Development of Microsatellite Markers for the Critically Endangered Frog Telmatobufo Bullocki and Cross-Species Amplification in Two Related Species
Total Page：16
File Type：pdf, Size：1020Kb
See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/263279904 Development of microsatellite markers for the critically endangered frog Telmatobufo bullocki and cross-species amplification in two related species Technical Report in Conservation Genetics Resources · June 2014 DOI: 10.1007/s12686-014-0231-7) CITATION READS 1 116 3 authors: Virginia Moreno-Puig Yeşerin Yıldırım Massey University Linnaeus University 6 PUBLICATIONS 168 CITATIONS 19 PUBLICATIONS 150 CITATIONS SEE PROFILE SEE PROFILE Dianne H Brunton Massey University, Auckland Campus 177 PUBLICATIONS 3,016 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Reintroduction biology of lizards (particularly Hoplodactylus Duvaucelii) View project PhD at Massey University, New Zealand View project All content following this page was uploaded by Yeşerin Yıldırım on 01 October 2014. The user has requested enhancement of the downloaded file. Conservation Genet Resour DOI 10.1007/s12686-014-0231-7 MICROSATELLITE LETTERS Development of microsatellite markers for the critically endangered frog Telmatobufo bullocki and cross-species amplification in two related species Virginia Moreno-Puig • Yes¸erin Yildirim • Dianne H. Brunton Received: 8 May 2014 / Accepted: 19 May 2014 Ó Springer Science+Business Media Dordrecht 2014 Abstract Fifteen microsatellite markers were developed Junior). Reads were screened for pure repeats, and primers for Telmatobufo bullocki, a critically endangered frog were designed using QDD v2.0 (Megle´cz et al. 2010). species from Chile. Genetic diversity that was assessed in Forward primers were modified with a M13(-21) tail, and 29 individuals from one location showed 3–19 alleles per three primers were used to fluorescently label amplicons locus. These markers were then tested for cross-species (Schuelke 2000). Fifty primer pairs were initially tested for amplification in two related and similarly threatened spe- amplification and polymorphism in seven individuals, cies. The markers will be used in genetic studies aiding the using gDNA extracted from buccal swabs of live frogs. management and conservation of T. bullocki. Loci that did not amplify consistently across these samples were discarded. The remaining 15 loci (Table 1) were Keywords Microsatellite loci Á Telmatobufo bullocki Á amplified and scored for a total of 29 individuals from one Cross-species amplification Á Callyptocephalellidae location (Elicura, Regio´n del Biobı´o). Amplification was performed in 12.5 ml reactions with Telmatobufo bullocki (Anura: Callyptocephalellidae) is a 1 9 PCR buffer, 2 mM MgCl2, 0.2 mM each dNTP, critically endangered (IUCN) frog endemic to Chile temperate 0.05 mM forward primer, 0.24 mM reverse primer, forests. Throughout its range, native forest has been exten- 0.2 mM fluorescence-labelled M13 primer, 2.0 U Amp- sively replaced and fragmented by exotic forestry plantations liTaq Gold 360 DNA Polymerase, 1.5 ml of DNA tem- (Fenolio et al. 2013). Urgent conservation research and action plate, and deionised water. PCR conditions were 5 min at is needed to effectively protect and manage remaining popu- 95 °C, 35 cycles of 30 s at 94 °C, 45 s at 56 °C, 45 s at lations. Microsatellite markers were developed to use in 72 °C, 15 cycles of 30 s at 94 °C, 45 s at 53 °C, and 45 s at conservation genetic studies of this species. 72 °C, and 10 min at 72 °C. PCR products were pooled Genomic DNA was isolated from ethanol preserved according to dye and size, and run in a ABI 3730 DNA tissue of T. bullocki, and pyrosequenced (Roche 454 GS Analyser. Alleles were manually scored using Geneious 7. Genotyping data was tested for errors and evidence for null alleles using MICRO-CHECKER v2.2.3 (Van Oosterhout et al. Electronic supplementary material The online version of this 2004). The number of alleles, expected and observed hetero- article (doi:10.1007/s12686-014-0231-7) contains supplementary material, which is available to authorized users. zygosities (Table 1), and deviations