrations of Barasertib for 2 h. Nocodazole and MG132 were included to prevent mitotic exit. Lysates were prepared and analyzed with immunoblotting. Uniform loading was confirmed by immunoblotting for actin. (b) Barasertib induces mitotic slippage. HeLa cells expressing histone H2B-GFP were exposed to buffer or the indicated concentrations of Barasertib. Individual cells were then tracked for 24 h with time- lapse microscopy. Each horizontal bar represents one cell (n ¼ 50). The key is the same as in Figure 1b. (c) Summary of Barasertib-mediated mitotic slippage. Live-cell imaging after Barasertib treatment was described in panel (b). The duration of mitosis (mean±90% confidence interval) and the percentage of cells that underwent mitotic slippage during the imaging period were quantified. (d) Genome reduplication after Barasertib-mediated mitotic slippage. HeLa cells were treated with the indicated concentrations of Barasertib for 36 h. DNA contents were analyzed with flow cytometry. (e) Barasertib induces mitotic slippage and genome reduplication in HCT116. Cells were treated with the indicated concentrations of Barasertib for 24 h. DNA contents were analyzed with flow cytometry. (f) Cytotoxicity induced by Barasertib. HeLa and HCT116 cells were cultured in the presence of the indicated concentrations of Barasertib for 48 h. Proliferation was assayed with WST-1 assay. (g) Barasertib induces genome reduplication and apoptosis. HeLa cells were incubated with 50 nM of Barasertib either in the presence or absence of the caspase inhibitor Z-VAD(OMe)-FMK. The cells were harvested at the indicated time points and analyzed with flow cytometry.

underwent very protracted mitosis as well as mitotic slippage. In infrared imaging system, no significant difference in AURKA was agreement with this, more HCT116(p53 À / À ) displayed 4N DNA found between the two cell lines and a twofold increase in AURKB contents after treatment with 250 nM of Alisertib than HCT116 was found in the p53-deficient cells (data not shown). Further- (Figure 5b). As the post-mitotic checkpoint also relies on p53, the more, phosphorylation of AURKAThr288 and AURKBThr232 was HCT116(p53 À / À ) cells also underwent genome reduplication after inhibited similarly in the presence or absence of p53 (Figure 5e), mitotic slippage (8N DNA contents). Also in agreement with the suggesting that the differential response was unlikely to be due to cytotoxicity associated with mitotic slippage (see above), the Aurora kinases per se. HCT116(p53 À / À ) appeared to be more sensitive than HCT116 to Although HCT116 and HCT116(p53 À / À ) are isogenic cell lines, Alisertib in long-term clonogenic survival (Figure 5c). the fact that p53 is essential for maintaining genome stability A trivial explanation of the difference in drug sensitivity of p53- opens the possibility that many genetic alterations may have containing and -deficient cells is that the p53-deficient cells occurred during culturing. To avoid the indirect effects due to the contained less AURKA and AURKB than wild-type cells. To test this long-term p53 deficiency, we also performed experiments in which hypothesis, the expression of AURKA and AURKB in HCT116 and p53 was transiently depleted with siRNAs (Figure 6a). Figure 6b HCT116(p53 À / À ) was examined side-by-side by immunoblotting shows that p53-depleted HCT116 cells underwent mitotic slippage (Figure 5d). By quantifying the immunoblots using the Odysseus at lower concentrations of Alisertib than control-depleted cells.

& 2014 Macmillan Publishers Limited Oncogene (2014) 3550 – 3560 p53 affects responses to Aurora kinase inhibitors M Marxer et al 3554

Figure 3. MK-5108 specifically inhibits AURKA and delays mitotic exit. (a) MK-5108 inhibits AURKA but not AURKB. Mitotic HeLa cells were obtained by exposure to nocodazole for 16 h followed by mechanical shake off. The cells were incubated with the indicated concentrations of MK-5108 for 2 h. Nocodazole and MG132 were included to prevent mitotic exit. Lysates were then prepared and activated phospho- AURKAThr288 and AURKBThr232 were detected with immunoblotting. Uniform loading was confirmed by immunoblotting for actin. (b) MK-5108 prevents activation of AURKA but not AURKB. HeLa cells were incubated with the indicated concentrations of MK-5108 for 8 h. Nocodazole was then added for another 6 h to trap any cells that entered mitosis. Mitotic cells were isolated by mechanical shake off. Lysates were prepared and analyzed with immunoblotting. Actin analysis was included to assess loading and transfer. (c) MK-5108 induces a G2/M delay. HeLa cells were treated with the indicated concentrations of MK-5108 for 24 h. DNA contents were analyzed with flow cytometry.

