Accumulation and Toxicity of Lanthanum and Neodymium in Horticultural Plants

Home , Dicoma, Lanthanum

Arefeh Rezaee

A Thesis

Presented to

The University of Guelph

In partial fulfillment of requirements

for the degree of

Master of Applied Science

Engineering

Guelph, Ontario, Canada

Accumulation and Toxicity of Lanthanum and Neodymium in Horticultural Plants

Arefeh Rezaee Advisors: University of Guelph, 2016 Dr. Emily YW Chiang Dr. Beverley Hale

In this study, the dose response of Brassica chinensis L. and Helianthus annuus L. to light rare earth elements (REEs), lanthanum and neodymium, were investigated in vitro. The phytotoxicity of the studied REEs was determined by measuring the aboveground and belowground biomass, and the chlorophyll concentration of the plants. The half maximal inhibitory concentration (IC50) in plant biomass and total chlorophyll concentration were estimated. The available ion species of La and Nd for plant uptake were determined through geochemical modeling. The concentration of these elements in the plants was measured to assay the ability of these plants to hyperaccumulate. Low dosages of La and Nd showed hormetic effects on the shoot and root masses of Helianthus annuus L., while both elements at high concentrations were toxic to the species tested. Tissue content analysis result indicated that the plants were not effective hyperaccumulators.

ACKNOWLEDGMENT

First, I would like to express my appreciation and gratitude to my advisor, Dr. Emily YW Chiang and my co-advisor Dr. Beverley Hale for their guidance and support of my research, this work would not have been possible without their support. In addition, I would like to mention my enormous appreciation for the guidance and help I received from Dr. Rafael Santos, Dr. Luba Vasiluk, Dr. Loo-Sar Chia, and Mr. Peter Smith.

Finally, I would like to thank my family for all their love, constant support, and understanding. My sincere thanks to my mother for her endless love and support, and also continuous encouragement throughout my study. Life would be meaningless without you.

iii

I dedicate this thesis to my late father

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGMENT...... iii

LIST OF TABLES ...... viii

LIST OF FIGURES ...... ix

INTRODUCTION ...... 1

LITERATURE REVIEW ...... 5

2.1. Phytomining Definition and Application ...... 5

2.2. Internal Factor Affecting Phytomining ...... 6

2.2.1. Hyperaccumulator Plants ...... 6

2.2.2. Metal Uptake Mechanism in Plants ...... 10

2.2.3. Genetic Mechanism of Metal Hyperaccumulation in Plants ...... 12

2.3. Hormesis and Metal Effects on Plant Growth...... 13

2.4. Photosynthesis Activity and Metal Accumulation Effects on Chlorophyll ...... 14

2.5. External Factors Affecting Metal Uptake by Plants ...... 15

2.5.1. Metal in Soils ...... 15

2.5.2. Soil pH ...... 16

2.5.3. Fertilizer ...... 17

2.5.4. Chelate ...... 17

2.6. Rare Earth Elements (REEs) ...... 18

2.7. An Economically Feasible Model for Phytomining ...... 21

OBJECTIVES ...... 23

MATERIALs AND METHODs ...... 24

4.1. Seed Sterilization and Germination ...... 24

Failed Seed Germination...... 25

4.2. Media Preparation and Metal Exposure ...... 26

4.2.1. Metal Oxide Powder Dissolution and Stock Solution Preparation ...... 26

4.2.2. Murashige & Skoog (MS) Medium Preparation ...... 28

4.3. Growth Condition ...... 29

4.4. Chlorophyll Extraction...... 29

4.5. Biomass Assessment, Plant Tissue Digestion, and Tissue Metal Content ...... 30

4.6. Toxicity Threshold (IC50) ...... 30

4.7. Ion Speciation ...... 31

4.8. Gene Expression Analysis ...... 31

4.8.1. Total RNA Extraction ...... 31

4.8.2. RNA Analysis ...... 33

4.8.3. Primer Design ...... 33

4.9. Statistical Analysis ...... 34

RESULTS ...... 35

Brassica chinensis L. Growth Response to Lanthanum and Estimated IC50 Values ... 35

Brassica chinensis L. Growth Response to Neodymium and Estimated IC50 Values . 38

Helianthus annuus L. Growth Response to Lanthanum and Estimated IC50 Values .. 41

Helianthus annuus L. Growth Response to Neodymium and Estimated IC50 Values . 45

Brassica chinensis L. Chlorophyll Response to Lanthanum and Neodymium, and Estimated IC50 Values ...... 48

Helianthus annuus L. Chlorophyll Response to Lanthanum and Neodymium, and Estimated IC50 Values ...... 49

Rare Earth Element Speciation And Uptake by Plants ...... 50

HMA4 Gene Expression ...... 54

DISCUSSION ...... 55

6.1. Growth Response and Inhibitory Concentration...... 55

6.2. Chlorophyll Response to Lanthanum and Neodymium ...... 57

6.3. Speciation and REE Uptake by The Plants ...... 58

CONCLUSIONS...... 61

RECOMENDATIONS ...... 63

REFERENCES ...... 64

APPENDICES ...... 79

10.1. Appendix A: A List of Hyperaccumulator Plants ...... 80

10.2. Appendix B: Fitted Curves ...... 85

10.3. Appendix C: MS Medium Components ...... 92

10.4. Appendix D: Statistical Analysis ...... 94

vii

LIST OF TABLES

Table 1- Reported hyperaccumulation concentrations for plants ...... 9

Table 2- Five REE hyperaccumulators and REE concentrations (ppm) in their leaves ...... 21

Table 3- Lanthanum stock solution preparation ...... 26

Table 4- Neodymium stock solution preparation...... 27

Table 5- Murashige and Skoog medium preparation ...... 28

Table 6- Stock solution dilution for media preparation ...... 29

Table 7- Lanthanum and neodymium speciation and total concentration percentage in the media, determined by Visual MINTEQ 3.1 modeling ...... 51

Table 8- Plant tissue La and Nd concentrations (ppm). Note: The results of ICP-OES for Brassica chinensis L. is based on wet weight (ppm WW), while for Helianthus annuus L. is based on the dry weight (ppm DW)...... 52

Table 9- Translocation factor in Helianthus annuus L. and Brassica chinensis L...... 53

viii

LIST OF FIGURES

Figure 1- Various sources of heavy metals in soil (Mahar et al., 2016) ...... 3

Figure 2- Theoretical response graph for metalloid and metal uptake in plant leaves/shoots (van der Ent et al., 2013) ...... 7

Figure 3- Apoplastic pathway (red arrow) and symplastic pathway (blue arrow) (http://cronodon.com/BioTech/Plant_Transport.html) ...... 11

Figure 4- Estimated the number of years remaining of precious and rare metal reserves, based on the current rate of consumption and disposal (Dodson et al., 2012)...... 19

Figure 5- Possible model for economic phytomining (Brooks et al., 1998) ...... 22

Figure 6- Brassica chinensis L. root length responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05) ...... 36

Figure 7- Brassica chinensis L. shoot height responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05) ...... 37

Figure 8- Brassica chinensis L. number of leaves after 30 days. Error bars show the standard deviation. Note: some of the treated plants had the same number of leavesand the standard deviation for those treatments were zero. (p < 0.05) ...... 37

Figure 9- Picture A, B, C, D, and E show harvested Brassica chinensis L. after 30 days of being exposed to 0, 17.3, 88.6, 173, and 268 ppm La, respectively...... 38

Figure 10- Brassica chinensis L. root length responses to Nd exposure and estimated IC50 value.. Error bars show the standard deviation. (p < 0.05) ...... 39

Figure 11- Brassica chinensis L. shoot height responses to Nd exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05) ...... 40

Figure 12- Brassica chinensis L. number of leaves after 30 days. Error bars show the standard deviation. Note: some of the treated plants had the same number of leaves andthe standard deviation for those treatments were zero. (p < 0.05) ...... 40

Figure 13- Picture A, B, C, D, and E show harvested Brassica chinensis L. after 30 days of being exposed to 0, 18.1, 89.5, 200, and 335 ppm Nd, respectively...... 41

Figure 14- Helianthus annuus L. root length responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05) ...... 43

Figure 15- Helianthus annuus L. shoot height responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05) ...... 43

Figure 16- Helianthus annuus L. number of leaves after 14 days. Error bars show the standard deviation. Note: some of the treated plants had the same number of leavesand the standard deviation for those treatments were zero. (p < 0.05) ...... 44

Figure 17- Picture A, B, C, D, and E show harvested Helianthus annuus L. after 14 days of being exposed to 0, 17.3, 88.6, 173, and 268 ppm La, respectively...... 44

Figure 18- Helianthus annuus L. root length responses to Nd exposureand estimated IC50 value.. Error bars show the standard deviation. (p < 0.05) ...... 46

Figure 19- Helianthus annuus L. shoot height responses to Nd exposureand estimated IC50 value.. Error bars show the standard deviation. (p < 0.05) ...... 46

Figure 20- Helianthus annuus L. number of leaves after 14 days. Error bars show the standard deviation. Note: some of the treated plants had the same number of leaves and the standard deviation for those treatments were zero. (p< 0.05) ...... 47

Figure 21- Picture A, B, C, D, and E show harvested Helianthus annuus L. after 14 days of being exposed to 0, 18.1, 89.5, 200, and 335 ppm Nd, respectively...... 47

Figure 22- Chlorophyll concentration in Brassica chinensis L. exposed to different concentrations of La for 30 days. Error bars show the standard deviation. (p < 0.05) ...... 48

Figure 23- Chlorophyll concentration in Brassica chinensis L. exposed to different concentrations of Nd for 30 days. Error bars show the standard deviation. (p < 0.05) ...... 49

Figure 24- Chlorophyll concentration in Helianthus annuus L. exposed to different concentrations of La for 14 days. Error bars show the standard deviation. (p > 0.05) ...... 50

Figure 25- Chlorophyll concentration in Helianthus annuus L. exposed to different concentrations of La for 14 days. Error bars show the standard deviation. (p > 0.05) ...... 50

INTRODUCTION

The International Council on Mining and Metals (ICMM) released statistics on global ore reserves in 2012, showing that ore grades are decreasing and shifting from high-grade low-bulk ores to low-grade high-bulk ores (Van der Ent et al., 2015). Therefore, conventional techniques, such as ore processing and pyrometallurgy, are no longer economically viable (Haris et al., 2009). In addition, environmental costs of the mining industries have become a hot topic for critical analysis. There is a demanding need for the development of new technologies to guarantee a sustainable relationship between the industry and the environment. Environmental awareness and management are top priorities. Therefore, mining projects are subjected to critical assessment, at all steps (C. Anderson et al., 1999).

Emerging and novel technologies that are plant-based, for heavy metal elimination and management, have been developed during recent years (C. Anderson et al., 1999). Phytoextraction is one of the most recent methods of heavy metal extraction that can be considered as a green in situ technology (Ernst, 2005). When phytoextraction technology is applied for cleaning soils, it is called phytoremediation. However, when this technology is used as a way of metal recovery from biomass, for economic profit, it is termed phytomining (Hunt et al., 2014). The process of phytomining includes growing plants that can accumulate high concentrations of metals from soil, gathering the plant biomass, and processing the biomass to generate bio-ore (C. W. N. Anderson et al., 1999). Phytomining can be used for the recovery of different metals, such as arsenic (As), selenium (Se), cadmium (Cd), cobalt (Co), manganese (Mn), nickel (Ni), thallium (Tl), and zinc (Zn), by using appropriate plants known as hyperaccumulators (Van der Ent et al., 2015).

Research has shown that some plant species have the ability to take up extremely high concentrations of one or multiple metals. These plants are known as hyperaccumulators. Researchers (C. Anderson et al., 1999) first identified this unique characteristic for Alyssum bertolonii, a small perennial shrub, in Italy. They discovered that the Ni concentration in the dry leaves of the plant was 7900 ppm (C. Anderson et al., 1999). Then, phytomining tests were done in California, for the first time in 1997. In these experiments, the Ni hyperaccumulator, 1

Streptanthus polygaloides, was used and the results demonstrated that sulfur-free Ni was generated at 100 kg/ha. Plant bio-ores are almost sulfur-free as compared to the sulphidic ores (C. W. N. Anderson et al., 1999). So far, Ni has proved as a feasible metal which can be recovered by phytomining and more than 400 Ni hyperaccumulator plants have been identified for Ni (X. Zhang et al., 2016).

Rare earth elements (REEs) are critical for manufacturing various high technology devices, which play an essential role in the industrial economy of the 21st century. They are vital for the development of high-tech products, namely iPods and tablet computers, and they are a significant part of the red color in TV screens. Moreover, the use of REEs in headphones is the reason behind the miniaturization of these merchandises and their ease of usage (“Why are rare earth elements so important?,” 2011). As a result, these elements are considered as strategic elements in a number of countries (Mazza, Blumenthal, & Schmitt, 2013). REEs are “rare” as their deposits with high concentrations are scarce (Messenger, 2016). The increasing demand for REEs gradually decreases the ore quality (AccessScience Editors, 2014). Phytomining enables us to recover and extract these metals from secondary sources, such as mining wastes, soil contaminated with these metals, and low-grade ores (Figure1) (X. Zhang et al., 2016). Only a few plants are known as REE hyperaccumulators; therefore, research is required to find suitable plants to tolerate and accumulate these metals in high concentration media.

The vast usage of REEs in the development of new technologies and their exploitation has led them to gain the label of emerging environmental pollutants. For instance, the application of these elements in the field of agriculture as fertilizers has resulted in the introduction of REEs to soil and water environment in large quantities (J. Zhang et al., 2015).

Figure 1- Various sources of heavy metals in soil (Mahar et al., 2016)

Considering the fact that these elements are new environmental pollutants (H. Hu et al., 2016) and there is the scarcity of information on the biological risks of REEs (Herrmann, Nolde, Berger, & Heise, 2016), regulatory thresholds for REE pollution and concentration in the environment have not yet been set. In particular, it was previously believed that these elements have limited toxicityand they are not hazardous to the environment (J. Zhang et al., 2015). Recent studies have shown contrary data. Alternations in soil-plant systems have been reported in China as REEs are being discharged in mining areas (Mayfield & Fairbrother, 2015). Lanthanum (La) has shown inhibitory effects on the growth of some plants, such as Zea mays and Vigna radiata. Toxicological studies indicate that the bioaccumulation of REEs can affect aquatic biota adversely (J. Zhang et al., 2015). Not only can REEs have adverse effects on the aquatic and terrestrial biota, but also studies on animals and humans exposed to REEs have shown tissue bioaccumulation of these elements, immune responses, and damages to several organ (Pagano et al., 2015).

In this study, the accumulating capacity and phytotoxicity of two REEs, La and neodymium (Nd), on Brassica chinensis L. and Helianthus annuus L. were investigated in vitro. Lanthanum and neodymium were chosen as previous reports show preferential hyperaccumulation for light REEs by plants (Van der Ent, Baker, Reeves, Pollard, & Schat,

2013). The chosen horticultural plant species are commonly known as bok choy and common sunflower, respectively. Interest in these species lies in their widespread cultivation (placing them at risk for contamination from industrial pollution), and rapid growth (a useful trait for phytoremediation). The effect of the REEs on the plant chlorophyll synthesis process and the growth of different plant parts was determined. Accumulation by the different plant parts was determined to assay the ability of these two species to hyperaccumulate the studied REEs. REE inhibitory concentrations leading to decrease (IC50) in the plant biomass and chlorophyll concentration were estimated. The gene expression of heavy metal A-types 4 (HMA4) in the plants exposed to the metals was also studied.

LITERATURE REVIEW

2.1. PHYTOMINING DEFINITION AND APPLICATION

Mining is an energy and capital intensive industrial practice to extract metals from ore reserves with target metals. High-grade ores have become exhausted as the result of industrialization. In low-grade ores and sub-grade ores, the concentrations of target elements are below the required level for conventional mining processing. Thus, extracting metals from these ore reserves by conventional methods is not economically viable (Thangavel & Sridevi, 2012). There is a need for exploring new technologies to process these ores in an economical and sustainable fashion.

Biomimetic resource management is a method of dealing with resources that is simulated from the way the living nature handles materials, processes, and structures. This approach provides an innovative means for dealing with metal loaded soil and providing raw materials for industries (Karman, Diah, & Gebeshuber, 2015). Plants, such as sunflower, can be used for reformulating waste or contamination to generate revenue for new industries. Biomimetic resource management includes bioremediation, biosorption, biosynthesis, and phytomining (Karman et al., 2015).

Phytomining is the accumulation and pre-concentration of bioavailable metals from the environment into the plant biomass, for commercial benefits. In essence, phytomining can be defined as metal farming (van der Ent et al., 2012). Mature plants after the accumulation of target metals are collected and burnt. This low volume ash contains high concentrations of target metals, called ‘bio ore’. Bio ore is then smelted to recapture the target metals (Robinson, Brooks, & Clothier, 1999). Phytomining has received a great deal of attention for two reasons (Harris et al., 2009):

1. Conventional mining methods in terms of negative environmental effects increase social and ecological concerns.

2. Conventional techniques are not suitable for reasonable metal recovery from low-grade ores.

Phytomining depends on biomass yield and high metal concentrations in the aboveground parts of the collected plants. A considerable number of metals are immobile, and the bioavailability of these metals is limited to plants. The availability of the metals can be affected by internal factors that are associated with plants and external factors that are related to soil (Sheoran, Sheoran, & Poonia, 2009). Therefore, phytomining can be affected by these external and internal factors.

Various aspects of this technology, such as hyperaccumulator plants, metal uptake mechanisms, genes expression roles, soil conditions, and REE effects on plants are discussed in the following subsections.

