Human Cancer Biology

S100A2 Induces Metastasis in Non ^ Small Cell Lung Cancer Etmar Bulk,1Bu« lent Sargin,1Utz Krug,1Antje Hascher,1Yu Jun,1Markus Knop,1Claus Kerkhoff,2 Volker Gerke, 3 Ruediger Liersch,1Rolf M. Mesters,1Marc Hotfilder,4 Alessandro Marra,6 Steffen Koschmieder,1Martin Dugas,5 Wolfgang E. Berdel,1Hubert Serve,1 and Carsten Mu« ller-Tidow1

Abstract Purpose: S100 proteins are implicated in metastasis development in several cancers. In this study, we analyzed the prognostic role of mRNA levels of all S100 proteins in early stage non ^ small cell lung cancer (NSCLC) patients as well as the pathogenetic of S100A2 in the development of metastasis in NSCLC. Experimental Design: Microarray data from a large NSCLC patient cohort was analyzed for the prognostic role of S100 proteins for survival in surgically resected NSCLC. Metastatic potential of the S10 0A2 gene was analyzed in vitro and in a lung cancer mouse model in vivo.Overexpression and RNAi approaches were used for analysis of the biological functions of S100A2. Results: High mRNA expression levels of several S100 proteins and especially S100A2 were associated with poor survival in surgically resected NSCLC patients. Upon stable transfection into NSCLC cell lines, S100A2 did not alter proliferation. However, S100A2 enhanced transwell migration as well as transendothelial migration in vitro. NOD/SCID mice injected s.c. with NSCLC cells overexpressing S100A2 developed significantly more distant metastasis (64%) than mice with control vector transfected tumor cells (17%; P < 0.05).When mice with S100A2 expressing tumors were treated i.v. with shRNA against S100A2, these mice developed significantly fewer lung metastasis than mice treated with control shRNA (P =0.021). Conclusions: These findings identify S100A2 as a strong metastasis inducer in vivo. S100A2 might be a potential biomarker as well as a novel therapeutic target in NSCLC metastasis.

Lung cancer is the leading cause of cancer death. Less than The S100 protein familyis a multigenic group of non- 20% of patients with non–small cell lung cancer (NSCLC) ubiquitous cytoplasmic EF-hand Ca2+-binding proteins com- survive 5 years (1, 2). The development of metastasis after prising 21 known human members each coded bya separate initial surgeryis the main reason for cancer related death in gene. At least 16 of these genes cluster to chromosome 1q21, earlystage NSCLC. The process of metastasis is still not known as the epidermal differentiation complex (6). Theyare completelyresolved, although several metastasis models exist differentiallyexpressed in a wide varietyof cell typesand have in vivo (3). Several steps are required for the metastatic process: been reported to be involved in the regulation of inflammatory Initially, tumor cells must invade into the surrounding tumor responses (7) and in cellular processes such as cell-cycle tissue, enter either the lymphatics or the bloodstream and progression and differentiation (8). Expression of several extravasate into a new tissue to settle and grow at this new site. S100 proteins seems to be altered in different types of cancers Currently, these steps can partially be reproduced in vitro using including lung adenocarcinomas (9–11). In addition, some assays for invasion and migration (4, 5). S100 proteins have been shown to be associated with metastasis (12–18). In 1989, Ebralidze et al. (14) indicated that the S100 protein S100A4 (mts1) is involved in regulating Authors’ Affiliations: Departments of 1Medicine, Hematology and Oncology, the metastatic behavior of tumor cells. Recently, we reported 2Experimental Dermatology, 3Medical Biochemistry, 4Pediatric Hematology and S100P and S100A2 overexpression in a small set of metasta- 5 Oncology, and Medical Informatics and Biomathematics University of Mu« nster, sizing tumors (12). Mu« nster, Germany; and the 6Department of Thoracic Surgery, Klinikum St. Georg, Osterkappeln, Germany An additional indication for their involvement in inflamma- Received 4/11/08; revised 7/29/08; accepted 7/30/08. toryand neoplastic disorders is that most S100 genes are found Grant support: Non ^ small cell lung cancer research in our laboratory is funded by near a break-point region on human chromosome 1q21, the Deutsche Forschungsgemeinschaft and the Deutsche Krebshilfe. This project which, if affected, is responsible for a number of genetic was partially supported by theWilhelm Sander-Stiftung. abnormalities related to autoimmune pathologies or cancer The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance (6). Although the function of S100 proteins in cancer cells is with 18 U.S.C. Section 1734 solely to indicate this fact. still unknown, the specific expression patterns of these proteins Requests for reprints: Carsten Mu« ller-Tidow, Department of Medicine A, are a valuable prognostic tool (19). Hematology and Oncology, University of Mu« nster, Domagkstr. 3, 48129 Mu« nster, Concerning S100A2, conflicting results have been pub- Germany. Phone: 49-251-835-2995; Fax: 49-251-835-2673; E-mail: muellerc@ uni-muenster.de. lished. Feng et al. (20) suggested S100A2 to be a putative F 2009 American Association for Cancer Research. tumor suppressor at an earlystage of human lung carcino- doi:10.1158/1078-0432.CCR-08-0953 genesis. Other groups described an association between the