Effective depletion of p53 was confirmed by immunoblotting Loss of p53 promotes AURKA inhibition and mitotic defects (Figure 6c). Of note is that the expression of AURKA and AURKB In addition to inducing mitotic slippage, Alisertib also delayed was not affected by the p53 siRNA. These results indicated that mitotic exit in p53-deficient cells (Figure 4a), suggesting that the sensitivity to Alisertib-mediated mitotic slippage was also AURKA inactivation was also sensitized by p53 deficiency. To test increased in cells transiently depleted of p53. this directly, we treated p53-proficient and -deficient cells with the As Alisertib inhibited both AURKA and AURKB, we next AURKA-specific inhibitor MK-5108. As expected, incubation with investigated whether p53 deficiency sensitized cells specifically MK-5108 lengthened the mitosis of HCT116 cells in a dose- to AURKB inhibition. HCT116 cells were transfected with control dependent manner (Figure 7c). Consistent with the specific or p53 siRNAs before incubating with different concentrations inhibition of AURKA, mitotic slippage was not induced. Signifi- of Barasertib. Figure 7a shows that while only B20% of control cantly, lower concentrations of MK-5108 were sufficient to delay cells underwent mitotic slippage in the presence of 6.25 nM mitotic exit in HCT116(p53 À / À ) cells than in control HCT116 cells of Barasertib, B60% of p53-depleted cells underwent mitotic (quantified in Figure 7d). Collectively, these results indicate that slippage with the same treatment (summarized in Figure 7b). the loss of p53 sensitizes cells to the inhibition of both AURKA and We also depleted p53 in another cell line (HepG2) to verify AURKB. these results. Once again the abundance of AURKA or AURKB was not affected by the absence of p53 (Figure 6c). Single-cell analysis revealed that p53-depleted HepG2 cells were more prone to mitotic slippage after Barasertib treatment than control cells DISCUSSION (Supplementary Figure S6). Given that inhibition of AURKA and AURKB causes essentially Collectively, these data indicate that cells lacking p53, either by opposite effects (mitotic exit delay and mitotic slippage, gene disruption or siRNA-mediated depletion, are sensitized to respectively), the two Aurora kinases in fact represent two AURKB inhibitors, resulting in mitotic slippage and subsequent different anti-cancer drug targets. We used an antibody that genome reduplication. recognized phosphorylated AURKAThr288 and AURKBThr232 to

