The Pennsylvania State University

The Graduate School

Department of Plant Pathology

WIDESPREAD OCCURRENCE AND EVOLUTION OF HUMAN PATHOGENIC

FUSARIUM

A Dissertation in

Plant Pathology

by

Dylan Short

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

December 2011

The dissertation of Dylan Short was reviewed and approved* by the following:

David M Geiser Professor of Plant Pathology Dissertation Advisor Chair of Committee

Maria del Mar Jiminez Gasco Professor of Plant Pathology

Eddie C Holmes Professor of Biology

Seogchang Kang Professor of Plant Pathology

Gary W Moorman Professor of Plant Pathology

Frederick E Gildow Jr. Professor of Plant Pathology Head of the Department of Plant Pathology

*Signatures are on file in the Graduate School

iii ABSTRACT

We tested the hypothesis that plumbing systems might serve as a significant environmental reservoir of human pathogenic isolates of Fusarium performing the first extensive multilocus sequence typing (MLST) survey of plumbing drain-associated Fusarium isolates, and comparing the diversity observed to the known diversity of clinical Fusarium isolates. We found that 66% of 471 sinks and 80% of 131 buildings surveyed yielded at least one Fusarium culture. The 297 isolates of Fusarium collected were subjected to MLST to identify the phylogenetic species and sequence types (STs) of these isolates.

The six most common STs in sinks were identical to those most frequently associated with human infections. We speculate that the most prevalent STs, by virtue of their ability to form and grow in biofilms, are well adapted to plumbing systems. The most common group observed, the Fusarium solani species complex, (FSSC) is the most common group of fusaria associated with life- threatening opportunistic human infections as well as infections of the cornea.

Here we present the description and taxonomy of Fusarium fistularum sp. nov., the single most common human pathogen in the genus Fusarium, that was previously known as FSSC Group 2. F. fistularum is genetically diverse, cosmopolitan and associated with biofilms on plumbing surfaces in the environment. Morphologically, F. fistularum isolates show high levels of variation in a range of characteristics that are typical for most concepts of ‘F. solani,’ with many isolates failing to produce sporodochia in culture and possessing aberrant

iv morphological characters. Similar ranges of morphology were observed in three other commonly encountered phylogenetic species in FSSC. Secondary metabolites produced by F. fistularum include anhydrofusarubin, fusarubin, solaniol, and javanicin. A haematonectria-like heterothallic sexual stage was produced for F. fistularum; an epitype was provided for the sexual stage, and described as an addendum to the description of F. fistularum. Most pairings of isolates indicated possible high levels of infertility. In addition, based on a DNA sequence connection with an ex-Type culture, we apply the name F. petroliphilum, elevated to species status from F. solani var. petroliphilum, to another common Fusarium species associated with human infections and biofilms, FSSC 1. To better understand the population dynamics of this F. fistularum for purposes of epidemiology and control, we expanded an existing 3- locus MLST system by adding six novel sequence-based markers developed based on the complete genome sequence of Nectria haematococca Mating

Population VI (FSSC 11). 9-locus MLSTs were generated for 231 isolates from six continents and from a variety of sources, including plumbing and from human and animal infections. High levels of genetic diversity and evidence for both recombination and clonality were detected among 111 unique 9-locus STs.

Inclusion of the mating type as a tenth marker revealed ten additional STs, indicating that true clones are not well resolved even with ten loci. The most common ST (2-d2), with 49 members, was found in plumbing, contact lenses and lens cases, as well as fusarial keratitis. No evidence for population differentiation

v between clinical isolates and isolates from environmental sources was found.

Cryptic speciation with F. fistularum suggested in the previous three-locus MLST system was not supported with the addition of new loci, but evidence of introgression of ribosomal RNA genes from another strongly supported phylogenetic species also known from plumbing and human infections (FSSC 9), was detected in two isolates of F. fistularum.

vi TABLE OF CONTENTS

LIST OF FIGURES ...... vii

LIST OF TABLES ...... x

ACKNOWLEDGEMENTS ...... xi

Chapter 1 Literature Review and Summary of Findings ...... 1

Chapter 2 Widespread occurrence of pathogenic types of the fungus Fuasrium in bathroom sinks ...... 28

Chapter 3 Fusarium fistularum sp. nov., a common human pathogen and inhabitant of plumbing-associated biofilms ...... 93

Chapter 4 Recombination, clonality, and hybridization in the polyextremophilic human pathogen Fusarium fistularum ...... 136

Chapter 5 Future Directions...... 216

vii

LIST OF FIGURES

Figure 2-1: Frequencies of Fusarium species complexes characterized by MLST from A. clinical sources based on previous studies and B. drains based on the present study ...... 34

Figure 2-2: Frequencies of 59 MLSTs represented by 297 fusaria isolated from drains in the present study ...... 36

Figure 2-3: Frequencies of FOSC STs isolated from A. clinical sources from previous studies and B. from drains in this study...... 37

Figure 2-4: Cladogram of the FSSC based on TEF, rDNA and RPB2 highlighting the spectrum of FSSC diversity found in drains ...... 38

Figure 2-5: Phylogram of the FDSC based on TEF, rDNA, and TUB highlighting the spectrum of FDSC diversity found in drains ...... 40

Figure 2-6: Phylogram of the FIESC based on TEF, rDNA, RPB2 and CAM highlighting the spectrum of diversity forund in drains ...... 42

Figure 2-7: Generalized schematic map showing 57 collection areas (black dots) containing buildings yielding Fusarium ...... 44

Figure 3-1: Phylogram of the FSSC based on TEF, rDNA, and RPB2 ...... 107

Figure 3-2: Sporodochial conidia (macroconidia) of five isolates of F. fistularum ...... 112

Figure 3-3: Aerial conidia, monophialides, and chalmydospore of five isolates of F. fistularum ...... 113

Figure 3-4: Sporodochial conidia of three isolates of F. petroliphilum ...... 113

Figure 3-5: Aerial conidia of two isolates of F. petroliphilum ...... 114

Figure 3-6: Colony pigmentation of eight isolates of F. fistularum grown on PDA...... 114

Figure 3-7: Colony pigmentation of eight isolates of F. petroliphilum grown on PDA...... 115

Figure 3-8: Red to scarlet perithecia from the cross of FRC S-2477 and FRC S-2391 ...... 116

viii Figure 3-9: Asci and ascospores of the cross of FRC S-2477 and FRC S- 2391 ...... 117

Figure 4-1: Plot of mean number of genotypes vs. number of loci sampled created using Multilocus 1.2b...... 166

Figure 4-2: Nine individual locus unrooted maximum parsimony trees created using the parsimony ratchet ...... 170

Figure 4-3: Neighbor net of 111 unique 9-locus haplotypes created using SplitsTree4...... 172

Figure 4-4: Population snapshots of F.fistularum created using Phyloviz Beta...... 175

Figure 4-S1a: First half of a maximum parsimony bootstrap tree for locus TEF...... 186

Figure 4-S1b: Second half of a maximum parsimony bootstrap tree for locus TEF...... 187

Figure 4-S2a: First half of a maximum parsimony bootstrap tree for locus rDNA...... 188

Figure 4-S2b: Second half of a maximum parsimony bootstrap tree for locus rDNA ...... 189

Figure 4-S3a: First half of a maximum parsimony bootstrap tree for locus RPB2...... 190

Figure 4-S3b: Second half of a maximum parsimony bootstrap tree for locus RPB2...... 191

Figure 4-S4a: First half of a maximum parsimony bootstrap tree for locus 3968...... 192

Figure 4-S4b: Second half of a maximum parsimony bootstrap tree for locus 3968 ...... 193

Figure 4-S5a: First half of a maximum parsimony bootstrap tree for locus 3972 ...... 194

Figure 4-S5b: Second half of a maximum parsimony bootstrap tree for locus 3972 ...... 195

ix

Figure 4-S6a: First thalf of a maximum parsimony bootstrap tree for locus 4081...... 196

Figure 4-S6b: Second half of a maximum parsimony bootstrap tree for locus 4081...... 197

Figure 4-S7a: First half of a maximum parsimony bootstrap tree for locus 6512 ...... 198

Figure 4-S7b: Second half of a maximum parsimony bootstrap tree for locus 6512...... 199

Figure 4-S8a: First half of a maximum parsimony bootstrap tree for locus 5439...... 200

Figure 4-S8b: Second half of a maximum parsimony bootstrap tree for locus 5439 ...... 201

Figure 4-S9a: First half of a maximum parsimony bootstrap tree for locus 5437...... 202

Figure 4-S9b: Second half of a maximum parsimony bootstrap tree for locus 5437...... 203

Figure 4-S10: Inferred membership of 111 unique STs in two clusters...... 204

x

LIST OF TABLES

Table 2-1: MLST markers employed in this study for each Species Complex together with primers used for PCR and DNA sequencing...... 53

Table 2-S1: Fusarium isolates collected in this study...... 65

Table 2-S2: Geographic origins of known clinical isolates of the six main human pathogenic STs...... 85

Table 3-1: Isolates analyzed for morphological and cultural characters in this study...... 98

Table 3-2: Growth rates and conidia sizes of common FSSC spp...... 108

Table 3-3: Measurements of cultures belonging to F. fistularum (FSSC 2) and F. petroliphilum...... 109

Table 3-4: Secondary metabolites of Fusarium cultures...... 118

Table 4-1: Characteristics of isolates studied...... 142

Table 4-2: Characteristics of loci employed...... 152

Table 4-3: Primer pairs used for PCR amplification and Sanger sequencing and additional charcteristics of loci...... 154

Table 4-4: 111 9-locus sequence types of F. fistularum and their frequencies based on the diverstiy of the 231 isolates used in this study...... 161

Table 4-5: Summary of statistics of the F. fistularum dataset ...... 167

xi ACKNOWLEDGEMENTS

I would like to acknowledge my advisor, David Geiser for his dedication and excellent guidance, my committee members M. del Mar Jiminez-Gasco, E.

Holmes, S. Kang, and G. Moorman for their scientific expertise and constructive criticism, as well as Sarah Melissa Witiak and Jean Juba for their support and help in the laboratory.

1

Chapter 1

Literature Review and Summary of Findings

Literature Review

Medically important fungi

Pathogenic fungi were among the first microorganisms to be recognized as etiologic agents of disease [14]. Human pathogens from the Kingdom Fungi usually belong to the Phyla Basidiomycota, Ascomycota, and Zygomycota [16].

Some genera are capable of infecting and causing serious disease in humans with functional immune systems, such as Filobasidella (Cryptococcus),

Coccidioides, Ajellomyces (Histoplasma and Blastomyces), Pneumocystis, and

Fusarium [15,16].

Other fungi are considered opportunistic pathogens and include commensal organisms that are part of the normal human-associated microbial community. These fungi obtain nutrients from keratinized substances in hair and nails (dermatophytes such as Trichophyton), or from skin oil secretions of the sebaceous glands (such as Malessezia) as well as other sources. While these fungi are usually benign, they may be capable of causing disease in immunodeficient hosts, including patients with HIV or undergoing cytotoxic 2 chemotherapy in advance of whole organ or bone marrow transplant [17,18]. A wide spectrum of fungal genera common in the environment can be opportunistic human pathogens, including Aspergillus, Penicillium, Rhodoturula, Rhizopus,

Mucor, and Alternaria [19].

Classical definitions of pathogenicity and virulence tend to refer to the ability to cause disease as a fixed trait [20]. However, defining fungal isolates as either pathogenic or non-pathogenic to humans and animals is often an oversimplification. The same isolate may be pathogenic to some hosts and non- pathogenic to others. The genotypes of the host and pathogens are important factors in host-pathogen interactions and determine the body's ability to limit the amount of damage a microbe can inflict [20]. This is one reason why understanding pathogen diversity is important.

Fungi capable of causing damage to the human body share common features including the ability to grow at human body temperature and obtain nutrients by digesting and absorbing components of human tissue and associated products. Fungi may also possess adaptations that serve as virulence factors, such as the cellular factors that allow Cryptococcus to survive within human phagocytic cells, [21] efflux pumps, proteases and phospholipases in Candida [22], glycoproteins for adhesion to human cells surfaces in

Pneumocystis, toxins (e.g. gliotoxin) in Aspergillus [23], polysaccharide capsules in Cryptococcus [23], and siderophores in Mucor and Rhizopus [23]. Other factors include the ability to form spores of quality and quantity to facilitate infection, formation of biofilms, and resistance to antifungal drugs. 3

What is Fusarium?

Fusarium is a diverse genus of ascomycetous fungi in the family Nectriaceae

(Hypocreales/ Hypocreomycetidae /Sordariomycetes /Pezizomycotina

/Ascomycota) that includes many saprophytes and parasites of plants and animals. The genus name refers to the asexual stage (anamorph), specifically to its distinctive falcate (canoe-shaped), septate conidia (macroconidia) that are borne from sporodochial conidiomata. Fusarium species often produce other asexual spores as well, including smaller conidia produced from mycelial phialides (microconidia) and resistant spores (chlamydospores). Sexual stages associated with Fusarium are perithecial and non-stromatic, in Gibberella and other genera.

Fusarium systematics

The systematics of Fusarium has been notoriously problematic. The first synthetic work on Fusarium taxonomy, Die Fusarien (Wollenweber and Reinking

1935) identified synonyms among the hundreds of Fusarium names and distilled them down to 65 species divided into 26 Sections. These morphological

Sections remain in wide use today. Shortly after the publication of Die Fusarien,

Snyder and Hansen synonymized many more species based on what they dismissed as cultural variation and mutation, resulting in a nine-species system

[1,2]. Subsequent morphological treatments were largely conservative revisions 4 either of the Wollenweber and Reinking or Snyder and Hansen system [3,4]. To further complicate the situation, variation that existed within these morphologically defined species was often organized into varieties (var.) and subspecies (subsp.). Other ways to categorize intraspecific variation include the formae specialis (f. sp.), which are presumed clonal lineages adapted to a specific plant host, and vegetative compatibility groups (VCGs), groups capable of forming a stable heterokaryon.

Advances in molecular systematics have allowed a more objective approach to recognize species in Fusarium. Phylogenetic species recognition utilizing genealogical concordance as a criterion [5] have now been applied to most major Fusarium lineages. Species boundaries based on concordance of multiple gene genealogies have indicated a much greater degree of species diversity compared to species definitions based on morphological characters

[6,7,8,9,10,11].

As a rule in fungi, species that are defined morphologically tend to comprise multiple evolutionary entities as recognized using mating compatibility and phylogenetic criteria [12]. Morphologically cryptic species abound, and

Fusarium is no exception, with many clearly distinct phylogenetic species having been recognized that still lack formal descriptions (e.g. [10]). Approaches to species recognition in Fusarium have consistently produced results congruent with those based on mating compatibility, suggesting that they converge upon reasonably defined evolutionary units. 5

In Fusarium, the dominant approach to phylogenetic species recognition utilizes evidence for evolutionary coalescence across multiple gene genealogies, termed “Genealogical Concordance Phylogenetic Species Recognition” [5].

GCPSR recognizes species as monophyletic entities that share a defined set of fixed nucleotide substitutions across multiple genes, due to common ancestry and shared evolutionary histories. These points of coalescence are interpreted as boundaries between interbreeding individuals of the same species, where concordance across gene genealogies is disrupted by recombination. A lack of interbreeding between members of different species reinforces fixed changes that differentiate the distinct entities as speciation progresses [13].

Fusarium as a human pathogen

Fusarium infection (fusariosis) may occur in various tissue types including skin

(dermatophytosis), nails (onychomycosis), cornea (keratitis), or vital organ tissues [25,26]. Symptomology varies depending on whether the disease syndrome is superficial (dermatophytosis, onychomycosis, keratitis) or invasive.

Invasive fusariosis may be localized subcutaneously, or, particularly in the immune compromised, disseminate to internal organs via the blood stream [25].

The immune response to Fusarium is primarily via innate immunity (neutrophils and macrophages), and thus invasive infection occurs most commonly in persistently and profoundly neutropenic individuals, particularly those undergoing cytotoxic chemotherapy associated with organ or bone marrow transplant [25].

Fusarium spores enter the human body most commonly through wounds, but 6 may also enter via the respiratory tract, gastrointestinal tract, and via central venous catheters [27]. Disseminated Fusarium infections have a high mortality rate, in part of because of their resistance to several antifungal drugs with different modes of action [24,28,29].

Fusarium and mycotic keratitis

Along with Aspergillus, Fusarium is among the most common etiological agents associated with mycotic keratitis, a fungal corneal infection [30,31,32]. Fungal keratitis is rare in temperate zones in the world, including most of the United

States (Florida is an exception). Incidence of mycotic keratitis is particularly prevalent in tropical India where spores or mycelial fragments may be introduced into the eye through dust or soil particles [31,32]. While Fusarium infections account for a relatively small fraction of invasive fungal infections, it is more prevalent in mycotic keratitis than other fungi, and causes half or more of all cases in some areas [31,32]. Symptoms of fusarial keratitis include inflammation of the cornea, suppurative (pus-filled) ulcerous lesions, painful and bloodshot eyes and sensitivity to light [32]. Corneal transplants may be required in fusarial keratitis if the infection is unresponsive to antifungal drugs [32].

In addition to soil- and dust-associated infections, keratitis is rarely associated with contact lens use. In 2005-2006, hundreds of cases of contact lens-associated fusarial keratitis occurred in the U.S. and Southeast Asia. The incidence of fusarial keratitis in this outbreak was highly associated with the use of one multipurpose contact lens solution, ReNuMultiplus with MoistureLoc 7 produced by Bausch & Lomb, Inc. [30,33,34,35]. The outcomes of CDC investigations and subsequent analyses into the diversity of pathogens associated with the outbreaks revealed that the corneal isolates comprised 29 haplotypes distributed among 16 phylogenetic species [11], consistent with the hypothesis of multiple sources of contamination. No relevant contamination of the product or production facility was discovered [35]. Instead of a point-source contamination, it is hypothesized that improper use of the solution through drying and loss of efficacy led to the loss of sorption of antimicrobial components to the lens surface, which in turn allowed the attachment and penetration of lenses by fungi [30]. This process, created by reuse of the contact lens solution, drastically reduced the efficacy of the component antimicrobial compounds, and upon inoculation by fungi in plumbing, allowed for the growth of fungal inoculum [36].

Storage of the product in inappropriate temperatures is also hypothesized to have contributed to the product‟s loss of effectiveness [75]. Fusarium species and haplotypes associated with human infections, including haplotypes from the contact lens associated keratitis outbreak, have been recovered from sink drains and other plumbing sources [6,36,37], leading to the hypothesis that fungal biofilms in domestic sink drains are the primary source of these pathogens

[11,29,35].

Clinically important Fusarium are contained in six distinct Species

Complexes 8

To date, 69 phylogenetic species of Fusarium have been associated with human infections. These species fall into 6 monophyletic species complexes, which vary in frequencies in human infections. The species complexes and their approximate relative occurrence in human infections are as follows: GFSC =

Gibberella fujikuroi species complex (10%); FOSC = Fusarium oxysporum species complex (10%); FIESC = Fusarium incarnatum/equiseti and FCSC =

Fusarium chlamydosporum species complexes (15%); FSSC = Fusarium solani species complex (60%); FDSC = Fusarium dimerum species complex (5%) [77].

Fusarium solani Species Complex

Members of the Fusarium solani species complex (FSSC) are the most commonly encountered fusaria in human infections, accounting for approximately

60% of the total sample characterized via multilocus sequence typing [MLST:

10]. The FSSC is known best as a group of saprotrophs and plant pathogens, causing mostly soilborne, rot diseases of plants. Because FSSC isolates can show strong plant host specificity, they are often assigned to formae speciales to designate pathogenicity to specific host plants; some of these formae speciales were correlated with Mating Populations reflecting the exclusive interfertility of groups of isolates pathogenic on the same host [40]. The FSSC is a monophyletic group associated with Nectria-like and Neocosmospora sexual stages, consisting of approximately 60 phylogenetic species distributed among three major clades [9]. Unlike the F. oxysporum species complex, defined 9 formae speciales in the FSSC are usually monophyletic, and often correspond to known Mating Populations and phylogenetic species.

In MLST analyses based on translation elongation factor 1-alpha (TEF), the internal transcribed spacer region of the nuclear rRNA gene repeat (ITS), and the D1/D2 region of the nuclear large subunit rRNA gene (LSU), it was discovered that FSSC isolates associated with human infection belonged to 99 unique haplotypes, ~75% of which were distributed among four different evolutionary lineages within the main clade (“Clade 3”sensu [6,9]. These phylogenetic species were termed Groups1, Group 2, Group 3 and Group 4.

The results of this phylogenetic analysis indicated that only Group 1 corresponded to any previously described species concept, namely the morphospecies described as F. solani var. petroliphilum [42], which is synonymous with F. solani Mating Population V and F. solani forma specialis cucurbitae Race 1 [39].

Groups 3 and 4 appeared to be closely related and have been provisionally lumped into a single species consisting of two major populations; the name F. falciforme is currently assigned to both groups together [11]. F. falciforme is the most commonly isolated member of the FSSC from soils worldwide and is significantly associated with cases or mycotic keratitis. This finding is consistent with the high frequency of mycotic keratitis cases that are known to originate from eye trauma associated with soil or plant material.

All of these species were shown to contain multiple isolates from a variety of environmental sources and human infections. Groups 1 and 2 in were often 10 associated with water-related sources, such as man-made water systems. For example, the three most prevalent multilocus haplotypes in the Zhang et al. study were recovered from hospital environment plumbing fixtures as well as human infections occurring in those hospitals (two of these haplotypes were from Group

2 and the third from Group 1), suggesting nosocomial sources of infections.

With the addition of sequence data of the second largest subunit of RNA polymerase II (RPB2), a 3-locus multilocus sequence typing (MLST) scheme has further enhance the phylogenetic nomenclature of the FSSC [11,35]. 225 isolates of the FSSC have now been analyzed based on a three-locus system

(ITS+LSU, TEF, RPB2), which fall into 180 unique haplotypes; 135 of these haplotypes were isolated from human infections [37]. In addition to Groups 1-4 discovered by Zhang et al. (2006), two additional phylogenetic species (FSSC 5 and 6) are also frequently associated with human infections [11].

A complete genome sequence has been determined for a single isolate of the FSSC (NRRL 40588), a member of Mating Population VI (= FSSC 11) and a member of forma specialis pisi. The genome of this isolate is ~55 MB on 17 chromosomes, three of which are small (~200,000 – 350,000 bp

(http://genome.jgi-psf.org/Necha2/Necha2.info.html)) and contain mostly genes of unknown origin, including some encoding pathogenicity and virulence related enzymes [43]. The origins of the extra chromosomes are unknown but are thought to allow the colonization of specific habitats and environmental niches

[44]. Previous work has demonstrated that members of MP VI contain conditionally dispensable, meiotically unstable chromosomes (CD chromosomes) 11 that contain genes that encode such activities [45,46,47]. Whether and to what extent CD chromosomes occur broadly in other species of the FSSC is unknown.

Zhang et al. (2006) found that the inferred phylogeny of the erg3 gene, which encodes a sterol demethylase involved in ergosterol production, was significantly non-concordant with other gene genealogies in the FSSC. This apparent deviation from gene orthology combined with other evidence for complex genome dynamics in the FSSC strongly motivates a careful multilocus approach to molecular systematics in this group.

Fusarium oxysporum Species Complex

Members of the Fusarium oxysporum species complex (FOSC) are the second most commonly encountered fusaria in human infections, accounting for approximately 18% of the total [10]. The FOSC is known best as a group of plant pathogens, causing mostly soilborne, vascular wilt diseases. Because FOSC strains tend to show strong plant host specificity, they are often assigned to formae speciales to designate pathogenicity. However, taxonomically, formae speciales in the FOSC are usually polyphyletic, indicating multiple independent evolutionary origins of pathogenicity to specific plant hosts [8,48].

A MLST system for the FOSC based on partial translation elongation 1- alpha (TEF), mitochondrial small ribosomal subunit (mtssu) and nuclear ribosomal intergeneric spacer (IGS) regions has been developed. Over 800 isolates of the FOSC have now been analyzed based on a two-locus system, which fall into over 250 unique haplotypes [50]. Analyses of thie MLST system 12 revealed that ~80% of all human infections associated FOSC isolates belonged to a single, geographically widespread sequence-based haplotype, which was associated with plumbing fixtures and other indoor sources [49]. Similar to what was observed in the FSSC, this widespread haplotype (FOSC ST 33) was also found in hospital environments [50]. Amplified fragment length polymorphism

(AFLP) analyses of ST 33 showed moderate diversitifcation, suggestive of clonality [49].

A complete genome sequence has been determined for a single isolate of the FOSC (NRRL 4286) that is capable of causing disease both in plants

(tomato) and in a mouse model [78]. The genome of this isolate is ~60 MB, ~50-

75% larger than those of F. graminearum and F. verticilloides. The origins of the extra genes and DNA in this isolate are unknown, but suggest genomic plasticity that may be relevant to ecological adaptability and pathogenicity.

Fusarium dimerum Species Complex

Members of the Fusarium dimerum Species Complex (FDSC) are fairly rare in human fusarial infections, accounting for about 5% of the total [10]. The FDSC is best known as a group of ubiquitous soilborne saprotrophs and mild plant pathogens. Although they cause a lower frequency of mycotic infections relative to members of the FSSC and FOSC, members of the FDSC are potentially just as deadly and worthy of investigation. MLST analyses of rDNA, TEF, and ß- tubulin, it was discovered that this complex contains at least 12 species recognizable through phylogenetic species recognition [7]. Only a single species 13 of this complex contains isolates from human infections, and that species retains the name F. dimerum. F. dimerum occurs in soils but is not as commonly encountered as either the FOSC or the FSSC. It is a known plumbing fixture inhabitant, having been recovered in separate studies from tap water and hospital drinking water fixtures [7].

Giberella fujikuroi Species Complex

Members of the Gibberella fujikuroi Species Complex (GFSC) account for about

10% of fusaria associated with human infection [50]. The GFSC is best known as a group of mycotoxigenic endophytes and plant pathogens causing a variety of diseases, including wilts, rots, and malformations in a diversity of host plants.

In MLST analyses based on rDNA, TEF, and RPB2, it was discovered that several of the approximately fifty species in the GFSC species contain human infection-associated fusaria including F. verticillioides, F. napiforme, F. thapsinum, F. fujikuroi, F. proliferatum, and F. nygami [11]. In a separate analysis based on ß-tubulin, it was discovered that the species F. sacchari also contains human infection-associated fusaria [51].

The two species F. verticillioides and F. proliferatum are responsible for the vast majority of GFSC-associated fusarioses. Both species are very common worldwide, and produce copious quantities of aerially dispersed asexual spores.

Both species are known plant pathogens and producers of fumonisin mycotoxins; while fumonisins are toxic to humans, they are not known to have a role in pathogenicity. 14

Fusarium incarnatum-equiseti and Fusarium chlamydosporum Species

Complexes

The Fusarium incarnatum-equiseti Species Complex (FIESC) and its sister taxon the F. chlamydosporum Species Complex (FCSC) are relatively uncommonly associated with human infections, together accounting for <15% of the total [10].

The FIESC + FCSC is best known as a group of weak plant pathogens and saprophytes, as well as occasional pathogens of domestic and aquatic animals.

In MLST analyses based on rDNA, TEF, RPB2, and calmodulin (CAM), it was discovered that human infection associated FIESC isolates belonged to 16 distinct phylogenetic species, only one of which could be connected to a corresponding taxon (F. equiseti). 29 unique haplotypes were discovered among

44 isolates from human infections [10]. Members of the FIESC have been reported to be some of the more commonly isolated fusaria indoors, and although some members do not produce microconidia, their macroconidia are often dry and easily dispersed indoors [4].

Summary of Findings

Chapter 2: Widespread occurrence of diverse pathogenic types of the fungus Fusarium in bathroom sink drains

In a survey of plumbing drains in the Eastern U.S., we discovered a markedly high proportion of sinks and buildings containing Fusarium on drain surfaces. 15

The diversity of frequencies of the most common fusaria were strikingly similar to the diversity and frequencies of fusaria that have been isolated from human infections. The six most common STs were identical in both sets of isolates and included FOSC ST 33, a geographically widespread, nosocomial problem and several STs within FSSC 1 and FSSC 2. Several novel STs and even phylogenetic species were discovered, as well as strong evidence for introgression between two FSSC phylogenetic species suggestive of hybridization, which has been observed in other Fusarium clades but not the

FSSC.

Chapter 3: Fusarium fistularum sp. nov., a common human pathogen and inhabitant of plumbing-associated biofilms

Our data suggest that F. fistularum (FSSC 2) is the single most common member of Fusarium in both human infections and drain biofilms. Fusarium species, particularly members of the F. solani species complex, are very difficult to identify, reflecting the historical instability of Fusarium taxonomy at the species level. We examined the morphology, pigmentation and colony characteristics of

FSSC 2 and formally described it as a novel taxon. We successfully demonstrated its capacity for sexual recombination by inducing sexual crosses yielding perithecia and recombinant ascospores. We collected data on secondary metabolite profiles of several F. fistularum isolates and one isolate of F. petroliphilum which suggest intraspecific variability in F. fistularum, but also interspecific differences. We recognized the inclusion of F. solani 16 var.petroliphilum within the phylogenetic species FSSC 1, and raised this taxon to species status based on its established cohesiveness as a phylogenetic and biological species.