2.2. INTERNAL FACTOR AFFECTING PHYTOMINING

2.2.1. Hyperaccumulator Plants

Hyperaccumulator plants can be considered as a subdivision of the larger category of metallophytes that are able to accumulate high concentrations of metals (1-6%) in their biomass. Metallophyte plants are able to find buried metal ores and decrease the risk of metal contaminated soil by the application of these plants in phytotechnologies. Hyperaccumulators can be used in biogeochemical prospecting, phytomining, and phytoremediation (Center for Mined Land, 2014). For phytomining, the identification of appropriate plant species, can be considered as the first step for the assessment of the technical viability of the operation of this technique. Plants should be able to hyperaccumulate target metals, and the condition of the location, where the metals are found, should be suitable for the plant growth (Harris et al., 2009). The hyperaccumulation of metals can be considered as an uncommon and complicated occurrence that takes place in plant species with a high metal accumulation capacity (Sheoran et al., 2009).

Plants have been categorized into three groups based on their ability to grow in metal polluted soils: 1- metal excluders, 2- indicators, and 3- accumulators or hyperaccumulators. Plants for which translocation of metals within them is limited, over an array of soil concentrations, are known as metal excluders. Indicator plants are plants with the ability to take up metals and store them in their aboveground tissues. The concentrations of metals in indicator plant aboveground tissues reflect the concentrations of metals in the soil. However, the uptake of metals continuously causes these plants to die-off. There are some criteria for the determination of excluders and hyperaccumulator plant species. For hyperaccumulator plants, the shoot/root quotient (the ratio of metal in the shoot to the root) and the extraction coefficient (the ratio of metal in the shoot to total metal concentration in the soil), must be higher than one. In addition, the concentration of metals in these plants is 10-500 times higher than normal plants (Mganga, Manoko, & Rulangaranga, 2011). As Figure 2 indicates, normal plants have a low tolerance for bioavailable metals and metalloids in soil. High concentrations of metals are toxic to these plants and cause them to die as the result of phytotoxicity (van der Ent et al., 2013).

Figure 2- Theoretical response graph for metalloid and metal uptake in plant leaves/shoots (van der Ent et al., 2013) 7

There are two types of hyperaccumulation systems: natural and induced. Hyperaccumulation in natural hyperaccumulator plants is based on the physiological ability of plants to take up heavy metals as they grow (Karman et al., 2015). However, the performance of induced hyperaccumulator plants is based on the manipulation of the soil-plant environment by the addition of chemicals to the soil. Hyperaccumulator plant characteristics can be summarized as follows (Karman et al., 2015):

1. Uptake property: Uptake property is defined as the minimum concentration of the target metal in shoots. For instance, lead (Pb), Ni, copper (Cu) and Co concentrations in plants must be more than 1000 ppm, whereas concentrations in plants for gold (Au) must be 1 ppm and for Cd this value is 100 ppm. 2. Translocation property: This is the concentration of metals in plant shoots. The shoot concentration must be higher than the root concentration. 3. Enrichment property: Can be defined as the enrichment factor (EF), which is the ratio of metal concentrations in plants to the soil metal concentration. This ratio for hyperaccumulator plants is higher than one (EF >1). 4. Tolerance property: Plants should have a high tolerance for the target metal to be considered as a hyperaccumulator.

As many as 450 plant species are known to tolerate high concentrations of heavy metals in their soil and most importantly in their shoots (Maestri et al., 2010; Prasad et al., 2003). A list of plants that can hyperaccumulate metals is presented in the Appendix A. Hyperaccumulator species mostly belong to Asteraceae , Brassicaceae, Caryophyllaceae, Poaceae, Violaceae, and Fabaceae families (Prasad et al., 2003). Among hyperaccumulator families, the Brassicaceae is known as the best metal hyperaccumulators and 87 Brassica species categorized as metal hyperaccumulators (Milner & Kochian, 2008). Table 1 presents a summary of the reported concentrations of metals required for plants to be considered as hyperaccumulators.

Table 1- Reported hyperaccumulation concentrations for plants

Plant metal Metal Percentage Ref. concentration (ppm)

Au > 0.001 0.0001% (Karman et al., 2015) (Rascio & Navari- Cd > 0.1 0.01% Izzo,2011) (Liang, Li, and REEs > 1 0.10% Wang,2014) As, Co, Cr, Cu, Ni, (Rascio & Navari- > 1 0.10% Pb, Sb, and TI Izzo,2011) (Rascio & Navari- Mn and Zn > 10 1% Izzo,2011)

Brassica chinensis L. (chinese cabbage) is commonly considered to be a vegetable (Sudmoon et al., 2015). Brassica chinensis L.is a quite tolerant plant to heavy metal contaminated soils (Biling, Zhengmiao, Jianjun, Juntao, & Qiufeng, 2007), and it is known that Brassica species can absorb heavy metals at high concentrations (Wu, McGrouther, Chen, Wu, & Wang, 2013). This plant is a hyperaccumulator of Cd and while the concentration of Cd in plants is normally 0.1 ppm, Brassica chinensis L. can take up more than 100 ppm of Cd. The concentration of Cd in both the stems and leaves of Brassica rapa can reach up to 2,439 ppm (Sudmoon et al., 2015). Another study has shown that the average Cd concentration in the shoot of Brassica chinensis L. was in the range of 198-227 ppm (C. P. Liu, Shen, & Li, 2006). It has been stated that Brassica chinensis L. has features that can be used for phytostabilization and phytoextraction (Sudmoon et al., 2015). The ability of this plant to accumulate other heavy metals, namely mercury (Hg), chromium (Cr), Pb, Cu and Zn was reported (Wu et al., 2013). Lead translocation from the root to the shoot of this plant can be increased by enhancing Pb concentrations in the soil (Wu et al., 2013). Brassica rapa belongs to the same genus that contains Brassica napus, Brassica juncea, and Brassica oleracea; they are known as hyperaccumulators (Ramani et al., 2011). It has been indicated that Brassica rapa grows in the soil with various concentrations of Cd, and it can also accumulate high concentrations of Cd from the soil. By increasing the Cd concentration in the soil, the concentration of Cd in the

shoots of Brassica rapa increases (Sudmoon et al., 2015). The ability of Brassica species to hyperaccumulate silver (Ag), Au and Cu has been demonstrated (Ramani et al., 2011).

Helianthus annuus L. (sunflower) is an annual plant. This plant is a part of the Asteraceae family, and it is native to the Americas. Helianthus annuus L. has a large flower, and it can grow in different types of soils (Adesodun et al., 2010). Helianthus annuus L. is a promising plant for the removal of heavy metals, such as Cu, Zn, and a considerable number of radionuclides. The concentrations of toxic metals are negligible in Helianthus annuus L. seeds and oil; therefore, the introduction of contamination in food chains is limited (Nehnevajova et al., 2005). Madejon et al. (2003) suggested that sunflowers can be used for phytoremediation since they are fast growing crops and their stems and leaves are not eaten by animals. Moreover, it is believed that harvesting seeds and producing oil to be used for industrial applications, can decrease the net cost of phytoremediation (Madejón et al., 2003). Helianthus annuus L. has the capability to remediate soils that have been contaminated with several heavy metals namely Cd, Cr, and As at the same time. In multiple metal accumulation with sunflowers, Ni cannot be hyperaccumulated by this plant in the presence of Fe (Cutright, Gunda, & Kurt, 2010). Dwarf sunflowers can hyperaccumulate some toxic metals, such as Cd, Hg, Ni, and Pb (Walliwalagedara et al., 2010).

2.2.2. Metal Uptake Mechanism in Plants

Plants take up inorganic elements from the soil as nutrients. These metals and metalloids, namely Zn, Cu, Fe, Mg, and Mn, are accumulated by plants at various concentrations and are crucial for biochemical and cellular processes. Besides these essential elements, other elements that do not play any biological role for plants can enter plant tissues (Maestri et al., 2010).

Plant root systems accumulate nutrients from soil and solutions (Cieśliński et al., 1998). Generally, solute must enter into the root cytoplasm before entering the xylem (Ghosh & Singh, 2005). The movement of the accumulated metals from roots into xylems is managed by three

processes: metals are sequestrated inside the cell of the root, then metals are transported into the stele via symplastic transport, and finally metals are released into xylem (Ghosh & Singh, 2005).

Bioavailable metals enter plant roots through two transport mechanisms; symplastic and apoplastic. As Figure 3 shows, during the symplastic pathway (blue narrow), soluble metals cross the plasma membranes of the root endodermal cells. On the other hand, in the apoplastic pathway (red arrow) soluble metals pass through extracellular spaces and cell walls that together form the apoplast (Shan et al., 2003). It has been shown that the apoplastic transport mechanism is the most common method, as accumulated Ni, Zn, and Cd have been found mostly in cell walls and outside the plasma membrane of epidermal, cortical, and endodermal cells (Shan et al., 2003). Metals to be translocated to aerial tissues must enter the xylem. Solutes for entering the xylem must bypass casparian strips. The casparian strip is a waxy coating that is impermeable to solutes unless solutes cross the cells of the endodermis by the action of a membrane pump or channel. Metals after loading into the xylem will be transported to the leaves by the xylem sap flow. They can be then stored in different types of leaf cells, depending on their forms and the plant species (Peer et al., 2005).

Figure 3- Apoplastic pathway (red arrow) and symplastic pathway (blue arrow) (http://cronodon.com/BioTech/Plant_Transport.html)

2.2.3. Genetic Mechanism of Metal Hyperaccumulation in Plants

Transition metals, such as Mn, Zn, Fe, and Cu play a critical role in the growth and development of normal plants. Therefore, the growth of a healthy plant requires a suitable concentration of metal uptake from soil and abundant distribution around plants (Hall & Williams, 2003). Plants, as sessile organisms, have established internal methods of micronutrient accumulation from soils with varying compositions (Colangelo & Guerinot, 2006). The central role seems to be played by membrane transport systems. Genomic and molecular analyses have determined a series of gene families involved in the transport of transition metals (Hall & Williams, 2003). These gene families differ in their substrate specificities, cellular localizations, and expression patterns. Transporter genes, which play roles in the metal efflux from the cytoplasm, contain the P1B-ATPase family (Colangelo & Guerinot, 2006).

Hyperaccumulator and non-hyperaccumulator plant relative molecular and physiological analysis have led to an interesting discovery. These comparative analyses have shown that the main reasons behind the high concentrations of metal uptake by hyperaccumulator plants involve various gene regulations and expressions found in plants (Verbruggen, Hermans, & Schat, 2009). High concentrations of metals are accumulated, translocated from roots to leaves, and sequestrated in vacuoles or cell walls by the constitutive overexpression of transmembrane transporter genes. These genes belong to HMA, ZIP, MATE and YSL families (Rascio & Navari-Izzo, 2011).

There is strong evidence indicating that an increase in xylem load takes place through the constitutive overexpression of transport system genes. Transport system genes are present in both non-hyperaccumulators and hyperaccumulators, however, these genes can dramatically increase the efficacy of the translocation of high concentrations of heavy metals from roots to shoots in hyperaccumulator plants. Heavy metal transporting ATPases (HMAs) or P1B-type ATPases are proteins that play a key role in metal transport, metal homeostasis, and metal tolerance in plants. T. caerulescens and A. halleri are Zn and Cd hyperaccumulators, and the overexpression of bivalent cation transporter genes belonging to HMAs (HMA4) in these two plants has been detected. In addition, exposure to high concentrations of Cd and Zn causes an 12

increase in the expression of HMA4 in hyperaccumulator plants. However, when non- hyperaccumulator plants are exposed to these metals, HMA4 genes are downregulated. An increase in the HMA4 expression enhances the ZIP family gene expression (Rascio & Navari- Izzo, 2011). The ZIP family genes (Zinc-regulated transporter and Iron-regulated transporter Proteins) are known as cation transporters located in plasma membranes. In addition, an increase in the Zn accumulation in roots of Zn hyperaccumulator plants is attributed to the overexpression of these genes (Rascio & Navari-Izzo, 2011).

The other genes, active in the translocation of metals in hyperaccumulator plants, belong to the MATE (Multidrug And Toxin Efflux) family. FDR3, which is a member of this family, is overexpressed in T. caerulescens and A. halleri roots. FDR3 is local to the pericycle plasma membranes of roots and is responsible for the transport of citrate into the xylem. Citrate is an essential ligand for Fe transport and homeostasis. Members of the YSL (Yellow Strip1-Like) family are also involved in the translocation of heavy metals. The products of these genes are a part of the nicotinamine-metal complex, particularly nicotinamine-Ni, and also play a role in vascular loadings and transportations. The overexpression of YSL genes in the root and shoot of T. caerulescens has been detected (Rascio & Navari-Izzo, 2011).

2.3. HORMESIS AND METAL EFFECTS ON PLANT GROWTH

Environmental contaminants, such as heavy metals, have adverse effects on humans and other living organisms. However, low concentrations of some poisonous chemicals could have beneficial impacts on living natures. This phenomenon, which is a biphasic dose-response, is identified as hormesis (Z. Liu et al., 2015). Hormesis is characterized by stimulatory effects at low concentrations and inhibitory effects at high concentrations of toxic substances (Calabrese & Blain, 2009). Therefore, the toxicity of materials depends on their concentration (Poschenrieder, Cabot, Martos, Gallego, & Barceló, 2013).

Hormetic growth stimulation in plants exposed to low dosages of toxic and non-essential metals has frequently been reported (Calabrese & Baldwin, 2001, 2003; Calabrese & Blain, 2009; Calabrese, 2008; Poschenrieder et al., 2013). For instance, hormetic effects of Cd, at low

dosages, on Lonicera japonica growth has been reported. However, at high concentrations, Cd can decrease chlorophyll concentration and plant growth (Z. Liu et al., 2015). Andrographis paniculata growth response to low concentrations of Pb, Zn, and Cd has shown the stimulatory effect of these metals on the plant growth (Tang et al., 2009). Moreover, REEs, which are considered as not nutritionally essential metals, can have hormetic impacts on plants (C. Wang et al., 2011).

REEs generally have low toxicities (Z. Hu, Haneklaus, Sparovek, & Schnug, 2006). Lanthanum nitrate or cerium (Ce) nitrate added to the growth medium showed a striking increase in Arabidopsis thaliana root growth and plant height when the plants were in the vegetation stage (Thomas, Carpenter, Boutin, & Allison, 2014). It has been shown that low concentrations of La can increase Oryza sativa L. (rice) and corn root growth (D. Liu, Wang, Zhang, & Gao, 2013). Hu et al. (2004) demonstrated that plant growth can be regulated by REEs since these elements affect the uptake of mineral elements (Z. Hu, Richter, Sparovek, & Schnug, 2004). Plant growth stimulation by REEs has been demonstrated by various experiments (Z. Hu et al., 2004).

2.4. PHOTOSYNTHESIS ACTIVITY AND METAL ACCUMULATION

EFFECTS ON CHLOROPHYLL

In plants, the toxicity of metals affects chloroplasts and photosynthesis (Aggarwal et al., 2012). The organelle responsible for photosynthesis in eukaryotes is the chloroplast which is enclosed by two membranes. The inner membrane contains a stroma which is a complex mixture in which a complex network of stacked sacs is embedded (Wang et al., 2003). Each stack is named a granum and is made up of a series of flattened sacs called thylakoids (Wang et al., 2003). Thylakoids hold photosystem I (PSI) and photosystem II (PS II) (Lai et al., 2006). The photosystems are made up of chlorophylls and other pigments (Wang et al., 2003). The cooperation of these two systems makes the whole photosynthesis process possible (Lai et al., 2006).

Monitoring the effects of fluctuations in the concentrations of chlorophyll a and b, as well as the total concentration of chlorophyll is important in determining the effects of environmental changes (Manios, Stentiford, & Millner, 2003). The impact of heavy metals on photosynthesis have indicated that metals cause decreased chlorophyll concentration in plants (Sarma, 2011). Chlorophyll synthesis is inhibited as a result of direct heavy metal interference with either an enzymatic step or nutrient uptake (Zengin & Munzuroglu, 2005). However, appropriate concentrations of REEs can improve the rate of photosynthesis in plants and the positive impacts of these elements on chlorophyll synthesis have been established (Emmanuel, Ramachandran, Ravindran, Natesan, & Maruthamuthu, 2010). Improvement in plant photosynthetic activities by REEs can be attributed to the growth of enzyme activities, the development of chloroplast, and an increase in the chlorophyll concentration in plants (Emmanuel et al., 2010; Lai et al., 2006). In Dicranopteris dichotoma, a REE hyperaccumulator, half of the total concentration of REEs in chloroplast are present on its membrane and the other half exist in the thylakoids of this plant (Lai et al., 2006).

2.5. EXTERNAL FACTORS AFFECTING METAL UPTAKE BY PLANTS

2.5.1. Metal in Soils

Soils play an essential role in the removal of metals from the terrestrial environment, by acting as a basin. Metals that enter this basin can experience one or more of the following events (Tappero, 2009):

1. Being integrated into the soil solution, 2. Binding to exchange sites that exist on soil solids, 3. Precipitating in soil with other compounds, 4. Being occluded within minerals present in soil, 5. Binding to the organic material present in soil, 6. Becoming a part of the soil biomass.

Soil metals are divided into three forms: available metals, potentially available metals, and unavailable metals. The available forms of metals are accessible for organisms. When available metals are eliminated, potentially available metals will become available (Sheoran et al., 2009). In order for metals to be taken up by plants from soil, the elements must be mobilized into the soil solution. After mobilization, target metals must be taken up by root cells. Contaminated soil situations are ideal for metal uptake if (Ernst, 2005):

1. Metal(s) are distributed in soil homogenously. 2. The soil is contaminated with one metal, instead of multiple contaminating metals. Some metals cannot be hyperaccumulated by plants in the presence of other metals. For example, in metal accumulation with sunflower, Ni cannot be hyperaccumulated by this plant in the presence of Fe (Cutright, Gunda, & Kurt, 2010) 3. Contaminating metal(s) are bioavailable. 4. Soil pH varies from 4 to 7. 5. Soil has a desirable water-holding capacity which eliminates the need for expensive irrigation or drainage. 6. Soil is fertile to eliminate the need for fertilization. 7. The landscape is smooth with no steep hills.