Oncogene (2014) 3550 – 3560 & 2014 Macmillan Publishers Limited p53 affects responses to Aurora kinase inhibitors M Marxer et al 3555 inhibitors including VX-68016 and ZM447439.17 However, the mechanism leading to mitotic slippage appears to be different when AURKA was also inhibited, because some cells could form a metaphase plate after AURKB alone was inhibited with Barasertib (Supplementary Video S5). Interestingly, the precise effects of inhibition of AURKB by Barasertib may be cell line-specific. In contrast to HeLa (Figure 2) and HCT116 cells (data not shown), which underwent mitotic slippage in the presence of Barasertib, HONE1 cells (nasopharyngeal carcinoma) underwent chromosome segregation before failing cytokinesis, giving rise to binucleated tetraploid cells (Jinny Hong and RYCP, unpublished data). This is in agreement from studies using chicken DT40 cells, in which cells lacking AURKB can form bipolar spindles but fail to properly align their chromosomes and exit mitosis with cytokinesis defects. Only when both AURKA and AURKB were deleted, cells exit mitosis without anaphase.18 Whether AURKA or AURKB is the better anti-cancer drug target is debatable.9 This may not be such a critical consideration in the past due to the fact that early generations of Aurora kinase inhibitors are generally not very specific and target both AURKA and AURKB. And as discussed above, this essentially promotes mitotic slippage followed by apoptosis. With the more recent development of relative specific inhibitors, this question has become relevant, in particular for treatment of cancer cells that have different propensity in undergoing mitotic slippage. Compared with inhibition of AURKB, inhibition of AURKA perhaps has an advantage of eliminating cancer cells quickly during the mitotic block. Nevertheless, as can be seen after HeLa cells were treated with 250 nM of Alisertib (Figures 1b and Supplementary Figure S1), only a portion of cells underwent apoptosis during mitosis. The rest (10–30%) were eventually able to complete mitosis. This proportion was consistent with the percentage of clonogenic survival after Alisertib treatment (Figure 1f). Mitotic cell death was even less pronounced in HCT116 than in HeLa after treatment with concentrations of Alisertib that inhibited AURKA (Supplementary Figure S4C) or with the AURKA-specific MK-5108 (Figure 7c). Nevertheless, HCT116 cells were very sensitive to AURKA inhibition as measured with clonogenic survival (Supplementary Figure S4B). The discrepancy Figure 4. p53 is activated after inhibition of AURKA and AURKB. (a) Activation of p53 by Alisertib. HCT116 cells were incubated with was likely to be due to the activation of p53 by the AURKA the indicated concentrations of Alisertib for 24 h. Lysates were inhibitors (Figure 4), which possibly could trigger cell cycle arrest prepared and analyzed with immunoblotting. Uniform loading and apoptosis after the initial mitotic arrest. In support of this, the CIP1/WAF1 was confirmed by immunoblotting for actin. (b) p53-dependent p53 downstream target p21 was induced after treatment activation of p21CIP1/WAF1 by Alisertib. HepG2, HCT116 and with Alisertib or MK-5108 (Figure 4). HCT116(p53 À / À ) cells were incubated with buffer or Alisertib Inhibition of AURKB, in contrast, triggers mitotic slippage and (250 nM or 1 mM) for 24 h. Lysates were prepared and analyzed with CIP1/WAF1 tetraploidization. A p53-dependent ‘tetraploidy checkpoint’ has immunoblotting. (c) Activation of p53-p21 pathway by been proposed to prevent S-phase entry in cells that have inhibitors of AURKA and AURKB. HCT116 cells were treated with undergone mitotic slippage or aborted cytokinesis.19 The buffer, Barasertib (25 nM and 50 nM) or MK-5108 (0.5 mM and 1 mM) for 24 h. Lysates were prepared and analyzed with immunoblotting. checkpoint is implicated to sense the increase in chromosome number and halt the cell in a tetraploid G1 state. However, the existence of this checkpoint has been disputed.20–22 It is likely that the p53-dependent arrest after tetraploidization is mainly due to determine the activation (Figure 1h) or inactivation (Figure 1g) of DNA damage or centrosomal stress during the aberrant mitosis.23 the Aurora kinases. These analyses could differentiate the actions Irrespective of the actual signals that activate the checkpoint, of different Aurora kinase inhibitors. Pan-Aurora kinase inhibitor p53 was clearly activated by Aurora kinase inhibitors that triggered that inhibited both AURKA and AURKB was exemplified by mitotic slippage (Figure 4). This may at least explain why despite ZM447439 (Supplementary Figure S3). Although Alisertib was also the fact that B90% of HCT116 cells survived after mitotic slippage a pan-Aurora kinase inhibitor, it inhibited either AURKA alone or (for example, Supplementary Figure S4C), clonogenic survival AURKA and AURKB simultaneously in a concentration-dependent was only at B20% (Supplementary Figure S4B). How inhibition of manner (Figures 1g and h). By contrast, newer generation of Aurora kinases activates p53 is not completely understood. As inhibitors such as MK-5108 (Figure 3) or Barasertib (Figure 2a) AURKA has been shown to directly phosphorylate p53 and could achieve specific inhibition of AURKA or AURKB, respectively. downregulate its transactivation activity and protein stability, One conclusion from experiments using these small-molecule AURKA inhibitors are expected to promote the accumulation and inhibitors is that inhibition of AURKB alone (rather than together activity of p53.10,11 AURKB has not been shown to regulate p53 with AURKA) is sufficient to trigger mitotic slippage, indicating directly. Instead of direct action, it is possible that stress during the that mitotic slippage does not require AURKA to be first inhibited. aberrant mitosis caused by AURKB inhibition may be involved in This is in good agreement with studies using other pan-Aurora activating p53.