Chapter 4: Recombination, clonality and hybridization in the common plumbing-borne human pathogen Fusarium fistularum

Using genomic resources, we developed six novel sequence based markers and deployed them in F. fistularum. Our data resolved 55 3-locus sequence types

(STs) into 112 unique 9-locus STs (122 STs when mating type idiomorph is included as a tenth marker). Levels of overall genetic diversity and allelic diversity of loci suggest that F. fistularum is highly diverse. Plots of the utility of the markers in resolving genotypes suggested that we have not fully resolved all clones, even with 9 loci. While diversity in the species is high, and while there is strong evidence for recombination, we also observed an apparent epidemic clonal structure within the 3-locus ST FSSC 2-d. We found no geographic correlation to genetic diversity, as certain widespread and common STs were found to have transcontinental distributions. We also observed no population differentiation between clinical isolates and those from other sources, statistically supporting the hypothesis of plumbing biofilms as an important environmental reservoir.

17

References

1. Snyder WC, Hansen HN (1941) The species concept in Fusarium with reference to section Martiella. American Journal of Botany 28: 738-742.

2. Snyder WC, Hansen HN (1945) The species concept in Fusarium with reference to Discolor and other sections. American Journal of Botany 32: 657-

666.

3. Nelson PE, Tousson TA, Marasas W FO (1983) Fusarium species: An

Illustrated Manual for Identification. The Pennsylvania State University Press,

University Park: 193 p.

4. Booth C (1971) The Genus Fusarium. Commonwealth Mycological Institute:

Kew, GB: 237 p.

5. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, et al. (2000)

Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21-32.

6. Zhang N, O'Donnell K, Sutton DA, Nalim FA, Summerbell RC, et al. (2006)

Members of the Fusarium solani Species Complex that cause infections in both humans and plants are common in the environment. Journal of Clinical

Microbiology 44: 2186.

7. Schroers HJ, O'Donnell K, Lamprecht SC, Kammeyer PL, Johnson S, et al.

(2009) Taxonomy and phylogeny of the Fusarium dimerum species group.

Mycologia 101: 44-70. 18

8. O'Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998) Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National

Academy of Sciences of the USA 95: 2044-2049.

9. O'Donnell K (2000) Molecular phylogeny of the Nectria haematococca-

Fusarium solani Species Complex. Mycologia 92: 919-938.

10. O'Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, et al. (2009) A

Novel MLST Scheme Reveals High Genetic Diversity of Human Pathogenic

Members of the Fusarium incarnatum-equiseti and F. chlamydosporum Species

Complexes within the US. Journal of Clinical Microbiology 47: 3851-3861.

11. O'Donnell K, Sarver BAJ, Brandt M, Chang DC, Noble-Wang J, et al. (2007)

Phylogenetic diversity and microsphere array-based genotyping of human pathogenic fusaria, including isolates from the multistate contact lens-associated

US keratitis outbreaks of 2005 and 2006. Journal of Clinical Microbiology 45:

2235-2248.

12. Geiser DM, del Mar Jimenez-Gasco M, Kang S, Makalowska I,

Veeraraghavan N, et al. (2004) FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. European Journal of Plant Pathology 110: 473-479.

13. Avise JC, Ayala FJ (1975) Genetic change and rates of cladogenesis.

Genetics 81: 757-773.

14. Emmons CW (1940) Medical mycology. The Botanical Review 6: 474-514. 19

15. Pfaller MA, Diekema DJ (2004) Rare and emerging opportunistic fungal pathogens: concern for resistance beyond Candida albicans and Aspergillus fumigatus. Journal of Clinical Microbiology 42: 4419-4431.

16. Boekhout T, Gueidan C, de Hoog S, Samson R, Varga J, et al. (2009) Fungal taxonomy: New developments in medically important fungi. Current Fungal

Infection Reports 3: 170-178.

17. Durden FM, Elewski B. Fungal infections in HIV-infected patients; 1997.

Seminars in Cutaneous Medicine and Surgery 16: 200-212.

18. Curtis L, Lieberman A, Stark M, Rea W, Vetter M (2004) Adverse health effects of indoor molds. Journal of Nutritional and Environmental Medicine 14:

261-274.

19. Alliot C, Desablens B, Garidi R, Tabuteau S (2000) Opportunistic infection with Rhodotorula in cancer patients treated by chemotherapy: two case reports.

Clinical Oncology 12: 115-117.

20. Casadevall A, Pirofski L (1999) Host-pathogen interactions: redefining the basic concepts of virulence and pathogenicity. Infection and Immunity 67: 3703-

3713.

21. Feldmesser M, Kress Y, Novikoff P, Casadevall A (2000) Cryptococcus neoformans is a facultative intracellular pathogen in murine pulmonary infection.

Infection and Immunity 68: 4225-4237.

22. Cutler JE (1991) Putative virulence factors of Candida albicans. Annual

Reviews in Microbiology 45: 187-218. 20

23. Hogan LH, Klein BS, Levitz SM (1996) Virulence factors of medically important fungi. Clinical Microbiology Reviews 9: 469-488.

24. Litvintseva AP, Thakur R, Vilgalys R, Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172:

2223-2238.

25. Nucci M, Anaissie E (2002) Cutaneous infection by Fusarium species in healthy and immunocompromised hosts: implications for diagnosis and management. Clinical Infectious Diseases 35: 909-920.

26. Nucci M, Anaissie E (2007) Fusarium infections in immunocompromised patients. Clinical Microbiology Reviews 20: 695-704.

27. Puck JM, McGowan KL (1993) Catheter-related Fusarium solani fungemia and pulmonary infection in a patient with leukemia in remission. Clinical

Infectious Diseases 16: 148-150.

28. Canuto MM, Rodero FG (2002) Antifungal drug resistance to azoles and polyenes. The Lancet Infectious Diseases 2: 550-563.

29. Imamura Y, Chandra J, Mukherjee PK, Lattif AA, Szczotka-Flynn LB, et al.

(2008) Fusarium and Candida albicans biofilms on soft contact lenses: model development, influence of lens type, and susceptibility to lens care solutions.

Antimicrobial Agents and Chemotherapy 52: 171-182.

30. Ahearn DG, Zhang S, Doyle Stulting R, Schwam BL, Simmons RB, et al.

(2008) Fusarium keratitis and contact lens wear: facts and speculations. Medical

Mycology 46: 397-410. 21

31. Srinivasan M, Gonzales CA, George C, Cevallos V, Mascarenhas JM, et al.

(1997) Epidemiology and etiological diagnosis of corneal ulceration in Madurai, south India. British Journal of Ophthalmology 81: 965-971.

32. Thomas PA (2003) Fungal infections of the cornea. Eye 17: 852-862.

33. Khor WB, Aung T, Saw SM, Wong TY, Tambyah PA, et al. (2006) An outbreak of Fusarium keratitis associated with contact lens wear in Singapore.

Journal of the American Medical Association 295: 2867-2873.

34. Saw SM, Ooi PL, Tan DTH, Khor WB, Fong CW, et al. (2007) Risk factors for contact lens-related Fusarium keratitis: A case-control study in Singapore.

Archives of Ophthalmology 125: 611-617.

35. Chang DC, Grant GB, O'Donnell K, Wannemuehler KA, Noble-Wang J, et al.

(2006) Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. Journal of the American Medical Association 296: 953-963.

36. Mehl HL, Epstein L (2007) Fusarium solani Species Complex isolates conspecific with Fusarium solani f. sp. cucurbitae race 2 from naturally infected human and plant tissue and environmental sources are equally virulent on plants, grow at 37 degree C and are interfertile. Environmental Microbiology 9: 2189-

2199.

37. Anaissie EJ, Kuchar RT, Rex JH, Francesconi A, Kasai M, et al. (2001)

Fusariosis associated with pathogenic Fusarium species colonization of a hospital water system: a new paradigm for the epidemiology of opportunistic mold infections. Clinical Infectious Diseases 33: 1871-1878. 22

38. Levy B, Heiler D, Norton S (2006) Report on testing from an investigation of

Fusarium keratitis in contact lens wearers. Eye & Contact Lens 32: 256-261.

39. O'Donnell K, Sutton DA, Fothergill A, McCarthy D, Rinaldi MG, et al. (2008)

Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani Species Complex. Journal of

Clinical Microbiology 46: 2477-2490.

40. Matuo T, Snyder WC (1973) Use of morphology and mating populations in the identification of formae speciales in Fusarium solani. Phytopathology 63: 562-

565.

41. Mehl HL, Epstein L (2008) Sewage and community shower drains are environmental reservoirs of Fusarium solani Species Complex group 1, a human and plant pathogen. Environmental Microbiology 10: 219-227.

42. Summerbell RC, Schroers HJ (2002) Analysis of phylogenetic relationship of

Cylindrocarpon lichenicola and Acremonium falciforme to the Fusarium solani

Species Complex and a review of similarities in the spectrum of opportunistic infections caused by these fungi. Journal of Clinical Microbiology 40: 2866-2875.

43. Coleman JJ, Rounsley SD, Rodriguez-Carres M, Kuo A, Wasmann CC, et al.

(2009) The Genome of Nectria haematococca: Contribution of Supernumerary

Chromosomes to Gene Expansion. PLoS Genetics 5: e1000618.

44. Rodriguez-Carres M, White G, Tsuchiya D, Taga M, VanEtten HD (2008) The supernumerary chromosome of Nectria haematococca that carries pea- pathogenicity-related genes also carries a trait for pea rhizosphere competitiveness. Applied and Environmental Microbiology 74: 3849-3856. 23

45. VanEtten H, Funnell-Baerg D, Wasmann C, McCluskey K (1994) Location of pathogenicity genes on dispensable chromosomes in Nectria haematococca

MPVI. Antonie Van Leeuwenhoek 65: 263-267.

46. Kistler HC, VanEtten HD (1984) Three non-allelic genes for pisatin demethylation in the fungus Nectria haematococca. Microbiology 130: 2595-

2603.

47. Miao VPW, Matthews DE, VanEtten HD (1991) Identification and chromosomal locations of a family of cytochrome P-450 genes for pisatin detoxification in the fungus Nectrla haematococca. Molecular and General

Genetics 226: 214-223.

48. Baayen RP, O'Donnell K, Breeuwsma S, Geiser DM, Waalwijk C (2001)

Molecular relationships of fungi within the Fusarium redolens-F. hostae clade.

Phytopathology 91: 1037-1044.

49. O'Donnell K, Sutton DA, Rinaldi MG, Magnon KC, Cox PA, et al. (2004)

Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. Journal of

Clinical Microbiology 42: 5109-5120.

50. O'Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW, et al. (2009) A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum Species Complex. Fungal Genetics and Biology 12:

963-948. 24

51. Azor M, Gene J, Cano J, Manikandan P, Venkatapathy N, et al. (2009) Less frequent species of Fusarium of clinical interest: correlation between morphological and molecular identification and antifungal susceptibility. Journal of Clinical Microbiology 47: 1463-1468.

52. Swofford DL (2001) PAUP* 4.0 beta 5: Phylogenetic Analysis Using

Parsimony (and other methods): Sinauer Associates Sunderland, MA.

53. Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics

22: 2688-2690.

54. Zwickl DJ (2006) Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion.

PhD Thesis: The University of Texas at Austin.

55. Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574.

56. Covert SF, Briley A, Wallace MM, McKinney VT (1999) Partial MAT-2 gene structure and the influence of temperature on mating success in Gibberella circinata. Fungal Genetics and Biology 28: 43-54.

57. LoBuglio KF, Pitt JI, Taylor JW (1993) Phylogenetic analysis of two ribosomal

DNA regions indicates multiple independent losses of a sexual Talaromyces state among asexual Penicillium species in subgenus Biverticillium. Mycologia

85: 592-604.

58. Geiser DM, Timberlake WE, Arnold ML (1996) Loss of meiosis in Aspergillus.

Molecular Biology and Evolution 13: 809-817. 25

59. Burt A, Carter DA, Koenig GL, White TJ, Taylor JW (1996) Molecular markers reveal cryptic sex in the human pathogen Coccidioides immitis. Proceedings of the National Academy of Sciences of the USA 93: 770-773.

60. Geiser DM, Arnold ML, Timberlake WE (1994) Sexual origins of British

Aspergillus nidulans isolates. Proceedings of the National Academy of Sciences of the USA 91: 2349-2352.

61. Maynard-Smith J, Smith NH, O'Rourke M, Spratt BG (1993) How clonal are bacteria? Proceedings of the National Academy of Sciences of the USA 90:

4384-4388.

62. Bull JJ, Huelsenbeck JP, Cunningham CW, Swofford DL, Waddell PJ (1993)

Partitioning and combining data in phylogenetic analysis. Systematic Biology 42:

384-397.

63. Barker FK, Lutzoni FM (2002) The utility of the incongruence length difference test. Systematic Biology 51: 625-637.

64. Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23: 254-267.

65. Bruen TC, Philippe H, Bryant D (2006) A simple and robust statistical test for detecting the presence of recombination. Genetics 172: 2665-2681.

66. Schneider S, Roessli D, Excoffier L (2005) ARLEQUIN ver 3.0: a software for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47–50.

67. Templeton AR (1998) Nested clade analyses of phylogeographic data: testing hypotheses about gene flow and population history. Molecular Ecology 7:

381-397. 26

68. Carbone I (2000) Population history and process, nested clade and coalescent analysis of multiple gene genealogies in a parasite of agricultural and wild plants. PhD Thesis. University of Toronto, Canada.

69. Carbone I, Kohn L (2004) Inferring process from pattern in fungal population genetics. Fungal Genomics 4: 29-58.

70. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

71. Didelot X, Falush D (2007) Inference of bacterial microevolution using multilocus sequence data. Genetics 175: 1251-1266.

72. McVean GAT, Myers SR, Hunt S, Deloukas P, Bentley DR, et al. (2004) The fine-scale structure of recombination rate variation in the human genome.

Science 304: 581-584.

73. McVean G, Auton A LDhat 2.1: A package for the population genetic analysis of recombination. Department of Statistics, Oxford, OX1 3TG, UK 2007.

74. Sun Y, Chandra J, Mukherjee PK, Szczotka-Flynn L, Ghannoum M, et al.

(2009) A murine model of contact lens associated Fusarium keratitis.

Investigative Ophthalmology & Visual Science 51: 1511-1516.

75. Bullock JD, Warwar RE, Elder BL, Northern WI (2008) Temperature instability of ReNu With MoistureLoc: a new theory to explain the worldwide Fusarium keratitis epidemic of 2004-2006. Archives of Ophthalmology 126: 1493-1498.

76. Ortoneda M, Guarro J, Madrid MP, Caracuel Z, Roncero MIG, et al. (2004)

Fusarium oxysporum as a multihost model for the genetic dissection of fungal virulence in plants and mammals. Infection and Immunity 72: 1760-1766. 27

77. Balajee SA, Borman AM, Brandt ME, Cano J, Cuenca-Estrella M, et al.

(2009) Sequence-based identification of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: where are we and where should we go from here? Journal of Clinical Microbiology 47: 877-884.

28

Chapter 2

Widespread occurrence of diverse pathogenic types of the fungus

Fusarium in bathroom sink drains

Dylan P.G. Short1, Kerry O‟Donnell2, Ning Zhang3, Jean H. Juba1, David M.

Geiser1

1 Department of Plant Pathology, Pennsylvania State University, University Park,

Pennsylvania, United States of America, 2 United States Department of

Agriculture, Agricultural Research Service, 1815 N. University St., Peoria, Illinois,

United States of America, 3 Department of Plant Biology and Pathology, Rutgers

University, 59 Dudley Road, New Brunswick, New Jersey 08901, United States of America. 29

Abstract

It has been proposed that plumbing systems might serve as a significant environmental reservoir of human pathogenic isolates of Fusarium. We tested this hypothesis by performing the first extensive multilocus sequence typing

(MLST) survey of plumbing drain-associated Fusarium isolates, and comparing their diversity to the known diversity of clinical Fusarium isolates. We sampled

471 drains, mostly in bathroom sinks, from 131 buildings in the United States using a swabbing method. We found that 66% of sinks and 80% of buildings surveyed yielded at least one Fusarium culture. The 297 isolates of Fusarium collected were subjected to MLST to identify the phylogenetic species and sequence types (STs) of these isolates. Our survey revealed that the six most common STs in sinks were identical to those most frequently associated with human infections. These results have important implications for human health in that they support the hypothesized epidemiological link between Fusarium infections and plumbing systems, and indicate a very high potential for exposure to these pathogens. The relative rarity of Fusarium infections, however, indicates that routine exposure does not present an increased risk except to the growing population of persistently neutropenic individuals. We speculate that the most prevalent STs, by virtue of their ability to form and grow in biofilms, are well adapted to plumbing systems.

30

Author Summary

Human diseases caused by fungi in the indoor environment range from mild respiratory problems to sight-threatening corneal infections to deadly invasive infections that can spread haematogenically in patients with compromised immune systems. Fusarium is a common mold that is problematic in hospital settings and is the most frequent cause of mycotic keratitis (fungal infection of the cornea). Its occurence in these types of infections is thought to be due to its ability to form biofilms on surfaces. Currently, there is convincing but limited evidence that plumbing systems may be a major hidden reservoir of Fusarium infections, particularly in outbreaks of contact lens-associated keratitis. Here, we investigated one spectrum of human pathogenic fusaria that people may routinely come into contact with in the indoor environment. Our study is the first to sample fusaria that inhabit plumbing systems over a broad geographic range and to identify them using multilocus DNA sequence data. We sampled sink drains in private homes and public buildings in the United States and found that the six most common types of Fusarium known to infect people were identical to the six most common types in plumbing systems. Elucidation of the diversity and abundance of the opportunistic fusaria in this hidden reservoir have important implications for public health.

31

Introduction

Fungi that cause human mycoses usually exist as saprophytes in the environment. Fusarium is an example; its extreme metabolic diversity reflects its diverse ecology, as these fungi are abundant in soil, as saprophytes, mutualists and parasites on plants and animals, in the indoors, and in aquatic habitats

[1,2,3,4]. Like many fungi, Fusarium is responsible for an array of mostly opportunistic mycoses, including localized subcutaneous infections, and life- threatening invasive mycoses in immune-compromised and immune-suppressed individuals [5]. Unlike many human pathogenic fungi which enter through the respiratory tract, Fusarium typically tends to enter the body through wounds, via catheters and intravenous apparati in the hospital [6], through trauma [7] or introduction of a biofilm to the eye [8]. Fusarium also exhibits very high levels of resistance to the spectrum of antifungal drugs currently available, making these infections particularly difficult to treat [5].

Fusarium consists of over two hundred species grouped into at least ten phylogenetically defined species complexes [9]. The 69 known species associated with infections of humans and other animals reflect a great deal of the ecological and phylogenetic diversity in the genus, in that they are distributed among six species complexes. Approximately 80% of all human infections are caused by members of the Fusarium solani and F. oxysporum species complexes (FSSC and FOSC, respectively) [9].

Mycotic keratitis appears to be caused disproportionately by Fusarium species [10]. Previous work indicated that F. falciforme, a soil-associated 32 phylogenetic species in the FSSC also known as FSSC 3+4, was the most common species associated with fungal keratitis, consistent with soil and plant debris particles being the main source of infection [11]. However, in the 2005-06 outbreaks of mycotic keratitis in Southeast Asia and North America associated with contact lens use [8]the most frequent species and multilocus sequence types (STs) associated with eye infections were two unnamed phylogenetic species, FSSC 1 and FSSC 2. The main environmental sources known for these species were plumbing systems, suggesting that this was likely the primary environmental reservoir for eye infections. Results of the outbreak investigation established that fungal biofilms formed on contact lenses and lens cases, and 10 matched corneal-environment isolates shared the same ST [12]. Collectively, these results suggest that patients inadvertently inoculated their cornea with contaminated lenses [8]. This hypothesis is further supported by the fact that

Fusarium has been recovered in many surveys of water systems, including surveys of municipal water system pipe sections [13] and from a hospital survey sampling plumbing fixtures [14]. It has also been demonstrated experimentally that fusaria, particularly members of the FSSC and FOSC, can attach to and form biofilms on contact lenses and PVC pipe [15,16,17,18].

Previous MLST studies have shown that a majority of clinically relevant fusaria were represented by six STs representing four different species in three phylogenetically distinct species complexes: one from the FOSC (FOSC ST 33), four from two species in the FSSC (STs a and b in FSSC 1, and STs d and k in

FSSC 2), and a single ST of F. dimerum (F. dimerum ST a), in the F. dimerum 33 species complex (FDSC). All six STs have also been recovered from hospital environments, including plumbing systems [8,11,12,14,19,20,21]. This connection has led to the hypothesis that indoor plumbing associated biofilms may act as hidden source of infection in hospitals and the community.

While a number of studies have shown that putatively pathogenic fusaria inhabit a wide variety of man-made water systems, the frequencies and genetic diversity of common pathogenic STs has not been investigated over a broad geographic range. In this study we assembled a panel of 297 plumbing- associated fusaria collected on a broad geographic scale, and used existing

MLST schemes to determine their identities at the species and ST levels. The distribution of STs collected from sinks was compared to the distribution of known human pathogenic STs reported in previous studies.

34

Results

Frequency and phylogenetic distribution of fusaria

312 (66%) of 471 sinks sampled and 107 (82%) of 131 buildings in Pennsylvania,

Virginia, Maryland, North Carolina, South Carolina, Georgia, Florida, and

California yielded at least one Fusarium isolate, determined by the production of diagnostic conidia on Nash agar. Of these, 297 were successfully obtained as pure cultures and subjected to full MLST analysis, yielding 59 unique STs

(multilocus DNA sequence data is available at GenBank. 99% of STs were nested within one of three species complexes: 185 from the FSSC (62%), 85 from the FOSC (28%), and 25 from the FDSC (8.5%) (Figure 1).

Figure 1. Frequencies of Fusarium species complexes characterized by

MLST from A. clinical sources based on previous studies and B. drains based on the present study.

35

Among clinical isolates, a review of STs from previous analyses (N=717) indicated that 60% came from the FSSC, 18% from the FOSC, 5% from the

FDSC, 7% from the Gibberella fujikuroi species complex (GFSC), 7% from the

FIESC, 3% from the F. chlamydosporum species complex (FCSC) and <1% from other species complexes (Figure 1). In the present study, only two isolates were from the FIESC and no members of the GFSC or FCSC were obtained from sink drains.

MLST diversity of sink fusaria

70% (209/297) of sink isolates belonged to six STs from four species in three species complexes. Nucleotide sequence data has been deposited in GenBank with accession numbers (JN235143-JN235946). From most to least common, the STs were 1) FOSC ST 33 (N=71), 2) FSSC 2-d (N=58), 3) FSSC 1-a (N=30),

4) F. dimerum ST a (N=24), 5) FSSC 1-b (N=15), and 6) FSSC 2-k (N=11)

(Figure 2). 36

Figure 2. Frequencies of 59 MLSTs represented by 297 fusaria isolated from drains in the present study. The six most common clinical STs are highlighted with asterisks: FSSC 1-a, FSSC 1-b, FSSC 2-d, FSSC 2-k, FOSC ST

33, and Fusarium dimerum a

Based on our census of isolates from clinical sources in published MLST studies, these same six STs were the six most common in human infections 37

(FOSC ST 33 = 74, FSSC 2-d = 44, FSSC 1-b = 29, F. dimerum a = 17, FSSC 1- a = 15, FSSC 2-k = 7). FOSC ST 33 was the most frequently isolated FOSC ST from both sink drain and clinical sources (Figure 3).

Figure 3. Frequencies of FOSC STs isolated from A. clinical sources from previous studies and B. from drains in this study. Asterisks highlight FOSC ST

33, the widespread clonal lineage known from human infections [21].

Of the 59 STs identified from sinks, 32 had not been observed in previous MLST studies of Fusarium (Figure 5, Figure 6, Figure 7). 38

Figure 5. Cladogram of the FSSC based on TEF, rDNA and RPB2 highlighting the spectrum of FSSC diversity found in drains. The tree is rooted at

F. staphyleae (NRRL 22316). Black dots indicate FSSC STs isolated from drains. Gray and black shading identify, respectively, novel FSSC STs and 39 species discovered in this study. Black arrows indicate the four most common

FSSC STs recovered from sinks. Numbers in parentheses indicate number of isolates recovered from drains in this study. All drain isolates are members of

FSSC Clade 3 sensu [54].

40

Figure 6. Phylogram of the FDSC based on TEF, rDNA, and TUB highlighting the spectrum of FDSC diversity found in drains. The tree is rooted at 41

F. domesticum (NRRL 29976). A black dot is used to identify two phylogenetically distinct STs within the FDSC isolated from sinks; black shading indicates the putatively novel species FDSC 6. Numbers of sink isolates from this study are indicated in parentheses.

42

Figure 7. Phylogram of the FIESC based on TEF, rDNA, RPB2 and CAM highlighting the spectrum of diversity forund in drains. The tree is rooted at F. concolor (NRRL 13459). Black dots and shading identify two putatively novel 43

FIESC species and STs, designated FIESC 31-a and FIESC 32-a, which were discovered in this study.

These novel STs included members of four putatively new Fusarium species based on their clear sequence divergence, one in the FSSC (FSSC 39), and one in the FDSC (FDSC 6), and two in the FIESC (FIESC 29 and 30). In addition, putative interspecific hybrids were detected representing two novel STs from phylogenetic species FSSC 2 which possessed rDNA alleles that were an exact match for those from a different phylogenetic species, FSSC 9 (data not shown). The remaining 27 STs were known from previous MLST studies of

Fusarium that mostly targeted clinical isolates. All 27 of these STs have been previously associated with at least one human infection.

Geographic Distribution

Of the 107 buildings that yielded a Fusarium culture, 86 (79%) yielded one of the six common STs known from human infections. FOSC ST 33, previously described as a widespread clonal lineage associated with human infections [21], was the most common ST recovered and was found 71 times in 42 buildings,

(Table S1). Moreover, FOSC ST 33 was found in every state sampled (Figure 4,

CA not shown); it has been reported from human infections in 5 countries on 2 continents, as well as a wide variety of environmental sources such as hospital water systems (Table S2). 44

Figure 4. Generalized schematic map showing 57 collection areas (black dots) containing buildings yielding Fusarium. Sites that yielded FOSC ST 33 are highlighted by white points within black dots.

FSSC 2-d, the next most commonly isolated ST, was found 58 times in 27 different buildings, 20 of which were in Florida. 21/23 (91%) of residences and

86/108 (80%) of public buildings yielded Fusarium. Multiple STs were found in two of the eight sinks that were swabbed twice: one sink yielded STs FSSC 2-d and FOSC ST 128, and another yielded FSSC 2-d and FSSC 2-ii.

45

Discussion

Widespread occurrence of pathogenic fusaria

With 66% of sinks and 82% of buildings found to harbor Fusarium, it is clear that their inhabitants are exposed to these fungi on a regular basis. Because our swabbing method was far from exhaustive, these frequencies should be considered a minimum estimate. The fact that the six most common STs found in sink drains, representing 70% of the fusaria recovered, are the same six most common STs responsible for human infections strongly supports the hypothesis that plumbing surface biofilms serve as reservoirs for human pathogenic fusaria

[8,14,17,28]. However, while we hypothesize that STs of opportunistic fusaria are very common in our indoor environment, we are quick to point out that

Fusarium infections are relatively rare, even among the severely immune- compromised and immune-suppressed [29,30,23]. Victims of the 2005-06 outbreak of Fusarium keratitis did not show any tendency toward immune deficiency, but the frequency of infections was also very low, with approximately

255 confirmed cases worldwide among the many millions of users of the contact lens solution associated with the infections [12,29,30]. It is noteworthy that five of the six most common STs we isolated from sinks represented 54% of the 67 isolates analyzed from infected corneas (i.e., FSSC 1-a: 13; FSSC 1-b: 3; FSSC

2-d: 9; FOSC 33: 10; F. dimerum a: 1) [12]. This striking concordance supports the hypothesis that the water systems in the patients‟ communities and/or homes served as the environmental reservoir in the keratitis outbreaks [8].

46

Diversity of sink fusaria

The six most common STs reflect a great deal of phylogenetic diversity within the genus, covering a minimum of four phylogenetic species in three divergent species complexes. In addition, based on their phylogenetic divergence at multiple loci, four isolates appear to represent putative novel phylogenetic species in three different species complexes, designated FIESC 29, FIESC 30,

FSSC 39, and FDSC 6. Because evolutionarily defined fungal species are often morphologically cryptic [31] it is not surprising that novel species were discovered in this survey, particularly in the species-rich FIESC, which has not been studied exhaustively [32]. In addition to the four new species, 28 novel STs were found within known phylogenetic species in the FSSC and the FDSC, as well as within the FOSC where phylogenetic species delimitation has been confounded by clonal-like reproduction and genealogical discordance [20].The 32 novel STs were observed most frequently as single isolates, with only 7 of them occurring more than once (Figure 2). Of the 27 previously known STs, all had been associated with at least one human infection. Previous MLST surveys of clinical isolates indicate that such “singleton” STs are commonly associated with human infections [9,11,21,32]

Connections to clinical fusaria

Fusarium has been shown to comprise at least ten phylogenetic groups referred to as species complexes, seven of which are known to harbor human pathogens

[9]. Four of the seven Fusarium species complexes known to harbor human 47 pathogens were isolated from sink drains in our study, with the GFSC, F. sambucinum species complex (FSamSC) and FCSC not observed, and the

FIESC only isolated twice. While the FIESC, GFSC and FCSC are less commonly associated with human infections, together they represent ~17% of the fusaria known from human infections; however, they represented <1% of the sink isolates recovered in our survey. In contrast, over 99% of the fusaria isolated from sink drains in this study were members of the FOSC, FSSC and

FDSC, which were associated with ~85% of human clinical isolates genotyped previously. The six dominant STs represented a great deal of diversity, four coming from two species of the FSSC (FSSC1-a, FSSC 1-b, FSSC 2-d and

FSSC 2-k), one from a species in the FDSC (F. dimerum a), and one from the

FOSC (FOSC ST 33). These same species and STs are known to be the most common in Fusarium infections across different continents (Table S2). The application of molecular markers with higher resolution at the population level, as has been previously applied to FOSC ST 33 [21], may reveal clonal and/or recombinant patterns of propagation within these common STs. We hypothesize that these cosmopolitan STs may thrive in man-made water systems and may have been distributed around the world anthropogenically.