2.5.2. Soil pH

Soil pH can affect the solubility of metals in soil and consequently affect the rate of metal uptake by plants. Robinson et al. (1999) used magnesium carbonate (MgCO3) and calcium carbonate (CaCO3) to increase the pH of nickel-rich ultramafic (‘serpentine’) soil. They observed that increasing the soil pH, decreases both Ni and Co accumulation by Berkheya coddii, as a result of reducing metal solubility in soil. They also reported that decreasing soil pH, by adding acid mine tailings (AMT), sharply increased the concentration of metals in the plant. Finally, sulfur addition to the soil, which decreases the soil pH, increases the Ni and Co accumulation by Berkheya coddii (Brooks et al., 1998). It is not possible to state an optimal pH value for all plants since the rhizosphere pH depends on the species and the plant age (Sheoran et al., 2009). 16

2.5.3. Fertilizer

Metals induce stress at the cellular level in plants and plant responses to metal stress play a critical role in phytoextraction. Plants defend themselves through enzymatic and non- enzymatic mechanisms. Fertilizers affect the plant response to stress, as well as the plant efficacy in metal extraction. Giansoldati et al. (2012) demonstrated that urea fertilizers strikingly decrease the growth inhibition in Brassica juncea and increase the production of biomass in this plant. The usage of urea fertilizer reduces the stress of boron (B) in the plant. Consequently, urea- treated soil can increase both biomass and B extraction by B. juncea. Nitrogen, among other macronutrients, can be considered as a limiting factor for biomass production, particularly in degraded soil. Appropriate N fertilizers can affect phytoextraction by enhancing plant biomass enriched in target metals (Giansoldati et al., 2012).

2.5.4. Chelate

The metal extraction process can be improved by enhancing the bioavailability of metals to plant roots, through the application of acidifying agents to the soil. Chelates are applied to increase the accumulation of elements, such as Pb, Ni, Cd, Cu, and Zn (Prasad et al., 2003). Chelation therapy is a method that entails the recurrent intravenous administration of a solution containing ethylene diamine tetra-acetic acid (EDTA). The ability of Brassica juncea to extract Pb from contaminated soil is very limited. However, it has been shown that the addition of EDTA can increase desorption of Pb in the soil, which allows Pb transfer to the roots. Due to the leakage of the PbEDTA chelate through the root membranes, the chelate can be transported to the shoots, through the process of transpiration. Therefore, high concentrations of Pb can be accumulated by B. juncea when EDTA is applied to the soil (Chaney et al., 2007).

Inducing metal extraction by plants is not a useful technique for all metals and crops. For example, the addition of nitrilotriacetic acid (NTA) and EDTA to soil for increasing Ni uptake by Berkheya coddii, inhibits metal extraction by this plant (Wilde, Brigmon, Dunn, Heitkamp, & Dagnan, 2005). Also, adding chelates to soil has some drawbacks. The application of chelate can result in metal leaching, which is a serious yet unavoidable problem (Römkens et al., 2002). The

rapid Pb leaching to groundwater has been reported in the US after EDTA addition. Metal dissolving by chelator application is based on the metal activity in soil and the metal selectivity for binding to the chelator. Adding chelators to soil can cause non-target metals to be dissolved and leached down through the soil profile when soil is irrigated. Not only does chelating increase the risk of metal leaching but also EDTA is an expensive chemical. The cost of commercial quantities of EDTA required for achieving more than 10000 mg Pb/kg dry shoot has been estimated around $ 30 000 ha-1 (Chaney et al., 2007).

2.6. RARE EARTH ELEMENTS (REES)

REEs were found in small deposits in granitic pegmatite in low quantities originally (Lusty & Walters, 2010). REEs, also called lanthanides, are related to a group of 15 metals. These metals are chemically active, mostly trivalent, and white silver. Chemical and physical properties of these elements are also similar. Scandium (Sc) and Yttrium (Y) are also considered as REEs since these two metals have similar chemical properties as lanthanides and also occur in the same ore deposits as REEs (Ichihashi, Morita, & Tatsukawa, 1992).

REEs are not as rare as their name implies, except for promethium (Pm). Promethium is an artificial radioactive element; therefore, it does not occur in nature (Palasz and Czekaj, 2000). It is known that 0.015% of the earth crust consists of REEs. REEs are as rich as Pb, Zn, and Cu; moreover, their occurrence is higher than Co, Ag, tin (Sn), and Hg (Hu et al., 2006). REEs occur as +3 ions with the exception of Ce that can form +4 ions (Institut et al., 1998). Based on the electron configuration of these elements, they can be divided into two groups: light-group or cerium group (LREE) and heavy-group or yttrium group (HREE). LREEs include La through gadolinium (Gd). HREEs include of terbium (Tb) to Y (Avalon, 2012).

REEs affect a wide range of industries in Canada and globally (Avalon, 2012). REEs have unique properties which cause these metals to be used in various areas and products. Medicines, chemical engineering, and aerospace industries, as well as mobile phones, rechargeable batteries, laptops, radar systems, medical imaging equipment, and LCD screens, are some of the high technology equipment that requires REEs (Avalon, 2012; H. Hu et al., 2016).

Moreover, the production of a substantial number of novel low-carbon technologies, such as wind turbine, energy saving light bulbs, electric cars, catalytic converters, and fuel cells involves the use of REEs and precious metals (Dodson, Hunt, Parker, Yang, & Clark, 2012). As a result, global REEs consumption is increasing while the supplies of these elements are decreasing (Massari & Ruberti, 2013).

Although a considerable number of minerals contain REEs, few of them are rich enough to be used as ores. In addition, traditional sources of these metals are about to run out. Dodson et al. (2012) estimated the number of years remaining of REE and precious metal reserves, as given in Figure 4, based on the current rate of consumption and disposal of these metals. (Dodson et al., 2012).

Figure 4- Estimated the number of years remaining of precious and rare metal reserves, based on the current rate of consumption and disposal (Dodson et al., 2012)

Hydrometallurgical and pyrometallurgical processes, which are traditional technologies, are suitable for metal mining from ores with high concentrations of target metals. The ores of REEs have been distributed in specific areas, while these ore bodies are being depleted quickly 19

(Dodson et al., 2012). The gap between the demand for REEs and their supply is increasing, and it is critical to find alternative mining processes for these elements (Franus, Wiatros-Motyka, & Wdowin, 2015). Therefore, researchers and companies have been encouraged to find alternative means of metal recovery from low-grade ores, mine tailings, and dumps. Besides these sources, another source of REEs is soils contaminated with these metals. Phytomining provides an opportunity for the recovery of these metals (Dodson et al., 2012).

REEs can enter plants via their roots and foliage. Root hairs absorb REEs into xylems through thin cell walls. Absorbed REEs then can be transferred to other parts of the plants (Hu et al., 2004). A study on erbium (Er) and La indicated that REEs could enter into the cells of wheat and cucumber. Then these elements can locate or deposit in different organelles. REEs located in the membrane system affect physiological and biochemical mechanisms in plants (Gao, Zeng, Yi, Ping, & Jing, 2003). REEs and Ca have a similar ionic radius, therefore, REEs can compete for plant sites that normally bind to Ca (Nicodemus, Salifu, & Jacobs, 2009). Replacing Ca with REEs lead to Ca deficiency (Kastori, Maksimović, Zeremski-Škorić, & Putnik-Delić, 2010).

Studies on plant capability to accumulate high concentrations of REEs has been done to find a feasible means of REEs remediation from contaminated soil (Liang, Li, & Wang, 2014). The results of these studies have shown that the concentrations of REEs are different in various species. REE concentrations in leaves of hyperaccumulators need to be higher than 1000 ppm dry mass. So far, five REE hyperaccumulator plants have been identified that (see in Table 2) (Liang et al., 2014). Accumulation of REEs depends on plant species, and it has been shown that only certain plant species have the ability to take up REEs. For example, the concentrations of La in some types of ferns reach up to 1000 ppm, and the total REEs in Dicranopteris dichotoma reached a concentration higher than 3000 ppm (Hu et al., 2006). Moreover, 1200 ppm of REEs has been reported to be present in Pronephrium simplex leaves (Lai et al., 2006). The distribution of REEs in plants can be affected by various factors, such as the method of application, plant tissue type, and REE concentrations in substrates (Hu et al., 2004).

Table 2- Five REE hyperaccumulators and REE concentrations (ppm) in their leaves

Max. REE Plant Name Plant Family Reference Concentration (Liang, Li, and Wang Mockernut hickory Juglandaceae 1,350 2014) (Liang, Li, and Wang Carya tomentosa Juglandaceae 2,296 2014) (Liang, Li, and Wang Blechnum orientale Blechnaceae 1,022 2014) (Liang, Li, and Wang Dicranopteris dichotoma Gleicheniaceae 3,358 2014) Pronephrium simplex Thelypteridaceae 1,200 (Lai et al. 2006)

The mobility of REEs in soil is low due to their strong binding capacity with soil particles (Hu et al., 2006). REEs in the form of oxide favorably bind with small sized soil particles (Zhang et al., 2001). The metal bioactivity and bioavailability control by soil pH have been widely discussed (S. Zhang & Shan, 2001). The correlation between the available REEs for plants and soil pH is negative in the soil pH range of 6 to 10. Clay and organic matter content in soil increase the available REEs for plant uptake (Hu et al., 2006). Generally, the bioavailability of REEs in soil depends on the REE exchangeable fraction that is affected by the physio-chemical properties of soil (Liang et al., 2005). The application of EDTA enhances REE desorption in soil, and increases REE uptake by plants (Kastori et al., 2010).

2.7. AN ECONOMICALLY FEASIBLE MODEL FOR PHYTOMINING

Figure 5 illustrates a feasible economic model for a phytomining system. Successful phytomining projects depend on the recovery of some energy released through the combustion of raw materials. Weather conditions have an effect on the feasibility of phytomining systems. The success of this system in tropical areas is a function of the possibility of having mature crops

each month. Two scenarios can be imagined when it comes to phytomining beyond the theoretic and pilot plan (Brooks et al., 1998):

1. Large scale projects require square kilometers of soils rich in metals, such as soils with low-grade mineralization sources or ultramafic rocks. 2. Phytomining by small-scale farmers, which seems to be more probable. Based on this scenario, a farmer grows plants on a few hectares of his/her property and after harvesting, plant biomass will be processed at the nearest facility.

Figure 5- Possible model for economic phytomining (Brooks et al., 1998) 22

OBJECTIVES

Based on the literature review, it can be concluded that phytomining provides an opportunity for the recovery of metals from secondary sources. The exploitation of mining wastes, soil contaminated with these metals, and low-grade ores has been made possible by this technology (X. Zhang et al., 2016). REEs can be considered as the most economically promising metals for exploitation since the value of and demand for REEs are increasing. However, the number of REE hyperaccumulator plants, which can be used for phytomining, is limited. Currently, only five of them have been recognized.

The vast utilization of REEs, particularly as fertilizers, result in high levels of these metals in the environment (J. Zhang et al., 2015) leading to toxicity concerns. However, information about REE toxicity and bioavailability is scarce. Due to this scarcity, there is no regulation on the REE thresholds for soil, which can be used to regulate REE release into the environment (Herrmann et al., 2016).

Therefore, more research is required on hyperaccumulation of REEs and toxicity of these elements. Two known metal hyperaccumulators, Helianthus annuus L. and Brassica chinensis L., were chosen in this study. The objectives of this study are as follows:

1. To investigate the effects of La and Nd on the growth of roots, shoots, and leaves of the studied plants. 2. To measure toxicity thresholds for roots, shoots, and leaves of the plants and chlorophyll concentrations. 3. To determine the ability of Helianthus annuus L. and Brassica chinensis L. to hyperaccumulate La and Nd. 4. To investigate the overexpression of the HMA4 gene in the studied plants after exposure to REEs.

MATERIALS AND METHODS

4.1. SEED STERILIZATION AND GERMINATION

Seed surface sterilization can be completed by various kinds of chemicals for the eradication of microorganisms. The selection of the type and concentration of chemicals must be conducted empirically as sterilant chemicals could potentially eradicate both pathogens and viable seeds (Chawla, 2002). The seeds of Helianthus annuus L. and Brassica chinensis L. were sterilized by rinsing with 70% ethanol (C2H6O) and soaking while stirring the tube, which contained the seeds, constantly for three minutes. The seeds were then rinsed with sterilized ultrapure water five times. After the sterilization, seeds were transferred into a petri dish between three layers of sterilized moist Kimwipes. The petri dish was kept in a dark place at room temperature for three days to germinate.

Germinated seeds were transferred into the prepared Murashige & Skoog (MS) media with known La and Nd concentrations. However, after a couple of days, molds grew on the media and around the seeds. The growth of molds demonstrated the ineffectiveness of the sterilization with 70% ethanol. Sodium hypochlorite (NaOCl), commercial bleach, is known as a very effective agent for sterilizations (Chawla, 2002). Thus, the next batch of seeds was sterilized by 70% ethanol followed by a sodium hypochlorite rinse. The procedure was done as follows:

1. Seeds were rinsed with 70% ethanol and soaked for three minutes, while constantly stirring the test tube. 2. Ethanol was then decanted, and seeds were rinsed with 5% sodium hypochlorite for another three minutes. 3. They were rinsed with the sterilized ultrapure water five times. 4. After the sterilization, the seeds were placed between three layers of sterilized moist kimwipes and kept in a dark place for three days.

Even though this method of the seed sterilization was shown to be effective for Brassica chinensis L. seeds, employing the same method for Helianthus annuus L. seeds led to mold growth. The infection of seedlings can be caused by seed-borne pathogens; pathogens in or on seeds. These pathogens can grow in or on seedlings after germination. Helianthus annuus L. is known to host more than 36 pathogenic organisms (Mohamed, Siddig, & Azhary, 2008). As a result, Helianthus annuus L. seed coats were removed to eliminate the growth of molds and increase the efficacy of experiments.

Helianthus annuus L. embryos were sterilized by rinsing with 70% ethanol and soaking for three minutes while stirring the test tube constantly. Then, they were rinsed with sterilized ultrapure water five times. Sterilized embryos were placed in a petri dish and laid between three layers of sterilized moist kimwipes. This method was effective for the embryo sterilization. In addition, the method eliminated the need for additional chemicals, such as sodium hypochlorite.

FAILED SEED GERMINATION

Originally, Salix nigra and Thlaspi caerulescens were chosen due to the characteristics of these two species. Salix nigra (black willow) is one of the most promising North American species for hyperaccumulating metals. Salix nigra can translocate high concentrations of Cd and Cu in its tissues. Moreover, the plant produces high biomass while it takes up high concentrations of metals (Kuzovkina, Knee, & Quigley, 2004). Thlaspi caerulescens is a natural hyperaccumulator which can take up Zn, Cd, and Ni (Cosio, Martinoia, & Keller, 2004).

Various conditions for the presoaked or non-soaked seeds of these plants were used for germination, such as placing between moist kimwipes, planting in water agar media, planting in MS media. However, none of them were successful, and seeds did not germinate. After unsuccessful attempts at growing the plants, a growth hormone was used to stimulate the germination of seeds. Gibberellic acid (GA-3) was used because it promotes dormant seed germination, and it can overcome various types of dormancy (Guimarães, Loureiro, & Salt, 2013).

Given its effectiveness, the following dosage of GA-3 and condition were used for Thlaspi caerulescens seeds: 500 ppm GA-3 under light at 20 °C (Guimarães et al., 2013). However, none of the seeds germinated; therefore, it was concluded that these seeds are not viable. Willow (Salix sp.) seeds are considered as short-lived seeds, and the viability of seeds is lost at room temperature within a few days (Maroder, 2000). Also, the viability of Thlaspi is lost under storage (Guimarães et al., 2013). These plants were replaced by Brassica chinensis L. and Helianthus annuus L.. These two plants were chosen as they are known as hyperaccumulator plants (Cutright et al., 2010; C. P. Liu et al., 2006).

4.2. MEDIA PREPARATION AND METAL EXPOSURE

4.2.1. Metal Oxide Powder Dissolution and Stock Solution Preparation

Lanthanum and neodymium are the metals of interest to be tested in this study.These metals were chosen as previous reports show preferential hyperaccumulation for light REEs by plants (Van der Ent et al., 2013). Stock solutions with 4000 ppm concentration and 300 mL final volume were prepared. Each metal oxide powder was dissolved in hydrochloric acid (HCl) (Van Loon & Barefoot, 2013). The procedure was as follows:

Lanthanum stock solution was prepared by dissolving 1.41 g La2O3 powder into 10 mL of 5 M HCl .Then, ultrapure water was added to reach the desired volume of 300 mL. Table 3 shows La stock solution preparation information.

Neodymium stock solution was prepared by dissolving 1.40 g Nd2O3 powder into 20 mL of 5 M HCl. Then, ultrapure water was added to reach the desired volume of 300 mL. Table 4 shows Nd stock solution preparation information.

Table 3- Lanthanum stock solution preparation

Stock Solution Preparation Value

Desired concentration of stock 4000 solution (ppm) 26

Stock Solution Preparation Value

Total solution volume (mL) 300

Metal MW (g/mol) 139

Metal oxide MW (g/mol) 326

Metal MW/Metal oxide MW 0.426

Mass of metal oxide used (g) 1.41±0.01

Table 4- Neodymium stock solution preparation

Stock Solution Preparation Value

Desired concentration of stock 4000 solution (ppm)

Total solution volume (mL) 300

Metal MW (g/mol) 144

Metal oxide MW (g/mol) 336

Metal MW/Metal oxide MW 0.429

Mass of metal oxide used (g) 1.4±0.01

4.2.2. Murashige & Skoog (MS) Medium Preparation

The combination of Murashige and Skoog (MS) salt mixture, a widely used culture for various cultivation applications (Chawla, 2002), was selected in this study for in vitro plant growth. The reason behind choosing MS medium instead of soil as the growth medium in this study was that the chemical components of MS medium is known, and can be used to simulate ion speciation of the studied REEs for plant uptake by geochemical modeling.In addition, MS medium was used for exposing the plants to the REEs since these elements are bioavailable in the medium and could stimulate the overexpression of HMA4 gene in the plants.

MS medium was prepared with four different concentrations, 20 ppm, 100 ppm, 200 ppm, and 300 ppm, of La and Nd, respectively (Table 5 and Table 6). MS medium without metal addition was also prepared for control experiments. The pH of MS media was adjusted to 5.6-5.8 with 0.1 M sodium hydroxide (NaOH) and 0.1 M HCl (the amount of added NaOH and HCL for adjusting the pH was taken into account for volume measurements). Then, 7 mL of each prepared medium with known concentrations was transferred into test tubes and sterilized in an autoclave. Each experimental trial was replicated three times; results are presented as averages of the triplicates.