Clin Cancer Res 2009;15(1) January 1, 2009 22 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. S100A2 Overexpression Induces Metastasis in NSCLC

fused at the NH2 terminus with enhanced green fluorescent protein Translational Relevance (EGFP). Stable transfection of the cloned construct into HTB56 (Calu6) was done with Lipofectamine reagent (Invitrogen) and selected with Distant metastasis is a major contributor to cancer relat- Neomycin (G418/Sigma). Bulk cultures were used for all experiments to ed death. Here, we identify S100A2 as a prometastatic avoid clone-specific effects. Expression levels were determined by gene in patients with non ^ small cell lung cancer (NSCLC): quantitative real-time reverse transcription-PCR, Western blotting, and High S100A2 expression is closely linked to poor survival Flow cytometry. Silencing of gene expression was achieved using shRNA in surgically resected NSCLC. Expression of S100A2 in technology. Oligonucleotides targeting S100A2 (sense, GATGAGAA- CAGTGACCAGCAG; antisense, CTGCTGGTCACTGTTCTCATC; loop, NSCLC cell lines induces a highly metastatic phenotype in TTGATATCCG) and the scrambled control (sense, AGATCCGTATAGTG- a murine xenograft model. Repression of S100A2 reverts TACCTTA; antisense, TAAGGTACACTATACGGATCT; loop, TTGA- the metastatic phenotype in vivo indicating that S100A2 TATCCG) were synthesized by Invitrogen, were annealed, and were is primarily responsible for metastasis development. These cloned into the shRNA expression vector pRNAT-H1.1/Neo (GenScript). findings suggest that S100A2 is an important contributor HTB58 cells were transfected and selected as described above. Expression to metastasis development in NSCLC. It might be possible levels were verified byquantitative real-time reverse transcription-PCR. to use S100A2 as a biomarker for metastasis risk and as a Gene expression analysis. Analysis of gene expression was done therapeutic target to specifically inhibit metastasis develop- using quantitative reverse transcription-PCR as described (24). The ment. primer and probe (FAM and TAMRA labeled) used were as follows: S100A2 forward (5¶- CTGGGTCTGTCTCTGCCACC), reverse (5¶-GCAG- GAGTACTTGTGGAAGGTAGTG), and probe (5¶- FAM-TGCCACAGATC- CATGATGTGCAGTTCT-TAMRA). The mRNA expression levels were down-regulation of S100A2 and the development of melano- calculated with regard to the internal standard of glyceraldehyde-3- ma (16) and other malignant cells (21). phosphate dehydrogenase as described (25). In this study, we analyzed the prognostic role of mRNA levels Western blot analysis. Proteins were detected using the following of all S100 proteins in earlystage NSCLC patients. S100A2 antibodies: S100A2 (Abcam), GFP (Santa Cruz), Stat5 (Santa Cruz), and Actin (Sigma-Aldrich) as first antibodies, Goat anti-mouse and emerged as a gene that is closelyassociated with poor survival Goat anti-rabbit (both from Dianova) as secondaryantibodies. Western in surgicallyresected NSCLC. S100A2 also induced a metastatic blot analysis was carried out as described (24). in vitro in vivo phenotype and indicating a prominent role for 3[H]-thymidine incorporation. A total of 2 Â 104 stablytransfected S100A2 in the metastatic process in NSCLC. HTB56 cells were incubated overnight at 37jC and 5% CO2 with 200 AL medium (Modified Eagle’s medium with 0.5% FCS) in a 96-well plate. The next day0.037 Mbq (1 ACi) 3[H]-thymidine was added to Materials and Methods each well, and cells were incubated for additional 8 h. Cells were harvested onto glass fiber filters, and h-emission of bound DNA was Patient data and statistical analysis of patient data. The mRNA analyzed by the Wallac 1450 microh liquid scintillation counter. The expression data for S100 proteins as analyzed by Affymetrix microarrays data represent the mean of three independent experiments done in was extracted from the National Center for BiotechnologyInformation hexaplets. Gene Expression Omnibus (22). A total of 196 patients (male, 123; Migration assay. A total of 5 Â 105 cells (in 100 AL Modified Eagle’s female, 72; missing, 1) were analyzed. Adenocarcinoma was diagnosed in medium with 5% FCS) were seeded into the upper part of a Transwell 138 patients and squamous cell carcinoma in 58 patients. Additional chamber (transwell filter inserts in 6.5 mm diameter with a pore size of patient information data were kindlyprovided byDrs. A. Potti and 5 Am; Corning, Inc.), which was 30 min precoated with 50 Ag J.R. Nevins (Duke University, Durham, NC). Most patients were fibronectin. In the lower part of the chamber, 600 AL Modified Eagle’s diagnosed with stage I disease (stage I, 120 patient; stage II, 12 patients; medium with 20% FCS (a serum gradient was used as chemoattractant) stage 3A, 11 patients; stage 3B, 8 patients; stage 4, 22 patients; missing was added and the assaywas done for 16 h at 37 jC and 5% CO2 before information, 23 patients). Additional information on the patient cohort migrated cells were analyzed by flow cytometry. For the migration assay can be found in the original publication (23). Expression data for S100 using transendothelial cells, transwell filters were precoated with 2.2 Â 5 proteins [S100A11, S100A10, S100A13 (two probesets), S100A8 (two 10 HMEC-1 cells for 48 h at 37jC and 3% CO2, forming a confluent probesets), S100A4, S100A9, S100A2, S100P, S100A1, S100A12, S100A7, transendothelial cell layer (5). NSCLC cells (5 Â 105) were stained for S100A3, S100A5, S100G, S100A11, S100B, S100A6, S100A14, S100PBP] 5 min with 5 Amol/L SNARF (1 carboxylic acid, acetate, succinimidyl were extracted from the normalized data based on the respective ester; Molecular Probes) to avoid counting fragments of endothelial Affymetrix gene identifiers and loaded into SPSS 14.0 (SPSS, Inc.). cells and added to the upper part of the transwell chamber coated with Expression data of all the probesets was analyzed for overall survival transendothelial cells. After 16 h of migration, cells were harvested by differences using a stepwise (Wald) Cox regression analysis that was trypsinization and analyzed (only SNARF-positive cells) by flow stratified for patients’ stage at the time of diagnosis. Kaplan Meier plots at cytometry. All assays were done in triplicate and independently done the 75th percentile of expression were calculated and evaluated using the for thrice. log-rank test. S100PBP is not a real S100 protein. Its exclusion from the Metastasis experiments in vivo. For all mouse experiments, we used Cox regression analysis did not alter the results (data not shown). 8- to 10-wk-old NOD.CB17-Prkdc/J [NOD/severe combined Cell culture. HTB56 and HTB58 lung adenocarcinoma cells were immunodeficient (SCID)] mice obtained from Charles River.