Biofilm adapatation and its role in infection

Biofilms on plumbing surfaces are known to be communities comprising a diverse spectrum of fungi and other microbes. The widespread distribution of certain Fusarium species and STs in sink drains suggests that these STs are 48 particularly well adapted to this environmental niche and/or highly fecund. Even though it is a semi-selective medium containing the fungicide pentachloronitrobenzene (PCNB), we observed some other fungi and bacteria in the drain samples streaked onto Nash agar, including unidentified dematiaceous hyphomycetes (darkly pigmented, putatively asexual fungi), Aspergillus and

Penicillium. However, based on its very high frequency, it is clear that Fusarium is a ubiquitous component of biofilm microbial communities in plumbing systems.

The adaptations that make Fusarium biofilm growth possible may also facilitate infection of humans. For example, in the 2005-06 mycotic keratitis outbreak, it was hypothesized that noncompliant use of the product led to reduced efficacy of its antimicrobial properties, which allowed fusaria to establish biofilms on contact lens surfaces and in lens cases [33]. Likewise, Fusarium can form biofilms on surfaces of indwelling catheters [6]. The biofilm may also play an important role in established infections in the human host by protecting the fungus from antifungal drug treatments, as biofilm phase fusaria tend to be more resistant to antifungal drugs than those growing planktonically [16].

Fusarium taxa not sampled

Additional studies of biofilms are needed to assess whether sampling biases may have effected the observed frequencies of taxa due to the use of a semi-selective medium. Thus it is difficult to draw conclusions about species that may have been expected but were missing or very infrequent. Fusicolla aquaeductuum (=

Fusarium aquaeductuum) is associated with trickling sewage filters [34] and may 49 well exist in drains and tap water sources, but not grow competitively against fast growing members of the FSSC and FOSC on Nash medium. Similarly, other taxa nested within the GFSC (reported as F. moniliforme and F. dlaminii), FIESC

(reported as F. pallidoroseum and F. equiseti) and even the FSamSC (reported as F. graminearum, F. sporotrichoides, and F. culmorum) have been reported from surveys of filamentous fungi in water systems [35,36]. Members of the

GFSC (reported as F. moniliforme) are also known to occur in trickling sewage filters and sewage polluted waters [37]. It is thus possible that members of these other Fusarium groups may make up some proportion of the total fusaria in drains and tap water sources. However, morphological species recognition is known to perform poorly in Fusarium, and many studies have demonstrated that molecular data is necessary to accurately assess the diversity of fusaria in any sample. Because members of these missing species complexes are known to grow competitively on the semi-selective medium we employed, our data suggest that they are either absent from or present in low numbers in drains.

The near absence of representatives of these species complexes in sinks may be explained in part by the way these fungi produce asexual spores.

Members of the FIESC, GFSC and FCSC tend to produce dry, small asexual spores (microconidia), whereas members of the FSSC, FOSC and FDSC produce conidia in a wet or adhesive material, either in small masses (false heads) that adhere to the spore-forming cells (phialides) or in larger masses

(pionnotes). While biofilms in plumbing systems may prove to represent the most important environmental reservoir of human pathogenic fusaria, other 50 sources, including dry indoor surfaces, soil, and plant material may be significant sources for infections caused by taxa within species complexes that do not form biofilms.

Biofilms may play a role in dispersal and metabolic diversity

Adaptation and spread through indoor environments is likely enhanced by water dispersal, as a number of mycological surveys have recovered Fusarium in activated sludge [38], from tap water [39], and specifically from tap water in hospitals [40,41,42,43,44,45].

In addition to their wide distribution in plumbing systems and in human infections, the common biofilm-forming Fusarium species are known to colonize other unusual man-made substrates, as contaminants of soap, ointments, pasteurized beverages in manufacturing plants, lubrication oils in heavy machinery, oily water and coolant fluids [9,11,19,46]. Biofilms also may facilitate interactions between Fusarium and other metabolically diverse, plumbing- associated microbes [47]. Biofilm-associated fusaria and their co-resident microbes may function as polyextremophiles in plumbing systems by virtue of novel metabolic capabilities that allow them to exploit a variety of challenging environmental niches, including the ability degrade keratin [48] and other refractory compounds [49]. Metagenomic approaches for dissecting the biofilm microbiome are needed to fully characterize the microbial communities and to determine what impact they have on the diversity of fusaria and vice versa.

51

Materials and Methods

Sampling from drains

471 plumbing drains were sampled, over 95% of which were bathroom sink drains. To capture as many different sampling points over as broad a geographic range as possible, drains were sampled from 131 buildings including businesses, homes, university dormitories and public facilities in Pennsylvania, Virginia,

Maryland, North Carolina, South Carolina, Georgia, Florida, and California.

Buildings <10 miles apart were grouped into 57 “sites” for depiction on maps. To isolate Fusarium, sterile 15 cm cotton-tipped applicators were dipped into bathroom drains, usually through the openings in drain filters, and used to scour the interior surface of drainpipes for approximately 5 seconds. Cotton-tipped applicators, often with visible detritus, were then immediately streaked onto 5 cm or 8.5 cm Petri plates of Nash-Snyder agar (Nash), a Fusarium semi-selective medium that contains the fungicide pentachloronitrobenzene [22], and the plates were sealed using paraffin tape. Plates were examined for the presence of fungal colonies under a dissection microscope 10-15 days after collection and putative fusaria were identified for subculturing. Growing hyphal tips of

Fusarium-like colonies were transferred to Carnation Leaf Agar (CLA) plates for further identification. Rarely, two discrete colonies growing on the same Nash plate were treated as potentially distinct fusaria and independently subcultured from hyphal tips. Fusarium colonies mixed with bacteria and/or other fungi were transferred to another plate of Nash until it was possible to establish a pure culture from a growing hyphal tip or single spore. Because other fungi,including 52

Penicillium, Aspergillus, Mucor and unidentified dematiaceous hyphomycetes

(darkly pigmented fungi producing mitotic spores) were rarely encountered, they were not included in the present study. For long-term storage, cultures growing on CLA were transferred to vials of sterile milk and lyophilized, vacuum-sealed and stored in the culture collection of the Fusarium Research Center, University

Park, PA, where they are available to all authorized users.

DNA Manipulation

Total genomic DNA was isolated from mycelium using a modified DNeasy Plant

Mini kit protocol (Qiagen, Valencia, CA, USA) and suspended in a 100 µl volume.

Portions of six gene fragments were employed for MLST based on published phylogenetic analyses, with different combinations of loci used for different species complexes as previously described: partial translation elongation factor

1- (TEF), the internal transcribed spacer region of the ribosomal RNA gene and domains D1 and D2 of the LSU (rDNA), the nuclear ribosomal DNA intergenic spacer region (IGS rDNA), two contiguous regions of the RNA polymerase II second largest subunit (RPB2), partial benA beta-tubulin (TUB), and calmodulin

(CAM) (Table 1; see references therein). 53

Table 1. MLST markers employed in this study for each Species Complex together with primers used for PCR and DNA sequencing.

Species Sequencing Primers and

MLST Locus Complexes PCR Primers References

FSSC, FOSC,

TEF1 FDSC, FIESC EF1-EF2 EF1,EF2: [50]

FSSC, FDSC, rDNA2 FIESC ITS5-NL4 ITS5: [51]. NL4: [50]

B-TUB3 FDSC T1-T22 T1 ,T22: [50]

CNS1,NL11,iNL11,NLa,CNSa

IGS4 FOSC CNS1/NL11 ,iCNS1: [20]

5F2-7CR/

RPB25 FSSC, FIESC 7CF-11AR 5F2,7CR,7CF,11AR: [52]

CAM6 FIESC CL1-CL2A CL1,CL2A: [53]

1. 5‟ end of the translation elongation factor 1-alpha gene, including three introns.

2. Portion of the nuclear ribosomal RNA gene operon that includes the ITS regions, 5.8S rRNA gene, and the D1-D2 region of the large (28S) ribosomal

RNA gene. 3. 5‟ end of a beta-tubulin gene, including three introns. 4.

Intergeneric spacer region of the nuclear ribosomal RNA gene operon. 5. Portion of the second largest RNA polymerase B-subunit gene. 6. Portion of the calmodulin gene

54

Polymerase Chain Reaction (PCR) was performed for TEF, rDNA, CAM, and RPB2 using GoTaq PCR Kits (Promega, Madison, WI, USA). Because of its longer amplicon length and secondary structure, PCR was performed for IGS using PlatinumTaq Kits (Invitrogen, Carlsbad, CA, USA) as previously described

[21,23]. PCR products were purified for DNA sequencing by incubating 5 µL of product in with 0.33 µl Shrimp Alkaline Phosphatase (1 U/ µl; USB, Cleveland),

0.67 µl Exonuclease I (10 U/ µl; Affymetrix, Santa Clara) and 1 µl Shrimp Alkaline

Phosphatase 10x reaction buffer (USB, Cleveland), prepared in a master mix for

30 min at 37° C, followed by 15 min at 80° C. Sanger sequencing was performed at the Penn State Genomics Core Facility, University Park, PA on an ABI 3730

XL automated DNA sequencer (Applied Biosystems, Carlsbad, CA, USA).

Sequencher version 4.8 (Gene Codes, Ann Arbor, MI, USA) was used to edit the raw sequence data, which was generated in both directions. Sequences were then aligned using CLUSTALW (www.align.genome.jp) and improved manually prior to addition to existing MLST alignments from previous studies.

Multilocus Sequence Typing (MLST)

A BLAST search employing TEF sequences against the FUSARIUM-ID [24] and

GenBank databases (www.ncbi.nlm.nih.gov) was used as an initial step to identify isolates to species and/or species complex. The results of these searches revealed that all isolates belonged to one of four species complexes: the FOSC, FSSC, FDSC and the F. incarnatum-equiseti species complex

(FIESC). Additional sequences were then generated for each isolate, using 55 species complex-specific MLST schemes (Table 1). Once edited, sequences were manually added to existing sequence alignments for the respective species complex. Missing or ambiguous DNA sequence data were assigned Ns in the alignments and these characters were treated as missing data in PAUP*. To assign isolates to known STs, a parsimony tree was first generated for isolates from each species complex using PAUPRat [25] implemented in PAUP*v.4.0.b9

[26], with the following settings: set seed=0, nreps=200, pct=15, set wtmode=uniform, set terse, with simple sequence addition and heuristic searches. Isolates were assigned to existing STs when they shared a common terminal node in the parsimony tree with a previously known ST, and their exact identity was confirmed by visual scrutiny of sequence alignments and chromatograms. Isolates were assigned to new STs when they formed a unique branch in the parsimony tree, confirmed by scrutiny of the sequence quality and alignments. Both indels and nucleotide substitutions were taken into account when assigning STs.

To compare the diversity of drain fusaria with the diversity of clinical fusaria, the frequencies of human pathogenic STs belonging to different

Fusarium species complexes were compiled from published phylogenetic analyses [8,11,12,19,21,27] using MLST data.

56

Acknowledgements

We thank Stacy Sink for excellent technical assistance, and Gregory F. Short and Nicolas A. Warren for their assistance with the surveys of Fusarium in plumbing systems. This work was supported in part by research grants from

Bausch & Lomb, Inc. and the National Eye Institute, as well as a special

Graduate Research grant provided by the Pennsylvania State College of

Agricultural Sciences awarded to DPGS. DPGS is supported by a USDA-AFRI grant in Microbial Genomics. The mention of firm names or trade products does not imply that they are endorsed or recommended by the U.S. Department of

Agriculture over other firms or similar products not mentioned. The USDA is an equal opportunity provider and employer.

57

References

1. Farr DF, Bills GF, Chamuris GP, Rossman AY (1989) Fungi on Plants and

Plant Products in the United States. St. Paul, Minnesota: American

Phytopathological Society. 1252 pages.

2. Palmero D, Iglesias C, de Cara M, Lomas T, Santos M, et al. (2009) Species of Fusarium isolated from river and sea water of southeastern Spain and pathogenicity on four plant species. Plant Disease 93: 377-385.

3. Leslie JF, Summerell BA, Bullock S (2006) The Fusarium Laboratory Manual.

Ames, Iowa: Blackwell Publishing. 388 pages.

4. Domsch KH, Gams W, Anderson TH (2007) Compendium of Soil Fungi, 2nd

Taxonomically Revised Edition. Eching, Germany: IHW-Verlag. 405 pages.

5. Sutton DA, Brandt ME (in press) Fusarium and other opportunistic hyaline fungi. In: J. Versalovic KCC, G. Funke, J. H. Jorgensen, M. L., editors. Manual of

Clinical Microbiology. 10th ed. Washington, D.C.: ASM Press.

6. Wey SB, Colombo A (1997) Fungal infections of catheters. In: H. Seifert, B.

Jansen, B. Farr, editors. Catheter-Related Infections. New York: Marcel Decker. pp.139-156.

7. Gopinathan U, Garg P, Fernandes M, Sharma S, Athmanathan S, et al. (2002)

The epidemiological features and laboratory results of fungal keratitis: a 10-year review at a referral eye care center in South India. Cornea 21: 555-559.

58

8. Chang DC, Grant GB, O'Donnell K, Wannemuehler KA, Noble-Wang J, et al.

(2006) Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. The Journal of the American Medical Association 296: 953-963.

9. O'Donnell K, Sutton DA, Rinaldi MG, Sarver BAJ, Balajee SA, et al. (2010)

Internet-Accessible DNA sequence database for identifying Fusaria from human and animal infections. Journal of Clinical Microbiology 48: 3708-3718.

10. Alfonso EC, Rosa RH (1997) Fungal Keratitis. In: Krachmer JH, Mannis, M.J.,

Holland, E.J., editors. Cornea and External Diseases: Clinical Diagnosis and

Management. St Louis: Mosby. pp. 1253-1266.

11. Zhang N, O'Donnell K, Sutton DA, Nalim FA, Summerbell RC, et al. (2006)

Members of the Fusarium solani Species Complex that cause infections in both humans and plants are common in the environment. Journal of Clinical

Microbiology 44: 2186-2190.

12. O'Donnell K, Sarver BAJ, Brandt M, Chang DC, Noble-Wang J, et al. (2007)

Phylogenetic diversity and microsphere array-based genotyping of human pathogenic fusaria, including isolates from the multistate contact lens - associated U.S. keratitis outbreaks of 2005 and 2006. Journal of Clinical

Microbiology 45: 2235-2248.

13. Doggett MS (2000) Characterization of fungal biofilms within a municipal water distribution system. Applied and Environmental Microbiology 66: 1249.

14. Anaissie EJ, Kuchar RT, Rex JH, Francesconi A, Kasai M, et al. (2001)

Fusariosis associated with pathogenic Fusarium species colonization of a 59 hospital water system: a new paradigm for the epidemiology of opportunistic mold Infections. Clinical Infectious Diseases 33: 1871-1878.

15. Simmons RB, Buffington JR, Ward M, Wilson LA, Ahearn DG (1986)

Morphology and ultrastructure of fungi in extended-wear soft contact lenses.

Journal of Clinical Microbiology 24: 21-25.

16. Dyavaiah M, Ramani R, Chu DS, Ritterband DC, Shah MK, et al. (2007)

Molecular characterization, biofilm analysis and experimental biofouling study of

Fusarium isolates from recent cases of fungal keratitis in New York State. BMC

Ophthalmology 7: 1-9.

17. Mehl HL, Epstein L (2008) Sewage and community shower drains are environmental reservoirs of Fusarium solani species complex group 1, a human and plant pathogen. Environmental Microbiology 10: 219-227.

18. Imamura Y, Chandra J, Mukherjee PK, Lattif AA, Szczotka-Flynn LB, et al.

(2008) Fusarium and Candida albicans biofilms on soft contact Lenses: Model development, influence of lens type, and susceptibility to lens care solutions.

Antimicrobial Agents and Chemotherapy 52: 171-182.

19. Schroers HJ, O'Donnell K, Lamprecht SC, Kammeyer PL, Johnson S, et al.

(2009) Taxonomy and phylogeny of the Fusarium dimerum species group.

Mycologia 101: 44-70.

20. O'Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW, et al. (2009) A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex. Fungal Genetics and Biology 46: 936-

948. 60

21. O'Donnell K, Sutton DA, Rinaldi MG, Magnon KC, Cox PA, et al. (2004)

Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. Journal of

Clinical Microbiology 42: 5109-5120.

22. Nash SM, Snyder WC (1962) Quantitative estimations by plate counts of propagules of the bean root rot Fusarium in field soils. Phytopathology 52: 567-

572.

23. Raad I. Tarrand J, Hanna H, Albitar M, Janssen E, et al. (2002)

Epidemiology, molecular mycology, and environmental sources of Fusarium infection in patients with cancer. Infection Control and Hospital Epidemiology

23:532-537.

24. Geiser DM, Jimenez-Gasco MD, Kang SC, Makalowska I, Veeraraghavan N, et al. (2004) FUSARIUM-ID v. 1.0: A DNA sequence database for identifying

Fusarium. European Journal of Plant Pathology 110: 473-479.

25. Sikes D. S., Lewis P. O. PAUPRat: PAUP implementation of the parsimony ratchet. Beta software, version 1. Distributed by the authors. Storrs: Department of Ecology and Evolutionary Biology, University of Connecticut; 2001.

26. Swofford DL (2002) PAUP* (Phylogenetic Analysis Using Parsimony and

Other Methods), Version 4.10 b. Sinauer, Sunderland, Massachusetts, USA.

27. O'Donnell K, Sutton DA, Fothergill A, McCarthy D, Rinaldi MG, et al. (2008)

Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro 61 antifungal resistance within the Fusarium solani Species Complex. Journal of

Clinical Microbiology 46: 2477-2490.

28. Anaissie EJ, Penzak SR, Dignani MC (2002) The hospital water supply as a source of nosocomial infections: a plea for action. Archives of Internal Medicine

162: 1483-1492.

29. Nucci M, Anaissie E (2007) Fusarium infections in immunocompromised patients. Clinical Microbiology Reviews 20: 695.

30. Martino P, Gastaldi R, Raccah R, Girmenia C (1994) Clinical patterns of

Fusarium infections in immunocompromised patients. Journal of Infection 28: 7-

15.

31. Epstein AB (2007) In the aftermath of the Fusarium keratitis outbreak: What have we learned? Clinical Ophthalmology 1: 355-366.

32. Donnio A, Van Nuoi DNG, Catanese M, Desbois N, Ayeboua L, et al. (2007)

Outbreak of keratomycosis attributable to Fusarium solani in the French West

Indies. American Journal of Ophthalmology 143: 356-358.

33. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, et al. (2000)

Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21-32.

34. O'Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, et al. (2009)

Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum Species Complexes within the United States. Journal of Clinical

Microbiology 47: 3851-3861. 62

35. Levy B, Heiler D, Norton S (2006) Report on testing from an investigation of

Fusarium keratitis in contact lens wearers. Eye & Contact Lens 32: 1-7.

36. Feldman AE (1957) Biota associated with sewage filtration. Sewage and

Industrial Wastes 29: 538-540.

37. Anaissie EJ, Kuchar RT, Rex JH, Francesconi A,Kasai M, et al. (2002)

Pathogenic Aspergillus species recovered from a hospital water System: A 3- year prospective study. Clinical Infectious Diseases 34: 780-789.

38. Kinsey G, Paterson R, Kelley J (2003) Filamentous fungi in water systems.

In: N.J. Horan, editor. Handbook of Water and Wastewater Microbiology. London:

Academic press. pp. 77-98.

39. Cooke WB, Kabler PW (1957) Plant disease fungi in sewage polluted water.

Public Health Reports 72: 651.

40. Awad MF, Kraume M (2011) Mycological survey of activated sludge in MBRs.

Mycoses. In Press.

41. Kanzler D, Buzina W, Paulitsch A, Haas D, Platzer S, et al. (2008)

Occurrence and hygienic relevance of fungi in drinking water. Mycoses 51: 165-

169.

42. Arvanitidou M, Kanellou K, Constantinides TC, Katsouyannopoulos V (1999)

The occurrence of fungi in hospital and community potable waters. Letters in

Applied Microbiology 29: 81-84.

43. Arvanitidou M, Spaia S, Velegraki A, Pazarloglou M, Kanetidis D, et al.

(2000) High level of recovery of fungi from water and dialysate in haemodialysis units. Journal of Hospital Infection 45: 225-230. 63

44. Warris A, Gaustad P, Meis J, Voss A, Verweij PE, et al. (2001) Recovery of filamentous fungi from water in a pediatric bone marrow transplantation unit.

Journal of Hospital Infection 47: 143-148.

45. Panagopoulou P, Filioti J, Petrikkos G, Giakouppi P, Anatoliotaki M, et al.

(2002) Environmental surveillance of filamentous fungi in three tertiary care hospitals in Greece. Journal of Hospital Infection 52: 185-191.

46. Hedayati MT, Mayahi S, Movahedi M, Shokohi T (2011) A study on fungal flora of tap water as a potential reservoir of fungi in hospitals from Sari City, Iran.

International Journal of Infectious Diseases 14: S45-S45.

47. Hayette MP, Christiaens G, Mutsers J, Barbier C, Huynen P, et al. (2010)

Filamentous fungi recovered from the water distribution system of a Belgian university hospital. Medical Mycology 48: 969-974.

48. Colombo JC, Cabello M, Arambarri AM (1996) Biodegradation of aliphatic and aromatic hydrocarbons by natural soil microflora and pure cultures of imperfect and lignolitic fungi. Environmental Pollution 94: 355-362.

49. Gostincar C, Grube M, Gunde-Cimerman N (2011) Evolution of fungal pathogens in domestic environments? Fungal Biology. In Press.

50. Friedrich J, Gradiöar H, Mandin D, Chaumont JP (1999) Screening fungi for synthesis of keratinolytic enzymes. Letters in Applied Microbiology 28: 127-130.

51. Hamada N, Abe N (2009) Physiological characteristics of 13 common fungal species in bathrooms. Mycoscience 50: 421-429. 64

52. O'Donnell K, Cigelnik E, Nirenberg HI (1998) Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90: 465-

493.

53. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: M. Innis, D.

Gelfand, J. Sninsky & T. White, editors. PCR Protocols: A Guide to Methods and

Applications. San Diego: Academic Press. pp. 315-322.

54. Liu YJ, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16: 1799-1808.

55. O'Donnell K, Kistler HC, Tacke BK, Casper HH (2000) Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proceedings from the National Academy of Sciences USA 97: 7905-7910.

56. O'Donnell K (2000) Molecular phylogeny of the Nectria haematococca-

Fusarium solani species complex. Mycologia 92: 919-938.

57. Nixon KC (1999) The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15: 407–414.

65

Table S1. Fusarium isolates collected in this study.