Table 5- Murashige and Skoog medium preparation

Medium Preparation Value

Mass of medium powder in 1L of 42.4 ultrapure water (g) Desired final volume of medium 100 (mL) Required mass of medium powder 4.24 (g)

Table 6- Stock solution dilution for media preparation

Volume of Stock Desired Final Volume Ultrapure Water Solution Required Concentration (ppm) (mL) Volume (mL) (mL) 20 100 0.5 99.5±0.4

100 100 2.5 97.5±0.4

200 100 5 95±0.4

300 100 7.5 92.5±0.4

4.3. GROWTH CONDITION

Germinated seeds were inoculated into the prepared medium and grown in a climate controlled growth tent, at 25±2 °C and 55% RH with a photoperiod of 12 hours per day.

4.4. CHLOROPHYLL EXTRACTION

For chlorophyll extraction, 0.1 g of fresh leaves were homogenized in 5 mL of 80% acetone. Leaves were crushed in acetone and then centrifuged for five minutes at 7000 rpm. Then, the supernatant was transferred into a flask, and 80% acetone was added to the solution to reach a volume of 10 mL. The light absorbance was measured at λ 663 nm and λ 645 nm against 80% acetone blank using a spectrophotometer.

To determine the chlorophyll a, b, and total chlorophyll concentration, in unit of mg/g of plant tissue, after measuring the absorbance at both wavelengths (λ 663 nm and λ 645 nm), the following equations were used (Ayvaz et al., 2012):

Chlorophyll a (mg/g) = [12.7 (D663) – 2.69(D645)] ×V / (1000 ×W)

Chlorophyll b (mg/g) = [22.9 (D645) – 4.68(D 663)] ×V / (1000 ×W)

Total Chlorophyll (mg/g) = [20.2 (D645) + 8.02(D663)] ×V / (1000 ×W)

Where D = absorbance value at the given wavelength,

W= fresh leaf sample weight (g),

V = chlorophyll solution final volume (mL)

4.5. BIOMASS ASSESSMENT, PLANT TISSUE DIGESTION, AND

TISSUE METAL CONTENT

Helianthus annuus L. seedlings after 14 days and Brassica chinensis L. seedlings after 30 days of being exposed to different concentrations of La and Nd were taken out of the media and washed thoroughly with ultrapure water. Helianthus annuus L. is a fast growing plant while Brassica chinensis L. is a slow growing plant. The rate of uptake by fast growing plants are higher than slow growing plant (Scheurwater, Cornelissen, Dictus, Welschen, & Lambers, 1998). Therefore, Brassica chinensis L. seedlings were kept in exposure to La and Nd for a longer time to reach the same growth stage, in terms of shoot height and number of leaves, as Helianthus annuus L. seedlings. After determining the root length, the shoot height, and the number of leaves, the seedlings were divided into three parts; roots, shoots, and leaves. At that point, the fresh weight of each part was determined. Plant materials were then oven dried at 80 °C for 24 hours and the dry weight of each part was measured. For the determination of accumulated metal concentrations, the oven dried plant parts were digested in 2 mL concentrated HNO3, heated in a water bath at 80 °C. The La and Nd concentrations in different plant parts were determined by an Optima 8300 inductively coupled plasma optical emissions spectrometer (ICP-OES). The relative accuracy of the analysis by ICP-OES was 4%.

4.6. TOXICITY THRESHOLD (IC50)

To estimate concentrations causing 50% decrease (IC50) in plant biomass and total chlorophyll concentration, dose-response curves for each root length, shoot height, and

chlorophyll concentration were fitted using CETIS software (see Appendix B) Curves were plotted based on the growth data, the chlorophyll concentrations, and the actual exposure concentrations. Hormetic effects were observed in some parts of the plants; therefore, the halfway response was estimated based on the hormetic maximum values.

The actual exposure concentrations were determined by ICP-OES. The medium with four nominal concentrations, 20 ppm, 100 ppm, 200 ppm, and 300 ppm, for both La and Nd was prepared. Then oven dried media were digested in concentrated HNO3 and HCl. The actual REE concentrations were determined.

4.7. ION SPECIATION

Lanthanum and neodymium ion speciation in the medium was estimated via geochemical modeling using Visual MINTEQ v3.1 (Gustafsson, 2013). The MINTEQ program was run based on the chemical composition of MS medium (see Appendix C), the pH of the media, and the temperature of the growth tent, which were 5.6 and 25 °C, respectively.

4.8. GENE EXPRESSION ANALYSIS

For the detection of HMA4 gene expression level and the quantification of the gene, real- time polymerase chain reaction (PCR) was used to amplify cDNA from mRNA. Seedlings of Helianthus annuus L. were selected for this test as they demonstrated better growth and lower IC50 value.

4.8.1. Total RNA Extraction

Total RNA was isolated from different parts (root, stem, and leaves) of 14 days old seedlings of Helianthus annuus L. Different parts of the plants were submerged into liquid nitrogen, and then ground to a fine powder in liquid nitrogen by using mortar and pestle. Fine ground tissue powder was weighed after evaporation of liquid nitrogen, and less than 0.1 mg of each part of the plant was transferred to 2 mL microcentrifuge tube and kept at -70 °C before tissues powder were treated by lysis solution. 31

Sigma-Aldrich Spectrum Plant Total RNA kit was used for total RNA isolation, and all steps were completed based on the isolation kit instruction. Briefly, 500 μL of the lysis solution was added to the tissue powder (< 0.1 mg) and immediately vortexed for 30 seconds. The sample was incubated at 56 °C for 3-5 minutes. Then, the incubated sample was centrifuged at maximum speed for three minutes in order to pellet cellular debris. After centrifugation, lysis supernatant was pipetted into a filtration column placed in a 2 ml collection tube and centrifuged at maximum speed for one minute to remove residual debris and the clarified flow-through lysate was saved. Five hundred μL of binding solution was added to the clarified lysate and mixed thoroughly by pipetting five times. Then, 700 μL of the solution was added to a binding column and placed into a 2 mL collection tubes, and the sample was centrifuged at maximum speed for one minute in order to bind RNA. The flow-through liquid was decanted, and the residual liquid was drained by tapping the collection tube upside down on absorbance paper.

After binding the RNA, wash solution (1) was added to the column and centrifuged at maximum speed for one minute. The flow-through liquid was decanted, and the residual liquid was drained by tapping the collection tube upside down on absorbent paper. The column was returned to the collection tube. In the next step, 500 μL of wash solution (2) was added to the column and centrifuged for 30 seconds at maximum speed. Again, the flow-through liquid was discarded after centrifugation, and the residual liquid was drained by tapping the collection tube upside down on absorbent paper. The column was returned to the collection tube. Third column wash again was done by adding another 500 μL of the wash solution (2) into the column and centrifuging at maximum speed for 30 seconds. The flow-through liquid and residual liquids were discarded and drained by pipetting and the tube upside down tapping, respectively. The column was returned to the collection tube and centrifuged at maximum speed for one minute to dry.

After the drying step, the column was transferred to a new 2 mL Collection Tube. Then 50 μL of elution solution was added to the center of the column directly to let the column sit for one minute. This column was centrifuged for one minute at maximum speed. After centrifugation, purified RNA was extracted in the flow-through eluate.

RNA quality and concentration after extraction were determined by Nanodrop. After determining the concentration of extracted RNA, DAN digestion was completed by Turbo DNA- free™ kit (Sigma-Aldrich, 2010).

4.8.2. RNA Analysis

Agilent bioanalyzer was used for the analysis of RNA samples, to check the quality of the extracted RNA.

4.8.3. Primer Design

The sequence of the target gene (HMA4) was not found for Helianthus annuus L. in different gene banks. Therefore, the sequence of Arabidopsis thaliana, which is known as a significant model system for gene identification and function (Samir Kaul et al., 2000), was used for designing oligonucleotide primers. The sequence of the HMA4 gene of Arabidopsis thaliana was retrieved from NCBI (National Center for Biotechnology Information) (Cates, 2016). Primer Express Software v3.0 was used for designing forward (F) and reverse (R) primers. The primers were generated from laboratory services molecular biology lab (Guelph, ON). The sequence of each primer was as follows:

 HMA4 (F): CCTCCTATCCTTCCTAAAGTTTGTCTAC

HMA4 (R): TTGGCAAGAATCGGATAGATACC.

 HMA4 (F): ACCTTTATCTGATCGCACCAAAC

HMA4 (R): TTTTCGGAGAAGAGAGGAGAGCTA

The complete coding of Helianthus annuus L. acting gene as a housekeeping gene was retrieved from NCBI (National Center for Biotechnology Information). Housekeeping genes are expressed in different cell types in all developmental stages under all experimental conditions.

Therefore, they are used as internal control to normalize gene expression (Valente et al., 2014). The sequence of the primer was as follows:

 Actin (F): AAAAGCAGCTCGTCTGTCGAA

Actin (R): AACCTCAGGGCAACGGAATC

4.9. STATISTICAL ANALYSIS

The data were statistically analyzed by one-way analysis of variance (ANOVA) using Microsoft Excel. Results are shown in the Appendix D. Also, significant differences among treatment means (t-test) were determined by Microsoft Excel. P-values are shown in the figure captions; the significance threshold used was 0.05.

RESULTS

BRASSICA CHINENSIS L. GROWTH RESPONSE TO LANTHANUM

AND ESTIMATED IC50 VALUES

The average root length (cm) of Brassica chinensis L. at different concentrations of La, which are 0, 17.3, 88.6, 173, and 268 ppm, is shown in Figure 6. In Brassica chinensis L., the effect of La on the root length at low concentrations was not substantial, and the root length at 17.3 ppm and 88.6 ppm of La as compared to the control did not show a significant difference. The root length at a concentration higher than 88.6 ppm of La started to decrease, and the length of the root was inhibited significantly at 173 ppm and 268 ppm of La. At these dosages, root length as compared to the control decreased by 74.5% and 94%, respectively. Besides the inhibition of the root length, other signs of toxicity were not observed at 173 ppm of La. However, at 268 ppm of La, the root showed the following morphological toxicity symptoms: roots were stunted, root cuticles turned brown also lateral root development, and hair root development were inhibited. The result indicated that the root length of the plant is inhibited by 50% at 139 ppm of La.

The average shoot height (cm) of Brassica chinensis L. at different studied concentrations of La is presented in Figure 7. The shoot response to La with studied concentrations indicated that by increasing the La concentration from 0 to 17.3, and 88.6 ppm, the shoot height remained at the same range, and the difference in the shoot height at these three dosages was not significant. When the La dosage was increased to 173 ppm and 268 ppm, the shoot height decreased significantly as compared to 0, 17.3 ppm, and 88.6 ppm. The shoot height decreased at 173 ppm and 268 ppm of La decreased by 26.5% and 80%, respectively. The inhibition of the shoot height at 268 ppm was extreme and dwarf plants grew at this concentration. Therefore, it can be concluded that La inhibitory effects on the shoot started at a concentration higher than 88.6 ppm of La. The IC50 value shows that the shoot height of the plant is inhibited by 50% at 194 ppm of La.

The average number of leaves of Brassica chinensis L. at different studied concentrations is presented in Figure 8. This metal can affect the number of leaves in the plant. The number of leaves significantly decreased by 33.3% at 268 ppm of La as compared to the control. At this dosage, the number of leaves reached its lowest level. The inhibitory concentration for the number of leaves started at a concentration higher than 173 ppm of La. The plants grew at the highest concentration (268 ppm) of this metal were dwarf size and toxicity symptoms were observable. Figure 9 shows harvested Brassica chinensis L. after exposure to different concentrations of La (for 30 days), and as the Figure 9-E shows, at 268 ppm of La toxicity symptoms on the root, shoot, and the number of leaves are clearly visible.

12 IC50 = 139 ppm 10

4 Root Length RootLength (cm) 2

0 0 50 100 150 200 250 300 La Exposure Concentrations (ppm)

Figure 6- Brassica chinensis L. root length responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05)

10 IC50 = 194 ppm 8

4 Shoot Height ShootHeight (cm) 2

0 0 50 100 150 200 250 300 La Exposure Concentrations (ppm)

Figure 7- Brassica chinensis L. shoot height responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05)

2 Number Number leaves of 1

0 0 50 100 150 200 250 300 La Exposure Concentrations (ppm)

Figure 8- Brassica chinensis L. number of leaves after 30 days. Error bars show the standard deviation. Note: some of the treated plants had the same number of leaves and the standard deviation for those treatments were zero. (p < 0.05)

Figure 9- Picture A, B, C, D, and E show harvested Brassica chinensis L. after 30 days of being exposed to 0, 17.3, 88.6, 173, and 268 ppm La, respectively.

BRASSICA CHINENSIS L. GROWTH RESPONSE TO NEODYMIUM

AND ESTIMATED IC50 VALUES

The average root length (cm) of Brassica chinensis L. at different concentrations of Nd, which are 0, 18.1, 89.5, 200, and 335, is presented in Figure 10. As the results indicate, the root length at 18.1 ppm and 89.5 ppm did not change significantly as compared to control. When the dosage of Nd was increased to 200 ppm, the root length decreased significantly (by 35.2%). Thus, inhibitory effects on the root length by Nd started at a concentration higher than 89.5 ppm. The root length decreased markedly at 335 ppm of Nd. At this concentration, the root growth reached its lowest level and decreased by 88.1%. Also, at 335 ppm of Nd morphological toxicity symptoms appeared in the plant. These symptoms were the same as the toxicity symptoms caused by La at 268 ppm concentration. The roots at 335 ppm did not develop, and the plants did not have any lateral roots and hair roots also root cuticles turned brown. The result indicated that the root length of the plant is inhibited by 50% at 222 ppm of Nd. 38

The average shoot height of Brassica chinensis L. at different concentrations of Nd is presented in Figure 11. The shoot response to Nd was different to the root response. The shoot height decreased significantly by 67.9% at 335 ppm as compared to the control. The decrease in the height of the shoot started at a concentration higher than 200 ppm. Therefore, the shoot inhibitory concentration started at a concentration higher than the root inhibitory concentration. The Nd IC50 for the shoot height shows that this part of the plant is inhibited by 50% at 299 ppm of Nd.

The average number of leaves of Brassica chinensis L. at different concentrations of Nd is presented in Figure 12. The stimulatory effect of Nd on the number of leaves was significant at 89.5 ppm. At this concentration, the number of leaves increased by 25% and reached its highest number as compared to the control and 18.1 ppm. However, the number of leaves decreased significantly by 25% at 335 ppm. As a result, the inhibitory concentration for the number of leaves by Nd started at a concentration higher than 200 ppm of Nd. Figure 13 shows harvested plants from various concentrations of Nd after 30 days, and the toxicity symptoms can be observed in Figure 13-E.

14 12 IC50= 222 ppm 10 ppm value 8 6

4 Root Length RootLength (cm) 2 0 0 50 100 150 200 250 300 350 400 Nd Exposure Concentrations (ppm)

Figure 10- Brassica chinensis L. root length responses to Nd exposure and estimated IC50 value.. Error bars show the standard deviation. (p < 0.05)

10 IC50 = 299 ppm 8

2 Shoot Height ShootHeight (cm)

0 0 50 100 150 200 250 300 350 400

Nd Exposure Concentrations (ppm)

Figure 11- Brassica chinensis L. shoot height responses to Nd exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05)

2 Number Number leaves of 1

0 0 50 100 150 200 250 300 350 400 Nd Exposure Concentrations (ppm)

Figure 13- Picture A, B, C, D, and E show harvested Brassica chinensis L. after 30 days of being exposed to 0, 18.1, 89.5, 200, and 335 ppm Nd, respectively.

HELIANTHUS ANNUUS L. GROWTH RESPONSE TO LANTHANUM

AND ESTIMATED IC50 VALUES

The average root length of Helianthus annuus L. at various concentrations of La is presented in Figure 14. The mean separation test (t-test) indicated that differences between the root length at the control, 17.3 ppm, and 88.6 ppm of La were not significant. When the concentration of La was increased to 173 ppm, the root length decreased by 53% as compared to the control. At this dosage, the decrease in root length was significant as compared to the control, 17.1 ppm, and 88.6 ppm. Even though the root length decreased significantly at 173 ppm of La, no signs of toxicity were observed in the plants. The decrease in the root length at this concentration showed that the inhibitory concentration of La on the root started at a concentration higher than 88.6 ppm. At 268 ppm, the root length decreased strikingly by 86.2%. At this concentration, the root did not develop well, and inhibitory effects were observed on

lateral root and hair root development. Also, at 268 ppm, other morphological toxicity symptoms, such as thick stunted roots and brown cuticles appeared (Figure 17). The result indicated that the La concentration at which the root length of Helianthus annuus L. is inhibited by 50% is 178 ppm.

The average shoot height of Helianthus annuus L. at various concentrations of La is presented in Figure 15. The shoot height at low concentrations of La (17.3 ppm and 88.6 ppm) increased by 43.5% and35.5% , respectively as compared to the control. As the Figure 15 shows, the shoot height increased significantly at 17.3 ppm of La. This stimulatory effect on shoot height continued to 88.6 ppm of La. When the La concentration was increased to 173 ppm, the shoot height decreased to the same level as the shoot height at the control. When the La dosage was increased from 173 ppm to 268 ppm, the shoot height decreased by 81.3% as compared to the control. The results showed the stimulatory effect of La on the shoot height started at a dosage of around 17.3 ppm of La and continued to the 88.6 ppm concentration. The inhibitory concentration for the shoot height started at a concentration higher than 88.6 ppm of La. The result showed that La IC50 for the shoot height of the plant is 139 ppm.

The average number of leaves of Helianthus annuus L. at various concentrations of La is presented in Figure 16. The number of the leaves at 268 ppm of La decreased significantly by 45.5% as compared to the control. The results indicated that the inhibitory concentration for the root and shoot started at a concentration higher than 88.6 ppm of La. However, the inhibitory concentration for the leaves started at a concentration higher than 173 ppm of La.