& 2014 Macmillan Publishers Limited Oncogene (2014) 3550 – 3560 p53 affects responses to Aurora kinase inhibitors M Marxer et al 3556

Figure 5. Loss of p53 increases sensitivity to Alisertib. (a) p53 deficiency sensitizes cells to Alisertib-mediated mitotic exit delay and slippage. HCT116 and HCT116(p53 À / À ) cells expressing histone H2B-GFP were exposed to buffer or the indicated concentrations of Alisertib. Individual cells were then tracked for 24 h with time-lapse microscopy. Each horizontal bar represents one cell (n ¼ 50). The key is the same as in Figure 1b. (b) p53 deficiency promotes Alisertib-mediated mitotic slippage and genome reduplication. HCT116 and HCT116(p53 À / À ) cells were incubated with buffer or the indicated concentrations of Alisertib. After 24 h, the cells were harvested and analyzed with flow cytometry. (c) p53 deficiency sensitizes cells to Alisertib-mediated cytotoxicity. HCT116 and HCT116(p53 À / À ) cells were treated with buffer or the indicated concentrations of Alisertib. After 24 h, the cells were washed gently and grown in normal medium for another 10–12 days. Colonies were fixed and stained with crystal violet staining solution. Average±s.d. from three independent experiments. (d) Similar levels of Aurora kinases are present in HCT116 and HCT116(p53 À / À ) cells. Cells were treated with buffer or the indicated concentrations of Alisertib for 24 h. Lysates were prepared and analyzed with immunoblotting. (e) Alisertib prevents activation of AURKA and AURKB independently of p53. HCT116 cells were incubated with the indicated concentrations of Alisertib for 8 h. Buffer or nocodazole was then added for another 6 h to trap cells in mitosis. Lysates were prepared and analyzed with immunoblotting.

Oncogene (2014) 3550 – 3560 & 2014 Macmillan Publishers Limited p53 affects responses to Aurora kinase inhibitors M Marxer et al 3557

Figure 6. Downregulation of p53 sensitizes cells to Alisertib. (a) Downregulation of p53 sensitizes cells to Alisertib. HCT116 cells expressing histone H2B-GFP were transfected with either control or p53 siRNAs. The cells were then treated with buffer or the indicated concentrations of Alisertib. Individual cells were then tracked for 24 h with time-lapse microscopy. Each horizontal bar represents one cell (n ¼ 50). The key is the same as in Figure 1b. (b) Downregulation of p53 promotes Alisertib-mediated mitotic slippage. Live-cell imaging after p53 siRNA transfection and Alisertib treatment was performed as described in panel (a) (with additional concentrations of Alisertib). The percentage of cells that underwent mitotic slippage during the imaging period was quantiﬁed. (c) Downregulation of p53 with siRNAs. The indicated cell lines were transfected with either control or p53 siRNAs. After 24 h, the cells were incubated with nocodazole for another 12 h to enrich mitotic cells. Lysates were prepared and analyzed with immunoblotting. Uniform loading was conﬁrmed by immunoblotting for actin.

Nevertheless, p53-dependent mechanism was clearly not the genome reduplication and subsequent multipolar mitosis after only mechanism that suppressed cell growth after mitotic mitotic slippage (Figures 1a–d). slippage. For example, HeLa cells also have low clonogenic Collectively, our data suggest that the status of p53 affects the survival after Alisertib-induced mitotic slippage (Figure 1f). This effectiveness of AURKA- and AURKB-based therapies differently. p53-independent cytotoxicity was likely to be contributed by the As both AURKA- and AURKB-speciﬁc inhibitors activate p53, cell

& 2014 Macmillan Publishers Limited Oncogene (2014) 3550 – 3560 p53 affects responses to Aurora kinase inhibitors M Marxer et al 3558

Figure 7. p53 deficiency promotes specific inhibition of AURKA and AURKB. (a) Downregulation of p53 sensitizes cells to Barasertib. HCT116 cells expressing histone H2B-GFP were transfected with either control or p53 siRNAs. The cells were then treated with buffer or the indicated concentrations of Barasertib. Individual cells were then tracked for 24 h with time-lapse microscopy. Each horizontal bar represents one cell (n ¼ 50). The key is the same as in Figure 1b. (b) Downregulation of p53 sensitizes cells to Barasertib-mediated mitotic slippage. Live-cell imaging after siRNA transfection and Barasertib treatment was described in panel (a). The percentage of cells that underwent mitotic slippage during the imaging period was quantified. (c) Increased sensitivity to MK-5108 in the absence of p53. HCT116 and HCT116(p53 À / À ) cells expressing histone H2B-GFP were treated with buffer or the indicated concentrations of MK-5108. Individual cells were then tracked for 24 h with time-lapse microscopy. Each horizontal bar represents one cell (n ¼ 50). The key is the same as in Figure 1b. (d) p53 deficiency increases AURKA inhibition-mediated delay in mitotic exit. Live-cell imaging after MK-5108 treatment was described in panel (c). The duration of mitosis was quantified (mean±90% confidence interval).