FRC Accession Species Species and Building

#1 Complex ST2 State Location Type No.3

E-317 FDSC F. dimerum a FL Hotel 6

E-318 FDSC F. dimerum a FL Hotel 6

E-319 FDSC F. dimerum a FL Restaurant 10

F. dimerum Office Supply

E-320 FDSC a FL Store 11

F. dimerum

E-321 FDSC a FL Shopping Center 12

F. dimerum

E-322 FDSC a FL Hotel 22

F. dimerum

E-323 FDSC a FL Hotel 22

F. dimerum

E-324 FDSC a FL Hotel 22

F. dimerum

E-325 FDSC a FL Restaurant 23

F. dimerum

E-326 FDSC a FL Hotel 24

E-327 FDSC FL Shopping Center 24 F. dimerum 66

a

E-328 FDSC 6-a FL Shopping Center 27

F. dimerum

E-329 FDSC a FL Shopping Center 39

F. dimerum

E-330 FDSC a FL Restaurant 41

F. dimerum

E-331 FDSC a FL Hotel 42

F. dimerum

E-332 FDSC a FL Hotel 45

F. dimerum

E-333 FDSC a FL Hotel 45

F. dimerum

E-334 FDSC a FL Hotel 45

F. dimerum

E-335 FDSC a VA Restaurant 54

F. dimerum

E-336 FDSC a VA Shopping Center 61

F. dimerum

E-337 FDSC a NC Shopping Center 72

E-338 FDSC PA Dormitory 87 F. dimerum 67

a

F. dimerum

E-339 FDSC a PA House 90

F. dimerum

E-340 FDSC a PA Apartment 102

F. dimerum

E-341 FDSC a PA Apartment 102

O-2512 FOSC ST 33 FL Shopping Center 4

O-2513 FOSC ST 298 FL Hotel 6

O-2514 FOSC ST 33 FL Restaurant 7

O-2515 FOSC ST 33 FL University Building 14

O-2516 FOSC ST 33 FL Shopping Center 15

O-2517 FOSC ST 33 FL Shopping Center 27

O-2518 FOSC ST 33 FL Shopping Center 27

O-2519 FOSC ST 297 FL University Building 31

O-2520 FOSC ST 33 FL University Building 33

O-2521 FOSC ST 33 FL Shopping Center 37

O-2522 FOSC ST 33 FL Beach 40

O-2523 FOSC ST 33 FL Hotel 42 68

O-2524 FOSC ST 33 FL Shopping Center 44

O-2525 FOSC ST 33 PA Shopping Center 51

O-2526 FOSC ST 33 PA Shopping Center 51

O-2527 FOSC ST 33 PA Shopping Center 51

O-2528 FOSC ST 33 VA Shopping Center 55

O-2529 FOSC ST 33 VA Shopping Center 58

O-2530 FOSC ST 126 VA Shopping Center 59

O-2531 FOSC ST 33 VA Shopping Center 58

O-2532 FOSC ST 33 VA Shopping Center 61

O-2533 FOSC ST 299 VA Shopping Center 61

O-2534 FOSC ST 33 VA Shopping Center 61

O-2535 FOSC ST 33 VA Grocery Store 62

Highway Rest

O-2536 FOSC ST 183 NC Area 64

O-2537 FOSC ST 33 SC Shopping Center 65

O-2538 FOSC ST 33 SC Shopping Center 65

O-2539 FOSC ST 33 SC Shopping Center 65

O-2540 FOSC ST 33 GA Shopping Center 67 69

O-2541 FOSC ST 33 GA Shopping Center 67

O-2542 FOSC ST 33 GA Shopping Center 68

O-2543 FOSC ST 33 GA Shopping Center 68

O-2544 FOSC ST 33 GA Shopping Center 68

O-2545 FOSC ST 128 GA Shopping Center 68

O-2546 FOSC ST 33 GA Grocery Store 69

O-2547 FOSC ST 33 GA Shopping Center 70

O-2548 FOSC ST 33 GA Shopping Center 70

O-2549 FOSC ST 33 SC Corporate Building 71

Highway Rest

O-2550 FOSC ST 33 NC Area 73

Highway Rest

O-2551 FOSC ST 33 NC Area 73

O-2552 FOSC ST 33 NC Shopping Center 72

O-2553 FOSC ST 33 NC Shopping Center 72

O-2554 FOSC ST 33 NC Bar 74

O-2555 FOSC ST 33 NC Shopping Center 75

O-2556 FOSC ST 33 NC Shopping Center 76

O-2557 FOSC ST 62 NC Shopping Center 76 70

O-2558 FOSC ST 62 NC Shopping Center 76

O-2559 FOSC ST 33 NC Shopping Center 76

O-2560 FOSC ST 33 NC Shopping Center 77

O-2561 FOSC ST 33 NC Shopping Center 77

O-2562 FOSC ST 33 NC Shopping Center 77

Highway Rest

O-2563 FOSC ST 33 VA Area 78

O-2564 FOSC ST 33 VA Shopping Center 79

O-2565 FOSC ST 33 VA Shopping Center 79

O-2566 FOSC ST 33 VA Shopping Center 79

O-2567 FOSC ST 33 VA Shopping Center 79

O-2568 FOSC ST 33 VA Shopping Center 79

O-2569 FOSC ST 33 VA Shopping Center 79

O-2570 FOSC ST 33 VA Shopping Center 79

O-2571 FOSC ST 33 MD Shopping Center 80

O-2572 FOSC ST 33 MD Shopping Center 80

O-2573 FOSC ST 33 MD Shopping Center 80

O-2574 FOSC ST 62 PA Public Park 81 71

O-2575 FOSC ST 33 PA Public Park 83

Convenience

O-2576 FOSC ST 33 GA Store 33

O-2577 FOSC ST 33 GA Drug Store 46

O-2578 FOSC ST 33 FL Shopping Center 37

O-2579 FOSC ST 33 FL Shopping Center* 4

O-2580 FOSC ST 33 VA Shopping Center 79

O-2581 FOSC ST 128 FL University Building 49

O-2582 FOSC ST 33 FL Shopping Center 24

O-2583 FOSC ST 33 CA Apartment 85

O-2584 FOSC ST 33 PA Apartment 88

O-2585 FOSC ST 7 PA House 90

O-2586 FOSC ST 62 PA Apartment 93

O-2587 FOSC ST 33 PA Apartment 94

O-2588 FOSC ST 33 PA Apartment 96

O-2589 FOSC ST 33 NC Apartment 97

O-2590 FOSC ST 33 NC Apartment 97

O-2591 FOSC ST 7 PA House 98 72

O-2592 FOSC ST 33 PA Apartment 99

O-2593 FOSC ST 33 PA Dormitory 100

O-2594 FOSC ST 126 PA Apartment 102

O-2595 FOSC ST 33 PA Dormitory 105

O-2596 FOSC ST 33 PA Apartment 107

R-10112 FIESC 32-a FL Public Park 18

R-10113 FIESC 31-a PA Public Park 106

S-2369 FSSC 2-ii FL Restaurant 1

S-2370 FSSC 1-b FL Restaurant 2

S-2371 FSSC 2-d FL Café 3

S-2372 FSSC 2-d FL Restaurant 4

S-2373 FSSC 2-d FL Restaurant 4

S-2374 FSSC 2-jj FL Shopping Center 4

S-2375 FSSC 2-s FL Shopping Center 4

S-2376 FSSC 2-f FL Shopping Center 4

S-2377 FSSC 2-f FL Shopping Center 4

S-2378 FSSC 2-d FL Shopping Center 4

S-2379 FSSC 2-k FL 5 Highway Rest 73

Area

Highway Rest

S-2380 FSSC 2-k FL Area 5

S-2381 FSSC 2-g FL Restaurant 7

Convenience

S-2382 FSSC 2-g FL Store 8

S-2383 FSSC 1-a FL Grocery Store 9

S-2384 FSSC 1-a FL Grocery Store 9

S-2385 FSSC 2-d FL Shopping Center 12

S-2386 FSSC 2-d FL Shopping Center 12

S-2387 FSSC 2-d FL Shopping Center 12

S-2388 FSSC 2-pp FL Shopping Center 12

S-2389 FSSC 2h FL Shopping Center 12

S-2390 FSSC 2-d FL Shopping Center 12

S-2391 FSSC 2-ll FL University Building 13

S-2392 FSSC 2-d FL Shopping Center 15

S-2393 FSSC 2-k FL Shopping Center 15

S-2394 FSSC 2-qq FL Shopping Center 15

S-2395 FSSC 2-d FL Shopping Center 15 74

S-2396 FSSC 1-a FL Shopping Center 15

S-2397 FSSC 3+4-vvv FL Shopping Center 15

S-2398 FSSC 2-d FL Shopping Center 15

S-2399 FSSC 1-b FL Shopping Center 15

S-2400 FSSC 2-d FL Shopping Center 15

S-2401 FSSC 2-d FL Shopping Center 15

S-2402 FSSC 2-o FL Shopping Center 15

S-2403 FSSC 2-o FL Shopping Center 15

Highway Rest

S-2404 FSSC 2-d FL Area 16

S-2405 FSSC 2-g FL Beach* 17

S-2406 FSSC 2-nn FL Public Park 19

S-2407 FSSC 2-tt FL Public Park 19

S-2408 FSSC 1-a FL Public Park 20

S-2409 FSSC 2-d FL Public Park 20

S-2410 FSSC 2-d FL Public Park 20

S-2411 FSSC 2-kk FL Grocery Store 21

S-2412 FSSC 2-kk FL Grocery Store 21 75

S-2413 FSSC 2-g FL Hotel 23

S-2414 FSSC 2-d FL Shopping Center 24

S-2415 FSSC 3+4-www FL Shopping Center 24

S-2416 FSSC 2-d FL Shopping Center 24

S-2417 FSSC 2-d FL Shopping Center 24

S-2418 FSSC 2-ii FL Grocery Store 25

S-2419 FSSC 2-d FL Grocery Store 25

S-2420 FSSC 2-d FL Grocery Store 25

Highway Rest

S-2421 FSSC 2-d FL Area 26

S-2422 FSSC 1-a FL Shopping Center 27

S-2423 FSSC 2-d FL Shopping Center 27

S-2424 FSSC 2-ii FL Shopping Center 27

S-2425 FSSC 2-ii FL Shopping Center 27

S-2426 FSSC 2-d FL Shopping Center 27

S-2427 FSSC 2-oo FL Shopping Center 27

S-2428 FSSC 2-d FL Shopping Center 27

S-2429 FSSC 2-d FL University Building 28 76

S-2430 FSSC 2-d FL University Building 29

S-2431 FSSC 3+4s FL University Building 29

S-2432 FSSC 39-a FL University Building 30

S-2433 FSSC 3+4-uuu FL University Building 30

S-2434 FSSC 2-d FL University Building 31

S-2435 FSSC 2-d FL University Building 31

S-2436 FSSC 2-d FL Restaurant 32

S-2437 FSSC 2-k GA Hotel 34

S-2438 FSSC 18-c GA Restaurant 35

S-2439 FSSC 2-k GA Drug Store 35

S-2440 FSSC 18-d GA Hotel 36

S-2441 FSSC 2-d GA Restaurant 36

S-2442 FSSC 2-d GA Drug Store 36

S-2443 FSSC 2-d FL Shopping Center 37

S-2444 FSSC 2-d FL Shopping Center 37

S-2445 FSSC 5-ff FL Shopping Center 37

S-2446 FSSC 5-c FL Shopping Center 37

S-2447 FSSC 2-d FL Shopping Center 37 77

S-2448 FSSC 2-d FL Shopping Center 37

S-2449 FSSC 2-d FL Shopping Center 37

S-2450 FSSC 2-d FL Shopping Center 37

S-2451 FSSC 2-b FL Shopping Center 37

S-2452 FSSC 3+4-qq FL Shopping Center 37

S-2453 FSSC 1-a FL Shopping Center 37

S-2454 FSSC 2-d FL Shopping Center 38

S-2455 FSSC 2-d FL Shopping Center 38

S-2456 FSSC 2-d FL Shopping Center 38

S-2457 FSSC 2-d FL Shopping Center 38

S-2458 FSSC 2-a FL Shopping Center 38

S-2459 FSSC 2-d FL Shopping Center 38

S-2460 FSSC 2-t FL Restaurant 43

S-2461 FSSC 2-s FL Shopping Center 44

S-2462 FSSC 1-j FL Shopping Center 44

S-2463 FSSC 1-b FL Shopping Center 44

S-2464 FSSC 2-d FL Shopping Center 44

S-2465 FSSC 2-vv FL Shopping Center 44 78

S-2466 FSSC 2-d FL Shopping Center 44

S-2467 FSSC 2-d FL Shopping Center 44

S-2468 FSSC 1-a PA Shopping Center 51

S-2469 FSSC 1-b PA Shopping Center 51

S-2470 FSSC 1-b PA Shopping Center 51

S-2471 FSSC 1-a PA Shopping Center 51

S-2472 FSSC 1-b PA Restaurant 52

Highway Rest

S-2473 FSSC 2-o PA Area 53

Highway Rest

S-2474 FSSC 1-a PA Area 53

Highway Rest

S-2475 FSSC 1-a PA Area 53

Highway Rest

S-2476 FSSC 2-o PA Area 53

S-2477 FSSC 2-ss VA Shopping Center 55

Highway Rest

S-2478 FSSC 2-rr VA Area 56

S-2479 FSSC 2-k VA Shopping Center 55

S-2480 FSSC 1-a VA Shopping Center 55 79

S-2481 FSSC 1-a VA Shopping Center 55

S-2482 FSSC 2-k VA Shopping Center 55

Highway Rest

S-2483 FSSC 1-a PA Area 56

Office Supply

S-2484 FSSC 9-d VA Store 57

S-2485 FSSC 9-a VA Shopping Center 58

S-2486 FSSC 2-k VA Shopping Center 58

S-2487 FSSC 2-f VA Shopping Center 58

S-2488 FSSC 1-a VA Shopping Center 58

Highway Rest

S-2489 FSSC 1-a VA Area 60

S-2490 FSSC 1-b VA Shopping Center 61

S-2491 FSSC 9-a VA Shopping Center 61

S-2492 FSSC 1-b VA Shopping Center 61

S-2493 FSSC 2-k VA Shopping Center 63

S-2494 FSSC 1-b VA Shopping Center 63

S-2495 FSSC 1-b VA Shopping Center 63

S-2496 FSSC 2-uu NC 64 Highway Rest 80

Area

Highway Rest

S-2497 FSSC 2-d SC Area 64

S-2498 FSSC 2-d SC Shopping Center 65

S-2499 FSSC 2-k SC Shopping Center 65

S-2500 FSSC 2-d SC Shopping Center 65

S-2501 FSSC 2-d SC Shopping Center 65

S-2502 FSSC 1-a SC Shopping Center 66

S-2503 FSSC 1-a SC Shopping Center 66

S-2504 FSSC 1-b SC Shopping Center 66

S-2505 FSSC 1-a GA Shopping Center 67

S-2506 FSSC 1-a GA Shopping Center 67

S-2507 FSSC 1-a GA Shopping Center 67

S-2508 FSSC 5-h GA Shopping Center 68

S-2509 FSSC 2-mm GA Shopping Center 68

S-2510 FSSC 1-a GA Shopping Center 70

S-2511 FSSC 3+4-h SC Shopping Center 72

S-2512 FSSC 1-b NC Shopping Center* 72 81

S-2513 FSSC 1-a NC Shopping Center 72

S-2514 FSSC 3+4-ttt NC Shopping Center 72

S-2515 FSSC 2-k NC Bar 74

S-2516 FSSC 5-ee NC Shopping Center 75

S-2517 FSSC 5-e NC Shopping Center 76

S-2518 FSSC 2-b NC Shopping Center 76

Highway Rest

S-2519 FSSC 9-a VA Area 78

S-2520 FSSC 1-a VA Shopping Center 79

S-2521 FSSC 2-d VA Shopping Center 79

S-2522 FSSC 1-c VA Shopping Center 79

S-2523 FSSC 2-d MD Shopping Center 80

S-2524 FSSC 1-a MD Shopping Center 80

S-2525 FSSC 1-a MD Shopping Center 80

S-2526 FSSC 1-a MD Shopping Center 80

S-2527 FSSC 2-uu MD Shopping Center 80

S-2528 FSSC 2-d PA Public Park 81

S-2529 FSSC 2-uu PA Museum 82 82

S-2530 FSSC 9-a PA Museum 82

S-2531 FSSC 9-a PA Museum 83

Highway Rest

S-2532 FSSC 1-a PA Area 84

Highway Rest

S-2533 FSSC 2-g PA Area 84

S-2534 FSSC 2-t FL University Building 31

S-2535 FSSC 2-d FL Shopping Center 4

Highway Rest

S-2536 FSSC 1-i GA Area 47

S-2537 FSSC 2-d FL Public Park 50

S-2538 FSSC 5-c CA Apartment 86

S-2539 FSSC 2-vv PA Dormitory 89

S-2540 FSSC 9-e PA House 90

S-2541 FSSC 9-e PA House 90

S-2542 FSSC 9-d PA House 90

International

S-2543 FSSC 9-d PA Airport 91

International

S-2544 FSSC 1-a PA Airport 91 83

International

S-2545 FSSC 1-a PA Airport 92

S-2546 FSSC 1-a PA Apartment 94

S-2547 FSSC 2-d PA Dormitory 95

S-2548 FSSC 1-b PA Apartment 101

S-2549 FSSC 1-b PA Movie Theater 103

S-2550 FSSC 1-b PA Dormitory 104

S-2551 FSSC 2-d FL Shopping Center 12

S-2552 FSSC 2-pp FL Restaurant 24

S-2553 FSSC 2-d FL Shopping Center 49

1 Fusarium Research Center Culture Collection, Department of Plant Pathology,

Pennsylvania State University

2 For the FIESC and FSSC, STs consist of a number indicating the phylogenetic species, followed by a letter or series of letters indicating the unique ST within the species, to which the isolate belongs. For the FOSC, only a number is provided to indicate the ST, since phylogenetic species boundaries have not been elucidated within this complex. ST nomenclature for the FDSC has not been developed, but the major ST of F. dimerum found here and elsewhere

(Schroers et al. 2009) was arbitrarily assigned ST a, and the putative novel

FDSC species found here was assigned 6, indicating FDSC phylogenetic species 84

6 and ST a. Three other novel phylogenetic species discovered in the present study include FIESC 31, FIESC 32, and FSSC 39.

3Building numbers were assigned after initial analyses indicated the presence of

Fusarium. Only buildings that yielded Fusarium are listed. An additional 24 buildings sampled did not yield fusaria.

*These three isolates were collected from water fountain drains. All others were collected from sink drains. 85

Table S2. Geographic origins of known clinical isolates of the six main human pathogenic STs [8,11,12,14,19,20,21].

NRRL / CBS /FRC No. Sequence Type Geographic Origin

34026 F. dimerum a USA DE

36145 F. dimerum a Netherlands

36146 F. dimerum a Canada

36161 F. dimerum a USA GA

36163 F. dimerum a Chile

36187 F. dimerum a USA OH

36190 F. dimerum a USA TX

36192 F. dimerum a USA MD

36384 F. dimerum a Netherlands

37071 F. dimerum a Chile

CBS 102613 F. dimerum a Sweden

CBS 108944 F. dimerum a Netherlands

CBS 116519 F. dimerum a USA

CBS 116523 F. dimerum a USA

CBS 116524 F. dimerum a USA

CBS 116637 F. dimerum a USA

CBS 327398 F. dimerum a USA

25378 FOSC ST 33 USA OK

25728 FOSC ST 33 Germany

25749 FOSC ST 33 Belgium

26361 FOSC ST 33 USA TN

26362 FOSC ST 33 USA SC 86

26372 FOSC ST 33 USA NY

26376 FOSC ST 33 USA NY

26386 FOSC ST 33 USA TX

26387 FOSC ST 33 USA TX

26389 FOSC ST 33 USA CT

26390 FOSC ST 33 USA TX

26391 FOSC ST 33 USA TX

26392 FOSC ST 33 USA TX

26393 FOSC ST 33 USA CT

26394 FOSC ST 33 USA CA

26398 FOSC ST 33 USA FL

26399 FOSC ST 33 USA TX

26551 FOSC ST 33 Canada

28013 FOSC ST 33 USA DE

31166 FOSC ST 33 USA TX

32176 FOSC ST 33 USA TX

32377 FOSC ST 33 USA TX

32511 FOSC ST 33 USA TX

32914 FOSC ST 33 USA CA

32915 FOSC ST 33 USA CO

32916 FOSC ST 33 USA TX

32917 FOSC ST 33 USA TX

32927 FOSC ST 33 USA TX

32929 FOSC ST 33 USA TX

32930 FOSC ST 33 USA TX 87

32932 FOSC ST 33 USA PA

32933 FOSC ST 33 USA TX

32935 FOSC ST 33 USA ME

32938 FOSC ST 33 USA TX

32940 FOSC ST 33 USA TX

32941 FOSC ST 33 USA TX

32942 FOSC ST 33 USA TX

32943 FOSC ST 33 USA TX

32944 FOSC ST 33 USA TX

32945 FOSC ST 33 USA TX

32948 FOSC ST 33 USA TX

32949 FOSC ST 33 USA TX

32950 FOSC ST 33 USA TX

32951 FOSC ST 33 USA TX

32952 FOSC ST 33 USA WI

32953 FOSC ST 33 USA TX

32954 FOSC ST 33 USA TX

32955 FOSC ST 33 USA TX

32956 FOSC ST 33 USA TX

32957 FOSC ST 33 USA TX

32958 FOSC ST 33 USA TX

32960 FOSC ST 33 USA TX

32961 FOSC ST 33 USA TX

32962 FOSC ST 33 USA TX

32999 FOSC ST 33 USA TX 88

36064 FOSC ST 33 USA TX

43455 FOSC ST 33 USA VT

43521 FOSC ST 33 USA FL

43692 FOSC ST 33 USA WA

43696 FOSC ST 33 USA TX

43698 FOSC ST 33 USA PA

43707 FOSC ST 33 USA CA

43734 FOSC ST 33 USA NY

43735 FOSC ST 33 USA NY

43810 FOSC ST 33 USA OH

44893 FOSC ST 33 Italy

44899 FOSC ST 33 Italy

46436 FOSC ST 33 Italy

46439 FOSC ST 33 Italy

46595 FOSC ST 33 Italy

46600 FOSC ST 33 Italy

46601 FOSC ST 33 Italy

46603 FOSC ST 33 Italy

46606 FOSC ST 33 Italy

22609 FSSC 1-a USA MA

28546 FSSC 1-a USA MS

28551 FSSC 1-a USA TX

28558 FSSC 1-a Brazil

28567 FSSC 1-a USA TX

32304 FSSC 1-a USA CO 89

32326 FSSC 1-a USA FL

32344 FSSC 1-a USA TX

32805 FSSC 1-a USA NY

32806 FSSC 1-a USA NY

32826 FSSC 1-a USA TX

32835 FSSC 1-a Japan

43372 FSSC 1-a USA NJ

46706 FSSC 1-a Qatar

32703 FSSC 1-a USA TX

22939 FSSC 1-b Germany

28545 FSSC 1-b USA CT

28547 FSSC 1-b USA

28557 FSSC 1-b USA CT

28560 FSSC 1-b USA

28579 FSSC 1-b Cuba

32299 FSSC 1-b USA IL

32300 FSSC 1-b USA CT

32302 FSSC 1-b USA CA

32303 FSSC 1-b USA CA

32315 FSSC 1-b USA TN

32318 FSSC 1-b USA TN

32320 FSSC 1-b USA MT

32329 FSSC 1-b USA FL

32330 FSSC 1-b USA KS

32332 FSSC 1-b USA CA 90

32333 FSSC 1-b USA CA

32335 FSSC 1-b USA IL

32337 FSSC 1-b USA CA

32485 FSSC 1-b USA TX

32704 FSSC 1-b Canada

32759 FSSC 1-b USA FL

32760 FSSC 1-b USA FL

32783 FSSC 1-b USA IL

32827 FSSC 1-b USA UT

32832 FSSC 1-b USA NY

32834 FSSC 1-b USA TX

34095 FSSC 1-b USA IL

43511 FSSC 1-b USA FL

22661 FSSC 2-d Japan

28036 FSSC 2-d Brazil

28543 FSSC 2-d USA

32487 FSSC 2-d USA TX

32489 FSSC 2-d USA PA

32504 FSSC 2-d USA TX

32803 FSSC 2-d USA TX

32853 FSSC 2-d USA TX

32855 FSSC 2-d USA TX

32911 FSSC 2-d USA FL

43439 FSSC 2-d USA PA

43444 FSSC 2-d USA NJ 91

43445 FSSC 2-d USA CT

43446 FSSC 2-d USA CT

43456 FSSC 2-d Singapore

43459 FSSC 2-d Singapore

43460 FSSC 2-d Singapore

43461 FSSC 2-d Singapore

43462 FSSC 2-d Singapore

43463 FSSC 2-d Singapore

43475 FSSC 2-d Hong Kong

43476 FSSC 2-d Hong Kong

43477 FSSC 2-d Hong Kong

43478 FSSC 2-d Hong Kong

43479 FSSC 2-d Hong Kong

43480 FSSC 2-d Hong Kong

43481 FSSC 2-d Hong Kong

43482 FSSC 2-d Hong Kong

43484 FSSC 2-d Hong Kong

43500 FSSC 2-d USA TN

43510 FSSC 2-d USA FL

43512 FSSC 2-d USA FL

43523 FSSC 2-d USA FL

43524 FSSC 2-d USA FL

43525 FSSC 2-d USA FL

43528 FSSC 2-d USA FL

43538 FSSC 2-d USA FL 92

43727 FSSC 2-d USA FL

43728 FSSC 2-d USA FL

46694 FSSC 2-d Qatar

32491 FSSC 2-d USA TX

32500 FSSC 2-d USA TX

FRC S-1273 FSSC 2-d USA TX

FRC S-2111 FSSC 2-d Qatar

25374 FSSC 2-k Canada

28568 FSSC 2-k USA New England

31165 FSSC 2-k USA

32482 FSSC 2-k USA TX

32801 FSSC 2-k Mexico

32804 FSSC 2-k USA NY

46443 FSSC 2-k Italy

93 Chapter 3

Fusarium fistularum sp. nov., a common human pathogen and inhabitant of

plumbing-associated biofilms

Dylan P.G. Short1, Kerry O‟Donnell2, Ulf Thrane3, Ning Zhang4, Jean H. Juba1,

David M. Geiser1

1. Department of Plant Pathology, Penn State University, University Park,

Pennsylvania, United States of America, 2. United States Department of

Agriculture, Agricultural Research Service, 1815 N. University St., Peoria,

Illinois, United States of America, 3. Department of Systems Biology and Center for Microbial Biotechnology, Technical University of Denmark, Lyngby, Denmark.

4. Department of Plant Biology & Pathology and Department of Biochemistry &

Microbiology, Rutgers University, New Brunswick, New Jersey, United States of

America. 94 Abstract

The Fusarium solani species complex, (FSSC) is the most common group of fusaria associated with life-threatening opportunistic human infections as well as infections of the cornea. Here we present the description and taxonomy of

Fusarium fistularum sp. nov., the single most common human pathogen in the genus Fusarium, that was previously known as FSSC Group 2. F. fistularum is genetically diverse, cosmopolitan and associated with biofilms on plumbing surfaces in the environment. Multiple independent loci indicate that F. fistularum represents a strongly supported phylogenetically exclusive lineage in Clade 3 of the FSSC sensu O‟Donnell (2000), despite the fact that two isolates show evidence for introgression from a closely related species, FSSC 9.

Morphologically, F. fistularum isolates show high levels of variation in a range of characteristics that are typical for most concepts of „F. solani,‟ with many isolates failing to produce sporodochia in culture and possessing aberrant morphological characters. Similar ranges of morphology are apparent in three other commonly encountered phylogenetic species in FSSC, possibly reflecting the high degree of taxonomic instability associated with this group. Secondary metabolites produced by F. fistularum include anhydrofusarubin, fusarubin, solaniol, and javanicin. A haematonectria-like heterothallic sexual stage was produced for F. fistularum by pairing fertile isolates of opposite mating type on V-8 agar. An epitype was provided for the sexual stage, and described as an addendum to the description of F. fistularum. Most pairings of isolates of opposite mating-type did not yield sexual structures, and the few that did often produced asci containing 95 six or fewer mature ascospores, indicating possible high levels of infertility. In addition, based on a DNA sequence connection with an ex-Type culture, we apply the name F. petroliphilum, elevated to species status from F. solani var. petroliphilum, to another common Fusarium species associated with human infections and biofilms, FSSC 1.

96 Introduction

The species-rich the Fusarium solani species complex (FSSC) is one of ten major clades currently recognized as Fusarium species complexes, and one of six that harbors opportunistic and mycotic keratitis-associated human pathogens

(2, 20-22). Over 60% of human pathogenic fusaria that have been subjected to multilocus sequence typing (MLST) belong to this species complex. These fungi are cosomopolitan, ecologically and metabolically diverse and occur in a wide variety of environments as saprophytes and in association with plants. The FSSC is a group of roughly 60 known morphologically cryptic phylogenetic species, seven of which are known to correspond exactly to exclusive groups of interfertile isolates biological species called Mating Populations (MP), (15). The vast majority of these phylogenetically diagnosable species lack Latin binomials.

The most common members of the FSSC that cause human infections tend also to be common in the environment. They are also hypothesized to be major components of the polyextremophilic microbial communities in indoor environments, especially man-made water systems, by virtue of their ability to form biofilms on plumbing surfaces (11). Biofilms appear to be an important reservoir for both opportunistic and mycotic keratitis-associated pathogenic fusaria (1).

Two major species within the FSSC are common in human infections and 97 biofilms

Within the FSSC, the two phylogenetic species FSSC 1 and FSSC 2 are relatively predominant in association with human infections and biofilms.

Members of these two species account for ~20% of the total sample of Fusarium clinical isolates characterized using MLST, and ~33% of all clinical FSSC isolates characterized. Based on phylogenetic analyses and connection to type material,

FSSC 1 comprises the isolates previously assigned the names Fusarium solani var. petroliphilum and F. solani f. sp. cucurbitae race 2 (26), also known as

Mating Population V (15). By contrast, FSSC 2 does not correspond to any known variety or formae specialis, and no sexual reproduction has yet been demonstrated in it.

To improve the taxonomy of these species for epidemiological inferences and the study of important phenotypes within phylogenetically defined species, we describe FSSC 2 as F. fistularum sp. nov., and apply the elevated name F. petroliphilum to FSSC 1. We present cultural, morphological, and preliminary secondary metabolite characters of multiple isolates belonging to FSSC 2 belonging to a diversity of MLST types and from a variety of sources and locations. For comparative purposes, we also present morphological data from

FSSC 1 and two other common species of the FSSC associated with human infections and the environment, the phylogenetic species F.falciforme (FSSC

3+4) and FSSC 5.

Materials and methods 98 Cultures

All fungal cultures analyzed are deposited in the Fusarium Research Center,

University Park, PA and the USDA NRRL collection in Peioria, IL. 7-10 isolates from each of the following species were chosen for comparison: FSSC 1, FSSC

2, FSSC 3+4 (F. falciforme), and FSSC 5. These isolates were chosen to represent a variety of isolation sources, geographic locations and MLSTs based on the loci partial translation elongation factor 1- (TEF), the internal transcribed spacer region of the ribosomal RNA gene and domains D1 and D2 of the LSU

(rDNA), and two contiguous regions of the RNA polymerase II second largest subunit (RPB2) (Table 1).

Table 1. Isolates analyzed for morphological and cultural characters in this study.

FRC / NRRL No. FSSC MLST1 Source Geo. Origin

FRC S-2244 1-a Human eye USA NJ

FRC S-2532 1-a Sink drain drain USA PA

FRC S-2481 1-a Sink drain USA VA

FRC S-1437 1-b Cucurbit New Zealand

FRC S-2469 1-b Sink drain USA PA

FRC S-0218 1-b Human Canada

FRC S-2321 1-c Contact lens case USA NY 99

FRC S-2522 1-c Sink drain USA VA

FRC S-1380 1-e Ceiling plaster USA OH

FRC S-2536 1-h Sink drain USA GA

FRC S-2462 1-j Sink drain USA FL

NRRL 43433 2-a Cornea USA OH

NRRL 43373 2-b Contact lens Malaysia

NRRL 22641 2-c Human Nigeria

NRRL 22661 2-d Human Japan

FRC S-2149 2-d Machine fluid USA

NRRL 43446 2-d Cornea USA CT

NRRL 43525 2-d Cornea USA FL

NRRL 43528 2-d Cornea USA FL

NRRL 43444 2-d Cornea USA NJ

NRRL 43651 2-d Lens solution bottle cap USA PR

NRRL 43510 2-d Cornea USA FL

FRC S-1360 2-d Sink drain USA TX

NRRL 43814 2-d Contact lens USA NY

FRC S-1370 2-d Sink drain USA TX 100

FRC S-1375 2-d Human blood USA TX

FRC S-2108 2-d Fish skin Germany

NRRL 43661 2-d Contact lens USA PR

FRC S-0617 2-f Soil New Caledonia

NRRL 43490 2-g Cornea USA MI

FRC S-2228 2-n Human eye USA FL

FRC S-0534 2-p Shrimp USA CA

FRC S-1512 2-q Human USA WI

FRC S-1427 2-r Human USA TX

FRC S-2226 2-s Human eye USA FL

FRC S-2227 2-s Human eye USA FL

FRC S-2369 2-ii Sink drain USA FL

FRC S-2477 2-ss Sink drain USA VA

FRC S-2391 2-ll Sink drain USA FL

NRRL 32959 2-ww Human skin USA FL

FRC S-1378 3+4-dd Human cancer USA TX

FRC S-1559 3+4-ff Human USA AR

FRC S-0432 3+4-tt Cornea USA FL 101

FRC S-2514 3+4-ttt Sink drain USA NC

FRC S-2433 3+4-uuu Sink drain USA FL

FRC S-0437 3+4-vv Cornea USA FL

FRC S-2397 3+4-vvv Sink drain USA FL

FRC S-0865 3+4-xxx Soil Thailand

FRC S-1327 5-c Human cancer USA TX

FRC S-2188 5-e Human toenails New Zealand

FRC S-2191 5-g Human eye India

FRC S-0370 5-i Soil Australia

FRC S-0431 5-k Cornea USA FL

FRC S-1142 5-l Human USA TX

FRC S-1198 5-m Cornea USA NE

FRC S-2361 5-v Soil Slovenia

FRC S-2513 5-aa Sink drain USA NC

FRC S-2445 5-cc Sink drain USA FL

1. MLST information is based on previously published studies (19, 20, 33).

Phylogenetic analysis

An alignment with all of the currently known 55 unique STs of FSSC 2 was 102 constructed using existing MLST data from the loci TEF, rDNA and RPB2 (the

STs 2-ww through 2-ccc are new to this study). To resolve the phylogenetic identity of NRRL 22268 (Fusarium solani var. petroliphilum), sequence data for this isolate and other representatives of FSSC species were included in the alignment. A maximum parsimony tree was generated, using the parsimony ratchet, (17) using PAUPRat (25) implemented in PAUP*v.4.0.b9 (29) with the following settings: set seed=0, nreps=200, pct=15, set wtmode=uniform, set terse, with simple sequence addition and heuristic searches. Bootstrap analysis was performed with 1000 replicates.

Growth rates

Single conidia from cultures grown on Carnation Leaf Agar (CLA) plates (5) were transferred to the centers of 8.5 cm Potato Dextrose Agar (PDA) plates and measured for growth. Two replicate PDA plates were inoculated for each isolate and placed into separate growth chambers at 25° C and 30° C. After 72 h, the diameters of colonies were measured using a ruler, and the average growth rate per species was calculated and expressed diametric growth per 24 hours.

Morphological analysis

Morphological traits were assessed from CLA plates grown at 22° C under alternating 12 hour cycles of light/dark using both fluorescent and UV light from

120 Volt bulbs. Wet mounts were prepared using conidia collected from sporodochia, generally growing on carnation leaf pieces if present, and from the 103 agar surface mycelium. Images for measurements of conidia were taken using a

DS-FI1 Camera head and DS-L2 camera controller mounted to a Nikon Eclipse

80i upright microscope (Nikon Instruments Inc., Melville, NY, USA). Still images were taken at 20x, 40x, and 60x magnification and conidia were measured in microns in the DS-L2 software.