10 IC50 = 178 ppm 8

Root Length RootLength (cm) 2

0 0 50 100 150 200 250 300 La Exposure Concentrations (ppm)

Figure 14- Helianthus annuus L. root length responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05)

18 16 IC50 = 139 ppm 14 12 10 8 6 Shoot Height ShootHeight (cm) 4 2 0 0 50 100 150 200 250 300 La Exposure Concentrations (ppm)

Figure 15- Helianthus annuus L. shoot height responses to La exposure and estimated IC50 value. Error bars show the standard deviation. (p < 0.05)

2 Number Number leaves of

0 0 50 100 150 200 250 300 La Exposure Concentrations (ppm)

Figure 16- Helianthus annuus L. number of leaves after 14 days. Error bars show the standard deviation. Note: some of the treated plants had the same number of leaves and the standard deviation for those treatments were zero. (p < 0.05)

Figure 17- Picture A, B, C, D, and E show harvested Helianthus annuus L. after 14 days of being exposed to 0, 17.3, 88.6, 173, and 268 ppm La, respectively.

HELIANTHUS ANNUUS L. GROWTH RESPONSE TO NEODYMIUM

AND ESTIMATED IC50 VALUES

The average root length of Helianthus annuus L. at different concentrations of Nd is presented in Figure 18. The root length increased significantly at 18.1 ppm of Nd by 36.9% as compared to the control. Based on the t-test results, when Nd dosages were increased to 89.5 and 200 ppm, the root length did not decrease significantly. However, when the Nd concentration was increased from 200 ppm to 335 ppm, the root length decreased by 86.2% as compared to the control. Also, the decrease in the root length at this dosage was significant as compared to the root length at 18.1 ppm, 89.5 ppm, and 200 ppm. Therefore, the inhibitory concentration for root length started at a dosage higher than the 200 ppm of Nd. As Figure 21 picture (E) shows, morphological toxicity symptoms can be observed at 335 ppm of Nd, and this dosage of Nd inhibited hair root and lateral root development. The primary root became stunted at 335 ppm of Nd and the root cuticle turned brown. These morphological toxicity signs were the same as those signs observed in the plant root at 268 ppm of La. The Nd concentration at which the root of the plant is inhibited by 50% is 258 ppm.

The average shoot height of Helianthus annuus L. at different concentrations of Nd is presented in Figure 19. The shoot response to Nd at various concentrations showed that differences in the growth of this part of the plant at 18.1 ppm, 89.5 ppm, and 200 ppm of Nd were not significant as compared to the control shoot height. When the Nd concentration was increased to 335 ppm, the shoot height decreased by 66.8% as compared to the control. At 335 ppm of Nd, the inhibition of the shoot growth was significant as compared to the shoot height at other dosages. Also, at this concentration of Nd, a toxicity symptom, in the form of purpled shoot, was observed on the shoot of the plants (Figure 21, picture E). The inhibitory concentration for the shoot height was the same as the inhibitory concentration for root length, 200 ppm of Nd. The result showed that Nd IC50 for the shoot height of the plant is 333 ppm.

The average number of leaves of Helianthus annuus L. at different concentrations of Nd is presented in Figure 20. Neodymium had an adverse effect on this part of the plant at high

dosages. When Nd concentration was increased to 335 ppm, the number of leaves decreased significantly by 45.5% as compared to the control. As a result, the inhibitory dosage for all parts of the plant started at a concentration higher than 200 ppm of Nd.

12 IC50= 258 ppm 10

4 Root Length RootLength (cm) 2

0 0 50 100 150 200 250 300 350 400 Nd Exposure Concentrations (ppm)

Figure 18- Helianthus annuus L. root length responses to Nd exposureand estimated IC50 value.. Error bars show the standard deviation. (p < 0.05)

18 IC50= 333 ppm 15 12 9

6 Shoot Height ShootHeight (cm) 3 0 0 50 100 150 200 250 300 350 400 Nd Exposure Concentrations (ppm)

Figure 19- Helianthus annuus L. shoot height responses to Nd exposure and estimated IC50 value.. Error bars show the standard deviation. (p < 0.05)

2 Number Number leaves of 1

0 0 50 100 150 200 250 300 350 400

Nd Exposure Concentrations (ppm)

Figure 21- Picture A, B, C, D, and E show harvested Helianthus annuus L. after 14 days of being exposed to 0, 18.1, 89.5, 200, and 335 ppm Nd, respectively.

BRASSICA CHINENSIS L. CHLOROPHYLL RESPONSE TO

LANTHANUM AND NEODYMIUM, AND ESTIMATED IC50 VALUES

The chlorophyll concentration of Brassica chinensis L. exposed to different La concentrations is shown in Figure 22 and the line graph shows fresh weight (FW) to dry weight (DW) ratio. At 17.3 ppm, 88.6 ppm, and 173 ppm of La, chlorophyll concentrations were not significantly different as compared to the control. However, when the La concentration was increased to 268 ppm, the chlorophyll a, b, and total chlorophyll concentrations decreased significantly as compared to the control and other treatments. At 268 ppm, the decrease in the chlorophyll concentration in the plant was visible and chlorotic leaves were observed. The La concentration at which the total chlorophyll concentration is inhibited by 50% is 244 ppm.

2.5 45 40 2 35 30 1.5 25

20 FW/DW 1 15

0.5 10

Chlorophyll Concentration (mg/g) ConcentrationChlorophyll 5 0 0 0 17.3 88.6 173 268 La Exposure Concentrations (ppm) Chlorophyll a Chlorophyll b Total Chlorophyll FW/DW

Figure 22- Chlorophyll concentration in Brassica chinensis L. exposed to different concentrations of La for 30 days. Error bars show the standard deviation. (p < 0.05)

The chlorophyll concentration of Brassica chinensis L. exposed to various concentrations of Nd is shown in Figure 23. The chlorophyll a, b, and total chlorophyll concentrations at the 18.1 ppm, and 89.5 ppm were the same as chlorophyll concentration in the control. Figure 23 shows that at 18.1 ppm and 89.5 ppm the chlorophyll concentrations decreased. The decrease in

the chlorophyll concentrations was related to the increase in the leaf water content (line graph in Figure 23). The chlorophyll concentration at 200 ppm of Nd increased significantly as compared to the control, 18.1 ppm, and 89.5 ppm. However, when the Nd dosage was increased to 335 ppm, the chlorophyll concentration decreased significantly. Therefore, it can be concluded that the decrease in chlorophyll concentration in Brassica chinensis L. started at a concentration higher than 200 ppm of Nd. The Nd concentration at which the total chlorophyll concentration is inhibited by 50% was not within the studied concentrations (IC50 >335).

2.5 45 40 2 35 30 1.5 25

20 FW/DW 1 15 0.5 10

5 Chlorophyll Concentration (mg/g) ConcentrationChlorophyll 0 0 0 18.1 89.5 200 335 Nd Exposure Concentrations (ppm) Chlorophyll a Chlorophyll b Total Chlorophyll FW/DW

Figure 23- Chlorophyll concentration in Brassica chinensis L. exposed to different concentrations of Nd for 30 days. Error bars show the standard deviation. (p < 0.05)

HELIANTHUS ANNUUS L. CHLOROPHYLL RESPONSE TO

LANTHANUM AND NEODYMIUM, AND ESTIMATED IC50 VALUES

Figures 24 and 25 show the chlorophyll concentrations of Helianthus annuus L. exposed to various concentrations of La and Nd, respectively. The line graphs (Figures 24 and 25) show FW/DW ratio. The effects of the both La and Nd on the chlorophyll concentrations of Helianthus annuus L. were not significant (p > 0.05). The data indicated that the IC50 values for both La and Nd were not within the tested concentrations.

1.4 20 18 1.2 16 1 14 0.8 12 10 0.6 8 FW/DW 0.4 6 4 0.2 2

Chlorophyll Chlorophyll Concentration (mg/g) 0 0 0 17.3 88.6 173 268 La Exposure Concentrations (ppm) Chlorophyll a Chlorophyll b Total Chlorophyll FW/DW

Figure 24- Chlorophyll concentration in Helianthus annuus L. exposed to different concentrations of La for 14 days. Error bars show the standard deviation. (p > 0.05)

1.4 20 18 1.2 16 1 14 0.8 12 10 0.6 8 FW/DW 0.4 6 4 0.2 2 0 0 Chlorophyll Chlorophyll Concentration (mg/g) 0 18.1 89.5 200 335 Nd Exposure Concentrations (ppm) Chlorophyll a Chlorophyll b Total Chlorophyll FW/DW

Figure 25- Chlorophyll concentration in Helianthus annuus L. exposed to different concentrations of La for 14 days. Error bars show the standard deviation. (p > 0.05)

RARE EARTH ELEMENT SPECIATION AND UPTAKE BY PLANTS

Lanthanum and neodymium speciation in the media were determined using Visual MINTEQ 3.1 withthe modeling output shown in Table 7.

Table 7- Lanthanum and neodymium speciation and total concentration percentage in the media, determined by Visual MINTEQ 3.1 modeling

Concentration (ppm) % of Total Concentration Species Name La 173 4.7 La+3 79 LaCl+2 - 0.029 La(SO4)2 + 3.5 LaSO4 +2 0.73 LaNO3 +2 1.9 LaH2PO4 10 LaEDTA- La 268 4.9 La+3 82 LaCl+2 - 0.025 La(SO4)2 + 3.3 LaSO4 +2 0.76 LaNO3 +2 2 LaH2PO4 6.6 LaEDTA- Nd 200 60 Nd+3 0.14 NdOH+2 - 0.022 Nd(SO4)2 + 15 NdSO4 +2 15 NdNO3 9.3 NdEDTA- 0.016 NdH-Glycine+3 Nd 335 67 Nd+3 0.16 NdOH+2 + 10 NdSO4 +2 17 NdNO3 5.6 NdEDTA- 0.018 NdH-Glycine+3

As the results of La ion speciation in the media showed, the dominant form of La ions was the chloride complex LaCl+2. However, Nd ion speciation showed that the dominant ionic 3+ + +2 species in the media was in the form of free Nd , followed by complex NdSO4 and NdNO3 ions. Although the composition of the media was the same, and the same form of La and Nd were added to the media, Nd-chloride complex did not form. Therefore, the highest percentage

of the available La for plant uptake was in the form of complex ions and the highest percentage of the available Nd for plant uptake was in the form of the free ion.

Lanthanum and neodymium uptake by the different parts of Helianthus annuus L. at different concentrations (173 ppm and 268 ppm of La, 200 ppm and 335 ppm of Nd) are shown in Table 8. The results showed that the concentrations of La and Nd in the roots were higher than in other parts of the plant. Roots accumulated more than 90% of La and Nd. Therefore, for both La and Nd, the distribution pattern was as follows: Root > Stem > Leaves. When Nd and La concentrations were increased in the media, root concentrations showed a significant increase (p < 0.05). However, the concentrations of La and Nd in the shoots and the leaves did not show significant increases (p > 0.05). The translocation factor (TF) for both La and Nd (Table 10) was less than one showing that the translocation of these elements from the root to the shoot was low.

Table 8- Helianthus annuus L. tissue La and Nd concentrations (ppm) based on the dry weight (ppm DW). The relative accuracy of the analysis was 4%.

Helianthus annuus L. (ppm DW) REE Dosage (ppm) Root Shoot Leaves

La 173 1567.7±856.77 119.80±108.63 5.556±9.6225

La 268 20505±1875.5 752.16±405.14 537.55±564.81

Nd 200 2745.1±346.72 211.31±32.564 152.07±62.254

Nd 335 29690±15323 878.58±905.49 179.94±100.76

Table 9- Brassica chinensis L. La and Nd concentrations (ppm) based on wet weight (ppm WW). The relative accuracy of the analysis was 4%.

Brassica chinensis L. (ppm WW) REE Dosage (ppm) Root Shoot Leaves

La 173 267.59±81.36 0 0.72464±1.255

La 268 5794.4±1893 1335±443.1 192.92±255.6

Nd 200 1053.2±401 29.734±6.599 28.104±7.815

Nd 335 7507.2±4163 1428.7±1343 126.75±75.67

Lanthanum and neodymium uptake by the different part of Brassica chinensis L. based on wet weight are shown in Table 9. The concentration of La in the root at 173 ppm of La was significantly lower than the concentration of Nd in the root at 200 ppm of Nd. Therefore, Brassica chinensis L. accumulated Nd at a higher rate than La. More than 90% of the total accumulated La and Nd by this plant were accumulated by the roots. When the La concentration was increased in the media, the concentration of La in the roots increased markedly (p < 0.05). When the Nd concentration was increased, the concentrations of Nd in the roots, shoots, and leaves did not change significantly (p > 0.05). The order of La and Nd concentrations in different parts of the plant was as follows: Root > shoot > leaves. The translocation factor (TF) for the both La and Nd was less than 1; therefore, the translocation of these metals from the root to the shoot of Brassica chinensis was low (Table 10).

Table 10- Translocation factor in Helianthus annuus L. and Brassica chinensis L.

REE Dosage Helianthus annuus L. Brassica chinensis L. (ppm) TF TF La 173 0.1 ± 0.1 0 La 268 0.04 ± 0.02 0.3 ± 0.2 Nd 200 0.08 ± 0.01 0.03 ± 0.02 Nd 335 0.02 ± 0.01 0.2 ± 0.08 53

HMA4 GENE EXPRESSION

The results of q-PCR showed that the sequence information of Helianthus annuus L. is different from sequence information of Arabidopsis thaliana. Therefore, the primers were not able to amplify the particular sequence (HMA4). The designed actin gene primer was the only primer that showed amplification.

DISCUSSION

6.1. Growth Response and Inhibitory Concentration

The impacts of REEs on plant physiology have been previously reported for different species. Researchers have shown that REEs can increase plant biomass. For instance, tobacco seedling growth can be stimulated by La (D. Liu et al., 2013). Hu et al. (2004) demonstrated that plant growth can be regulated by REEs since these elements affect mineral element uptake by plants. It has been shown that K, Ca, and Mn accumulation by Oryza sativa L. (rice) increased at 6.9 ppm and 13.9 ppm concentrations of La. However, at 69.4 ppm and 138.9 ppm of La, the bioaccumulation of these nutrient elements decreases (D. Liu et al., 2013). The stimulatory impacts of any poisonous substances on any life form, at subinhibitory dosages, is known as hormesis (D. Liu et al., 2013; Poschenrieder et al., 2013). Our results with La and Nd on the shoot and root of Helianthus annuus L., respectively, are in agreement with this concept; this study showed that La and Nd at low dosages had a hormetic effect on the shoot and root, respectively, of this plant. Also, the hormetic effect of Nd was observed on the number of leaves in Brassica chinensis L.. Determining the exact description of hormetic dose-response for species and metals is considered a critical step when the adequacy and risk of metals with hormetic phenomenon are regulating (D. Liu et al., 2013). Also, metal ion homeostasis in plants requires stringent control since these metals can be toxic to plants (Briat & Lebrun, 1999).

Our study contradicts previous research that has been done on the effects of La on the root of Oryza sativa L.. In our study, it was found that low concentrations of La did not cause an increase in the root growth of Brassica chinensis L. and Helianthus annuus L.. Liu et al. (2013), reported that 6.9 ppm and 13.9 ppm of La can increase the root growth of Oryza sativa L.. Moreover, they reported that 139 ppm and 208 ppm of La have inhibitory effects on the root growth of this plant. The root growth increase in Oryza sativa L. at low concentrations of La occurs as a result of the stimulatory impact of La on the accumulation of nutrients in the plants (D. Liu et al., 2013). The normal growth and development of plants require high concentrations of inorganic elements, moderate concentrations of nutrients, trace elements and beneficial

elements. It is believed that the absorption of other mineral elements in plants can be regulated by REEs (C. Zhang, Li, Zhang, Zhang, & Li, 2013). The nutrient metabolism in plants has shown a significant increase when in the presence of REEs. The activity of nitrates in both peanut and tomato has increased by spraying REEs. Also, REEs caused the acceleration of the rate of N transfer from an inorganic to organic form that is beneficial for protein synthesis and nutrient balance regulation (Pang, Li, & Peng, 2002). It has been reported that low concentrations of La increase growth in corn roots (D. Liu et al., 2013). The stimulation of plant growth by REEs has been demonstrated by various experiments (Z. Hu et al., 2004). REEs, such as La, Ce, Pr, and Nd, at low concentrations increase the growth of roots in coconut. However, at high concentrations, decreased root growth has been observed. This inverse relationship between root growth and REE concentration in coconut is due to the inhibitory effects of REEs on the absorption of P and Zn (Z. Hu et al., 2004). Based on the present study results, the stimulatory effect of REEs on plant root growth is dependent on the characteristic of the species being studied. There are controversies about possible metal tolerance mechanisms in plants. The complexity of the nature of plant responses to metal toxicity resulted in the lack of information about the metal toxicity in plants. It seems that tolerance mechanisms to an excess metal between various species are different. Also it is likely that each plant exposed to a toxic metal operates more than one metal tolerance mechanism (Reichman, 2002).

The signs of toxicity observed in this study match the signs of toxicity reported by other researchers studying other plant species and metals. It has been observed that excess concentrations of metals have a marked effect on plant growth. Root deformations, thick stunted roots, brown cuticles are among the signs observed with excess concentrations of metals, such as aluminum (Al) and Mn (Dekock, 1956; Fay, Chaney, & White, 1978). Other signs of Al toxicity observed in plants are overall stunting and changing of the stem color to purple (Fay et al., 1978). Furthermore, it has been reported that in Sinapis alba, dwarfism, purpled stem, and chlorosis were signs of Cu toxicity (Dekock, 1956).