cycle arrest and apoptosis are major treatment outcomes for p53 promotes the survival of cells that can complete mitosis after p53-positive cells. For p53-negative cells treated with AURKB treatment with AURKA inhibitors. But it is also possible that other inhibitors, however, genome reduplication and multipolar mitosis mechanisms, such as p73, are involved in apoptosis after AURKA after mitotic slippage become unchecked, and many cells are then inhibition in p53-deﬁcient cells.24 eliminated due to gross chromosomal instability. Following these In this study, we found that in addition to its role in cell cycle arguments, AURKB inhibitors should be effective for both arrest and apoptosis, p53 also affected the intrinsic sensitivity p53-positive and -negative cells. On the other hand, the lack of to Aurora kinase inhibitors. Compare to HCT116 cells, HCT116

Oncogene (2014) 3550 – 3560 & 2014 Macmillan Publishers Limited p53 affects responses to Aurora kinase inhibitors M Marxer et al 3559 (p53 À / À ) cells were more sensitive to the AURKA inhibitor protein. Cells were propagated in Dulbecco’s modified Eagle’s medium MK-5108 (Figure 7c) and the AURKB inhibitor Barasertib supplemented with 10% (v/v) calf serum (Life Technologies, Carlsbad, CA, (Figure 7a). The main effects of inhibition of the individual USA) (for HeLa) or fetal bovine serum (Life Technologies) (for HCT116 and Aurora kinase, namely mitotic exit delay or mitotic slippage, were HepG2) and 50 U/ml penicillin streptomycin (Life Technologies) in a 1 induced by a lower drug concentration in HCT116(p53 À / À ) cells. humidified incubator at 37 Cin5%CO2. Unless stated otherwise, cells were treated with the following reagents at the indicated final Consistent with these results, HCT116(p53 À / À ) cells were more concentration: Alisertib (Selleck Chemicals, Houston, TX, USA) (1 mM), sensitive than HCT116 to Alisertib-induced mitotic exit delay Barasertib (Selleck Chemicals) (25 nM), MG132 (10 mM), nocodazole (0.1 mg/ and slippage (Figure 5a) and in long-term clonogenic survival ml for HeLa; 0.4 mg/ml for HCT116), thymidine (2 mM), MK-5108 (Selleck (Figure 5c). Similar results were obtained when p53 was depleted Chemicals) (1 mM), ZM447439 (Selleck Chemicals) (2 mM) and Z-VAD(OMe)- with siRNAs (Figure 6a and Supplementary Figure S6), excluding FMK (Enzo Life Sciences, Farmingdale, NY, USA) (10 mM). Synchronization at the possibility that the p53-dependent effects were resulted mitosis was performed by first releasing cells from a double thymidine 32 from long-term genome instability. Similar results were also block for 6 h before adding nocodazole for another 6 h; mitotic cells were then collected by mechanical shake off. Cell-free extracts were prepared as obtained when we imaged the cells using bright field only (using 33 re-attachment as an indicator of mitotic slippage), excluding the described previously. possibility that UV stress of the imaging may contribute to the p53-dependent responses (our unpublished data). siRNA and transfection Why a loss of p53 increases in sensitivity to Aurora kinase Cells were transfected with siRNA by Lipofectamine RNAiMAX (Life Techno- inhibitors? The expression of AURKA and AURKB was not affected logies). The following siRNAs were obtained from the indicated suppliers: after p53 was disrupted with homologous recombination or AURKA 50-GGCCAAUGCUCAGAGAAGUACUUGA-30), AURKB (50-UCUUAGGGCU 0 0 depletion with siRNAs (Figure 6c). Inactivation of individual Aurora CAAGGGAGAGCUGAA-3 ), p53 (a mixture of three siRNA was used: 5 -GCUU CGAGAUGUUCCGAGAGCUGAA 0 0 CCGGACGAUAUUGAACAAUGGUUCA 0 kinases also appeared to be unaffected by p53 (Figure 5e). In fact, -3 ,5- -3 and 50-GCCAAGUCUGUGACUUGCACGUACU-30) (Life Technologies); AURKC the answer to the question may not be straightforward due to the (50-GAUCCAGGCUCAUCUACAA-30) (RiboBio, Guangzhou, China). myriad of transcriptional targets of p53 and the equally numerous substrates of Aurora kinases. Several p53 targets including GADD45a have been reported to interact with Aurora kinases.25 Cell viability assays 34 However, we did not detect differences in GADD45a expression in Trypan blue analysis was performed as described. WST-1 assays were p53-containing and -deficient cells with or without Aurora kinase performed according to the instructions of the