cultured at 37jC, high humidity, and 5% CO2 in Modified Eagle’s To analyze metastasis development following primary tumor medium (Invitrogen). The medium was supplemented with 10% FCS, removal, 2.5 Â 106 stablytransfected NSCLC cells (supplemented in 1% streptomycin and penicillin, 1% glutamine, 1% sodium pyruvate, 200 AL PBS) were injected s.c. into the right flank. After 4 wk of tumor and 1% nonessential amino acid. HMEC-1 cells were cultured at 37jC, growth, primarytumors were surgicallyremoved and the tumor weight

high humidity, and 3% CO2 using MCDB 131 medium (Invitrogen) (grams) was determined. Mice were followed for 8 additional wk with 1% streptomycin and penicillin, 5% glutamine, 10% FCS Gold, (12 wk after initial tumor injection). At this time, mice were sacrificed, and 50 Ag/mL gentamicin. and tumor weight and metastasis development was determined. Cloning and transfection. The coding sequence of S100A2 Metastasis development was evaluated bycounting individual (NM_005978) was cloned into the expression vector pcDNA3.1(+), metastatic nodules. For histologic analyses, the lungs were fixed in

www.aacrjournals.org 23 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Human Cancer Biology

Fig. 1. High expression levels of S100A2 are associated with inferior survival in patients with early stage NSCLC.A, Kaplan-Meier survival curves of NSCLC patients differing in S100 protein mRNA expression. The shown S100 proteins were selected based on their significant association with NSCLC survival in Cox regression analysis. Kaplan-Meier plots were statistically evaluated using the log-rank test. B, fraction of surviving patients based on low or high mRNA expression levels for S100A2. More than half of the patients with high S100A2 levels died during follow up, which is in contrast to patients with low levels of S100A2 (P =0.031;m2 test). C, phylogenetic tree of S100 proteins. The relationship between the different S100 proteins is indicated. Please note that S100P does not have a murine homologue (_hu, human; _mu, murine). The phylogenetic tree of S100 proteins was calculated using the Phylogeny Interference Package Phylip (47). S100 proteins whose mRNA expression was identified to be survival associated in the cox regression analysis are marked in bold and are underlined. 4% paraformaldehyde. To analyze shRNA effects on metastasis cells, dissolved in 200 AL PBS) were injected i.v. into the tail vein. One development upon i.v. tumor cell injection, NOD/SCID mice were week after transplantation, 20 Ag shRNA (dissolved in 250 AL PBS) were irradiated with a single dose of 3.5 Gyfrom a cobalt-60 unit 1 d before i.v. injected. Treatment with shRNA was repeated four times every transplantation. A total of 2 Â 106 stable transfected cells (EGFP-control fourth day. Subsequent to the treatment, mice were followed for an