The results of the present study indicated that Brassica chinensis L. and Helianthus annuus L. are more resistant to high dosages of La and Nd, as compared to findings of other studies (Fashui, Ling, & Chao, 2003; K. Wen, Liang, Wang, Hu, & Zhou, 2011); decreased 56

growth in various parts of these plants occurred at high concentrations of La and Nd. In contrast, it has been shown (K. Wen et al., 2011) that La at 11.1 ppm increases shoot height and root length in soybean, while at a higher concentration (55.6 ppm) a reduction in the growth of these parts of the soybean seedling occurs. Growth reduction was strikingly greater at the dosage of 166.7 ppm La. Therefore, 11.1 ppm of La is the approximate concentration at which soybean growth is enhanced. However, La stimulatory dosages vary based on the species (K. Wen et al.,

2011). It has been shown that La(NO3)3 at 20 to 700 ppm could increase the root growth of rice, while the effects of REEs on the shoot were reportedly not significant (Fashui et al., 2003). As the assayed plants in this study showed higher tolerance to La and Nd, the plants have the ability to be used in phytostabilization. For the application of a plant in phytostabilization, which is a feasible means of contaminated soil management, a plant with a high tolerance to metals is considered a required characteristic (Colzi, Rocchi, Rangoni, Del Bubba, & Gonnelli, 2014).

6.2. Chlorophyll Response to Lanthanum and Neodymium

The chlorophyll concentration in Brassica chinensis L. increased when exposed to 200 ppm of Nd. However, when the concentration of Nd was increased to 335 ppm, the chlorophyll concentration decreased significantly. Other studies have demonstrated the positive impact of REEs on chlorophyll synthesis. Appropriate concentrations of REEs can improve plant rate of photosynthesis, markedly (Emmanuel et al., 2010; Fashui, Ling, Xiangxuan, Zheng, & Guiwen, 2002; Pang et al., 2002). The reduction in chlorophyll concentration of plants could be attributed to both the pigment synthesis disturbance and the chlorophyll degradation (Gajewska, Skłodowska, Słaba, & Mazur, 2006).

This study showed that La does not increase the chlorophyll concentration in Brassica chinensis L.. This finding is not in agreement with studies on other plants, which stated that a suitable concentration of La can increase the rate of photosynthesis in tobacco and rice (D. Liu et al., 2013; L. Wang, Wang, Zhou, & Huang, 2014). A study on LaCl3 at different dosages indicated that LaCl3 at a suitable concentration (20 ppm) can improve the process of photosynthesis in rice. However, increasing the LaCl3 concentrations to 300-600 ppm decreases the photosynthetic activities (L. Wang et al., 2014). The differences in plant responses to toxic 57

metals can be attributed to the different characteristics of each species studied since it is believed that each plant species has various metal tolerance mechanisms (Reichman, 2002).

Our data showed that the reduction in chlorophyll concentration observed in the studied plants occurs at higher concentrations of La and Nd, as compared to other plants. Previously, it has been shown that La at 50-100 ppm causes a reduction in chlorophyll concentration in tobacco (Chen, Tao, Gu, & Zhao, 2001). Moreover, the chlorophyll concentration in soybean exposed to 55.6-167 ppm La has shown a decrease (K. Wen et al., 2011). Therefore, the plants herein studied are not as sensitive as other plants that have been studied so far.

6.3. Speciation and REE Uptake by The Plants

In this study, La and Nd ion speciation showed that the dominant form of La ions was the chloride complex LaCl+2 and the dominated form of Nd was the free ion. Our findings are in agreement with other studies indicating that the Nd- chloride complexes only form in hydrothermal solutions at elevated temperature. Migdisov and Williams-Joes (2002) examined the possibility of the formation of Nd complexes in chloride solutions, at 25 °C to 250 °C and 50 bar. The result of their study indicated that at 25°C, simple Nd+3 ions are the dominant species. +2 + However, NdCl and NdCl2 become dominant at elevated temperatures (Migdisov & Williams- Jones, 2002). Also, there is evidence that shows that the complex form of Nd-chloride is weak or non-existent at lower temperatures (Gammons, Wood, & Williams-Jones, 1994).

In this study, the result of the plant tissue content analysis indicated that Nd concentration in the roots and shoots of Brassica chinensis L. and Helianthus annuus L. were higher than La. The reason Nd was higher in the shoots and roots of the plants is that this element was available in the form of free Nd ions. It is known that metal accumulation by plants, in the short term, is related to free ion activity (Ge, Murray, & Hendershot, 2000). This fact is in agreement with the results of Nd analysis in this study. The result of La ion complex accumulation in the assayed plants is in agreement with other studies that demonstrated the ability of plants to take up complex ions. Researchers have shown the ability of Lemna minor L. and other vascular plants to take up complex ions (Weltje, Brouwer, Verburg, Wolterbeek, & de Goeij, 2002). It has been

shown that Lemna minor L. in addition to free Cu+2 ions, can take up Cu in the form of organic complexes. Moreover, it has been suggested that Cd is accumulated by Solanum lycopersicum in the form of CdEDTA-2 complex (Weltje et al., 2002). Studies have shown that Cd accumulation by swiss chard is enhanced by increasing the CdCl+ activity (Smolders & McLaughlin, 1996). Finally, it has been indicated that the concentration of REEs in the root of wheat (Tritiicum) has a positive linear correlation with ionic REEs and REE-EDTA complexes in nutrient solutions (Xinde, Xiaorong, & Guiwen, 2000).

For both the studied plants, the REE concentrations in roots were higher than other parts of the plants. When the concentrations of these elements were increased in the growth media, the root La and Nd concentrations in Helianthus annuus L. and Brassica chinesis L. increased significantly. It has been shown that REE concentrations in roots correlate with exposure dosages of REEs (Liang et al., 2005). High concentrations of REEs in the roots agree with the plant general behaviors towards the environmental stress. Metal translocation into the aboveground parts of plants is thus minimized, to decrease the toxicity effects of the metals on plants (S. Zhang & Shan, 2001). Since aboveground parts of plants are considered as a primary place for photosynthesis, REE uptake in shoots and leaves is more problematic and causes more toxic effects (Thomas et al., 2014).

The REE concentration in plant aboveground parts is considered as an indicator to identify REE hyperaccumulators; REE concentration in such plants must be higher than 1000 ppm in foliage (Liang et al., 2014). The concentrations of REEs in aboveground parts of the studied plants as compared to D. dichotoma, P. simplex, and Mockernut hickory, which are REE hyperaccumulators, are clearly low. It has been reported that TF for hyperaccumulator plants should be greater than one (Karman et al., 2015); however, the TF for both the studied plants was less than one. Our finding supports the results of other studies that showed the uptake of REEs within aboveground organelles of vascular plants is low (Z. Hu et al., 2004; Thomas et al., 2014; B. Wen, Yuan, Shan, Li, & Zhang, 2001).

In this study, MS medium was used as the growth medium for plants. In this media, nutrients were available at high levels; therefore, root growth reduction, hair root, and lateral root

growth inhibition did not affect the accessibility of the plants to nutrients. The root development and plant growth at 268 ppm La and 335 ppm Nd were inhibited, and dwarf plants grew at these dosages. For reaching hyperaccumulator status, only plant foliage must be considered as aerial tissue. Moreover, plants must be able to grow in unfavorable conditions and take up metal while they maintain growth (Mahar et al., 2016). For culturing plants in the soil environment, root surface area is considered as an important factor for determination of the plant ability to accumulate nutrients and water from the soil. Therefore, in soil, root growth and root hair proliferation can have more impact on the plants (Sheldon & Menzies, 2005). As a result of toxicity symptoms and low REE tissue contents that have been observed in the studied plants, these plants cannot be considered as REE hyperaccumulators.

CONCLUSIONS

The purpose of this study was to assess the toxicity and hyperaccumulation of two REEs, La and Nd, on two horticultural plants, Helianthus annuus L. and Brassica chinensis L.. The investigation into the toxic effects revealed that the studied REEs are toxic to the plants, at high dosages. However, at low dosages, La and Nd showed hormetic effects on the shoot and root of Helianthus annuus L. Nd showed stimulatory effects on the number of leaves and chlorophyll concentration of Brassica chinensis L., at low dosages. A comparison of the concentrations at which La and Nd cause a 50% decrease (IC50) in the shoot height, root length indicated that La is more toxic for the studied plants.

The estimated IC50 values found in this study (e.g. 139 and 178 La ppm for the roots of Brassica chinensis L. and Helianthus annuus L. and 222 and 258 Nd ppm for the roots of Brassica chinensis L. and Helianthus annuus L.) are close to the reported soil REE concentrations found in Australia, Germany, and Japan (105 ppm, 305 ppm, and 98 ppm, respectively (wang & Liang, 2014)). REEs enter the environment as a result of human activity (Thomas et al., 2014), and it could cause the concentrations of these elements in soil to reach the IC50 values determined in this study. Lanthanum and neodymium speciation in the media showed that the dominant ionic species in the media for Nd was in the form of the free Nd3+ ion. However, the dominant ionic species in the media for La was in the form of chloride complex LaCl+2. Metal accumulations by plants, in the short term, is related to the free ion activity (Ge et al., 2000). However, based on these result of La ion speciation, the plants are able to accumulate the LaCl+2 complex. It is to be noted that the results found in this study were through environmental exposure in agar; in soil solution, the speciation of the metals could be different and, therefore, the plants may exhibit different responses.

The potential of the plants to hyperaccumulate the REEs was also determined. This assessment was done through gene analysis and tissue content analysis. Given the genome sequence of Helianthus annuus L. is not completely available, primers were designed based on the Arabidopsis thaliana gene sequence. However, the results of q-PCR showed that the HMA4 gene sequence information of Arabidopsis thaliana is different from HMA4 gene sequence 61

information of Helianthus annuus L.. Therefore, the determination of the HMA4 gene expression in Helianthus annuus L. exposed to La and Nd was not possible. On the other hand, since the sequence of the actin gene for Helianthus annuus L. is available on the gene bank, designing a primer with the ability to amplify this sequence was possible.

The results of the tissue content analysis of the plants showed that the concentrations of La and Nd in the roots of the plants were higher than the concentrations of these elements in the plant leaves. Therefore, the plants are unable to accumulate and translocate high concentrations of REEs in their foliage (TF<1). As REEs are known as new environmental pollutants (H. Hu et al., 2016), and REE deposits are depleting (Van der Ent et al., 2015) it is important to identify REE hyperaccumulator plants and utilize them in soil remediation and REE recycling.

RECOMENDATIONS

The following recommendations can be considered for future studies related to this research area:

 More studies are required to be conducted on ion speciation and bioavailability of REEs in soil environment. o Study the effects of different pHs on the availability of REEs for plant uptake. o Study the effects of plant growth promoting bacteria on the bioavailability of REEs in soil.  More genomic analyses are required regarding plant genes that are responsible for REE ions transportation in plants. o Analysis of the expression level and quantification of gene families, such as HMA, ZIP and MATE in REE hyperaccumulator plants after exposure to these elements. o Identify genes that play a role in REE homeostasis, REE transportation and REE tolerance in hyperaccumulator plants.

REFERENCES

AccessScience Editors. (2014). Rare-earth elements: recycling or replacement. In AccessScience.McGraw-Hill Education, 46(6), 3406–3414. doi:10.1021/es203518d

Adesodun, J. K., Atayese, M. O., Agbaje, T. A., Osadiaye, B. A., Mafe, O. F., & Soretire, A. A. (2010). Phytoremediation potentials of sunflowers (Tithonia diversifolia and Helianthus annuus) for metals in soils contaminated with zinc and lead nitrates. Water, Air, and Soil Pollution, 207(1-4), 195–201. doi:10.1007/s11270-009-0128-3

Aggarwal, A., Sharma, I., Tripathi, B. N., Munjal, A. K., Baunthiyal, M., & Sharma, V. (2012). Metal toxicity and photosynthesis. Photosynthesis: Overviews on Recent Progress and Future Perspectives. Retrieved from http://www.researchgate.net/publication/231608518_Metal_Toxicity_and_Photosynthesis/fi le/9fcfd506da4bcd18d2.pdf

Anderson, C., Brooks, R., Stewart, R., Simcock, R., & Robinson, B. (1999). The phytoremediation and phytomining of heavy metals. In Pacrim, 99, 127–135.

Anderson, C. W. N., Brooks, R. R., Chiarucci, A., Lacoste, C. J., Leblanc, M., Robinson, B. H., … Stewart, R. B. (1999). Phytomining for nickel, thallium and gold. Journal of Geochemical Exploration, 67(1-3), 407–415. doi:10.1016/S0375-6742(99)00055-2

Avalon. (2012). Rare Earth 101. Retrieved from www.raremetalblog.com

Ayvaz, M., Koyuncu, M., Guven, A., & Fagerstedt, K. V. (2012). Does boron affect hormone levels of barley cultivars? EurAsian Journal of BioSciences, 120(October), 113–120. doi:10.5053/ejobios.2012.6.0.14

Biling, W., Zhengmiao, X., Jianjun, C., Juntao, J., & Qiufeng, S. (2007). Effects of field applicaation of phosphate fertilizers on the availibility and uptake of lead, zinc and casmium by cabbage (Brassica chinensis L.) in a mining tailing contaminated soil, 20, 1109–1117.

doi:10.1016/S1001-0742(08)62363-3

Briat, J.-F., & Lebrun, M. (1999). Plant responses to metal toxicity. Comptes Rendus de l’Académie Des Sciences - Series III - Sciences de La Vie, 322(1), 43–54. doi:10.1016/S0764-4469(99)80016-X

Brooks, R. R., Chambers, M. F., Nicks, L. J., & Robinson, B. H. (1998). Phytomining. Trends in Plant Science, 3(9), 359–362. doi:10.1016/S1360-1385(98)01283-7

Calabrese, E. J. (2008). Hormesis: principles and applications for pharmacology and toxicology. Am J Pharmacol Toxicol, 3(1), 59–71.

Calabrese, E. J., & Baldwin, L. A. (2001). The frequency of U-shaped sose responses in the toxicological loterature. Toxicol. Sci., 62, 330–338.

Calabrese, E. J., & Baldwin, L. A. (2003). The Hormetic Dose-Response Model Is More Common than the Threshold Model in Toxicology, 250, 246–250. doi:10.1093/toxsci/71.2.246

Calabrese, E. J., & Blain, R. B. (2009). Hormesis and plant biology. Environmental Pollution, 157(1), 42–48. doi:10.1016/j.envpol.2008.07.028

Castor, S. B., & JHedrick, B. H. (2010). Rare earth elements. Industrial Minerals and Rocks, 7th Edition: Society for Mining, Metallurgy, and Exploration, Littleton, Colorado, 769–792. doi:10.1002/14356007.a22

Cates, S. (2016). NCBI: National Center fo Biotechnology Information. Retrieved from http://www.ncbi.nlm.nih.gov/snp

Center for Mined Land. (2014). Phytomining Workshop (pp. 16–18). The University of Queensland.

Chaney, R. L., Angle, J. S., Broadhurst, C. L., Peters, C. A., Tappero, R. V, & Sparks, D. L.

(2007). Improved understanding of hyperaccumulation yields commercial phytoextraction and phytomining technologies. Journal of Environmental Quality, 36(5), 1429–1443. doi:10.2134/jeq2006.0514

Chawla, H. S. (2002). Introduction to Plant Biotechnology. Sience Publishers.

Chen, W. J., Tao, Y., Gu, Y. H., & Zhao, G. W. (2001). Effect of lanthanide chloride on photosynthesis and dry matter accumulation in tobacco seedlings. Biological Trace Element Research, 79(2), 169–176. doi:10.1385/BTER:79:2:169

Cieśliński, G., Van Rees, K. C. J., Szmigielska, A. M., Krishnamurti, G. S. R., & Huang, P. M. (1998). Low-molecular-weight organic acids in rhizosphere soils of durum wheat and their effect on cadmium bioaccumulation. Plant and Soil, 203(183639), 109–117. doi:10.1023/A:1004325817420

Colangelo, E. P., & Guerinot, M. Lou. (2006). Put the metal to the petal: metal uptake and transport throughout plants. Current Opinion in Plant Biology, 9(3), 322–330. doi:10.1016/j.pbi.2006.03.015

Colzi, I., Rocchi, S., Rangoni, M., Del Bubba, M., & Gonnelli, C. (2014). Specificity of metal tolerance and use of excluder metallophytes for the phytostabilization of metal polluted soils: the case of Silene paradoxa L. Environmental Science and Pollution Research, 21(18), 10960–10969. doi:10.1007/s11356-014-3045-y

Cosio, C., Martinoia, E., & Keller, C. (2004). Hyperaccumulation of cadmium and zinc in Thlaspi caerulescens and Arabidopsis halleri at the leaf cellular level. Plant Physiology, 134(February), 716–725. doi:10.1104/pp.103.031948.translocation

Cutright, T., Gunda, N., & Kurt, F. (2010). Simultaneous hyperaccumulation of multiple heavy metals by Helianthus annuus grown in a contaminated sandy-loam soil. International Journal of Phytoremediation, 12(6), 562–573. doi:10.1080/15226510903353146

Dekock, P. C. (1956). Heavy Metal Toxicity and Iron Chlorosis. Annals of Botany, 20(1), 133– 66

141.

Dodson, J. R., Hunt, A. J., Parker, H. L., Yang, Y., & Clark, J. H. (2012). Chemical Engineering and Processing : Process Intensification Elemental sustainability : Towards the total recovery of scarce metals. Chemical Engineering & Processing: Process Intensification, 51, 69–78. doi:10.1016/j.cep.2011.09.008

Emmanuel, E. S. C., Ramachandran, A. M., Ravindran, A. D., Natesan, M., & Maruthamuthu, S. (2010). Effect of some rare earth elements on dry matter partitioning , nodule formation and chlorophyll content in Arachis hypogaea L . plants. Australian Journal of Crop Science, 4(9), 670–675.

Ernst, W. H. O. (2005). Phytoextraction of mine wastes - Options and impossibilities. Chemie Der Erde - Geochemistry, 65, 29–42. doi:10.1016/j.chemer.2005.06.001

Fashui, H., Ling, W., & Chao, L. (2003). Study of lanthanum on seed germination and growth of rice. Biological Trace Element Research, 94(3), 273–86. doi:10.1385/BTER:94:3:273

Fashui, H., Ling, W., Xiangxuan, M., Zheng, W., & Guiwen, Z. (2002). The effect of cerium (III) on the chlorophyll formation in spinach. Biological Trace Element Research, 89(3), 263–276. doi:10.1385/BTER:89:3:263

Fay, C. D., Chaney, R. L., & White, M. C. (1978). The physiology of metal toxicity in plants. Annual Review of Plant Physiology, 29(1), 511–566.