For sporodochial conidia (macroconidia), length and width were recorded for 27-31 spores from at least 7 sporodochial forming cultures of each species.

For every sporodochium-forming isolate measured, mean macroconidial length and width were calculated. Species means were calculated based on individual isolate means. For each species, standard error of sporodochial conidia length and width was calculated using the individual isolate means.

Aerial conidial (microconidium) length and width measured for the largest and smallest conidia observed in multiple wet mounts of 8-10 cultures of each species.

Pigments

Images of cultures grown on PDA plates used in the growth rate assay were taken after 12-14 days of growth to illustrate variation in pigment production. All colors used for describing top and reverse colony color come from Rayner (23).

Mating types and sexual stage discovery 104 Primers were designed to amplify both mating types in F. fistularum from existing

FSSC sequences of these regions. To develop F. fistularum specific primers,

PCR was performed with the degenerate primers M1F-1,

GCCCTCTKAAYGCCTTYATGG, M1R-2, GGMSGGWTCAAYCATGYKCAT,

M2F-1, GGGAATCTRARAAAGRTACGTAC, and M2R-4

CGAGGKCGGTACTGGTAGTCGGG (32) on seven FSSC isolates (FRC S-

0564, FRC S-0631, FRC S-0745, FRC S-1340, FRC S-1344, FRC S-1554, and

FRC S-1751). PCR reactions were performed using 0.8 mM dNTPs, 0.6 µM each of the four primers, 1.25 U Taq polymerase, 5 ng of template DNA in 50 µl volumes, using the following parameters: an initial 5 min at 93 C, 35 cycles of 45 sec at 93 C, 1 min at 57 C and 1 min 30 sec at 72 C, and a final 10 min at 72 C.

PCR products were purified using QIAquick PCR purification kit (Qiagen,

Valencia, CA, USA) following the manufacturer‟s protocol. The purified amplicons were cloned with the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer‟s protocol. Eight colonies were analyzed for each cloning reaction. Plasmid DNA were extracted, amplified and sequenced for the selected colonies, using primers T3 and T7. The MAT gene sequences obtained were aligned manually and primers were then designed based on the conservative regions.

Mating types of F. fistularum isolates were determined using a multiplex

PCR with the primers MAT-1-1 FW (ATGGCTTTCCGCAGTAAGGA), MAT-1-1

RV (CATGATAGGGCAGCAAAGAG), MAT-1-2 FW

(GGGAATCTGAGAAAGATACGTAC) and MAT-1-2 RV 105 (CGGTACTGGTAGTCGGGAT) in 50 microliter reactions using GoTaq Kits

(Promega, San Luis Obispo CA, USA). Gel electorphoresis was performed on multiplex PCR products using a 1.5% agarose gel. After staining with ethidium bromide, gels were visualized and scored using a transilluminator. Isolates were scored as MAT-1-1 if they were positive for a ~200 bp band and as MAT-1-2 if they were positive for a ~800 bp band.

For mating, isolates of opposite mating types were grown separately on

CLA and then paired on V-8 agar (14). ~0.5 cm cubes of mycelium were placed

~5 cm apart on 8.5 cm plates containing V-8 agar, wrapped in Parafilm and grown at ~22C under 12 hour cycles of direct flourescent and UV light from 120

Volt bulbs. After several weeks, any perithecium-like structures were examined for the presence of developing asci and ascospores. To prove sexual recombination, 21 ascospores from a cross (FRC S-2477 and FRC S-2391) were independently isolated from a single cirrhus. The cirrhus was transferred to 8 mL sterile water, shaken and poured onto a 8.5 cm water agar plate which was elevated at one end and left 24 hours. Single germinated ascospores were verified by light microscopy and independently transferred to separate CLA plates. These cultures were then subjected to genomic DNA isolation followed by mating type PCR and PCR and sequencing of TEF as previously described

(9). The resulting combinations of MAT type and TEF alleles were tabulated. A two-tailed Fisher's exact test and a two-tailed Chi squared test were performed on the data to determine whether the two loci were co-segregating and thus potentially the result of selfing. 106

Secondary Metabolite Profiles:

Chemotyping was performed as previously described (30). Briefly, culture extracts were obtained (26) and were analyzed by high-performance liquid chromatography with diode array detection (HPLC-DAD). Chromatographic peaks monitored at 225 nm were characterized by their retention time index (RI) and their UV spectrum (200–600 nm) (7) and compared to metabolite standards analyzed under similar conditions.

Results

Phylogenetic analysis

The phylogenetic analysis of representatives of thirty-eight FSSC spp. based on three loci illustrates the strongly supported monophyly of FSSC 2, which received a 100% bootstrap value. (Figure 1). The ex-Type culture of F. solani var. petroliphilum, NRRL 22268 = NF4475, 3-locus sequence type was identical to that of FSSC 1-b, and formed part of a 95% bootstrap-supported clade with

FSSC 1 (Figure 1). 107

108 Figure 1. Phylogram of one of the most parsimonious trees of representiatives of the FSSC based on TEF, rDNA, and RPB2, rooted using F. staphylea (NRRL

22316) as an outgroup. Bootstrap values (1000 replicates) are indicated below branches, with the nodes corresponding to F. fistularum and F. petroliphilum indicated by lines. The ex-type of F. solani var. petroliphilum, NRRL 22268 =

NF4475, is indicated with an asterisk.

Comparison of cultural and morphological features

Species means of colony diameter of single-spored cultures after 72 hours at 25° and 30° C are shown in Table 2; The measurements of colony diameters for cultures of F. fistularum and F. petroliphilum are shown in Table 3.

Table 2. Growth rates and conidia sizes.

Growth 25° Growth 30° Sporo. Con. Aerial

C1 C Averages2 Conidia FSSC sp. Mean / No. Mean / No. W W L (µm) L(µm) cultures cultures (µm) (µm)

FSSC 1 (F. 48.08 ± 5.49 ± 4.58- 2.6- 0.69 mm / 10 0.72 mm / 10 petroliphilum) 4.06 0.38 24.87 7.09

FSSC 2 (F. 40.06 ± 5.50 ± 3.05- 2.90- 0.75 mm / 8 0.876 mm / 8 fistularum) 3.26 0.23 35.76 6.62

FSSC 3+4 (F. 0.79 mm / 7 1.0 mm / 8 44.34 ± 6 ± 4.76- 3.1- 109 falciforme) 2.55 0.07 41.83 9.37

45.65 ± 5.73 ± 6.69- 2.71- FSSC 5 0.75 mm / 10 0.95 mm / 10 2.10 0.04 47.97 7.64

1. Growth rate is expressed as colony diameter growth per 24 hours . 2. Species averages of sporodochial conidia.

Table 3. Measurements of cultures belonging to F. fistularum (FSSC 2) and F. petroliphilum (FSSC 1).

Sporodochial Conidia Aerial conidia FSS Growth1 NRRL/ (μm) (μm) C FRC. No 25° 30° St. sp. L W St. E. L W C C E.

FSS 0.7 0.7 54. 5.9 5.9 5.43- 3.05- S-2244 0.61 C 1 6 8 77 2 4 16.85 6.95

FSS 0.7 52. 5.0 6.5 5.26- S-1437 0.7 0.69 2.26-7 C 1 1 56 2 7 16.36

FSS 0.7 0.7 51. 6.5 5.4 5.01- 3.011- S-1380 0.69 C 1 6 8 04 2 7 17.28 7.09

FSS 0.7 57. 5.5 4.76- 2.38- S-2532 0.7 5.4 0.63 C 1 3 16 8 13.5 5.43

FSS S-2469 0.7 0.8 56. 5.3 6.7 0.79 4.73- 2.63- 110 C 1 2 1 09 2 6 17.97 5.33

FSS 0.6 44. 5.9 5.4 6.1- 3.38- S-2481 0.7 0.59 C 1 6 81 8 8 21.27 4.04

FSS 0.6 46. 12. 4.7 5.14- 3.01- S-2522 0.7 0.57 C 1 8 45 29 7 21.55 7.14

FSS 0.6 0.6 21. 2.9 3.3 4.17- 3.43- S-2536 0.47 C 1 6 5 78 2 3 24.87 6.62

FSS 0.6 0.6 4.58- 2.71- S-2462 no sporodochia C 1 2 8 15.27 5.435

FSS 0.6 0.7 4.86- 2.45- S-0218 no sporodochia C 1 6 6 15.54 5.61

FSS 11.82- 3.8- 22661 0.7 0.9 no sporodochia C 2 23.89 4.36

FSS 0.7 0.9 52. 4.4 6.1 0.704 22641 4.3-34 1.9-6.5 C 2 5 5 18 56 37 12

FSS 0.9 43. 3.0 5.1 0.467 11.55- 3.46- S-0534 0.8 C 2 3 23 09 25 5 34.06 6.4

FSS 0.8 33. 3.5 4.4 0.672 2.875- S-1512 1 5.2-40 C 2 6 87 01 7 77 6.48

FSS 0.6 0.7 4.98- 2.56- S-2149 no sporodochia C 2 6 1 35.76 5.56

FSS S-2369 0.7 0.8 no sporodochia 6.74- 3.34- 111 C 2 1 6 29.44 5.4

FSS 0.7 0.8 48. 2.5 5.2 12.27- 3.34- S-2477 0.39 C 2 6 8 57 7 8 27.9 6.1

FSS 0.7 0.7 41. 3.4 6.0 12.8- 3.2- S-2391 0.54 C 2 6 6 15 6 5 33.14 6.62

FSS n. n. 29. 4.8 6.0 5.75- 2.5- S-2108 0.71 C 2 m. m. 21 3 7 13.52 3.38

FSS n. n. 32. 7.0 5.3 3.05- 3.05- 43444 0.74 C 2 m. m. 2 6 9 18.54 4.6

1. Growth is expressed as diametric growth per 25 hours.

Sporodochial conidia and aerial conidia of F. fistularum and F. petroliphilum were variable intraspecifically, and interspecifically in conidiation on CLA (Figures 2-5) and pigmentation on PDA (Figures 6, 7). 112

Figure 2. Sporodochial conidia (macroconidia) of five isolates of F. fistularum.

Scale bar = 10 microns. a) FRC S-2477 b) NRRL 22641 c) FRC S-1512 d) FRC

S-2108

113

Figure 3. Aerial conidia, monophialides, and chalmydospore of five isolates of F. fistularum. Scale bar = 10 microns. a) FRC S-2391 b) FRC S-2149 c) FRC S-

1512 d) FRC S-2108 e) FRC S-0534 f) FRC S-0534

Figure 4. Sporodochial conidia of three isolates of F. petroliphilum. Scale bar =

10 microns. a) FRC S-2536 b) FRC S-2522 c) FRC S-2532.

114

Figure 5. Aerial conidia of two isolates of F. petroliphilum. Scale bar = 10 microns. a) FRC S-2532 b) FRC S-2522.

115 Figure 6. Colony pigmentation of eight isolates of F. fistularum grown on PDA. 1) top view 2) reverese view. A) FRC S-2391 B) NRRL 22641 C) FRC S-0534 D)

FRC s-2477 E) FRC S-1512 F) FRC s-2369 G) NRRL 22661 H) FRC S-2149.

Figure 7. Colony pigmentation of eight isolates of F. petroliphilum grown on PDA.

1) top view 2) reverse view. A) A) FRC S-0218 B) FRC S-1437 C) FRC S-1380

D) FRC S-2462 E) FRC S-2244 F) FRC S-2536 G) FRC S-2532 H) FRC S-

2469. 116 Recombinant progeny derived from mating cross

Only two crosses of two different pairs of isolates, (FRC S-1500 (male) paired with FRC S-2228 (female) and FRC S-2477 (female) paired with FRC S-2391

(male)), out of 60 attempted crosses yielded perithecia that contained ascospores (Figures 8, 9).

Figure 8. Red to scarlet perithecia, single or often in groups of several, formed from the cross of FRC S-2477 and FRC S-2391. Mature perithecia have prominent cirrhi.

117

Figure 9. Asci and ascospores of the cross of FRC S-2477 and FRC S-2391.

Scale bar = 10 microns. Examples of asci with 4 and 8 ascospores are shown.

In most crosses, asci were observed with four or six ascospores, sometimes with no asci containing eight. The type specimen presented here (FRC S-2477) appears to be the sole "good female" isolate (14), in that it consistently produces protoperithecia on V-8 agar. The cross (FRC S-2477 and FRC S-2391) that consistently produced asci with eight ascospores was analyzed for independent assortment of genetic markers. The 21 progeny derived from single ascospores had MAT idiomorphs in the ratio of 10:11; all progeny had a TEF allele (~700 bp) that exactly matched one of the two parent isolates in a ratio of 10:11. The progeny contained all four possible combinations of parental TEF and MAT alleles in the ratio 7:7:4:3 (results not shown). A two-tailed Fisher's exact test 118 performed on these allele associations indicated no evidence of association between TEF and MAT in the 21 progeny, inconsistent with homothallic derivation of the progeny.

Secondary metabolite profiles

Preliminary chemotyping indicated that isolates of F. fistularum vary in their secondary metabolite profiles, with fusarubin being the most consistently observed metabolite (Table 4).

Table 4. Secondary metabolites of Fusarium cultures.

Secondary Metabolites1 FRC/NRRL FSSC

No. MLST A F S J G UNID

S-2321 1-c X X X

S-1360 2-d X X X X

S-2228 2-n X X

43373 2-b

S-2226 2-s X

43433 2-a X

119 43490 2-g X

S-1512 2-q X X X X X

S-2227 2-s X

32959 2-ww X

S-1370 2-d X

S-0534 2-p X X X

S-1427 2-r X

S-0617 2-f X X

1. A=Anhydrofusarubin. F= Fusarubin. S=Solaniol. J=Javanicin. GA=

Gibepyrone A. UNID=More unidentified naphthoquinone pigments.

Gibepyrone A was observed in the one representative of F. petroliphilum, and none of the F. fistularum isolates.

Discussion

Circumscription of F. fistularum sp. nov. for FSSC 2, and elevation of F. solani var. petroliphilum to species status

Previous studies have consistently revealed a monophyletic group within FSSC that is very commonly associated with human infections as well as frequent 120 isolation from plumbing surfaces, provisionally labeled FSSC 2 (19, 33). Our analysis of all 231 known sequence types of FSSC 2, including two strains that possess distinct rDNA types that are 100% identical to those found in FSSC 9, yielded a strongly supported monophyletic group (Figure 1). Because of the identity of these unusual rDNA alleles to those in all known members of FSSC 9, we hypothesize that these isolates have experienced hybridization with FSSC 9 at some point in their pedigree. In addition to TEF and RPB2, where these isolates possess alleles with a clear connection to FSSC 2, they possess FSSC

2-typical alleles at six additional loci suggesting that they are heavily backcrossed into FSSC 2 (data not shown). Because of its monophyly and high degree of genealogical exclusivity, in addition to its importance as a human pathogen and cosmopolitan biogeography, we formally describe this species as

F. fistularum sp. nov.

Because of the strong support for the inclusion of the ex-Type of F. solani var. petroliphilum within FSSC 1, and its exact match to the previously known, very common ST FSSC 1-b (3, 19, 33), we further recognize that FSSC 1 represents this previously described taxon (28). Because of the genealogical exclusivity of FSSC 1/F. solani var. petroliphilum and its known association with the reproductively isolated group F. solani f.sp. cucurbitae Race 2 = Mating

Population V of F. solani (15), we argue that this variety should be elevated to species status and heretofore be recognized as F. petroliphilum.

121 Variable asexual growth and reproduction in F. fistularum and F. petroliphilum

The observed isolates of F. fistularum were highly variable. While some isolates produced macroconidia with shapes and dimensions typical for the classic morphological concept of ‘F. solani’ (Figures 2a, 2b), others produced much smaller spores from sporodochial conidiophores (Figures 2c, 2d), and some none at all. In addition to these characteristics, a number of aberrant morphological variants were observed in isolates of F. fistularum, including characteristics that are often considered culture degeneration, including frequently vacuolated or empty macroconidial compartments and obviously constricted septal boundaries in macroconidia. Isolates of F. fistularum also display vary different pigmentation on PDA, including the production of red pigments, possibly as indicated by the detection of fusarubins in the chemotypic analyses (Table 4). The degree of morphological divergence in clinically derived FSSC species is well-documented and problematic. FSSC isolates not producing macroconidia in sporodochia

(Table 3), but instead producing septate or aseptate conidia from long mycelial conidiophores typical of FSSC, have been described in the genera

Cylindrocarpon and Acremonium (28). The degree of morphological variation observed in isolates of F. fistularum and other clinicially relevant species could be the result of mutation and/or other forms of degeneration that tend to survive in isolates that have grown in humans or in biofilms, or in post-isolation treatment. While this variation might be considered aberrant, and perhaps be rescuable via single-spore transfer or other forms purification, it appears to be 122 the rule rather than the exception. Since these are forms that are likely to be encountered by clinical microbiologists and others who encounter these fungi, it would be a disservice to present an idealized form.

In general, the F. petroliphilum cultures observed tended to have longer and more slender sporodochial conidia than F. fistularum and had, on average, the longest macroconidia of the four common species compared (Table 2, 3).

Yet F. petroliphilum also displayed high variability, such as the diminutive sporodochial conidia observed in FRC S-2536 (Table 3, Figure 4a). The range in sporodochial conidia sizes observed in both of these species is reflected in the standard errors of these measurements (Table 2) compared to those of F. falciforme and FSSC 5. Consistent with published reports of temperature- dependent differences in the shapes of this species' microconidia (16), microconidia in F. petroliphilum tended to be slightly rounder than those of F. fistularum (Figure 4b). Chlamydospore production was seen in both of these species, formed intercalary within hyphae and macroconidia, in pairs and sometimes in larger groups, without any significant morphological difference

(data not shown).

Both F. fistularum and F. petroliphilum have been occasionally isolated from oily substrates, and are known to be the two most common plumbing biofilm-associated Fusarium spp (1, 33). We have encountered only a single F. fistularum isolate from a plant (FRC S-0752), from a severe outbreak of cyclamen wilt in Australia in 1982 (L. Burgess, pers. comm.). This culture, identified morphologically as ‘F. solani,‟ was isolated along with F. oxysporum, a 123 known cause of cyclamen wilt, and we speculate that it was not the cause of the disease. In contrast F. petroliphilum is a common weak plant pathogen of cucurbits, known historically as Fusarium solani f. sp. cucurbitae race 2 (18, 31).

Isolates of F. petroliphilum from human infections have been experimentally demonstrated to be plant pathogenic (14). F. falciforme has a strong association with soil (33) and is a common cause of mycotic keratitis in the tropics (10) but does not appear to be nearly as abundant in biofilms as F. petroliphilum or F. fistularum (33). We find that all four species are capable of growing at 37° C by connecting isolates previously reported to grow at body temperature (27) to their current MLST schemes (20) and the fact that they have been isolated from human infections. The fact that identical MLSTs within species can vary in morphological and culture characteristics, such as the non-sporodochium forming cultures of FSSC 2-d (NRRL 22641 and FRC S-2149) and FSSC 1-b (FRC S-

0218) (Table 3) suggests that there may be more genetic diversity within the

STs, as defined by these 3 loci.

Sexual cycle of F. fistularum

Overall, we observed low fertility between pairs of isolates of opposite mating type within F. fistularum, with <4% of isolates tested readily forming protoperithecia using the methods described. The red, warty perithecia (Figure 7) and striate ascospores (not shown) were typical of known sexual stages of FSSC spp., which have been reported as morphologically identical among the Mating

Populations (15). The teleomorph resulting from a cross of the type specimen 124 (FRC S-2477 with FRC S-2391) contained asci with 4, 6, or 8 ascospores (Figure

6); similar results were observed in another successful cross of two unrelated isolates. Because TEF and mating-type were found to segregate randomly in 21 single-spored ascospores, we conclude that they were produced through heterothallic outcrossing. In addition, we recently discovered molecular evidence for interspecies genetic introgression has been between F. fistularum and FSSC

9, neither of which corresponds to any previously known mating population. Our discovery of an apparently functional sexual cycle in F. fistularum was supported by analyses of a 9-locus dataset for the presence of recombination in addition to evidence for high levels of clonality (see Chapter 4). Following the 2011

Amsterdam Declaration and the previous description and epitypification of the sexual stage for F. tucumaniae, (4) we did not formally describe the sexual stage under a teleomorph genus, for the following reasons. First, we do not wish to add more names and confusion to the literature by using two names for one fungus.

Second, there is no satisfactory teleomorph genus in which to place this species.

The most commonly applied teleomorph genus name to F. solani is Nectria, which is incorrectly applied, while the name Haematonectria proposed to remedy that problem represents a paraphyletic assemblage with respect to

Neocosmospora (18, 24). Neocosmospora is also problematic because it is morphologically distinct from the sexual stage associated with the remainder of the FSSC, producing a smooth-walled perithecium, and usually single-celled ascospores. Finally, the sexual stage is unlikely to be encountered, whereas the

Fusarium asexual stage is, and this characteristic unites this fungus with other 125 Fusarium human pathogens.

Chemotypes

Filamentous fungi have large numbers of genes coding for secondary metabolites (6). Fusarium is well-known for its secondary metabolite and mycotoxin production, and several isolates of F. fistularum are known cyclosporine producers (27). In Fusarium studies of the secondary metabolite profiles have revealed interspecific differences in secondary metbolite profiles

(12) and intraspecific variation in types and amounts of chemicals produced (13).

Chemotypes may be more reliable than morphological characters and be useful for taxonomy (8).

Our preliminary observations reveal that F. fistularum exhibits variation in secondary metabolite production (Table 4). Within F. fistularum, Fusarubin was observed in all but one isolate and not observed in the one representative of F. petroliphilum; similarly Gibepyrone A was only observed in F. petroliphilum.

These observations are consistent with interspecific variability in pigment production on PDA (Figure 6, 7) and justify more detailed chemotype analyses of these and other common FSSC species.

Taxonomy

Based on its multilocus phylogenetic equivalence (NRRL 22268 in Figure 1) and matching morphology, we elevate FSSC 1 (a.k.a. Fusarium solani var. petroliphilum, Fusarium solani f. sp. curubitae race 2, and Fusarium solani 126 Mating Population V) to species status with the name Fusarium petroliphilum.

We elevate FSSC 2 to species status with the name Fusarium fistularum with the following description.

Fusarium fistularum D. Geiser, O‟Donnell, Short et Zhang, sp. nov.

Coloniae in PDA 72 hora obscuritate apud 25° C 2.00-2.60 cm diametro, apud

30° C 2.15-3.00 diametro. Coloniae albae, salmoneae, persicinae, vinoso- griseae, vel olivaceo-bubalinae. Coloniae reversae olivaceo-griseae, incarnateae, salmoneae, olivaceo-bubalinae, vel luteolae. Mycelium aerium parcum vel floccosum; crebro in coloniis pionnotium simile. Sporodochia in LA praesentia vel absentia, crocea vel salmonea. Conidia sporodochialia plerumque

3-5 septata, raro 1-2 septata, plerumque cylindrica vel modice curvata, nonnumquam falcata, circumscriptione interna et externa quasi parallelis, sursum modice expandentia, cellula apicali acuta, basilari pediformi; nonnumquam fusiformia, circumscriptione interna et externa quasi parallelis, 13.2-60.1 µm x

2.8-8.2 µm. Conidophora aeria copiosa in CLA simplicia vel ramosa; monophialides plerumque ~ 40 µm. Conidia aeria hyalina, fusiformia, ovalia, pyriformia, napiformia, vel ellipsoidea, 0-3 septata, 3.1-35.7 µm x 1.9-6.62 µm.

Chlamydosporae in hyphis et in conidiis frequentes, plerumque subglobosae, intercalares vel terminales, singulae, frequenter binae, hyalinae vel pallide pigmentiferae, laeves vel asperatae, 6.0-8.0 µm. Sclerotia absentia.

127 Colonies on PDA grown in the dark showing growth in diameter of 2.00-2.60 cm after 72 hours at 25° C and 2.15-3.00 at 30° C. Colony color on PDA in shades of white, salmon, peach, vinaceous grey and pale olivaceous grey; reverse pigmentation in shades of pale olivaceous grey, flesh, salmon, olivaceous buff, ochreous and pale luteous. Colony margin entire to undulate. Aerial mycelium ranging from sparse to dense floccose. Cultures often pionnotal. Sporodochia may be present or absent on CLA, saffron to salmon. Sporodochial conidia generally 3-5 septate, rarely 1-2 septate, usually cylindrical and gently curved, sometimes falcate, with dorsal and ventral lines nearly parallel or gradually wider basally, with an acuate apical cell and a distinct basal foot cell; other sporodochial conidia may be spindle-shaped with dorsal and ventral lines nearly parallel, and no distinctly foot-shaped basal cell. On CLA sporodochial conidia

13.2-60.1 µm x 2.8-8.2 µm. Aerial conidiophores formed abundantly on CLA, branched or unbranched; monophialides generally ~ 40 µm. Aerial conidia hyaline, oval, fusiform, pyriform, napiform or cylindrical, 0-3 septate, 3.1-35.7 µm in length and 1.9-6.62 µm in width. No obvious odor. Chlamydospores formed frequently, after several weeks, in hyphae and in conidia, mostly subglobose, often intercalary, single, frequently in pairs, hyaline, pale to yellowish grey, smooth to rough-walled, 6.0-8.0 µm. Sclerotia absent.

Holotype specimen: FRC S-2477. UNITED STATES. VIRGINIA: Winchester, isolated from indoor plumbing, June 2009, lyophilized culture. D. Short

128 Etymology: fistularum; based on the Latin word for “pipe,” fistula, due to the widespread occurrence of this species in pipes of man-made water systems.

Distribution: Worldwide. Known to be present in North America, South America,

Asia, Africa, and Europe.

Epitype: (Resulting from a fertile sexual cross of FRC S-2477 and FRC S-2391 grown together on V-8 agar). Perithecia globosae, superficialia vel intra agaro, singulae, frequentes gregariae, rubrae, sigilatae, 300-400 µm diametro. Asci fusiformae, 75-100 µm, octospori vel tetraspori vel sexaspori. Ascosporae exudatae in cirrhus, hyalinae, striatae, ovaloidaea, pyriformae, ellipsoidae, vel obovoidae, 0-1 septatae, plerumque 1 septatae et ad septum leviter constrictae,

11.59-18.10 µm x 6.58-8.235 µm.

Perithecia round, superficial or embedded in agar, solitary to aggregated in groups of a few to many, often seated on a minute stromatic base, warty, 300-

400 µm in diameter; scarlet to red. Asci fusiform, regularly dehiscing upon examination under the microscope, 75-100 µm with 4, 6 or 8 ascospores.

Ascospores striate, exuded in a cirrhus, oval to pyriform to elispoidal to obovoid, often with both ends rounded, usually 1-septate and slightly constricted at the septum, 11.59 -18.10 µm x 6.58- 8.235 µm.

Additional cultures examined: GERMANY. Isolated from fish, FRC S-2108, MAT- 129 1-1. UNITED STATES, New Jersey. Isolated from human eye, FRC S-2254,

MAT-1-1. JAPAN. Isoalted from human eye, NRRL 22661, MAT-1-2. NIGERIA.

Isolated from human eye. NRRL 22641, MAT-1-2. UNITED STATES, Kentucky.

Isolated from machine oil, FRC S-2149, MAT-1-1. UNITED STATES, Wisconsin.

Isolated from human skin. FRC S-1512, MAT-1-2. UNITED STATES, California.

Isolated from brown shrimp, FRC S-0534. MAT-1. UNITED STATES, Florida,

Orlando. Isolated from restaurant sink drain, FRC S-2369, MAT-1-1. UNITED

STATES, Florida, Tampa. Isolated from University sink drain, FRC S-2391,

MAT-1-1.

Note: The sexual stage of F. fistularum matches well with the described sexual stage Haematonectria (24)and is typical of sexual stages in the FSSC, with the exception of taxa in the Neocosmospora clade nested within it (18).

130 References

1. Anaissie, E. J., R. T. Kuchar, J. H. Rex, A. Francesconi, M. Kasai, F. M. C.

Muller, L. C. Mario, R. C. Summerbell, M. C. Dignani, and S. J. Chanock.

2001. Fusariosis associated with pathogenic Fusarium species colonization of a hospital water system: a new paradigm for the epidemiology of opportunistic mold infections. Clinical Infectious Diseases 33:1871-1878.

2. Balajee, S. A., A. M. Borman, M. E. Brandt, J. Cano, M. Cuenca-Estrella, E.

Dannaoui, J. Guarro, G. Haase, C. C. Kibbler, and W. Meyer. 2009.

Sequence-Based Identification of Aspergillus, Fusarium, and Mucorales Species in the Clinical Mycology Laboratory: Where Are We and Where Should We Go from Here? Journal of Clinical Microbiology 47:877-884.

3. Chang, D. C., G. B. Grant, K. O'Donnell, K. A. Wannemuehler, J. Noble-

Wang, C. Y. Rao, L. M. Jacobson, C. S. Crowell, R. S. Sneed, F. M. T. Lewis,

J. K. Schaffzin, M. A. Kainer, C. A. Genese, E. C. Alfonso, D. B. Jones, A.

Srinivasan, S. K. Fridkin, and B. J. Park. 2006. Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. Journal of the American

Medical Association 296:953-963.