Clin Cancer Res 2009;15(1) January 1, 2009 24 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. S100A2 Overexpression Induces Metastasis in NSCLC

additional 5 wk before metastasis development was analyzed. In a few stated together with the P value. When more than two groups were cases, mice died: 1 mouse transplanted with the S100A2-transfected compared, one wayANOVA was used. A P value of <0.05 was HTB 56 cells died during surgery, 2 other mice died the following day considered significant. after theywere i.v. injected with overexpressing cells for S100A2. Therefore, the number of the mice differs byone or two. None of the mice died in the week after shRNA injection. In all experiments, Results treatment groups were randomized to prevent cage effects. Statistical analysis. All experimental data are shown as mean plus Subsequent to surgery, death in early stage NSCLC can in SD if not indicated otherwise. The mean values of two groups were most cases be attributed to metastasis development (25). compared by t test. In the few cases where the variances differed Several S100 proteins have been implicated in metastasis, but significantly, the nonparametric Mann-Whitney U test was used and a general assessment has been missing. Therefore, we analyzed

Fig. 2. S100A2 overexpression in NSCLC cells enhances transendothelial migration in vitro. A, HTB56 lung adenocarcinoma cells were transfected with either EGFP-S100A2 or EGFP alone and expression on the protein level was confirmed by Western blot analysis. Protein expression of S100A2 was observed only in the overexpressing cell line of S100A2. No S100A2 expression was detectable on the endogenous level. B, real-time reverse transcription-PCR indicated f3-fold higher mRNA levels of S100A2 in HTB56 cells compared with nontransfected and HTB56-EGFP cells.This difference indicates nonexcessive overexpression upon transfection. Columns, mean of two independent experiments; bars. SD. C, flow cytometry of EGFP expression in Fluorescence 1 channel (Fl-1) indicated that the vast majority of the transfected and selected cells do express EGFP or EGFP-S100A2. In addition, levels of fluorescence indicating EGFP expression was comparable between HTB56-EGFP and HTB56-S100A2 cells. Nontransfected HTB56 was nonfluorescend. D, 3[H]-thymidine assay of stably transfected cells showed similar proliferation kinetics between S100A2 overexpressing and control cells. Columns, mean of two independent experiments each done in six wells; bars, SF. E, migration activity is increased in cells overexpressing S100A2. Left, transwell migration of stably transfected HTB56 cells. An FCS gradient of 5% to 20% was used for the upper to the lower chamber.The percentage of migrated cells isshowninrelationtotheEGFPcontrolcellline. Analysis was done using flow cytometry. Experiments were done in triplets and independently repeated twice. Right, transendothelial migration: Transwell filters were overgrown for 48 h with 2.2 Â 10 5 HMEC-1cells forming a confluent transendothelial cell layer, before adding stably transfected cells (stained with SNARF). Only SNARF-positive cells were analyzed using flow cytometry after 16-h migration. Columns, mean of independent experiments each done in triplicate (t test); bars, SD.

www.aacrjournals.org 25 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Human Cancer Biology