Franus, W., Wiatros-Motyka, M. M., & Wdowin, M. (2015). Coal fly ash as a resource for rare earth elements. Environmental Science and Pollution Research, 9464–9474. doi:10.1007/s11356-015-4111-9

Gajewska, E., Skłodowska, M., Słaba, M., & Mazur, J. (2006). Effect of nickel on antioxidative enzyme activities, proline and chlorophyll contents in wheat shoots. Biologia Plantarum, 50(4), 653–659. doi:10.1007/s10535-006-0102-5

Gammons, C. H., Wood, S. A., & Williams-Jones, A. E. (1994). Experimental investigation of the stability of neodymium chloride complexes to 300°C. Mineralogical Magazine, 58a, 311-3(1), 311–312.

Gao, Y., Zeng, F., Yi, A., Ping, S., & Jing, L. (2003). Research of the entry of rare earth elements Eu3+ and La3+ into plant cell. Biological Trace Element Research, 91(3), 253– 265. doi:10.1385/BTER:91:3:253

Ge, Y., Murray, P., & Hendershot, W. H. (2000). Trace metal speciation and bioavailability in urban soils. Environmental Pollution, 107(1), 137–144. doi:10.1016/S0269-7491(99)00119- 0

Ghosh, M., & Singh, S. P. (2005). A review on phytoremediation of heavy metals and utilization of its byproducts. Applied Ecology and Environmental Research, 3(1), 1–18.

Giansoldati, V., Tassi, E., Morelli, E., Gabellieri, E., Pedron, F., & Barbafieri, M. (2012). Nitrogen fertilizer improves boron phytoextraction by Brassica juncea grown in contaminated sediments and alleviates plant stress. Chemosphere, 87(10), 1119–1125. doi:10.1016/j.chemosphere.2012.02.005

GraphPad Curve Fitting Guide. (2016). Fitting a dose-response curve to find the absolute IC50. Retrieved from http://www.graphpad.com/guides/prism/6/curve- fitting/index.htm?reg_the_ec50.htm

Guimarães, M. de A., Loureiro, M. E., & Salt, D. E. (2013). Inducing flowering in Noccaea caerulescens ( J . & C . Presl ) F . K . Mey ( Brassicaceae ), a species having high heavy- metal accumulation 1. Ciência Agronômica, 44, 834–841.

Gustafsson, J. P. (2013). Visual MINTEQ ver. 3.1. 2013.

Hall, J. L., & Williams, L. E. (2003). Transition metal transporters in plants. Journal of Experimental Botany, 54(393), 2601–2613. doi:10.1093/jxb/erg303

Haris, M., Kumar, A., Kumar Kesari, K., & Arif, J. M. (2009). Biomining - A Useful Approach Toward Metal Extraction. Journal of Agronomy, 2(2), 84–88.

Harris, A. T., Naidoo, K., Nokes, J., Walker, T., & Orton, F. (2009). Indicative assessment of the feasibility of Ni and Au phytomining in Australia. Journal of Cleaner Production, 17(2), 194–200. doi:10.1016/j.jclepro.2008.04.011

Herrmann, H., Nolde, J., Berger, S., & Heise, S. (2016). Aquatic ecotoxicity of lanthanum - A review and an attempt to derive water and sediment quality criteria. Ecotoxicology and Environmental Safety, 124, 213–238. doi:10.1016/j.ecoenv.2015.09.033

Hu, H., Wang, L., Li, Y., Sun, J., Zhou, Q., & Huang, X. (2016). Insight into mechanism of lanthanum (III) induced damage to plant photosynthesis. Ecotoxicology and Environmental Safety, 127, 43–50. doi:10.1016/j.ecoenv.2016.01.008

Hu, Z., Haneklaus, S., Sparovek, G., & Schnug, E. (2006). Rare Earth Elements in Soils. Communications in Soil Science and Plant Analysis (Vol. 37). doi:10.1080/00103620600628680

Hu, Z., Richter, H., Sparovek, G., & Schnug, E. (2004). Physiological and Biochemical Effects of Rare Earth Elements on Plants and Their Agricultural Significance: A Review. Journal of Plant Nutrition, 27(1), 183–220. doi:10.1081/PLN-120027555

Hunt, A. J., Anderson, C. W. N., Bruce, N., García, A. M., Graedel, T. E., Hodson, M., … Clark, J. H. (2014). Phytoextraction as a tool for green chemistry. Green Processing and Synthesis, 3(1), 3–22. doi:10.1515/gps-2013-0103

Ichihashi, H., Morita, H., & Tatsukawa, R. (1992). Rare earth elements (REEs) in naturally grown plants in relation to their variation in soils. Environmental Pollution (Barking, Essex : 1987), 76(2), 157–162. doi:10.1016/0269-7491(92)90103-H

Karman, S. B., Diah, S. Z. M., & Gebeshuber, I. C. (2015). Raw Materials Synthesis from Heavy Metal Industry Effluents with Bioremediation and Phytomining : A Biomimetic Resource 69

Management Approach. Advances in Materials Science and Engineering, 2015.

Kastori, R. R., Maksimović, I. V., Zeremski-Škorić, T. M., & Putnik-Delić, M. I. (2010). Rare earth elements: Yttrium and higher plants. Zbornik Matice Srpske Za Prirodne Nauke, (118), 87–98. doi:10.2298/ZMSPN1018087K

Kuzovkina, Y. A., Knee, M., & Quigley, M. F. (2004). Cadmium and copper uptake and translocation in five willow (Salix L.) species. International Journal of Phytoremediation, 6(3), 269–287. doi:10.1080/16226510490496726

Lai, Y., Wang, Q., Yang, L., & Huang, B. (2006). Subcellular distribution of rare earth elements and characterization of their binding species in a newly discovered hyperaccumulator Pronephrium simplex. Talanta, 70(1), 26–31. doi:10.1016/j.talanta.2005.12.062

Liang, T., Li, K., & Wang, L. (2014). State of rare earth elements in different environmental components in mining areas of China. Environmental Monitoring and Assessment, 186(3), 1499–513. doi:10.1007/s10661-013-3469-8

Liang, T., Zhang, S., Wang, L., Kung, H. Te, Wang, Y., Hu, A., & Ding, S. (2005). Environmental biogeochemical behaviors of rare earth elements in soil-plant systems. Environmental Geochemistry and Health, 27(4), 301–311. doi:10.1007/s10653-004-5734-9

Liu, C. P., Shen, Z. G., & Li, X. D. (2006). Uptake of cadmium by different cultivars of Brassica pekinens (Lour.) Rupr. and Brassica chinensis L. and their potential for phytoremediation. Bulletin of Environmental Contamination and Toxicology, 76(4), 732–739. doi:10.1007/s00128-006-0981-3

Liu, D., Wang, X., Zhang, X., & Gao, Z. (2013). Effects of lanthanum on growth and accumulation in roots of rice seedlings. Plant, Soil and Environment, 59(5), 196–200.

Liu, Z., Chen, W., He, X., Jia, L., Yu, S., & Zhao, M. (2015). Hormetic Responses of Lonicera japonica Thunb. to Cadmium Stress. Dose-Response, 1(-1), 1–10. doi:10.2203/dose- response.14-033. 70

Madejón, P., Murillo, J. M., Marañón, T., Cabrera, F., & Soriano, M. a. (2003). Trace element and nutrient accumulation in sunflower plants two years after the Aznalcóllar mine spill. Science of the Total Environment, 307(1-3), 239–257. doi:10.1016/S0048-9697(02)00609-5

Maestri, E., Marmiroli, M., Visioli, G., & Marmiroli, N. (2010). Metal tolerance and hyperaccumulation: Costs and trade-offs between traits and environment. Environmental and Experimental Botany, 68, 1–13. doi:10.1016/j.envexpbot.2009.10.011

Mahar, A., Wang, P., Ali, A., Awasthi, M. K., Lahori, A. H., Wang, Q., … Zhang, Z. (2016). Challenges and opportunities in the phytoremediation of heavy metals contaminated soils: A review. Ecotoxicology and Environmental Safety, 126, 111–121. doi:10.1016/j.ecoenv.2015.12.023

Manios, T., Stentiford, E. I., & Millner, P. A. (2003). The effect of heavy metals accumulation on the chlorophyll concentration of Typha latifolia plants, growing in a substrate containing sewage sludge compost and watered with metaliferus water. Ecological Engineering, 20(1), 65–74. doi:10.1016/S0925-8574(03)00004-1

Maroder, H. (2000). Storage Behaviour of Salix alba and Salix matsudana Seeds. Annals of Botany, 86(5), 1017–1021. doi:10.1006/anbo.2000.1265

Massari, S., & Ruberti, M. (2013). Rare earth elements as critical raw materials: Focus on international markets and future strategies. Resources Policy, 38(1), 36–43. doi:10.1016/j.resourpol.2012.07.001

Mayfield, D. B., & Fairbrother, A. (2015). Examination of rare earth element concentration patterns in freshwater fish tissues. Chemosphere, 120, 68–74. doi:10.1016/j.chemosphere.2014.06.010

Mazza, M., Blumenthal, D., & Schmitt, G. J. (2013). Ensuring Japan ’ S Critical Resource Security. American Enterprise Insiture, AEI, 4–11.

Messenger, B. (2016). Recycling: Rarely so Critical. INDUSTRIEMAGAZIN Verlag GmbH. 71

Retrieved from URL:https://waste-management-world.com/a/recycling-rarely-so-critical

Mganga, N., Manoko, M. L. K., & Rulangaranga, Z. K. (2011). Classification of plants according to their heavy metal content around North Mara Gold Mine, Tanzania: Implication for phytoremediation. Tanz. J. Sci., 37, 109–119.

Migdisov, A. A., & Williams-Jones, A. E. (2002). A spectrophotometric study of neodymium(III) complexation in chloride solutions. Geochimica et Cosmochimica Acta, 66(24), 4311–4323. doi:10.1016/S0016-7037(02)00995-X

Milner, M. J., & Kochian, L. V. (2008). Investigating heavy-metal hyperaccumulation using Thlaspi caerulescens as a model system. Annals of Botany, 102(1), 3–13. doi:10.1093/aob/mcn063

Mohamed, A., Siddig, E., & Azhary, E. (2008). A STUDY ON SEED-BORNE FUNGI OF SUNFLOWER. University of Khartoum, Khartoum, Sudan.

Nehnevajova, E., Herzig, R., Federer, G., Erismann, K.-H., & Schwitzguébel, J.-P. (2005). Screening of sunflower cultivars for metal phytoextraction in a contaminated field prior to mutagenesis. International Journal of Phytoremediation, 7(4), 337–349. doi:10.1080/16226510500327210

Nicodemus, M. A., Salifu, K. F., & Jacobs, D. F. (2009). Influence of lanthanum level and interactions with nitrogen source on early development of Juglans nigra. Journal of Rare Earths, 27(2), 270–279. doi:10.1016/S1002-0721(08)60233-1

Pagano, G., Aliberti, F., Guida, M., Oral, R., Siciliano, A., Trifuoggi, M., & Tommasi, F. (2015). Rare earth elements in human and animal health: State of art and research priorities. Environmental Research, 142, 215–220. doi:10.1016/j.envres.2015.06.039

Palasz, A., & Czekaj, P. (2000). Toxicological and cytophysiological aspects of lanthanides action. Acta Biochimica Polonica, 47(4), 1107–1114.

Pang, X., Li, D., & Peng, A. (2002). Application of rare-earth elements in the agriculture of China and its environmental behavior in soil. Environmental Science and Pollution Research International, 9(2), 143–148. doi:10.1007/BF02987718

Peer, W. A., Baxter, I. R., Richards, E. L., Freeman, J. L., & Murphy, A. S. (2005). Phytoremediation and Hyperaccumulator Plants. Topic in Current Genetic, 14(August 2005), 300–339. doi:10.1007/4735

Poschenrieder, C., Cabot, C., Martos, S., Gallego, B., & Barceló, J. (2013). Do toxic ions induce hormesis in plants? Plant Science, 212, 15–25. doi:10.1016/j.plantsci.2013.07.012

Prasad, M. N. V, Prasad, M. N. V, Freitas, H. M., & Freitas, H. M. (2003). Metal hyperaccumulation in plants- Boidiversity prospecting for phytoremediation technology., 6(3), 285–321. doi:10.2225/vol6-issue3-fulltext-6

Ramani, N., Paez, A., Queenan, C., Calabro, A., Kim, D., Sankar, J., & Becker, D. (2011). Rapid Cycling Brassica rapa: A Novel Phytomining Plant. Microscopy and Microanalysis, 17(S2), 342–343. doi:10.1017/S1431927611002583

Rascio, N., & Navari-Izzo, F. (2011). Heavy metal hyperaccumulating plants: How and why do they do it? And what makes them so interesting? Plant Science, 180(2), 169–181. doi:10.1016/j.plantsci.2010.08.016

Reichman, S. M. (2002). The Response of Plants to Metal Toxicity : A Review Focusing on Copper , Manganese and Zinc. Australian Minerals & Energy Environment Foundation, 54.

Robinson, B., Brooks, R. R., & Clothier, B. E. (1999). Soil Amendments Affecting Nickel and Cobalt Uptake by Berkheya coddii: Potential Use for Phytomining and Phytoremediation. Annals of Botany, 84(6), 689–694. doi:10.1006/anbo.1999.0970

Römkens, P., Bouwman, L., Japenga, J., & Draaisma, C. (2002). Potentials and drawbacks of chelate-enhanced phytoremediation of soils. Environmental Pollution, 116(1), 109–121. doi:10.1016/S0269-7491(01)00150-6 73

Saad, A. I. M., & Elshahed, A. M. (2012). Plant Tissue Culture Media. Recent Advances in Plant in Vitro Culture, 29–40. doi:10.1007/BF02796489

Samir Kaul, Koo, H. L., Jenkins, J., Rizzo, M., Rooney, T., Tallon, L. J., … Creasy, T. H. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Macmillan Magazines, 408(6814), 796–815. doi:10.1038/35048692

Sarma, H. (2011). Metal Hyperaccumulation in Plant: A Review Focusing on Phytoremediation Technology.pdf. Jornal of Environmental Science and Technology, 4(2), 118–138.

Scheurwater, I., Cornelissen, C., Dictus, F., Welschen, R., & Lambers, H. (1998). Why do fast- and slow-growing grass species differ so little in their rate of root respiration, considering the large differences in rate of growth and ion uptake? Plant, Cell and Environment, 21(10), 995–1005. doi:10.1046/j.1365-3040.1998.00341.x

Shan, X., Wang, H., Zhang, S., Zhou, H., Zheng, Y., Yu, H., & Wen, B. (2003). Accumulation and uptake of light rare earth elements in a hyperaccumulator Dicropteris dichotoma. Plant Science, 165(6), 1343–1353. doi:10.1016/S0168-9452(03)00361-3

Sheldon, A. R., & Menzies, N. W. (2005). The effect of copper toxicity on the growth and root morphology of Rhodes grass (Chloris gayana Knuth.) in resin buffered solution culture. Plant and Soil, 278(1-2), 341–349. doi:10.1007/s11104-005-8815-3

Sheoran, V., & Sheoran, A. (2015). Biotechnologies and Biomimetics for Civil Engineering. doi:10.1007/978-3-319-09287-4

Sheoran, V., Sheoran, A. S., & Poonia, P. (2009). Phytomining: A review. Minerals Engineering, 22(12), 1007–1019. doi:10.1016/j.mineng.2009.04.001

Sigma-Aldrich. (2010). Spectrum Plant Total RNA Kit. Sigma-Aldrich Co., 1–16. Retrieved from http://www.sigmaaldrich.com/content/dam/sigmaaldrich/docs/Sigma/Bulletin/strn50bul.pdf

Smolders, E., & McLaughlin, M. J. (1996). Chloride Increases Cadmium Uptake in Swiss Chard in a Resin-buffered Nutrient Solution. Soil Science Society America Journal, 60, 1443– 1447. doi:10.2136/sssaj1996.03615995006000050022x

Sudmoon, R., Neeratanaphan, L., Thamsenanupap, P., & Tanee, T. (2015). Hyperaccumulation of Cadmium and DNA Changes in Popular Vegetable , Brassica chinensis L . International Journal of Environment, 9(2), 433–438.

Tang, Y. T., Qiu, R. L., Zeng, X. W., Ying, R. R., Yu, F. M., & Zhou, X. Y. (2009). Lead, zinc, cadmium hyperaccumulation and growth stimulation in Arabis paniculata Franch. Environmental and Experimental Botany, 66(1), 126–134. doi:10.1016/j.envexpbot.2008.12.016

Tappero, R. V. (2009). Microspectroscopic Study of Cobalt Specialation And Localization in Hyperaccumulator Allyssum Murale. University of Delaware, Newark, DE.

Thangavel, P., & Sridevi, G. (2012). Environmental Sustainability: Role of Freen Technologies. Psychology. Springer, Ne w Delhi, India.

Thomas, P. J., Carpenter, D., Boutin, C., & Allison, J. E. (2014). Rare earth elements (REEs): Effects on germination and growth of selected crop and native plant species. Chemosphere, 96, 57–66. doi:10.1016/j.chemosphere.2013.07.020

Valente, V., Teixeira, S. A., Neder, L., Okamoto, O. K., Oba-Shinjo, S. M., Marie, S. K. N., … Carlotti, C. G. (2014). Selection of suitable housekeeping genes for expression analysis in glioblastoma using quantitative RT-PCR. Annals of Neurosciences, 21(2), 62–63. doi:10.5214/ans.0972.7531.210207

Van der Ent, A., Baker, A. J. M., Reeves, R. D., Chaney, Ru. L., Anderson, C. W. N., Meech, J. A., … Rongliang, Q. (2015). Agromining: Farming for Metals in the Future? Environmental Science & Technology, 49(February 2016), 4773.