manufacturer (Roche Applied Science, Indianapolis, IN, USA). For clonogenic survival assays, 1000 inhibition (our unpublished data). Likewise, knockdown of the p53 CIP1/WAF1 cells were seeded onto 60 mm-dishes. After 12 h, the cells were either target p21 did not affect responses to Aurora kinase mock treated or exposed to the different concentrations of drugs for inhibitors (our unpublished data). another 24 h. The cells were then gently washed three times with Although the molecular basis of p53-dependent sensitivity to phosphate-buffered saline and cultured in normal medium. After 10 days, Aurora kinase inhibitors is not known, the fact that p53 is mutated colonies were fixed with methanol/acetic acid (2:1 v/v) and visualized by in half of all cancers has important implications in therapies staining with 2% (w/v) crystal violet in 20% methanol. targeting Aurora kinases. Several published studies have also hinted the involvement of p53 in the sensitivity to Aurora Flow cytometry inhibitors. For example, Barasertib-mediated radiosensitization is Flow cytometry analysis after propidium iodide staining was performed as more pronounced in p53-negative cancer cells than in p53- described previously.34 positive cells.26 The induction of endoreduplication and apoptosis by VX-680 was also more effective in cells lacking the p53 post- Live-cell imaging mitotic checkpoint.27 Other studies, however, did not observe an effect of p53 on Aurora kinase inhibitors.28 It should be noted that Cells were seeded onto poly-lysine-coated glass plates and imaged using a TE2000E-PFS inverted fluorescent microscope, Plan Fluor ELWD ADL 20X the published studies are mainly based on end-point assays. Only objective N.A. 0.45 (Nikon, Melville, NY, USA) equipped with a 1 K Â 1K, the extensive use of live-cell imaging allowed us to identify the 8 mm2 pixels, cooling SPOT BOOST EMCCD camera (Diagnostic Instrument, increase in mitotic exit delay and slippage in the absence of p53, Sterling Heights, MI, USA) and a INU-NI- F1 temperature, humidity, and CO2 which may also explain why these discoveries have not been control system (Tokai Hit, Shizuoka-ken, Japan). enhanced green fluor- made earlier. escent protein was excited by 12.5% output of HG Precentered Fiber In conclusion, loss of p53 increases sensitivity to pharmaco- Illuminator (Nikon) with HQ470/30 excitation filter (Chroma, Bellows Falls, logical inhibition of both AURKA and AURKB, causing mitotic exit VT, USA). The fluorescent images were acquired with minimal exposure delay and slippage, respectively. As the p53 post-mitotic time (50–200 ms). Data acquisition was carried out at 5 m/frame. checkpoint is also important for preventing genome reduplication after mitotic slippage, p53 deficiency represents a ‘double Antibodies and immunological methods whammy’ for cancer cells treated with Aurora kinase inhibitors. Antibodies against b-actin,35 CDK136 and cyclin B130 were obtained from sources as described previously. Antibodies against phospho-histone H3Ser10, p21CIP1/WAF1, p53 and PLK1 (Santa Cruz Biotechnology, Santa MATERIALS AND METHODS Cruz, CA, USA), AURKA (BD Biosciences, Franklin Lakes, NJ, USA), AURKB (Sigma-Aldrich), AURKC (Life Technologies) and phospho-AURKAThr288/ Materials AURKBThr232/AURKCThr198 (Cell Signaling Technology, Beverly, MA, USA) All reagents were obtained from Sigma-Aldrich (St Louis, MO, USA) unless were obtained from the indicated suppliers. Immunoblotting was stated otherwise. performed as described.33

Cell culture CONFLICT OF INTEREST HepG2 was obtained from the American Type Culture Collection (Manassas, VA, USA). HCT116 (colorectal carcinoma) and HCT116 The authors declare no conflict of interest. (p53 À / À ) were gifts from Dr Bert Vogelstein (Johns Hopkins University). No authentication was done by the authors. The HeLa used in this study was a clone that expressed the tTA tetracycline repressor chimera.29 ACKNOWLEDGEMENTS HeLa30 and HCT11631 that stably expressed histone H2B-green fluorescent Many thanks are due to Michelle Chen, Nelson Lee and Kenji Nishiura for technical protein were used for live-cell imaging. Similar approach was used to assistance. This work was supported in part by the Research Grants Council grant generate HCT116(p53 À / À ) that expressed histone H2B-green fluorescent HKU7/CRG/09 to RYCP.