analysis, high expression levels of S100A2 (P = 0.001), S100P (P = 0.009), S100A12 (P = 0.002), and S100B (P = 0.026) were independentlyassociated with poor prognosis. The association between gene expression and survival for these genes was subsequentlyassessed in Kaplan-Meier plots. Patient samples with high S100A2 expression (>75th percentile) showed a significantlyinferior overall survival compared with low-level expressing patients (Fig. 1A). Differences for S100P and S100A2 were marginallysignificant, whereas no survival differences were found for different levels of S100B expression (Fig. 1A, bottom left). Overall, 41.9% (62 of 148 patients) of the patients with low-level expression of S100A2 died, whereas 60.4% of patients with high expression died (P = 0.031; Fig. 1B). The phylogenetic tree of human and murine S100 proteins is shown in Fig. 1C. Interestingly, S100A2 is related to S100A4, a known metastasis inducing gene (13–15). Because these findings indicated a potentiallyspecific role for S100A2 in metastasis, we further analyzed the metastatic properties of S100A2. First, we expressed S100A2 in the HTB56 adenocarcinoma cell line, which is onlyweakly metastatic. Establishing a stable cell line of HTB56 expressing S100A2 was achieved bycloning this gene, fused with EGFP, into the expression vector pcDNA3.1(+). As control cells, we used HTB56 cells expressing EGFP alone. After transfection into HTB56, cells were selected with Neomycin and sorted by flow cytometry. Bulk cultures were used to avoid clone specific effects. S100A2 expression was verified byWestern blotting, real-time PCR, and flow cytometry. Both cell lines expressing S100A2-EGFP and EGFP alone showed a corresponding band on the protein level using a GFP antibody(Fig. 2A). Over- expression of S100A2 was confirmed both on the protein and on the mRNA level (Fig. 2A and B). Flow cytometry analysis displayed at least 90% EGFP positivity of the bulk culture (Fig. 2C). In relation to the control cell line, no alteration regarding growth properties or proliferative capacitywas recognized in the cell line overexpressing S100A2 (data not shown; Fig. 2D). To analyze migration, we used a two-chamber assay(Transwell chamber) where cells migrate through a microporous filter from the upper into the lower chamber. To mimic the in vivo situation, we also did assays in which the cells had to migrate through an endothelial monolayer grown on the microporous filter. In both sets of migration experiments, S100A2 significantly enhanced migration, i.e., transwell migration as well as Fig. 3. Metastasis development after primary tumor resection in NOD/SCID mice. A, metastasis development in the NOD/SCID mouse model. NOD/SCID mice were transwell migration through an endothelial layer toward a injected s.c. with 2.5 Â 10 6 stably transfected NSCLC cells. Four weeks after s.c. serum gradient, compared with the control cells expressing only inoculation of tumor cells, the tumor nodule was surgically removed. Mice were P t followed for 8 additional week before macroscopic and histologic analysis. B, EGFP ( < 0.005, test; Fig. 2E). differences in metastasis development between HTB56-EGFP and HTB56-S100A2 Because in vitro experiments cannot recapitulate the com- cells. Mice with S100A2 overexpressing tumors developed significantly more plexityof metastasis, we used a recentlyestablished metastasis metastasis than mice inoculated with EGFP-expressing control tumors. Filled bars, number of mice that developed lung metastasis (P = 0.036; Fischer’s exact test, model (27) that involved surgical removal after tumor two groups). C, lung metastasis in mice. Photographs from lung were taken formation resembling earlystage NSCLC treatment (Fig. 3A). 8 wk after tumor resection; black arrows, visible metastases. After transplantation of 2.5 Â 106 stable NSCLC cells (HTB56 cells expressing EGFP or S100A2-EGFP) into the right flank of NOD/SCID mice, tumor growth was monitored for 4 weeks. a large microarrayexpression data set of surgicallyresected Afterwards, the tumor nodule was surgicallyremoved. In NSCLC with respect to the association between S100 mRNA contrast to our previous findings regarding S100P, neoangio- levels and lung cancer related death in earlyNSCLC. genesis was not significantlyenhanced in tumors overexpress- To identifysurvival associated S100 proteins in this data set, ing S100A2 (data not shown). we did an exploratoryanalysiswith a stage adjusted Cox Subsequent to the surgery, the mice were monitored for regression model with all S100 proteins whose mRNA 8 additional weeks. At this, time lungs and other organs were expression was analyzed bythe microarraydata. In this analyzed for the development of distant metastasis. Distant

Clin Cancer Res 2009;15(1) January 1, 2009 26 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. S100A2 Overexpression Induces Metastasis in NSCLC metastasis developed in 17% (2 of 12 mice developed lung fourth dayfor a total of four injections. In parallel experiments, metastasis) of control gene–transfected HTB56 cells. In 10 mice each were treated with shRNA against S100A2 or the contrast, metastasis formation was >3-fold increased in mice scrambled control. Six weeks after i.v. injection of HTB56-EGFP initiallytransplanted with the S100A2-transfected HTB56 cells cells, the lungs of the mice treated with scrambled shRNA were with 64% (7 of 11) of the mice with S100A2-expressing tumors all infiltrated with metastasis. In all mice (10 of 10) lungs were developing metastasis (Fig. 3B and C). penetrated with at least 3 and up to 11 metastases. In contrast, Next, we analyzed whether shRNA directed against S100A2 25% of mice (2 of 8) treated with shRNA against S100A2 did could be used to reduce metastasis development in S100A2- not develop metastases (Fig. 4D). Furthermore, the numbers of expressing tumors. First, shRNAs against S100A2 or the metastasis was significantlydecreased in these mice, treated scrambled version (control) were tested in vitro. HTB58 cells with shRNA against S100A2 (P = 0.021, t test; Fig. 4E). The were used in these experiments because these expressed treatment with shRNA against S100A2 reduced the metastasis relativelyhigh levels of S100A2. HTB58 cells stablytransfected counts in the lungs by f70%. These results suggested that with shRNA against S100A2 (cloned into the siRNA expression S100A2 was relevant for metastasis development in this mouse vector pRNAT-H1.1/Neo) were found to suppress S100A2 at model. the mRNA level (Fig. 4A). In addition, endogenous S100A2 protein expression was stronglyreduced in cells transfected Discussion with shRNA against S100A2 compared with the control cells (Fig. 4B and C). Metastasis is the most common cause for tumor-related After the identification of active and specific shRNA against death. In lung cancer as well as in other common cancers such S100A2, a total of 2 Â 106 HTB56 cells were injected i.v. into as breast and colon, patient prognosis ultimatelydepends on the tail vein of a NOD/SCID mouse. One week after the occurrence or absence of metastasis (28). Metastasis is a transplantation, 20 Ag shRNA (dissolved in 250 AL PBS) was complex phenomenon that is still not well-understood. i.v. injected. The treatment with shRNA was repeated every Preliminarystudies show that metastasis is not onlydependent