Van der Ent, A., Baker, A. J. M., Reeves, R. D., Pollard, A. J., & Schat, H. (2012). 75

Hyperaccumulators of metal and metalloid trace elements: Facts and fiction. Plant and Soil, 362(1-2), 319–334. doi:10.1007/s11104-012-1287-3

Van der Ent, A., Baker, A. J. M., Reeves, R. D., Pollard, A. J., & Schat, H. (2013). Hyperaccumulators of metal and metalloid trace elements: Facts and fiction. Plant and Soil, 362(1-2), 319–334. doi:10.1007/s11104-012-1287-3

Van Loon, J. C., & Barefoot, R. R. (2013). Analytical Methods For Geochemical Exploration. Elsevier.

Verbruggen, N., Hermans, C., & Schat, H. (2009). Molecular mechanisms of metal hyperaccumulation in plants. New Phytologist, 181(4), 759–776. doi:10.1111/j.1469- 8137.2008.02748.x

Walliwalagedara, C., Atkinson, I., Van Keulen, H., Cutright, T., & Wei, R. (2010). Differential expression of proteins induced by lead in the Dwarf Sunflower Helianthus annuus. Phytochemistry, 71(13), 1460–1465. doi:10.1016/j.phytochem.2010.05.018

Wang, C., He, M., Shi, W., Wong, J., Cheng, T., Wang, X., … Chen, F. (2011). Toxicological effects involved in risk assessment of rare earth lanthanum on roots of Vicia faba L. seedlings. Journal of Environmental Sciences, 23(10), 1721–1728. doi:10.1016/S1001- 0742(10)60598-0 wang, L., & Liang, T. (2014). Accumulation and fractionation of rare earth elements in atmospheric particulates around a mine tailing in Baotou, China. Atmospheric Environment, 88, 23–29. doi:10.1016/j.atmosenv.2014.01.068

Wang, L., Wang, W., Zhou, Q., & Huang, X. (2014). Combined effects of lanthanum (III) chloride and acid rain on photosynthetic parameters in rice. Chemosphere, 112, 355–361. doi:10.1016/j.chemosphere.2014.04.069

Wang, X.-P., Shan, X.-Q., Zhang, S.-Z., & Wen, B. (2003). Distribution of rare earth elements among chloroplast components of hyperaccumulator Dicranopteris dichotoma. Analytical 76

and Bioanalytical Chemistry, 376(6), 913–7. doi:10.1007/s00216-003-2014-y

Weltje, L., Brouwer, A. H., Verburg, T. G., Wolterbeek, H. T., & de Goeij, J. J. M. (2002). Accumulation and elimination of lanthanum by duckweed (Lemna minor L.) as influenced by organism growth and lanthanum sorption to glass. Environmental Toxicology and Chemistry / SETAC, 21(7), 1483–1489.

Wen, B., Yuan, D. A., Shan, X. Q., Li, F. L., & Zhang, S. Z. (2001). The influence of rare earth element fertilizer application on the distribution and bioaccumulation of rare earth elements in plants under field conditions. Chemical Speciation and Bioavailability, 13(2), 39–48. doi:10.3184/095422901783726825

Wen, K., Liang, C., Wang, L., Hu, G., & Zhou, Q. (2011). Combined effects of lanthanumion and acid rain on growth, photosynthesis and chloroplast ultrastructure in soybean seedlings. Chemosphere, 84(5), 601–608. doi:10.1016/j.chemosphere.2011.03.054

Why are rare earth elements so important? (2011). Retrieved from http://www.bbc.com/news/world-us-canada-14116753

Wilde, E. W., Brigmon, R. L., Dunn, D. L., Heitkamp, M. A., & Dagnan, D. C. (2005). Phytoextraction of lead from firing range soil by Vetiver grass. Chemosphere, 61(10), 1451–1457. doi:10.1016/j.chemosphere.2005.04.059

Wu, Z., McGrouther, K., Chen, D., Wu, W., & Wang, H. (2013). Subcellular distribution of metals within Brassica chinensis L. in response to elevated lead and chromium stress. Journal of Agricultural and Food Chemistry, 61(20), 4715–4722. doi:10.1021/jf4005725

Wyttenbach, A., Furrer, V., Schleppi, P., & Tobler, L. (1998). Rare earth elements in soil and in soil-grown plants. Journal of Plant and Soil, 267–273.

Xinde, C., Xiaorong, W., & Guiwen, Z. (2000). Assessment of the bioavailability of rare earth elements in soils by chemical fractionation and multiple regression analysis. Chemosphere, 40(1), 23–28. doi:10.1016/S0045-6535(99)00225-8 77

Zengin, F. K., & Munzuroglu, O. (2005). Effects of some heavy metals on content of chlorophyll, proline and some antioxidant chemicals in bean (Phaseolus vulgaris L.) seedlings. Acta Biologica Cracoviensia Series Botanica, 47(2), 157–164.

Zhang, C., Li, Q., Zhang, M., Zhang, N., & Li, M. (2013). Effects of rare earth elements on growth and metabolism of medicinal plants. Acta Pharmaceutica Sinica B, 3(1), 20–24. doi:10.1016/j.apsb.2012.12.005

Zhang, J., Zhang, T., Lu, Q., Cai, S., Chu, W., Qiu, H., … Xu, Q. (2015). Oxidative effects, nutrients and metabolic changes in aquatic macrophyte, Elodea nuttallii, following exposure to lanthanum. Ecotoxicology and Environmental Safety, 115, 159–165. doi:10.1016/j.ecoenv.2015.02.013

Zhang, S., & Shan, X. Q. (2001). Speciation of rare earth elements in soil and accumulation by wheat with rare earth fertilizer application. Environmental Pollution, 112(3), 395–405. doi:10.1016/S0269-7491(00)00143-3

Zhang, X. C., Friedrich, J. M., Nearing, M. A., & Norton, L. D. (2001). Potential use of Rare Earth Oxides as Tracers for Soil Erosion and Aggregation Studies. Soil Science Society of America Journal, 65(October), 1508. doi:10.2136/sssaj2001.6551508x

Zhang, X., Laubie, B., Houzelot, V., Plasari, E., Echevarria, G., & Simonnot, M.-O. (2016). Increasing purity of ammonium nickel sulfate hexahydrate and production sustainability in a nickel phytomining process. Chemical Engineering Research and Design, 106, 26–32. doi:10.1016/j.cherd.2015.12.009

APPENDICES

10.1. APPENDIX A: A LIST OF HYPERACCUMULATOR PLANTS

Appendix A-1- Hyperaccumulator plants and metals that can be hyperaccumulated by the plants (Sheoran & Sheoran, 2015)

Metal plant Chamomilla recutita Helianthus annuus Arabidopsis halleri Brassica juncea Cadmium Thlaspi caerulescens Salsola kali Hypericum perforatum Medicago sativa Zea mays Commelina communis B. juncea Ipomea alpina Erica andevalensis Elsholtzia splendens Copper Pelargonium species Silene vulgaris Hirschfeldia incana Haumaniastrum katangense Crepidorhopalon perennis Acalypha cupricola Helianthus annuus Brassica juncea Convolvulus arvensis Pelaronium species Prosopis species Salsola kali Sutera fodina Dicoma niccolifera Leptospermum scoparium Chromium Genipa americana Typha spp. Amaranthus viridis Miscanthus Oryza sativa Continued

Meta Plant Convonvulus arvensis Leucaea leucocephalla Chromium Willows (Salix sp.) Loilium perenne Mercury Eichhornia crassipes Psyshotria douarrei Brassicae juncea Thlaspi goesingense Streptanthus polygaloides Alyssum bertoloni Nickel Berkheya codii Alyssum murale Alyssum narkgrafii Alyssum narkgrafii Sebertia acuminate Phyllanthus species Euphorbia helenae, Leucocroton flavicans L. linearifolius Dittrichia viscose B. pekinesis B.campetris B. juncea Pisum sativum B. carinata B. napus, B. nigra Lead Helianthus annuus Thlaspi rotundifolium Zea mays Sesbania drummondii Pelargonium species Vetiveria zizaniodes Pelargonium crispum Triticum aestivum L Trifolium respens L. Vicia faba B. juncea Continued 82

Metal Plant Lead Hemidesmus indicus Sedum alfredii B. juncea Avena sativa B.napus B.rapa Zinc Hordeum vulgare Arabidopsis halleri Viola calaminaria Thlaspi calaminare

Thlaspi careulescens Polygonium aviculare B.napus Hibiscus cannabinus Festuca arundianacea Astragalus racemose Sinapis arvensis Astragallus bisulcatus Selenium Grindelia squarosa Stangeria pinnata Larrea tridentate Salvia roemeriana Dryopteris fern Pteris genera Typha spp. B. chinensis B. juncea Uranium B. narinosa Uncinia leptostachya Coprosma arborea Picea mariana Iberis intermedia Biscutela laevigata Thallium Zea mays B. napus Hirschfeldia incana, Continued

Metal Plant Diplotaxis catholica Lolium perenne Thallium B. napus Phaseolus vulgaris B. oleracea acephala Iberis intermedia Haumaniastrum katangense Crepidorhopalon perennis Cobalt Acalypha cupricola Haumaniastrum roberti Anisopapus chinesis B. junceae Pteris vittata Eleocharis spp., Arsenic Pityrogramma calomelanos Pteris cretica, Pteris longifolia Pteris umbrosa B. junceae Gold B. codii Chicory C. linearis B. juncea Silver Medicago sativa Amanita strobiliformis Manganese Macadamia neurophylla Phytolacca acinosa Platinum Sinapis alba Lolium perenne

10.2. APPENDIX B: FITTED CURVES

Log(X+1)

Appendix B-1- Fitted curve for root length responses to La in Brassica chinensis L.

3P Log-Logistic EV [Y=A/ (1+(X/D)^C)]

R2 = 0.80

Appendix B -2- Fitted curve for shoot height responses to La in Brassica chinensis L.

3P Log-Logistic EV [Y=A/ (1+(X/D)^C)]

R2 = 0.6

Appendix B-3- Fitted curve for root length responses to Nd in Brassica chinensis L.

3P Log-Logistic EV [Y=A/(1+(X/D)^C)]

R2 = 0.8

Appendix B-4- Fitted curve for shoot height responses to Nd in Brassica chinensis L.

Log (X+1)

Total ChlorophyllConcentration

Appendix B-5- Fitted curve for total chlorophyll concentration in Brassica chinensis L. after being exposed to La

Log (X+1)

Total ChlorophyllConcentration

Appendix B-6- Fitted curve for total chlorophyll concentration in Brassica chinensis L. after being exposed to Nd

3P Log-Logistic EV [Y=A/ (1+(X/D)^C)]

R2 = 0.9

Appendix B-7- Fitted curve for root length responses to La in Helianthus annuus L.

4P Logistic+ Hormesis [Y=A (1+EX)/ (1+ exp (-C(X-D)))]

R2 = 0.9

Appendix B-8- Fitted curve for shoot height responses to La in Helianthus annuus L. 89

Log-Logistic EV [Y=A/ (1+(X/D)^C)]

R2 = 0.8

Appendix B-9- Fitted curve for root length responses to Nd in Helianthus annuus L.

3P Log-Logistic EV [Y=A/ (1+(X/D) ^C)]

R2 = 0.5

Appendix B-10- Fitted curve for shoot height responses to Nd in Helianthus annuus L. 90

3P Log-Logistic EV [Y=A/ (1+(X/D) ^C)]

Total ChlorophyllConcentration

Appendix B-11- Fitted curve for total chlorophyll concentration in Helianthus annuus L. after being exposed to La

Log(X+1)

Total ChlorophyllConcentration

Appendix B-12- Fitted curve for total chlorophyll concentration in Helianthus annuus L. after being exposed to Nd

10.3. APPENDIX C: MS MEDIUM COMPONENTS

Appendix C-1- MS medium components and concentrations (Saad & Elshahed, 2012)

Medium Components Concentrations (ppm)

NH4NO3 1650

KNO3 1900

CaCl2.2H2O 440

MgSO4.7H2O 370

KH2PO4 170 KI 0.83

H3BO3 6.2

MnSO4.4H2O 22.3

ZnSO4.7H2O 8.6

Na2MoO4.2H2O 0.25

CuSO4.5H2O 0.025

CoCl2.6H2O 0.025

Na2EDTA 37.3

FeSO4.7H2O 27.8 Inositol 100 Glycine 2 Thiamine HCl 0.1 Pyridoxine HCl 0.5 Nicotinic acid 0.5

10.4. APPENDIX D: STATISTICAL ANALYSIS

Appendix D -1- Lanthanum effect on root length of Helianthus annuus L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 61.47333 4 15.36833 34.40672 8.07E-06 3.47805 Within Groups 4.466667 10 0.446667

Total 65.94 14

Appendix D -2- Lanthanum effect on shoot height of Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit

Between Groups 314.8507 4 78.71267 33.51377 9.11E-06 3.47805 Within Groups 23.48667 10 2.348667

Total 338.3373 14

Appendix D -3- Lanthanum effects on the number of leaves of Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 8.4 4 2.1 15.75 0.000256 3.47805 Within Groups 1.333333 10 0.133333

Total 9.733333 14

Appendix D -4- Neodymium effect on root length of Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 102.176 4 25.544 22.2638 5.76E-05 3.47805 Within Groups 11.47333 10 1.147333

Total 113.6493 14

Appendix D -5- Neodymium effect on shoot height of Helianthus annuus L.

ANOVA

Source of Variation SS df MS F p-value F crit

Between Groups 158.8893 4 39.72233 5.450375 0.013613 3.47805 Within Groups 72.88 10 7.288

Total 231.7693 14

Appendix D -6- Neodymium effect on the number of leaves of Helianthus annuus L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 6.933333 4 1.733333 4.333333 0.027337 3.47805 Within Groups 4 10 0.4

Total 10.93333 14

Appendix D -7- Lanthanum effect on the chlorophyll (a) concentration in Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 0.070015 4 0.017504 0.886491 0.506231 3.47805 Within Groups 0.197451 10 0.019745

Total 0.267466 14

Appendix D -8- Lanthanum effect on the chlorophyll (b) concentration in Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 0.011172 4 0.002793 1.313703 0.329541 3.47805 Within Groups 0.02126 10 0.002126

Total 0.032432 14

Appendix D -9- Lanthanum effect on the total chlorophyll concentration in Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 0.137966 4 0.034492 1.002066 0.450615 3.47805 Within Groups 0.344205 10 0.03442

Total 0.482171 14

Appendix D -10- Neodymium effect on the chlorophyll (a) concentration in Helianthus annuus L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 0.144119 4 0.03603 2.488207 0.110487 3.47805 Within Groups 0.144802 10 0.01448

Total 0.288921 14

Appendix D -11- Neodymium effect on the chlorophyll (b) concentration in Helianthus annuus L.

ANOVA Source of Variation SS df MS F p-value F crit

Between Groups 0.01927 4 0.004818 2.406955 0.118518 3.47805 Within Groups 0.020015 10 0.002002

Total 0.039286 14

Appendix D-12- Neodymium effect on the total chlorophyll concentration in Helianthus annuus L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 0.267614 4 0.066904 2.481111 0.111163 3.47805 Within Groups 0.269651 10 0.026965

Total 0.537265 14

Appendix D -13- Lanthanum effect on root length of Brassica chinensis L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 166.3893 4 41.59733 9.116891 0.002273 3.47805 Within Groups 45.62667 10 4.562667

Total 212.016 14

Appendix D -14- Lanthanum effect on shoot height of Brassica chinensis L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 67.58 4 16.895 20.62042 8.07E-05 3.47805 Within Groups 8.193333 10 0.819333

Total 75.77333 14

Appendix D -15- Lanthanum effect on the number of leaves of Brassica chinensis L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 6.266667 4 1.566667 11.75 0.000851 3.47805 Within Groups 1.333333 10 0.133333

Total 7.6 14

Appendix D-16- Neodymium effect on root length of Brassica chinensis L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 127.134 4 31.7835 60.4249 0.000202 5.192168 Within Groups 2.63 5 0.526

Total 129.764 9

Appendix D -17- Neodymium effect on shoot height of Brassica chinensis L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 45.08933 4 11.27233 20.49515 8.29E-05 3.47805 Within Groups 5.5 10 0.55

Total 50.58933 14

Appendix D -18- Neodymium effect on the number of leaves of Brassica chinensis L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 6.266667 4 1.566667 5.875 0.010683 3.47805 Within Groups 2.666667 10 0.266667

Total 8.933333 14

100

Appendix D -19- Lanthanum effect on the chlorophyll (a) concentration in Brassica chinensis L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 0.438675 4 0.109669 8.118766 0.003488 3.47805 Within Groups 0.135081 10 0.013508

Total 0.573756 14

Appendix D -20- Lanthanum effect on the chlorophyll (b) concentration in Brassica chinensis L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 0.055796 4 0.013949 5.721452 0.011646 3.47805 Within Groups 0.02438 10 0.002438

Total 0.080176 14

Appendix D -21- Lanthanum effect on the total chlorophyll concentration in Brassica chinensis L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 0.957186 4 0.239296 7.95209 0.003761 3.47805 Within Groups 0.300923 10 0.030092

Total 1.258109 14 101

Appendix D -22- Neodymium effect on the chlorophyll (a) concentration in Brassica chinensis L.

ANOVA Source of Variation SS df MS F p-value F crit

Between Groups 2.210014 4 0.552503 44.57518 2.42E-06 3.47805

Within Groups 0.123949 10 0.012395

Total 2.333962 14

Appendix D -23- Neodymium effect on the chlorophyll (b) concentration in Brassica chinensis L.

ANOVA

Source of Variation SS df MS F p-value F crit Between Groups 0.303415 4 0.075854 39.63378 4.19E-06 3.47805 Within Groups 0.019139 10 0.001914

Total 0.322554 14

Appendix D -24- Neodymium effect on the total chlorophyll concentration in Brassica chinensis L.

ANOVA Source of Variation SS df MS F p-value F crit Between Groups 4.140863 4 1.035216 44.23293 2.51E-06 3.47805

0.234037 10 0.023404 Within Groups

Total 4.3749 14

102