& 2014 Macmillan Publishers Limited Oncogene (2014) 3550 – 3560 p53 affects responses to Aurora kinase inhibitors M Marxer et al 3560 REFERENCES 19 Andreassen PR, Lohez OD, Lacroix FB, Margolis RL. Tetraploid state induces p53- 1 Ma HT, Poon RY. How protein kinases co-ordinate mitosis in animal cells. Biochem dependent arrest of nontransformed mammalian cells in G1. Mol Biol Cell 2001; J 2011; 435: 17–31. 12: 1315–1328. 2 Karthigeyan D, Prasad SB, Shandilya J, Agrawal S, Kundu TK. Biology of Aurora A 20 Fujiwara T, Bandi M, Nitta M, Ivanova EV, Bronson RT, Pellman D. Cytokinesis kinase: implications in cancer manifestation and therapy. Med Res Rev 2010; 31: failure generating tetraploids promotes tumorigenesis in p53-null cells. Nature 757–793. 2005; 437: 1043–1047. 3 Ruchaud S, Carmena M, Earnshaw WC. Chromosomal passengers: conducting cell 21 Uetake Y, Sluder G. Cell cycle progression after cleavage failure: mammalian division. Nat Rev Mol Cell Biol 2007; 8: 798–812. somatic cells do not possess a "tetraploidy checkpoint". J Cell Biol 2004; 165: 4 Kimura M, Matsuda Y, Yoshioka T, Okano Y. Cell cycle-dependent expression and 609–615. centrosome localization of a third human aurora/Ipl1-related protein kinase, AIK3. 22 Wong C, Stearns T. Mammalian cells lack checkpoints for tetraploidy, aberrant J Biol Chem 1999; 274: 7334–7340. centrosome number, and cytokinesis failure. BMC Cell Biol 2005; 6:6. 5 Scutt PJ, Chu ML, Sloane DA, Cherry M, Bignell CR, Williams DH et al. Discovery 23 Storchova Z, Kuffer C. The consequences of tetraploidy and aneuploidy. J Cell Sci and exploitation of inhibitor-resistant aurora and polo kinase mutants for the 2008; 121: 3859–3866. analysis of mitotic networks. J Biol Chem 2009; 284: 15880–15893. 24 Dar AA, Belkhiri A, Ecsedy J, Zaika A, El-Rifai W. Aurora kinase A inhibition leads to 6 Yasui Y, Urano T, Kawajiri A, Nagata K, Tatsuka M, Saya H et al. Autophos- p73-dependent apoptosis in p53-deficient cancer cells. Cancer Res 2008; 68: phorylation of a newly identified site of Aurora-B is indispensable for cytokinesis. 8998–9004. J Biol Chem 2004; 279: 12997–13003. 25 Shao S, Wang Y, Jin S, Song Y, Wang X, Fan W et al. Gadd45a interacts with aurora- 7 Gautschi O, Heighway J, Mack PC, Purnell PR, Lara PNJ, Gandara DR. Aurora A and inhibits its kinase activity. J Biol Chem 2006; 281: 28943–28950. kinases as anticancer drug targets. Clin Cancer Res 2008; 14: 1639–1648. 26 Tao Y, Zhang P, Girdler F, Frascogna V, Castedo M, Bourhis J et al. Enhancement of 8 Green MR, Woolery JE, Mahadevan D. Update on Aurora kinase targeted ther- radiation response in p53-deficient cancer cells by the Aurora-B kinase inhibitor apeutics in oncology. Expert Opin Drug Discov 2011; 6: 291–307. AZD1152. Oncogene 2008; 27: 3244–3255. 9 Keen N, Taylor S. Aurora-kinase inhibitors as anticancer agents. Nat Rev Cancer 27 Gizatullin F, Yao Y, Kung V, Harding MW, Loda M, Shapiro GI. The Aurora kinase 2004; 4: 927–936. inhibitor VX-680 induces endoreduplication and apoptosis preferentially in cells 10 Liu Q, Kaneko S, Yang L, Feldman RI, Nicosia SV, Chen J et al. Aurora-A abrogation with compromised p53-dependent postmitotic checkpoint function. Cancer Res of p53 DNA binding and transactivation activity by phosphorylation of serine 215. 2006; 66: 7668–7677. J Biol Chem 2004; 279: 52175–52182. 