4. Covert, S. F., T. Aoki, K. O'Donnell, D. Starkey, A. Holliday, D. M. Geiser,

F. Cheung, C. Town, A. Strom, J. Juba, M. Scandiani, and X. B. Yang. 2007.

Sexual reproduction in the soybean sudden death syndrome pathogen Fusarium tucumaniae. Fungal Genetics and Biology 44:799-807. 131 5. Fisher, N. L., L. W. Burgess, T. A. Toussoun, and P. E. Nelson. 1982.

Carnation Leaves as a Substrate and for Preserving Cultures of Fusarium

Species. Phytopathology 72:151-153.

6. Frisvad, J. C., B. Andersen, and U. Thrane. 2008. The use of secondary metabolite profiling in chemotaxonomy of filamentous fungi. Mycological research

112:231-240.

7. Frisvad, J. C., and U. Thrane. 1987. Standardized high-performance liquid chromatography of 182 mycotoxins and other fungal metabolites based on alkylphenone retention indices and UV--VIS spectra (diodearray detection).

Journal of Chromatography A 404:195-214.

8. Frisvad, J. C., U. Thrane, and O. Filtenborg. 1998. Role and use of secondary metabolites in fungal taxonomy. In: Frisvad, J.C., Bridge, P.D., Arora,

D.K., (eds.) Chemical FungalTaxonomy: 289-319.

9. Geiser, D. M., M. D. Jimenez-Gasco, S. C. Kang, I. Makalowska, N.

Veeraraghavan, T. J. Ward, N. Zhang, G. A. Kuldau, and K. O'Donnell. 2004.

FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium.

European Journal of Plant Pathology 110:473-479.

10. Gopinathan, U., P. Garg, M. Fernandes, S. Sharma, S. Athmanathan, and

G. N. Rao. 2002. The epidemiological features and laboratory results of fungal keratitis: a 10-year review at a referral eye care center in South India. Cornea

21:555-559.

11. Gostincar, C., M. Grube, and N. Gunde-Cimerman. Evolution of fungal pathogens in domestic environments? Fungal Biology. In Press. 132 12. Hestbjerg, H., K. F. Nielsen, U. Thrane, and S. Elmholt. 2002. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and

Fusarium equiseti on common laboratory media and a soil organic matter agar: an ecological interpretation. Journal of Agricultural and Food Chemistry 50:7593-

7599.

13. Kosiak, E. B., A. Holst-Jensen, T. Rundberget, M. T. Gonzalez Jaen, and

M. Torp. 2005. Morphological, chemical and molecular differentiation of

Fusarium equiseti isolated from Norwegian cereals. International journal of food microbiology 99:195-206.

14. Leslie, J. F., B. A. Summerell, S. Bullock, and C. Ebooks. 2006. The

Fusarium Laboratory Manual. Ames, Iowa: Blackwell Publishing. 388 p.

15. Matuo, T., and W. C. Snyder. 1973. Use of morphology and mating populations in the identification of formae speciales in Fusarium solani.

Phytopathology 63:562-565.

16. Mehl, H. L., and L. Epstein. 2007. Fusarium solani species complex isolates conspecific with Fusarium solani f. sp. cucurbitae race 2 from naturally infected human and plant tissue and environmental sources are equally virulent on plants, grow at 37 C and are interfertile. Environmental Microbiology 9:2189-2199.

17. Nixon, K. C. 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15:407-414.

18. O'Donnell, K. 2000. Molecular phylogeny of the Nectria haematococca-

Fusarium solani species complex. Mycologia 92:919-938. 133 19. O'Donnell, K., B. A. J. Sarver, M. Brandt, D. C. Chang, J. Noble-Wang, B.

J. Park, D. A. Sutton, L. Benjamin, M. Lindsley, A. Padhye, D. M. Geiser, and

T. J. Ward. 2007. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic fusaria, including isolates from the multistate contact lens - Associated US Keratitis outbreaks of 2005 and 2006. Journal of

Clinical Microbiology 45:2235-2248.

20. O'Donnell, K., D. A. Sutton, A. Fothergill, D. McCarthy, M. G. Rinaldi, M.

E. Brandt, N. Zhang, and D. M. Geiser. 2008. Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the

Fusarium solani species complex. Journal of Clinical Microbiology 46:2477-2490.

21. O'Donnell, K., D. A. Sutton, M. G. Rinaldi, C. Gueidan, P. W. Crous, and

D. M. Geiser. 2009. Novel Multilocus Sequence Typing Scheme Reveals High

Genetic Diversity of Human Pathogenic Members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum Species Complexes within the United States.

Journal of Clinical Microbiology 47:3851-3861.

22. O'Donnell, K., D. A. Sutton, M. G. Rinaldi, B. A. J. Sarver, S. A. Balajee,

H. J. Schroers, R. C. Summerbell, V. A. R. G. Robert, P. W. Crous, and N.

Zhang. 2010. Internet-Accessible DNA Sequence Database for Identifying

Fusaria from Human and Animal Infections. Journal of Clinical Microbiology

48:3708.

23. Rayner, R. W. 1970. A mycological colour chart. Kew, Surrey, England: CMI and British Mycological Society. 34 p. 134 24. Rossman, A. Y., G. J. Samuels, C. T. Rogerson, and R. Lowen. 1999.

Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales,

Ascomycetes). Studies in Mycology 42:1-248.

25. Sikes D. S., Lewis P. O. PAUPRat: PAUP implementation of the parsimony ratchet. Beta software, version 1. Distributed by the authors. Storrs: Department of Ecology and Evolutionary Biology, University of Connecticut; 2001.

26. Smedsgaard, J. 1997. Micro-scale extraction procedure for standardized screening of fungal metabolite production in cultures. Journal of Chromatography

A 760:264-270.

27. Sugiura, Y., J. R. Barr, D. B. Barr, J. W. Brock, C. M. Elie, Y. Ueno, D. G.

Patterson Jr, M. E. Potter, and E. Reiss. 1999. Physiological characteristics and mycotoxins of human clinical isolates of Fusarium species. Mycological

Research 103:1462-1468.

28. Summerbell, R. C., and H. J. Schroers. 2002. Analysis of phylogenetic relationship of Cylindrocarpon lichenicola and Acremonium falciforme to the

Fusarium solani species complex and a review of similarities in the spectrum of opportunistic infections caused by these fungi. Journal of Clinical Microbiology

40:2866-2875.

29. Swofford, D. L. 2002. PAUP*(Phylogenetic Analysis Using Parsimony and

Other Methods), Version 4.10 b. Sinauer, Sunderland, Massachusetts, USA.

30. Thrane, U., A. Adler, P. E. Clasen, F. Galvano, W. Langseth, H. Lew, A.

Logrieco, K. F. Nielsen, and A. Ritieni. 2004. Diversity in metabolite production 135 by Fusarium langsethiae, Fusarium poae, and Fusarium sporotrichioides.

International journal of food microbiology 95:257-266.

31. Toussoun, T. A., and W. C. Snyder. 1961. The pathogenicity, distribution, and control of two races of Fusarium (Hypomyces) solani f. cucurbitae.

Phytopathology 51:17-22.

32. Wallace, M. M., and S. F. Covert. 2000. Molecular mating type assay for

Fusarium circinatum. Applied and Environmental Microbiology 66:5506-5508.

33. Zhang, N., K. O'Donnell, D. A. Sutton, F. A. Nalim, R. C. Summerbell, A.

A. Padhye, and D. M. Geiser. 2006. Members of the Fusarium solani species complex that cause infections in both humans and plants are common in the environment. Journal of Clinical Microbiology 44:2186-2190.

136 Chapter 4

Recombination, clonality and hybridization in the plumbing-borne human

pathogen Fusarium fistularum

Dylan P.G. Short1, Kerry O‟Donnell2, Ning Zhang3, Eric J. Pearlman4 and David

M. Geiser1

1 Department of Plant Pathology, Pennsylvania State University, University Park,

Pennsylvania, United States of America, 2 United States Department of

Agriculture, Agricultural Research Service, 1815 N. University St., Peoria, Illinois,

United States of America, 3 Department of Plant Biology and Pathology, Rutgers

University, 59 Dudley Road, New Brunswick, New Jersey 08901, United States of America. 4 Department of Ophthalmology, Case Western Reserve University,

10900 Euclid Avenue, Cleveland, Ohio, United States of America.

137 Abstract

Fusarium fistularum, known previously as Fusarium solani species complex phylogenetic species 2 (FSSC 2), is an emerging human pathogen and polyextremophile, and one of the most common fusaria associated with human infections. F. fistularum is one of a few Fusarium species common in plumbing biofilms and it shows high levels of resistance to a broad spectrum of antifungal drugs. To better understand the population dynamics of this species for purposes of epidemiology and control, we expanded an existing 3-locus MLST system by adding six novel sequence-based markers developed based on the complete genome sequence of Nectria haematococca Mating Population VI

(FSSC 11). 9-locus MLSTs were generated for 231 isolates from six continents and from a variety of sources, including plumbing and from human and animal infections. High levels of genetic diversity and evidence for both recombination and clonality were detected among 111 unique 9-locus STs. Inclusion of the mating type as a tenth marker revealed ten additional STs, indicating that true clones are not well resolved even with ten loci. The most common ST (2-d2), with 49 members, was found in plumbing, contact lenses and lens cases, as well as fusarial keratitis. No evidence for population differentiation between clinical isolates and isolates from environmental sources was found. Cryptic speciation with F. fistularum suggested in the previous three-locus MLST system was not supported with the addition of new loci, but evidence of introgression of ribosomal RNA genes from another strongly supported phylogenetic species also 138 known from plumbing and human infections (FSSC 9), was detected in two isolates of F. fistularum.

139 Introduction

Fusarium fistularum is a cosmopolitan fungus implicated in human mycoses, which include both localized subcutaneous infections and life-threatening disseminated mycoses in immune-compromised and immune-suppressed individuals, with more limited infections in the fully immunocompetent. Like other fusaria, F. fistularum is a predominant cause of mycotic keratitis, associated with both eye trauma and contact lens-associated biofilms (3, 11). This species is capable of forming biofilms on other man-made surfaces and infections are often introduced via catheters and intravenous apparti (68). Based on current analyses, members of this species are the most common fusaria associated with human infections of any kind, including the widespread clonal lineage Fusarium oxysporum Species Complex ST 33 (46, 51). Interestingly, they also appear to be the most common fusaria in sink-drain biofilms, strongly supporting the hypothesis that plumbing surfaces are an important environmental reservoir for

F. fistularum infections.

Although its monophyly is well supported (48, 49, 71), the morphology of

F. fistularum is highly variable and generally involves prolific production of asexual spores, particularly from simple mycelial conidiophores (microconidia), making morphological identification virtually impossible. F. fistularum‟s apparent adaptation to form biofilms in aquatic systems may provide protection against current antifungal drugs (16, 30), which are notoriously ineffective against members of the Fusarium solani species complex (FSSC) and other fusaria (44,

62). 140 A current 3-locus MLST system developed for the FSSC, utilizes 1) an intron-rich portion of the translation elongation factor 1-alpha gene (TEF) 2) a portion of the nuclear ribosomal RNA gene repeat that includes the internal transcribed spacer (ITS) regions, 5.8S rRNA, and D1-D2 region of the large ribosomal RNA subunit gene (rDNA) and 3) most of the gene encoding the RNA polymerase II second largest subunit (RPB2). This system resolves over 40 phylogenetic species and also serves to distinguish as many as 71 genetically distinct sequence types (STs) within species. In previous analyses of mostly clinical isolates using this three locus system, 55 unique STs were resolved within F. fistularum. In addition to supporting its monophyly, the combined three- locus phylogeny showed a moderately supported partition within FSSC 2, suggesting that further genetic subdivision may exist within this phylogenetic species (49).

Application of the three-locus MLST system revealed that 107/231 isolates from both clinical and environmental sources belonged to a single ST, FSSC 2-d.

This ST was the single most common Fusarium ST isolated from sink drains in a survey within the United States, and is also the most common Fusarium ST among characterized clinical isolates. Another ST of F. fistularum, FSSC 2-k, was the sixth most frequent ST found in our sample of isolates from both sink drains and clinical sources.

Successful sexual crosses of F. fistularum under laboratory conditions suggest that sexual reproduction could be an important force underlying the genetic diversity of this species. However, very few attempts to mate F. 141 fistularum isolates of opposite mating-type were successful, and successful crosses often yielded asci containing six or fewer ascospores, suggesting infertility elements in crosses. Other mechanisms which could generate diversity include the exchange of small mobile chromosomes, which are known to exist in

FSSC genomes (12), and have been transferred in vitro between unrelated strains of F. oxysporum (39). Hybridization and introgression between strongly supported phylogenetic species has been observed in other species of Fusarium

(36, 47).

Our goal in this study was to increase our resolution of populations and individuals within F. fistularum to facilitate epidemiological inference and the study of important phenotypes, as well as to enable the selection of unique isolates for complete genome sequencing. We expanded the 3-locus system with six novel sequence based markers developed using the complete genome sequence of a related species, FSSC 11 (‘Nectria’ haematococca Mating

Population VI; (12)), with PCR-inferred mating-type utilized as a tenth locus in discriminating STs. We applied these markers to environmental and clinical isolates from previous studies to infer the relative roles of recombination and clonality, population and possible species structure, and hybridization in F. fistularum.

Material and Methods

Isolates of F. fistularum 142 231 isolates of F. fistularum were used in this study, which consisted of mostly clinical and plumbing sources, but included isolates from infections of marine animals such as sharks, shrimp, and turtles, as well as isolates from a cockroach, a cyclamen plant, and soil. The source and geographic location of each isolate is listed in Table 1.

Table 1. Characteristics of isolates studied.

FRC/ Geographic 9-locus Mating NRRL Substrate Origin ST1 Type2 No./

s-0534 Brown Shrimp USA CA 2-p1 M1

s-0617 Soil New Caledonia 2-f1 M2

s-0669 Shrimp USA HI 2-o2 M2

s-0752 Cyclamen Australia 2-x2 M2

s-1223 Bonnethead Shark USA TX 2-d3 M2

s-1224 Bonnethead Shark USA FL 2-o3 M1

s-1268 Human thumb USA TX 2-v1 M2

s-1273 Human USA TX 2-d1 M1

s-1375 Human blood USA TX 2-d5 M1

s-2074 Water Denmark 2-f2 M1

s-2088 Pool Germany 2-d1 M1

s-2108 Fish Germany 2-d1 M1

s-2111 Human foot ulcer Qatar 2-d2 M1

s-2112 Human foot Qatar 2-vv2 M1

s-2149 Machine fluid USA KY 2-d2 M1 143 s-2369 Bathroom sink drain USA FL 2-ii2 M1 s-2371 Bathroom sink drain USA FL 2-d1 M1 s-2372 Bathroom sink drain USA FL 2-d1 M1 s-2373 Bathroom sink drain USA FL 2-d1 M1 s-2374 Bathroom sink drain USA FL 2-jj2 M2 s-2375 Bathroom sink drain USA FL 2-s1 M2 s-2376 Bathroom sink drain USA FL 2-f2 M1 s-2377 Bathroom sink drain USA FL 2-f2 M2 s-2378 Bathroom sink drain USA FL 2-d1 M1 s-2379 Bathroom sink drain USA FL 2-k4 M2 s-2380 Bathroom sink drain USA FL 2-k4 M2 s-2381 Bathroom sink drain USA FL 2-g4 M1 s-2382 Bathroom sink drain USA FL 2-g2 M2 s-2385 Bathroom sink drain USA FL 2-d2 M1 s-2386 Bathroom sink drain USA FL 2-d2 M1 s-2387 Bathroom sink drain USA FL 2-d2 M1 s-2388 Bathroom sink drain USA FL 2-pp2 M1 s-2389 Bathroom sink drain USA FL 2-h1 M1 s-2390 Bathroom sink drain USA FL 2-d2 M1 s-2391 Bathroom sink drain USA FL 2-ll1 M1 s-2392 Bathroom sink drain USA FL 2-d2 M1 s-2393 Bathroom sink drain USA FL 2-k11 M1 s-2394 Bathroom sink drain USA FL 2-qq1 M1 s-2395 Bathroom sink drain USA FL 2-d1 M2 s-2398 Bathroom sink drain USA FL 2-d1 M2 s-2400 Bathroom sink drain USA FL 2-d1 M1 144 s-2401 Bathroom sink drain USA FL 2-d2 M1 s-2402 Bathroom sink drain USA FL 2-o4 M1 s-2403 Bathroom sink drain USA FL 2-o5 M2 s-2404 Bathroom sink drain USA FL 2-d5 M1 s-2405 Water fountain drain USA FL 2-g3 M2 s-2406 Bathroom sink drain USA FL 2-nn1 M1 s-2407 Bathroom sink drain USA FL 2-tt1 M1 s-2409 Bathroom sink drain USA FL 2-d8 M1 s-2410 Bathroom sink drain USA FL 2-d8 M1 s-2411 Bathroom sink drain USA FL 2-kk1 M1 s-2412 Bathroom sink drain USA FL 2-kk1 M1 s-2413 Bathroom sink drain USA FL 2-g5 M1 s-2414 Bathroom sink drain USA FL 2-d1 M1 s-2416 Bathroom sink drain USA FL 2-f6 M2 s-2417 Bathroom sink drain USA FL 2-d17 M1 s-2418 Bathroom sink drain USA FL 2-ii4 M2 s-2419 Bathroom sink drain USA FL 2-d8 M1 s-2420 Bathroom sink drain USA FL 2-d7 M1 s-2421 Bathroom sink drain USA FL 2-d8 M1 s-2423 Bathroom sink drain USA FL 2-d1 M1 s-2424 Bathroom sink drain USA FL 2-ii3 M1 s-2425 Bathroom sink drain USA FL 2-ii1 M1 s-2426 Bathroom sink drain USA FL 2-d1 M1 s-2427 Bathroom sink drain USA FL 2-oo1 M2 s-2428 Bathroom sink drain USA FL 2-d2 M1 s-2429 Bathroom sink drain USA FL 2-d2 M1 145 s-2430 Bathroom sink drain USA FL 2-d2 M1 s-2434 Bathroom sink drain USA FL 2-d2 M1 s-2435 Bathroom sink drain USA FL 2-d2 M1 s-2436 Bathroom sink drain USA FL 2-d2 M1 s-2437 Bathroom sink drain USA GA 2-k12 M1 s-2439 Bathroom sink drain USA GA 2-k12 M1 s-2441 Bathroom sink drain USA GA 2-d12 M1 s-2442 Bathroom sink drain USA GA 2-d12 M1 s-2443 Bathroom sink drain USA FL 2-d1 M1 s-2447 Bathroom sink drain USA FL 2-d2 M1 s-2448 Bathroom sink drain USA FL 2-d2 M1 s-2449 Bathroom sink drain USA FL 2-d8 M1 s-2450 Bathroom sink drain USA FL 2-d8 M1 s-2451 Bathroom sink drain USA FL 2-b2 M1 s-2454 Bathroom sink drain USA FL 2-d1 M1 s-2455 Bathroom sink drain USA FL 2-d5 M1 s-2456 Bathroom sink drain USA FL 2-d4 M1 s-2457 Bathroom sink drain USA FL 2-d2 M1 s-2458 Bathroom sink drain USA FL 2-a1 M1 s-2459 Bathroom sink drain USA FL 2-d2 M1 s-2460 Bathroom sink drain USA FL 2-t2 M1 s-2461 Bathroom sink drain USA FL 2-s2 M1 s-2464 Bathroom sink drain USA FL 2-d3 M1 s-2465 Bathroom sink drain USA FL 2-vv1 M2 s-2466 Bathroom sink drain USA FL 2-d8 M1 s-2467 Bathroom sink drain USA FL 2-d5 M1 146 s-2473 Bathroom sink drain USA PA 2-o1 M2 s-2476 Bathroom sink drain USA PA 2-o1 M2 s-2477 Bathroom sink drain USA VA 2-ss1 M2 s-2478 Bathroom sink drain USA VA 2-rr1 M1 s-2479 Bathroom sink drain USA VA 2-k5 M2 s-2482 Bathroom sink drain USA VA 2-k5 M2 s-2486 Bathroom sink drain USA VA 2-k10 M2 s-2487 Bathroom sink drain USA VA 2-f2 M1 s-2493 Bathroom sink drain USA VA 2-k6 M2 s-2496 Bathroom sink drain USA NC 2-uu1 M1 s-2497 Bathroom sink drain USA SC 2-d1 M1 s-2498 Bathroom sink drain USA SC 2-d1 M1 s-2499 Bathroom sink drain USA SC 2-k9 M1 s-2500 Bathroom sink drain USA SC 2-d5 M1 s-2501 Bathroom sink drain USA SC 2-d1 M1 s-2509 Bathroom sink drain USA GA 2-mm1 M1 s-2515 Bathroom sink drain USA NC 2-k6 M2 s-2518 Bathroom sink drain USA NC 2-b2 M2 s-2521 Bathroom sink drain USA VA 2-d16 M2 s-2523 Bathroom sink drain USA MD 2-d2 M1 s-2527 Bathroom sink drain USA MD 2-uu1 M1 s-2528 Bathroom sink drain USA PA 2-d2 M2 s-2529 Bathroom sink drain USA PA 2-uu1 M1 s-2533 Bathroom sink drain USA PA 2-g5 M1 s-2534 Bathroom sink drain USA FL 2-t3 M1 s-2535 Bathroom sink drain USA FL 2-d1 M1 147 s-2537 Bathroom sink drain USA FL 2-d17 M1 s-2539 Bathroom sink drain USA PA 2-vv2 M2 s-2547 Bathroom sink drain USA PA 2-d2 M1 s-2551 Bathroom sink drain USA FL 2-pp1 M1 s-2552 Bathroom sink drain USA FL 2-d10 M2 s-2553 Bathroom sink drain USA FL 2-d2 M1

22640 Human eye Argentina 2-i2 M2

22641 Human eye Nigeria 2-c1 M2

22645 Shrimp USA HI 2-m1 M1

22661 Human eye Japan 2-d11 M2

22791 Iguana tail UK 2-h5 M1

25374 Human foot Canada 2-k5 M2

28014 Human leg USA CA 2-o2 M1

28036 Human Brazil 2-d18 M2

28543 Human skin USA 2-d2 M1

28544 Human nail USA 2-h2 M1

28550 Human skin USA WI 2-q1 M2

USA New 28561 Human wound 2-f7 M2 England

USA New 28568 Human toe 2-vv2 M2 England

31165 Human blood USA 2-k7 M1

32325 Human cornea Germany 2-xx1 M2

32482 Human USA TX 2-k1 M1

32487 Human USA TX 2-d8 M1

32489 Human USA PA 2-d4 M1 148

32491 Human USA TX 2-d9 M1

32493 Human USA TX 2-v1 M2

32497 Shower drain USA TX 2-d2 M2

32498 Sink drain USA TX 2-f7 M2

32499 Sink drain USA TX 2-d2 M1

32503 Human USA TX 2-i3 M2

32504 Human USA TX 2-d6 M1

32707 Human Eye USA FL 2-s3 M2

32710 Human Eye USA FL 2-t1 M1

32711 Human Eye USA FL 2-n1 M1

32734 Human Eye USA FL 2-s5 M1

32753 Turtle head lesion USA FL 2-qq2 M2

32756 Turtle neck lesion USA FL 2-aaa1 M1

32780 Sea Turtle USA TX 2-u1 M1

32782 Human USA NY 2-h4 M2

32795 Human bone marrow transplant USA NY 2-bbb1 M2

32801 Human eye Mexico 2-k13 M1

32803 Human sputum and arm lesion USA TX 2-d2 M1

32804 Human maxillary region USA NY 2-k4 M1

32829 Human USA TX 2-f3 M2

32839 Human blood USA DC 2-pp3 M2

32840 Human skin USA DC 2-pp3 M2

32841 Human USA NY 2-ccc1 M1

32851 Faucet aerator USA TX 2-d2 M1

32852 Water tank USA TX 2-k4 M2

32853 Human abdomen USA TX 2-d5 M1 149

32855 Human blood USA TX 2-d5 M1

32862 Human lesion USA TX 2-r1 M1

32911 Human cornea USA FL 2-d1 M1

32959 Human Skin USA FL 2-l1 M1

34100 Sink drain USA TX 2-d2 M1

34101 Sink drain USA TX 2-d2 M1

34102 Sink drain USA TX 2-i1 M1

34103 Hospital cockroach USA TX 2-k8 M1

34104 Sink drain USA TX 2-s4 M2

34105 Sink drain USA TX 2-d2 M1

43373 Contact lens Malaysia 2-b1 M2

43374 Cornea Nigeria 2-c1 M2

43378 Contact lens Malaysia 2-b1 M2

43433 Cornea USA OH 2-a1 M1

43435 Contact lens USA OH 2-a2 M1

43439 Cornea USA PA 2-d1 M1

43444 Cornea USA NJ 2-d2 M1

43445 Cornea USA CT 2-d2 M1

43446 Cornea USA CT 2-d2 M1

43458 Cornea Singapore 2-e1 M2

43464 Cornea Singapore 2-f6 M2

43490 Cornea USA MI 2-g1 M2

43492 Contact lens USA NJ 2-d2 M1

43493 Contact lens solution bottle cap USA CT 2-d2 M1

43500 Cornea USA TN 2-d14 M1

43510 Cornea USA FL 2-d5 M1 150

43512 Cornea USA FL 2-d1 M1

43514 Cornea USA FL 2-i4 M2

43523 Cornea USA FL 2-d2 M1

43524 Cornea USA FL 2-d2 M1

43525 Cornea USA FL 2-d8 M1

43528 Cornea USA FL 2-d15 M1

43532 Cornea USA FL 2-h3 M2

43538 Cornea USA FL 2-d1 M1

43585 Human USA UT 2-yy1 M2

43586 Cornea USA TX 2-ww1 M2

43649 Human USA NV 2-j1 M2

43651 Contact lens solution bottle cap USA PR 2-d2 M1

43652 Contact lens USA PR 2-d2 M1

43659 Contact lens USA PR 2-d2 M1

43660 Contact lens case USA PR 2-d2 M1

43661 Contact lens case USA PR 2-d2 M1

43673 Contact lens case USA NJ 2-d2 M1

43690 Contact lens USA PR 2-f6 M2

43691 Contact lens USA PR 2-f6 M1

43702 Contact lens fluid USA OH 2-a1 M1

43705 Contact lens case USA PR 2-f6 M2

43727 Cornea USA FL 2-d2 M1

43728 Cornea USA FL 2-d2 M1

43729 Contact lens fluid USA FL 2-f6 M2

43814 Contact lens USA NY 2-d2 M1

43818 Contact lens case USA NY 2-d2 M1 151

43874 Contact lens case USA NY 2-d2 M1

43876 Contact lens case USA NY 2-d2 M1

46438 Onychomycosis toe Italy 2-aa1 M1

46443 Dermatomycosis foot Italy 2-k2 M1

46693 Human eye Brazil 2-f4 M1

46694 Human Qatar 2-d13 M1

46696 Human eye Brazil 2-w1 M2

46697 Human Qatar 2-x1 M1

46700 Human eye Brazil 2-f5 M1

53132 Onychomycosis toe Italy 2-cc1 M1

1. Letters indicate STs defined by shared identity at the three loci from a previous

MLST system; numbers after letters expand upon this system, i.e. 2-d1 and 2-d2.

2. Mating type idiomorph; M1 = MAT-1-1, M2 = MAT-1-2

Six continents are represented, but 84% of isolates originated in North America.

76 isolates were collected from clinical sources and 110 were recently recovered in a survey of Fusarium in sink drains in the U.S. All but six of 55 of the previously characterized 3-locus STs of F. fistularum were included in this study.

Locus development and primer design

Six new loci were developed in this study, utilized in addition to the existing 3- locus system (Table 2). 152 Table 2. Characteristics of loci employed

P. I. No. of Indels/Msats Genome Position Locus1 Chars. SNPs4 : No. of Alleles C. I.6 in MPVI2 3 for Each5

sca_2_chr3_3_0: TEF 18 23 4 : 3,3,2,2s 0.75 2429595-2430256

rDNA unknown 9 10* / 6 none observed 0.9

sca_20_chr6_4_0: RPB2 14 21 none observed 1 1850977-1852794

sca_8_chr1_1_0: 3968 11 17 2 : 2s, 2 0.95 1137337-1138068

sca_82_chr10_2_0: 3972 10 17 1 : 2s 1 791230-792036

sca_8_chr1_1_0: 4081 13 28 5 : 2,5,2s,2s,2s 0.95 544046-544635

sca_26_chr2_2_0: 6512 9 12 2 : 2s, 2s 0.93 74409-74990

sca_37_chr_6_2_0: 5439 6 8 4 : 2s,2,2s,2s 1 374081-374828

sca_37_chr_6_2_0: 5437 25 27 2 : 11,2 0.95 78042-78546

MAT sca_2_chr3_3_0: N.A. N.A. N.A. N.A. N.A. 153

1. Name of locus 2. Scaffold, chromosome and inclusive base pairs of targeted sequences in NhMPVI. 3. Number of parsimony informative characters observed within F. fistularum. 4. Number of single nucleotide polymorphisms observed within F. fistularum. 5. Number of total insertion/deletion and microsatellite polymorphisms observed within F. fistularum (underlined), followed by the number of alleles observed at each, i.e. locus 5437 contains 2 such polymorphisms, one of which has 11 alleles. Superscript s indicates that this polymorphism was found in only one isolate. 6. Consistency index of individual locus maximum parsimony trees.