Fig. 4. shRNA for S100A2 reduces metastasis after i.v. injection of tumor cells. A, down-regulationof S100A2 onthemRNA level. Stably transfected HTB58 cells expressing low levels of S100A2 were analyzed using quantitative real-time reverse transcription-PCR.Total RNAwas isolated from transfected cells and transcribed into cDNA. Expression of S100A2 was verified using primer and probe targeting S100A2. Columns, mean of two independent experiments; bars, SD. B, protein expression is reduced in HTB58 cells stably transfected with shRNA against S100A2.Whole cell lysates of cells transfectedeither withshRNA for S100A2 or the control shRNA (scrambled) were used forWestern blot analysis. Antibodies against S100A2 (Abcam) and Actin (Sigma-Aldrich) as a loading control were used. C, densitometry of theWestern blot analysis, showing the reduced S100A2 expression using shRNA against S100A2. Absorbance between scrambled and sh-S100A2 is 0.746 against 0.086. D, shRNA for S100A2 prevents metastasis development in mice. NOD/SCIDmice i.v. injected with HTB56 NSCLC cells expressing EGFP and endogenous S100A2 were treated 5 times with 20 Ag shRNA-S100A2 (n =8)orthe scrambled control (n =10).Sixweeksafter i.v. injection of EGFP-HTB56 cells, the mice were sacrificed. Left, 2of8mice(25%) treated with shRNA-S100A2 developed no metastasis, whereas allmice (10of10;100%) treated with the scrambled shRNA developed metastasis. Right, lungs from mice treated with shRNA for S100A2 or the scrambled control. Representative example of the mice not showing metastasis. Arrows, metastasis. E, aboxplotdiagramof the number of metastasis for each mouse. The number of metastasis was significantly reduced in mice treated with shRNA against S100A2 (P =0.021;t test).

www.aacrjournals.org 27 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Human Cancer Biology on an individual gene; rather it seems that complex networks S100A2 enhanced migration and transendothelial migration are involved in this process. Recently, our group and others in vitro. Importantly, in a xenograft mouse model, distant identified metastasis-related genes using mircroarrayexpression metastasis was found to be >3-fold increased in mice with analysis and other genome wide techniques (12, 23, 29, 30). S100A2-expressing tumors. We could show that S100 proteins, in particular S100A2 or Often, the process of metastasis is described to be associated S100P, were associated with a significantlyincreased risk for with the recruitment of new blood vessels, angiogenesis NSCLC patients to develop distant metastasis (12). It is (43–46). No significant increase in blood vessel formation in interesting to note that several S100 proteins are overexpressed tumor samples from our mice positive for metastasis could be in human tumors (9, 16, 31–37) and that this expression observed. Indeed, the vessel area per visual field was increased, correlates with tumor progression (15, 38–40) and metastasis but compared with our recent results with S100P (27), no (12–14, 17). In the current study, we used a large data set of significant association between metastasis and angiogenesis was NSCLC patients to identifymetastasis associated S100 proteins. observed. Nonetheless, S100A2 was functionallyimportant in We also analyzed the similarities between metastasis-associated metastasis development because in vivo treatment with shRNA and other S100 proteins. Phylogenetic tree algorithms do not against S100A2 inhibited metastasis development. cluster metastatic versus nonmetastatic S100 proteins. Rather, Taken together, our studies provide evidence that S100A2 specific nonconserved domains might be relevant. plays an important role in metastasis development and, thus, Our previous microarrayanalysesimplicated S100A2 as a could be a valuable drug target. Its close association with metastasis-associated gene (12). Other studies had reported patient survival in independent data sets further highlights its conflicting results indicative of either tumor-suppressive or potential importance and its usabilityas a biomarker. Because tumor-promoting functions of S100A2 (20, 41, 42). The close S100A2 did not induce angiogenesis, the mode of action of association between S100A2 expression and metastasis/death in S100A2 might differ, at least in part, from S100P. a large, independent data set from the group of A. Potti and JR Nevins (23) now provides additional evidence for the metasta- DisclosureofPotentialConflictsofInterest sis-associated phenotype of S100A2. These analyses are in accordance with recentlypublished data (11). The authors No potential conflicts of interest were disclosed. observed increased expression of S100A2 in early-stage tumors of patients with NSCLC. Manylung adenocarcinomas expressed S100A2 (41). Correlation of S100A2 with progression and poor Acknowledgments prognosis was also reported for pancreatic cancer (42). We thank Dr. J.R. Nevins and Dr. A. Potti from the Duke Institute for Genome Based on these findings, we analyzed the involvement of Sciences and Policy, Duke University, Durham, North Carolina for providing us S100A2 in prometastatic functions in vitro and in vivo. Indeed, clinical data from NSCLC patients that were analyzed in microarray experiments.