28 Curry J, Angove H, Fazal L, Lyons J, Reule M, Thompson N et al. Aurora B kinase 11 Katayama H, Sasai K, Kawai H, Yuan ZM, Bondaruk J, Suzuki F et al. Phospho- inhibition in mitosis: strategies for optimising the use of aurora kinase inhibitors rylation by aurora kinase A induces Mdm2-mediated destabilization and inhibi- such as AT9283. Cell Cycle 2009; 8: 1921–1929. tion of p53. Nat Genet 2004; 36: 55–62. 29 Yam CH, Siu WY, Lau A, Poon RY. Degradation of cyclin A does not require its 12 Manfredi MG, Ecsedy JA, Chakravarty A, Silverman L, Zhang M, Hoar KM et al. phosphorylation by CDC2 and cyclin-dependent kinase 2. J Biol Chem 2000; 275: Characterization of Alisertib (MLN8237), an investigational small-molecule inhi- 3158–3167. bitor of aurora A kinase using novel in vivo pharmacodynamic assays. Clin Cancer 30 Chan YW, Ma HT, Wong W, Ho CC, On KF, Poon RY. CDK1 inhibitors antagonize Res 2011; 17: 7614–7624. the immediate apoptosis triggered by spindle disruption but promote apoptosis 13 Ditchfield C, Johnson VL, Tighe A, Ellston R, Haworth C, Johnson T et al. Aurora B following the subsequent rereplication and abnormal mitosis. Cell Cycle 2008; 7: couples chromosome alignment with anaphase by targeting BubR1, Mad2, and 1449–1461. Cenp-E to kinetochores. J Cell Biol 2003; 161: 267–280. 31 On KF, Chen Y, Ma HT, Chow JP, Poon RY. Determinants of mitotic catastrophe on 14 Yang J, Ikezoe T, Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y et al. AZD1152, a abrogation of the G2 DNA damage checkpoint by UCN-01. Mol Cancer Ther 2011; novel and selective aurora B kinase inhibitor, induces growth arrest, 10: 784–794. apoptosis, and sensitization for tubulin depolymerizing agent or topoisomerase II 32 Ma HT, Poon RY. Synchronization of HeLa cells. Methods Mol Biol 2011; 761: inhibitor in human acute leukemia cells in vitro and in vivo. Blood 2007; 110: 151–161. 2034–2040. 33 Poon RY, Toyoshima H, Hunter T. Redistribution of the CDK inhibitor p27 between 15 Shimomura T, Hasako S, Nakatsuru Y, Mita T, Ichikawa K, Kodera T et al. MK-5108, different cyclin.CDK complexes in the mouse fibroblast cell cycle and in cells a highly selective Aurora-A kinase inhibitor, shows antitumor activity alone and in arrested with lovastatin or ultraviolet irradiation. Mol Biol Cell 1995; 6: 1197–1213. combination with docetaxel. Mol Cancer Ther 2010; 9: 157–166. 34 Siu WY, Arooz T, Poon RY. Differential responses of proliferating versus quiescent 16 Harrington EA, Bebbington D, Moore J, Rasmussen RK, Ajose-Adeogun AO, cells to adriamycin. Exp Cell Res 1999; 250: 131–141. Nakayama T et al. VX-680, a potent and selective small-molecule inhibitor 35 Chan YW, On KF, Chan WM, Wong W, Siu HO, Hau PM et al. The kinetics of p53 of the Aurora kinases, suppresses tumor growth in vivo. Nat Med 2004; 10: activation versus cyclin E accumulation underlies the relationship between the 262–267. spindle-assembly checkpoint and the postmitotic checkpoint. J Biol Chem 2008; 17 Girdler F, Gascoigne KE, Eyers PA, Hartmuth S, Crafter C, Foote KM et al. Validating 283: 15716–15723. Aurora B as an anti-cancer drug target. J Cell Sci 2006; 119: 3664–3675. 36 Siu WY, Lau A, Arooz T, Chow JP, Ho HT, Poon RY. Topoisomerase poisons 18 Hegarat N, Smith E, Nayak G, Takeda S, Eyers PA, Hochegger H. Aurora A and differentially activate DNA damage checkpoints through ataxia-telangiectasia Aurora B jointly coordinate chromosome segregation and anaphase microtubule mutated-dependent and -independent mechanisms. Mol Cancer Ther 2004; 3: dynamics. J Cell Biol 2011; 195: 1103–1113. 621–632.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)

Oncogene (2014) 3550 – 3560 & 2014 Macmillan Publishers Limited