from Hardy–Weinberg Equilibrium (HWE) were calculated with GenoDive v2.0 V. Moreno-Puig (&) Á D. H. Brunton (Meirmans and Van Tienderen 2004). The average observed Ecology, Conservation and Behaviour Group, Institute of heterozygosity across all loci was H = 0.561. Locus Tbu28 Natural and Mathematical Sciences, Massey University, North o Shore Mail Centre, Private Bag 102904, Auckland, New Zealand and Tbu48 significantly deviated from HWE and showed e-mail: [email protected] homozygote excess, suggesting potential null alleles. There was no evidence for large allele dropout at any of the loci. No Y. Yildirim loci were in linkage disequilibrium after Bonferroni correction. New Zealand Institute for Advanced Study and Allan Wilson Centre for Molecular Ecology and Evolution, Massey Microsatellite loci were tested for cross-species ampli- University, Auckland, New Zealand fication and polymorphism in eight individuals of the 123 Conservation Genet Resour Table 1 Characterisation of microsatellite loci for T. bullocki 0 0 a Locus Primer sequence (5 –3 ) Repeat motif Size range Na Ho HE T. venustus C. gayi Tbu03 F: TAGCACAATGCGTTTTCCAG (TG)8 313–319 4 0.679 0.74 ? R: CTGGGAGTGTCCCCTAGACA Tbu06 F: TGTTTCAGGTCATGCAATGG (CA)11 117–125 4 0.321 0.395 ?? R: CCTTTGACATGGAACCAAGG Tbu19 F: AGCAATGGCAGGCTGAATAC (TCTA)13 212–288 19 0.893 0.942 R: CTCCTCTTGCCTGAAACCAG Tbu20 F: AAACCAGGATTTGAGGGAGG (ATCT)11 258–298 9 0.571 0.739 ?? R: GCACATGCTAGGGCTATTGG Tbu23 F: TTACCCAATCAAGTCCACCG (TG)12 221–227 4 0.586 0.632 ?? ? R: CCAATACTCTGCAAGCCACC Tbu24 F: CCCAATATCTGCACCAATCC (GT)10 158–168 5 0.655 0.597 ? R: GTGGTTTACAGTGGCAAGGG Tbu28 F: ATCTAATCTTTGCATGCGGG (TTA)10 120–132 5 0.259 0.498 R: CTCAACTGTATGGCGCTGTG Tbu33 F: GGCTGGCTAAATCCATTGTC (CT)9 238–253 6 0.571 0.663 ?? R: GACAGGGCAAAGAAATGACG Tbu34 F: CCTCCAGTCTAAATGGGTTGC (AG)10 156–166 6 0.379 0.48 ?? R: CTGCTTTGCCCTTTGAATTG Tbu35 F: AATGAATGTGGCTAAGGTGTATG (ATCT)8 190–214 7 0.793 0.768 ?? R: TCTACAGCCTCTCCAAGCCC Tbu39 F: GGTATTGGCTGCACCTTGAC (TTTA)6 249–261 4 0.375 0.389 R: TCACAAAGCAAGGACTGTTCC Tbu42 F: AAATTTGCAGCTGGTATCTTTC (TTAT)6 117–125 3 0.414 0.424 ?? R: CAGGAACATCACGTGCAATAAG Tbu44 F: ATGGTATGTGCTACGGTGGG (CA)11 216–218 7 0.536 0.558 ?? ? R: AACAAATTGGGTGGTTGTTTG Tbu47 F: TAAATTCACATGGTTCCCGC (TG)8 171–181 6 0.643 0.532 ?? ? R: TCCTGAGGACTGCAATCAGAC Tbu48 F: TTGGCAGAAGCGACAGACTC (AC)13 125–153 9 0.607 0.838 ?? ? R: TAATCCGGCCCAATACAACC Na number of alleles, Ho observed and HE expected heterozygosity, ? successful amplification, ?? successful amplification and polymorphic a Includes M13(-21) tail closely related Telmatobufo venustus. Amplification only conservation of a Gondwana legacy: Bullock’s false toad, was tested in two samples of C. gayi (Table 1). Telmatobufo bullocki (Amphibia: Anura: Calyptocephalellidae). Herpetol Rev 44(4):583–590 Megle´cz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, Acknowledgments Funded by the European Association of Zoos Martin J-F (2010) QDD: a user-friendly program to select and Aquaria and Auckland Zoo Conservation Fund. We thank to Paul microsatellite markers and design primers from large sequencing B. Rainey and Heather Hendrickson for access to lab space and projects. Bioinformatics 26(3):403–404. doi:10.1093/bioinfor Claudio Correa for providing DNA samples. Thanks to Forestal Ar- matics/btp670 auco S.A. for access permits and to Zoolo´gico Nacional de Chile and Meirmans PG, Van Tienderen PH (2004) GENOTYPE and GENO- Dante´ Fenolio for assistance with captive animal sampling. Research DIVE: two programs for the analysis of genetic diversity of permit provided by Servicio Agrı´cola y Ganadero (N86977). asexual organisms. Mol Ecol Notes 4(4):792–794. doi:10.1111/j. 1471-8286.2004.00770.x Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol 18(2):233–234 References Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) Micro-checker: software for identifying and correcting genotyp- ing errors in microsatellite data. Mol Ecol Notes 4(3):535–538. Fenolio DB, Moreno-Puig V, Levy MG, Nun˜ez JJ, Lamar WW, Fabry doi:10.1111/j.1471-8286.2004.00684.x MO, Tirado MS, Crump ML, Charrier A (2013) Status and 123 View publication stats.