References 1. Herbst RS, Bunn PA, Jr. Targeting the epidermal 10. Beer DG, Kardia SL, Huang CC, et al. Gene-expres- associated proteins in non-small cell lung cancer by growth factor receptor in non-small cell lung cancer. sion profiles predict survival of patients with lung ade- comparative proteomic analysis. Cancer Sci 2007;98: Clin Cancer Res 2003;9:5813^24. nocarcinoma. Nat Med 2002;8:816^ 24. 1265^74. 2. Jemal A, Murray T,Ward E, et al. Cancer Statistics, 11. BartlingB,RehbeinG,SchmittWD,HofmannHS, 19. HeizmannCW,FritzG,SchaferBW.S100proteins: 2005. CA Cancer J Clin 2005;55:10^30. Silber RE, Simm A. S100A2 ^ 100P expression profile structure, functions and pathology. Front Biosci 2002; 3. Steeg PS. Tumor metastasis: mechanistic insights and diagnosis of non-small cell lung carcinoma: im- 7:d1356 ^ 68. and clinical challenges. Nat Med 2006;12:895 ^ 904. pairment by advanced tumor stages and neoadjuvant 20. Feng G, Xu X,Youssef EM, Lotan R. Diminished Ex- 4. Melchiori A, Albini A, Ray MJ, Stetler-Stevenson chemotherapy. Eur J Cancer 2007;43:1935^ 43. pression of S100A2, a Putative Tumor Suppressor, at WG. Inhibition of tumor cell invasion by a highly con- 12. Diederichs S, Bulk E, Steffen B, et al. S100 family Early Stage of Human Lung Carcinogenesis. Cancer served peptide sequence from the matrix metallopro- members and trypsinogens are predictors of distant Res 2001;61:7999^8004. teinase enzyme prosegment. Cancer Res 1992;52: metastasis and survival in early-stage non-small cell 21. Liu D, Rudland PS, Sibson, DR, Platt-Higgins A, 2353 ^ 6. lung cancer. Cancer Res 2004;64:5564 ^ 9. Barraclough R. Expression of calcium-binding protein 5. Kielbassa-Schnepp K, Strey A, Janning A, Missiaen 13. Garrett SG, Varney KM, Weber DJ, Bresnick AR. S100A2 in breast lesions. Br J Cancer 2000;83: L, Nilius B, Gerke V. Endothelial intracellular Ca2+ re- S100A4, a Mediator of Metastasis. J Biol Chem 1473 ^ 9. lease following monocyte adhesion is required for the 2006;281:677 ^ 80. 22. NCBI Gene Expression Omnibus (GEO) DataSets: transendothelial migration of monocytes. Cell Calcium 14. EbralidzeA,Tulchinsky E, Grigorian M, et al. Isolation Genomic approach to refine prognosis for adjuvant 2001;30:29 ^ 40. and characterization of a gene specifically expressed therapy in early stage non-small cell lung carcinoma 6. Mischke D, Korge BP, Marenholz I,Volz A, Ziegler A. in different metastatic cells and whose deduced gene (GSE3593 record). Genes encoding structural proteins of epidermal corni- product has a high degree of homology to a Ca2+- 23. Potti A, Mukherjee S, Petersen R, et al. A genomic fication and S100 calcium-binding proteins form a binding protein family. Genes Dev 1989;3:1086 ^ 93. strategy to refine prognosis in early-stage non-small- gene complex (‘‘epidermal differentiation complex’’) 15. Helfman DM, Kim EJ, Lukanidin E, Grigorian M.The cell lung cancer. N Engl J Med 2006;355:570 ^ 80. on human chromosome 1q21. J Invest Dermatol 1996; metastasis associated protein S100A4: role in tumor 24. Schwa« ble J, Choudhary C, Thiede C, et al. RGS2 is 106:989^92. progression and metastasis. Br J Cancer 2005;92: an important target gene of Flt3-ITD mutations in 7. Nacken W, Roth J, Sorg C, Kerkhoff C. S100A9/ 19 55 ^ 8. AML and functions in myeloid differentiation and leu- S100A8: Myeloid representatives of the S100 protein 16. Maelandsmo GM, Florenes VA, Mellingsaeter T, kemic transformation. Blood 2005;105:2107 ^ 14. family as prominent players in innate immunity. Hovig E, Kerbel RS, Fodstad O. Differential expression 25. Mu« ller-Tidow C, Diederichs S, Bulk E, et al. Identifi- Microsc ResTech 2003;60:569 ^ 80. patterns of S100A2, S100A4 and S100A6 during pro- cation of metastasis-associated receptor tyrosine 8. Donato R. Intracellular and extracellular roles of S100 gression of human malignant melanoma. Int J Cancer kinases in non-small cell lung cancer. Cancer Res proteins. Microsc ResTech 2003;60:540 ^ 51. 1997;74:464^9. 2005;65:1778 ^ 82. 9. Arai K,Teratani T, Nozawa R,YamadaT. Immunohisto- 17. Wang G, Platt-Higgins A, Carroll J, et al. Induction of 26. Dowen SE, Crnogorac-JurcevicT, Gangeswaran R, chemical investigation of S100A9 expression in pul- metastasis by S100P in a rat mammary model and its et al. Expression of S100P and its novel binding part- monary adenocarcinoma: S100A9 expression is association with poor survival of breast cancer ner S100PBPR in early pancreatic cancer. Am J Pathol associated with tumor differentiation. Oncol Rep patients. Cancer Res 2006;66:1199 ^ 207. 2005;166:81 ^ 92. 2001;8:591 ^ 6. 18. TianT, Hao J, Xu A, et al. Determination of metastasis- 27. Bulk E, HascherA, Liersch R, et al. Adjuvant therapy