The 3-locus system was implemented as described previously (45, 49, 71) and many of these data were derived from previous studies. New loci were developed using the complete genome sequence of unnamed phylogenetic species FSSC 11, also known as „Nectria’ haematococca Mating Population VI

(NhMPVI) as a guide. The complete genome was downloaded at

(http://genome.jgi-psf.org) and searched for 500-800 bp regions containing perfect microsatellite repeats using Perfect Microsatellite Repeat Finder

(http://sgdp.iop.kcl.ac.uk/nikammar/repeatfinder.html). Flanking primers were designed using Primer3 (http://frodo.wi.mit.edu/primer3/). Six loci were chosen based on their polymorphism content in a panel of 20 isolates of F. fistularum.

The chromosomal positions in the NhMPVI genome is given for each locus in 154 Table 2; the nuclear rDNA repeat is not present in the NhMPVI assembly so its chromosomal position remains unknown.

Nucleic acid manipulation

Total genomic DNA was isolated from mycelium using a modified DNeasy Plant

Minikit protocol (Qiagen, Valencia, CA, USA) and suspended in a 100 µl volume.

PCR was performed using GoTaq PCR Kits (Promega, Madison, WI, USA) in 50

µl volumes following the manufacturer‟s instructions, with reactions subjected to

2 minutes at 94° C, 35 cycles of 1 minute at 94° C, 1 minute at the appropriate annealing temperature, and 1 minute at 72° C, followed by 10 minutes at 72° C.

Primer sequences for the nine loci and PCR annealing temperatures are listed in

Table 3, otherwise loci were Mating type PCR for F. fistularum was performed in multiplex reactions as previously described, using two idiomorph-specific primer pairs (see Chapter 3).

Table 3. Primer pairs used for PCR amplification and Sanger sequencing and further charcteristics of loci.

Annealing Locus Fw Primer Rv Primer Size1 (bp) Temp.

EF1: EF2:

TEF(45) ATGGGTAAGGA GGARGTACCA 53 667

RGACAAGAC GTSATCATGT 155 T

ITS5: NL4:

GGAAGTAAAAG GGTCCGTGTT rDNA (45, 69) 53 1029 TCGTAACAAGG TCAAGACGG

5f2: 7cr:

RPB2 5-7(38) GGGGWGAYCA CCCATRGCTT 55 863

GAAGAAGGC GYTTRCCCAT

11ar: 7cf: GCRTGGATCT RPB2 7-11(38) ATGGGYAARCA 55 881 TRTCRTCSAC AGCYATGGG C

3968fw: 3968rv:

3968 TGTTGGTTCGA GAGAAGGGC 53 770

GATGGTTGA AACTGGGAGA

3972rv: 3972fw: ATCGGACGAA 3972 TCTGATGCAGA 53 831 ACAGAGCAG CTAGCACTCG G

4081fw: 4081rv:

4081 TGACRAGGATG TGACCAGCCT 56 642

AATGAGCGA CCAAGSG 156 6512rv: 6512fw: CAAAGCAGAT 6512 GGAGGACCAGG 53 644 CGACTGAGG AGGAATAGG A

5439rv: 5439fw: AGGGGCTGC 5439 AATGGGAATAC 53 779 TGTTAGTGAG GAGCGTCAG A

5437fw: 5437rv:

5437 AACAAGACAAG TCCAGAGGAA 56 544

GCAGCAGGT CGACGAGGC

MAT1-S-1F: MAT1-S-1R:

MAT-1-1 ATGGCTTTCCG CATGATAGGG 53 ~200

CAGTAAGGA CAGCAAAGAG

MAT2-S-1R: MAT2-S-1F: CGGTACTGGT MAT-1-2 GGGAATCTGAG 53 ~800 AGTCGGGAT AAAGATACGTAC

Sequence composition No. Alleles Average Genetic

(bp) 2 observed Diversity (H)3

256 intronic; 411 exonic 22 0.8919

705 intronic; 324 ITS 6 0.3588 157 All exonic 11 0.5132

- - -

All intergenic 12 0.6852

All intergenic 13 0.4569

All intergenic 18 0.8

All intergenic 12 0.5206

All intergenic 10 0.4846

213 exonic, 331 intergenic 23 0.883

N. A. N. A. N. A.

N. A. N. A. N. A.

1. Number of characters in the aligned dataset. For different isolates, the exact length of any region may be variable due to indels and microsatellite repeats 2.

ITS = intergenic spacers 1 and 2. Locus 5437 contains coding regions of a predicted hypothetical protein of unknown function. 3. Average genetic diversity of each of the 9 loci calculated using LIAN (accessed at (pubmed.mlst.org).

Mating type PCR products were visualized using a 1.5% agarose gel and scored as MAT1-1 or MAT1-2 based on the amplicon size (~200 and 800 bp, respectively).

Sequence Type designations 158 Missing or ambiguous DNA sequence data were assigned Ns in the alignments and treated as missing data. Isolates were assigned to new and existing STs of the three-locus MLST system as described previously (Chapter 2). For the nine- locus system, existing three-locus STs were amended with numerals indicating additional subdivision revealed by the new six loci. For example, FSSC 2-d, the most common ST in the 3-locus system, was subdivided into 18 9-locus STs designated FSSC 2-d1 through FSSC 2-d18. For certain MLST analyses, alleles at each locus were assigned simple numerical identifiers, which we refer to as digitized 9-locus STs, e.g. 16-1-1-4-6-2-3-4-13.

Data Analysis

ST diversity

The number of 9-locus STs was calculated using the digitized 9-locus STs as input into the application DNAcollapser implemented in the website FaBox

(v.1.35; http://users-birc.au.dk/biopv/php/fabox/). The MAT-1 idiomorph was then used as a tenth allele and the number of 10-locus STs was calculated in the same way. 9-locus ST diversity of the total sample was estimated using the formula [n/(n - 1)](1 - ∑xi2), where xi is the frequency of the ith allele and n is the number of isolates (43). Genetic diversity of loci and mean genetic diversity were calculated from the digitized 9-locus STs using LIAN (25) accessed at

(pubmlst.org).

NeighborNet and recombination analysis 159 A clone corrected, concatenated dataset including all nucleotide characters was used to perform the PHI test for recombination (7) implemented in SplitsTree4. A clone corrected, concatenated Nexus data file with constant characters removed was used to generate a NeighborNet in SplitsTree4 (28), as well as to calculate the dataset's δ score (a measure of treelikeness, where higher δ values may indicate higher levels of recombination) (26) and phylogenetic diversity (a measure of diversity based on branch lengths (19)).

Index of Association and plotting genotypes vs. no. of loci

To test for the non-random association of alleles, a clone corrected, concatenated dataset with constant characters removed was used to calculate the Index of Association (IA) (41) and rBarD using Multilocus ver. 1.3b (1). The observed IA and rBarD values were calculated for the nine loci and compared to

1000 randomized datasets. In addition, the clone corrected, digitized 9-locus

STs were used to calculate a standardized IA implemented in LIAN (25), accessed at (pubmlst.org).

A clone corrected dataset with constant characters removed was used for plotting the mean number of genotypes vs. the number of loci in Multilocus ver.1.3b, by randomly sampling 1-182 characters 100 times each.

Burst Analyses 160 To generate population snapshots and to estimate the extent of recombination and relationships among genotypes, the set of 111 unique digitized 9-locus STs was used as input into an eBURST MLST analysis (20, 63) implemented using the web application at eburst.mlst.net, at the single locus variant (SLV) level.

The total set of 231 digitized 9-locus STs was analyzed at the triple locus variant

(TLV) level utilizing the goEBURST algorithm (2) implemented in Phyloviz Beta

(phyloviz.net/beta). STs that were not part of any TLV group were added to the figure manually as standalone data points. Mating type data and source information were separately superimposed upon the resulting display of the TLV analysis of the digitized 9-locus MLST dataset using Phyloviz Beta, with high- level edges (connections between STs identical at 7/8 and 6/8 loci) displayed, and edited manually.

Population structure

To test for the presence of population structure, a clone corrected, concatenated dataset with constant characters removed was analyzed in Structure ver. 2.3.X

(58) using a burn-in period of 10000 and 10000 Markov Chain Monte Carlo

(MCMC) simulations, the model with admixture, K set from 1 to 15, and ten iterations for each K. The ad hoc statistic ΔK was computed (17) using the online version of Dent's Structure Harvester ver 0.6.6

(http://taylor0.biology.ucla.edu/struct_harvest/). Results were graphically displayed with Distruct (61).

161 Population Differentiation

To test for patterns of population differentiation, the dataset of 231 isolates was divided into two “populations” comprising 1) clinical (n=76) and non-clinical

(n=155) isolates and 2) tropical/subtropical (Florida, Puerto Rico (n=109)) and non-tropical (remainder of mainland US (n=88)) groups which were individually clone corrected. An exact test of population differentiation was performed in

Arlequin ver 3.11 (18) using the digitized 9-locus STs.

Results

F. fistularum shows high levels of ST diversity

111 9-locus (Table 4) and 122 10-locus STs (using mating type idiomorph as the tenth marker) reflected high levels of diversity in the total sample of 231 isolates.

Table 4. 111 9-locus sequence types of F. fistularum and their frequencies based on the diverstiy of the 231 isolates used in this study.

9-digit ST Digitized 9-locus ST1 No.

Isolates

2-a1 1-1-1-1-1-1-1-1-1 3

2-a2 1-1-1-1-1-1-1-2-1 1

2-b1 20-1-1-1-1-1-1-1-1 2

2-b2 20-1-1-1-2-6-1-1-6 2

2-c1 16-1-1-4-6-2-3-4-13 2

2-d1 20-1-4-1-2-2-1-1-13 23 162

2-d10 20-1-4-1-2-2-5-1-13 1

2-d11 20-1-4-1-1-2-1-1-10 1

2-d12 20-1-4-1-1-2-1-1-6 2

2-d13 20-1-4-1-2-2-1-1-6 1

2-d14 20-1-4-1-2-6-1-1-6 1

2-d16 20-1-4-1-2-18-1-1-1 1

2-d17 20-1-4-1-2-18-1-1-2 2

2-d18 20-1-4-1-13-2-1-3-2 1

2-d15 20-1-4-1-2-2-1-1-1 1

2-d2 20-1-4-1-2-18-1-1-13 49

2-d3 20-1-4-1-2-18-1-7-13 2

2-d4 20-1-4-1-2-2-1-7-13 2

2-d5 20-1-4-1-2-2-6-7-10 8

2-d6 20-1-4-1-2-8-6-7-10 1

2-d7 20-1-4-1-2-8-6-1-10 1

2-d8 20-1-4-1-2-2-6-1-10 9

2-d9 20-1-4-5-2-17-1-3-13 1

2-e1 18-1-1-1-1-1-1-1-6 1

2-f1 18-1-4-1-2-7-1-8-6 1

2-f2 18-1-4-1-2-7-1-1-6 4

2-f3 18-1-4-1-2-6-1-1-6 1

2-f4 18-1-4-1-6-6-1-8-6 1

2-f5 18-1-4-1-2-2-1-8-6 1

2-f6 18-1-4-1-2-2-1-1-13 6

2-f7 18-1-4-1-2-7-1-1-21 2

2-g1 14-1-4-3-2-2-1-1-8 1 163

2-g2 14-1-4-3-2-2-1-1-15 1

2-g3 14-1-4-5-2-7-1-1-5 1

2-g4 14-1-4-3-2-2-1-1-1 1

2-g5 14-1-4-3-2-16-8-1-5 2

2-h1 20-3-4-1-2-18-1-1-13 1

2-h2 20-3-4-1-2-2-6-1-2 1

2-h3 20-3-4-1-2-9-6-1-2 1

2-h4 20-3-4-1-2-2-1-1-2 1

2-h5 20-3-4-1-2-2-1-1-1 1

2-i1 22-1-4-1-2-6-1-1-11 1

2-i2 22-1-4-1-2-6-1-8-6 1

2-i3 22-1-4-1-2-2-1-1-6 1

2-i4 22-1-4-1-2-7-1-1-1 1

2-j1 4-1-6-3-2-2-1-1-3 1

2-k1 15-1-4-1-2-2-1-3-13 1

2-k10 15-1-4-8-2-8-1-3-2 1

2-k11 15-1-4-9-2-2-1-9-1 1

2-k12 15-1-4-1-2-2-1-3-2 2

2-k2 15-1-4-11-11-2-7-3-9 1

2-k3 15-1-4-10-11-2-7-3-16 1

2-k4 15-1-4-1-10-2-1-3-2 4

2-k5 15-1-4-1-10-2-12-9-2 3

2-k6 15-1-4-1-10-8-12-9-2 2

2-k7 15-1-4-1-10-2-1-1-2 1

2-k8 15-1-4-8-10-2-12-3-2 1

2-k9 15-1-4-8-10-2-1-1-2 1 164

2-l1 9-1-4-3-2-3-10-1-2 1

2-m1 10-1-1-6-2-4-10-10-10 1

2-n1 3-2-1-1-2-6-1-1-18 1

2-o1 14-2-4-3-2-2-8-1-3 2

2-o2 14-2-4-3-2-2-1-1-1 2

2-o3 14-2-4-3-2-7-1-1-1 1

2-o4 14-2-4-9-2-13-8-1-5 1

2-o5 14-2-4-12-8-7-1-1-1 1

2-p1 7-5-5-1-12-14-11-5-19 1

2-q1 5-5-10-12-2-11-1-1-4 1

2-r1 5-5-9-5-2-11-8-1-17 1

2-s1 8-1-4-3-9-3-8-1-5 1

2-s2 8-1-4-5-2-2-8-1-2 1

2-s3 8-1-4-12-2-2-8-6-2 1

2-s4 8-1-4-12-2-7-1-1-2 1

2-s5 8-1-4-3-2-16-1-1-8 1

2-t1 1-1-4-12-2-17-8-1-3 1

2-t2 1-1-4-1-2-2-1-1-2 1

2-t3 1-1-4-9-9-10-8-3-3 1

2-u1 5-3-9-3-5-7-1-1-1 1

2-v1 22-1-10-1-2-6-1-1-17 2

2-w1 7-1-5-2-6-2-1-1-14 1

2-x1 12-1-4-1-2-15-1-1-12 1

2-x2 12-1-4-1-14-5-1-1-2 1

2-aa1 21-1-4-1-3-2-1-1-2 1

2-cc1 6-4-4-7-7-6-4-3-7 1 165

2-ii1 14-1-11-3-2-7-8-1-13 1

2-ii2 14-1-11-3-2-10-8-4-17 1

2-ii3 14-1-11-3-2-7-8-1-1 1

2-ii4 14-1-11-3-2-7-1-1-5 1

2-jj2 14-1-6-5-2-6-8-1-1 1

2-kk1 13-2-4-3-2-16-9-1-5 2

2-ll1 11-2-4-3-2-7-1-1-8 1

2-mm1 14-6-4-5-2-7-1-1-5 1

2-nn1 11-6-4-3-2-7-1-1-2 1

2-oo1 2-1-4-1-2-6-1-1-22 1

2-pp1 8-1-11-9-2-10-10-1-13 1

2-pp2 8-1-11-3-2-7-8-1-3 1

2-pp3 8-1-11-9-2-7-1-3-3 2

2-qq1 1-1-11-12-2-7-1-1-1 1

2-qq2 1-1-11-3-2-7-1-3-3 1

2-rr1 4-2-4-9-2-16-1-1-2 1

2-ss1 7-3-3-9-2-12-1-1-15 1

2-tt1 8-1-2-3-2-17-1-1-2 1

2-uu1 5-1-4-3-2-7-8-1-1 3

2-vv1 15-1-7-1-10-2-12-3-2 1

2-vv2 15-1-7-1-10-2-1-3-2 3

2-ww1 22-1-5-1-2-2-1-1-6 1

2-xx1 14-1-11-3-2-6-1-1-2 1

2-yy1 1-1-5-1-2-2-2-1-23 1

2-aaa1 1-2-8-3-4-3-1-1-3 1

2-bbb1 17-1-4-1-2-2-1-1-13 1 166

2-ccc1 14-1-1-12-2-10-1-1-2 1

1. 9 alleles are in the order TEF-rDNA-RPB2-3968-3972-4081-6512-5439-5437.

SNP, microsatellites, and indel polymorphisms are included in allele assignments.

As revealed by the plot of genotypes vs. number of loci sampled, more diversity is probably contained within this panel of isolates than was resolved, even with 9 loci covering ~7650 bp (Figure 1).

120

100

80

60

Mean No. Genotypes No. Mean 40

20

0 0 50 100 150 200

No. Loci Sampled

Figure 1. Plot of mean number of genotypes vs. number of loci sampled created using Multilocus 1.2b. 167

ST diversity was estimated at 0.94 among the 9-locus STs, and in SplitsTree4, phylogenetic diversity was calculated as 0.4549 (Table 5).

Table 5. Summary of statistics of the F. fistularum dataset.

No. isolates 231

No. 9-locus STs 111

MAT-1-1:MAT-1-2 (total) 162:69

MAT-1-1:MAT-1-2 (without 2- 64:60 d types)

Allelic Diversity1 0.94

Average genetic 0.6216 diversity of loci2

NeighborNet δ score3 0.288

Phylogenetic Diversity4 0.4549

Index of Association5 4.656

rBarD6 0.0327

7 Standardized IA 0.0598

No. of eBURST SLV groups 9

(clonal complexes)

No. STs connected at SLV 50 level 168 No. isolates in SLV level STs 162

No. singletons at SLV level 69

1. STdiversity calculated from Nei (43). 2. Average genetic diversity of the 9 loci calculated using LIAN (25). 3. Average δ score (26) of the clone corrected set of

111 unique STs calculated using SplitsTree. 4. Phylogenetic diversity (19) of the clone corrected set of 111 unique STs calculated using SplitsTree. 5. The Index of Association (41) calculated using Multilocus 1.3b (1) was found to be significantly different (p<0.01) than 1000 randomizations, which showed an expected range of 2.86-4.09 (mean = 3.46). 6. rBarD calculated using Multilocus

1.3b was found to be significantly different (p<0.01) than 1000 randomizations, which showed an expected range of 0.0208-0.0283 (mean = 0.024).

Standardized IA calculated using LIAN (25); the null hypothesis of linkage equilibrium was rejected using 1000 resamplings in a Monte Carlo Tests and a

Parametric test, with p<0.001 and p< 3x1021 respectively.

The genetic diversity observed of the 9 loci ranged from 0.35 to 0.89 (Table 3) with an average of 0.62 (Table 5). The number of MAT-1-1 idiomorphs observed was 162 (70%) and the number of MAT-1-2 idiomorphs observed was 69 (30%).

Clinical isolates (n=75) were found to comprise 55 unique STs; non-clinical isolates (n=156 isolates) were found to comprise 68 unique STs. Multiple STs 169 contained isolates from both clinical and environmental sources (Table 1). Of

197 U.S. isolates used in the geographic analysis, 109 were from Florida and

Puerto Rico, comprising 51 unique STs, while 88 were from other mainland U.S. states comprising 48 unique STs.

No evidence for cryptic species boundaries within F. fistularum

Comparisons between the nine individual gene trees for each locus did not reveal any consistent, strongly supported (>60%) bootstrap values in the MP trees (Supplemental Figures S1-S9). We interpret this to be a lack of genealogical evidence for historical reproductive boundaries within the species.

Introgression between Phylogenetic Species

3-locus MLST identified two F. fistularum isolates with distinctive rDNA sequences that were a perfect match to FSSC 9, suggesting either interspecific hybridization or recent horizontal gene transfer events. TEF and RPB2 sequences of FRC S-2406 (from Honeymoon Island Park in Florida) and FRC S-

2509 (from a shopping center in Georgia) BLASTed with 99-100% identity to known FSSC 2 haplotypes; all six of the novel markers also indicate a clear membership to to F. fistularum compared to related FSSC taxa FSSC 5 and

FSSC 9, as well as the more distantly related FSSC 1 and FSSC 11 (NhMPVI

(Figure 2)).

170

Figure 2. Nine individual locus unrooted maximum parsimony trees created using the parsimony ratchet (72, 73) implemented in PAUP* 4.0. In eight of the trees, s-2406 and s-2510 are strongly supported members of F. fistularum. In 171 the rDNA tree, however, these two isolates are strongly supported members of

FSSC 9.

However, the rDNA sequences showed 100% BLAST maximum identity to ST a within FSSC phylogenetic species 9 (FSSC 9-a), and possessed 2 length polymorphisms and 5-6 single nucleotide changes in the internal transcribed spacer (ITS) regions that distinguished them from the FSSC 2 isolates. FRC S-

2406 and FRC S-2509 possessed identical rDNA sequences across 1037 bp.

This result was verified for each of these isolates by resequencing the TEF and rDNA of 10 cultures derived from these isolates by transfer of single, haploid spores. Furthermore, a separate polymorphic region of the nuclear ribosomal

RNA gene repeat, the IGS region, was sequenced in multiple isolates of FSSC 2,

FSSC 9, and FRC S-2406 and FRC S-2509. Sequence analysis confirmed that within a 350 bp region of the IGS, 14 SNP polymorphisms and 7 indel polymorphisms ranging from 1-9 bp were found between these two isolates and a member of FSSC 2 (NRRL 32710), while there were no differences between the putative hybrid isolates and a member of FSSC 9 (FRC S-2519). Overall, this indicates that S-2406 and S-2509 possess ribosomal RNA repeats that are derived from FSSC 9, while the other eight genes have clear origins in FSSC 2.

Other than these unusual isolates with FSSC 9 rDNA, each of the loci indicates reciprocal monophyly between FSSC 2 versus FSSC 9 and FSSC 5.

172 Evidence for recombination

There is strong evidence for recombination in that the individual gene trees show significant incongruence among the taxa (Supplemental figure S1-S18). The PHI test for recombination implemented in SplitsTree showed support for the presence of recombination in the dataset (p<0.0001). The NeighborNet generated by SplitsTree and has an obvious net-like, reticulated topology (Figure

3).

173 Figure 3. Neighbor net of 111 unique 9-locus haplotypes created using

SplitsTree. A PHI test for recombination (7) implemented in SplitsTree4 indicates a statistically high likelihood of recombination in the full dataset (p<0.0001).

The average δ score of the 111 unique STs using the concatenated dataset was calculated as 0.288 (Table 5), which is a departure from 0 (treelikeness) and could be due to the presence of recombinant taxa (26). Individual F. fistularum gene trees indicated various levels of intralocus homoplasy, with Consistency

Indices (CI) ranging between 0.75 in TEF to 1.0 in RPB2, 3972, and 5439 (Table

2).

Evidence for non-random association of alleles

While there was evidence for recombination, multiple analyses revealed that there was also a statistically significant association of alleles among loci, indicating that isolates may be related through asexual processes of population evolution. The index of association (IA) and rBarD were calculated as 4.65 and

0.032 respectively; both differed significantly from the ranges of these values observed in1000 artificially recombined datasets (p<0.01 (Table 5)); A standardized (IA) (25) was calculated as 0.059, and the null hypothesis of linkage equilibrium was rejected using 1000 resamplings in a monte carlo Test and a parametric test (p<0.001 and p< 3x1021 respectively).

174 Burst analyses

9 distinct clonal complexes (2) comprising 50 STs were defined at the SLV level

(unique STs that are identical at 8/9 loci, solid black lines), as well as offshoots of these at the DLV (unique STs that are identical at 7/9 identical loci, dashed lines) and the TLV (unique STs that are identical at 6/9 loci) (Figure 4). 175

Figure 4. Population snapshots of F.fistularum created using Phyloviz Beta.

Each node represents a unique ST (the prefix “2-“ has been omitted for clarity); 176 areas of nodes are proportional to the number of isolates. STs with 8/9 loci in common (SLVs) are connected with solid black lines, STs with 7/9 loci in common (DLVs) are connected with dashed lines, STs with 6/9 loci in common

(TLVs) are connected with dotted lines. STs different at more than three loci not connected to a group. 9 SLV groups are shown. In A) light gray indicates proportion of STs that are MAT-1-1; darker gray shading indicates proportion of

STs that is MAT-1-2. In B) light gray indicates isolates from clinical sources; darker gray indicates isolates from all other sources. Plus signs denote STs containing isolates known to produce cyclosporin in vitro. Asterisks denote the

ST of the ISO standard ATCC 36031 strain. White stars denote STs containing isolates successfully crossed in mating experiments.

In eBURST analysis, 96 STs fell into a single group of isolates connected at the triple locus variant (TLV) level. There were 14 STs (standalone points in Figure

4) comprising 15 isolates that were different at four of more loci and are displayed as unconnected STs, suggestive that they are recombinant, harboring high levels of otherwise unsampled diversity, or some combination thereof.

These standalone STs contain the isolate that is the ISO standard ATCC 36031

(2-c1) and one of the isolates used for successful laboratory mating crosses (2- ss1).

177 Lack of plausible population structure

The ad hoc statistic ΔK calculated for the results of Structure analysis indicated that the most likely number of clusters was K=2 (Figure S10). However, this result seems to lack biological meaning, in that isolates with highly inferred memberships (greater than 0.9) to these clusters lack any unifying ecological or geographical characteristics; both clusters contain a variety of STs from clinical and environmental sources from broad geographic spans. Since the ad hoc statistic ΔK may not be calculated for K=1, we hypothesize that there is no discernable structure to be found using these methods.

Exact tests of population differentiation (18) comparing the ST diversity between isolates from clinical sources and isolates from all other sources found no significant population differentiation. Likewise, the analyses comparing ST diversity between Florida and Puerto Rican isolates and isolates from other mainland U.S. states showed no evidence of significant population differentiation.

Discussion

Many systems for studying the genetic diversity and population biology of fungal human pathogens have been developed, utilizing a variety of typing methods. In

Fusarium, several studies utilizing MLST have revealed strongly supported species boundaries and identified the spectrum of fusaria associated with human pathogenicity (46, 48-53, 67, 71). These studies have made clear the importance of strong evolutionary inferences about species boundaries before embarking on studies of population dynamics (66). Our goal in this study was to 178 deploy novel sequence based markers to understand the diversity and population biology of the single most commonly isolated clinically relevant Fusarium species, which previous multilocus studies had indicated to be genealogically exclusive (49, 71).

In addition to their application in questions of basic ecology and epidemiology, MLST in F. fistularum is useful for selecting unique STs for genomic and pathogenicity studies. It also provides a framework for the study of phenotypes of interest. For example, F. fistularum STs vary in the types of secondary metabolites produced, including anhydrofusarubin, fusarubin, solaniol, and javanicin and these compounds may be ecologically and clinically relevant.

F. fistularum is also known to produce cyclosporine; here we show this ability is found in at least six unique clinical 9-locus STs (indicated by "+" in Figure 4) (64).

Additionally, isolate NRRL 22641 (= ATCC 36031) was recommended by the

International Organization for Standardization guidelines for testing disinfectants, but shown not to form biofilms in in vitro models (29). This isolate has the 9- locus ST 2-c1 (indicated by an asterisk in Figure 4), a singleton that appears to be quite divergent from more frequently observed STs in the species, casting further doubt on its choice for testing the efficacy of antimicrobial treatments. It is unknown whether this isolate‟s aberrant morphology and failure to form biofilms can be attributed to mutation, perhaps post-isolation, or phenotypes segregating in natural populations. Further tests of ATCC 36031 in comparison to other clinical isolates has led to the recommendation that multiple clinical isolates be utilized in disinfectant testing (27). Finally, two STs (2-ss1 and 2-ll1) used in a 179 successful mating cross under laboratory conditions (FRC S-2477 and FRC S-

2391), and whose progeny were proven to be recombinant, are highlighted by white stars in Figure 2.

High levels of genetic diversity in F. fistularum

The nine loci employed in this study displayed a great deal of diversity, with a range of 6-23 alleles per locus identified among the 231 isolates studied. The six new markers in this study were originally targeted because they harbored microsatellite repeats in the NhMPVI genome. Sequencing these regions in F. fistularum, revealed high levels of linked nucleotide polymorphisms, motivating us to utilize them as sequence based markers, to capture the full extent of sequence diversity contained within alleles, and also to avoid issues of convergence that can be problematic in interpreting VNTRs (5). Within F. fistularum, SNPs were the most common polymorphisms observed (163 out of

~7650 characters (Table 2)), which is a "SNP return" (6) of 2.1%; with microsatellite and indel polymorphisms included, this value is 2.3%. This level of polymorphism per region sequenced is higher than what has been observed in other MLST systems of fungal human pathogens such as Aspergillus fumigatus

(6), but lower than C. albicans , C. tropicalis and C. glabrata (6).

A limited application to other FSSC species indicated utility of these markers throughout the complex (Figure 2), with evidence for polymorphism found in other species. A recent study utilized five additional protein-coding genes and found that they were effective at resolving STs broadly within the 180 FSSC (14) but the degree of resolution these loci provided within phylogenetically defined species was not determined. The six new loci developed in this study consisted almost entirely of non-coding sequence residing in intergenic regions, but surprisingly, the levels of genetic diversity observed within F. fistularum was comparable to that of the protein-coding genes

(Table 2).

Previous MLST studies indicated that environmental and human pathogenic fusaria are diverse, spanning multiple species complexes, species, and STs within species, but certain STs have been found to be dominant.

Fusarium oxysporum Species Complex ST 33 was identified as one such widespread clonal lineage (46, 51) based on TEF and the IGS region of the rDNA repeat, but additional analysis of amplified fragment length polymorphisms

(AFLPs) revealed seven distinct haplotypes within the ST (51). In F. fistularum, we observed a similar trend with the addition of six new markers to the previous three-locus MLST scheme. A majority of previously defined 3-locus STs with multiple isolates were shown to comprise multiple 9-locus STs with the addition of new molecular markers (Table 1), some of which appear to be quite distinct from other members of their 3-locus ST (Figure 3, 4). Furthermore, the plot of genotypic diversity vs. number of loci sampled indicates that there is likely additional diversity present in the 9-locus STs that is not resolved (Figure 1).