Clin Cancer Res 2009;15(1) January 1, 2009 28 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. S100A2 Overexpression Induces Metastasis in NSCLC

with small hairpin RNAi prevents NSCLC development sion of S100A6 and S100A4 in matched samples of growth, survival, and invasion. Clin Cancer Res in mice. Cancer Res 2008;68:1896 ^ 904. human colorectal mucosa, primary colorectal adeno- 2005;11:5356^64. 28. ChangY,Wu C, LeeY. Surgical treatment of sychron- carcinomas and liver metastases. Oncology 2002;63: 41. Smith SL, Gugger M, Hoban P, et al. S100A2 is ous multiple primary lung cancers: Experience of 92 192 ^ 20 0. strongly expressed in airway basal cells, prenoplastic patients. J Thorac Cardiovasc Surg 2007;134:630 ^ 7. 35. El-Rifai W, Moskaluk CA, Abdrabbo MK, et al. Gas- bronchial lesions and primary non-small cell lung car- 29. Raponi M, ZhangY,YuJ, et al. Gene expression sig- tric cancers overexpress S100A calcium-binding pro- cinomas. Br J Cancer 2004;91:1515 ^ 24. natures for predicting prognosis of squamous cell and teins. Cancer Res 2002;62:6823^ 6. 42. Ohuchida K, Mizumoto K, Miyasaka Y, et al. Over- adenocarcinomas of the lung. Cancer Res 2006;66: 36. Seth A, Kitching R, Landberg G, Xu J, Zubovits J, expression of S100A2 in pancreatic cancer correlates 7466^72. Burger AM. Gene expression profiling of ductal carci- with progression and poor prognosis. J Pathol 2007; 30. LuY, LemonW, Liu PY, et al. A gene expression sig- nomas in situ and invasive breast tumors. Anticancer 213:275 ^ 82. nature predicts survival of patients with stage I non- Res 2003;23:2043 ^ 51. 43. Zetter BR. Angiogenesis and tumor metastasis. small cell lung cancer. PLoS Med 2006;3:e467. 37. Hsieh HL, Scha« fer BW, Sasaki N, Heizmann CW.Ex- Annu Rev Med 1998;49:407^24. 31. Logsdon CD, Simeone DM, Binkley C, et al. Molec- pression analysis of S100 proteins and RAGE in hu- 44. Folkman J. Role of angiogenesis in tumor growth ular profiling of pancreatic adenocarcinoma and man tumors using tissue microarrays. Biochem and metastasis. Semin Oncol 2002;29:15^ 8. chronic pancreatitis identifies multiple genes differen- Biophys Res Commun 2003;307:375 ^ 81. 45.Weidner N, Semple JP,Welch WR, Folkman J. Tumor tially regulatedin pancreatic cancer. Cancer Res 2003; 38. Harpio R, Einarsson R. S100 proteins as cancer bio- angiogenesis and metastasis-correlation in invasive 63:2649 ^ 57. markers with focus on S100B in malignant melanoma. breast carcinoma. N Engl J Med 1991;324:1 ^8. 32. Crnogorac-JurcevicT, Missiaglia E, Blaveri E, et al. Clin Biochem 2004;37:512^ 8. 46. Mori S, Ueda T, Kuratsu S, Hosono N, Izawa K, Molecularalterationsinpancreatic carcinoma:expression 39. Saleem M, Kweon M, Johnson JJ, et al. S100A4 Uchida A. Suppression of pulmonary metastasis by profiling shows that dysregulated expression of S100 accelerates tumorigenesis and invasion of human angiogenesis inhibitorTNP-470 in murine osteosarco- genes is highly prevalent. JPathol 2003;201:63 ^ 74. prostate cancer through the transcriptional regulation ma. Int J Cancer 1995;61:148 ^ 52. 33. Ribe A, McNutt NS. S100A6 protein expression is of matrix metalloproteinase 9. PNAS 2006;103: 47. Felsenstein J. PHYLIP (Phylogeny Inference Pack- different in Spitz nevi and melanomas. Mod Pathol 14825^ 30. age) version 3.5c. Distributed by the author. Depart- 2003;16:505^11. 40. Arumugam T, Simeone DM, Van Golen K, Logs- ment of Genetics, University of Washington, Seattle 34. Komatsu K, Murata K, Kameyama M, et al. Expres- don CD. S100P promotes pancreatic cancer 19 93.

www.aacrjournals.org 29 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. S100A2 Induces Metastasis in Non−Small Cell Lung Cancer

Etmar Bulk, Bülent Sargin, Utz Krug, et al.

Clin Cancer Res 2009;15:22-29.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/15/1/22

Cited articles This article cites 45 articles, 15 of which you can access for free at: http://clincancerres.aacrjournals.org/content/15/1/22.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/15/1/22.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/15/1/22. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research.