This is obvious considering that in 10 unique 9-locus STs containing multiple isolates, both mating types were observed (Figure 4).

181 Evidence for FSSC 2-d as a transcontinental epidemic clone

Despite the incomplete resolution from nine loci, there is evidence for an epidemic clone (an ST that is common, geographically widespread and appears to be genetically identical) in F. fistularum. FSSC 2-d is the 3-locus ST most commonly associated with both plumbing fixture biofilm and human infections and represents49 46% of our dataset (107 isolates). Here, FSSC 2-d was further divided into 18 unique types in our 9-locus system, some of which are fragmented into genetically divergent STs and possibly recombined with other types (Figures 3, 4). However, the majority of FSSC 2-d isolates belonged to the two most common 9-locus types, 2-d1 and 2-d2, which comprise 94% MAT-1-1 isolates. Both of these STs contain multiple isolates from plumbing drains and contact lens-associated keratitis, as well as other sources. While the majority of the isolates in 2d-1 and 2d-2 originated in the mainland United States, they include isolates from Germany, Qatar and Puerto Rico (Table 1). The presence of types that are both common and have a widespread distribution in F. fistularum is similar to what has been observed in other fungal human pathogens such as Cryptococcus gatii (10), a system in which the same common clone has been observed in Australia and the United States.

In contrast, FSSC 2-k, also among the six most common biofilm associated human pathogenic fusaria, shows more evidence for historical recombination (Figure 3, 4), with 2-k2 and 2-k3 being members of unconnected

TLV groups in the eBURST analysis (Figure 4); additionally, members of 2-k show a 9:10 MAT1-1:MAT1-2 mating-type ratio. 182 F. fistularum shows evidence of clonality and recombination

STs of our sample of F. fistularum isolates showed evidence for both clonality and recombination, which is not surprising since both modes of reproduction have been observed in this fungus. Clonal dispersal in FSSC species is expected via natural and human mediated of spread of mitotically produced, asexual propagules (macroconidia, microconidia, chlamydospores) that can be dispersed through the movement of water in man-made and natural systems (4,

55). Sexual recombination through formation of perithecia and recombinant ascospores has been successfully induced in the laboratory, although it has never been observed in nature. We hypothesize that sex in this species occurs in nature, although fertility in the laboratory was low and some crosses produced asci with aberrant numbers of ascospores, suggesting infertility factors being present (successfully crossed STs are highlighted by white stars in Figure 4).

The observed frequencies of mating types in F. fistularum in the total sample deviated significantly from the expected 1:1 ratio (p<0.0001 in a two-tailed

Fisher's exact test), with 162 isolates being MAT1-1 and 69 MAT1-2. This aberration may be, in part, due to oversampling of the most common widespread clones. This is supported by the fact that with the STs 2-d1 and 2-d2 removed

(94:65 MAT1-1:MAT1-2; p=0.115 in a two-tailed Fisher's exact test), and when all

2-d types are removed the ratio becomes (64:60 MAT1-1:MAT1-2; p=0.898 in a two-tailed Fisher's exact test).

A rough estimate of the contribution of mutation relative to recombination may be calculated as the ratio of STs with shared alleles (individuals which are 183 more likely to be part of the same clonal complex) to STs which incorporate new alleles (individuals which may be recombinant) (21). In F. fistularum, 9 clonal complexes at the SLV level were identified comprising 2, 2, 2, 3, 4, 4, 5, 6, and

22 unique STs each (STs identical at 8/9 loci are connected by solid black lines in Figure 2). The number of STs that could not be joined to others at the SLV level was 62, which gives a ratio of mutation:recombination equal to 1:1.24.

When the actual number of isolates within these STs is taken into account, however, there are 162 isolates connected at the SLV level compared to 69 isolates which are identical at fewer than 8/9 loci, giving a mutation:recombination ratio of 2.3:1. This estimate contrasts with that in the more clonal P. marneffei, where the mutation:recombination ratio was approximately 5:1 (21). Indeed, a mixed clonal/recombinant structure is not unusual; other medically relevant fungi that show evidence of both clonality and recombination include Aspergillus fumigatus (57), Cryptococcus gattii (9),

Candida albicans (24, 65), Candida glabrata (15), and Paracoccidioides brasiliensis (40).

Introgression and hybridization

Our previous work identified two isolates that possessed RPB2 and TEF alleles that clearly placed them in FSSC 2, but their rDNA showed a clear connection to

FSSC 9 (100% sequence identity to all known FSSC 9 haplotypes). FSSC 2 and

FSSC 9 are closely related, and both occur in plumbing biofilms, so the simplest explanation for this is introgression due to a hybridization event. Analyses of the 184 six additional loci in these putative hybrids showed that both isolates possessed typical FSSC 2 alleles at all loci, suggesting that if the introgression of rDNA was due to a hybridization event, the isolates are likely heavily backcrossed into the

FSSC 2 background. Hybridization between closely related, phylogenetically defined species has been observed in Fusarium in multiple instances (31, 54,

70). The introgressed FSSC 9 rDNA includes the ITS regions, the 5.8S rRNA gene, a portion of the large subunit rRNA, and a portion of the intergenic spacer

(IGS) region. Because the genomic location of the ribosomal RNA repeat is unknown in the FSSC, we were not able to determine the genomic boundaries of the introgressed segment. Furthermore, we cannot determine whether the mode of introgression was via interspecific sexual reproduction versus other parasexual means. Introgression has also been observed in other medically important fungi including Cryptococcus (34) and Candida spp. (59), and is hypothesized to play an important role in generating diversity.

It is also possible that other unorthodox mechanisms may be at play in generating genetic diversity in F. fistularum. Small conditionally dispensible (CD) chromosomes are known to exist in the FSSC (42) as well as in other Fusarium species complexes. The genome of NhMPVI includes three CD chromosomes, which disproportionately harbor genes with no clear Fusarium orthologues, leading to the hypothesis that they were gained through unknown horizontal gene transfer (HGT) events (12). While HGT has not been formally demonstrated in the FSSC, it has been shown experimentally in F. oxysporum (39).

185 Geographic correlations with genetic diversity

Molecular markers have revealed genetic diversity correlated with geography in a number of fungal human pathogens (32), including Coccidioides immitis (8),

Histoplasma capsulatum (33, 35), and Cryptococcus gatti (37), Penicillium marnefeii (22). In contrast, Aspergillus fumigatus (13, 60), Candida albicans, and

Cryptococcus neoformans (23) do not show significant population structure with regard to geography (32).

Although the methods used to detect the highest level of genetic population structure within a clone corrected dataset indicated that the most likely number of clusters of related genotypes was two, the ad hoc statistic ∆K cannot be used to test whether the number of clusters could equal 1 (17). Therefore, we hypothesize that there is no correlation between genetic diversity and geography in our sample.

Environmental sources of clinical isolates

An extensive body of literature has suggested that many Fusarium infections, particularly nosocomial infections, are caused by isolates resident in the patient indoor environment (4, 11, 51, 71). Similar to what has been observed in other common nosocomial fungal pathogens, including A. fumgatus (56), we found no evidence differentiating clinical isolates and those from all other sources, including biofilms in plumbing drains.

186

Figure S1a. First half of a maximum parsimony bootstrap tree for locus TEF. 187

Figure S1b. Second half of a maximum parsimony bootstrap tree for locus TEF. 188

Figure S2a. First half of a maximum parsimony bootstrap tree for the locus rDNA. 189

Figure S2b. Second half of a maximum parsimony bootstrap tree for locus rDNA. 190

Figure S3a. First half of the maximum parsimony bootstrap tree for locus RPB2. 191

Figure S3b. Second half of a maximum parsimony bootstrap tree for locus RPB2. 192

Figure S4a. First half of the maximum parsimony bootstrap tree for locus 3968. 193

Figure S4b. Second half of a maximum parsimony bootstrap tree for locus 3968. 194

Figure S5a. First half of the maximum parsimony bootstrap tree for locus 3972. 195

Figure S5b. Second half of a maximum parsimony bootstrap tree for locus 3972. 196

Figure S6a. First half of the maximum parsimony bootstrap tree for locus 4081. 197

Figure S6b. Second half of a maximum parsimony bootstrap tree for locus 4081. 198

Figure S7a. First half of the maximum parsimony bootstrap tree for locus 6512. 199

Figure S7b. Second half of a maximum parsimony bootstrap tree for locus 6512. 200

Figure S8a. First half of the maximum parsimony bootstrap tree for locus 5439. 201

Figure S8b. Second half of a maximum parsimony bootstrap tree for locus 5439. 202

Figure S9a. First half of the maximum parsimony bootstrap tree for locus 5437. 203

Figure S9b. Second half of a maximum parsimony bootstrap tree for locus 5437.

204

Figure S10. Inferred membership of 111 unique STs into two clusters.

205 References

1. Agapow, P. M., and A. Burt. 2001. Indices of multilocus linkage disequilibrium.

Molecular Ecology Notes 1: 101-102.

2. Alexandre, F., B. Miguel, and R. Mario. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinformatics 10:

152

3. Alfonso, E. C., and R. H. Rosa. 1997. Fungal keratitis. In J. H. Krachmer,

Mannis, M.J., Holland, E.J. (Ed.), Fundamentals of Cornea and External diseases: Clinical Diagnosis and Management. Mosby, St Louis: 1253-1266

4. Anaissie, E. J., R. T. Kuchar, J. H. Rex, A. Francesconi, M. Kasai et. al. 2001.

Fusariosis associated with pathogenic Fusarium species colonization of a hospital water system: a new paradigm for the epidemiology of opportunistic mold infections. Clinical infectious Diseases 33: 1871-1878.

5. Avise, J. C. 2004. Molecular markers, Natural History, and Evolution. 2nd ed.:

Sinauer Associates. Sunderland MA. 684 p.

6. Bain, J. M., A. Tavanti, A. D. Davidson, M. D. Jacobsen, D. Shaw, N. A. R.

Gow, and F. C. Odds. 2007. Multilocus sequence typing of the pathogenic fungus

Aspergillus fumigatus. Journal of Clinical Microbiology 45: 1469-1477

7. Bruen, T. C., H. Philippe, and D. Bryant. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172: 2665-2681.

8. Burt, A., B. M. Dechairo, G. L. Koenig, D. A. Carter, T. J. White et. al.1997.

Molecular markers reveal differentiation among isolates of Coccidioides immitis from California, Arizona and Texas. Molecular Ecology 6: 781-786. 206 9. Campbell, L. T., B. J. Currie, M. Krockenberger, R. Malik, W. Meyer, J.

Heitman, and D. Carter. 2005. Clonality and recombination in genetically differentiated subgroups of Cryptococcus gattii. Eukaryotic Cell 4: 1403.

10. Carriconde, F., F. Gilgado, I. Arthur, D. Ellis, R. Malik, N. van de Wiele, V.

Robert, B. J. Currie, W. Meyer, and K. Nielsen. Clonality and α-a Recombination in the Australian Cryptococcus gattii VGII Population-An Emerging Outbreak in

Australia. PloS One 6: e16936.

11. Chang, D. C., G. B. Grant, K. O'Donnell, K. A. Wannemuehler, J. Noble-

Wang et. al. 2006. Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. Journal of the American Medical Association 296: 953-

963.

12. Coleman, J. J., S. D. Rounsley, M. Rodriguez-Carres, A. Kuo, C. C.

Wasmann, J. Grimwood, J. Schmutz, M. Taga, G. J. White, and S. Zhou. 2009.

The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 5: e1000618.

13. Debeaupuis, J. P., J. Sarfati, V. Chazalet, and J. P. Latge. 1997. Genetic diversity among clinical and environmental isolates of Aspergillus fumigatus.

Infection and Immunity 65: 3080-3085.

14. Debourgogne, A., C. Gueidan, C. Hennequin, N. Contet-Audonneau, S. de

Hoog, and M. Machouart. 2010. Development of a new MLST scheme for differentiation of Fusarium solani Species Complex (FSSC) isolates. Journal of

Microbiological Methods 82: 319-323. 207 15. Dodgson, A. R., C. Pujol, M. A. Pfaller, D. W. Denning, and D. R. Soll. 2005.

Evidence for recombination in Candida glabrata. Fungal Genetics and Biology

42: 233-243.

16. Dyavaiah, M., R. Ramani, D. S. Chu, D. C. Ritterband, M. K. Shah et. al.

2007. Molecular characterization, biofilm analysis and experimental biofouling study of Fusarium isolates from recent cases of fungal keratitis in New York

State. BMC Ophthalmology 7: 1.

17. Evanno, G., S. Regnaut, and J. Goudet. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study.

Molecular Ecology 14: 2611-2620.

18. Excoffier, L., G. Laval, and S. Schneider. 2006. Arlequin ver 3.1--An

Integrated Software Package for Population Genetics Data Analysis.

Evolutionary Bioinformatics Online 1: 47-50.

19. Faith, D. P. 1992. Conservation evaluation and phylogenetic diversity.

Biological Conservation 61: 1-10.

20. Feil, E. J., B. C. Li, D. M. Aanensen, W. P. Hanage, and B. G. Spratt. 2004. eBURST: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. Journal of

Bacteriology 186: 1518-1530.

21. Fisher, M. C. 2007. The Evolutionary Implications of an Asexual Lifestyle

Manifested by Penicillium. In Heitman, J. Kronstad, W. Smith, M., Taylor, J.W.,

(Eds). Sex in fungi: molecular determination and evolutionary implications. ASM

Press, Washington D.C.: 201-212. 208 22. Fisher, M. C., D. Aanensen, S. De Hoog, and N. Vanittanakom. 2004.

Multilocus microsatellite typing system for Penicillium marneffei reveals spatially structured populations. Journal of Clinical Microbiology 42: 5065-5069.

23. Franzot, S. P., J. S. Hamdan, B. P. Currie, and A. Casadevall. 1997.

Molecular epidemiology of Cryptococcus neoformans in Brazil and the United

States: evidence for both local genetic differences and a global clonal population structure. Journal of Clinical Microbiology 35: 2243-2251.

24. Graser, Y., M. Volovsek, J. Arrington, G. Schonian, W. Presber et. al. 1996.

Molecular markers reveal that population structure of the human pathogen

Candida albicans exhibits both clonality and recombination. Proceedings of the

National Academy of Sciences of the USA 93: 12473-12477.

25. Haubold, B., and R. R. Hudson. 2000. LIAN 3.0: detecting linkage disequilibrium in multilocus data. Bioinformatics 16: 847-849.

26. Holland, B. R., K. T. Huber, A. Dress, and V. Moulton. 2002. δ Plots: a tool for analyzing phylogenetic distance data. Molecular Biology and Evolution 19:

2051-2059.

27. Hume, E. B. H., J. Flanagan, S. Masoudi, H. Zhu, N. Cole, and M. D. P.

Willcox. 2009. Soft contact lens disinfection solution efficacy: clinical Fusarium isolates vs. ATCC 36031. Optometry & Vision Science 86: 415-419.

28. Huson, D. H. 1998. A program for analyzing and visualizing evolutionary data. Bioinformatics, 14: 68-73.

29. Imamura, Y., J. Chandra, P. K. Mukherjee, A. A. Lattif, L. B. Szczotka-Flynn, et. al. 2008. Fusarium and Candida albicans biofilms on soft contact lenses: 209 model development, influence of lens type, and susceptibility to lens care solutions. Antimicrobial Agents and Chemotherapy 52: 171-182.

30. Jabra-Rizk, M. A., W. A. Falkler, and T. F. Meiller. 2004. Fungal biofilms and drug resistance. Emerging Infectious Diseases 10: 14-19.

31. Jurgenson, J. E., R. L. Bowden, K. A. Zeller, J. F. Leslie, N. J. Alexander, and R. D. Plattner. 2002. A genetic map of Gibberella zeae (Fusarium graminearum). Genetics 160: 1451-1460.

32. Kasuga, T., J. W. Taylor, and T. J. White. 1999. Phylogenetic relationships of varieties and geographical groups of the human pathogenic fungus

Histoplasma capsulatum Darling. Journal of Clinical Microbiology 37: 653-663.

33. Kasuga, T., T. J. White, G. Koenig, J. McEwen, A. Restrepo et. al. 2003.

Phylogeography of the fungal pathogen Histoplasma capsulatum. Molecular

Ecology 12: 3383-3401.

34. Kavanaugh, L. A., J. A. Fraser, and F. S. Dietrich. 2006. Recent evolution of the human pathogen Cryptococcus neoformans by intervarietal transfer of a 14- gene fragment. Molecular biology and evolution 23: 1879-1890.

35. Keath, E. J., G. S. Kobayashi, and G. Medoff. 1992. Typing of Histoplasma capsulatum by restriction fragment length polymorphisms in a nuclear gene.

Journal of Clinical Microbiology 30: 2104-2107.

36. Leslie, J. F., L. L. Anderson, R. L. Bowden, and Y. W. Lee. 2007. Inter-and intra-specific genetic variation in Fusarium. International journal of food microbiology 119: 25-32. 210 37. Litvintseva, A. P., R. Thakur, R. Vilgalys, and T. G. Mitchell. 2006. Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana.

Genetics 172: 2223-2238.

38. Liu, Y. J., S. Whelen, and B. D. Hall. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Molecular

Biology and Evolution 16: 1799-1808.

39. Ma, L. J., H. C. van der Does, K. A. Borkovich, J. J. Coleman, M. J.

Daboussi, A. Di Pietro, M. Dufresne, M. Freitag, M. Grabherr, and B. Henrissat.

2010. Comparative genomics reveals mobile pathogenicity chromosomes in

Fusarium. Nature 464: 367-373.

40. Matute, D. R., J. G. McEwen, R. Puccia, B. A. Montes, G. San-Blas, E.

Bagagli, J. T. Rauscher, A. Restrepo, F. Morais, and G. Nigo-Vega. 2006. Cryptic speciation and recombination in the fungus Paracoccidioides brasiliensis as revealed by gene genealogies. Molecular Biology and Evolution 23: 65-73.

41. Maynard Smith, J., N. H. Smith, M. O'Rourke, and B. G. Spratt. 1993. How clonal are bacteria? Proceedings from the National Academy of Sciences of the

USA 90: 4384-4388.

42. Miao, V. P., S. F. Covert, and H. D. VanEtten. 1991. A fungal gene for antibiotic resistance on a dispensable (" B") chromosome. Science 254: 1773-

1776.

43. Nei, M., and F. Tajima. 1981. DNA polymorphism detectable by restriction endonucleases. Genetics 97: 145-163. 211 44. Nelson, P. E., M. C. Dignani, and E. J. Anaissie. 1994. Taxonomy, biology, and clinicll aspects of Fusarium species. Clinical Microbiology Reviews 7: 479-

504.

45. O'Donnell, K., E. Cigelnik, and H. I. Nirenberg. 1998. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90:

465-493.

46. O'Donnell, K., C. Gueidan, S. Sink, P. R. Johnston, P. W. Crous et. al. 2009.

A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex. Fungal Genetics and Biology

46: 936-948.

47. O'Donnell, K., H. C. Kistler, B. K. Tacke, and H. H. Casper. 2000. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab.

Proceedings of the National Academy of Sciences of the USA 97: 7905-7910.

48. O'Donnell, K., B. A. J. Sarver, M. Brandt, D. C. Chang, J. Noble-Wang et. al.

2007. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic fusaria, including isolates from the multistate contact lens -

Associated US Keratitis outbreaks of 2005 and 2006. Journal of Clinical

Microbiology 45: 2235-2248.

49. O'Donnell, K., D. A. Sutton, A. Fothergill, D. McCarthy, M. G. Rinaldi et. al.

2008. Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani species complex. Journal of Clinical Microbiology 46: 2477-2490. 212 50. O'Donnell, K., D. A. Sutton, M. G. Rinaldi, C. Gueidan, P. W. Crous, and D.

M. Geiser. 2009. Novel Multilocus Sequence Typing Scheme Reveals High

Genetic Diversity of Human Pathogenic Members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum Species Complexes within the United States.

Journal of Clinical Microbiology 47: 3851-3861.

51. O'Donnell, K., D. A. Sutton, M. G. Rinaldi, K. C. Magnon, P. A. Cox et. al.

2004. Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: Evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. Journal of

Clinical Microbiology 42: 5109-5120.

52. O'Donnell, K., D. A. Sutton, M. G. Rinaldi, B. A. J. Sarver, S. A. Balajee et. al. 2010. Internet-Accessible DNA Sequence Database for Identifying Fusaria from Human and Animal Infections. Journal of Clinical Microbiology 48: 3708-

3718.

53. O'Donnell, K., T. J. Ward, D. Aberra, H. C. Kistler, T. Aoki et. al. 2008.

Multilocus genotyping and molecular phylogenetics resolve a novel head blight pathogen within the Fusarium graminearum species complex from Ethiopia.

Fungal Genetics and Biology 45: 1514-1522.

54. O'Donnell, K., T. J. Ward, D. M. Geiser, H. C. Kistler, and T. Aoki. 2004.

Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct 213 species within the Fusarium graminearum clade. Fungal Genetics and Biology

41: 600-623.

55. Palmero, D., J. M. RodrÌguez, M. de Cara, F. Camacho, C. Iglesias et. al.

2010. Fungal microbiota from rain water and pathogenicity of Fusarium species isolated from atmospheric dust and rainfall dust. Journal of Industrial

Microbiology & Biotechnology 1: 13-20.

56. Paoletti, M., C. Rydholm, E. U. Schwier, M. J. Anderson, G. Szakacs et. al.

2005. Evidence for sexuality in the opportunistic fungal pathogen Aspergillus fumigatus. Current Biology 15: 1242-1248.

57. Pringle, A., D. M. Baker, J. L. Platt, J. P. Wares, J. P. Latge, and J. W.

Taylor. 2005. Cryptic speciation in the cosmopolitan and clonal human pathogenic fungus Aspergillus fumigatus. Evolution 59: 1886-1899.

58. Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

59. Pujol, C., K. J. Daniels, S. R. Lockhart, T. Srikantha, J. B. Radke, J. Geiger, and D. R. Soll. 2004. The closely related species Candida albicans and Candida dubliniensis can mate. Eukaryotic Cell 3: 1015-1027.

60. Rinyu, E., J. Varga, and L. Ferenczy. 1995. Phenotypic and genotypic analysis of variability in Aspergillus fumigatus. Journal of clinical microbiology 33:

2567-2575.

61. Rosenberg, N. A. 2004. DISTRUCT: a program for the graphical display of population structure. Molecular Ecology Notes 4: 137-138. 214 62. Speeleveld, E., B. Gordts, H. W. Landuyt, C. D. Vroey, and C. Raes

Wuytack. 1996. Susceptibility of clinical isolates of Fusarium to antifungal drugs.

Mycoses 39: 37-40.

63. Spratt, B. G., W. P. Hanage, B. Li, D. M. Aanensen, and E. J. Feil. 2004.

Displaying the relatedness among isolates of bacterial species: the eBURST approach. FEMS Microbiology Letters 241: 129-134.

64. Sugiura, Y., J. R. Barr, D. B. Barr, J. W. Brock, C. M. Elie, Y. Ueno, D. G.

Patterson Jr, M. E. Potter, and E. Reiss. 1999. Physiological characteristics and mycotoxins of human clinical isolates of Fusarium species. Mycological Research

103: 1462-1468.

65. Tavanti, A., N. A. R. Gow, M. C. J. Maiden, F. C. Odds, and D. J. Shaw.

2004. Genetic evidence for recombination in Candida albicans based on haplotype analysis. Fungal Genetics and Biology 41: 553-562.

66. Taylor, J. W., D. M. Geiser, A. Burt, and V. Koufopanou. 1999. The evolutionary biology and population genetics underlying fungal strain typing.

Clinical Microbiology Reviews 12: 126-146.

67. Wang, H., M. Xiao, F. Kong, S. Chen, H. T. Dou et. al. Accurate and

Practical Identification of 20 Fusarium Species by Seven-Locus Sequence

Analysis and Reverse Line Blot Hybridization, and an In Vitro Antifungal

Susceptibility Study. Journal of Clinical Microbiology 49: 1890.

68. Wey SB, Colombo A (1997) Fungal infections of catheters. In H. Seifert, B.

Jansen, B. Farr (Eds). Catheter-Related Infections. Marcel Decker, New York:

39-156. 215 69. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D.

H. Gelfand, J. J. Sninsky, and T. J. White (Eds). PCR protocols a guide to methods and applications. Academic Press, New York: 315-322.70. Zeller, K.

A., R. L. Bowden, and J. F. Leslie. 2004. Population differentiation and recombination in wheat scab populations of Gibberella zeae from the United

States. Molecular Ecology 13: 563-571.

71. Zhang, N., K. O'Donnell, D. A. Sutton, F. A. Nalim, R. C. Summerbell et. al.

2006. Members of the Fusarium solani species complex that cause infections in both humans and plants are common in the environment. Journal of Clinical

Microbiology 44: 2186-2190.

72. Nixon KC (1999) The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15: 407–414.

73. Sikes D. S., Lewis P. O. PAUPRat: PAUP implementation of the parsimony ratchet. Beta software, version 1. Distributed by the authors. Storrs: Department of Ecology and Evolutionary Biology, University of Connecticut; 2001.

74. Swofford DL (2002) PAUP* (Phylogenetic Analysis Using Parsimony and

Other Methods), Version 4.10 b. Sinauer, Sunderland, Massachusetts, USA. 216 Chapter 5

Future Directions

The results of this research provide a framework for understanding the diversity of common environmental and human pathogenic Fusarium Species Complexes, species, and sequence types. By studying genetically distinct isolates, the bases of important phenotypes can be investigated. Questions that this research will enable include:

1. What are the chemotypic differences between common phylogenetic

species and sequence types of Fusarium?

2. How does the spectrum of diversity of fusaria (and other fungi) from cases

of trauma-associated mycotic keratitis from the tropics compare to the

spectrum of diversity observed from cases of biofilm-associated mycotic

keratits?

3. Are common Fusarium species and sequence types susceptible to any

novel antifungal compounds?

4. How do the genomes of different phylogenetic species differ, and are

there genomic regions associated with ecological adaptations? For

example, what is the genetic basis for biofilm formation in Fusarium and

what allows its survival in complex microbiological communities? What are

the mechanisms and evolutionary origins of antifungal drug resistance?

The following are examples of research initiated into some of these areas:

217 Comparisons of detailed secondary metabolite profiles of FSSC 1, FSSC 2,

FSSC 3+4, and FSSC 5

Analyses of secondary metabolite profiles of four common FSSC species are currently underway in collaboration with the laboratory of Dr. Ulf Thrane at the

Technical University of Denmark. Seven to fifteen isolates of each of these FSSC species were selected based on their diverse MLST identities. These analyses will be used to test the hypothesis of secondary metabolite variation within and between common species in the FSSC.

Phylogenetic diversity of mycotic keratitis associated fungi from India

Cases of mycotic keratitis associated with Fusarium and Aspergillus spp. in the tropics are exceptionally common. To better understand the phylogenetic diversity of fungi implicated in these infections, we received a few hundred cultures from clinical laboratories in India. Although there were many cases of cultures mixed with saprophytes, we obtained pure cultures and have applied

MLST to 40 isolates of Aspergillus and 85 isolates of Fusarium. Several species of Aspergillus were observed including A. fumigatus, A. flavus, A. niger and A. oryzae. Likewise, the Fusarium sample was species-rich. However, the spectrum of fusarial diversity was markedly different from the panel collected from plumbing drains and contact-lens associated keratitis. For example, only a single isolate from the FOSC was observed, and, consistent with previous observations, the sample was dominated by diverse members of FSSC 3+4.

218

In vitro susceptibility of Fusarium to RSAFP-2 a plant defensin from radish seeds

Antifungal drug resistance in Fusarium in general, and the FSSC in particular remains a problem. Clinical Fusarium isolates consistently demonstrate high minimum inhibitory concentrations (MICs) of a variety of standard antifungal drugs, including azoles, echinocandins and amphotericin B. Radish Seed

Antifungal Peptide-2 (RSAFP2) is a compound discovered in radish seeds that interacts with fungal glucosylceramides and has been recently shown to be effective against Candida albicans in vitro and in vivo in a murine model.

RSAFP2 has only been tested against a limited number of fusaria, and their exact phylogenetic identities remain unknown. The complete genome of Nectria

Haematococca MPVI has coding regions that are likely glucosylceramides, suggesting that members of the FSSC may be susceptible to this antimicrobial compound. Antifungal susceptibility tests are currently underway in collaboration with the Antifungal Drug Unit of the Mycotic Diseases Branch of the CDC. Our goal is to investigate the efficacy of RSAFP2 against a phylogenetically diverse panel of fusaria, including the six most commonly encountred sequence types and other phylogenetically divergent fusaria within the genus from clinical sources. Testing will include FSSC isolates for which there are previously quantified measures of antifungal resistance.

Vita

Dylan Short

Personal Information

Born: April 18 1983, Pittsburgh, PA

Education

B.S., Biology, 2005, Pennsylvania State University, University Park, PA

Ph.D., Plant Pathology, 2011, Pennsylvania State University, University Park, PA

Honors and Awards

USDA National Needs Fellowship in Agricultural & Food Biosecurity, 2007-2009

Pennsylvania State University College of Agricultural Sciences Doctoral Competitive Grant Award, 2009

Pennsylvania State University Department of Plant Pathology Travel Award, 2009

Pennsylvania State University Department of Plant Pathology Henry W. Popp Award, 2010

USDA-NIFA Microbial Genomics Training Grant, 2010-2011

Association Memberships

American Phytopathological Society, Since 2007

Mycological Society of America, Since 2007

Current Research

Fungal phylogenetic diversity, genomics, systematics and evolution

Antifungal drug resistance

Teaching Experience

Biology of Fungi

Plant Microbe Interactions